WorldWideScience

Sample records for watson francis crick

  1. The Francis Crick Institute.

    Science.gov (United States)

    Peters, Keith; Smith, Jim

    2017-04-01

    The Francis Crick Institute Laboratory, opened in 2016, is supported by the Medical Research Council, Cancer Research UK, the Wellcome Trust, and University College London, King's College London and Imperial College London. The emphasis on research training and early independence of gifted scientists in a multidisciplinary environment provides unique opportunities for UK medical science, including clinical and translational research. © Royal College of Physicians 2017. All rights reserved.

  2. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  3. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  4. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  5. Francis Crick (1916–2004)

    Indian Academy of Sciences (India)

    Administrator

    The death of Francis Crick deprives us of one of the great- est scientists of the 20th century, whose creativity and power of mind dominated molecular biology in its golden years. Many people have told the story of his achievements; here I would simply like to recollect some of the qualities of this remarkable man. The first ...

  6. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  7. Francis Crick, DNA, and the Central Dogma

    Science.gov (United States)

    Olby, Robert

    1970-01-01

    This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

  8. On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.

    Science.gov (United States)

    Teive, Hélio A G

    2016-04-01

    The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  9. Francis Crick (1916–2004)

    Indian Academy of Sciences (India)

    Administrator

    him. When somebody gave a lecture, Francis was ready at the end (and often in the middle) to give them a lucid and exact account of what their work meant, for better or for worse. This made the Laboratory of Molecular Biology's end-of-year lectures a terrifying ordeal for many, but in- creased their intellectual value, and ...

  10. On the centenary of the birth of Francis H. C. Crick – from physics to genetics and neuroscience

    Directory of Open Access Journals (Sweden)

    Hélio A. G. Teive

    2016-04-01

    Full Text Available ABSTRACT The year 2016 marks the centenary of the birth of Francis Crick (1916–2004, who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  11. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  12. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  13. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  14. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  15. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  16. 60 years ago, Francis Crick changed the logic of biology.

    Directory of Open Access Journals (Sweden)

    Matthew Cobb

    2017-09-01

    Full Text Available In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  17. 60 years ago, Francis Crick changed the logic of biology

    Science.gov (United States)

    2017-01-01

    In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences. PMID:28922352

  18. 60 years ago, Francis Crick changed the logic of biology.

    Science.gov (United States)

    Cobb, Matthew

    2017-09-01

    In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  19. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  20. On Francis Crick, the genetic code, and a clever kid.

    Science.gov (United States)

    Goldstein, Bob

    2018-04-02

    A few years ago, Francis Crick's son told me a story that I can't get out of my mind. I had contacted Michael Crick by email while digging through the background of the researchers who had cracked the genetic code in the 1960s. Francis had died in 2004, and I was contacting some of the people who knew him when he was struggling to decipher the code. Francis didn't appear to struggle often - he is known mostly for his successes - and, as it turns out, this one well-known struggle may have had a clue sitting just barely out of sight. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  2. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  3. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  4. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  5. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  6. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  7. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  8. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  9. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  10. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  11. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  12. Francis Crick: A Singular Approach to Scientific Discovery.

    Science.gov (United States)

    Lawrence, Peter A

    2016-12-01

    Francis' office window (at the Salk) commanded a panorama of the Pacific. "This grand natural scene was a physical correlate of Francis's intellectual world: wide-ranging, brilliantly lit, a little overawing, but also immensely inviting and above all an exciting place to be." (Mitchison, 2004). Copyright © 2016 Elsevier Inc. All rights reserved.

  13. A world in one dimension: Linus Pauling, Francis Crick and the central dogma of molecular biology.

    Science.gov (United States)

    Strasser, Bruno J

    2006-01-01

    In 1957, Francis Crick outlined a startling vision of life in which the great diversity of forms and shapes of macromolecules was encoded in the one-dimensional sequence of nucleic acids. This paper situates Crick's new vision in the debates of the 1950s about protein synthesis and gene action. After exploring the reception of Crick's ideas, it shows how they differed radically from a different model of protein synthesis which enjoyed wide currency in that decade. In this alternative model, advocated by Linus Pauling and other luminaries, three-dimensional templates directed the folding of proteins. Even though it was always considered somewhat speculative, this theory was supported by a number of empirical results originating in different experimental systems. It was eventually replaced by a model in which the forms and shapes of macromolecules resulted solely from their amino acid sequence, dramatically simplifying the problem of protein synthesis which Crick was attempting to solve in 1957.

  14. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  16. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  17. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  18. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  19. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  20. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  1. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  4. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  5. Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience.

    Science.gov (United States)

    Aicardi, Christine

    2016-02-01

    The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a 'cross-worlds influencer' who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise 'un-disciplined' new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against 'vitalism': anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of 'doing science' and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: 'follow the cross-worlds influencers' who worked to build and organise these semi-institutional gatherings and institutional structures. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

  6. Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience

    Science.gov (United States)

    Aicardi, Christine

    2016-01-01

    The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a ‘cross-worlds influencer’ who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise ‘un-disciplined’ new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against ‘vitalism’: anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of ‘doing science’ and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: ‘follow the cross-worlds influencers’ who worked to build and organise these semi-institutional gatherings and institutional structures. PMID:26383132

  7. London home for Crick archive.

    Science.gov (United States)

    Williams, Nigel

    2002-01-08

    Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.

  8. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  9. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  11. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  12. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  13. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  14. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  15. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  16. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  17. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  18. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  19. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  1. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  2. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  3. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  4. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  5. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  8. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  9. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  10. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  11. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  13. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  14. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  16. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  17. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  19. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  20. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  1. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  2. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  3. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  4. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  5. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  6. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  7. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  8. Of the Helmholtz Club, South-Californian seedbed for visual and cognitive neuroscience, and its patron Francis Crick.

    Science.gov (United States)

    Aicardi, Christine

    2014-03-01

    Taking up the view that semi-institutional gatherings such as clubs, societies, research schools, have been instrumental in creating sheltered spaces from which many a 20th-century project-driven interdisciplinary research programme could develop and become established within the institutions of science, the paper explores the history of one such gathering from its inception in the early 1980s into the 2000s, the Helmholtz Club, which brought together scientists from such various research fields as neuroanatomy, neurophysiology, psychophysics, computer science and engineering, who all had an interest in the study of the visual system and of higher cognitive functions relying on visual perception such as visual consciousness. It argues that British molecular biologist turned South Californian neuroscientist Francis Crick had an early and lasting influence over the Helmholtz Club of which he was a founding pillar, and that from its inception, the club served as a constitutive element in his long-term plans for a neuroscience of vision and of cognition. Further, it argues that in this role, the Helmholtz Club served many purposes, the primary of which was to be a social forum for interdisciplinary discussion, where 'discussion' was not mere talk but was imbued with an epistemic value and as such, carefully cultivated. Finally, it questions what counts as 'doing science' and in turn, definitions of success and failure-and provides some material evidence towards re-appraising the successfulness of Crick's contribution to the neurosciences. Copyright © 2013 The Author. Published by Elsevier Ltd.. All rights reserved.

  9. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  10. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  11. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  12. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  14. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  15. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  16. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  17. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  18. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  19. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  20. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  1. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  2. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  3. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  4. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  5. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  6. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  7. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  8. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  9. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  10. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  15. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  16. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  17. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  18. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  19. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  20. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  1. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  3. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  4. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  5. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  6. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  7. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  8. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  9. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  10. Alternative Watson-Crick Synthetic Genetic Systems.

    Science.gov (United States)

    Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

    2016-11-01

    In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  11. Erwin Schroedinger, Francis Crick and epigenetic stability

    Directory of Open Access Journals (Sweden)

    Ogryzko Vasily V

    2008-04-01

    Full Text Available Abstract Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  12. Erwin Schroedinger, Francis Crick and epigenetic stability.

    Science.gov (United States)

    Ogryzko, Vasily V

    2008-04-17

    Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  13. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  14. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  15. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  16. On Fair Lotteries

    OpenAIRE

    STONE, PETER

    2008-01-01

    PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

  17. Replication infidelity via a mismatch with Watson–Crick geometry

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

    2011-01-01

    In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

  18. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  19. Francis Picabia hilislooming

    Index Scriptorium Estoniae

    1998-01-01

    Aastavahetusel Hamburgi teises Deichtorhalles olnud näitusest, kus eksponeeriti Francis Picabia (1879-1953) loomingut alates 1935. aastast. Näitus tutvustas Picabiat kui aktimaalijat, portretisti, fotograafi ja kirjameest

  20. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  1. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  2. Interviewing Francis Bacon

    OpenAIRE

    Kisters, Sandra

    2012-01-01

    British painter Francis Bacon (1909-1992) was known for the eloquence with which he talked about his art. He was easy to talk to, and was interviewed countless times by numerous critics. However, when studying Bacon's paintings one soon comes across the published interviews with art critic and curator David Sylvester (1924-2001), who interviewed him as many as 18 times between 1962 and 1986. Art historian Sandra Kisters argues that Sylvester's interviews with Bacon are carefully constructed a...

  3. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  4. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  5. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  6. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  7. Genetics by the Numbers

    Science.gov (United States)

    ... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

  8. Francis Bacon's behavioral psychology.

    Science.gov (United States)

    MacDonald, Paul S

    2007-01-01

    Francis Bacon offers two accounts of the nature and function of the human mind: one is a medical-physical account of the composition and operation of spirits specific to human beings, the other is a behavioral account of the character and activities of individual persons. The medical-physical account is a run-of-the-mill version of the late Renaissance model of elemental constituents and humoral temperaments. The other, less well-known, behavioral account represents an unusual position in early modern philosophy. This theory espouses a form of behavioral psychology according to which (a) supposed mental properties are "hidden forms" best described in dispositional terms, (b) the true character of an individual can be discovered in his observable behavior, and (c) an "informed" understanding of these properties permits the prediction and control of human behavior. Both of Bacon's theories of human nature fall under his general notion of systematic science: his medical-physical theory of vital spirits is theoretical natural philosophy and his behavioral theory of disposition and expression is operative natural philosophy. Because natural philosophy as a whole is "the inquiry of causes and the production of effects," knowledge of human nature falls under the same two-part definition. It is an inquisition of forms that pertains to the patterns of minute motions in the vital spirits and the production of effects that pertains both to the way these hidden motions produce behavioral effects and to the way in which a skillful agent is able to produce desired effects in other persons' behavior. (c) 2007 Wiley Periodicals, Inc.

  9. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  10. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    Science.gov (United States)

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  11. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  12. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  13. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  14. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  15. Francis Bacon and Jacobean legitimation

    OpenAIRE

    Rodríguez García, José María

    1997-01-01

    Francis Bacon (1561-1626) maintained a lifelong interest in the institutional implementation of experimental science. What changed over the years were the rhetorical strategies employed to give this project legitimacy. I systematize those changes by dividing Bacon's works into three groups according to three criteria: what rite of officialization is enacted in each text (e.g., conversion, fatherly generation, royal delegation); who the inscribed addressee is (e.g., an imagin...

  16. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  17. Derivation of the Crick-Wyman equation for allosteric proteins defining the difference between the number of binding sites and the Hill coefficient.

    Science.gov (United States)

    Poitevin, Frédéric; Edelstein, Stuart J

    2013-05-13

    In response to a 100-word footnote in the 1965 article by Monod, Wyman, and Changeux, a detailed manuscript signed by Francis Crick and Jeffries Wyman with 6000 words and 30 equations entitled "A Footnote on Allostery" circulated in 1965 among a limited group of scientists interested in allosteric interactions. This interesting and provocative document is published in this special issue for the first time. An intriguing equation in their text relates the difference between n (the number of ligand binding sites) and n' (the Hill coefficient) to the ratio of the saturation functions Y¯, for oligomers with n-1 and n binding sites. A compact derivation of this equation was not provided by Crick and Wyman, but one is presented here based on a definition of Y¯ involving the binding polynomial and its first derivative. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  19. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  20. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  1. Francis Bacon, un moderne intempestif

    OpenAIRE

    Mavrakis, Annie

    2017-01-01

    À propos de la peinture de Francis Bacon et en prenant appui sur des réflexions de Michel Leiris, cet article se propose de revenir sur la question de la modernité conçue non de façon absolue (LA modernité, non figurative, anti-littéraire) mais relative, dégagée d’une vision historiciste orientée de l’histoire de l’art. Cette modernité est intempestive puisque, s’opposant au classique (cf. La Querelle des Anciens et des Modernes) et non au périmé, elle fait revivre les grandes problématiques ...

  2. Francis Bacon and the Technology of Style.

    Science.gov (United States)

    Baker, Christopher

    1983-01-01

    Examines Francis Bacon's intentionally devised style for scientific writings and the theoretical basis of that style. Discusses his emphasis on a truly objective point of view, and his use of aphorisms to adapt to his audience. (HTH)

  3. Francis Bacon and Magnetical Cosmology.

    Science.gov (United States)

    Wang, Xiaona

    2016-12-01

    A short-lived but important movement in seventeenth-century English natural philosophy—which scholars call “magnetical philosophy” or “magnetical cosmology”—sought to understand gravity (both terrestrial and celestial) by analogy with magnetism. The movement was clearly inspired by William Gilbert’s De magnete (1600) and culminated with Robert Hooke’s prefiguring of the universal principle of gravitation, which he personally communicated to Isaac Newton in 1679. But the magnetical cosmology, as professed by those in the movement, differed from Gilbert’s philosophy in highly significant ways. Proponents never accepted Gilbert’s animistic account of magnets and seem tacitly to have accepted a belief in action at a distance that Gilbert himself rejected. This essay argues that Francis Bacon (1561–1626) had already provided just the adaptations to Gilbert’s philosophy that the later thinkers adopted, including an important endorsement of action at a distance, and that he should be recognized as playing an important role in the movement.

  4. The discovery of the structure of DNA

    Science.gov (United States)

    Squires, G. L.

    2003-04-01

    On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

  5. Improving the Army’s Next Effort in Technology Forecasting

    Science.gov (United States)

    2010-09-01

    DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

  6. The coevolution of genes and genetic codes: Crick's frozen accident revisited.

    Science.gov (United States)

    Sella, Guy; Ardell, David H

    2006-09-01

    The standard genetic code is the nearly universal system for the translation of genes into proteins. The code exhibits two salient structural characteristics: it possesses a distinct organization that makes it extremely robust to errors in replication and translation, and it is highly redundant. The origin of these properties has intrigued researchers since the code was first discovered. One suggestion, which is the subject of this review, is that the code's organization is the outcome of the coevolution of genes and genetic codes. In 1968, Francis Crick explored the possible implications of coevolution at different stages of code evolution. Although he argues that coevolution was likely to influence the evolution of the code, he concludes that it falls short of explaining the organization of the code we see today. The recent application of mathematical modeling to study the effects of errors on the course of coevolution, suggests a different conclusion. It shows that coevolution readily generates genetic codes that are highly redundant and similar in their error-correcting organization to the standard code. We review this recent work and suggest that further affirmation of the role of coevolution can be attained by investigating the extent to which the outcome of coevolution is robust to other influences that were present during the evolution of the code.

  7. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  8. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  9. Orbital interactions and charge redistribution in weak hydrogen bonds: The Watson-Crick AT mimic adenine-2,4-difluorotoluene

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.

    2003-01-01

    An overview is given of results that reestablish hydrogen bonding as an essential factor in DNA replication involving natural bases as well as less polar mimics and they also confirm the importance of steric factors, in line with Kool's experimental work. In addition they show that knowledge of the

  10. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  11. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  13. DNA before Watson & Crick-The Pioneering Studies of J. M. Gulland and D. O. Jordan at Nottingham

    Science.gov (United States)

    Booth, Harold; Hey, Michael J.

    1996-10-01

    A description placed in a historical context, of the physico-chemical investigations of DNA carried out in the period 1940-1950 by a group at University College, Nottingham led by J.M.Gulland and D.O.Jordan. The isolation of a pure sample of DNA from calf thymus was followed by its analysis by potentiometric titrations and by measurements at variable pH of viscosity and streaming birefringence. Unlike the phosphoric acid groups, the primary amino and enolic hydroxyl groups could only be titrated after prior treatment with strong acid or strong base. The conclusion of Gulland and Jordan, that extremes of pH caused liberation of amino and enolic hydoxyl groups by disruption of hydrogen bonds between neighbouring polynucleotide chains, proved to be of considerable importance. The article includes life histories of Gulland and Jordan, and reference to Linus Pauling's remarkable foresight during his Sir Jesse Boot Foundation Lecture delivered at Nottingham in 1948.

  14. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  15. Poetic and Francis Bacon's Ambivalence toward Language.

    Science.gov (United States)

    Pribble, Paula Tompkins

    Just as rhetoric is a way of knowing, so is poetic, both of which, for Francis Bacon, produce false knowledge. But Bacon is not entirely negative. When the poetic elements of language are used in strategic and public communication, like the scholarly communication Bacon attempts to reform, poetic and rhetoric work together to create a plurality of…

  16. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  17. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  18. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  19. Cavitation erosion prediction on Francis turbines

    Energy Technology Data Exchange (ETDEWEB)

    Bourdon, P.; Farhat, M.; Simoneau, R.; Lavigne, P. [Hydro-Quebec, Montreal, PQ (Canada); Pereira, F.; Dupont, P.; Avellan, F.; Caron, J.F. [IMHEF/EPFL, (France); Dorey, J.M.; Archer, A. [Electricite de France (EDF), 92 - Clamart (France). Dir. des Etudes et Recherches; and others

    1997-12-31

    On-board aggressiveness measurement methods were tested on a severely eroded prototype blade of a 266 MW Francis turbine: pressure, pit counting, DECER electrochemical and vibration measurements. The test program provided understanding of the heterogeneous erosion distribution of the prototype blades and quantitative data for comparison in subsequent tests on the model of the machine. Model tests and flow analysis were also performed, to detect cavitation on a Francis turbine model. The results are compared to those obtained on the prototype measurements. The model used for that study is built on the basis of a geometrical recovery of one of the most eroded blade of the prototype. Different methods were investigated to predict cavitation erosion on Francis turbines from model. They are based on measurement of pitting, pressure fluctuations and acceleration. The methods proposed are suitable to measure cavitation aggressiveness on model and on prototype, and that the level on the model is several orders of magnitude smaller than on the prototype. (author) 18 refs.

  20. Homage to Francis Perrin - 1901-1992

    International Nuclear Information System (INIS)

    1994-05-01

    Francis Perrin had a brilliant and rapid career. He was a strict and honest man. He had a fast intelligence, a huge knowledge, he was faithful. Finally his courtesy and his generosity had made of him an outstanding and model personality very little known because of his extreme discretion. He lived his professional career (1920-1970) with passion. He thought that science might be one mankind heritage. He worked in CEA and played a crucial role in the CERN creation. He was an accomplished scientist since he tackled the mathematics, physics, and even chemistry scope. 52 refs

  1. Failure analysis of a Francis turbine runner

    Energy Technology Data Exchange (ETDEWEB)

    Frunzaverde, D; Campian, V [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta Traian Vuia 1-4, RO-320085, Resita (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Marginean, G [University of Applied Sciences Gelsenkirchen, Neidenburger Str. 10, 45877 Gelsenkirchen (Germany); Marsavina, L [Department of Strength, ' Politehnica' University of Timisoara, Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Terzi, R; Serban, V, E-mail: gabriela.marginean@fh-gelsenkirchen.d, E-mail: d.frunzaverde@uem.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A., Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)

    2010-08-15

    The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.

  2. Failure analysis of a Francis turbine runner

    International Nuclear Information System (INIS)

    Frunzaverde, D; Campian, V; Muntean, S; Marginean, G; Marsavina, L; Terzi, R; Serban, V

    2010-01-01

    The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.

  3. Development of a 5kw Francis Turbine Runner Using Computation ...

    African Journals Online (AJOL)

    A small scale Francis turbine runner for a turbine located at Awba dam in the University of Ibadan with designed head and flow rate of 6m and 0.244m3/s is designed. The basic design of the Francis turbine runner is completed based on basic fluid dynamics turbo machinery principles. A 2-D and 3-D steady state, ...

  4. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  5. [Sir Francis Galton: the father of eugenics].

    Science.gov (United States)

    Aubert-Marson, Dominique

    2009-01-01

    Not only was Sir Francis Galton a famous geographer and statistician, he also invented "eugenics" in 1883. Eugenics, defined as the science of improving racial stock, was developed from a new heredity theory, conceived by Galton himself, and from the evolution theory of Charles Darwin, transposed to human society by Herbert Spencer. Galton's eugenics was a program to artificially produce a better human race through regulating marriage and thus procreation. Galton put particular emphasis on "positive eugenics", aimed at encouraging the physically and mentally superior members of the population to choose partners with similar traits. In 1904, he presented his ideas in front of a vast audience of physicians and scientists in London. His widely-publicized lecture served as the starting point for the development of eugenics groups in Europe and the United States during the first half of the 20th century.

  6. O duplo legado de Francis Poulenc

    Directory of Open Access Journals (Sweden)

    Joana Resende

    2009-12-01

    Full Text Available Déjàvu,or better,déjà écouté is an appropriate expression to describe an audition of certain works by Francis Poulenc (1899-1963. A sui-generis character in 20th century music, Poulenc has questioned the whole heritage that came before him, French or not, according to the premises of the group he belonged to, Les Six, although not always reaching similar results. His main concern was to make good music, an ideal not far from that of Debussy, “music should humbly seek to please” (Harry Halbreich. This article approaches the use of quotation and other processes of allusion in the works by Poulenc, as seen in his voice and piano mélodies cycle La fraîcheur et le feu, identifying thematic, melodic, and harmonic, origins used coherently in several pieces. and helping to solidly build his musical language.

  7. 10 años de la secuenciación del genoma humano: Encuentro entre el imaginario y la realidad

    Directory of Open Access Journals (Sweden)

    María Teresa Reguero Reza

    2013-01-01

    Full Text Available Lejano parece en año de 1953 cuando se publica en Nature un artículo sobre la estructura helicoidal de ADN, propuesta por dos investigadores, el británico Francis Crick y el estadounidense James Watson, lo que constituyó la piedra angular de los procesos de secuenciación.

  8. Allies and Competitors as Enscripted Audiences in Scientific Writing.

    Science.gov (United States)

    Perry, Susan

    A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…

  9. The Discovery of the Double Helix

    CERN Multimedia

    CERN. Geneva

    2011-01-01

    Professor James D. Watson has kindly agreed to make a presentation on the 1953 finding of the Double Helix at the Cavendish Laboratory by Francis Crick and himself. Being one of the greatest scientific discoveries in human history, little else needs to be added.

  10. Confronting Science: The Dilemma of Genetic Testing.

    Science.gov (United States)

    Zallen, Doris T.

    1997-01-01

    Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)

  11. X-Ray Diffraction and the Discovery of the Structure of DNA

    Science.gov (United States)

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  12. The History of Molecular Structure Determination Viewed through the Nobel Prizes.

    Science.gov (United States)

    Jensen, William P.; Palenik, Gus J.; Suh, Il-Hwan

    2003-01-01

    Discusses the importance of complex molecular structures. Emphasizes their individual significance through examination of the Nobel Prizes of the 20th century. Highlights prizes awarded to Conrad Rontgen, Francis H.C. Crick, James D. Watson, Maurice H.F. Wilkins, and others. (SOE)

  13. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  14. Assessing Attitude towards Religion: The Astley-Francis Scale of Attitude towards Theistic Faith

    Science.gov (United States)

    Astley, Jeff; Francis, Leslie J.; Robbins, Mandy

    2012-01-01

    This study builds on the research tradition modelled by the Francis Scale of Attitude towards Christianity, the Katz-Francis Scale of Attitude towards Judaism, the Sahin-Francis Scale of Attitude towards Islam and the Santosh-Francis Scale of Attitude towards Hinduism to propose a generic instrument concerned with attitudes towards theistic faith.…

  15. Francis Goyat kuuleb pühapäeval

    Index Scriptorium Estoniae

    2003-01-01

    Belgia kitarristist Francis Goyast, kontsertidest Pärnu kontserdimajas 19. nov., Tartus Vanemuise kontserdimajas 21.nov ja Tallinnas Estonia kontserdisaalis 23. nov., heliplaadist "Pleased to meet You, Mr. Valgre"

  16. Francis Bacon: “pintar sensações” (Francis Bacon: “to paint sensations”)

    OpenAIRE

    Borges, Sonia; UVA

    2013-01-01

    RESUMO O texto aborda, pela via da psicanálise, o que consideramos como o “método” de Francis Bacon: “pintar sensações”. Para isto, tomo, como referências principais, a Carta 52 (1896), da correspondência de Freud com Fliess, e Em busca do tempo perdido, romance de Marcel Proust ([1922] 1995), observando a possibilidade de considerar o que Proust nomeia como “memória involuntária” e o seu papel no processo criativo como uma ilustração esclarecedora do que Freud nos traz na Carta sobre a estr...

  17. A POÉTICA DE FRANCIS BACON

    Directory of Open Access Journals (Sweden)

    Sonia Borges

    2013-02-01

    Full Text Available A partir da perspectiva psicanalítica, a autora aborda a obra de Francis Bacon se utilizando de uma concepção estética que a reconhece como uma realidade ontológica. Dessa forma, considera que como obra de arte, são seus próprios elementos constitutivos, numa tensão interna, que são capazes de provocar efeitos ou as sensações que são o seu objetivo último conforme defendia Bacon. Em sua análise a autora examina e discute a dialética “tempo - espaço”, revelada pelo poeta pintor, como sendo de especial interesse para a clínica psicanalítica na medida em que esclarece importantes questões relativas ao Real como impossível, tal como o compreendeu Lacan. A pintura de Bacon examinada como referência à “sublimação criacionista da pulsão de morte” permite, segundo a autora, vislumbrarmos o para além da cadeia significante. Conclui que a arte, assim como a clínica psicanalítica, supõe deslocamentos subjetivos que implicam corte - rompimento com a tendência unificadora e pacificadora de Eros.

  18. HydroHillChart – Francis module. Software used to Calculate the Hill Chart of the Francis Hydraulic Turbines

    Directory of Open Access Journals (Sweden)

    Dorian Nedelcu

    2015-07-01

    Full Text Available The paper presents the Hydro Hill Chart - Francis module application, used to calculate the hill chart of the Pelton, Francis and Kaplan hydraulic turbine models, by processing the data measured on the stand. After describing the interface and menu, the input data is graphically presented and the universal characteristic for measuring scenarios ao=const. and n11=const is calculated. Finally, the two calculated hill charts are compared through a graphical superimposition of the isolines.

  19. Measurement of pressure pulsations in Francis turbines

    Energy Technology Data Exchange (ETDEWEB)

    Kobro, Einar

    2010-11-15

    The work presented in this thesis involves preparation and execution of measurements on Francis runners. The measurements were performed by means of onboard measuring equipment both in model runners and full-scale prototype runners. Also, analysis of the measured data, and the discussion of the results, is presented. The measurements resulted in large data sets. These data sets were used by the author to investigate the dynamic pressure and strain in the runners. The results of the analysis can be used as input in future turbine design. Andritz Hydro AG has used the data for verification of their numerical simulation tools. In connection with the refurbishment of Tokke power plant, two model runners were made available for onboard pressure measurements. To investigate the dynamic pressure in these runners, methods for integration of pressure transducers in the runner blades needed to be developed. After initial difficulties during the preparation, successful measurements were obtained from both model runners. At Tokke power plant, both the original and replacement runners were made accessible for onboard pressure and strain gauge measurements. On the original Kvaerner Brug AS runner, the test was prepared and performed by the author. This test failed, due to water intrusion in the logging chain. The second test was performed on the Andritz Hydro AG replacement runner. This test was prepared and performed by the author in close cooperation with Andritz Hydro AG, and the results were successful. The analysis results from both model and prototype runners show that the wake leaving the guide vanes is the most severe source of dynamic pressure in the runner. The draft tube vortex rope pulsation propagates upstream the runner, but does not appear as a significant frequency in the runner strain measurements. (Author)

  20. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  1. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  2. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  3. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  4. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  5. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  6. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  7. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  8. Numerical Study of a High Head Francis Turbine with Measurements from the Francis-99 Project

    International Nuclear Information System (INIS)

    Wallimann, H; Neubauer, R

    2015-01-01

    For the Francis-99 project initiated by the Norwegian University of Science and Technology (NTNU, Norway) and the Luleå University of Technology (LTU, Sweden) numerical flow simulation has been performed and the results compared to experimentally obtained data. The full machine including spiral casing, stay vanes, guide vanes, runner and draft tube was simulated transient for three operating points defined by the Francis-99 organisers. Two sets of results were created with differing time steps. Additionally, a reduced domain was simulated in a stationary manner to create a complete cut along constant prototype head and constant prototype discharge. The efficiency values and shape of the curves have been investigated and compared to the experimental data. Special attention has been given to rotor stator interaction (RSI). Signals from several probes and their counterpart in the simulation have been processed to evaluate the pressure fluctuations occurring due to the RSI. The direct comparison of the hydraulic efficiency obtained by the full machine simulation compared to the experimental data showed no improvement when using a 1° time step compared to a coarser 2° time step. At the BEP the 2° time step even showed a slightly better result with an absolute deviation 1.08% compared with 1.24% for the 1° time step. At the other two operating points the simulation results were practically identical but fell short of predicting the measured values. The RSI evaluation was done using the results of the 2° time step simulation, which proved to be an adequate setting to reproduce pressure signals with peaks at the correct frequencies. The simulation results showed the highest amplitudes in the vaneless space at the BEP operating point at a location different from the probe measurements available. This implies that not only the radial distance, but the shape of the vaneless space influences the RSI

  9. Verdade e método em Francis Bacon

    OpenAIRE

    Secco, Márcio

    2004-01-01

    Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Filosofia e Ciências Humanas. Programa de Pós-Graduação em Filosofia. Estudo sobre o método e o conceito de verdade defendido por Francis Bacon, sendo nossos principais objetivos nesse trabalho: a) esclarecer algumas questões relativas ao método baconiano, principalmente no que se refere ao uso de hipóteses; b) apresentar uma interpretação falibilista da teoria de Francis Bacon, mostrando que a verdade e a utilidade...

  10. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  11. Orbital interactions and charge redistribution in weak hydrogen bonds: Watson-Crick GC mimic involving C-H proton donor and F proton acceptor groups

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2006-01-01

    The discovery by Kool and coworkers that 2,4-difluorotoluene (F) mimics thymine (T) in DNA replication has led to controversy regarding the question of whether this mimic has the capability of forming hydrogen bonds with adenine (A). Recently, we have provided evidence for an important role of both

  12. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  13. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  14. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence binding properties in these recognition events. Subunit (1R,3R)-3-aminocyclopentanecarboxylic acid broadens our scope to design novel polyamides. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  16. Francis Bacon and the Historiography of Scientific Rhetoric.

    Science.gov (United States)

    Zappen, James P.

    1989-01-01

    Reviews three twentieth-century interpretations of Francis Bacon's science and rhetoric: positivistic science and the plain style; institutionalized science and its more highly figured style; and democratic science. Presents the author's own interpretation, and concludes that each interpretation reflects different perceptions of the good of the…

  17. Scientific Cousins: The Relationship between Charles Darwin and Francis Galton

    Science.gov (United States)

    Fancher, Raymond E.

    2009-01-01

    This article traces the personal as well as the intellectual and scientific relationship between Charles Darwin and his younger half-cousin Francis Galton. Although they had been on friendly terms as young men, and Darwin had in some ways been a role model for Galton, the two did not share major scientific interests until after the publication of…

  18. Master equation and runaway speed of the Francis turbine

    Science.gov (United States)

    Zhang, Zh.

    2018-04-01

    The master equation of the Francis turbine is derived based on the combination of the angular momentum (Euler) and the energy laws. It relates the geometrical design of the impeller and the regulation settings (guide vane angle and rotational speed) to the discharge and the power output. The master equation, thus, enables the complete characteristics of a given Francis turbine to be easily computed. While applying the energy law, both the shock loss at the impeller inlet and the swirling loss at the impeller exit are taken into account. These are main losses which occur at both the partial load and the overloads and, thus, dominantly influence the characteristics of the Francis turbine. They also totally govern the discharge of the water through the impeller when the impeller is found in the standstill. The computations have been performed for the discharge, the hydraulic torque and the hydraulic efficiency. They were also compared with the available measurements on a model turbine. Excellent agreement has been achieved. The computations also enable the runaway speed of the Francis turbine and the related discharge to be determined as a function of the setting angle of the guide vanes.

  19. Sunrayce 97 Continues Day 7 - Smith Center to St. Francis

    Science.gov (United States)

    Manager (202) 586-0713 St. Francis, Kan. -- It was a close race for the top three places on the 7th day of running great. It's a solid car. We may not have the fastest or most efficient vehicle in the race, but we withdraw from the race yesterday due to suspension problems. The team was presented an "Inspector's

  20. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  1. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  2. Major historical developments in the design of water wheels and Francis hydroturbines

    International Nuclear Information System (INIS)

    Lewis, B J; Cimbala, J M; Wouden, A M

    2014-01-01

    The first record of water wheels dates back to ancient Greece. Over the next several centuries the technology spread all over the world. The process of arriving at the design of the modern Francis runner lasted from 1848 to approximately 1920. Though the modern Francis runner has little resemblance to the original turbines designed by James B. Francis in 1848, it became know as the Francis turbine around 1920, in honor of his many contributions to hydraulic engineering analysis and design. The modern Francis turbine is the most widely used turbine design today, particularly for medium head and large flow rate situations, and can achieve over 95% efficiency

  3. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  4. Francis Bacon: The Real's Brutality. The Figure and the Other

    Directory of Open Access Journals (Sweden)

    Guido Mannucci

    2014-03-01

    Full Text Available Getting in front of painting by Francis Bacon touches you deeply. I’m talking about aesthetics, sensations: resounding flow that strikes abruptly, making futile any search for meaning. Francis Bacon circumvents the figurative, the meaning, he aims to the figural: to feelings, not words. Beauty, in his paintings, shows itself in the peaceful union of the positive and of its contrary; if the negative wasn’t there, though, his paintings wouldn’t exude such a brutal sense of reality. This essay investigates the figure of Francis Bacon and the spectator – the Other – as he tries to confront the painting. Bacon will be analysed using a purely phenomenological approach, with references that range from Merleau-Ponty to Martin Heidegger; the meeting-collision between the spectator and the painting, instead, will be examined taking inspiration from the Winnicott’s thesis on the relationship between Bacon and mirrors in the painter’s childhood. In order to take distance from Winnicott’s psychoanalytical approach, this essay will focus on the relationship between spectator and painting from a more anthropological point of view. 

  5. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  6. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  7. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  8. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  9. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  10. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  11. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  12. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  13. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  14. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  15. Cost of enlarged operating zone for an existing Francis runner

    Science.gov (United States)

    Monette, Christine; Marmont, Hugues; Chamberland-Lauzon, Joël; Skagerstrand, Anders; Coutu, André; Carlevi, Jens

    2016-11-01

    Traditionally, hydro power plants have been operated close to best efficiency point, the more stable operating condition for which they have been designed. However, because of changes in the electricity market, many hydro power plants operators wish to operate their machines differently to fulfil those new market needs. New operating conditions can include whole range operation, many start/stops, extensive low load operation, synchronous condenser mode and power/frequency regulation. Many of these new operating conditions may impose more severe fatigue damage than the traditional base load operation close to best efficiency point. Under these conditions, the fatigue life of the runner may be significantly reduced and reparation or replacement cost might occur sooner than expected. In order to design reliable Francis runners for those new challenging operating scenarios, Andritz Hydro has developed various proprietary tools and design rules. These are used within Andritz Hydro to design mechanically robust Francis runners for the operating scenarios fulfilling customer's specifications. To estimate residual life under different operating scenarios of an existing runner designed years ago for best efficiency base load operation, Andritz Hydro's design rules and tools would necessarily lead to conservative results. While the geometry of a new runner can be modified to fulfil all conservative mechanical design rules, the predicted fatigue life of an existing runner under off-design operating conditions may appear rather short because of the conservative safety factor included in the calculations. The most precise and reliable way to calculate residual life of an existing runner under different operating scenarios is to perform a strain gauge measurement campaign on the runner. This paper presents the runner strain gage measurement campaign of a mid-head Francis turbine over all the operating conditions available during the test, the analysis of the measurement signals

  16. Design of large Francis turbine using optimal methods

    Science.gov (United States)

    Flores, E.; Bornard, L.; Tomas, L.; Liu, J.; Couston, M.

    2012-11-01

    Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China -32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.

  17. Design of large Francis turbine using optimal methods

    International Nuclear Information System (INIS)

    Flores, E; Bornard, L; Tomas, L; Couston, M; Liu, J

    2012-01-01

    Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China −32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.

  18. Transient CFD simulation of a Francis turbine startup

    International Nuclear Information System (INIS)

    Nicolle, J; Morissette, J F; Giroux, A M

    2012-01-01

    To assess the life expectancy of hydraulic turbines, it is essential to obtain the loading on the blades, especially during transient operations known to be the most damaging. This paper presents a simplified CFD setup to model the startup phase of a Francis turbine while it goes from rest to speed no-load condition. The fluid domain included one distributor sector coupled with one runner passage. The guide vane motion and change in the angular velocity were included in a commercial code with user functions. Comparisons between numerical results and measurements acquired on a full-size turbine showed that most of the flow physics occurring during startup were captured.

  19. Consciousness.

    Science.gov (United States)

    Sejnowski, Terrence J

    2015-01-01

    No one did more to draw neuroscientists' attention to the problem of consciousness in the twentieth century than Francis Crick, who may be better known as the co-discoverer (with James Watson) of the structure of DNA. Crick focused his research on visual awareness and based his analysis on the progress made over the last fifty years in uncovering the neural mechanisms underlying visual perception. Because much of what happens in our brains occurs below the level of consciousness and many of our intuitions about unconscious processing are misleading, consciousness remains an elusive problem. In the end, when all of the brain mechanisms that underlie consciousness have been identified, will we still be asking: "What is consciousness?" Or will the question shift, just as the question "What is life?" is no longer the same as it was before Francis Crick?

  20. Efficiency limit factor analysis for the Francis-99 hydraulic turbine

    Science.gov (United States)

    Zeng, Y.; Zhang, L. X.; Guo, J. P.; Guo, Y. K.; Pan, Q. L.; Qian, J.

    2017-01-01

    The energy loss in hydraulic turbine is the most direct factor that affects the efficiency of the hydraulic turbine. Based on the analysis theory of inner energy loss of hydraulic turbine, combining the measurement data of the Francis-99, this paper calculates characteristic parameters of inner energy loss of the hydraulic turbine, and establishes the calculation model of the hydraulic turbine power. Taken the start-up test conditions given by Francis-99 as case, characteristics of the inner energy of the hydraulic turbine in transient and transformation law are researched. Further, analyzing mechanical friction in hydraulic turbine, we think that main ingredients of mechanical friction loss is the rotation friction loss between rotating runner and water body, and defined as the inner mechanical friction loss. The calculation method of the inner mechanical friction loss is given roughly. Our purpose is that explore and research the method and way increasing transformation efficiency of water flow by means of analysis energy losses in hydraulic turbine.

  1. The green roof dilemma - discussion of Francis and Lorimer (2011).

    Science.gov (United States)

    Henry, Alexandre; Frascaria-Lacoste, Nathalie

    2012-08-15

    Urban ecosystems are the most complex mosaics of vegetative land cover that can be found. In a recent paper, Francis and Lorimer (2011) evaluated the reconciliation potential of living roofs and walls. For these authors, these two techniques for habitat improvement have strong potential for urban reconciliation ecology. However they have some ecological and societal limitations such as the physical extreme environmental characteristics, the monetary investment and the cultural perceptions of urban nature. We are interested in their results and support their conclusions. However, for a considerable time, green roofs have been designed to provide urban greenery for buildings and the green roof market has only focused on extensive roof at a restricted scale within cities. Thus, we have strong doubts about the relevance of their use as possible integrated elements of the network. Furthermore, without dynamic progress in research and the implementation of well-thought-out policies, what will be the real capital gain from green roofs with respect to land-use complementation in cities? If we agree with Francis and Lorimer (2011) considering that urban reconciliation ecology between nature and citizens is a current major challenge, then "adaptive collaborative management" is a fundamental requirement. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. LDA measurements in the Francis-99 draft tube cone

    International Nuclear Information System (INIS)

    Sundstrom, L R J; Amiri, K; Cervantes, M J; Bergan, C; Dahlhaug, O G

    2014-01-01

    Velocity measurements were performed in the draft tube cone of a 1:5.1 scaled model of the Tokke hydropower plant, Norway; also known as the Francis-99 model. Results from the laser Doppler anemometry measurements undertaken at three operating points will be used as validation data for an upcoming workshop on the state of the art of Francis turbine numerical simulation. With the turbine operating at the best efficiency point, a sensitivity analysis of the flow parameters head, flow rate and runner rotational speed shows that the effects on the dimensionless velocity profiles are small as long as n ED and Q ED are held constant. The results indicate a well-functioning turbine at the best efficiency point and high load. At the part load operating point, a vortex breakdown occurs which distorts the velocity profiles and significantly lowers the turbine's hydraulic efficiency. Frequency spectrums of each LDA signal at part load reveals a peak which is asynchronous to that of the runner angular speed. The peaks might be related to the precession of a rotating vortex rope but the characteristics of the LDA signals are different compared to previous studies involving rotating vortex ropes

  3. The Second Christ, Saint Francis of Assisi and ecological consciousness

    Directory of Open Access Journals (Sweden)

    Hendrik Viviers

    2014-01-01

    Full Text Available Even though the life stories of Jesus and the so-called second Christ, Francis of Assisi, incline to the fantastical, their value for a modern ecological consciousness is defendable. Behind Francis� personification of nature and his mystical experiences of nature lie an intuitive sense of interconnectedness and interdependence, of being fully part of the natural web of life (confirmed by empirical science. The same is true of the immanence of Jesus. Religious figures like Francis and Jesus can provide a sound moral attitude towards caring for the natural world, but attitudes need to be informed by scientific knowledge to act ecologically correct. A partnership between attitudes and knowledge hopefully contains good news for a sustainable �green� planet.Intradisciplinary and/or�interdisciplinary�implications: Ecological hermeneutics (part of liberation theology or hermeneutics challenges traditional theologies� often anthropocentric bias in the intra-disciplinary arena. It respects the interconnectedness or interdependence of human and non-human life, including the non-organic, empirically substantiated by natural science. This shared realisation allows for a fruitful inter-disciplinary discourse with science to address the global ecological crisis.

  4. Effect of Guide Vane Clearance Gap on Francis Turbine Performance

    Directory of Open Access Journals (Sweden)

    Ravi Koirala

    2016-04-01

    Full Text Available Francis turbine guide vanes have pivoted support with external control mechanism, for conversion of pressure to kinetic energy and to direct them to runner vanes. This movement along the support is dependent on variation of load and flow (operating conditions. Small clearance gaps between facing plates and the upper and lower guide vane tips are available to aid this movement, through which leakage flow occurs. This secondary flow disturbs the main flow stream, resulting performance loss. Additionally, these increased horseshoe vortex, in presence of sand, when crosses through the gaps, both the surfaces are eroded. This causes further serious effect on performance and structural property by increasing gaps. This paper discusses the observation of the severity in hydropower plants and effect of clearance gaps on general performance of the Francis turbine through computational methods. It also relates the primary result with the empirical relation for leakage flow prediction. Additionally, a possible method to computationally estimate thickness depletion has also been presented. With increasing clearance gap, leakage increases, which lowers energy conversion and turbine efficiency along with larger secondary vortex.

  5. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  6. Nanotechnology: Threats and Deterrent Opportunities by 2035

    Science.gov (United States)

    2010-02-17

    22. 17 James Watson and Francis Crick discovered the structure of Deoxyribonucleic acid ( DNA ) in 1953. 18 Self-replication is when nanoscale machine...which then improves researchers’ understanding of critical, computationally intensive fields of study like DNA .17 These complementary scientific and...researchers’ clarity on critical medical issues like Deoxyribonucleic acid ( DNA ). 102 Omar Khayyam, Rubaiyat of Omar Khayyam (NY: Random House, 1947

  7. Forecasting Science and Technology for the Department of Defense

    Science.gov (United States)

    2009-12-01

    Watson and Francis Crick announced that they had elucidated the structure of DNA and had therefore “discovered the secret of life.” While this was a...an organic chemist, figured out a process by which very small quantities of DNA could be amplified with high fidelity. This process, known as...polymerase chain reaction (PCR), for the first time, allowed scientists to produce DNA in large quantities. Roughly during this period, Leroy Hood and

  8. Do cells care about physics?

    Science.gov (United States)

    Guck, Jochen

    2009-07-01

    Ever since James Watson and Francis Crick cracked the code of life and laid the foundations for molecular biology, biologists have almost exclusively focused on the molecular aspects of biological systems. This cumulated in the mapping of the entire human genome a few years ago-the entire blueprint of every cell. So, does that mean we can stop? Is everything known that we can possibly know about cells? Far from it.

  9. Das DNA-Puzzle

    Science.gov (United States)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  10. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  11. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  12. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  13. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  14. Francis Bacon: constructing natural histories of the invisible.

    Science.gov (United States)

    Rusu, Doina-Cristina

    2012-01-01

    The natural histories contained in Francis Bacon's Historia naturalis et experimentalis seem to differ from the model presented in De augmentis scientiarum and the Descriptio globi intellectualis in that they are focused on the defining properties of matter, its primary schematisms and the spirits. In this respect, they are highly speculative. In this paper I aim to describe the Historia naturalis et experimentalis as a text about matter theory, the histories of which are ascending from what is most evident to the senses to what is least accessible to them. Moreover, the Latin natural histories are parts of a methodological procedure in which the provisional rules and axioms obtained in one history can be used as theoretical assumptions for another history, thereby permitting one to delve ever more profoundly into the structure of nature.

  15. The "Visual Shock" of Francis Bacon: an essay in neuroesthetics.

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a "visual shock."We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his "visual shock" because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  16. Francis Bacon: teory, method and contributions to the education

    Directory of Open Access Journals (Sweden)

    Roberto Carlos Simões Galvão

    2007-04-01

    Full Text Available In the present article, we propose a brief analysis of Francis Bacon’s thought (1561-1626 and his contributions to the Education. With Bacon, the old religious or metaphysical character of knowledge was substituted by the objectivity of the experimental science, something unknown until then. The science started to represent a means in search of an end, i.e., man’s control over nature. The desire of Bacon to promote a reorganization of the power of the human knowledge, not based on the old scholastic knowledge, but in the new scientific knowledge, was shared by educators, philosophers and statesmen of his time. The role of the school would be to assure the dissemination of this new knowledge which, properly unified, would be within reach of all the children

  17. Experimental vibration level analysis of a Francis turbine

    International Nuclear Information System (INIS)

    Bucur, D M; Dunca, G; Calinoiu, C

    2012-01-01

    In this study the vibration level of a Francis turbine is investigated by experimental work in site. Measurements are carried out for different power output values, in order to highlight the influence of the operation regimes on the turbine behavior. The study focuses on the turbine shaft to identify the mechanical vibration sources and on the draft tube in order to identify the hydraulic vibration sources. Analyzing the vibration results, recommendations regarding the operation of the turbine, at partial load close to minimum values, in the middle of the operating domain or close to maximum values of electric power, can be made in order to keep relatively low levels of vibration. Finally, conclusions are drawn in order to present the real sources of the vibrations.

  18. Simulations of Steady Cavitating Flow in a Small Francis Turbine

    Directory of Open Access Journals (Sweden)

    Ahmed Laouari

    2016-01-01

    Full Text Available The turbulent flow through a small horizontal Francis turbine is solved by means of Ansys-CFX at different operating points, with the determination of the hydrodynamic performance and the best efficiency point. The flow structures at different regimes reveal a large flow eddy in the runner and a swirl in the draft tube. The use of the mixture model for the cavity/liquid two-phase flow allowed studying the influence of cavitation on the hydrodynamic performance and revealed cavitation pockets near the trailing edge of the runner and a cavitation vortex rope in the draft tube. By maintaining a constant dimensionless head and a distributor vane opening while gradually increasing the cavitation number, the output power and efficiency reached a critical point and then had begun to stabilize. The cavitation number corresponding to the safety margin of cavitation is also predicted for this hydraulic turbine.

  19. Prediction of dynamic blade loading of the Francis-99 turbine

    International Nuclear Information System (INIS)

    Nicolle, J; Cupillard, S

    2015-01-01

    CFD simulations focusing on capturing dynamic fluctuations of the flow for three operating points were performed for a scale model of a high head Francis turbine. A mesh sensitivity study showed an influence of the near wall resolution, consequently a low Reynolds mesh with a SST turbulence model was used. Rotor/stator fluctuations are well reproduced with the full turbine simulation at all operating points. Velocity contours and average velocity profiles from LDV measurements in the draft tube confirm that the flow physics is generally well reproduced. Simplified approaches such as profile transform and Fourier transform underestimated the measured fluctuations. As full turbine simulations were time-consuming, a simulation with only the draft tube was performed at part load to predict the fluctuations in the draft tube cone. The SAS-SST turbulence model was able to capture the vortex rope behavior

  20. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  1. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  2. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  3. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  4. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  5. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  6. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  7. State of the art in numerical simulation of high head Francis turbines

    Directory of Open Access Journals (Sweden)

    Trivedi Chirag

    2016-01-01

    Full Text Available The Francis-99 test case consists in a high head Francis turbine model, which geometry together with meshes and detailed experimental measurements is freely available at www.francis-99.org. Three workshops were initially planned to exchange experience on numerical investigations of the test case concerning steady state operating conditions, transient operating conditions and fluid structure analysis. The first workshop was held in Trondheim, Norway in December 2014. Some results of the 14 contributions are presented. They are concerned with the influence of the near wall space discretization and turbulence modelling in order to capture hydraulic efficiency, torque, pressure and velocity with a good uncertainty at three operating conditions.

  8. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  9. Reliability of the Francis Scale of Attitude Toward Christianity among 8-yr-olds.

    Science.gov (United States)

    Robbins, Mandy; Francis, Leslie J; Williams, Naomi

    2003-02-01

    The Francis Scale of Attitude Toward Christianity was completed by 78 8-yr.-olds (40 boys and 38 girls) whose data support reliability measured as the internal consistency of the scale for this young sample.

  10. The Power of the Word and the Mastery of Nature: Renaissance Magic and Francis Bacon

    Czech Academy of Sciences Publication Activity Database

    Špelda, Daniel

    19/43/, - (2005), s. 7-36. ISBN 80-7007-236-9. ISSN 0231-5955 Institutional research plan: CEZ:AV0Z90090514 Keywords : magic * renaissance philosophy * Francis Bacon Subject RIV: AA - Philosophy ; Religion

  11. Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System

    OpenAIRE

    Fengjiao Wu; Junling Ding; Zhengzhong Wang

    2016-01-01

    The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the d...

  12. The great war correspondent: Francis McCullagh, 1874–1956

    OpenAIRE

    Horgan, John

    2009-01-01

    Trotsky of Russia knows Francis McCullagh. So does President Calles of Mexico. Peter, the King of Serbia, was McCullagh’s friend. The headhunters of the upper Amazon list Francis McCullagh as one of their principal deities. The warring tribes of Morocco call him blood brother. A room is always ready for him in the imperial palace of Siam. The latchstrings of hundreds of Siberian peasant huts are out in anticipation of his coming.

  13. The Visual Shock of Francis Bacon: An essay in neuroesthetics

    Directory of Open Access Journals (Sweden)

    Semir eZeki

    2013-12-01

    Full Text Available In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a visual shock. We explore what this means in terms of brain activity and what insights into the brain’s visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs and cars. We show that viewing face and house stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his visual shock because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  14. Civil history and poetry, certainty and truth in Francis Bacon

    Directory of Open Access Journals (Sweden)

    Silvia Manzo

    2015-02-01

    Full Text Available This article aims at studying key components of Francis Bacon’s theory of history and of his work as practitioner of civil history, particularly in regard to truth and certainty in historical narratives. It compares Bacon’s theories of history and poetry, and the way in which he conceives their relation to certainty, truth and fiction. It analyzes mainly two sorts of writings. On the one hand, it investigates the programmatic texts where Bacon’s views of history and poetry are developed. On the other hand, it examines the finished and unfinished civil histories written by Bacon as historian. In addition, the article evaluates Bacon’s stances against the background of Renaissance and early modern English historiography. It concludes that although history and poetry constitute separate branches in Bacon’s classification of learning, they share important elements, in keeping with the view of poetry maintained by his contemporary Philip Sidney. Thus, Bacon included fictional patterns in his historical narrative and distinguished certainties from conjectures in a particular way. This attitude towards civil history shows a strong contrast to Bacon’s methodology for natural histories, which, in order to reach certainty, staunchly recommends to exclude any fictional narrative in reporting the facts of nature.

  15. The medical philosophy of Francis Bacon (1561-1626).

    Science.gov (United States)

    Boss, J

    1978-01-01

    Francis Bacon's view of man is dualistic but, although he takes note of mental faculties, he makes the relation between mind and body, rather than the substance of mind, the basis for enquiry into mental processes and, more particularly, for the medically relevant study of mind. (He uses "mind" and "soul" as equivalent terms.) The healing of the body requires study of the body, and the ineffectiveness of physicians is due to their failure in this respect rather than to the body's complexity. To learn about the body requires clinical observation and recording, together with the comparison of bodies, experiments on living animals and attention to pathological changes. The aims of medicine should include not only the restoration of health but also the relief of suffering and they are not to be limited by putting aside a disease as incurable. To learn from treatment it must be fixed in its ordering with controlled and limited variation. Bacon has no separation of medicine from natural science; his philosophy of medicine is his general philosophy of the advancement of knowledge, but limited to a particular field of application. If medicine is separated from natural philosophy it is changed wholly or greatly into empiricism.

  16. Computation of Cavitating Flow in a Francis Hydroturbine

    Science.gov (United States)

    Leonard, Daniel; Lindau, Jay

    2013-11-01

    In an effort to improve cavitation characteristics at off-design conditions, a steady, periodic, multiphase, RANS CFD study of an actual Francis hydroturbine was conducted and compared to experimental results. It is well-known that operating hydroturbines at off-design conditions usually results in the formation of large-scale vaporous cavities. These cavities, and their subsequent collapse, reduce efficiency and cause damage and wear to surfaces. The conventional hydro community has expressed interest in increasing their turbine's operating ranges, improving their efficiencies, and reducing damage and wear to critical turbine components. In this work, mixing planes were used to couple rotating and stationary stages of the turbine which have non-multiple periodicity, and provide a coupled solution for the stay vanes, wicket gates, runner blades, and draft tube. The mixture approach is used to simulate the multiphase flow dynamics, and cavitation models were employed to govern the mass transfer between liquid and gas phases. The solution is compared with experimental results across a range of cavitation numbers which display all the major cavitation features in the machine. Unsteady computations are necessary to capture inherently unsteady cavitation phenomena, such as the precessing vortex rope, and the shedding of bubbles from the wicket gates and their subsequent impingement upon the leading edge of the runner blades. To display these features, preliminary unsteady simulations of the full machine are also presented.

  17. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  19. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  20. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  1. Turbulence modeling for Francis turbine water passages simulation

    International Nuclear Information System (INIS)

    Maruzewski, P; Munch, C; Mombelli, H P; Avellan, F; Hayashi, H; Yamaishi, K; Hashii, T; Sugow, Y

    2010-01-01

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-ε model, or the standard k-ε model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  2. Turbulence modeling for Francis turbine water passages simulation

    Energy Technology Data Exchange (ETDEWEB)

    Maruzewski, P; Munch, C; Mombelli, H P; Avellan, F [Ecole polytechnique federale de Lausanne, Laboratory of Hydraulic Machines Avenue de Cour 33 bis, CH-1007 Lausanne (Switzerland); Hayashi, H; Yamaishi, K; Hashii, T; Sugow, Y, E-mail: pierre.maruzewski@epfl.c [Nippon KOEI Power Systems, 1-22 Doukyu, Aza, Morijyuku, Sukagawa, Fukushima Pref. 962-8508 (Japan)

    2010-08-15

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-{epsilon} model, or the standard k-{epsilon} model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  3. Turbulence modeling for Francis turbine water passages simulation

    Science.gov (United States)

    Maruzewski, P.; Hayashi, H.; Munch, C.; Yamaishi, K.; Hashii, T.; Mombelli, H. P.; Sugow, Y.; Avellan, F.

    2010-08-01

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-epsilon model, or the standard k-epsilon model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  4. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  5. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  6. Sigmund Freud and the Crick-Koch hypothesis. A footnote to the history of consciousness studies.

    Science.gov (United States)

    Smith, D L

    1999-06-01

    The author describes Crick and Koch's recently developed theory of the neurophysiological basis of consciousness as synchronised neural oscillations. The thesis that neural oscillations provide the neurophysiological basis for consciousness was anticipated by Sigmund Freud in his 1895 'Project for a scientific psychology'. Freud attempted to solve his neuropsychological 'problem of quality' by means of the hypothesis that information concerning conscious sensory qualities is transmitted through the mental apparatus by means of neural 'periods'. Freud believed that information carried by neural oscillations would proliferate across 'contact-barriers' (synapses) without inhibition. Freud's theory thus appears to imply that synchronised neural oscillations are an important component of the neurophysiological basis of consciousness. It is possible that Freud's thesis was developed in response to the experimental research of the American neuroscientist M. M. Garver.

  7. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  8. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  9. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  10. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  11. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  12. Five-Item Francis Scale of Attitude toward Christianity: Construct and Nomological Validity and Internal Consistency among Colombian College Students

    Science.gov (United States)

    Ceballos, Guillermo A.; Suescun, Jesus D.; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto

    2015-01-01

    The Spanish version of the five-item Francis scale of attitude toward Christianity is a refinement of the short version of the Francis scale of attitude toward Christianity. The scale is a good measurement for intrinsic religiosity. It has been applied previously among Colombian adolescent students. The internal consistency and construct and…

  13. 75 FR 80730 - Francis Slakey on Behalf of the American Physical Society; Receipt of Petition for Rulemaking

    Science.gov (United States)

    2010-12-23

    ... [Docket No. PRM-70-9; NRC-2010-0372] Francis Slakey on Behalf of the American Physical Society; Receipt of... the NRC by Francis Slakey on behalf of the American Physical Society (APS). The petition was docketed... that over the next few years, the NRC would be reviewing license applications for new technologies, and...

  14. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  15. Francis Bacon's New Science: Rhetoric and the Transformative Power of Print.

    Science.gov (United States)

    Heckel, David

    The process of projecting textual models onto the phenomenal world began with the invention of writing and accelerated through the manuscript culture of classical antiquity and the Middle Ages into the age of print. In Francis Bacon's work, the book (a metaphor for the phenomenal world) adapted to the demands of the printed text and reflects the…

  16. The Culture of Science and the Rhetoric of Scientism: From Francis Bacon to the Darwin Fish

    Science.gov (United States)

    Lessl, Thomas M.

    2007-01-01

    The culture of modern science continues to establish its public identity by appealing to values and historical conceptions that reflect its appropriation of various religious ideals during its formative period, most especially in the rhetoric of Francis Bacon. These elements have persisted because they continue to achieve similar goals, but the…

  17. Internal consistency of a Spanish translation of the Francis Scale of Attitude Toward Christianity Short Form.

    Science.gov (United States)

    Campo-Arias, Adalberto; Oviedo, Heidi Celina; Díaz, Carmen Elena; Cogollo, Zuleima

    2006-12-01

    This study evaluated the internal consistency of a Spanish version of the short form of the Francis Scale of Attitude Toward Christianity based on responses of 405 Colombian adolescent students ages 13 to 17 years. This translated short-form version of the scale had an internal consistency of .80. This estimate indicates suitable internal consistency reliability for research use in this population.

  18. "Ajaloo lõpp" on lähedal / Francis Fukuyama ; interv. Adam Piore

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2003-01-01

    Ajakirjas Newsweek ilmunud intervjuus vastab filosoof Francis Fukuyama küsimustele 2004. aasta kõige olulisemate probleemide, EL-i, Cancunis toimunud Maailma Kaubandusorganisatsiooni kõneluste, ajaloo lõppu jõudmise, Pakistani presidendile tehtud atentaadi kohta

  19. Power Swing Generated in Francis Turbines by Part Load and Overload Instabilities

    Directory of Open Access Journals (Sweden)

    David Valentín

    2017-12-01

    Full Text Available Hydropower plays a key role in the actual energy market due to its fast response and regulation capacity. In that way, hydraulic turbines are increasingly demanded to work at off-design conditions, where complex flow patterns and cavitation appear, especially in Francis turbines. The draft tube cavitation surge is a hydraulic phenomenon that appears in Francis turbines below and above its Best Efficiency Point (BEP. It is a low frequency phenomenon consisting of a vortex rope in the runner outlet and draft tube, which can become unstable when its frequency coincides with a natural frequency of the hydraulic circuit. At this situation, the output power can significantly swing, endangering the electrical grid stability. This study is focused on the detection of these instabilities in Francis turbines and their relationship with the output power swings. To do so, extensive experimental tests for different operating conditions have been carried out in a large prototype Francis turbine (444 MW of rated power within the frame of the European Project Hyperbole (FP7-ENERGY-2013-1. Several sensors have been installed in the hydraulic circuit (pressure sensors in the draft tube, spiral casing, and penstock, in the rotating and static structures (vibration sensors, proximity probes, and strain gauges in the runner and in the shaft, as well as in the electrical side (output power, intensity, and voltage. Moreover, a numerical Finite Element Method (FEM has been also used to relate the hydraulic excitation with the output power swing.

  20. Francis Farley presenting his novel "Catalysed Fusion" in the CERN Library

    CERN Multimedia

    Farley, Irina

    2013-01-01

    "Catalysed Fusion" is described by its author Francis Farley, 92, as a "true-to-life fantasy woven around particle physics" set in 1980s Geneva – "the city where nations meet and particles collide". Farley presented the book in the program "Literature in Focus" on Tuesday 16th April 2013.

  1. Hydraulic Turbines: The Francis Turbine. Technical Terminology Bulletin. Terminotech, Vol. 2, No. 2.

    Science.gov (United States)

    General Electric Co. of Canada, Ltd., Montreal, Quebec.

    This issue of a bulletin of technological terminology is devoted to the Francis turbine. A brief narrative on the subject is presented in both French and English. An English-French dictionary of terms comprises the bulk of the document. An explanatory illustration is appended. (JB)

  2. Saint Francis Xavier on Jesuit School Stages of the Bohemian Province

    Czech Academy of Sciences Publication Activity Database

    Bobková, Kateřina; Jacková, Magdaléna

    2015-01-01

    Roč. 25, č. 2 (2015), s. 135-155 ISSN 0515-3190 R&D Projects: GA ČR GPP406/12/P823 Institutional support: RVO:68378068 ; RVO:67985963 Keywords : St. Francis Xavier * Jesuit saints * Jesuit theatre * neolatin drama * school theatre * Avancini, Nicolaus * Engel, Arnoldus Subject RIV: AJ - Letters, Mass-media, Audiovision; AB - History (HIU-Y)

  3. Inventing Citizens, Imagining Gender Justice: The Suffrage Rhetoric of Virginia and Francis Minor

    Science.gov (United States)

    Ray, Angela G.; Richards, Cindy Koenig

    2007-01-01

    From the late 1860s through the mid-1870s, woman suffrage activists developed an ingenious legal argument, claiming that the U.S. Constitution already enfranchised women citizens. The argument, first articulated by St. Louis activists Virginia and Francis Minor, precipitated rhetorical performances by movement activists on public platforms and in…

  4. Glade/woodland restoration in the St. Francis Mountain Bird Conservation Area

    Science.gov (United States)

    David A. Hasenbeck

    2007-01-01

    The Missouri Department of Conservation (MDC), the Missouri Department of Natural Resources, the U.S. Forest Service, and American Bird Conservancy, share goals to restore and manage high quality glade, savanna, and woodland habitats within the Saint Francis Bird Conservation Area. The partnership endeavors to maintain and enhance an ecosystem with native glade and...

  5. Validez y confiabilidad de la escala breve de Francis para actitud ante el cristianismo

    Directory of Open Access Journals (Sweden)

    Zuleima Cogollo

    2012-04-01

    Resultados. La escala Francis-5 mostró una estructura unidimensional, con un valor propio de 3,681 que dio cuenta del 73,6% de la varianza. Las mujeres puntuaron significativamente mayor que los varones, 18,5 (DE=2,7 vs. 17,9 (DE=3,3 (t = 4,3; p

  6. 78 FR 59913 - Revision of the Land Management Plan for the Francis Marion National Forest

    Science.gov (United States)

    2013-09-30

    ... telecommunication devices for the deaf (TDD) may call the Federal Information Relay Service (FIRS) at 1-800- 877... planning process can also be found on the Francis Marion National Forest Web site at www.fs.usda.gov/goto/scnfs/fmplan . SUPPLEMENTARY INFORMATION: Pursuant to the 2012 Forest Planning Rule (36 CFR Part 219...

  7. Hydrologic and water quality monitoring on Turkey Creek watershed, Francis Marion National Forest, SC

    Science.gov (United States)

    D.M. Amatya; T.J. Callahan; A. Radecki-Pawlik; P. Drewes; C. Trettin; W.F. Hansen

    2008-01-01

    The re-initiation of a 7,260 ha forested watershed study on Turkey Creek, a 3rd order stream, within the Francis Marion National forest in South Carolina, completes the development of a multi-scale hydrology and ecosystem monitoring framework in the Atlantic Coastal Plain. Hydrology and water quality monitoring began on the Santee Experimental...

  8. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  9. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  10. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be considered as a source of the mutagenic tautomers of the DNA bases, as the A·G base mispair dissociates during DNA replication exceptionally into the A and G monomers in the canonical tautomeric form. Copyright © 2013 Wiley Periodicals, Inc.

  11. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  12. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  13. The Internal Consistency Reliability of the Katz-Francis Scale of Attitude toward Judaism among Australian Jews

    Directory of Open Access Journals (Sweden)

    Patrick Lumbroso

    2016-09-01

    Full Text Available The Katz-Francis Scale of Attitude toward Judaism was developed initially to extend among the Hebrew-speaking Jewish community in Israel a growing body of international research concerned to map the correlates, antecedents and consequences of individual differences in attitude toward religion as assessed by the Francis Scale of Attitude toward Christianity. The present paper explored the internal consistency reliability and construct validity of the English translation of the Katz-Francis Scale of Attitude toward Judaism among 101 Australian Jews. On the basis of these data, this instrument is commended for application in further research.

  14. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  15. Internal consistency of a five-item form of the Francis Scale of Attitude Toward Christianity among adolescent students.

    Science.gov (United States)

    Campo-Arias, Adalberto; Oviedo, Heidi Celina; Cogollo, Zuleima

    2009-04-01

    The short form of the Francis Scale of Attitude Toward Christianity (L. J. Francis, 1992) is a 7-item Likert-type scale that shows high homogeneity among adolescents. The psychometric performance of a shorter version of this scale has not been explored. The authors aimed to determine the internal consistency of a 5-item form of the Francis Scale of Attitude Toward Christianity among 405 students from a school in Cartagena, Colombia. The authors computed the Cronbach's alpha coefficient for the 5 items with a greater corrected item-total punctuation correlation. The version without Items 2 and 7 showed internal consistency of .87. The 5-item version of the Francis Scale of Attitude Toward Christianity exhibited higher internal consistency than did the 7-item version. Future researchers should corroborate this finding.

  16. Effects of draft tube on the hydraulic performance of a Francis turbine

    International Nuclear Information System (INIS)

    Jeon, J H; Byeon, S S; Kim, Y J

    2013-01-01

    The draft tube is an important component of a Francis turbine which influences the hydraulic performance. It is located just under the runner and allowed to decelerate the flow velocity exiting the runner, thereby converting the excess of kinetic energy into static pressure. In this study, we have numerically investigated the hydraulic performance of a Francis turbine on the 15MW hydropower generation with various design parameters (three types of draft tube, thickness of guide vane) through a three-dimensional numerical method with the SST turbulent model. The vortex rope characteristics of the draft tube were confirmed. The results of the vortex flow fields and flow characteristics were graphically depicted with different design parameters and operating conditions

  17. Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System

    Directory of Open Access Journals (Sweden)

    Fengjiao Wu

    2016-01-01

    Full Text Available The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the designed controller has good robustness which could resist external random disturbances. Numerical simulations are employed to verify the effectiveness and superiority of the designed finite-time sliding mode control scheme. The approach proposed in this paper is simple and also provides a reference for relevant hydropower systems.

  18. Experimental investigations of the unsteady flow in a Francis turbine draft tube cone

    International Nuclear Information System (INIS)

    Baya, A; Muntean, S; Campian, V C; Cuzmos, A; Diaconescu, M; Balan, G

    2010-01-01

    Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.

  19. Experimental investigations of the unsteady flow in a Francis turbine draft tube cone

    Energy Technology Data Exchange (ETDEWEB)

    Baya, A [Department of Hydraulic Machinery, ' Politehnica' University of Timisoara Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Campian, V C; Cuzmos, A [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta. Traian Vuia 1-4, RO-320085, Resita (Romania); Diaconescu, M; Balan, G, E-mail: abaya@mh.mec.upt.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A. Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)

    2010-08-15

    Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.

  20. Psychometric properties of the Francis Scale of Attitude Towards Christianity among Portuguese university students.

    Science.gov (United States)

    Ferreira, Ana Veríssimo; Neto, Félix

    2002-12-01

    To facilitate use of the adult form of the Francis Scale of Attitude Towards Christianity in cross-cultural studies, the psychometric characteristics of the translated scale were examined among 323 university students in Portugal (130 men and 193 women). Their ages ranged from 18 to 31 years. Analysis supported the unidimensionality, internal consistency, and construct validity of this scale in this sample of Portuguese university students.

  1. The Norwegian translation of the Francis Scale of Attitude toward Christianity.

    Science.gov (United States)

    Francis, Leslie J; Enger, Trond

    2002-12-01

    This paper reviews the development of the Francis Scale of Attitude toward Christianity and then examines the psychometric properties of the Norwegian translation of this instrument among a sample of 479 young people between the ages of 11 and 18 years attending secondary school. The data support the reliability of this instrument and commend it for further validation studies and for wider general use among young people in Norway.

  2. Assessing clergy work-related psychological health : reliability and validity of the Francis Burnout Inventory

    OpenAIRE

    Francis, Leslie J.; Laycock, Patrick; Crea, Giuseppe

    2017-01-01

    Drawing on the classic model of balanced affect, the Francis Burnout Inventory (FBI) conceptualised good work-related psychological health among clergy in terms of negative affect being balanced by positive affect. In the FBI negative affect is assessed by the Scale of Emotional Exhaustion in Ministry (SEEM) and positive affect is assessed by the Satisfaction in Ministry Scale (SIMS). In support of the idea of balanced affect, previous work had shown a significant interaction between the effe...

  3. The calculation of fluid-structure interaction and fatigue analysis for Francis turbine runner

    International Nuclear Information System (INIS)

    Wang, X F; Li, H L; Zhu, F W

    2012-01-01

    Francis turbine, as a widely used hydro turbine, is especially suited for the hydropower station with high hydraulic head and higher hydraulic head. For such turbine generator units all around the world, the crack streaks usually come out after a long time use and the resulted accidents may cause huge losses. Hence, it is meaningful to refine the design assuring the stability and safety of the Francis turbine. In this paper, the stiffness and strength as well as the fatigue life of the Francis turbine are studied. Concerning on the turbine of one certain hydropower station, the flow field inside the turbine are first simulated and the pressure distribution around the blades are derived. Meanwhile, the stress distributions of the blades are also obtained. Based on these, the fatigue analyses are applied on the turbine. According to the results of fatigue analyses, some optimal designs on the turbine are verified. The results show that with the optimal designs, the hydraulic performances of the turbine do not change too much while the maximum stress on the turbine decrease and the fatigue life increase as well.

  4. Hydroacoustic simulation of rotor-stator interaction in resonance conditions in Francis pump-turbine

    International Nuclear Information System (INIS)

    Nicolet, C; Ruchonnet, N; Alligne, S; Avellan, F; Koutnik, J

    2010-01-01

    Combined effect of rotating pressure field related to runner blade and wakes of wicket gates leads to rotor stator interactions, RSI, in Francis pump-turbines. These interactions induce pressures waves propagating in the entire hydraulic machine. Superposition of those pressure waves may result in standing wave in the spiral casing and rotating diametrical mode in the guide vanes and can cause strong pressure fluctuations and vibrations. This paper presents the modeling, simulation and analysis of Rotor-Stator Interaction of a scale model of a Francis pump-turbine and related test rig using a one-dimensional approach. The hydroacoustic modeling of the Francis pump-turbine takes into account the spiral casing, the 20 guide vanes, the 9 rotating runner vanes. The connection between stationary and rotating parts is ensured by a valve network driven according to the unsteady flow distribution between guide vanes and runner vanes. Time domain simulations are performed for 2 different runner rotational speeds in turbine mode. The simulation results are analyzed in frequency domain and highlights hydroacoustic resonance between RSI excitations and the spiral case. Rotating diametrical mode in the vaneless gap and standing wave in the spiral case are identified. The influence of the resonance on phase and amplitude of pressure fluctuations obtained for both the spiral case and the vaneless gap is analyzed. The mode shape and frequencies are confirmed using eigenvalues analysis.

  5. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  6. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  7. (Mis)understanding Science: The Problem with Scientific Breakthroughs.

    Science.gov (United States)

    Evans, James P

    2016-09-01

    On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.

  8. After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

    Science.gov (United States)

    Creager, Angela N H; Morgan, Gregory J

    2008-06-01

    Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

  9. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  10. High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

    Science.gov (United States)

    Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

    2003-01-01

    We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

  11. Cancer and Evolution

    International Nuclear Information System (INIS)

    Guevara Pardo, Gonzalo

    2001-01-01

    First it was the luminous idea of the natural selection, proposed by Alfred Russell Wallace and Talk Darwin, the one that allowed understanding the way as the living organisms are evolve. Then they were the brilliant Francis Crick and James Watson who discovered the curvilinear molecule of deoxyribonucleic acid (DNA) and then it was the great explosion of the molecular biology. The cancer, illness that wakes up our deepest fears, is analyzed in this article from an evolutionary conception that could give us a road but appropriate to understand it and maybe to guide us toward better therapeutic options

  12. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  13. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  14. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  15. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  16. Dos obras del escultor neoclásico inglés John Francis (1780- 1861 en una colección particular española

    Directory of Open Access Journals (Sweden)

    Quintanilla Martínez, Emilio

    2012-09-01

    Full Text Available Two previously unknown works by the British neoclassical sculptor John Francis dating from the second quarter of the 19th century, representing the 1st Duke of Sutherland and, most likely, the sculptor Sir John Francis, have been located in a Spanish private collection.

    Dos obras, hasta ahora inéditas, del escultor neoclásico inglés John Francis del segundo cuarto del siglo XIX, y que representan al primer duque de Sutherland y seguramente al escultor Sir John Francis, en colección privada española.

  17. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  18. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  19. A Song in the Dark. Francis of Assisi’s Canticle of Brother Sun

    Directory of Open Access Journals (Sweden)

    Speelman Willem Marie

    2016-10-01

    Full Text Available The Canticle of the Creatures or Canticle of Brother Sun is based on a particular way of perceiving reality. Francis, who had turned away from ‘the world’, discovered a different way of looking at it. This is a divine way of perceiving, in which the senses do not grasp reality, but accept it as it communicates itself. This way of perceiving is only possible if one does not attempt to master the environment, but allows one’s senses to be weak. It is significant, therefore, that this song of praise was born at a moment of the utmost despair and weakness. The song’s content is in line with this weak perception: it is not about Francis who praises God and (or for His creatures, but rather it is a testimony that the creatures-the elements-are already praising God, and a prayer that He should let Himself be praised by the creatures. Also in line with this weak perception is the fact that the creatures are praised just as they communicate themselves to Francis: as bodies. The theology of this song is that the creatures through their bodies resonate (strengthen, and colour the blessings that come from God, thereby making His blessing present here on earth. Francis’ role is to give a voice and a language to the heavenly praises as they resound in his environment. The transformative power of this song is that we, whether consciously or not, do the same thing when we participate in this song.

  20. Francis Bacon's Valerius Terminus and the Voyage to the "Great Instauration".

    Science.gov (United States)

    Serjeantson, Richard

    2017-01-01

    Francis Bacon's earliest surviving natural philosophical treatise (composed circa 1603) bears the title Valerius Terminus of the Interpretation of Nature. This study, resting on fresh attention to the surviving authorial manuscript, has three goals. It begins by identifying a lost precursor work apparently entitled "Of Active Knowledge." It then examines the significance of the pseudonyms Bacon chose to introduce his ideas, considering especially his invocation of Erasmus's emblem, the Roman deity Terminus. Finally, it shows how the Valerius Terminus's global vision of contemporary knowledge ultimately helped shape the iconography of Bacon's published Instauratio magna.

  1. The Rule of Three for Prizes in Science and the Bold Triptychs of Francis Bacon.

    Science.gov (United States)

    Goldstein, Joseph L

    2016-09-22

    For many scientific awards, such as Nobels and Laskers, the maximum number of recipients is three. This Rule of Three forces selection committees to make difficult decisions that increase the likelihood of singling out those individuals who open a new field and continue to lead it. The Rule of Three is reminiscent of art's three-panel triptych, a form that the modern master Francis Bacon used to distill complex stories in a bold way. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Stability of the Spanish version of the five-item Francis Scale of Attitude toward Christianity.

    Science.gov (United States)

    Miranda-Tapia, Giskar Alonso; Cogollo, Zuleima; Herazo, Edwin; Campo-Arias, Adalberto

    2010-12-01

    The aim of this study was to establish test-retest reliability of a Spanish version of the Francis Scale of Attitude toward Christianity (Campo-Arias, Oviedo, & Cogollo, 2009) among adolescent students in Cartagena, Colombia. A group of ninth grade students from two public schools in Colombia (N = 157) completed the five-item scale. Cronbach's alphas were .74 and .76 in the first and second administrations, respectively. Both Pearson's rho and intra-class correlation coefficient were .69. A Spanish translation of the 5-item scale had consistent stability over four weeks.

  3. Influence of the rotor-stator interaction on the dynamic stresses of Francis runners

    International Nuclear Information System (INIS)

    Guillaume, R; Scolaro, D; Deniau, J L; Colombet, C

    2012-01-01

    Thanks to advances in computing capabilities and Computational Fluid Dynamics (CFD) techniques, it is now possible to calculate realistic unsteady pressure fields in Francis turbines. This paper will explain methods to calculate the structural loads and the dynamic behaviour in order to optimize the turbine design and maximize its reliability and lifetime. Depending on the operating conditions of a Francis turbine, different hydraulic phenomena may impact the mechanical behaviour of the structure. According to their nature, these highly variable phenomena should be treated differently and specifically in order to estimate the potential risks arising on submerged structures, in particular the runner. The operating condition studied thereafter is the point at maximum power with the maximum head. Under this condition, the runner is excited by only one dynamic phenomenon named the Rotor-Stator Interaction (RSI). The origin of the phenomenon is located on the radial gap of the turbine and is the source of pressure fluctuations. A fluid-structure analysis is performed to observe the influence of that dynamic pressure field on the runner behaviour. The first part of the paper deals with the unsteady fluid computation. The RSI phenomenon is totally unsteady so the fluid simulation must take into account the entire machine and its rotation movement, in order to obtain a dynamic pressure field. In the second part of the paper, a method suitable for the RSI study is developed. It is known that the fluctuating pressure in this gap can be described as a sum of spatial components. By evaluating these components in the CFD results and on the scale model, it is possible to assess the relevance of the numerical results on the whole runner. After this step, the numerical pressure field can be used as the dynamic load of the structure. The final part of the paper presentsthe mechanical finite element calculations. A modal analysis of the runner in water and a harmonic analysis of its

  4. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  5. Francis Bacon's natural history and the Senecan natural histories of early modern Europe.

    Science.gov (United States)

    Jalobeanu, Dana

    2012-01-01

    At various stages in his career, Francis Bacon claimed to have reformed and changed traditional natural history in such a way that his new "natural and experimental history" was unlike any of its ancient or humanist predecessors. Surprisingly, such claims have gone largely unquestioned in Baconian scholarship. Contextual readings of Bacon's natural history have compared it, so far, only with Plinian or humanist natural history. This paper investigates a different form of natural history, very popular among Bacon's contemporaries, but yet unexplored by contemporary students of Bacon's works. I have provisionally called this form of natural history'Senecan' natural history, partly because it took shape in the Neo-Stoic revival of the sixteenth-century, partly because it originates in a particular cosmographical reading of Seneca's Naturales quaestiones. I discuss in this paper two examples of Senecan natural history: the encyclopedic and cosmographical projects of Pierre de la Primaudaye (1546-1619) and Samuel Purchas (1577-1626). I highlight a number of similarities between these two projects and Francis Bacon's natural history, and argue that Senecan natural history forms an important aspect in the historical and philosophical background that needs to be taken into consideration if we want to understand the extent to which Bacon's project to reform natural history can be said to be new.

  6. Prediction of Francis Turbine Prototype Part Load Pressure and Output Power Fluctuations with Hydroelectric Model

    Science.gov (United States)

    Alligné, S.; Nicolet, C.; Béguin, A.; Landry, C.; Gomes, J.; Avellan, F.

    2017-04-01

    The prediction of pressure and output power fluctuations amplitudes on Francis turbine prototype is a challenge for hydro-equipment industry since it is subjected to guarantees to ensure smooth and reliable operation of the hydro units. The European FP7 research project Hyperbole aims to setup a methodology to transpose the pressure fluctuations induced by the cavitation vortex rope from the reduced scale model to the prototype generating units. A Francis turbine unit of 444MW with a specific speed value of ν = 0.29, is considered as case study. A SIMSEN model of the power station including electrical system, controllers, rotating train and hydraulic system with transposed draft tube excitation sources is setup. Based on this model, a frequency analysis of the hydroelectric system is performed for all technologies to analyse potential interactions between hydraulic excitation sources and electrical components. Three technologies have been compared: the classical fixed speed configuration with Synchronous Machine (SM) and the two variable speed technologies which are Doubly Fed Induction Machine (DFIM) and Full Size Frequency Converter (FSFC).

  7. Prediction Method for the Complete Characteristic Curves of a Francis Pump-Turbine

    Directory of Open Access Journals (Sweden)

    Wei Huang

    2018-02-01

    Full Text Available Complete characteristic curves of a pump-turbine are essential for simulating the hydraulic transients and designing pumped storage power plants but are often unavailable in the preliminary design stage. To solve this issue, a prediction method for the complete characteristics of a Francis pump-turbine was proposed. First, based on Euler equations and the velocity triangles at the runners, a mathematical model describing the complete characteristics of a Francis pump-turbine was derived. According to multiple sets of measured complete characteristic curves, explicit expressions for the characteristic parameters of characteristic operating point sets (COPs, as functions of a specific speed and guide vane opening, were then developed to determine the undetermined coefficients in the mathematical model. Ultimately, by combining the mathematical model with the regression analysis of COPs, the complete characteristic curves for an arbitrary specific speed were predicted. Moreover, a case study shows that the predicted characteristic curves are in good agreement with the measured data. The results obtained by 1D numerical simulation of the hydraulic transient process using the predicted characteristics deviate little from the measured characteristics. This method is effective and sufficient for a priori simulations before obtaining the measured characteristics and provides important support for the preliminary design of pumped storage power plants.

  8. Dynamic stresses in a Francis model turbine at deep part load

    Science.gov (United States)

    Weber, Wilhelm; von Locquenghien, Florian; Conrad, Philipp; Koutnik, Jiri

    2017-04-01

    A comparison between numerically obtained dynamic stresses in a Francis model turbine at deep part load with experimental ones is presented. Due to the change in the electrical power mix to more content of new renewable energy sources, Francis turbines are forced to operate at deep part load in order to compensate stochastic nature of wind and solar power and to ensure grid stability. For the extension of the operating range towards deep part load improved understanding of the harsh flow conditions and their impact on material fatigue of hydraulic components is required in order to ensure long life time of the power unit. In this paper pressure loads on a model turbine runner from unsteady two-phase computational fluid dynamics simulation at deep part load are used for calculation of mechanical stresses by finite element analysis. Therewith, stress distribution over time is determined. Since only few runner rotations are simulated due to enormous numerical cost, more effort has to be spent to evaluation procedure in order to obtain objective results. By comparing the numerical results with measured strains accuracy of the whole simulation procedure is verified.

  9. A highly efficient Francis turbine designed for energy recovery in cooling towers

    Directory of Open Access Journals (Sweden)

    Daqing Zhou

    2015-03-01

    Full Text Available In China, cooling water entering cooling towers still retains surplus pressure between 39,240 and 147,150 Pa. In order to utilize this wasted energy, it is suggested that the surplus water energy can be harnessed to drive a type of hydroturbine installed in the inner platform of cooling tower and make the fan rotate via its coupled shafts. However, conventional hydroturbines are not suited for this job because of their low efficiency or unmatched rotating speed with that of the fan under the operating conditions of cooling towers. In this article, according to the requirements of turbine work environment in cooling towers, a new type of hydroturbine, Francis turbine with ultra-low specific speed (ns  = 50 m.kW, was designed to replace the fan motor in a cooling tower. Primarily, the shape, position, and number of runner blades were designed and optimized through theoretical analyses and computational fluid dynamics simulations. Additionally, metal elliptical volute and single-row ring guide vanes were applied to scale down the structural dimensions. Finally, the optimal scheme of the new Francis turbine was proven to have a high efficiency of 88% and good operation stability through testing of a physical model and can achieve the goal of harvesting renewable energy in the cooling tower.

  10. Research on Francis Turbine Modeling for Large Disturbance Hydropower Station Transient Process Simulation

    Directory of Open Access Journals (Sweden)

    Guangtao Zhang

    2015-01-01

    Full Text Available In the field of hydropower station transient process simulation (HSTPS, characteristic graph-based iterative hydroturbine model (CGIHM has been widely used when large disturbance hydroturbine modeling is involved. However, by this model, iteration should be used to calculate speed and pressure, and slow convergence or no convergence problems may be encountered for some reasons like special characteristic graph profile, inappropriate iterative algorithm, or inappropriate interpolation algorithm, and so forth. Also, other conventional large disturbance hydroturbine models are of some disadvantages and difficult to be used widely in HSTPS. Therefore, to obtain an accurate simulation result, a simple method for hydroturbine modeling is proposed. By this method, both the initial operating point and the transfer coefficients of linear hydroturbine model keep changing during simulation. Hence, it can reflect the nonlinearity of the hydroturbine and be used for Francis turbine simulation under large disturbance condition. To validate the proposed method, both large disturbance and small disturbance simulations of a single hydrounit supplying a resistive, isolated load were conducted. It was shown that the simulation result is consistent with that of field test. Consequently, the proposed method is an attractive option for HSTPS involving Francis turbine modeling under large disturbance condition.

  11. Velocity and pressure measurements in guide vane clearance gap of a low specific speed Francis turbine

    Science.gov (United States)

    Thapa, B. S.; Dahlhaug, O. G.; Thapa, B.

    2016-11-01

    In Francis turbine, a small clearance gap between the guide vanes and the cover plates is usually required to pivot guide vanes as a part of governing system. Deflection of cover plates and erosion of mating surfaces causes this gap to increase from its design value. The clearance gap induces the secondary flow in the distributor system. This effects the main flow at the runner inlet, which causes losses in efficiency and instability. A guide vane cascade of a low specific speed Francis turbine has been developed for experimental investigations. The test setup is able to produce similar velocity distributions at the runner inlet as that of a reference prototype turbine. The setup is designed for particle image velocimetry (PIV) measurements from the position of stay vane outlet to the position of runner inlet. In this study, velocity and pressure measurements are conducted with 2 mm clearance gap on one side of guide vane. Leakage flow is observed and measured together with pressure measurements. It is concluded that the leakage flow behaves as a jet and mixes with the main flow in cross-wise direction and forms a vortex filament. This causes non-uniform inlet flow conditions at runner blades.

  12. On the performance of a high head Francis turbine at design and off-design conditions

    International Nuclear Information System (INIS)

    Aakti, B; Amstutz, O; Casartelli, E; Romanelli, G; Mangani, L

    2015-01-01

    In the present paper, fully 360 degrees transient and steady-state simulations of a Francis turbine were performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL), using different numerical approaches for the pressure-velocity coupling. The simulation domain includes the spiral casing with stay and guide vanes, the runner and the draft tube. The main target of the investigations is the numerical prediction of the overall performance of the high head Francis turbine model as well as local and integral quantities of the complete machine in different operating conditions. All results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with a new in-house, 3D, unstructured, object-oriented finite volume code within the framework of the open source OpenFOAM library. The novel fully coupled pressure-based solver is designed to solve the incompressible RANS- Equations and is capable of handling multiple references of frame (MRF). The obtained results show that the overall performance is well captured by the simulations. Regarding the local flow distributions within the inlet section of the draft-tube, the axial velocity is better estimated than the circumferential component

  13. Study on stress characteristics of Francis hydraulic turbine runner based on two-way FSI

    International Nuclear Information System (INIS)

    Zhu, W R; Xiao, R F; Yang, W; Wang, F J; Liu, J

    2012-01-01

    In recent years, cracking phenomenon occurs in many large-sized turbines both nationally and internationally, which has threatened the stable operation of hydraulic turbines. Consequently, Stress characteristics calculation and analysis of a Francis hydraulic turbine runner by application of fluid-structure interaction (FSI) technology become significantly important. In order to introduce two-way coupling technology to hydraulic machinery, two-way FSI technology is applied in this article to calculate and analyze stress characteristics. Through coordinate system transformation, the continuity equations and Navier-Stokes equations in the Cartesian coordinates system are firstly transformed to ALE coordinates system. The fluid field control equations are then constructed and discrete equations can be obtained by using flow-condition-based interpolation (FBIC-C). The structure static mechanics equations used are established in rotation coordinate system, and modeled with the finite method. Two-way coupling is computed by using iteration method. The fluid equations and structure equations are iterated until coupling coefficients converge. According to structure result, the maximum stress, displacement as well as its location can be found. As a result, the most easily wear position can be discovered which provides valuable basis for optimized design and stable operation of Francis hydraulic turbines. After comparing the results with that of one-way coupling, it is discovered that displacements is the key factors which affects the results of one-way and two-way coupling.

  14. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  15. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  16. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  17. Temporal stability of the Francis Scale of Attitude toward Christianity short-form: test-retest data over one week.

    Science.gov (United States)

    Lewis, Christopher Alan; Cruise, Sharon Mary; McGuckin, Conor

    2005-04-01

    This study evaluated the test-retest reliability of the Francis Scale of Attitude toward Christianity short-form. 39 Northern Irish undergraduate students completed the measure on two occasions separated by one week. Stability across the two administrations was high, r = .92, and there was no significant change between Time 1(M = 25.2, SD = 5.4) and Time 2 (M = 25.7, SD = 6.2). These data support the short-term test-retest reliability of the Francis Scale of Attitude toward Christianity short-form.

  18. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  19. Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art

    Directory of Open Access Journals (Sweden)

    Catarina Pinheiro

    2014-06-01

    Full Text Available Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.

  20. Internal consistency reliability and construct validity of the Dutch translation of the Francis Scale of Attitude toward Christianity among adolescents.

    Science.gov (United States)

    Francis, L J; Hermans, C A

    2000-02-01

    A sample of 1,021 young people attending Years 7, 8, 9, 10, and 11 at Catholic secondary schools within the state-maintained sector completed the Dutch translation of the Francis Scale of Attitude toward Christianity. The data support its reliability and validity and commend it for further use in studies conducted among young people in The Netherlands.

  1. Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art

    OpenAIRE

    Pinheiro, Catarina; Dias, Maria João; Rosa, Alda

    2009-01-01

    Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.

  2. Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art

    OpenAIRE

    Catarina Pinheiro; Maria João Dias; Alda Rosa

    2014-01-01

    Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.

  3. Measuring Attitude toward Theistic Faith: Assessing the Astley-Francis Scale among Christian, Muslim and Secular Youth in England

    Science.gov (United States)

    Francis, Leslie J.; Brockett, Adrian; Village, Andrew

    2013-01-01

    Alongside a family of instruments designed to measure the attitudinal dimension of religion within specific faith contexts (Christianity, Hinduism, Islam, and Judaism), the Astley-Francis Scale of Attitude toward Theistic Faith was designed to assess the attitudinal dimension of religion within a multifaith context. Drawing on a sample of 4338…

  4. Francis Bacon's concept of objectivity and the idols of the mind.

    Science.gov (United States)

    Zagorin, P

    2001-12-01

    This paper examines the concept of objectivity traceable in Francis Bacon's natural philosophy. After some historical background on this concept, it considers the question of whether it is not an anachronism to attribute such a concept to Bacon, since the word 'objectivity' is a later coinage and does not appear anywhere in his writings. The essay gives reasons for answering this question in the negative, and then criticizes the accounts given of Bacon's understanding of objectivity by Lorraine Daston and Julie Robin Solomon. It argues that this understanding is most directly and fully expressed in his discussion of the idols of the mind. In this connection, the paper notes Bacon's critical attitude to sixteenth-century scepticism and its relevance to the idea of objectivity implicit in his comments on the idols. In conclusion, the paper argues that Bacon was not a pure empiricist and describes the place assigned to theories and hypotheses in his natural philosophy.

  5. Images of trauma: pain, recognition, and disavowal in the works of Frida Kahlo and Francis Bacon.

    Science.gov (United States)

    Bose, Joerg

    2005-01-01

    The role of art in the encounter with trauma and destructiveness is comparatively studied in the works of Frida Kahlo and Francis Bacon as examples of a direct and a more indirect way of dealing with such experiences. A creative product may function intrapsychically as a kind of messenger between dissociated self-states and consciousness, and it may also serve as a witnessing presence in a self-supporting and self-constituting way. Artistic work may thus be used by the artist for an expressive as well as for a protective purpose, as a means of sympathetic participation in painful experience, or as a medium for a view from the outside. The act itself of finding and of making expressive forms at the time of traumatic experience is a remarkable assertion of the human capability to synthesize and to counteract fragmenting dissociative processes.

  6. Special article: Francis Hoeffer McMechan, MD: creator of modern anesthesiology?

    Science.gov (United States)

    Bacon, Douglas R

    2012-12-01

    If one person can be credited with the creation of the infrastructure of modern anesthesiology, that individual would be Francis Hoeffer McMechan. He has been largely forgotten since his death in 1939 despite his remarkable and enduring accomplishments. McMechan edited the first national journal devoted to anesthesiology, created and managed almost all of the national and regional societies devoted to the specialty between 1912 and his death, and created the first international physician certification as a specialist in anesthesiology. His accomplishments are even more amazing given the severe arthritis that left him wheelchair-bound for almost his entire professional life and denied him the ability to practice anesthesia. Our specialty owes an incredible debt to this largely unknown and unsung hero.

  7. Scanning-PIXE analysis of gold lace embroideries in a relic of St. Francis

    Energy Technology Data Exchange (ETDEWEB)

    Migliori, A. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Firenze, Via G. Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy)], E-mail: migliori@fi.infn.it; Grassi, N.; Mando, P.A. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Firenze, Via G. Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy)

    2008-05-15

    In this work, we describe the compositional analysis performed by scanning-mode PIXE on the metal threads of a XIII century embroidery. The precious work analysed is the pillow-case used to cover the pillow, on which - according to tradition - St. Francis of Assisi was resting his head when he died. Measurements were performed in order to characterise the embroideries of the two sides and the passementerie in the lateral hems. Several areas, each of the order of two square millimetres, were scanned with a 3 MeV proton external beam of 20 {mu}m size on target, using the external micro-beam facility of our laboratory, with list-mode acquisition. Analysis of elemental maps and spectra from selected homogeneous sub-areas allowed us to extract the quantitative composition of the gilded tape and estimates of its thickness.

  8. Scanning-PIXE analysis of gold lace embroideries in a relic of St. Francis

    International Nuclear Information System (INIS)

    Migliori, A.; Grassi, N.; Mando, P.A.

    2008-01-01

    In this work, we describe the compositional analysis performed by scanning-mode PIXE on the metal threads of a XIII century embroidery. The precious work analysed is the pillow-case used to cover the pillow, on which - according to tradition - St. Francis of Assisi was resting his head when he died. Measurements were performed in order to characterise the embroideries of the two sides and the passementerie in the lateral hems. Several areas, each of the order of two square millimetres, were scanned with a 3 MeV proton external beam of 20 μm size on target, using the external micro-beam facility of our laboratory, with list-mode acquisition. Analysis of elemental maps and spectra from selected homogeneous sub-areas allowed us to extract the quantitative composition of the gilded tape and estimates of its thickness

  9. Scanning-PIXE analysis of gold lace embroideries in a relic of St. Francis

    Science.gov (United States)

    Migliori, A.; Grassi, N.; Mandò, P. A.

    2008-05-01

    In this work, we describe the compositional analysis performed by scanning-mode PIXE on the metal threads of a XIII century embroidery. The precious work analysed is the pillow-case used to cover the pillow, on which - according to tradition - St. Francis of Assisi was resting his head when he died. Measurements were performed in order to characterise the embroideries of the two sides and the passementerie in the lateral hems. Several areas, each of the order of two square millimetres, were scanned with a 3 MeV proton external beam of 20 μm size on target, using the external micro-beam facility of our laboratory, with list-mode acquisition. Analysis of elemental maps and spectra from selected homogeneous sub-areas allowed us to extract the quantitative composition of the gilded tape and estimates of its thickness.

  10. Adam Smith e Francis Ysidro Edgeworth: uma crítica do utilitarismo

    Directory of Open Access Journals (Sweden)

    Solange Regina Marin

    2012-01-01

    Full Text Available Sugerimos, nesse trabalho, a investigação das concepções de Adam Smith e a de Francis Ysidro Edgeworth do utilitarismo. Ambas as concepções foram utilizadas para desenvolver a Ciência Econômica. Porém, também apresentaram as limitações da teoria econômica, cujas fronteiras vislumbradas pelos autores remetem para a necessidade de avaliar as ações e condutas humanas com teoria moral diferente do utilitarismo. Entendemos que a teoria moral de Adam Smith, esquecida pela história do pensamento econômico, se apresenta como alternativa e, em decorrência, uma ideia promissora para aperfeiçoar o estudo das ações e condutas ditas econômicas.

  11. Unsteady hydraulic simulation of the cavitating part load vortex rope in Francis turbines

    Science.gov (United States)

    Brammer, J.; Segoufin, C.; Duparchy, F.; Lowys, P. Y.; Favrel, A.; Avellan, F.

    2017-04-01

    For Francis turbines at part load operation a helical vortex rope is formed due to the swirling nature of the flow exiting the runner. This vortex creates pressure fluctuations which can lead to power swings, and the unsteady loading can lead to fatigue damage of the runner. In the case that the vortex rope cavitates there is the additional risk that hydro-acoustic resonance can occur. It is therefore important to be able to accurately simulate this phenomenon to address these issues. In this paper an unsteady, multi-phase CFD model was used to simulate two part-load operating points, for two different cavitation conditions. The simulation results were validated with test-rig data, and showed very good agreement. These results also served as an input for FEA calculations and fatigue analysis, which are presented in a separate study.

  12. Classics in psychiatry and the law: Francis Wharton on involuntary confessions.

    Science.gov (United States)

    Weiss, Kenneth J

    2012-01-01

    Philadelphia attorney Francis Wharton was a key intellectual figure in linking the sciences of medicine and law. In 1860, he published a monograph on involuntary confessions, which represented the closing chapter of Wharton and Stillé's Treatise on Medical Jurisprudence. He had already published A Monograph on Mental Unsoundness in 1855, the first book of the Treatise in its first edition. Wharton was convinced that many criminals had an inner compulsion to confess or to be caught, explained as divine jurisprudence. His remarks on confessions include a typology spanning psychodynamics to police tactics, using contemporaneous, historical, and literary examples. This remarkable document provides insight into the dynamics of unintended and involuntary confessions and is compatible, in part, with current scholarship. The author contrasts Wharton's schema with those of his English predecessor Jeremy Bentham, the psychoanalyst Theodore Reik, and others, and concludes that it represents an important transition toward a psychological approach to the criminology of confessions.

  13. From political economy to sociology: Francis Galton and the social-scientific origins of eugenics.

    Science.gov (United States)

    Renwick, Chris

    2011-09-01

    Having coined the word 'eugenics' and inspired leading biologists and statisticians of the early twentieth century, Francis Galton is often studied for his contributions to modern statistical biology. However, whilst documenting this part of his work, historians have frequently neglected crucial aspects of what motivated Galton to establish his eugenics research programme. Arguing that his work was shaped more by social than by biological science, this paper addresses these oversights by tracing the development of Galton's programme, from its roots in a debate about political economy to his appeals for it to be taken up by sociologists. In so doing, the paper not only returns Galton's ideas to their original context but also provides a reason to reflect on the place of the social sciences in history-of-science scholarship.

  14. Modelling and Internal Fuzzy Model Power Control of a Francis Water Turbine

    Directory of Open Access Journals (Sweden)

    Klemen Nagode

    2014-02-01

    Full Text Available This paper presents dynamic modelling of a Francis turbine with a surge tank and the control of a hydro power plant (HPP. Non-linear and linear models include technical parameters and show high similarity to measurement data. Turbine power control with an internal model control (IMC is proposed, based on a turbine fuzzy model. Considering appropriate control responses in the entire area of turbine power, the model parameters of the process are determined from a fuzzy model, which are further included in the internal model controller. The results are compared to a proportional-integral (PI controller tuned with an integral absolute error (IAE objective function, and show an improved response of internal model control.

  15. Numerical investigation of flow structure and pressure pulsation in the Francis-99 turbine during startup

    Science.gov (United States)

    Minakov, A.; Sentyabov, A.; Platonov, D.

    2017-01-01

    We performed numerical simulation of flow in a laboratory model of a Francis hydroturbine at startup regimes. Numerical technique for calculating of low frequency pressure pulsations in a water turbine is based on the use of DES (k-ω Shear Stress Transport) turbulence model and the approach of “frozen rotor”. The structure of the flow behind the runner of turbine was analysed. Shows the effect of flow structure on the frequency and intensity of non-stationary processes in the flow path. Two version of the inlet boundary conditions were considered. The first one corresponded measured time dependence of the discharge. Comparison of the calculation results with the experimental data shows the considerable delay of the discharge in this calculation. Second version corresponded linear approximation of time dependence of the discharge. This calculation shows good agreement with experimental results.

  16. The Southern Society for Philosophy and Psychology and Francis Cecil Sumner.

    Science.gov (United States)

    Thomas, Roger K

    2011-01-01

    In 1939, a psychologist could become a member of the Southern Society for Philosophy and Psychology (SSPP) automatically with the endorsement of two members, payment of dues, and membership in the American Psychological Association (APA). Non-APA members with endorsements and payment of dues had to be voted in by the membership. In 1940, the rules for admission were changed to eliminate the automatic membership for APA members. Francis Cecil Sumner, the first African American PhD in psychology, qualified for SSPP membership as a member of the APA in 1939, but the SSPP's council delayed his membership and introduced the amendment to its constitution that eliminated Sumner's route to membership. This article examines the circumstances surrounding council's actions and the role that Sumner's application for membership played in it as an example of the role that race and discrimination played in the decision to change the route to SSPP membership for members of the APA.

  17. The Welcoming Pope: Images of Pope Francis in the Catholicism under mediatization

    Directory of Open Access Journals (Sweden)

    Tatiane MILANI

    2017-12-01

    Full Text Available In the context of the society in mediatization more and more the social fields are inserted in an ambiance in which borders are constantly tensioned, meaning that social practices are crossed by the logic of other fields, rather than their own place of knowing. It is perceived that the social/political/religious conjuncture interpenetrates with the logic of mediatization, and this phenomenon arouses transformations in all Christianity. The objective of this work is to analyze the circulation of Pope Francis' images in the media which formulate, in the collective imaginary, a mediated totem image of the Pope of embrace or of the welcoming Pope, what adheres to the new media technologies.

  18. On the upper part load vortex rope in Francis turbine: Experimental investigation

    International Nuclear Information System (INIS)

    Nicolet, C; Zobeiri, A; Maruzewski, P; Avellan, F

    2010-01-01

    The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and

  19. On the upper part load vortex rope in Francis turbine: Experimental investigation

    Energy Technology Data Exchange (ETDEWEB)

    Nicolet, C [Power Vision Engineering sarl Ch. des Champs-Courbes 1, CH-1024 Ecublens (Switzerland); Zobeiri, A; Maruzewski, P; Avellan, F, E-mail: christophe.nicolet@powervision-eng.c [Laboratory for Hydraulic Machines, Ecole polytechnique federale de Lausanne, EPFL Av. de Cour 33bis, CH-1007 Lausanne (Switzerland)

    2010-08-15

    The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and

  20. On the upper part load vortex rope in Francis turbine: Experimental investigation

    Science.gov (United States)

    Nicolet, C.; Zobeiri, A.; Maruzewski, P.; Avellan, F.

    2010-08-01

    The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and

  1. Prediction of a Francis turbine prototype full load instability from investigations on the reduced scale model

    Science.gov (United States)

    Alligné, S.; Maruzewski, P.; Dinh, T.; Wang, B.; Fedorov, A.; Iosfin, J.; Avellan, F.

    2010-08-01

    The growing development of renewable energies combined with the process of privatization, lead to a change of economical energy market strategies. Instantaneous pricings of electricity as a function of demand or predictions, induces profitable peak productions which are mainly covered by hydroelectric power plants. Therefore, operators harness more hydroelectric facilities at full load operating conditions. However, the Francis Turbine features an axi-symmetric rope leaving the runner which may act under certain conditions as an internal energy source leading to instability. Undesired power and pressure fluctuations are induced which may limit the maximum available power output. BC Hydro experiences such constraints in a hydroelectric power plant consisting of four 435 MW Francis Turbine generating units, which is located in Canada's province of British Columbia. Under specific full load operating conditions, one unit experiences power and pressure fluctuations at 0.46 Hz. The aim of the paper is to present a methodology allowing prediction of this prototype's instability frequency from investigations on the reduced scale model. A new hydro acoustic vortex rope model has been developed in SIMSEN software, taking into account the energy dissipation due to the thermodynamic exchange between the gas and the surrounding liquid. A combination of measurements, CFD simulations and computation of eigenmodes of the reduced scale model installed on test rig, allows the accurate calibration of the vortex rope model parameters at the model scale. Then, transposition of parameters to the prototype according to similitude laws is applied and stability analysis of the power plant is performed. The eigenfrequency of 0.39 Hz related to the first eigenmode of the power plant is determined to be unstable. Predicted frequency of the full load power and pressure fluctuations at the unit unstable operating point is found to be in general agreement with the prototype measurements.

  2. Prediction of a Francis turbine prototype full load instability from investigations on the reduced scale model

    International Nuclear Information System (INIS)

    Alligne, S; Maruzewski, P; Avellan, F; Dinh, T; Wang, B; Fedorov, A; Iosfin, J

    2010-01-01

    The growing development of renewable energies combined with the process of privatization, lead to a change of economical energy market strategies. Instantaneous pricings of electricity as a function of demand or predictions, induces profitable peak productions which are mainly covered by hydroelectric power plants. Therefore, operators harness more hydroelectric facilities at full load operating conditions. However, the Francis Turbine features an axi-symmetric rope leaving the runner which may act under certain conditions as an internal energy source leading to instability. Undesired power and pressure fluctuations are induced which may limit the maximum available power output. BC Hydro experiences such constraints in a hydroelectric power plant consisting of four 435 MW Francis Turbine generating units, which is located in Canada's province of British Columbia. Under specific full load operating conditions, one unit experiences power and pressure fluctuations at 0.46 Hz. The aim of the paper is to present a methodology allowing prediction of this prototype's instability frequency from investigations on the reduced scale model. A new hydro acoustic vortex rope model has been developed in SIMSEN software, taking into account the energy dissipation due to the thermodynamic exchange between the gas and the surrounding liquid. A combination of measurements, CFD simulations and computation of eigenmodes of the reduced scale model installed on test rig, allows the accurate calibration of the vortex rope model parameters at the model scale. Then, transposition of parameters to the prototype according to similitude laws is applied and stability analysis of the power plant is performed. The eigenfrequency of 0.39 Hz related to the first eigenmode of the power plant is determined to be unstable. Predicted frequency of the full load power and pressure fluctuations at the unit unstable operating point is found to be in general agreement with the prototype measurements.

  3. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  4. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  5. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  6. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  7. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  8. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  9. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  10. Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2010-10-01

    DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA WatsonCrick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... WatsonCrick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

  11. Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2011-10-01

    or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA WatsonCrick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through WatsonCrick binding

  12. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

    Science.gov (United States)

    2010-03-01

    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC WatsonCrick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  13. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  14. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  15. Non-Watson–Crick interactions between PNA and DNA inhibit the ATPase activity of bacteriophage T4 Dda helicase

    Science.gov (United States)

    Tackett, Alan J.; Corey, David R.; Raney, Kevin D.

    2002-01-01

    Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106

  16. Sir Francis Joseph Campbell and His Family: The First Family in Professional Services for People Who Are Blind or Visually Impaired

    Science.gov (United States)

    Welsh, Richard L.

    2008-01-01

    The author discusses the pivotal roles of Sir Francis Campbell (1832-1914) and members of his family, especially his son Charles Campbell, in the evolution of the blindness field to a professional and reason-based service.

  17. On the physical mechanisms governing self-excited pressure surge in Francis turbines

    International Nuclear Information System (INIS)

    Müller, A; Favrel, A; Landry, C; Yamamoto, K; Avellan, F

    2014-01-01

    The required operating range for hydraulic machines is continually extended in an effort to integrate renewable energy sources with unsteady power outputs into the existing electrical grid. The off-design operation however brings forth unfavorable flow patterns in the machine, causing dynamic problems involving cavitation, which may represent a limiting factor to the energy production. In Francis turbines it is observed that the self-excited oscillation of a vortex rope in the draft tube cone prevents the delivery of maximum power when required. This phenomenon is referred to as full load pressure surge and has been the object of extensive research during the past decades. Several contributions deepened its understanding through measurement and simulation of the local flow properties and the global stability parameters. The draft tube pressure level and the runner outlet swirl are identified as key variables in the modelling of the vortex rope dynamics. Recently, a cyclic appearance of blade cavitation has been observed at overload conditions in a multiphase numerical simulation coupling the runner and the draft tube. From the analysis of the simulation it becomes obvious that the cyclic appearance of blade cavitation has a direct effect on the runner outlet swirl, thus introducing an additional interaction mechanism that is not accounted for in formerly published models. For the presented work, the results of this numerical study are confirmed experimentally on a reduced scale model of a Francis turbine. Several wall pressure measurements in the draft tube cone are performed, together with high speed visualizations of the vortex rope and the blade cavitation. The flow swirl is calculated based on Laser Doppler Velocimetry measurements. A possible mechanism explaining the coupling between the self-excited pressure and vortex rope oscillation and the cyclic appearance of the blade cavitation is proposed. Furthermore, the streamwise propagation speed of the flow

  18. On the sloshing free surface in the draft tube cone of a Francis turbine operating in synchronous condenser mode

    Science.gov (United States)

    Vagnoni, E.; Andolfatto, L.; Avellan, F.

    2017-04-01

    Hydropower plants may be required to operate in synchronous condenser mode in order to supply reactive power to the grid for compensating the fluctuations introduced by the intermittent renewable energies such wind and solar. When operating in this mode, the tail water in the Francis turbine or pump-turbine is depressed below the runner by injecting pressurized air in order to spin in air to reduce the power consumption. Many air-water interaction phenomena occur in the machine causing air losses and a consequent power consumption to recover the air lost. In this paper, the experimental investigation of the sloshing motion in the cone of a dewatered Francis turbine performed by image visualization and pressure measurements is presented. The developed image post processing method for identifying the amplitude and frequency of the oscillation of the free surface is described and the results obtained are illustrated and discussed.

  19. Fukuyama : kõigepealt hea valitsus, siis demokraatia ja ajaloo lõpp / Francis Fukuyama ; interv. Nathan Gardels

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2005-01-01

    Francis Fukuyama sõnul vajab riik oma arenguks esmajoones head valitsemist. Kõige olulisem on, et oleks toimiv riik, mis suudab tagada julgeoleku ja majandusarengu elementaarsed tingimused. Iraagi praeguste probleemide põhjus on selles, et USA ei suutnud ette näha, kuidas riik Saddami kukkudes kokku variseb, kuid tuleb mõista, et aeg-ajalt on USA ja kogu maailma huvides kusagil maailma nurgas riigi ehitamine tõsiselt ette võtta, ütleb autor

  20. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  1. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  2. Numerical analysis of solid–liquidtwo-phase turbulent flow in Francis turbine runner with splitter bladesin sandy water

    Directory of Open Access Journals (Sweden)

    Hua Hong

    2015-03-01

    Full Text Available As the key component of a hydroelectric power generation system, hydraulic turbine plays a decisive role in the overall performance of the system. There are many sandy rivers in the world, and turbines working in these rivers are seriously damaged. Therefore, the research of flow in sandy water has great theoretical significance and practical value. Based on the specific hydrological conditions of a hydropower station, the solid–liquid two-phase flow in the whole flow passage of a Francis turbine with splitter blades in sandy water was numerically studied. A geometric model of the whole flow passage of the Francis turbine was established on the basis of given design parameters. The solid–liquid two-phase turbulent flows in Francis turbine runner under three different loads were numerically analyzed by using this model. The three different loads are as follows: Condition 1: single unit with 1/4 load, Condition 2: single unit with 1/2 load, and Condition 3: single unit with full load. The distributions of pressure and sand concentration on the leading side and the suction side of the runner blades, as well as the velocity vector distribution of water and sand on the horizontal section of the runner, were obtained under different load conditions. Therefore, the damages to various flow passage components by sand can be qualitatively predicated under various conditions. To guarantee the safety and stability of the unit, the adverse conditions shall be avoided, which can provide certain reference for plant operation.

  3. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    Energy Technology Data Exchange (ETDEWEB)

    Fedi, M.E. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)], E-mail: fedi@fi.infn.it; Cartocci, A.; Taccetti, F.; Mando, P.A. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)

    2008-05-15

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.

  4. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    International Nuclear Information System (INIS)

    Fedi, M.E.; Cartocci, A.; Taccetti, F.; Mando, P.A.

    2008-01-01

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics

  5. AMS radiocarbon dating of medieval textile relics: The frocks and the pillow of St. Francis of Assisi

    Science.gov (United States)

    Fedi, M. E.; Cartocci, A.; Taccetti, F.; Mandò, P. A.

    2008-05-01

    Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.

  6. Expected load spectra of prototype Francis turbines in low-load operation using numerical simulations and site measurements

    Science.gov (United States)

    Eichhorn, M.; Taruffi, A.; Bauer, C.

    2017-04-01

    The operators of hydropower plants are forced to extend the existing operating ranges of their hydraulic machines to remain competitive on the energy market due to the rising amount of wind and solar power. Faster response times and a higher flexibility towards part- and low-load conditions enable a better electric grid control and assure therefore an economic operation of the power plant. The occurring disadvantage is a higher dynamic excitation of affected machine components, especially Francis turbine runners, due to pressure pulsations induced by unsteady flow phenomena (e.g. draft tube vortex ropes). Therefore, fatigue analysis becomes more important even in the design phase of the hydraulic machines to evaluate the static and dynamic load in different operating conditions and to reduce maintenance costs. An approach including a one-way coupled fluid-structure interaction has been already developed using unsteady CFD simulations and transient FEM computations. This is now applied on two Francis turbines with different specific speeds and power ranges, to obtain the load spectra of both machines. The results are compared to strain gauge measurements on the according Francis turbines to validate the overall procedure.

  7. Francis Bacon and the "Interpretation of Nature" in the late Renaissance.

    Science.gov (United States)

    Serjeantson, Richard

    2014-12-01

    The "interpretation of nature" (interpretatio naturae) is the leading idea in Francis Bacon's natural philosophy. But by contrast with his ideas about method, induction, or experiment, the significance of the "interpretation of nature" has received very little scholarly attention. This essay tests the originality of Bacon's idea by means of a focused survey of existing forms of Renaissance natural knowledge-Aristotelian and anti-Aristotelian natural philosophy, Galenic and Paracelsian medicine, natural magic, physiognomy, natural history-before turning to consider the much more prominent place of "interpretation" in the fields of Renaissance logic, revealed and natural theology, and law. It finds that Bacon's application of the idea of "interpretation" to nature was highly original, but also that certain important aspects of his conception have analogies in Renaissance civil law. The essay concludes by exploring the implications of these findings for a recent body of scholarship in the history of the sciences that invokes the notion of the "interpretation of nature" to characterize pre-Baconian natural philosophy more generally.

  8. The “Visual Shock” of Francis Bacon: an essay in neuroesthetics

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a “visual shock.”We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his “visual shock” because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts. PMID:24339812

  9. The mine and the furnace: Francis Bacon, Thomas Russell, and early Stuart mining culture.

    Science.gov (United States)

    Pastorino, Cesare

    2009-01-01

    Notwithstanding Francis Bacon's praise for the philosophical role of the mechanical arts, historians have often downplayed Bacon's connections with actual artisans and entrepreneurs. Addressing the specific context of mining culture, this study proposes a rather different picture. The analysis of a famous mining metaphor in The Advancement of Learning shows us how Bacon's project of reform of knowledge could find an apt correspondence in civic and entrepreneurial values of his time. Also, Bacon had interesting and so far unexplored links with the early modern English mining enterprises, like the Company of Mineral and Battery Works, ofwhich he was a shareholder. Moreover, Bacon's notes in a private notebook, Commentarius Solutus, and records of patents of invention, allow us to start grasping Bacon's connections with the metallurgist and entrepreneur Thomas Russell. Lastly, this paper argues that, to fully understand Bacon's links with the world of Stuart technicians and entrepreneurs, it is necessary to consider a different and insufficiently studied aspect of Bacon's interests, namely his work as patents referee while a Commissioner of Suits.

  10. The role of high cycle fatigue (HCF) onset in Francis runner reliability

    International Nuclear Information System (INIS)

    Gagnon, M; Tahan, S A; Bocher, P; Thibault, D

    2012-01-01

    High Cycle Fatigue (HCF) plays an important role in Francis runner reliability. This paper presents a model in which reliability is defined as the probability of not exceeding a threshold above which HCF contributes to crack propagation. In the context of combined Low Cycle Fatigue (LCF) and HCF loading, the Kitagawa diagram is used as the limit state threshold for reliability. The reliability problem is solved using First-Order Reliability Methods (FORM). A study case is proposed using in situ measured strains and operational data. All the parameters of the reliability problem are based either on observed data or on typical design specifications. From the results obtained, we observed that the uncertainty around the defect size and the HCF stress range play an important role in reliability. At the same time, we observed that expected values for the LCF stress range and the number of LCF cycles have a significant influence on life assessment, but the uncertainty around these values could be neglected in the reliability assessment.

  11. When sleep-related hypermotor epilepsy (SHE) met Charles Darwin and Francis Galton.

    Science.gov (United States)

    Parrino, Liborio; Pavesi, Giovanni

    2017-08-01

    Sleep-related hypermotor epilepsy (SHE) is characterized by short-lasting seizures patterned by repetitive and stereotyped motor events in the same person. In autosomal dominant SHE, genetic factors play a well-known key role. In The Expression of Emotions in Man and Animals, Charles Darwin quotes a plausible example of SHE illustrated by his cousin Sir Francis Galton: "the gentleman…lay fast asleep on his back in bed, raising his right arm slowly in front of his face, up to his forehead, and then dropping it with a jerk, so that the wrist fell heavily on the bridge of his nose. The trick did not occur every night, but occasionally, and was independent of any ascertained cause. Sometimes it was repeated incessantly for an hour or more." Similar manifestations during sleep occurred also in the patient's son and granddaughter, suggesting an autosomal inheritance without sex relationship. Differential diagnosis with REM behavior disorder and other parasomnias is discussed. To our knowledge, this could be the first description of a stereotyped SHE pattern with genetic transmission. © 2017 American Academy of Neurology.

  12. The 'root-brain' hypothesis of Charles and Francis Darwin: Revival after more than 125 years.

    Science.gov (United States)

    Baluska, Frantisek; Mancuso, Stefano; Volkmann, Dieter; Barlow, Peter W

    2009-12-01

    This year celebrates the 200(th) aniversary of the birth of Charles Darwin, best known for his theory of evolution summarized in On the Origin of Species. Less well known is that, in the second half of his life, Darwin's major scientific focus turned towards plants. He wrote several books on plants, the next-to-last of which, The Power of Movement of Plants, published together with his son Francis, opened plants to a new view. Here we amplify the final sentence of this book in which the Darwins proposed that: "It is hardly an exaggeration to say that the tip of the radicle thus endowed [with sensitivity] and having the power of directing the movements of the adjoining parts, acts like the brain of one of the lower animals; the brain being seated within the anterior end of the body, receiving impressions from the sense-organs, and directing the several movements." This sentence conveys two important messages: first, that the root apex may be considered to be a 'brain-like' organ endowed with a sensitivity which controls its navigation through soil; second, that the root apex represents the anterior end of the plant body. In this article, we discuss both these statements.

  13. Numerical Simulation and Validation of a High Head Model Francis Turbine at Part Load Operating Condition

    Science.gov (United States)

    Goyal, Rahul; Trivedi, Chirag; Kumar Gandhi, Bhupendra; Cervantes, Michel J.

    2017-07-01

    Hydraulic turbines are operated over an extended operating range to meet the real time electricity demand. Turbines operated at part load have flow parameters not matching the designed ones. This results in unstable flow conditions in the runner and draft tube developing low frequency and high amplitude pressure pulsations. The unsteady pressure pulsations affect the dynamic stability of the turbine and cause additional fatigue. The work presented in this paper discusses the flow field investigation of a high head model Francis turbine at part load: 50% of the rated load. Numerical simulation of the complete turbine has been performed. Unsteady pressure pulsations in the vaneless space, runner, and draft tube are investigated and validated with available experimental data. Detailed analysis of the rotor stator interaction and draft tube flow field are performed and discussed. The analysis shows the presence of a rotating vortex rope in the draft tube at the frequency of 0.3 times of the runner rotational frequency. The frequency of the vortex rope precession, which causes severe fluctuations and vibrations in the draft tube, is predicted within 3.9% of the experimental measured value. The vortex rope results pressure pulsations propagating in the system whose frequency is also perceive in the runner and upstream the runner.

  14. Numerical investigation of the air injection effect on the cavitating flow in Francis hydro turbine

    Science.gov (United States)

    Chirkov, D. V.; Shcherbakov, P. K.; Cherny, S. G.; Skorospelov, V. A.; Turuk, P. A.

    2017-09-01

    At full and over load operating points, some Francis turbines experience strong self-excited pressure and power oscillations. These oscillations are occuring due to the hydrodynamic instability of the cavitating fluid flow. In many cases, the amplitude of such pulsations may be reduced substantially during the turbine operation by the air injection/ admission below the runner. Such an effect is investigated numerically in the present work. To this end, the hybrid one-three-dimensional model of the flow of the mixture "liquid-vapor" in the duct of a hydroelectric power station, which was proposed previously by the present authors, is augmented by the second gaseous component — the noncondensable air. The boundary conditions and the numerical method for solving the equations of the model are described. To check the accuracy of computing the interface "liquid-gas", the numerical method was applied at first for solving the dam break problem. The algorithm was then used for modeling the flow in a hydraulic turbine with air injection below the runner. It is shown that with increasing flow rate of the injected air, the amplitude of pressure pulsations decreases. The mechanism of the flow structure alteration in the draft tube cone has been elucidated, which leads to flow stabilization at air injection.

  15. Experimental Investigation of Inter-Blade Vortices in a Model Francis Turbine

    Science.gov (United States)

    LIU, Demin; LIU, Xiaobing; ZHAO, Yongzhi

    2017-07-01

    The inter-blade vortex in a Francis turbine becomes one of the main hydraulic factors that are likely to cause blade erosion at deep part load operating conditions. However, the causes and the mechanism of inter-blade vortex are still under investigation according to present researches. Thus the causes of inter-blade vortex and the effect of different hydraulic parameters on the inter-blade vortex are investigated experimentally. The whole life cycle of the inter-blade vortex is observed by a high speed camera. The test results illustrate the whole life cycle of the inter-blade vortex from generation to separation and even to fading. It is observed that the inter-blade vortex becomes stronger with the decreasing of flow and head, which leads to pressure fluctuation. Meanwhile, the pressure fluctuations in the vane-less area and the draft tube section become stronger when inter-blade vortices exist in the blade channel. The turbine will be damaged if operating in the inter-blade vortex zone, so its operating range must be far away from that zone. This paper reveals the main cause of the inter-blade vortex which is the larger incidence angle between the inflow angle and the blade angle on the leading edge of the runner at deep part load operating conditions.

  16. Experiences with the hydraulic design of the high specific speed Francis turbine

    International Nuclear Information System (INIS)

    Obrovsky, J; Zouhar, J

    2014-01-01

    The high specific speed Francis turbine is still suitable alternative for refurbishment of older hydro power plants with lower heads and worse cavitation conditions. In the paper the design process of such kind of turbine together with the results comparison of homological model tests performed in hydraulic laboratory of ČKD Blansko Engineering is introduced. The turbine runner was designed using the optimization algorithm and considering the high specific speed hydraulic profile. It means that hydraulic profiles of the spiral case, the distributor and the draft tube were used from a Kaplan turbine. The optimization was done as the automatic cycle and was based on a simplex optimization method as well as on a genetic algorithm. The number of blades is shown as the parameter which changes the resulting specific speed of the turbine between n s =425 to 455 together with the cavitation characteristics. Minimizing of cavitation on the blade surface as well as on the inlet edge of the runner blade was taken into account during the design process. The results of CFD analyses as well as the model tests are mentioned in the paper

  17. Experiences with the hydraulic design of the high specific speed Francis turbine

    Science.gov (United States)

    Obrovsky, J.; Zouhar, J.

    2014-03-01

    The high specific speed Francis turbine is still suitable alternative for refurbishment of older hydro power plants with lower heads and worse cavitation conditions. In the paper the design process of such kind of turbine together with the results comparison of homological model tests performed in hydraulic laboratory of ČKD Blansko Engineering is introduced. The turbine runner was designed using the optimization algorithm and considering the high specific speed hydraulic profile. It means that hydraulic profiles of the spiral case, the distributor and the draft tube were used from a Kaplan turbine. The optimization was done as the automatic cycle and was based on a simplex optimization method as well as on a genetic algorithm. The number of blades is shown as the parameter which changes the resulting specific speed of the turbine between ns=425 to 455 together with the cavitation characteristics. Minimizing of cavitation on the blade surface as well as on the inlet edge of the runner blade was taken into account during the design process. The results of CFD analyses as well as the model tests are mentioned in the paper.

  18. The Catholic Bishops in the U.S. Public Arena: Changing Prospects under Pope Francis

    Directory of Open Access Journals (Sweden)

    Richard L. Wood

    2016-02-01

    Full Text Available The public profile of the Roman Catholic bishops of the United States results not simply from their own interventions in political life, but from the broad array of actions and actors within “public Catholicism” broadly conceived. This article assesses the contemporary profile of the American bishops from this broad angle, particularly in light of new dynamics under the papacy of Francis I. It does so by documenting public Catholicism’s presence in ecclesial institutions, other public institutions, and lay-centered social movements (particularly faith-based community organizing and via a case study of the healthcare reform debate around the State Children’s Health Insurance Program and the Affordable Care Act. Cultural and institutional factors shaping Catholic public presence are analyzed in three dimensions of social life: institutional leadership; authority dynamics within the Church; and the culture of prayer, spirituality, and worship in parishes. Finally, the conclusion discusses the key dynamics likely to shape the future of public Catholicism in America.

  19. Simulation of the Francis-99 Hydro Turbine During Steady and Transient Operation

    Science.gov (United States)

    Dewan, Yuvraj; Custer, Chad; Ivashchenko, Artem

    2017-01-01

    Numerical simulation of the Francis-99 hydroturbine with correlation to experimental measurements are presented. Steady operation of the hydroturbine is analyzed at three operating conditions: the best efficiency point (BEP), high load (HL), and part load (PL). It is shown that global quantities such as net head, discharge and efficiency are well predicted. Additionally, time-averaged velocity predictions compare well with PIV measurements obtained in the draft tube immediately downstream of the runner. Differences in vortex rope structure between operating points are discussed. Unsteady operation of the hydroturbine from BEP to HL and from BEP to PL are modeled. It is shown that simulation methods used to model the steady operation produce predictions that correlate well with experiment for transient operation. Time-domain unsteady simulation is used for both steady and unsteady operation. The full-fidelity geometry including all components is meshed using an unstructured polyhedral mesh with body-fitted prism layers. Guide vane rotation for transient operation is imposed using fully-conservative, computationally efficient mesh morphing. The commercial solver STAR-CCM+ is used for all portions of the analysis including meshing, solving and post-processing.

  20. Applying Turbulence Models to Hydroturbine Flows: A Sensitivity Analysis Using the GAMM Francis Turbine

    Science.gov (United States)

    Lewis, Bryan; Cimbala, John; Wouden, Alex

    2011-11-01

    Turbulence models are generally developed to study common academic geometries, such as flat plates and channels. Creating quality computational grids for such geometries is trivial, and allows stringent requirements to be met for boundary layer grid refinement. However, engineering applications, such as flow through hydroturbines, require the analysis of complex, highly curved geometries. To produce body-fitted grids for such geometries, the mesh quality requirements must be relaxed. Relaxing these requirements, along with the complexity of rotating flows, forces turbulence models to be employed beyond their developed scope. This study explores the solution sensitivity to boundary layer grid quality for various turbulence models and boundary conditions currently implemented in OpenFOAM. The following models are resented: k-omega, k-omega SST, k-epsilon, realizable k-epsilon, and RNG k-epsilon. Standard wall functions, adaptive wall functions, and sub-grid integration are compared using various grid refinements. The chosen geometry is the GAMM Francis Turbine because experimental data and comparison computational results are available for this turbine. This research was supported by a grant from the DoE and a National Defense Science and Engineering Graduate Fellowship.

  1. A Parametric Study of Unsteady Rotor-Stator Interaction in a Simplified Francis Turbine

    Science.gov (United States)

    Wouden, Alex; Cimbala, John; Lewis, Bryan

    2011-11-01

    CFD analysis is becoming a critical stage in the design of hydroturbines. However, its capability to represent unsteady flow interactions between the rotor and stator (which requires a 360-degree, mesh-refined model of the turbine passage) is hindered. For CFD to become a more effective tool in predicting the performance of a hydroturbine, the key interactions between the rotor and stator need to be understood using current numerical methods. As a first step towards evaluating this unsteady behavior without the burden of a computationally expensive domain, the stator and Francis-type rotor blades are reduced to flat plates. Local and global variables are compared using periodic, semi-periodic, and 360-degree geometric models and various turbulence models (k-omega, k-epsilon, and Spalart-Allmaras). The computations take place within the OpenFOAM® environment and utilize a general grid interface (GGI) between the rotor and stator computational domains. The rotor computational domain is capable of dynamic rotation. The results demonstrate some of the strengths and limitations of utilizing CFD for hydroturbine analysis. These case studies will also serve as tutorials to help others learn how to use CFD for turbomachinery. This research is funded by a grant from the DOE.

  2. Experimental Investigation on the Characteristics of Hydrodynamic Stabilities in Francis Hydroturbine Models

    Directory of Open Access Journals (Sweden)

    Wen-Tao Su

    2014-03-01

    Full Text Available This paper presents an experimental investigation of flow phenomena related to the characteristic frequencies of pressure fluctuation in Francis hydroturbine models. The experiments were carried out on two test rigs with two model runners having hydraulic similarities. Flow field around the guide vanes was measured with a particle image velocimetry (PIV on the first PIV test rig. Flow structures at the inlet region of runner and in draft tube at different operating conditions were visualized on another hydrodynamic test rig. Analyses of dominant frequency of unsteady hydraulic behaviors in the tested hydroturbines were performed. It was observed that the main frequency of flow over the guide vanes and the dominant frequency of channel vortex equal the blade passing frequency; the dominant frequency of flow separation at the suction side of blade inlet equals the vane passing frequency; the vortex rope in the draft tube displays a low-frequency nature. The flow instabilities and fluctuations directly influence the running of hydroturbine, thus these experimental results could provide important evidence for the stability study of a real hydroturbine.

  3. Laboratory modeling of flow regimes in a draft tube of Francis hydro-turbine

    Directory of Open Access Journals (Sweden)

    Shtork Sergey

    2017-01-01

    Full Text Available The paper reports on some results of the experimental study of flow and pressure pulsations in a laboratory model of the draft tube (DT of Francis-99 hydro-turbine over a broad range of operating regimes. Velocity distributions at the model inlet varied within 866 modes of the turbine load conditions, including those with maximum coherent pressure pulsations on the model walls. The contact and non-contact methods were used to measure pressure pulsations on the model walls using acoustic sensors and to measure the averaged velocity distribution with a laser Doppler anemometer “LAD-06i”. Analysis of the results have showed that in the model cone there are flow modes with forming of precessing vortex cores, accompanied by a sharp increase in the amplitude of coherent pressure pulsations on the wall and the velocity field rearrangement. It is shown that the vortex core starts forming with an increase in the integral parameter of swirl up to S>0.5. A novelty of the work is the combination of the rapid prototyping (3-d printing of the inflow swirl generators and computerized measurement techniques that makes it possible to acquire rapidly a large amount of experimental data for a variety of designs and operating conditions. The results can provide insight into the effect of various design and operating parameters on the flow physics, as well as serve for verification of the numerical simulations.

  4. Deciphering the language of nature: cryptography, secrecy, and alterity in Francis Bacon.

    Science.gov (United States)

    Clody, Michael C

    2011-01-01

    The essay argues that Francis Bacon's considerations of parables and cryptography reflect larger interpretative concerns of his natural philosophic project. Bacon describes nature as having a language distinct from those of God and man, and, in so doing, establishes a central problem of his natural philosophy—namely, how can the language of nature be accessed through scientific representation? Ultimately, Bacon's solution relies on a theory of differential and duplicitous signs that conceal within them the hidden voice of nature, which is best recognized in the natural forms of efficient causality. The "alphabet of nature"—those tables of natural occurrences—consequently plays a central role in his program, as it renders nature's language susceptible to a process and decryption that mirrors the model of the bilateral cipher. It is argued that while the writing of Bacon's natural philosophy strives for literality, its investigative process preserves a space for alterity within scientific representation, that is made accessible to those with the interpretative key.

  5. From medicine to natural philosophy: Francis Hauksbee's way to the air-pump.

    Science.gov (United States)

    Brundtland, Terje

    2008-06-01

    Francis Hauksbee (1660-1713) is well known for his double-barrelled air-pump. However, the origin of this pump, and Hauksbee's background, are often described as a mystery. This text seeks to dispel the riddle. It is argued that Hauksbee's competence as an exceptional maker of air-pumps was developed between 1699 and 1703 as a result of his experiences with the construction, manufacturing and sale of cupping-glasses. His cupping utensils embodied a new design, where syringes were used to evacuate the glasses, instead of the traditional way by fire or mouth suction. These syringes, which in fact were small air-pumps, were perfected between 1699 and 1701. A larger syringe, introduced in 1701, served as a transition from the cupping-syringe to his first air-pump for use in natural philosophy. This syringe was described as a 'combined engine', which could serve as an air-pump, a condensing engine and a syringe for injecting air, wax or mercury into pathological specimens. Hauksbee's first air-pump was a single-barrelled model introduced in 1702, based on the combined engine. Its various features, such as easy and convenient leak-tightening, exact pressure measurements by an in-built barometer and an air-inlet function for readmission of air into the receiver, are discussed. Finally, it is shown that these activities gave Hauksbee the reputation of being an outstanding instrument-maker, years before the double-barrelled air-pump was in sight.

  6. Experimental Hydro-Mechanical Characterization of Full Load Pressure Surge in Francis Turbines

    Science.gov (United States)

    Müller, A.; Favrel, A.; Landry, C.; Yamamoto, K.; Avellan, F.

    2017-04-01

    Full load pressure surge limits the operating range of hydro-electric generating units by causing significant power output swings and by compromising the safety of the plant. It appears during the off-design operation of hydraulic machines, which is increasingly required to regulate the broad integration of volatile renewable energy sources into the existing power network. The underlying causes and governing physical mechanisms of this instability were investigated in the frame of a large European research project and this paper documents the main findings from two experimental campaigns on a reduced scale model of a Francis turbine. The multi-phase flow in the draft tube is characterized by Particle Image Velocimetry, Laser Doppler Velocimetry and high-speed visualizations, along with synchronized measurements of the relevant hydro-mechanical quantities. The final result is a comprehensive overview of how the unsteady draft tube flow and the mechanical torque on the runner shaft behave during one mean period of the pressure oscillation, thus defining the unstable fluid-structure interaction responsible for the power swings. A discussion of the root cause is initiated, based on the state of the art. Finally, the latest results will enable a validation of recent RANS flow simulations used for determining the key parameters of hydro-acoustic stability models.

  7. Investigation of a High Head Francis Turbine at Runaway Operating Conditions

    Directory of Open Access Journals (Sweden)

    Chirag Trivedi

    2016-03-01

    Full Text Available Hydraulic turbines exhibit total load rejection during operation because of high fluctuations in the grid parameters. The generator reaches no-load instantly. Consequently, the turbine runner accelerates to high speed, runaway speed, in seconds. Under common conditions, stable runaway is only reached if after a load rejection, the control and protection mechanisms both fail and the guide vanes cannot be closed. The runner life is affected by the high amplitude pressure loading at the runaway speed. A model Francis turbine was used to investigate the consequences at the runaway condition. Measurements and simulations were performed at three operating points. The numerical simulations were performed using standard k-ε, k-ω shear stress transport (SST and scale-adaptive simulation (SAS models. A total of 12.8 million hexahedral mesh elements were created in the complete turbine, from the spiral casing inlet to the draft tube outlet. The experimental and numerical analysis showed that the runner was subjected to an unsteady pressure loading up to three-times the pressure loading observed at the best efficiency point. Investigates of unsteady pressure pulsations at the vaneless space, runner and draft tube are discussed in the paper. Further, unsteady swirling flow in the blade passages was observed that was rotating at a frequency of 4.8-times the runaway runner angular speed. Apart from the unsteady pressure loading, the development pattern of the swirling flow in the runner is discussed in the paper.

  8. Water hammer effect in the spiral case and penstock of Francis turbines

    Science.gov (United States)

    Pepa, D.; Ursoniu, C.; Gillich, R. N.; Campian, C. V.

    2017-01-01

    Sudden pressure increases in the penstock or spiral case of a hydraulic turbine are the effect of sudden flow variation that occur during transient processes of type opening / closing or load rejection of the hydro unit. The consequence of the pressure rise in the spiral case and penstock is the water hammer phenomenon, whose effects can be devastating in some cases, up to breaking pipes and calamities produced in the area. This paper aims to analyze the method of calculation of the maximum pressure values that might occur in load rejection situations to a hydraulic turbine, in spiral case and in penstock, conditioned by the limiting of the values of the over speed and measures of limiting the increase in pressure in conjunction with limiting the increase in speed in these specific processes. As an example, we studied and analyzed the situation of a hydroelectric power plant equipped with a 7.8 MW Francis turbine without pressure regulator and the inflow surge. The results of analytical calculation overlaid on the experimental measurements performed during the performance tests of the hydro unit lead to the conclusion that the calculation algorithm proposed has been chosen correctly and the 2-stage closing law of the wicket gate promoted in this case is effective in such situations.

  9. Predicting the performance of a high head Francis turbine using a fully implicit mixing plane

    International Nuclear Information System (INIS)

    Amstutz, O; Aakti, B; Casartelli, E; Mangani, L; Hanimann, L

    2015-01-01

    In the present paper numerical investigations of a complete high head Francis turbine comprehensive of a spiral casing, stay and guide vanes and draft tube have been performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL). The main target of the investigations is to assess the prediction accuracy of a reduced domain of the complete turbine using a novel mixing-plane formulation. The computational domain is simplified simulating one single passage of the runner, thus assuming rotational periodicity and steady state conditions. The results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with an in-house adapted, 3D, unstructured, object-oriented finite volume code based on the OpenFOAM-V2.2 framework and designed to solve steady-state incompressible RANS-Equations. The pressure-based solver uses a SIMPLE-C like algorithm and is capable of handling multiple references of frame (MRF). The influence of the turbulence has been considered applying the shear-stress transport model (SST). Full second order upwind scheme for advection discretization has been used for all computations

  10. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  11. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  12. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  13. Computation and analysis of cavitating flow in Francis-class hydraulic turbines

    Science.gov (United States)

    Leonard, Daniel J.

    Hydropower is the most proven renewable energy technology, supplying the world with 16% of its electricity. Conventional hydropower generates a vast majority of that percentage. Although a mature technology, hydroelectric generation shows great promise for expansion through new dams and plants in developing hydro countries. Moreover, in developed hydro countries, such as the United States, installing generating units in existing dams and the modern refurbishment of existing plants can greatly expand generating capabilities with little to no further impact on the environment. In addition, modern computational technology and fluid dynamics expertise has led to substantial improvements in modern turbine design and performance. Cavitation has always presented a problem in hydroturbines, causing performance breakdown, erosion, damage, vibration, and noise. While modern turbines are usually designed to be cavitation-free at their best efficiency point, due to the variable demand of the energy market it is fairly common to operate at off-design conditions. Here, cavitation and its deleterious effects are unavoidable, and hence, cavitation is a limiting factor on the design and operation of these turbines. Multiphase Computational Fluid Dynamics (CFD) has been used in recent years to model cavitating flow for a large range of problems, including turbomachinery. However, CFD of cavitating flow in hydroturbines is still in its infancy. This dissertation presents steady-periodic Reynolds-averaged Navier-Stokes simulations of a cavitating Francis-class hydroturbine at model and prototype scales. Computational results of the reduced-scale model and full-scale prototype, undergoing performance breakdown, are compared with empirical model data and prototype performance estimations based on standard industry scalings from the model data. Mesh convergence of the simulations is also displayed. Comparisons are made between the scales to display that cavitation performance breakdown

  14. Numerical Simulation of the Francis Turbine and CAD used to Optimized the Runner Design (2nd).

    Science.gov (United States)

    Sutikno, Priyono

    2010-06-01

    , medium head Francis type, with following value for the most important parameter, the rated specific speed ns.

  15. Sobre as afinidades entre a filosofia de Francis Bacon e o ceticismo

    Directory of Open Access Journals (Sweden)

    Luiz A. A. Eva

    2006-06-01

    Full Text Available Este texto se ocupa de um exame, em caráter introdutório, das relações entre a reflexão de Bacon acerca das limitações de nossas faculdades e o ceticismo filosófico - um tema pouco considerado pela literatura mais recente, a despeito das muitas referências a tal filosofia. Ainda que, à primeira vista, tais referências possam parecer vagas e imprecisas, pensamos que um exame adequado de algumas delas pode revelar, não apenas a importância do tema para a compreensão de aspectos do seu próprio empreendimento, mas o interesse de Bacon pela literatura cética contemporânea. As peculiaridades de sua própria interpretação, por sua vez, parecem antecipar traços do modo como essa filosofia foi compreendida por filósofos posteriores, como Hume.This text focuses, in a preliminary way, on the relations between Francis Bacon's reflections on the limits of our cognitive faculties and philosophical skepticism, a theme not much considered by most of recent commentaries, in spite of Bacon's own explicit and numerous allusions to this philosophy. Even if these allusions seem at first sight somewhat loose and not very sharp, some of them reveal, we think, not only its relevance for understanding of some aspects of his own enterprise, but also Bacon's attention to the skeptical literature produced on the period. Moreover, the particularities of his own interpretation of skepticism seem to anticipate important features of the way this philosophy was understood by later philosophers as Hume.

  16. Two-phase simulations of the full load surge in Francis turbines

    Science.gov (United States)

    Wack, J.; Riedelbauch, S.

    2016-11-01

    At off-design conditions, Francis turbines experience cavitation which may reduce the power output and can cause severe damage in the machine. Certain conditions can cause self-excited oscillations of the vortex rope in the draft tube at full load operating point. For the presented work, two-phase simulations are carried out at model scale on a domain ranging from the inlet of the spiral case to the outlet of the draft tube. At different locations, wall pressure measurements are available and compared to the simulation results. Furthermore, the dynamics of the cavity volume in the draft tube cone and at the trailing edge of the runner blades are investigated by comparing with high speed visualization. To account for the selfexcited behaviour, proper boundary conditions need to be set. In this work, the focus lies on the treatment of the boundary condition at the inlet. In the first step, the dynamic behaviour of the cavity regions is investigated using a constant mass flow. Thereafter, oscillations of the total pressure and mass flow rate are prescribed using various frequencies and amplitudes. This methodology enables to examine the response of the cavity dynamics due to different excitations. It can be observed that setting a constant mass flow boundary condition is not suitable to account for the self-excited behaviour. Prescribing the total pressure has the result that the frequency of the vapour volume oscillation is the same as the frequency of the excitation signal. Contrary to that, for an excitation with a mass flow boundary condition, the response of the system is not equal to the excitation.

  17. The Origin of DIRT (Detrital Input and Removal Treatments): the Legacy of Dr. Francis D. Hole

    Science.gov (United States)

    Townsend, K. L.; Lajtha, K.; Caldwell, B.; Sollins, P.

    2007-12-01

    Soil organic matter (SOM) plays a key role in the cycling and retention of nitrogen and carbon within soil. Both above and belowground detrital inputs determine the nature and quantity of SOM. Studies on detrital impacts on SOM dynamics are underway at several LTER, ILTER and LTER-affiliated sites using a common experimental design, Detrital Input and Removal Treatments (DIRT). The concept for DIRT was originally based on experimental plots established at the University of Wisconsin Arboretum by Dr. Francis D. Hole in 1956 to study the effects of detrital inputs on pedogenesis. These plots are located on two forested sites and two prairie sites within the arboretum. Manipulations of the forested sites include double litter, no litter and removal of the O and A horizons. Manipulations of the prairie sites include harvest, mulch, bare and burn. These original treatments have largely been maintained since 1956. After 40 years of maintenance, there were significant differences in soil carbon between the double and no litter plots. The double litter plots had increased by nearly 30% while the no litter plots had decreased over 50%. The original DIRT plots are now 50 years old and have been re-sampled, where possible, for total carbon and nitrogen, labile and recalcitrant carbon fractions, net and gross nitrogen mineralization rates, and SOM bioavailability through CO2 respiration. The soils were fractionated by density to examine the role of carbon in each density fraction. The mean age of carbon in each fraction was determined by radiocarbon dating. This sampling and analysis is of special significance because it provides a glimpse into the future SOM trajectories for the new DIRT sites: Harvard Forest (MA), Bousson (PA), Andrews Experimental Forest (OR) and Sikfokut (Hungary).

  18. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  19. Natural knowledge as a propaedeutic to self-betterment: Francis Bacon and the transformation of natural history.

    Science.gov (United States)

    Lancaster, James A T

    2012-01-01

    This paper establishes the 'emblematic' use of natural history as a propaedeutic to self-betterment in the Renaissance; in particular, in the natural histories of Gessner and Topsell, but also in the works of Erasmus and Rabelais. Subsequently, it investigates how Francis Bacon's conception of natural history is envisaged in relation to them. The paper contends that, where humanist natural historians understood the use of natural knowledge as a preliminary to individual improvement, Bacon conceived self-betterment foremost as a means to Christian charity, or social-betterment. It thus examines the transformation of the moralizing aspect of Renaissance natural history in Bacon's conception of his Great Instauration.

  20. Abortion, metaphysics and morality: a review of Francis Beckwith's defending life: a moral and legal case against abortion choice.

    Science.gov (United States)

    Nobis, Nathan

    2011-06-01

    In Defending Life: A Moral and Legal Case Against Abortion Choice (2007) and an earlier article in this journal, "Defending Abortion Philosophically"(2006), Francis Beckwith argues that fetuses are, from conception, prima facie wrong to kill. His arguments are based on what he calls a "metaphysics of the human person" known as "The Substance View." I argue that Beckwith's metaphysics does not support his abortion ethic: Moral, not metaphysical, claims that are part of this Substance View are the foundation of the argument, and Beckwith inadequately defends these moral claims. Thus, Beckwith's arguments do not provide strong support for what he calls the "pro-life" view of abortion.

  1. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  2. Francis Bacon sob o olhar de Gilles Deleuze: a imagem como intensidade

    Directory of Open Access Journals (Sweden)

    Osvaldo Fontes Filho

    2007-12-01

    Full Text Available O ensaio de Gilles Deleuze La logique de la sensation é texto que se detém principalmente na prática e na eficácia da imagem. A pintura de Francis Bacon é ali tomada como paradigma de modernidade ao investir contra os clichês expressivos e ao produzir imagem junto à brutalidade dos fatos, como um contra-efeito do narrativo. Em uma obra que conjura todo modelo a representar, toda história a contar, “alguma coisa se passa”, explica Deleuze, “que define o funcionamento da pintura”. Algo se passa, tem lugar: o acontecimento de uma catástrofe e de uma histeria no ato de pintura que acomete a Figura de modo a transmitir uma potencial violência de reação e de expressão. O “Bacon” de Deleuze apresenta a realidade vivida em uma nova e não-convencional ordem de sensação. Neste artigo, são comentados os modos como o filósofo interpreta os atos físicos da pintura de Bacon — marcas aleatórias, varredura da massa pictural, escansão das superfícies —, procedimentos que introduzem no mundo visual da figuração a variedade caótica dos fatos e sentidos. Mostra-se como as faces e as figuras contorcidas, distorcidas, escorchadas de Bacon recebem uma voz conceitual complementar no texto de Deleuze. Consequentemente, focaliza-se a disposição de alguns conceitos do filósofo: diagrama, Figura, diferença, espaço háptico. Locados no espaço afetivo ou na “lógica da sensação” da pintura baconiana, esses conceitos atribuem legitimidade ao entrelaçamento e à co-implicação entre arte e filosofia. Uma última observação dá conta do fato de a prática da imagem em Bacon, apresentada por Deleuze no palco de uma modernidade particularmente solapada por um “dilúvio anestésico de imagens reprimindo a possibilidade de pensar”, evidenciar para o filósofo os rumos necessariamente sinuosos, “reptilíneos”, do pensamento moderno. Tanto o conceito como a forma criam por catástrofe, por conflagração, por varia

  3. Francis full-load surge mechanism identified by unsteady 2-phase CFD

    Energy Technology Data Exchange (ETDEWEB)

    Doerfler, P K; Keller, M; Braun, O, E-mail: peter.doerfler@andritz.co [R and D Department, Andritz Hydro Ltd., Zurich (Switzerland)

    2010-08-15

    Francis turbines may produce spontaneous pulsations of pressure and output power when operating at very high discharge. In such cases there is a cavitating central vortex in the draft tube with variable cavity volume V{sub c}. Until today, researchers agree that the main destabilizing agent is the so-called mass flow gain factor, defined as the derivative of cavity volume by the local discharge. Recent studies about 1D high-load stability analysis assumed that the mass-flow gain factor obtained from steady-state vortex data acts on the transient discharge downstream of the cavity. There are however good reasons to question this assumption. Most strikingly, the direct cause of the mass flow gain effect is the increase of swirl produced at the runner exit and hence upstream, not downstream of the cavity. To enhance the reliability of full-load stability predictions, the authors directly investigated the vortex dynamics. The development of the transient cavitating flow in the draft tube was simulated by means of unsteady 2-phase CFD. CFD work started with 1-phase calculations as presented by other authors. This was then extended to a more realistic 2-phase calculation. To contain the computing time within acceptable limits, given the very fine mesh and short time step required, the simulation domain was restricted to the draft tube and, at the same time, the problem was reduced to a basically 2-dimensional rotationally symmetric case. The response of the cavitating draft tube flow to a time-dependent inflow and time-dependent pressure at the draft tube exit was simulated. The results were input to a statistical identification procedure to check possible 1D transient models and find representative parameter values in the sense of a best fit between 1D model and CFD result. As we had suspected, the conventional vortex model with mass flow gain controlled by downstream discharge is not compatible with direct simulation and needs to be modified. The CFD results correspond

  4. THE DESIRE FOR RECOGNITION IN THE CONTEXT OF FRANCIS FUKUYAMA’S UNIVERSAL HISTORY

    Directory of Open Access Journals (Sweden)

    T. V. Danylova

    2016-12-01

    Full Text Available Introduction. Francis Fukuyama in his famous book “The End of History and the Last Man” assumes that human history should be considered as the battle of ideologies that reaches its goal in the universalization of Western liberal democracy. Author’s ideas have gained many supporters. At the same time, they were subjected to severe criticism that reflected the important trends of political life and ideological preferences. Leaving aside the criticism based on geopolitical and civilizational confrontation and confusion which confronts Fukuyama’s theory, it should be stated that anthropological aspect of Fukuyama’s theory has vastly evaded philosophical comprehension. Purpose. This article attempts to test Fukuyama’s theory through the lens of philosophical anthropology and analyze human desire for recognition in the context of Fukuyama’s World History. Methodology. The analysis is focused on human desire for recognition as a significant dimension of human nature. The author has used hermeneutical methodology and anthropological integrative approach. Theoretical basis and results. Fukuyama is not satisfied by merely economic interpretation of history emphasizing that human is not simply an economic animal. Economic development fails to explain why people advocate the principles of liberal democracy. The author goes back to Hegel’s non-materialistic view of history based on the struggle for recognition. According to Fukuyama, this deeply rooted human desire for recognition is the great motor of history and cause of tyranny, conflicts, and wars. But at the same time, it also acts as a psychological foundation of many virtues – the spirit of citizenship, courage, and justice. Throughout history, this desire for recognition was not satisfied. Only modern liberal democracy provides universal recognition of all humans ensuring and protecting their rights. Originality. Fukuyama’s concept is important and interesting because it draws

  5. Numerical investigation of a high head Francis turbine under steady operating conditions using foam-extend

    International Nuclear Information System (INIS)

    Lenarcic, M; Eichhorn, M; Schoder, S J; Bauer, Ch

    2015-01-01

    In this work the incompressible turbulent flow in a high head Francis turbine under steady operating conditions is investigated using the open source CFD software package FOAM-extend- 3.1. By varying computational domains (cyclic model, full model), coupling methods between stationary and rotating frames (mixing-plane, frozen-rotor) and turbulence models (kω-SST, κε), numerical flow simulations are performed at the best efficiency point as well as at operating points in part load and high load. The discretization is adjusted according the y + -criterion with y + mean > 30. A grid independence study quantifies the discretization error and the corresponding computational costs for the appropriate simulations, reaching a GCI < 1% for the chosen grid. Specific quantities such as efficiency, head, runner shaft torque as well as static pressure and velocity components are computed and compared with experimental data and commercial code. Focusing on the computed results of integral quantities and static pressures, the highest level of accuracy is obtained using FOAM in combination with the full model discretization, the mixing-plane coupling method and the κω-SST turbulence model. The corresponding relative deviations regarding the efficiency reach values of Δη rel ∼ 7% at part load, Δη rel ∼ 0.5% at best efficiency point and Δη rel ∼ 5.6% at high load. The computed static pressures deviate from the measurements by a maximum of Δp rel = 9.3% at part load, Δp rel = 4.3% at best efficiency point and Δp rel = 6.7% at high load. Commercial code in turn yields slightly better predictions for the velocity components in the draft tube cone, reaching a good accordance with the measurements at part load. Although FOAM also shows an adequate correspondence to the experimental data at part load, local effects near the runner hub are captured less accurate at best efficiency point and high load. Nevertheless, FOAM is a reasonable alternative to commercial code

  6. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  7. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  8. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  9. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  10. Processing the papal encyclical through perceptual filters: Pope Francis, identity-protective cognition, and climate change concern.

    Science.gov (United States)

    Landrum, Asheley R; Lull, Robert B; Akin, Heather; Hasell, Ariel; Jamieson, Kathleen Hall

    2017-09-01

    Previous research suggests that when individuals encounter new information, they interpret it through perceptual 'filters' of prior beliefs, relevant social identities, and messenger credibility. In short, evaluations are not based solely on message accuracy, but also on the extent to which the message and messenger are amenable to the values of one's social groups. Here, we use the release of Pope Francis's 2015 encyclical as the context for a natural experiment to examine the role of prior values in climate change cognition. Based on our analysis of panel data collected before and after the encyclical's release, we find that political ideology moderated views of papal credibility on climate change for those participants who were aware of the encyclical. We also find that, in some contexts, non-Catholics who were aware of the encyclical granted Pope Francis additional credibility compared to the non-Catholics who were unaware of it, yet Catholics granted the Pope high credibility regardless of encyclical awareness. Importantly, papal credibility mediated the conditional relationships between encyclical awareness and acceptance of the Pope's messages on climate change. We conclude by discussing how our results provide insight into cognitive processing of new information about controversial issues. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Self-validated calculation of characteristics of a Francis turbine and the mechanism of the S-shape operational instability

    International Nuclear Information System (INIS)

    Zhang, Z; Titzschkau, M

    2012-01-01

    A calculation method has been presented to accurately estimate the characteristics of a Francis turbine. Both the shock loss at the impeller inlet and the swirling flow loss at the Impeller exit have been confirmed to dominantly influence the turbine characteristics and particularly the hydraulic efficiency. Both together totally govern the through flow of water through the impeller being at the rest. Calculations have been performed for the flow rate, the shaft torque and the hydraulic efficiency and compared with the available measurements on a model turbine. Excellent agreements have been achieved. Some other interesting properties of the turbine characteristics could also be derived from the calculations and verified by experiments. For this reason and because of not using any unreliable assumptions the calculation method has been confirmed to be self-validated. The operational instability in the upper range of the rotational speed, known as the S-shape instability, is ascribed to the total flow separation and stagnation at the impeller inlet. In that range of the rotational speed, the operation of the Francis turbine oscillates between pump and turbine mode.

  12. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  13. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  14. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  15. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  16. Rotor optimization of a Francis type hydraulic turbine through the computer flow analysis (CFD); Optimizacion del rodete de una turbina hidraulica tipo Francis a traves del analisis computacional del flujo (CFD)

    Energy Technology Data Exchange (ETDEWEB)

    Rosado Tamariz, Erick

    2007-06-15

    In the analysis of fluid behavior through hydraulic turbines, two basic methodologies for flow analysis and optimization processes in turbines are used, which are: a) modeled of flow through the entire turbine (joint), or modeled one of each component separately, obtaining satisfactory results by both methodologies. The analysis of computational fluids dynamics (CFD) to geometries improved by means of finite volume method (FVM) with their corresponding initials and boundary conditions is made, to solve a system differential equations of second order that correspond to the flow around the dominion of runner blades; considering nonviscous flow and the implementation of the two equations models for the solution of the equations that govern the turbulent flow. Also, used parameterization techniques based in a parametric geometry an objective function and the diminution of cavitation. This work presents the optimization of a runner from a Francis hydro turbine for a 75 MW considering three different load conditions (75%, 85% and 100%) through CFD as a part of the hydraulic analysis for modernization of the actual condition of a power generation unit. Francis runner optimization is made, through a previous analysis of CFD by means of the FVM, considering the viscous effects of the fluid and the model of turbulence developed by Sparlart and Allmaras; modeling the wicket and runner separately. Later the generation of a parametric model of the runner is made and the simulation for the generation of data base is formed. Finally an objective function is considered to develop the optimal geometry of the runner blades. The results are presented in a graphic form in such a way, that it shows the distributions of pressure and speed around the blades runner, the geometrical and performance (efficiency and power) comparison between original and optimized model. [Spanish] En el analisis del comportamiento del fluido a traves de turbinas hidraulicas, se emplean dos metodologias

  17. Tod in den Anden. Ein Brief Francis Halls an Humboldt 1831 und seine historischen und politischen Hintergründe

    Directory of Open Access Journals (Sweden)

    Thomas Schmuck

    2013-12-01

    Full Text Available Zusammenfassung Der Forschungsreisende Francis Hall kam als Soldat nach Südamerika und betätigte sich hier auch als Pflanzensammler, Reiseschriftsteller und Bergsteiger. Er war Freund und Briefpartner Jeremy Benthams und versuchte gemeinsam mit Jean-Baptiste Boussingault den Chimborazo zu besteigen. Der liberale Journalist wurde 1833 in bürgerkriegsähnlichen Unruhen in Ecuador ermordet. Der einzige Brief Halls an Humboldt, in dem er diesen für die Naturerschließung des Landes zu gewinnen versucht, eine Sammlung andiner Pflanzen übersendet und seine Einschätzung zur politischen Lage und Zukunft Südamerikas kundtut, wird hier veröffentlicht und kommentiert. Abstract The British explorer Francis Hall was active in South-America as a soldier, a collector of plants, a writer of travelogues and a mountaineer. Together with Jean-Baptiste Boussingault he failed in ascending the Chimborazo. Friend and correspondent of Jeremy Bentham and also liberal journalist, Hall was killed during riots in Ecuador in 1833. In one single letter addressed to Humboldt, which is presented here, Hall tries to awaken interest for Ecuador, develops his views on the political future of South America and sends a collection of plants from the Andes. Resumen El explorador británico Francis Hall llegó a América del Sur como soldado y allí también se dedicó a la colección de plantas, a escribir sobre viajes y a hacer alpinismo. Intentó subir al Chimborazo con Jean-Baptiste Boussingault. El periodista liberal, amigo de Jeremy Bentham con el que también mantenía correspondencia, fue asesinado en los disturbios de 1833 en Ecuador. En la única carta de Hall a Humboldt, que está publicada y comentada aquí, Hall intenta despertar el interés de Humboldt por la naturaleza del país enviando una colección de plantas andinas y dando su opinión sobre la situación política y el futuro de América del Sur. (Traducción: Christine Lebas

  18. Francis Bacon czyli Diego Velázquez na fotelu dentystycznym - malarskie i inne cytaty jako "dodatek" do rozpraszającego się życia

    NARCIS (Netherlands)

    van Nieukerken, A.

    2014-01-01

    "Francis Bacon or Diego Velázquez in a dentist’s chair" - pictorial and other kinds of quotations as an addition to a disintegrating life The mature poetry of Tadeusz Różewicz seems to be at odds with both modernist and postmodern literary tenets. It undeniably makes abundant use of intertextuality

  19. Dialoguing from a Fixed Point: How Aristotle and Pope Francis Illuminate the Promise--and Limits--of Inclusion in Catholic Higher Education

    Science.gov (United States)

    Petrusek, Matthew Richard

    2017-01-01

    This article examines the meaning of the word "inclusion" as it relates to Catholic identity in higher education. Noting the widespread presence of this value in the mission statements of Catholic colleges, the article draws on insights from Aristotelian logic and Pope Francis's theology of encounter to argue that inclusion can only be…

  20. If Auditors Are Like Belgian Beers, Which Style Would You Prefer? : Discussion of “Auditor Style and Financial Statement Comparability” by Francis, Pinnuck, and Watanabe .

    NARCIS (Netherlands)

    Bruynseels, L.M.L.; Brenk, van H.M.

    2016-01-01

    Recent research by Francis, Pinnuck, and Watanabe (2014) has shown that financial reporting outcomes are influenced by the audit firm’s unique audit style. They argue that audit firm styles are driven by their “unique set of internal working rules that guide the auditor’s application of accounting

  1. St. Francis Rain Garden Water Quality Sampling Interim Data Report; Total Nitrogen, Total Phosphorus, Sediments or Solids, and E. Coli for the period April to June, 2014

    Science.gov (United States)

    This interim data reported is being provided per request to the Metropolitan Sewer District (MSD) to provide summary statistics on a limited set of water quality parameters as measured at the St. Francis Rain Garden site in the Lick Run Valley as it pertains to MSD's Project Grou...

  2. The Red-Attractiveness Effect, Applying the Ioannidis and Trikalinos (2007b) Test, and the Broader Scientific Context: A Reply to Francis (2013)

    Science.gov (United States)

    Elliot, Andrew J.; Maier, Markus A.

    2013-01-01

    Francis (2013) tested for and found evidence of publication bias in 1 of the 3 focal relations examined in Elliot et al. (2010), that between red and attractiveness. He then called into question the research as a whole and the field of experimental psychology more generally. Our reply has 3 foci. First, we attend to the bottom line regarding the…

  3. The Battle between the Biometricians and the Mendelians: How Sir Francis Galton's Work Caused His Disciples to Reach Conflicting Conclusions about the Hereditary Mechanism

    Science.gov (United States)

    Gillham, Nicholas W.

    2015-01-01

    Francis Galton, Charles Darwin's cousin, had wide and varied interests. They ranged from exploration and travel writing to fingerprinting and the weather. After reading Darwin's "On the Origin of Species," Galton reached the conclusion that it should be possible to improve the human stock through selective breeding, as was the…

  4. Renaissance Epyllions: A Comparative Reading of Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus"

    Science.gov (United States)

    Mahmoudi, Yazdan

    2016-01-01

    The present paper is supposed to compare and contrast three of these masterpieces written the Renaissance period. The epyllions under study are Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus." Bush believes that "the influence…

  5. Il De uno alla luce dell’Exemplum tractatus de iustitia universali, sive de fontibus iuris di Francis Bacon

    Directory of Open Access Journals (Sweden)

    Romana Bassi

    2016-11-01

    Full Text Available [Reading “De uno” in light of Francis Bacon’s “Exemplum tractatus de iustitia universali, sive de fontibus iuris”]. Although Vico was admittedly disappointed by Bacon’s Exemplum tractatus, a parallel reading of this text and De uno can provide insights as to how Vico ended up having to confront a series of issues: how does the universal law project itself into history? Where does the law stem from? Is there a link between law, occasion, and utility? What are the sources and the scope of authority? How does violence affect the law? What role for religion and piety? How to devise a philology for the laws and ancient fables? Bacon’s scattered aphorisms offer glimpses into problems which find a solution in the all-encompassing order of De uno.

  6. Francis-99 turbine numerical flow simulation of steady state operation using RANS and RANS/LES turbulence model

    Science.gov (United States)

    Minakov, A.; Platonov, D.; Sentyabov, A.; Gavrilov, A.

    2017-01-01

    We performed numerical simulation of flow in a laboratory model of a Francis hydroturbine at three regimes, using two eddy-viscosity- (EVM) and a Reynolds stress (RSM) RANS models (realizable k-ɛ, k-ω SST, LRR) and detached-eddy-simulations (DES), as well as large-eddy simulations (LES). Comparison of calculation results with the experimental data was carried out. Unlike the linear EVMs, the RSM, DES, and LES reproduced well the mean velocity components, and pressure pulsations in the diffusor draft tube. Despite relatively coarse meshes and insufficient resolution of the near-wall region, LES, DES also reproduced well the intrinsic flow unsteadiness and the dominant flow structures and the associated pressure pulsations in the draft tube.

  7. Francis Pomponi, Vendetta, justice et politique en Corse. « L’affaire Viterbi » (1789-1821

    Directory of Open Access Journals (Sweden)

    Jean-Claude Farcy

    2010-08-01

    Full Text Available Causes célèbres, crimes et criminels sortant de l’ordinaire ont toujours passionné l’opinion et donné naissance à une littérature à succès, revenant périodiquement sur les mêmes affaires judiciaires. Les historiens de la criminalité et de la justice ont, plus récemment, emprunté cette voie et revisité nombre de ces affaires en les replaçant, avec plus ou moins de succès, dans le contexte de leur époque. L’ouvrage de Francis Pomponi s’inscrit dans cette perspective, celle d’une étude de cas, d...

  8. Using clinical supervision to improve the quality and safety of patient care: a response to Berwick and Francis.

    Science.gov (United States)

    Tomlinson, Jonathon

    2015-06-11

    After widely publicised investigations into excess patient deaths at Mid Staffordshire hospital the UK government commissioned reports from Robert Francis QC and Professor Don Berwick. Among their recommendations to improve the quality and safety of patient care were lifelong learning, professional support and 'just culture'. Clinical supervision is in an excellent position to support these activities but opportunities are in danger of being squeezed out by regulatory and managerial demands. Doctors who have completed their training are responsible for complex professional judgements for which narrative supervision is particularly helpful. With reference to the literature and my own practice I propose that all practicing clinicians should have regular clinical supervision. Clinical supervision has patient-safety and the quality of patient care as its primary purposes. After training is completed, doctors may practice for the rest of their career without any clinical supervision, the implication being that the difficulties dealt with in clinical supervision are no longer difficulties, or are better dealt with some other way. Clinical supervision is sufficiently flexible to be adapted to the needs of experienced clinicians as its forms can be varied, though its functions remain focused on patient safety, good quality clinical care and professional wellbeing. The evidence linking clinical supervision to the quality and safety of patient care reveals that supervision is most effective when its educational and supportive functions are separated from its managerial and evaluative functions. Among supervision's different forms, narrative-based-supervision is particularly useful as it has been developed for clinicians who have completed their training. It provides ways to explore the complexity of clinical judgements and encourages doctors to question one another's authority in a supportive culture. To be successful, supervision should also be professionally led and

  9. LDV survey of cavitation and resonance effect on the precessing vortex rope dynamics in the draft tube of Francis turbines

    Science.gov (United States)

    Favrel, A.; Müller, A.; Landry, C.; Yamamoto, K.; Avellan, F.

    2016-11-01

    The large-scale penetration of the electrical grid by intermittent renewable energy sources requires a continuous operating range extension of hydropower plants. This causes the formation of unfavourable flow patterns in the draft tube of turbines and pump-turbines. At partial load operation, a precessing cavitation vortex rope is formed at the Francis turbine runner outlet, acting as an excitation source for the hydraulic system. In case of resonance, the resulting high-amplitude pressure pulsations can put at risk the stability of the machine and of the electrical grid to which it is connected. It is therefore crucial to understand and accurately simulate the underlying physical mechanisms in such conditions. However, the exact impact of cavitation and hydro-acoustic resonance on the flow velocity fluctuations in the draft tube remains to be established. The flow discharge pulsations expected to occur in the draft tube in resonance conditions have for instance never been verified experimentally. In this study, two-component Laser Doppler Velocimetry is used to investigate the axial and tangential velocity fluctuations at the runner outlet of a reduced scale physical model of a Francis turbine. The investigation is performed for a discharge equal to 64 % of the nominal value and three different pressure levels in the draft tube, including resonance and cavitation-free conditions. Based on the convective pressure fluctuations induced by the vortex precession, the periodical velocity fluctuations over one typical precession period are recovered by phase averaging. The impact of cavitation and hydro-acoustic resonance on both axial and tangential velocity fluctuations in terms of amplitude and phase shift is highlighted for the first time. It is shown that the occurrence of resonance does not have significant effects on the draft tube velocity fields, suggesting that the synchronous axial velocity fluctuations are surprisingly negligible compared to the velocity

  10. FRamework Assessing Notorious Contributing Influences for Error (FRANCIE): Perspective on Taxonomy Development to Support Error Reporting and Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lon N. Haney; David I. Gertman

    2003-04-01

    Beginning in the 1980s a primary focus of human reliability analysis was estimation of human error probabilities. However, detailed qualitative modeling with comprehensive representation of contextual variables often was lacking. This was likely due to the lack of comprehensive error and performance shaping factor taxonomies, and the limited data available on observed error rates and their relationship to specific contextual variables. In the mid 90s Boeing, America West Airlines, NASA Ames Research Center and INEEL partnered in a NASA sponsored Advanced Concepts grant to: assess the state of the art in human error analysis, identify future needs for human error analysis, and develop an approach addressing these needs. Identified needs included the need for a method to identify and prioritize task and contextual characteristics affecting human reliability. Other needs identified included developing comprehensive taxonomies to support detailed qualitative modeling and to structure meaningful data collection efforts across domains. A result was the development of the FRamework Assessing Notorious Contributing Influences for Error (FRANCIE) with a taxonomy for airline maintenance tasks. The assignment of performance shaping factors to generic errors by experts proved to be valuable to qualitative modeling. Performance shaping factors and error types from such detailed approaches can be used to structure error reporting schemes. In a recent NASA Advanced Human Support Technology grant FRANCIE was refined, and two new taxonomies for use on space missions were developed. The development, sharing, and use of error taxonomies, and the refinement of approaches for increased fidelity of qualitative modeling is offered as a means to help direct useful data collection strategies.

  11. Space and time reconstruction of the precessing vortex core in Francis turbine draft tube by 2D-PIV

    Science.gov (United States)

    Favrel, A.; Müller, A.; Landry, C.; Yamamoto, K.; Avellan, F.

    2016-11-01

    Francis turbines operating at part load conditions experience the development of a high swirling flow at the runner outlet, giving rise to the development of a cavitation precessing vortex rope in the draft tube. The latter acts as an excitation source for the hydro-mechanical system and may jeopardize the system stability if resonance conditions are met. Although many aspects of the part load issue have been widely studied in the past, the accurate stability analysis of hydro-power plants remains challenging. A better understanding of the vortex rope dynamics in a wide range of operating conditions is an important step towards the prediction and the transposition of the pressure fluctuations from reduced to prototype scale. For this purpose, an investigation of the flow velocity fields at the outlet of a Francis turbine reduced scale physical model operating at part load conditions is performed by means of 2D-PIV in three different horizontal cross-sections of the draft tube cone. The measurements are performed in cavitation-free conditions for three values of discharge factor, comprised between 60% and 81% of the value at the Best Efficiency Point. The present article describes a detailed methodology to properly recover the evolution of the velocity fields during one precession cycle by means of phase averaging. The vortex circulation is computed and the vortex trajectory over one typical precession period is finally recovered for each operating point. It is notably shown that below a given value of the discharge factor, the vortex dynamics abruptly change and loose its periodicity and coherence.

  12. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  13. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  14. The rise of pathophysiologic research in the United States: the role of two Harvard hospitals.

    Science.gov (United States)

    Tishler, Peter V

    2013-01-01

    Pathophysiologic research, the major approach to understanding and treating disease, was created in the 20th century, and two Harvard-affiliated hospitals, the Peter Bent Brigham Hospital and Boston City Hospital, played a key role in its development. After the Flexner Report of 1910, medical students were assigned clinical clerkships in teaching hospitals. Rockefeller-trained Francis Weld Peabody, who was committed to investigative, pathophysiologic research, was a critical leader in these efforts. At the Brigham, Harvard medical students observed patients closely and asked provocative questions about their diseases. Additionally, physicians returned from World War I with questions concerning the pathophysiology of wartime injuries. At the Boston City Hospital's new Thorndike Memorial Laboratory, Peabody fostered investigative question-based research by physicians. These physicians expanded pathophysiologic investigation from the 1920s. Post-war, Watson and Crick's formulation of the structure of DNA led shortly to modern molecular biology and new research approaches that are being furthered at the Boston Hospitals.

  15. The birth and development of the DNA theory of inheritance: sixty years since the discovery of the structure of DNA.

    Science.gov (United States)

    Portin, Petter

    2014-04-01

    The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.

  16. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  17. Instability Rules: The Ten Most Amazing Ideas of Modern Science

    Science.gov (United States)

    Flowers, Charles

    2002-03-01

    World-altering discoveries that reveal a universe of uncertainty and constant change Whether probing the farthest reaches of the vast universe or exploring the microscopic world of genetics and the subatomic world of quantum mechanics, Instability Rules is a remarkably informative and engaging look at ten milestone discoveries and their discoverers-a wide range of very human personalities whose insights have dramatically altered our most basic assumptions about human existence during the last century. The stories include Edwin Hubble and the expanding universe, Alfred Wegener and continental drift, Neils Bohr and quantum mechanics, Alan Turing and artificial intelligence, and James Watson and Francis Crick and DNA. Also covering discoveries of the twenty-first century that are already refining these and other ideas, Instability Rules is an exhilarating, sometimes amusing encounter with the defining scientific discoveries of our age.

  18. [DNA: from Miescher to Venter and beyond].

    Science.gov (United States)

    Gabryelska, Marta M; Szymański, Maciej; Barciszewski, Jan

    2009-01-01

    DNA, one of the most famous molecules is 140-years-old. Its history has engaged three centuries of experiments, leading us to a point, where the Homo sapiens genome sequence is known. The "DNA breakthrough" is dated on 1953, when James Watson and Francis Crick proposed the model of molecular structure of DNA. But the origin of that great achievement goes back to 1869 and early efforts of Friedrich Miescher, the Swiss doctor, who isolated DNA (than termed nuclein) for the first time. Since that time wealth information on "nuclein", its functions, structure and usage has been collected and formed a basis for modern molecular biology, chemical biology and biotechnology. This article describes the events and circumstances of the most important DNA discoveries since its first isolation up to completing the human genome project and deep DNA sequencing techniques application.

  19. Major Additions to the Linus Pauling Canon

    Science.gov (United States)

    Davenport, Derek A.

    2002-08-01

    The National Library of Medicine has also just posted a Web site on Linus Pauling in its Profiles of Science series. While by no means as rich as the various Oregon State University sites, it is well worth visiting. There are texts of various speeches (including his Nobel address), many downloadable photographs, correspondence (including a poignant letter to James Watson and Francis Crick concerning their "rival" structures for DNA), and much else besides. There is a certain irony in Linus Pauling being honored by the National Library of Medicine. Ever since his 1949 presidential address to the American Chemical Society, and perhaps earlier, Pauling had been at loggerheads, sometimes acrimoniously so, with the medical establishment. It is easy to imagine him somewhere in the timeless infinitude of the empyrean sporting his characteristic ear-to-ear grin.

  20. Simplicity and complexity

    Science.gov (United States)

    Crutchfield, James; Wiesner, Karoline

    2010-02-01

    Is anything ever simple? When confronted with a complicated system, scientists typically strive to identify underlying simplicity, which we articulate as natural laws and fundamental principles. This simplicity is what makes nature appear so organized. Atomic physics, for example, approached a solid theoretical foundation when Niels Bohr uncovered the organization of electronic energy levels, which only later were redescribed as quantum wavefunctions. Charles Darwin's revolutionary idea about the "origin" of species emerged by mapping how species are organized and discovering why they came to be that way. And James Watson and Francis Crick's interpretation of DNA diffraction spectra was a discovery of the structural organization of genetic information - it was neither about the molecule's disorder (thermodynamic entropy) nor about the statistical randomness of its base-pair sequences.

  1. Road Bridges and Culverts, MDTA Culverts, Culverts on John F. Kennedy Highway (I95), Baltimore Harbor Tunnel Throughway, Francis Scott Key Bridge, Bay bridge, Nice Bridge, Published in 2010, 1:1200 (1in=100ft) scale, Maryland Transportation Authority.

    Data.gov (United States)

    NSGIC State | GIS Inventory — Road Bridges and Culverts dataset current as of 2010. MDTA Culverts, Culverts on John F. Kennedy Highway (I95), Baltimore Harbor Tunnel Throughway, Francis Scott Key...

  2. THE SONATA FOR CLARINET AND PIANO BY FRANCIS POULENC FROM THE POINT OF VIEW OF THE GENRE EVOLUTION OF THE 20th CENTURY SONATA

    Directory of Open Access Journals (Sweden)

    ROJNOVEANU ANGELA

    2015-09-01

    Full Text Available The article focuses on the analysis of the Sonata for clarinet and piano by Francis Poulenc that still presents great interest nowadays. This is a masterpiece of twenty century music – an original composition considered from the point of view of its stylistic structure in the context of the experiments carried out in the composition techniques of last century. The author ap­proaches problems of opus themes and architectonics as well as some aspects of musical language.

  3. Compassionate care in radiography recruitment, education and training: A post-Francis Report review of the current literature and patient perspectives

    International Nuclear Information System (INIS)

    Bleiker, J.; Knapp, K.M.; Hopkins, S.; Johnston, G.

    2016-01-01

    Compassion is elemental in the care of a patient during their medical imaging (MI) procedure and is highly topical in the light of the Francis Report. The patient–practitioner interaction is an amalgam of context, communication and individual differences, and whilst compassion is a term in common parlance in the media, policy and radiographers' professional documents, its meaning and manifestation in radiography recruitment, education and practice are less clearly articulated. A review of the existing literature was undertaken, including a small scale study exploring patients' experiences in diagnostic medical imaging. Themes from the study included communication; competence; emotions; attitudes and relationships, but notably absent was any mention of compassion per se. Radiography research would benefit from further exploratory work into the nature of compassionate patient care in the unique context of the medical imaging encounter; offering an evidence-based contribution to radiography in the light of the Francis Report. - Highlights: • An increased focus on compassion was recommended in the Francis Report. • Best compassionate care is a requirement in radiographers' Code of Professional Conduct. • The meaning of compassionate patient care in radiography is not well understood. • Equally neither is the expression of compassion in radiography. • Research into compassion will contribute to evidence-based practice in radiography.

  4. Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

    2017-01-01

    Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

  5. La prolongation de la vie humaine selon Francis Bacon. Ou : quel Tithon voulons-nous être ?

    Directory of Open Access Journals (Sweden)

    Dominique Weber

    2011-07-01

    Full Text Available Afin de comprendre avec exactitude la manière dont Francis Bacon envisage la question de la prolongation de la vie humaine, il faut impérativement examiner l’assise théologique de la réflexion du philosophe à ce sujet. Il convient aussi de restituer l’intégration de cette réflexion dans les objectifs plus amples de la philosophie naturelle nouvelle. Enfin, il est nécessaire de comprendre les dimensions proprement morales de la question. Car la prolongation de la vie humaine n’est pas seulement, au sein de la philosophie naturelle nouvelle, un cas parmi d’autres des recherches qu’il faut désormais effectuer : en réalité, c’est elle qui lui donne et qui lui fixe son sens ; avec elle se joue l’effectivité de l’identité espérée entre science et puissance. Mais il faut encore préciser qu’il ne s’agit aucunement pour l’homme de vieillir pour vieillir : il s’agit pour lui de pouvoir vieillir bien. Les leçons que Bacon tire de la fable de Tithon sont ici véritablement décisives.

  6. An Intelligent Optimization Method for Vortex-Induced Vibration Reducing and Performance Improving in a Large Francis Turbine

    Directory of Open Access Journals (Sweden)

    Xuanlin Peng

    2017-11-01

    Full Text Available In this paper, a new methodology is proposed to reduce the vortex-induced vibration (VIV and improve the performance of the stay vane in a 200-MW Francis turbine. The process can be divided into two parts. Firstly, a diagnosis method for stay vane vibration based on field experiments and a finite element method (FEM is presented. It is found that the resonance between the Kármán vortex and the stay vane is the main cause for the undesired vibration. Then, we focus on establishing an intelligent optimization model of the stay vane’s trailing edge profile. To this end, an approach combining factorial experiments, extreme learning machine (ELM and particle swarm optimization (PSO is implemented. Three kinds of improved profiles of the stay vane are proposed and compared. Finally, the profile with a Donaldson trailing edge is adopted as the best solution for the stay vane, and verifications such as computational fluid dynamics (CFD simulations, structural analysis and fatigue analysis are performed to validate the optimized geometry.

  7. Nonlinear dynamic analysis and robust controller design for Francis hydraulic turbine regulating system with a straight-tube surge tank

    Science.gov (United States)

    Liang, Ji; Yuan, Xiaohui; Yuan, Yanbin; Chen, Zhihuan; Li, Yuanzheng

    2017-02-01

    The safety and stability of hydraulic turbine regulating system (HTRS) in hydropower plants become increasingly important since the rapid development and the broad application of hydro energy technology. In this paper, a novel mathematical model of Francis hydraulic turbine regulating system with a straight-tube surge tank based on a few state-space equations is introduced to study the dynamic behaviors of the HTRS system, where the existence of possible unstable oscillations of this model is studied extensively and presented in the forms of the bifurcation diagram, time waveform plot, phase trajectories, and power spectrum. To eliminate these undesirable behaviors, a specified fuzzy sliding mode controller is designed. In this hybrid controller, the sliding mode control law makes full use of the proposed model to guarantee the robust control in the presence of system uncertainties, while the fuzzy system is applied to approximate the proper gains of the switching control in sliding mode technique to reduce the chattering effect, and particle swarm optimization is developed to search the optimal gains of the controller. Numerical simulations are presented to verify the effectiveness of the designed controller, and the results show that the performances of the nonlinear HTRS system assisted with the proposed controller is much better than that with the commonly used optimal PID controller.

  8. Influence of upstream disturbance on the draft-tube flow of Francis turbine under part-load conditions

    Science.gov (United States)

    Chen, Ting; Zheng, Xianghao; Zhang, Yu-ning; Li, Shengcai

    2018-02-01

    Owing to the part-load operations for the enhancement of grid flexibility, the Francis turbine often suffers from severe low-frequency and large-amplitude hydraulic instability, which is mostly pertinent to the highly unsteady swirling vortex rope in the draft tube. The influence of disturbances in the upstream (e.g., large-scale vortex structures in the spiral casing) on the draft-tube vortex flow is not well understood yet. In the present paper, the influence of the upstream disturbances on the vortical flow in the draft tube is studied based on the vortex identification method and the analysis of several important parameters (e.g., the swirl number and the velocity profile). For a small guide vane opening (representing the part-load condition), the vortices triggered in the spiral casing propagate downstream and significantly affect the swirling vortex-rope precession in the draft tube, leading to the changes of the intensity and the processional frequency of the swirling vortex rope. When the guide vane opening approaches the optimum one (representing the full-load condition), the upstream disturbance becomes weaker and thus its influences on the downstream flow are very limited.

  9. Proper Orthogonal Decomposition of Pressure Fields in a Draft Tube Cone of the Francis (Tokke) Turbine Model

    International Nuclear Information System (INIS)

    Stefan, D; Rudolf, P

    2015-01-01

    The simulations of high head Francis turbine model (Tokke) are performed for three operating conditions - Part Load, Best Efficiency Point (BEP) and Full Load using software Ansys Fluent R15 and alternatively OpenFOAM 2.2.2. For both solvers the simulations employ Realizable k-e turbulence model. The unsteady pressure pulsations of pressure signal from two monitoring points situated in the draft tube cone and one behind the guide vanes are evaluated for all three operating conditions in order to compare frequencies and amplitudes with the experimental results. The computed velocity fields are compared with the experimental ones using LDA measurements in two locations situated in the draft tube cone. The proper orthogonal decomposition (POD) is applied on a longitudinal slice through the draft tube cone. The unsteady static pressure fields are decomposed and a spatio-temporal behavior of modes is correlated with amplitude-frequency results obtained from the pressure signal in monitoring points. The main application of POD is to describe which modes are related to an interaction between rotor (turbine runner) and stator (spiral casing and guide vanes) and cause dynamic flow behavior in the draft tube. The numerically computed efficiency is correlated with the experimental one in order to verify the simulation accuracy

  10. An Evaluation of a Phase-Lag Boundary Condition for Francis Hydroturbine Simulations Using a Pressure-Based Solver

    Science.gov (United States)

    Wouden, Alex; Cimbala, John; Lewis, Bryan

    2014-11-01

    While the periodic boundary condition is useful for handling rotational symmetry in many axisymmetric geometries, its application fails for analysis of rotor-stator interaction (RSI) in multi-stage turbomachinery flow. The inadequacy arises from the underlying geometry where the blade counts per row differ, since the blade counts are crafted to deter the destructive harmonic forces of synchronous blade passing. Therefore, to achieve the computational advantage of modeling a single blade passage per row while preserving the integrity of the RSI, a phase-lag boundary condition is adapted to OpenFOAM® software's incompressible pressure-based solver. The phase-lag construct is accomplished through restating the implicit periodic boundary condition as a constant boundary condition that is updated at each time step with phase-shifted data from the coupled cells adjacent to the boundary. Its effectiveness is demonstrated using a typical Francis hydroturbine modeled as single- and double-passages with phase-lag boundary conditions. The evaluation of the phase-lag condition is based on the correspondence of the overall computational performance and the calculated flow parameters of the phase-lag simulations with those of a baseline full-wheel simulation. Funded in part by DOE Award Number: DE-EE0002667.

  11. On the Flow Instabilities and Turbulent Kinetic Energy of Large-Scale Francis Hydroturbine Model at Low Flow Rate Conditions

    Directory of Open Access Journals (Sweden)

    Wen-Tao Su

    2014-07-01

    Full Text Available This paper is to make a better understanding of the flow instabilities and turbulent kinetic energy (TKE features in a large-scale Francis hydroturbine model. The flow instability with aspect of pressure oscillation and pressure-velocity correlation was investigated using large eddy simulation (LES method along with two-phase cavitation model. The numerical simulation procedures were validated by the existing experimental result, and further the TKE evolution was analyzed in a curvilinear coordinates. By monitoring the fluctuating pressure and velocities in the vanes’ wake region, the local pressure and velocity variations were proven to have a phase difference approaching π/2, with a reasonable cross-correlation coefficient. Also the simultaneous evolution of pressure fluctuations at the opposite locations possessed a clear phase difference of π, indicating the stresses variations on the runner induced by pressure oscillation were in an odd number of nodal diameter. Considering the TKE generation, the streamwise velocity component us′2 contributed the most to the TKE, and thus the normal stress production term and shear stress production term imparted more instability to the flow than other production terms.

  12. Les livres de recettes « francisés » au Mexique au XIXe siècle

    Directory of Open Access Journals (Sweden)

    Sarah Bak-Geller Corona

    2008-05-01

    Full Text Available L’apparition des premiers livres de cuisine au Mexique - publiés par des maisons d’édition françaises spécialisées en ouvrages en espagnol - marque le début de l’histoire de la cuisine mexicaine. Cet événement s’inscrit par ailleurs dans une histoire plus large : celle de la construction de l’État-nation, entre nationalisme et cosmopolitisme. L’article s’intéresse aux idéaux de nation et de cuisine cohabitant dans deux des livres de recettes francisés du XIXe siècle au Mexique : l’Arte novísimo de cocina et le Nuevo cocinero americano/mexicano en forma de diccionario.French-fashioned Mexican recipe books in the 19th century. Globalization and construction of a national culinary modelThe first Mexican recipe books were published in the early 1830’s by French publishing houses specialized in Spanish written books. This article deals with the different nationalistic and cuisine models in two French-fashioned Mexican recipe books -the Arte novísimo de cocina and the Nuevo cocinero americano/mexicano en forma de diccionario- and their relationship with the nation-building context in nineteenth century Mexico.

  13. Cavitation on a scaled-down model of a Francis turbine guide vane: high-speed imaging and PIV measurements

    Science.gov (United States)

    Pervunin, K. S.; Timoshevskiy, M. V.; Churkin, S. A.; Kravtsova, A. Yu; Markovich, D. M.; Hanjalić, K.

    2015-12-01

    Cavitation on two symmetric foils, a NACA0015 hydrofoil and a scaled-down model of a Francis turbine guide vane (GV), was investigated by high-speed visualization and PIV. At small attack angles the differences between the profiles of the mean and fluctuating velocities for both hydrofoils were shown to be insignificant. However, at the higher angle of incidence, flow separation from the GV surface was discovered for quasi-steady regimes including cavitation-free and cavitation inception cases. The flow separation leads to the appearance of a second maximum in velocity fluctuations distributions downstream far from the GV surface. When the transition to unsteady regimes occurred, the velocity distributions became quite similar for both foils. Additionally, for the GV an unsteady regime characterized by asymmetric spanwise variations of the sheet cavity length along with alternating periodic detachments of clouds between the sidewalls of the test channel was for the first time visualized. This asymmetric behaviour is very likely to be governed by the cross instability that was recently described by Decaix and Goncalvès [8]. Moreover, it was concluded that the existence of the cross instability is independent on the test body shape and its aspect ratio.

  14. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  15. Experimental evidence of inter-blade cavitation vortex development in Francis turbines at deep part load condition

    Science.gov (United States)

    Yamamoto, K.; Müller, A.; Favrel, A.; Avellan, F.

    2017-10-01

    Francis turbines are subject to various types of cavitation flow depending on the operating condition. To enable a smooth integration of the renewable energy sources, hydraulic machines are now increasingly required to extend their operating range, especially down to extremely low discharge conditions called deep part load operation. The inter-blade cavitation vortex is a typical cavitation phenomenon observed at deep part load operation. However, its dynamic characteristics are insufficiently understood today. In an objective of revealing its characteristics, the present study introduces a novel visualization technique with instrumented guide vanes embedding the visualization devices, providing unprecedented views on the inter-blade cavitation vortex. The binary image processing technique enables the successful evaluation of the inter-blade cavitation vortex in the images. As a result, it is shown that the probability of the inter-blade cavitation development is significantly high close to the runner hub. Furthermore, the mean vortex line is calculated and the vortex region is estimated in the three-dimensional domain for the comparison with numerical simulation results. In addition, the on-board pressure measurements on a runner blade is conducted, and the influence of the inter-blade vortex on the pressure field is investigated. The analysis suggests that the presence of the inter-blade vortex can magnify the amplitude of pressure fluctuations especially on the blade suction side. Furthermore, the wall pressure difference between pressure and suction sides of the blade features partially low or negative values near the hub at the discharge region where the inter-blade vortex develops. This negative pressure difference on the blade wall suggests the development of a backflow region caused by the flow separation near the hub, which is closely related to the development of the inter-blade vortex. The development of the backflow region is confirmed by the numerical

  16. SCAN TO BIM FOR 3D RECONSTRUCTION OF THE PAPAL BASILICA OF SAINT FRANCIS IN ASSISI IN ITALY

    Directory of Open Access Journals (Sweden)

    M. G. Angelini

    2017-05-01

    Full Text Available The historical building heritage, present in the most of Italian cities centres, is, as part of the construction sector, a working potential, but unfortunately it requires planning of more complex and problematic interventions. However, policies to support on the existing interventions, together with a growing sensitivity for the recovery of assets, determine the need to implement specific studies and to analyse the specific problems of each site. The purpose of this paper is to illustrate the methodology and the results obtained from integrated laser scanning activity in order to have precious architectural information useful not only from the cultural heritage point of view but also to construct more operative and powerful tools, such as BIM (Building Information Modelling aimed to the management of this cultural heritage. The Papal Basilica and the Sacred Convent of Saint Francis in Assisi in Italy are, in fact, characterized by unique and complex peculiarities, which require a detailed knowledge of the sites themselves to ensure visitor’s security and safety. For such a project, we have to take in account all the people and personnel normally present in the site, visitors with disabilities and finally the needs for cultural heritage preservation and protection. This aim can be reached using integrated systems and new technologies, such as Internet of Everything (IoE, capable of connecting people, things (smart sensors, devices and actuators; mobile terminals; wearable devices; etc., data/information/knowledge and processes to reach the desired goals. The IoE system must implement and support an Integrated Multidisciplinary Model for Security and Safety Management (IMMSSM for the specific context, using a multidisciplinary approach.

  17. Scan to Bim for 3d Reconstruction of the Papal Basilica of Saint Francis in Assisi in Italy

    Science.gov (United States)

    Angelini, M. G.; Baiocchi, V.; Costantino, D.; Garzia, F.

    2017-05-01

    The historical building heritage, present in the most of Italian cities centres, is, as part of the construction sector, a working potential, but unfortunately it requires planning of more complex and problematic interventions. However, policies to support on the existing interventions, together with a growing sensitivity for the recovery of assets, determine the need to implement specific studies and to analyse the specific problems of each site. The purpose of this paper is to illustrate the methodology and the results obtained from integrated laser scanning activity in order to have precious architectural information useful not only from the cultural heritage point of view but also to construct more operative and powerful tools, such as BIM (Building Information Modelling) aimed to the management of this cultural heritage. The Papal Basilica and the Sacred Convent of Saint Francis in Assisi in Italy are, in fact, characterized by unique and complex peculiarities, which require a detailed knowledge of the sites themselves to ensure visitor's security and safety. For such a project, we have to take in account all the people and personnel normally present in the site, visitors with disabilities and finally the needs for cultural heritage preservation and protection. This aim can be reached using integrated systems and new technologies, such as Internet of Everything (IoE), capable of connecting people, things (smart sensors, devices and actuators; mobile terminals; wearable devices; etc.), data/information/knowledge and processes to reach the desired goals. The IoE system must implement and support an Integrated Multidisciplinary Model for Security and Safety Management (IMMSSM) for the specific context, using a multidisciplinary approach.

  18. Fidelity Mechanisms of DNA Polymerase Alpha

    Science.gov (United States)

    2008-07-23

    between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

  19. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  20. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.