Weighted Watson-Crick automata
Energy Technology Data Exchange (ETDEWEB)
Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)
2014-07-10
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Weighted Watson-Crick automata
International Nuclear Information System (INIS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-01-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power
Closure properties of Watson-Crick grammars
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.
Teive, Hélio A G
2016-04-01
The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.
Multi-head Watson-Crick automata
Chatterjee, Kingshuk; Ray, Kumar Sankar
2015-01-01
Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...
On the centenary of the birth of Francis H. C. Crick – from physics to genetics and neuroscience
Directory of Open Access Journals (Sweden)
Hélio A. G. Teive
2016-04-01
Full Text Available ABSTRACT The year 2016 marks the centenary of the birth of Francis Crick (1916–2004, who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
Directory of Open Access Journals (Sweden)
Graur Dan
2011-02-01
Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2005-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...
Peters, Keith; Smith, Jim
2017-04-01
The Francis Crick Institute Laboratory, opened in 2016, is supported by the Medical Research Council, Cancer Research UK, the Wellcome Trust, and University College London, King's College London and Imperial College London. The emphasis on research training and early independence of gifted scientists in a multidisciplinary environment provides unique opportunities for UK medical science, including clinical and translational research. © Royal College of Physicians 2017. All rights reserved.
Indian Academy of Sciences (India)
Administrator
The death of Francis Crick deprives us of one of the great- est scientists of the 20th century, whose creativity and power of mind dominated molecular biology in its golden years. Many people have told the story of his achievements; here I would simply like to recollect some of the qualities of this remarkable man. The first ...
London home for Crick archive.
Williams, Nigel
2002-01-08
Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.
Francis Crick, DNA, and the Central Dogma
Olby, Robert
1970-01-01
This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)
On Francis Crick, the genetic code, and a clever kid.
Goldstein, Bob
2018-04-02
A few years ago, Francis Crick's son told me a story that I can't get out of my mind. I had contacted Michael Crick by email while digging through the background of the researchers who had cracked the genetic code in the 1960s. Francis had died in 2004, and I was contacting some of the people who knew him when he was struggling to decipher the code. Francis didn't appear to struggle often - he is known mostly for his successes - and, as it turns out, this one well-known struggle may have had a clue sitting just barely out of sight. Copyright © 2018 Elsevier Ltd. All rights reserved.
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Watson-Crick hydrogen bonding of unlocked nucleic acids
DEFF Research Database (Denmark)
Langkjær, Niels; Wengel, Jesper; Pasternak, Anna
2015-01-01
We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
60 years ago, Francis Crick changed the logic of biology.
Cobb, Matthew
2017-09-01
In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
60 years ago, Francis Crick changed the logic of biology.
Directory of Open Access Journals (Sweden)
Matthew Cobb
2017-09-01
Full Text Available In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.
60 years ago, Francis Crick changed the logic of biology
2017-01-01
In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences. PMID:28922352
Rao, B J; Radding, C M
1994-01-01
Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
STONE, PETER
2008-01-01
PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
A world in one dimension: Linus Pauling, Francis Crick and the central dogma of molecular biology.
Strasser, Bruno J
2006-01-01
In 1957, Francis Crick outlined a startling vision of life in which the great diversity of forms and shapes of macromolecules was encoded in the one-dimensional sequence of nucleic acids. This paper situates Crick's new vision in the debates of the 1950s about protein synthesis and gene action. After exploring the reception of Crick's ideas, it shows how they differed radically from a different model of protein synthesis which enjoyed wide currency in that decade. In this alternative model, advocated by Linus Pauling and other luminaries, three-dimensional templates directed the folding of proteins. Even though it was always considered somewhat speculative, this theory was supported by a number of empirical results originating in different experimental systems. It was eventually replaced by a model in which the forms and shapes of macromolecules resulted solely from their amino acid sequence, dramatically simplifying the problem of protein synthesis which Crick was attempting to solve in 1957.
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience.
Aicardi, Christine
2016-02-01
The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a 'cross-worlds influencer' who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise 'un-disciplined' new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against 'vitalism': anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of 'doing science' and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: 'follow the cross-worlds influencers' who worked to build and organise these semi-institutional gatherings and institutional structures. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.
Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience
Aicardi, Christine
2016-01-01
The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a ‘cross-worlds influencer’ who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise ‘un-disciplined’ new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against ‘vitalism’: anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of ‘doing science’ and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: ‘follow the cross-worlds influencers’ who worked to build and organise these semi-institutional gatherings and institutional structures. PMID:26383132
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E
Czech Academy of Sciences Publication Activity Database
Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří
2003-01-01
Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Improving the Army’s Next Effort in Technology Forecasting
2010-09-01
DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Indian Academy of Sciences (India)
Administrator
him. When somebody gave a lecture, Francis was ready at the end (and often in the middle) to give them a lucid and exact account of what their work meant, for better or for worse. This made the Laboratory of Molecular Biology's end-of-year lectures a terrifying ordeal for many, but in- creased their intellectual value, and ...
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Francis Crick: A Singular Approach to Scientific Discovery.
Lawrence, Peter A
2016-12-01
Francis' office window (at the Salk) commanded a panorama of the Pacific. "This grand natural scene was a physical correlate of Francis's intellectual world: wide-ranging, brilliantly lit, a little overawing, but also immensely inviting and above all an exciting place to be." (Mitchison, 2004). Copyright © 2016 Elsevier Inc. All rights reserved.
The discovery of the structure of DNA
Squires, G. L.
2003-04-01
On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
International Nuclear Information System (INIS)
Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz
2007-01-01
The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.
International Nuclear Information System (INIS)
Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.
1988-01-01
The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-05-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.
2003-01-01
Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Aicardi, Christine
2014-03-01
Taking up the view that semi-institutional gatherings such as clubs, societies, research schools, have been instrumental in creating sheltered spaces from which many a 20th-century project-driven interdisciplinary research programme could develop and become established within the institutions of science, the paper explores the history of one such gathering from its inception in the early 1980s into the 2000s, the Helmholtz Club, which brought together scientists from such various research fields as neuroanatomy, neurophysiology, psychophysics, computer science and engineering, who all had an interest in the study of the visual system and of higher cognitive functions relying on visual perception such as visual consciousness. It argues that British molecular biologist turned South Californian neuroscientist Francis Crick had an early and lasting influence over the Helmholtz Club of which he was a founding pillar, and that from its inception, the club served as a constitutive element in his long-term plans for a neuroscience of vision and of cognition. Further, it argues that in this role, the Helmholtz Club served many purposes, the primary of which was to be a social forum for interdisciplinary discussion, where 'discussion' was not mere talk but was imbued with an epistemic value and as such, carefully cultivated. Finally, it questions what counts as 'doing science' and in turn, definitions of success and failure-and provides some material evidence towards re-appraising the successfulness of Crick's contribution to the neurosciences. Copyright © 2013 The Author. Published by Elsevier Ltd.. All rights reserved.
The History of Molecular Structure Determination Viewed through the Nobel Prizes.
Jensen, William P.; Palenik, Gus J.; Suh, Il-Hwan
2003-01-01
Discusses the importance of complex molecular structures. Emphasizes their individual significance through examination of the Nobel Prizes of the 20th century. Highlights prizes awarded to Conrad Rontgen, Francis H.C. Crick, James D. Watson, Maurice H.F. Wilkins, and others. (SOE)
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
The Discovery of the Double Helix
CERN. Geneva
2011-01-01
Professor James D. Watson has kindly agreed to make a presentation on the 1953 finding of the Double Helix at the Cavendish Laboratory by Francis Crick and himself. Being one of the greatest scientific discoveries in human history, little else needs to be added.
Watson-Crick hydrogen bonds : Nature and role in DNA replication
Guerra, Célia Fonseca; Bickelhaupt, F. Matthias
2006-01-01
The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of
International Nuclear Information System (INIS)
Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt
2000-01-01
This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds
Confronting Science: The Dilemma of Genetic Testing.
Zallen, Doris T.
1997-01-01
Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)
Human Genome Research: Decoding DNA
dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human
Sejnowski, Terrence J
2015-01-01
No one did more to draw neuroscientists' attention to the problem of consciousness in the twentieth century than Francis Crick, who may be better known as the co-discoverer (with James Watson) of the structure of DNA. Crick focused his research on visual awareness and based his analysis on the progress made over the last fifty years in uncovering the neural mechanisms underlying visual perception. Because much of what happens in our brains occurs below the level of consciousness and many of our intuitions about unconscious processing are misleading, consciousness remains an elusive problem. In the end, when all of the brain mechanisms that underlie consciousness have been identified, will we still be asking: "What is consciousness?" Or will the question shift, just as the question "What is life?" is no longer the same as it was before Francis Crick?
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Allies and Competitors as Enscripted Audiences in Scientific Writing.
Perry, Susan
A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
(Mis)understanding Science: The Problem with Scientific Breakthroughs.
Evans, James P
2016-09-01
On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.
After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.
Creager, Angela N H; Morgan, Gregory J
2008-06-01
Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.
Bandyopadhyay, D; Bhattacharyya, D
2006-10-15
It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.
10 años de la secuenciación del genoma humano: Encuentro entre el imaginario y la realidad
Directory of Open Access Journals (Sweden)
María Teresa Reguero Reza
2013-01-01
Full Text Available Lejano parece en año de 1953 cuando se publica en Nature un artículo sobre la estructura helicoidal de ADN, propuesta por dos investigadores, el británico Francis Crick y el estadounidense James Watson, lo que constituyó la piedra angular de los procesos de secuenciación.
X-Ray Diffraction and the Discovery of the Structure of DNA
Crouse, David T.
2007-01-01
A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…
Replication infidelity via a mismatch with Watson–Crick geometry
Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.
2011-01-01
In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421
Nanotechnology: Threats and Deterrent Opportunities by 2035
2010-02-17
22. 17 James Watson and Francis Crick discovered the structure of Deoxyribonucleic acid ( DNA ) in 1953. 18 Self-replication is when nanoscale machine...which then improves researchers’ understanding of critical, computationally intensive fields of study like DNA .17 These complementary scientific and...researchers’ clarity on critical medical issues like Deoxyribonucleic acid ( DNA ). 102 Omar Khayyam, Rubaiyat of Omar Khayyam (NY: Random House, 1947
A 3D-DNA Molecule Made of PlayMais
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M
2011-08-01
The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.
Guck, Jochen
2009-07-01
Ever since James Watson and Francis Crick cracked the code of life and laid the foundations for molecular biology, biologists have almost exclusively focused on the molecular aspects of biological systems. This cumulated in the mapping of the entire human genome a few years ago-the entire blueprint of every cell. So, does that mean we can stop? Is everything known that we can possibly know about cells? Far from it.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Forecasting Science and Technology for the Department of Defense
2009-12-01
Watson and Francis Crick announced that they had elucidated the structure of DNA and had therefore “discovered the secret of life.” While this was a...an organic chemist, figured out a process by which very small quantities of DNA could be amplified with high fidelity. This process, known as...polymerase chain reaction (PCR), for the first time, allowed scientists to produce DNA in large quantities. Roughly during this period, Leroy Hood and
Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.
2018-01-01
The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
Kirchner, Stefan
Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.
Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M
2017-12-20
This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.
Srivastava, Ruby
2018-03-01
We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.
International Nuclear Information System (INIS)
Gao, X.; Patel, D.J.
1988-01-01
The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M
2017-05-19
In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So
Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing
2010-03-01
that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
International Nuclear Information System (INIS)
Guevara Pardo, Gonzalo
2001-01-01
First it was the luminous idea of the natural selection, proposed by Alfred Russell Wallace and Talk Darwin, the one that allowed understanding the way as the living organisms are evolve. Then they were the brilliant Francis Crick and James Watson who discovered the curvilinear molecule of deoxyribonucleic acid (DNA) and then it was the great explosion of the molecular biology. The cancer, illness that wakes up our deepest fears, is analyzed in this article from an evolutionary conception that could give us a road but appropriate to understand it and maybe to guide us toward better therapeutic options
Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer
2010-10-01
DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and
Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer
2011-10-01
or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding
Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding
2008-07-11
Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Fidelity Mechanisms of DNA Polymerase Alpha
2008-07-23
between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied
Poitevin, Frédéric; Edelstein, Stuart J
2013-05-13
In response to a 100-word footnote in the 1965 article by Monod, Wyman, and Changeux, a detailed manuscript signed by Francis Crick and Jeffries Wyman with 6000 words and 30 equations entitled "A Footnote on Allostery" circulated in 1965 among a limited group of scientists interested in allosteric interactions. This interesting and provocative document is published in this special issue for the first time. An intriguing equation in their text relates the difference between n (the number of ligand binding sites) and n' (the Hill coefficient) to the ratio of the saturation functions Y¯, for oligomers with n-1 and n binding sites. A compact derivation of this equation was not provided by Crick and Wyman, but one is presented here based on a definition of Y¯ involving the binding polynomial and its first derivative. Copyright © 2013 Elsevier Ltd. All rights reserved.
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
DEFF Research Database (Denmark)
Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.
2015-01-01
about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...
Crutchfield, James; Wiesner, Karoline
2010-02-01
Is anything ever simple? When confronted with a complicated system, scientists typically strive to identify underlying simplicity, which we articulate as natural laws and fundamental principles. This simplicity is what makes nature appear so organized. Atomic physics, for example, approached a solid theoretical foundation when Niels Bohr uncovered the organization of electronic energy levels, which only later were redescribed as quantum wavefunctions. Charles Darwin's revolutionary idea about the "origin" of species emerged by mapping how species are organized and discovering why they came to be that way. And James Watson and Francis Crick's interpretation of DNA diffraction spectra was a discovery of the structural organization of genetic information - it was neither about the molecule's disorder (thermodynamic entropy) nor about the statistical randomness of its base-pair sequences.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Toll-Like Receptor-9-Mediated Invasion in Breast Cancer
2011-07-01
AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA
Data Discovery with IBM Watson
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
Glutamate Receptor Aptamers and ALS
2009-01-01
considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus
Distributional Watson transforms
Dijksma, A.; Snoo, H.S.V. de
1974-01-01
For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-08-14
The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.
Seven essential questions on G-quadruplexes.
König, Sebastian L B; Evans, Amanda C; Huppert, Julian L
2010-08-01
The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.
Instability Rules: The Ten Most Amazing Ideas of Modern Science
Flowers, Charles
2002-03-01
World-altering discoveries that reveal a universe of uncertainty and constant change Whether probing the farthest reaches of the vast universe or exploring the microscopic world of genetics and the subatomic world of quantum mechanics, Instability Rules is a remarkably informative and engaging look at ten milestone discoveries and their discoverers-a wide range of very human personalities whose insights have dramatically altered our most basic assumptions about human existence during the last century. The stories include Edwin Hubble and the expanding universe, Alfred Wegener and continental drift, Neils Bohr and quantum mechanics, Alan Turing and artificial intelligence, and James Watson and Francis Crick and DNA. Also covering discoveries of the twenty-first century that are already refining these and other ideas, Instability Rules is an exhilarating, sometimes amusing encounter with the defining scientific discoveries of our age.
[DNA: from Miescher to Venter and beyond].
Gabryelska, Marta M; Szymański, Maciej; Barciszewski, Jan
2009-01-01
DNA, one of the most famous molecules is 140-years-old. Its history has engaged three centuries of experiments, leading us to a point, where the Homo sapiens genome sequence is known. The "DNA breakthrough" is dated on 1953, when James Watson and Francis Crick proposed the model of molecular structure of DNA. But the origin of that great achievement goes back to 1869 and early efforts of Friedrich Miescher, the Swiss doctor, who isolated DNA (than termed nuclein) for the first time. Since that time wealth information on "nuclein", its functions, structure and usage has been collected and formed a basis for modern molecular biology, chemical biology and biotechnology. This article describes the events and circumstances of the most important DNA discoveries since its first isolation up to completing the human genome project and deep DNA sequencing techniques application.
Major Additions to the Linus Pauling Canon
Davenport, Derek A.
2002-08-01
The National Library of Medicine has also just posted a Web site on Linus Pauling in its Profiles of Science series. While by no means as rich as the various Oregon State University sites, it is well worth visiting. There are texts of various speeches (including his Nobel address), many downloadable photographs, correspondence (including a poignant letter to James Watson and Francis Crick concerning their "rival" structures for DNA), and much else besides. There is a certain irony in Linus Pauling being honored by the National Library of Medicine. Ever since his 1949 presidential address to the American Chemical Society, and perhaps earlier, Pauling had been at loggerheads, sometimes acrimoniously so, with the medical establishment. It is easy to imagine him somewhere in the timeless infinitude of the empyrean sporting his characteristic ear-to-ear grin.
Predicting and Modeling RNA Architecture
Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice
2011-01-01
SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963
The coevolution of genes and genetic codes: Crick's frozen accident revisited.
Sella, Guy; Ardell, David H
2006-09-01
The standard genetic code is the nearly universal system for the translation of genes into proteins. The code exhibits two salient structural characteristics: it possesses a distinct organization that makes it extremely robust to errors in replication and translation, and it is highly redundant. The origin of these properties has intrigued researchers since the code was first discovered. One suggestion, which is the subject of this review, is that the code's organization is the outcome of the coevolution of genes and genetic codes. In 1968, Francis Crick explored the possible implications of coevolution at different stages of code evolution. Although he argues that coevolution was likely to influence the evolution of the code, he concludes that it falls short of explaining the organization of the code we see today. The recent application of mathematical modeling to study the effects of errors on the course of coevolution, suggests a different conclusion. It shows that coevolution readily generates genetic codes that are highly redundant and similar in their error-correcting organization to the standard code. We review this recent work and suggest that further affirmation of the role of coevolution can be attained by investigating the extent to which the outcome of coevolution is robust to other influences that were present during the evolution of the code.
Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing
2010-01-01
DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a
Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D
2017-07-11
RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Shanker, Sudhanshu; Bandyopadhyay, Pradipta
2017-08-01
The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.
Portin, Petter
2014-04-01
The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
The protein side of the central dogma: permanence and change.
Morange, Michel
2006-01-01
There are two facets to the central dogma proposed by Francis Crick in 1957. One concerns the relation between the sequence of nucleotides and the sequence of amino acids, the second is devoted to the relation between the sequence of amino acids and the native three-dimensional structure of proteins. 'Folding is simply a function of the order of the amino acids,' i.e. no information is required for the proper folding of a protein other than the information contained in its sequence. This protein side of the central dogma was elaborated in a scientific context in which the characteristics and functions of proteins, and the mechanisms of protein folding, were seen very differently. This context, which made the folding problem a simple one, supported the bold proposition of Francis Crick. The protein side of the central dogma was not challenged by the discovery of prions if one adopts the definition of information given by Francis Crick. It might have been challenged by the discovery that regulatory enzymes exist in different conformations, and the evidence for the existence of chaperones assisting protein folding. But it was not, and folding remains what it was for Francis Crick, 'simply a function of the order of amino acids'. But the meaning of 'function' has dramatically changed. It is no longer the result of simple physicochemical laws, but that of a long evolutionary process which has optimized protein folding. Molecular mechanistic explanations have to be allied with evolutionary explanations, in a way characteristic of present biology.
78 FR 43198 - Watson Cogeneration Company; Notice of Filing
2013-07-19
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...
Indian Academy of Sciences (India)
University, to suggest that a meaningful gesture, given that it was Franklin's data that the Watson and Crick ... However,. Maddox also adds that Franklin understood her capabilities and \\vas forthright about speaking ... did not allow him to see how much of her work had influenced the DNA model he and Crick had proposed.
The rise of pathophysiologic research in the United States: the role of two Harvard hospitals.
Tishler, Peter V
2013-01-01
Pathophysiologic research, the major approach to understanding and treating disease, was created in the 20th century, and two Harvard-affiliated hospitals, the Peter Bent Brigham Hospital and Boston City Hospital, played a key role in its development. After the Flexner Report of 1910, medical students were assigned clinical clerkships in teaching hospitals. Rockefeller-trained Francis Weld Peabody, who was committed to investigative, pathophysiologic research, was a critical leader in these efforts. At the Brigham, Harvard medical students observed patients closely and asked provocative questions about their diseases. Additionally, physicians returned from World War I with questions concerning the pathophysiology of wartime injuries. At the Boston City Hospital's new Thorndike Memorial Laboratory, Peabody fostered investigative question-based research by physicians. These physicians expanded pathophysiologic investigation from the 1920s. Post-war, Watson and Crick's formulation of the structure of DNA led shortly to modern molecular biology and new research approaches that are being furthered at the Boston Hospitals.
From the peas of Gregor Mendel to the human genome and beyond
Paces, V
2008-01-01
In the middle of the 19th century, Gregor Mendel conducted his experiments with peas. This took place in the Augustinian monastery in Brno (now the Czech Republic), where he was the abbot. These experiments laid the foundations of modern genetics. At around the same time Charles Darwin formulated his theory of evolution. Through their work, these two men inaugurated the age of modern biology. The next most important step came in 1953 when James Watson and Francis Crick solved the elusive DNA structure. Since then methods for ‘reading’ genetic information have developed quickly, and genomes of many organisms have been analysed, including our own. The human genome consists of 3 billion letters (nucleotides) and it comprises approximately 25,000 genes. The smallest natural genome is the genome of Mycoplasma genitalium. It consists of a mere 500,000 nucleotides and is composed of 500 genes. Yet, mycoplasma is capable of a completely independent life. It would appear from this fact that basic life itself is no...
1998-01-01
Aastavahetusel Hamburgi teises Deichtorhalles olnud näitusest, kus eksponeeriti Francis Picabia (1879-1953) loomingut alates 1935. aastast. Näitus tutvustas Picabiat kui aktimaalijat, portretisti, fotograafi ja kirjameest
Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-l-LNA
DEFF Research Database (Denmark)
Kosbar, Tamer R.; Sofan, Mamdouh A.; Abou-Zeid, Laila
2015-01-01
G-rich anti-parallel DNA triplexes were modified with LNA or α-l-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability...... of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-l-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-l-LNA and LNA in the middle of the triplex...
Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA
DEFF Research Database (Denmark)
Aagaard, C; Douthwaite, S
1994-01-01
RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...
Alternative Watson-Crick Synthetic Genetic Systems.
Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia
2016-11-01
In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
2012-07-01
like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH
Indian Academy of Sciences (India)
Unknown
2004-11-29
Nov 29, 2004 ... Crick's and Wilkins' reactions were not at all unusual at the time – in fact, book reviews of The Double ... As a youngish man in his mid-thirties at the time when Watson met him, Crick was ... moved into the field of biology instead. .... recent realization that the action is in the proteome rather than the genome ...
Structure of the DNA duplex d(ATTAAT2 with Hoogsteen hydrogen bonds.
Directory of Open Access Journals (Sweden)
Francisco J Acosta-Reyes
Full Text Available The traditional Watson-Crick base pairs in DNA may occasionally adopt a Hoogsteen conformation, with a different organization of hydrogen bonds. Previous crystal structures have shown that the Hoogsteen conformation is favored in alternating AT sequences of DNA. Here we present new data for a different sequence, d(ATTAAT2, which is also found in the Hoogsteen conformation. Thus we demonstrate that other all-AT sequences of DNA with a different sequence may be found in the Hoogsteen conformation. We conclude that any all-AT sequence might acquire this conformation under appropriate conditions. We also compare the detailed features of DNA in either the Hoogsteen or Watson-Crick conformations.
DEFF Research Database (Denmark)
Vester, B; Hansen, L H; Douthwaite, S
1995-01-01
the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...
Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua
2010-08-01
Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.
Training IBM Watson using Automatically Generated Question-Answer Pairs
Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh
2016-01-01
IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...
Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje
Stojić, Igor
2016-01-01
Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...
Hydrogen bond indices and tertiary structure of yeast tRNA sup(Phe)
International Nuclear Information System (INIS)
Giambiagi, M.S. de; Giambiagi, M.; Esquivel, D.M.S.
1982-01-01
The rigidity and stability of the tertiary structure of yeast tRNA sup(Phe) is related to a bond index employed in an IEHT calculation. The index permits a quantitative estimate of the electronic cloud along the hydrogen bond, having thus an appealing physical meaning. The results indicate that Hoogsteen-type bonds have, as expected, greater electronic population than Watson-Crick type ones. Other non-Watson-Crick pairings, the wobble pair and G 15 -C 48 , exhibit high values of the index for the NH...O bond. In the triples, the electronic density of the hydrogen bridges does not weaken, comparing it with the one of the pairs involved. Contour density maps are shown and dipolar moments of pairs and triples are qualitatively discussed. (Author) [pt
The rise and fall of central dogmas.
Klein, George; Klein, Eva
2016-01-01
Stimulated by Francis Cricks "central dogma of molecular biology" open to criticism and rebuttal, five statements are formulated on current notions of tumor biology, inviting the criticism of the reader.
Cavitation erosion prediction on Francis turbines
Energy Technology Data Exchange (ETDEWEB)
Bourdon, P.; Farhat, M.; Simoneau, R.; Lavigne, P. [Hydro-Quebec, Montreal, PQ (Canada); Pereira, F.; Dupont, P.; Avellan, F.; Caron, J.F. [IMHEF/EPFL, (France); Dorey, J.M.; Archer, A. [Electricite de France (EDF), 92 - Clamart (France). Dir. des Etudes et Recherches; and others
1997-12-31
On-board aggressiveness measurement methods were tested on a severely eroded prototype blade of a 266 MW Francis turbine: pressure, pit counting, DECER electrochemical and vibration measurements. The test program provided understanding of the heterogeneous erosion distribution of the prototype blades and quantitative data for comparison in subsequent tests on the model of the machine. Model tests and flow analysis were also performed, to detect cavitation on a Francis turbine model. The results are compared to those obtained on the prototype measurements. The model used for that study is built on the basis of a geometrical recovery of one of the most eroded blade of the prototype. Different methods were investigated to predict cavitation erosion on Francis turbines from model. They are based on measurement of pitting, pressure fluctuations and acceleration. The methods proposed are suitable to measure cavitation aggressiveness on model and on prototype, and that the level on the model is several orders of magnitude smaller than on the prototype. (author) 18 refs.
Nonequilibrium Phase Transitions Associated with DNA Replication
2011-02-11
polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing
Directory of Open Access Journals (Sweden)
Dorian Nedelcu
2015-07-01
Full Text Available The paper presents the Hydro Hill Chart - Francis module application, used to calculate the hill chart of the Pelton, Francis and Kaplan hydraulic turbine models, by processing the data measured on the stand. After describing the interface and menu, the input data is graphically presented and the universal characteristic for measuring scenarios ao=const. and n11=const is calculated. Finally, the two calculated hill charts are compared through a graphical superimposition of the isolines.
Human genes and genomes: science, health, society
National Research Council Canada - National Science Library
Rosenberg, Leon E; Rosenberg, Diane Drobnis
2012-01-01
"In the nearly 60 years since Watson and Crick proposed the double helical structure of DNA, the molecule of heredity, waves of discoveries have made genetics the most thrilling field in the sciences...
Assessing Attitude towards Religion: The Astley-Francis Scale of Attitude towards Theistic Faith
Astley, Jeff; Francis, Leslie J.; Robbins, Mandy
2012-01-01
This study builds on the research tradition modelled by the Francis Scale of Attitude towards Christianity, the Katz-Francis Scale of Attitude towards Judaism, the Sahin-Francis Scale of Attitude towards Islam and the Santosh-Francis Scale of Attitude towards Hinduism to propose a generic instrument concerned with attitudes towards theistic faith.…
Maartens, Aidan
2017-08-01
Jim Smith is Director of Science at the Wellcome Trust and a group leader at the Francis Crick Institute, where he was formerly Director of Research. A Fellow of both the Royal Society and the Academy of Medical Sciences, he was knighted for his services to medical research and science education in 2016. His lab works on mesoderm induction in the early vertebrate embryo. We met Jim in the Crick to hear about his life in science, his visions for the Crick and the Wellcome Trust, and his advice for early career scientists. © 2017. Published by The Company of Biologists Ltd.
Major historical developments in the design of water wheels and Francis hydroturbines
International Nuclear Information System (INIS)
Lewis, B J; Cimbala, J M; Wouden, A M
2014-01-01
The first record of water wheels dates back to ancient Greece. Over the next several centuries the technology spread all over the world. The process of arriving at the design of the modern Francis runner lasted from 1848 to approximately 1920. Though the modern Francis runner has little resemblance to the original turbines designed by James B. Francis in 1848, it became know as the Francis turbine around 1920, in honor of his many contributions to hydraulic engineering analysis and design. The modern Francis turbine is the most widely used turbine design today, particularly for medium head and large flow rate situations, and can achieve over 95% efficiency
Directory of Open Access Journals (Sweden)
Masaru Tsunoda
2010-01-01
Full Text Available Hydroxyl radicals are potent mutagens that attack DNA to form various base and ribose derivatives. One of the major damaged thymine derivatives is 5-formyluracil (fU, which induces pyrimidine transition during replication. In order to establish the structural basis for such mutagenesis, the crystal structures of two kinds of DNA d(CGCGRATfUCGCG with R = A/G have been determined by X-ray crystallography. The fU residues form a Watson-Crick-type pair with A and two types of pairs (wobble and reversed wobble with G, the latter being a new type of base pair between ionized thymine base and guanine base. In silico structural modeling suggests that the DNA polymerase can accept the reversed wobble pair with G, as well as the Watson-Crick pair with A.
Intrathalamic Mechanisms of Visual Attention
Mayo, J. Patrick
2009-01-01
The classical model of visual processing emphasizes the lateral geniculate nucleus (LGN) as the major intermediary between the retina and visual cortex. Yet, anatomical findings inspired Francis Crick to suggest an alternative model in which the thalamic reticular nucleus, which envelops the LGN, acts as the “guardian” of visual cortex by modulating LGN activity. Recent work by McAlonan and colleagues supports Crick's hypothesis, thereby enhancing our understanding of the early stages of visu...
Intrathalamic mechanisms of visual attention.
Mayo, J Patrick
2009-03-01
The classical model of visual processing emphasizes the lateral geniculate nucleus (LGN) as the major intermediary between the retina and visual cortex. Yet, anatomical findings inspired Francis Crick to suggest an alternative model in which the thalamic reticular nucleus, which envelops the LGN, acts as the "guardian" of visual cortex by modulating LGN activity. Recent work by McAlonan and colleagues supports Crick's hypothesis, thereby enhancing our understanding of the early stages of visual processing.
Nucleic acid nanomaterials: Silver-wired DNA
Auffinger, Pascal; Ennifar, Eric
2017-10-01
DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.
Erwin Schroedinger, Francis Crick and epigenetic stability
Directory of Open Access Journals (Sweden)
Ogryzko Vasily V
2008-04-01
Full Text Available Abstract Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.
Erwin Schroedinger, Francis Crick and epigenetic stability.
Ogryzko, Vasily V
2008-04-17
Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
2006-01-01
Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...
Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities
Kidd, Gary R.
2004-05-01
Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
2013-03-20
... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...
Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.
Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik
2016-09-07
One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.
Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A
2018-02-01
Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.
Indian Academy of Sciences (India)
Unknown
and Watson clearly showed how, in fact, a gene could work. ... fifties Crick suggested that RNA acts as an adaptor that enables amino acids to associate ... tions, segmentation and complementation in development and origin of life on earth.
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
2013-10-25
... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...
Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory
International Nuclear Information System (INIS)
Geltman, S.
1996-01-01
Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society
On the scaling limits of Galton Watson processes in varying environment
Bansaye, V.; Simatos, F.
2011-01-01
Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Sommerfeld-Watson transformation for nuclear fission
International Nuclear Information System (INIS)
Alexandru, G.
1978-01-01
It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)
Master equation and runaway speed of the Francis turbine
Zhang, Zh.
2018-04-01
The master equation of the Francis turbine is derived based on the combination of the angular momentum (Euler) and the energy laws. It relates the geometrical design of the impeller and the regulation settings (guide vane angle and rotational speed) to the discharge and the power output. The master equation, thus, enables the complete characteristics of a given Francis turbine to be easily computed. While applying the energy law, both the shock loss at the impeller inlet and the swirling loss at the impeller exit are taken into account. These are main losses which occur at both the partial load and the overloads and, thus, dominantly influence the characteristics of the Francis turbine. They also totally govern the discharge of the water through the impeller when the impeller is found in the standstill. The computations have been performed for the discharge, the hydraulic torque and the hydraulic efficiency. They were also compared with the available measurements on a model turbine. Excellent agreement has been achieved. The computations also enable the runaway speed of the Francis turbine and the related discharge to be determined as a function of the setting angle of the guide vanes.
Kisters, Sandra
2012-01-01
British painter Francis Bacon (1909-1992) was known for the eloquence with which he talked about his art. He was easy to talk to, and was interviewed countless times by numerous critics. However, when studying Bacon's paintings one soon comes across the published interviews with art critic and curator David Sylvester (1924-2001), who interviewed him as many as 18 times between 1962 and 1986. Art historian Sandra Kisters argues that Sylvester's interviews with Bacon are carefully constructed a...
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
Unusual hydrogen bonding patterns in AF [aminofluorene] and AAF [acetylaminofluorene] modified DNA
International Nuclear Information System (INIS)
Broyde, S.; Hingerty, B.E.; Shapiro, R.; Norman, D.; Oak Ridge National Lab., TN; New York Univ., NY; Columbia Univ., New York, NY
1989-01-01
New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs
Chawla, Mohit; Poater, Albert; Besalu-Sala, Pau; Kalra, Kanav; Oliva, Romina; Cavallo, Luigi
2018-01-01
of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared
DEFF Research Database (Denmark)
Geny, Sylvain; Moreno, Pedro M D; Krzywkowski, Tomasz
2016-01-01
Targeting and invading double-stranded DNA with synthetic oligonucleotides under physiological conditions remain a challenge. Bis-locked nucleic acids (bisLNAs) are clamp-forming oligonucleotides able to invade into supercoiled DNA via combined Hoogsteen and Watson-Crick binding. To improve the b...
Circular dichroism as a means to follow DNA gymnastics: on the shoulders of giants
Directory of Open Access Journals (Sweden)
H.H. Klump
2010-01-01
Full Text Available This is the first report of DNA stem-loops self-assembled by ‘foot-loop’ interactions into either two-dimensional strings or three-dimensional spirals, distinguished by circular dichroism spectroscopy. All subunits are linked by cooperative Watson-Crick hydrogen bonds.
Hamlin, Trevor A.; Poater, Jordi; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias
2017-01-01
We have computationally analyzed a comprehensive series of Watson-Crick and mismatched B-DNA base pairs, in the gas phase and in several solvents, including toluene, chloroform, ammonia, methanol and water, using dispersion-corrected density functional theory and implicit solvation. Our analyses
Macromolecules Vis-a-Vis the Traditions of Chemistry
Flory, Paul J.
1973-01-01
Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…
Synthesis and Structural Characterization of 2'-Fluoro-α-L-RNA-Modified Oligonucleotides
DEFF Research Database (Denmark)
Bundgaard Jensen, Troels; Pasternak, Anna; Stahl Madsen, Andreas
2011-01-01
with the smallest destabilization towards RNA. Thermodynamic data show that the duplex formation with 2'-fluoro-α-L-RNA nucleotides is enthalpically disfavored but entropically favored. 2'-Fluoro-α-L-RNA nucleotides exhibit very good base pairing specificity following Watson-Crick rules. The 2'-fluoro......-α-L-RNA monomer was designed as a monocyclic mimic of the bicyclic α-L-LNA, and molecular modeling showed that this indeed is the case as the 2'-fluoro monomer adopts a C3'-endo/C2'-exo sugar pucker. Molecular modeling of modified duplexes show that the 2'-fluoro-α-L-RNA nucleotides partake in Watson-Crick base......We describe the synthesis and binding properties of oligonucleotides that contain one or more 2'-fluoro-α-L-RNA thymine monomer(s). Incorporation of 2'-fluoro-α-L-RNA thymine into oligodeoxynucleotides decreased thermal binding stability slightly upon hybridization with complementary DNA and RNA...
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences; Volume 41; Issue 2. Toward the 'new century' of handedness in biology: In commemoration of the 100th anniversary of the birth of Francis Crick. Koji Tamura. Clipboard Volume 41 Issue 2 June 2016 pp 169-170 ...
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
Rilling, M
2000-01-01
Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.
Verdade e método em Francis Bacon
Secco, Márcio
2004-01-01
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Filosofia e Ciências Humanas. Programa de Pós-Graduação em Filosofia. Estudo sobre o método e o conceito de verdade defendido por Francis Bacon, sendo nossos principais objetivos nesse trabalho: a) esclarecer algumas questões relativas ao método baconiano, principalmente no que se refere ao uso de hipóteses; b) apresentar uma interpretação falibilista da teoria de Francis Bacon, mostrando que a verdade e a utilidade...
Graham Watson: Eesti vajab enam riigi sekkumist majandusse
Watson, Graham
2009-01-01
18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Development of a 5kw Francis Turbine Runner Using Computation ...
African Journals Online (AJOL)
A small scale Francis turbine runner for a turbine located at Awba dam in the University of Ibadan with designed head and flow rate of 6m and 0.244m3/s is designed. The basic design of the Francis turbine runner is completed based on basic fluid dynamics turbo machinery principles. A 2-D and 3-D steady state, ...
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
Did John B. Watson Really "Found" Behaviorism?
Malone, John C
2014-05-01
Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
LNA-antisense rivals siRNA for gene silencing
DEFF Research Database (Denmark)
Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan
2004-01-01
Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...
Genetic, epigenetic and exogenetic information in development and evolution.
Griffiths, Paul E
2017-10-06
The idea that development is the expression of information accumulated during evolution and that heredity is the transmission of this information is surprisingly hard to cash out in strict, scientific terms. This paper seeks to do so using the sense of information introduced by Francis Crick in his sequence hypothesis and central dogma of molecular biology. It focuses on Crick's idea of precise determination. This is analysed using an information-theoretic measure of causal specificity. This allows us to reconstruct some of Crick's claims about information in transcription and translation. Crick's approach to information has natural extensions to non-coding regions of DNA, to epigenetic marks, and to the genetic or environmental upstream causes of those epigenetic marks. Epigenetic information cannot be reduced to genetic information. The existence of biological information in epigenetic and exogenetic factors is relevant to evolution as well as to development.
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
DEFF Research Database (Denmark)
Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.
2008-01-01
to ortho in homopyrimidine TINAs. Thus, for para-TINAs the bulge insertion of an intercalator led to high thermal stability of Hoogsteen-type parallel triplexes and duplexes, whereas Watson-Cricktype duplexes were destabilized. In the case of ortho-TINA, both Hoogsteen and Watson-Crick-type complexes were......A postsynthetic, on-column Sonogashira reaction was applied on DNA molecules modified by 2- or 4-iodophenylmethylglycerol in the middle of the sequence, to give the corresponding ortho- and para-twisted intercalating nucleic acids (TINA) with 1-, 2-, and 4-ethynylpyrene residues. The convenient...
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
A history of the term radical behaviorism: From Watson to Skinner
Schneider, Susan M.; Morris, Edward K.
1987-01-01
This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958
The great war correspondent: Francis McCullagh, 1874–1956
Horgan, John
2009-01-01
Trotsky of Russia knows Francis McCullagh. So does President Calles of Mexico. Peter, the King of Serbia, was McCullagh’s friend. The headhunters of the upper Amazon list Francis McCullagh as one of their principal deities. The warring tribes of Morocco call him blood brother. A room is always ready for him in the imperial palace of Siam. The latchstrings of hundreds of Siberian peasant huts are out in anticipation of his coming.
Watson's theorem and resonant pion photoproduction amplitude in the delta channel
International Nuclear Information System (INIS)
Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.
1984-01-01
The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)
Substituent Effects on Hydrogen Bonds in DNA : A Kohn-Sham DFT Approach
Guerra, Célia Fonseca; Bickelhaupt, F. Matthias
2006-01-01
In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing
Francis Bacon and the Technology of Style.
Baker, Christopher
1983-01-01
Examines Francis Bacon's intentionally devised style for scientific writings and the theoretical basis of that style. Discusses his emphasis on a truly objective point of view, and his use of aphorisms to adapt to his audience. (HTH)
Watson's behaviorism: a comparison of the two editions (1925 and 1930).
Carpintero, Helio
2004-05-01
J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.
Francis Goyat kuuleb pühapäeval
2003-01-01
Belgia kitarristist Francis Goyast, kontsertidest Pärnu kontserdimajas 19. nov., Tartus Vanemuise kontserdimajas 21.nov ja Tallinnas Estonia kontserdisaalis 23. nov., heliplaadist "Pleased to meet You, Mr. Valgre"
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. Graeme Mitchison. Articles written in Journal of Genetics. Volume 83 Issue 2 August 2004 pp 221-221 Obituary. Francis Crick (1916–2004) · Graeme Mitchison · More Details Fulltext PDF. Journal of Genetics. Current Issue : Vol. 97, Issue 1. Current Issue Volume 97 | Issue 1
State of the art in numerical simulation of high head Francis turbines
Directory of Open Access Journals (Sweden)
Trivedi Chirag
2016-01-01
Full Text Available The Francis-99 test case consists in a high head Francis turbine model, which geometry together with meshes and detailed experimental measurements is freely available at www.francis-99.org. Three workshops were initially planned to exchange experience on numerical investigations of the test case concerning steady state operating conditions, transient operating conditions and fluid structure analysis. The first workshop was held in Trondheim, Norway in December 2014. Some results of the 14 contributions are presented. They are concerned with the influence of the near wall space discretization and turbulence modelling in order to capture hydraulic efficiency, torque, pressure and velocity with a good uncertainty at three operating conditions.
Engaging with Molecular Form to Understand Function
Barber, Nicola C.; Stark, Louisa A.
2014-01-01
Cells are bustling factories with diverse and prolific arrays of molecular machinery. Remarkably, this machinery self-organizes to carry out the complex biochemical activities characteristic of life. When Watson and Crick published the structure of DNA, they noted that DNA base pairing creates a double-stranded form that provides a means of…
Molecular Structure of Nucleic Acids
Indian Academy of Sciences (India)
Molecular Structure of Nucleic Acids. A Structure for Deoxyribose Nucleic Acid. J. D. Watson and F. H. C. Crick. Medical Research Council Unit for the Study of the Molecular Structure of Biological. Systems, Cavendish Laboratory, Cambridge. April 2. We wish to suggest a structure for the salt of deoxyribose nucleic acid ...
Multiparent intercross populations in analysis of quantitative traits
Indian Academy of Sciences (India)
2012-04-17
Apr 17, 2012 ... Discovery of DNA structure by Watson and Crick (1953), and subsequent ... tified 11 QTL for seed dormancy in Arabidopsis by simul- taneously analysing six ..... for seed dormancy in Arabidopsis is regulated by additive genetic and .... Sax K. 1923 Association of size differences with seed–coat pat- tern and ...
Gao, J.; Berden, G.; Rodgers, M.T.; Oomens, J.
2016-01-01
The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
Francis Bacon and Jacobean legitimation
Rodríguez García, José María
1997-01-01
Francis Bacon (1561-1626) maintained a lifelong interest in the institutional implementation of experimental science. What changed over the years were the rhetorical strategies employed to give this project legitimacy. I systematize those changes by dividing Bacon's works into three groups according to three criteria: what rite of officialization is enacted in each text (e.g., conversion, fatherly generation, royal delegation); who the inscribed addressee is (e.g., an imagin...
A conversation with Geoff Watson
Beran, R. J.; Fisher, N. I.
1998-01-01
Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...
Chapter 24: the coming of molecular biology and its impact on clinical neurology.
Smith, Christopher U M
2010-01-01
Although the chemical study of the nervous system dates back well into the 19th century, molecular biology and especially molecular neurobiology only began to be established in the second half of the 20th century. This chapter reviews their impact on clinical neuroscience during the 50 years since Watson and Crick published their seminal paper. After a short review of the part played by F.O. Schmitt in establishing molecular neuroscience the chapter outlines work that led to a detailed understanding of the biochemical structure and function of nerve cell membranes and their embedded channel proteins, receptors, and other molecules. The chapter then turns to the numerous pathologies that result from disorders of these elements: the various channel and gap-junction pathologies. The chapter continues with a discussion of some of the diseases caused by defective DNA, especially the trinucleotide repeat expansion diseases (TREDs) and ends with a short account of the development of molecular approaches to prion diseases, myasthenia gravis, and the neurodegenerative diseases of old age. Francis Bacon said long ago that "knowledge is power." The hope is that increasing molecular knowledge will help cure some of the human suffering seen in the neurological ward and clinic.
Grigoriadis, Dimitri E; Hoare, Samuel R J; Lechner, Sandra M; Slee, Deborah H; Williams, John A
2009-01-01
Beginning with the discovery of the structure of deoxyribose nucleic acid in 1953, by James Watson and Francis Crick, the sequencing of the entire human genome some 50 years later, has begun to quantify the classes and types of proteins that may have relevance to human disease with the promise of rapidly identifying compounds that can modulate these proteins so as to have a beneficial and therapeutic outcome. This so called 'drugable space' involves a variety of membrane-bound proteins including the superfamily of G-protein-coupled receptors (GPCRs), ion channels, and transporters among others. The recent number of novel therapeutics targeting membrane-bound extracellular proteins that have reached the market in the past 20 years however pales in magnitude when compared, during the same timeframe, to the advancements made in the technologies available to aid in the discovery of these novel therapeutics. This review will consider select examples of extracellular drugable targets and focus on the GPCRs and ion channels highlighting the corticotropin releasing factor (CRF) type 1 and gamma-aminobutyric acid receptors, and the Ca(V)2.2 voltage-gated ion channel. These examples will elaborate current technological advancements in drug discovery and provide a prospective framework for future drug development.
HGSA DNA day essay contest winner 60 years on: still coding for cutting-edge science.
Yates, Patrick
2013-08-01
MESSAGE FROM THE EDUCATION COMMITTEE: In 2013, the Education Committee of the Human Genetics Society of Australasia (HGSA) established the DNA Day Essay Contest in Australia and New Zealand. The contest was first established by the American Society of Human Genetics in 2005 and the HGSA DNA Day Essay Contest is adapted from this contest via a collaborative partnership. The aim of the contest is to engage high school students with important concepts in genetics through literature research and reflection. As 2013 marks the 60th anniversary of the discovery of the double helix of DNA by James Watson and Francis Crick and the 10th anniversary of the first sequencing of the human genome, the essay topic was to choose either of these breakthroughs and explain its broader impact on biotechnology, human health and disease, or our understanding of basic genetics, such as genetic variation or gene expression. The contest attracted 87 entrants in 2013, with the winning essay authored by Patrick Yates, a Year 12 student from Melbourne High School. Further details about the contest including the names and schools of the other finalists can be found at http://www.hgsa-essay.net.au/. The Education Committee would like to thank all the 2013 applicants and encourage students to enter in 2014.
Structural Properties of G,T-Parallel Duplexes
Directory of Open Access Journals (Sweden)
Anna Aviñó
2010-01-01
Full Text Available The structure of G,T-parallel-stranded duplexes of DNA carrying similar amounts of adenine and guanine residues is studied by means of molecular dynamics (MD simulations and UV- and CD spectroscopies. In addition the impact of the substitution of adenine by 8-aminoadenine and guanine by 8-aminoguanine is analyzed. The presence of 8-aminoadenine and 8-aminoguanine stabilizes the parallel duplex structure. Binding of these oligonucleotides to their target polypyrimidine sequences to form the corresponding G,T-parallel triplex was not observed. Instead, when unmodified parallel-stranded duplexes were mixed with their polypyrimidine target, an interstrand Watson-Crick duplex was formed. As predicted by theoretical calculations parallel-stranded duplexes carrying 8-aminopurines did not bind to their target. The preference for the parallel-duplex over the Watson-Crick antiparallel duplex is attributed to the strong stabilization of the parallel duplex produced by the 8-aminopurines. Theoretical studies show that the isomorphism of the triads is crucial for the stability of the parallel triplex.
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Michel Morange. Articles written in Journal of Biosciences. Volume 29 Issue 4 December 2004 pp 378-380. Commentary: The death of Francis Crick: the end of a golden age in biology · Michel Morange · More Details Fulltext PDF. Volume 30 Issue 3 June 2005 pp 313-316 Series.
Resonance – Journal of Science Education | Indian Academy of ...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 9; Issue 11. Francis Crick (1916-2004). S Mahadevan. Article-in-a-Box Volume 9 Issue 11 November 2004 pp 3-7. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/009/11/0003-0007. Author Affiliations.
Elementary? Question Answering, IBM's Watson, and the Jeopardy ...
Indian Academy of Sciences (India)
IAS Admin
One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...
Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen
2015-10-29
Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.
DNA Mapping Made Simple: An Intellectual Activity about the Genetic Modification of Organisms
Marques, Miguel; Arrabaca, Joao; Chagas, Isabel
2004-01-01
Since the discovery of the DNA double helix (in 1953 by Watson and Crick), technologies have been developed that allow scientists to manipulate the genome of bacteria to produce human hormones, as well as the genome of crop plants to achieve high yield and enhanced flavor. The universality of the genetic code has allowed DNA isolated from a…
Relativistic generalisation of the Kroll-Watson formula
International Nuclear Information System (INIS)
Kaminski, J.Z.
1985-01-01
The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)
The Search for Symmetries in the Genetic Code:
Antoneli, Fernando; Forger, Michael; Hornos, José Eduardo M.
We give a full classification of the possible schemes for obtaining the distribution of multiplets observed in the standard genetic code by symmetry breaking in the context of finite groups, based on an extended notion of partial symmetry breaking that incorporates the intuitive idea of "freezing" first proposed by Francis Crick, which is given a precise mathematical meaning.
International Nuclear Information System (INIS)
Fargher, H.E.; Roberts, M.J.
1983-01-01
Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)
Francis Bacon: “pintar sensações” (Francis Bacon: “to paint sensations”)
Borges, Sonia; UVA
2013-01-01
RESUMO O texto aborda, pela via da psicanálise, o que consideramos como o “método” de Francis Bacon: “pintar sensações”. Para isto, tomo, como referências principais, a Carta 52 (1896), da correspondência de Freud com Fliess, e Em busca do tempo perdido, romance de Marcel Proust ([1922] 1995), observando a possibilidade de considerar o que Proust nomeia como “memória involuntária” e o seu papel no processo criativo como uma ilustração esclarecedora do que Freud nos traz na Carta sobre a estr...
Francis Bacon: The Real's Brutality. The Figure and the Other
Directory of Open Access Journals (Sweden)
Guido Mannucci
2014-03-01
Full Text Available Getting in front of painting by Francis Bacon touches you deeply. I’m talking about aesthetics, sensations: resounding flow that strikes abruptly, making futile any search for meaning. Francis Bacon circumvents the figurative, the meaning, he aims to the figural: to feelings, not words. Beauty, in his paintings, shows itself in the peaceful union of the positive and of its contrary; if the negative wasn’t there, though, his paintings wouldn’t exude such a brutal sense of reality. This essay investigates the figure of Francis Bacon and the spectator – the Other – as he tries to confront the painting. Bacon will be analysed using a purely phenomenological approach, with references that range from Merleau-Ponty to Martin Heidegger; the meeting-collision between the spectator and the painting, instead, will be examined taking inspiration from the Winnicott’s thesis on the relationship between Bacon and mirrors in the painter’s childhood. In order to take distance from Winnicott’s psychoanalytical approach, this essay will focus on the relationship between spectator and painting from a more anthropological point of view.
Poetic and Francis Bacon's Ambivalence toward Language.
Pribble, Paula Tompkins
Just as rhetoric is a way of knowing, so is poetic, both of which, for Francis Bacon, produce false knowledge. But Bacon is not entirely negative. When the poetic elements of language are used in strategic and public communication, like the scholarly communication Bacon attempts to reform, poetic and rhetoric work together to create a plurality of…
Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
International Nuclear Information System (INIS)
Catalan, G.; Roberts, M.J.
1979-01-01
A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)
Nuclear histochemistry: Its history in fifty volumes
Directory of Open Access Journals (Sweden)
M.G. Manfredi Romanini
2014-01-01
Full Text Available The fiftieth anniversary of the double helix was marked two years ago. The elucidation of the structure of DNA by Watson and Crick can rightfully be considered to be "the" milestone in modern biology because it has conditioned the explosive growth in our understanding of the molecular mechanisms regulating the structural and functional organization of single cells and multicellular organisms....
A proposal for re-defining the way the aetiology of schizophrenia ...
Indian Academy of Sciences (India)
2010-02-03
Feb 3, 2010 ... ``The two big problems – the nature of development and the nature of the mind – are being subdued. I don't know whether there will be beautiful, general theories to come out of this – something really nice like Watson and Crick's double helix – or whether there will be an accumulation of more and more ...
O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante
Directory of Open Access Journals (Sweden)
Cláudio Ivan de Oliveira
Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.
Francis Bacon and the Historiography of Scientific Rhetoric.
Zappen, James P.
1989-01-01
Reviews three twentieth-century interpretations of Francis Bacon's science and rhetoric: positivistic science and the plain style; institutionalized science and its more highly figured style; and democratic science. Presents the author's own interpretation, and concludes that each interpretation reflects different perceptions of the good of the…
A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3
International Nuclear Information System (INIS)
Roberts, M.J.
1988-01-01
Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)
Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System
Fengjiao Wu; Junling Ding; Zhengzhong Wang
2016-01-01
The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the d...
Power Swing Generated in Francis Turbines by Part Load and Overload Instabilities
Directory of Open Access Journals (Sweden)
David Valentín
2017-12-01
Full Text Available Hydropower plays a key role in the actual energy market due to its fast response and regulation capacity. In that way, hydraulic turbines are increasingly demanded to work at off-design conditions, where complex flow patterns and cavitation appear, especially in Francis turbines. The draft tube cavitation surge is a hydraulic phenomenon that appears in Francis turbines below and above its Best Efficiency Point (BEP. It is a low frequency phenomenon consisting of a vortex rope in the runner outlet and draft tube, which can become unstable when its frequency coincides with a natural frequency of the hydraulic circuit. At this situation, the output power can significantly swing, endangering the electrical grid stability. This study is focused on the detection of these instabilities in Francis turbines and their relationship with the output power swings. To do so, extensive experimental tests for different operating conditions have been carried out in a large prototype Francis turbine (444 MW of rated power within the frame of the European Project Hyperbole (FP7-ENERGY-2013-1. Several sensors have been installed in the hydraulic circuit (pressure sensors in the draft tube, spiral casing, and penstock, in the rotating and static structures (vibration sensors, proximity probes, and strain gauges in the runner and in the shaft, as well as in the electrical side (output power, intensity, and voltage. Moreover, a numerical Finite Element Method (FEM has been also used to relate the hydraulic excitation with the output power swing.
The Game is aFoot, Watson: DeepQA systems and the future of HCI
Keates, Simeon; Varker, Philip
2012-01-01
In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...
Directory of Open Access Journals (Sweden)
Patrick Lumbroso
2016-09-01
Full Text Available The Katz-Francis Scale of Attitude toward Judaism was developed initially to extend among the Hebrew-speaking Jewish community in Israel a growing body of international research concerned to map the correlates, antecedents and consequences of individual differences in attitude toward religion as assessed by the Francis Scale of Attitude toward Christianity. The present paper explored the internal consistency reliability and construct validity of the English translation of the Katz-Francis Scale of Attitude toward Judaism among 101 Australian Jews. On the basis of these data, this instrument is commended for application in further research.
Meijer, Rob R.
I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..
Dynamic basis for dG•dT misincorporation via tautomerization and ionization
Kimsey, Isaac J.; Szymanski, Eric S.; Zahurancik, Walter J.; Shakya, Anisha; Xue, Yi; Chu, Chia-Chieh; Sathyamoorthy, Bharathwaj; Suo, Zucai; Al-Hashimi, Hashim M.
2018-02-01
Tautomeric and anionic Watson-Crick-like mismatches have important roles in replication and translation errors through mechanisms that are not fully understood. Here, using NMR relaxation dispersion, we resolve a sequence-dependent kinetic network connecting G•T/U wobbles with three distinct Watson-Crick mismatches: two rapidly exchanging tautomeric species (Genol•T/UG•Tenol/Uenol population less than 0.4%) and one anionic species (G•T-/U- population around 0.001% at neutral pH). The sequence-dependent tautomerization or ionization step was inserted into a minimal kinetic mechanism for correct incorporation during replication after the initial binding of the nucleotide, leading to accurate predictions of the probability of dG•dT misincorporation across different polymerases and pH conditions and for a chemically modified nucleotide, and providing mechanisms for sequence-dependent misincorporation. Our results indicate that the energetic penalty for tautomerization and/or ionization accounts for an approximately 10-2 to 10-3-fold discrimination against misincorporation, which proceeds primarily via tautomeric dGenol•dT and dG•dTenol, with contributions from anionic dG•dT- dominant at pH 8.4 and above or for some mutagenic nucleotides.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
Historical review: another 50th anniversary--new periodicities in coiled coils.
Gruber, Markus; Lupas, Andrei N
2003-12-01
In 1953, Francis Crick and Linus Pauling both proposed models of supercoiled alpha helices ('coiled coils') for the structure of keratin. These were the first attempts at modelling the tertiary structure of a protein. Crick emphasized the packing mode of the side-chains ('knobs-into-holes'), which required a periodicity of seven residues over two helical turns (7/2) and a supercoil in the opposite sense of the constituent helices. By contrast, Pauling envisaged a broader set of periodicities (4/1, 7/2, 18/5, 15/4, 11/3) and supercoils of both senses. Crick's model became canonical and the 'heptad repeat' essentially synonymous with coiled coils, but 50 years later new crystal structures and protein sequences show that the less common periodicities envisaged by Pauling also occur in coiled coils, adding a variant packing mode ('knobs-to-knobs') to the standard model. Pauling's laboratory notebooks suggest that he searched unsuccessfully for this packing mode in 1953.
Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer
2013-09-01
reads were then processed to determine the dinucleotide composition on the 5’ end by separating the Watson and Crick strands, and the dinucleotide...AD_________________ Award Number: W81XWH-12-1-0333 TITLE: Determining the Location of DNA ...COVERED 15 August 2012 – 14 August 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Determining the Location of DNA Modification and Mutation Caused
Massively Parallel Nanostructure Assembly Strategies for Sensing and Information Technology. Phase 2
2013-05-25
Mirkin In order to remove the nanoparticle thin-film superlattices from the saline environment necessary to preserve Watson - Crick base-pairing and...polypyrroles and motor proteins. Functionalizing carbon nanotube bridged wires with biological receptors allowed fabrication of biosensors that could detect DNA ...the application of electrical stimuli. From an assembly perspective, we report on two major advances: (1) the utilization of DNA -mediated assembly to
Watson, Skinner y Algunas Disputas dentro del Conductismo
Directory of Open Access Journals (Sweden)
RICARDO PELLÓN SUÁREZ DE PUGA
2013-01-01
Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Design of large Francis turbine using optimal methods
Flores, E.; Bornard, L.; Tomas, L.; Liu, J.; Couston, M.
2012-11-01
Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China -32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.
Design of large Francis turbine using optimal methods
International Nuclear Information System (INIS)
Flores, E; Bornard, L; Tomas, L; Couston, M; Liu, J
2012-01-01
Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China −32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
Moving beyond Watson-Crick models of coarse grained DNA dynamics.
Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D
2011-11-28
DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.
Campo-Arias, Adalberto; Oviedo, Heidi Celina; Cogollo, Zuleima
2009-04-01
The short form of the Francis Scale of Attitude Toward Christianity (L. J. Francis, 1992) is a 7-item Likert-type scale that shows high homogeneity among adolescents. The psychometric performance of a shorter version of this scale has not been explored. The authors aimed to determine the internal consistency of a 5-item form of the Francis Scale of Attitude Toward Christianity among 405 students from a school in Cartagena, Colombia. The authors computed the Cronbach's alpha coefficient for the 5 items with a greater corrected item-total punctuation correlation. The version without Items 2 and 7 showed internal consistency of .87. The 5-item version of the Francis Scale of Attitude Toward Christianity exhibited higher internal consistency than did the 7-item version. Future researchers should corroborate this finding.
The Central Dogma of Molecular Biology
Indian Academy of Sciences (India)
Srimath
Since that tim e,m any disciplines have m im icked ... of religion, he considered dogm as sim ply as bold hy- p oth eses ... Form any students,now fam iliarw ith the C entralD ogm a since their ..... m olecules,R N A s and proteins,existed initially,and D N A .... B J Strasser, A world in one dimension: Linus Pauling, Francis Crick.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-01-01
Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.
Gobind Khorana, H.
1997-12-01
Leslie Orgel and Francis Crick with Gobind Khorana in Madison, Wisconsin (December 1965). I first met Leslie at the Endicott House (MIT) in February 1964. Leslie was then spending a period of time at MIT and the occasion was a party for him. During our conversation, Leslie talked about starting some experimental work. He seemed to be particularly interested in polyphosphates and the chemical activation of small molecules (building blocks). Shortly after his move to the Salk Institute in the Fall of 1964 I visited him in January 1965. He already had a lab going. I remember meeting Jim Ferris, in particular, and John Sulston sometime later. That particular time was exciting for my research as well. We had the first results on the Genetic Code using the chemical-biochemical approach that my lab had developed. Francis Crick was also at the Salk Institute during the time of my visit. Both Leslie and Francis were very excited by my results and they began to ask a lot of questions and gave me a whole lot of suggestions about further experiments. In fact, my thinking and planning of things that we were doing were so scrutinized and clarified during these discussions that, it seemed to me, my own group had only to turn out all the experiments that were needed. These interactions with Francis and Leslie continued intensively throughout that year and later. In fact, both Leslie and Francis accepted my invitation to Madison in December 1965 for more discussions. Since those early days of the Salk Institute, I have made numerous visits over the years to Leslie and his research group. It has always been very exciting to learn about the many discoveries bearing on chemical evolution that have unfolded from Leslie's research group. In addition, I have always benefitted from the insightful comments that Leslie invariably provided on my own research. I look forward to our continued interactions and friendship in the future. Leslie, A Happy Birthday!
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
Directory of Open Access Journals (Sweden)
Katy Shaw
2016-04-01
Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.
Francis Bacon, un moderne intempestif
Mavrakis, Annie
2017-01-01
À propos de la peinture de Francis Bacon et en prenant appui sur des réflexions de Michel Leiris, cet article se propose de revenir sur la question de la modernité conçue non de façon absolue (LA modernité, non figurative, anti-littéraire) mais relative, dégagée d’une vision historiciste orientée de l’histoire de l’art. Cette modernité est intempestive puisque, s’opposant au classique (cf. La Querelle des Anciens et des Modernes) et non au périmé, elle fait revivre les grandes problématiques ...
Watson: A new link in the IIE iron chain
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
The role of biotechnology in the socio-economic advancement and ...
African Journals Online (AJOL)
Biotechnology is any technique which involves the application of biological organisms or their components, systems or processes to manufacturing and service industries to make or modify products, to improve plants or animals or to develop micro-organisms for special uses. Since 1953, when James Watson and Francis ...
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
2013-01-01
devices; however, DNA is not the only polymer that can take advantage of the specicity of the Watson – Crick base-pair to achieve these goals. Central to...14. ABSTRACT 16. SECURITY CLASSIFICATION OF: New nanoscale hetero-oligonucleotide tiles are assembled from DNA , RNA and morpholino oligos and...purified using size exclusion filtration. Homo-oligonucleotide tiles assembled from RP-cartridge processed DNA oligos are purified by nondenaturing gel
Directory of Open Access Journals (Sweden)
Vikash Bhardwaj
2015-07-01
Full Text Available Worldwide, there is an issue of irreproducibility in life science research. In the USA alone $28 billion per year spent on preclinical research is not reproducible. Within this opinion article, I provide a brief historical account of the discovery of the Watson-Crick DNA model and introduce another neglected model of DNA. This negligence may be one of the fundamental reasons behind irreproducibility in molecular biology research.
2010-12-23
... [Docket No. PRM-70-9; NRC-2010-0372] Francis Slakey on Behalf of the American Physical Society; Receipt of... the NRC by Francis Slakey on behalf of the American Physical Society (APS). The petition was docketed... that over the next few years, the NRC would be reviewing license applications for new technologies, and...
Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland
DEFF Research Database (Denmark)
Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.
2013-01-01
For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...
Effects of draft tube on the hydraulic performance of a Francis turbine
International Nuclear Information System (INIS)
Jeon, J H; Byeon, S S; Kim, Y J
2013-01-01
The draft tube is an important component of a Francis turbine which influences the hydraulic performance. It is located just under the runner and allowed to decelerate the flow velocity exiting the runner, thereby converting the excess of kinetic energy into static pressure. In this study, we have numerically investigated the hydraulic performance of a Francis turbine on the 15MW hydropower generation with various design parameters (three types of draft tube, thickness of guide vane) through a three-dimensional numerical method with the SST turbulent model. The vortex rope characteristics of the draft tube were confirmed. The results of the vortex flow fields and flow characteristics were graphically depicted with different design parameters and operating conditions
High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds
Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.
2003-01-01
We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985
Failure analysis of a Francis turbine runner
Energy Technology Data Exchange (ETDEWEB)
Frunzaverde, D; Campian, V [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta Traian Vuia 1-4, RO-320085, Resita (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Marginean, G [University of Applied Sciences Gelsenkirchen, Neidenburger Str. 10, 45877 Gelsenkirchen (Germany); Marsavina, L [Department of Strength, ' Politehnica' University of Timisoara, Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Terzi, R; Serban, V, E-mail: gabriela.marginean@fh-gelsenkirchen.d, E-mail: d.frunzaverde@uem.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A., Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)
2010-08-15
The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.
Failure analysis of a Francis turbine runner
International Nuclear Information System (INIS)
Frunzaverde, D; Campian, V; Muntean, S; Marginean, G; Marsavina, L; Terzi, R; Serban, V
2010-01-01
The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.
Numerical Study of a High Head Francis Turbine with Measurements from the Francis-99 Project
International Nuclear Information System (INIS)
Wallimann, H; Neubauer, R
2015-01-01
For the Francis-99 project initiated by the Norwegian University of Science and Technology (NTNU, Norway) and the Luleå University of Technology (LTU, Sweden) numerical flow simulation has been performed and the results compared to experimentally obtained data. The full machine including spiral casing, stay vanes, guide vanes, runner and draft tube was simulated transient for three operating points defined by the Francis-99 organisers. Two sets of results were created with differing time steps. Additionally, a reduced domain was simulated in a stationary manner to create a complete cut along constant prototype head and constant prototype discharge. The efficiency values and shape of the curves have been investigated and compared to the experimental data. Special attention has been given to rotor stator interaction (RSI). Signals from several probes and their counterpart in the simulation have been processed to evaluate the pressure fluctuations occurring due to the RSI. The direct comparison of the hydraulic efficiency obtained by the full machine simulation compared to the experimental data showed no improvement when using a 1° time step compared to a coarser 2° time step. At the BEP the 2° time step even showed a slightly better result with an absolute deviation 1.08% compared with 1.24% for the 1° time step. At the other two operating points the simulation results were practically identical but fell short of predicting the measured values. The RSI evaluation was done using the results of the 2° time step simulation, which proved to be an adequate setting to reproduce pressure signals with peaks at the correct frequencies. The simulation results showed the highest amplitudes in the vaneless space at the BEP operating point at a location different from the probe measurements available. This implies that not only the radial distance, but the shape of the vaneless space influences the RSI
A bouquet of DNA structures: Emerging diversity.
Kaushik, Mahima; Kaushik, Shikha; Roy, Kapil; Singh, Anju; Mahendru, Swati; Kumar, Mohan; Chaudhary, Swati; Ahmed, Saami; Kukreti, Shrikant
2016-03-01
Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson-Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.
Directory of Open Access Journals (Sweden)
Kai Hoehlig
Full Text Available A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications.
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Homage to Francis Perrin - 1901-1992
International Nuclear Information System (INIS)
1994-05-01
Francis Perrin had a brilliant and rapid career. He was a strict and honest man. He had a fast intelligence, a huge knowledge, he was faithful. Finally his courtesy and his generosity had made of him an outstanding and model personality very little known because of his extreme discretion. He lived his professional career (1920-1970) with passion. He thought that science might be one mankind heritage. He worked in CEA and played a crucial role in the CERN creation. He was an accomplished scientist since he tackled the mathematics, physics, and even chemistry scope. 52 refs
The calculation of fluid-structure interaction and fatigue analysis for Francis turbine runner
International Nuclear Information System (INIS)
Wang, X F; Li, H L; Zhu, F W
2012-01-01
Francis turbine, as a widely used hydro turbine, is especially suited for the hydropower station with high hydraulic head and higher hydraulic head. For such turbine generator units all around the world, the crack streaks usually come out after a long time use and the resulted accidents may cause huge losses. Hence, it is meaningful to refine the design assuring the stability and safety of the Francis turbine. In this paper, the stiffness and strength as well as the fatigue life of the Francis turbine are studied. Concerning on the turbine of one certain hydropower station, the flow field inside the turbine are first simulated and the pressure distribution around the blades are derived. Meanwhile, the stress distributions of the blades are also obtained. Based on these, the fatigue analyses are applied on the turbine. According to the results of fatigue analyses, some optimal designs on the turbine are verified. The results show that with the optimal designs, the hydraulic performances of the turbine do not change too much while the maximum stress on the turbine decrease and the fatigue life increase as well.
Efficiency limit factor analysis for the Francis-99 hydraulic turbine
Zeng, Y.; Zhang, L. X.; Guo, J. P.; Guo, Y. K.; Pan, Q. L.; Qian, J.
2017-01-01
The energy loss in hydraulic turbine is the most direct factor that affects the efficiency of the hydraulic turbine. Based on the analysis theory of inner energy loss of hydraulic turbine, combining the measurement data of the Francis-99, this paper calculates characteristic parameters of inner energy loss of the hydraulic turbine, and establishes the calculation model of the hydraulic turbine power. Taken the start-up test conditions given by Francis-99 as case, characteristics of the inner energy of the hydraulic turbine in transient and transformation law are researched. Further, analyzing mechanical friction in hydraulic turbine, we think that main ingredients of mechanical friction loss is the rotation friction loss between rotating runner and water body, and defined as the inner mechanical friction loss. The calculation method of the inner mechanical friction loss is given roughly. Our purpose is that explore and research the method and way increasing transformation efficiency of water flow by means of analysis energy losses in hydraulic turbine.
Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer
2010-09-01
combining the number of Watson - Crick base pairs (+1) with mismatches (-1). Hairpin secondary structures were screened by using the probe sequence to...Annual Report 5 Aim 2. Task 1. To identify DNA sequences that act as promoters in tumors but not in normal tissue (year 1). This step of the...promoters using Nimblegen arrays. Plasmid DNA was extracted from the original promoter library (Library-0), from a sub-library of clones activated in
DNA-Enabled Integrated Molecular Systems for Computation and Sensing
2014-05-21
Computational devices can be chemically conjugated to different strands of DNA that are then self-assembled according to strict Watson − Crick binding rules... DNA -Enabled Integrated Molecular Systems for Computation and Sensing Craig LaBoda,† Heather Duschl,† and Chris L. Dwyer*,†,‡ †Department of...guided folding of DNA , inspired by nature, allows designs to manipulate molecular-scale processes unlike any other material system. Thus, DNA can be
Interaction entre la proteine ribosomique L20 et l'ARN 23S : sondage direct par piege optique
Mangeol , Pierre
2009-01-01
This thesis is focused on force measurements applied to single RNA alone or associated with a protein. One of the biggest challenges arising when studying RNA comes from its structure, essentially because the interactions taking place are not reduced to the Watson-Crick base pairs and tertiary interactions are frequent. Force measurements give complementary information compared to classical bulk measurements, because they enable to probe directly the complex interactions in RNA and give an ac...
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Directory of Open Access Journals (Sweden)
Quintanilla Martínez, Emilio
2012-09-01
Full Text Available Two previously unknown works by the British neoclassical sculptor John Francis dating from the second quarter of the 19th century, representing the 1st Duke of Sutherland and, most likely, the sculptor Sir John Francis, have been located in a Spanish private collection.
Dos obras, hasta ahora inéditas, del escultor neoclásico inglés John Francis del segundo cuarto del siglo XIX, y que representan al primer duque de Sutherland y seguramente al escultor Sir John Francis, en colección privada española.
Impact parameter representation from the Watson-Sommerfeld transform
International Nuclear Information System (INIS)
Islam, M.M.
1976-01-01
Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)
Some Econometric Results for the Blanchard-Watson Bubble Model
DEFF Research Database (Denmark)
Johansen, Soren; Lange, Theis
The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...
LDA measurements in the Francis-99 draft tube cone
International Nuclear Information System (INIS)
Sundstrom, L R J; Amiri, K; Cervantes, M J; Bergan, C; Dahlhaug, O G
2014-01-01
Velocity measurements were performed in the draft tube cone of a 1:5.1 scaled model of the Tokke hydropower plant, Norway; also known as the Francis-99 model. Results from the laser Doppler anemometry measurements undertaken at three operating points will be used as validation data for an upcoming workshop on the state of the art of Francis turbine numerical simulation. With the turbine operating at the best efficiency point, a sensitivity analysis of the flow parameters head, flow rate and runner rotational speed shows that the effects on the dimensionless velocity profiles are small as long as n ED and Q ED are held constant. The results indicate a well-functioning turbine at the best efficiency point and high load. At the part load operating point, a vortex breakdown occurs which distorts the velocity profiles and significantly lowers the turbine's hydraulic efficiency. Frequency spectrums of each LDA signal at part load reveals a peak which is asynchronous to that of the runner angular speed. The peaks might be related to the precession of a rotating vortex rope but the characteristics of the LDA signals are different compared to previous studies involving rotating vortex ropes
"Ajaloo lõpp" on lähedal / Francis Fukuyama ; interv. Adam Piore
Fukuyama, Francis
2003-01-01
Ajakirjas Newsweek ilmunud intervjuus vastab filosoof Francis Fukuyama küsimustele 2004. aasta kõige olulisemate probleemide, EL-i, Cancunis toimunud Maailma Kaubandusorganisatsiooni kõneluste, ajaloo lõppu jõudmise, Pakistani presidendile tehtud atentaadi kohta
Ceballos, Guillermo A.; Suescun, Jesus D.; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto
2015-01-01
The Spanish version of the five-item Francis scale of attitude toward Christianity is a refinement of the short version of the Francis scale of attitude toward Christianity. The scale is a good measurement for intrinsic religiosity. It has been applied previously among Colombian adolescent students. The internal consistency and construct and…
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist
Effect of Guide Vane Clearance Gap on Francis Turbine Performance
Directory of Open Access Journals (Sweden)
Ravi Koirala
2016-04-01
Full Text Available Francis turbine guide vanes have pivoted support with external control mechanism, for conversion of pressure to kinetic energy and to direct them to runner vanes. This movement along the support is dependent on variation of load and flow (operating conditions. Small clearance gaps between facing plates and the upper and lower guide vane tips are available to aid this movement, through which leakage flow occurs. This secondary flow disturbs the main flow stream, resulting performance loss. Additionally, these increased horseshoe vortex, in presence of sand, when crosses through the gaps, both the surfaces are eroded. This causes further serious effect on performance and structural property by increasing gaps. This paper discusses the observation of the severity in hydropower plants and effect of clearance gaps on general performance of the Francis turbine through computational methods. It also relates the primary result with the empirical relation for leakage flow prediction. Additionally, a possible method to computationally estimate thickness depletion has also been presented. With increasing clearance gap, leakage increases, which lowers energy conversion and turbine efficiency along with larger secondary vortex.
Directory of Open Access Journals (Sweden)
Thaís Schossler
2008-01-01
Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.
Bone Marrow Failure Secondary to Cytokinesis Failure
2015-12-01
Kottemann, M.C. and A. Smogorzewska, Fanconi anaemia and the repair of Watson and Crick DNA crosslinks. Nature, 2013. 493(7432): p. 356-63. 5. Sawyer, S.L...BRCA DNA repair pathway and regulate cellular resistance to genotoxic DNA cross- linking agents [3-5]. Disruption of any of the 18 FA genes accounts for... DNA and nuclear membrane Lap2 and analyzed microscopically for the presence of binucleated cells as described previously [6]. The HSC activity was
Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates
2008-06-01
might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed
DNA Based Electrochromic and Photovoltaic Cells
2012-01-01
using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high
Modeling Thermal Inactivation of Bacillus Spores
2009-03-01
information is preserved and replicated by the Watson - Crick base pairing in which 4-3 complementary bases recognize each other. One incorrect amino acid can...hydrolysis reactions to take place with the spore’s DNA and other proteins. These chemical reactions degrade the DNA and proteins to such an extent that the... DNA cannot be repaired or replicated, thus causing spore death. We further assert that damage to a spore is based on a certain initial DNA information
Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the
2006-01-01
Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues? In...
When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.
Malone, John C; García-Penagos, Andrés
2014-07-25
Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.
Sunrayce 97 Continues Day 7 - Smith Center to St. Francis
Manager (202) 586-0713 St. Francis, Kan. -- It was a close race for the top three places on the 7th day of running great. It's a solid car. We may not have the fastest or most efficient vehicle in the race, but we withdraw from the race yesterday due to suspension problems. The team was presented an "Inspector's
Scientific Cousins: The Relationship between Charles Darwin and Francis Galton
Fancher, Raymond E.
2009-01-01
This article traces the personal as well as the intellectual and scientific relationship between Charles Darwin and his younger half-cousin Francis Galton. Although they had been on friendly terms as young men, and Darwin had in some ways been a role model for Galton, the two did not share major scientific interests until after the publication of…
Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System
Directory of Open Access Journals (Sweden)
Fengjiao Wu
2016-01-01
Full Text Available The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the designed controller has good robustness which could resist external random disturbances. Numerical simulations are employed to verify the effectiveness and superiority of the designed finite-time sliding mode control scheme. The approach proposed in this paper is simple and also provides a reference for relevant hydropower systems.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-12-01
Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.
On the extension of the Fermi-Watson Theorem to high energy diffraction
International Nuclear Information System (INIS)
Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati
1995-12-01
The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
"Elementary, my dear Watson". Per una falsa citazione
Directory of Open Access Journals (Sweden)
Irene Minella
2014-12-01
Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
Hydroacoustic simulation of rotor-stator interaction in resonance conditions in Francis pump-turbine
International Nuclear Information System (INIS)
Nicolet, C; Ruchonnet, N; Alligne, S; Avellan, F; Koutnik, J
2010-01-01
Combined effect of rotating pressure field related to runner blade and wakes of wicket gates leads to rotor stator interactions, RSI, in Francis pump-turbines. These interactions induce pressures waves propagating in the entire hydraulic machine. Superposition of those pressure waves may result in standing wave in the spiral casing and rotating diametrical mode in the guide vanes and can cause strong pressure fluctuations and vibrations. This paper presents the modeling, simulation and analysis of Rotor-Stator Interaction of a scale model of a Francis pump-turbine and related test rig using a one-dimensional approach. The hydroacoustic modeling of the Francis pump-turbine takes into account the spiral casing, the 20 guide vanes, the 9 rotating runner vanes. The connection between stationary and rotating parts is ensured by a valve network driven according to the unsteady flow distribution between guide vanes and runner vanes. Time domain simulations are performed for 2 different runner rotational speeds in turbine mode. The simulation results are analyzed in frequency domain and highlights hydroacoustic resonance between RSI excitations and the spiral case. Rotating diametrical mode in the vaneless gap and standing wave in the spiral case are identified. The influence of the resonance on phase and amplitude of pressure fluctuations obtained for both the spiral case and the vaneless gap is analyzed. The mode shape and frequencies are confirmed using eigenvalues analysis.
Directory of Open Access Journals (Sweden)
Shinjiro Sawada
2017-10-01
Full Text Available DNA carries genetic information in its sequence of bases. Synthetic oligonucleotides that can sequence-specifically recognize a target gene sequence are a useful tool for regulating gene expression or detecting target genes. Among the many synthetic oligonucleotides, tail-clamp peptide nucleic acid (TC-PNA offers advantages since it has two homopyrimidine PNA strands connected via a flexible ethylene glycol-type linker that can recognize complementary homopurine sequences via Watson-Crick and Hoogsteen base pairings and form thermally-stable PNA/PNA/DNA triplex structures. Here, we synthesized a series of TC-PNAs that can possess different lengths of azobenzene-containing linkers and studied their binding behaviours to homopurine single-stranded DNA. Introduction of azobenzene at the N-terminus amine of PNA increased the thermal stability of PNA-DNA duplexes. Further extension of the homopyrimidine PNA strand at the N-terminus of PNA-AZO further increased the binding stability of the PNA/DNA/PNA triplex to the target homopurine sequence; however, it induced TC-PNA/DNA/TC-PNA complex formation. Among these TC-PNAs, 9W5H-C4-AZO consisting of nine Watson-Crick bases and five Hoogsteen bases tethered with a beta-alanine conjugated azobenzene linker gave a stable 1:1 TC-PNA/ssDNA complex and exhibited good mismatch recognition. Our design for TC-PNA-AZO can be utilized for detecting homopurine sequences in various genes.
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Noncanonical self-assembly of multifunctional DNA nanoflowers for biomedical applications.
Zhu, Guizhi; Hu, Rong; Zhao, Zilong; Chen, Zhuo; Zhang, Xiaobing; Tan, Weihong
2013-11-06
DNA nanotechnology has been extensively explored to assemble various functional nanostructures for versatile applications. Mediated by Watson-Crick base-pairing, these DNA nanostructures have been conventionally assembled through hybridization of many short DNA building blocks. Here we report the noncanonical self-assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications. These NFs were assembled from long DNA building blocks generated via rolling circle replication (RCR) of a designer template. NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson-Crick base-pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA sequence design. NF sizes were readily tunable in a wide range, by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, or dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieties. All these properties make NFs promising for versatile applications. As a proof-of-principle demonstration, in this study, NFs were integrated with aptamers, bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery.
Francis Farley presenting his novel "Catalysed Fusion" in the CERN Library
Farley, Irina
2013-01-01
"Catalysed Fusion" is described by its author Francis Farley, 92, as a "true-to-life fantasy woven around particle physics" set in 1980s Geneva – "the city where nations meet and particles collide". Farley presented the book in the program "Literature in Focus" on Tuesday 16th April 2013.
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-04-24
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
Reliability of the Francis Scale of Attitude Toward Christianity among 8-yr-olds.
Robbins, Mandy; Francis, Leslie J; Williams, Naomi
2003-02-01
The Francis Scale of Attitude Toward Christianity was completed by 78 8-yr.-olds (40 boys and 38 girls) whose data support reliability measured as the internal consistency of the scale for this young sample.
2011-01-01
On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano. var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');
The association constant of 5',8-cyclo-2'-deoxyguanosine with cytidine
Directory of Open Access Journals (Sweden)
Amedeo eCapobianco
2015-03-01
Full Text Available The association of 5',8-cyclo-2'-deoxyguanosine (cdG, a DNA tandem lesion, with its complementary base cytosine has been studied by voltammetry and NMR in chloroform, using properly silylated derivatives of the two nucleobases for increasing their solubilities. Both voltammetric data and NMR titrations indicated that the Watson-Crick complex of cytidine with cdG is weaker than that with guanosine, the difference being approximately of one order of magnitude between the two association constants.
Xiao, Shou-Jun
2017-01-01
RNA nanoparticles are designed and self-assembled according to noncanonical interactions of naturally conserved RNA motifs and/or canonical Watson-Crick base-pairing interactions, which have potential applications in gene therapy and nanomedicine. These artificially engineered nanoparticles are mainly synthesized from in vitro transcribed RNAs, purified by denaturing and native polyacrylamide gel electrophoresis (PAGE), and characterized with native PAGE, AFM, and TEM technologies. The protocols of in vitro transcription, denaturing and native PAGE, and RNA nanoparticle self-assembly are described in detail.
The Second Christ, Saint Francis of Assisi and ecological consciousness
Directory of Open Access Journals (Sweden)
Hendrik Viviers
2014-01-01
Full Text Available Even though the life stories of Jesus and the so-called second Christ, Francis of Assisi, incline to the fantastical, their value for a modern ecological consciousness is defendable. Behind Francis� personification of nature and his mystical experiences of nature lie an intuitive sense of interconnectedness and interdependence, of being fully part of the natural web of life (confirmed by empirical science. The same is true of the immanence of Jesus. Religious figures like Francis and Jesus can provide a sound moral attitude towards caring for the natural world, but attitudes need to be informed by scientific knowledge to act ecologically correct. A partnership between attitudes and knowledge hopefully contains good news for a sustainable �green� planet.Intradisciplinary and/or�interdisciplinary�implications: Ecological hermeneutics (part of liberation theology or hermeneutics challenges traditional theologies� often anthropocentric bias in the intra-disciplinary arena. It respects the interconnectedness or interdependence of human and non-human life, including the non-organic, empirically substantiated by natural science. This shared realisation allows for a fruitful inter-disciplinary discourse with science to address the global ecological crisis.
Glade/woodland restoration in the St. Francis Mountain Bird Conservation Area
David A. Hasenbeck
2007-01-01
The Missouri Department of Conservation (MDC), the Missouri Department of Natural Resources, the U.S. Forest Service, and American Bird Conservancy, share goals to restore and manage high quality glade, savanna, and woodland habitats within the Saint Francis Bird Conservation Area. The partnership endeavors to maintain and enhance an ecosystem with native glade and...
Cost of enlarged operating zone for an existing Francis runner
Monette, Christine; Marmont, Hugues; Chamberland-Lauzon, Joël; Skagerstrand, Anders; Coutu, André; Carlevi, Jens
2016-11-01
Traditionally, hydro power plants have been operated close to best efficiency point, the more stable operating condition for which they have been designed. However, because of changes in the electricity market, many hydro power plants operators wish to operate their machines differently to fulfil those new market needs. New operating conditions can include whole range operation, many start/stops, extensive low load operation, synchronous condenser mode and power/frequency regulation. Many of these new operating conditions may impose more severe fatigue damage than the traditional base load operation close to best efficiency point. Under these conditions, the fatigue life of the runner may be significantly reduced and reparation or replacement cost might occur sooner than expected. In order to design reliable Francis runners for those new challenging operating scenarios, Andritz Hydro has developed various proprietary tools and design rules. These are used within Andritz Hydro to design mechanically robust Francis runners for the operating scenarios fulfilling customer's specifications. To estimate residual life under different operating scenarios of an existing runner designed years ago for best efficiency base load operation, Andritz Hydro's design rules and tools would necessarily lead to conservative results. While the geometry of a new runner can be modified to fulfil all conservative mechanical design rules, the predicted fatigue life of an existing runner under off-design operating conditions may appear rather short because of the conservative safety factor included in the calculations. The most precise and reliable way to calculate residual life of an existing runner under different operating scenarios is to perform a strain gauge measurement campaign on the runner. This paper presents the runner strain gage measurement campaign of a mid-head Francis turbine over all the operating conditions available during the test, the analysis of the measurement signals
Building Watson: An Overview of the DeepQA Project
Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris
2010-01-01
IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...
Saint Francis Xavier on Jesuit School Stages of the Bohemian Province
Czech Academy of Sciences Publication Activity Database
Bobková, Kateřina; Jacková, Magdaléna
2015-01-01
Roč. 25, č. 2 (2015), s. 135-155 ISSN 0515-3190 R&D Projects: GA ČR GPP406/12/P823 Institutional support: RVO:68378068 ; RVO:67985963 Keywords : St. Francis Xavier * Jesuit saints * Jesuit theatre * neolatin drama * school theatre * Avancini, Nicolaus * Engel, Arnoldus Subject RIV: AJ - Letters, Mass-media, Audiovision; AB - History (HIU-Y)
Francis Bacon's New Science: Rhetoric and the Transformative Power of Print.
Heckel, David
The process of projecting textual models onto the phenomenal world began with the invention of writing and accelerated through the manuscript culture of classical antiquity and the Middle Ages into the age of print. In Francis Bacon's work, the book (a metaphor for the phenomenal world) adapted to the demands of the printed text and reflects the…
DEFF Research Database (Denmark)
Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent
2014-01-01
–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
Francis Bacon and Magnetical Cosmology.
Wang, Xiaona
2016-12-01
A short-lived but important movement in seventeenth-century English natural philosophy—which scholars call “magnetical philosophy” or “magnetical cosmology”—sought to understand gravity (both terrestrial and celestial) by analogy with magnetism. The movement was clearly inspired by William Gilbert’s De magnete (1600) and culminated with Robert Hooke’s prefiguring of the universal principle of gravitation, which he personally communicated to Isaac Newton in 1679. But the magnetical cosmology, as professed by those in the movement, differed from Gilbert’s philosophy in highly significant ways. Proponents never accepted Gilbert’s animistic account of magnets and seem tacitly to have accepted a belief in action at a distance that Gilbert himself rejected. This essay argues that Francis Bacon (1561–1626) had already provided just the adaptations to Gilbert’s philosophy that the later thinkers adopted, including an important endorsement of action at a distance, and that he should be recognized as playing an important role in the movement.
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Crick, F H C; Wyman, Jeffries
2013-05-13
A manuscript on allostery signed by Francis Crick and Jeffries Wyman was sent by Crick to Jacques Monod in 1965. Monod transmitted a copy of the manuscript, upon which he had written several comments, to Jean-Pierre Changeux, then a post-doctoral fellow at the University of California Berkeley in the laboratory of Howard Schachman. Changeux provided a copy to Stuart Edelstein, a graduate student in the same laboratory. The manuscript was never submitted for publication, but Edelstein retained his copy since that time and has edited it for publication in the special issue on allostery. The text emphasized the interpretation of the properties of an allosteric oligomer by characterizing its equivalent monomer. The text also developed the concept of the allosteric range and included a simple equation for calculation of the Hill coefficient from the parameters of the Monod-Wyman-Changeux model. Copyright © 2013 Elsevier Ltd. All rights reserved.
The generative power of weighted one-sided and regular sticker systems
Siang, Gan Yee; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod
2014-06-01
Sticker systems were introduced in 1998 as one of the DNA computing models by using the recombination behavior of DNA molecules. The Watson-Crick complementary principle of DNA molecules is abstractly used in the sticker systems to perform the computation of sticker systems. In this paper, the generative power of weighted one-sided sticker systems and weighted regular sticker systems are investigated. Moreover, the relationship of the families of languages generated by these two variants of sticker systems to the Chomsky hierarchy is also presented.
The green roof dilemma - discussion of Francis and Lorimer (2011).
Henry, Alexandre; Frascaria-Lacoste, Nathalie
2012-08-15
Urban ecosystems are the most complex mosaics of vegetative land cover that can be found. In a recent paper, Francis and Lorimer (2011) evaluated the reconciliation potential of living roofs and walls. For these authors, these two techniques for habitat improvement have strong potential for urban reconciliation ecology. However they have some ecological and societal limitations such as the physical extreme environmental characteristics, the monetary investment and the cultural perceptions of urban nature. We are interested in their results and support their conclusions. However, for a considerable time, green roofs have been designed to provide urban greenery for buildings and the green roof market has only focused on extensive roof at a restricted scale within cities. Thus, we have strong doubts about the relevance of their use as possible integrated elements of the network. Furthermore, without dynamic progress in research and the implementation of well-thought-out policies, what will be the real capital gain from green roofs with respect to land-use complementation in cities? If we agree with Francis and Lorimer (2011) considering that urban reconciliation ecology between nature and citizens is a current major challenge, then "adaptive collaborative management" is a fundamental requirement. Copyright © 2012 Elsevier Ltd. All rights reserved.
Lewis, Christopher Alan; Cruise, Sharon Mary; McGuckin, Conor
2005-04-01
This study evaluated the test-retest reliability of the Francis Scale of Attitude toward Christianity short-form. 39 Northern Irish undergraduate students completed the measure on two occasions separated by one week. Stability across the two administrations was high, r = .92, and there was no significant change between Time 1(M = 25.2, SD = 5.4) and Time 2 (M = 25.7, SD = 6.2). These data support the short-term test-retest reliability of the Francis Scale of Attitude toward Christianity short-form.
A Song in the Dark. Francis of Assisi’s Canticle of Brother Sun
Directory of Open Access Journals (Sweden)
Speelman Willem Marie
2016-10-01
Full Text Available The Canticle of the Creatures or Canticle of Brother Sun is based on a particular way of perceiving reality. Francis, who had turned away from ‘the world’, discovered a different way of looking at it. This is a divine way of perceiving, in which the senses do not grasp reality, but accept it as it communicates itself. This way of perceiving is only possible if one does not attempt to master the environment, but allows one’s senses to be weak. It is significant, therefore, that this song of praise was born at a moment of the utmost despair and weakness. The song’s content is in line with this weak perception: it is not about Francis who praises God and (or for His creatures, but rather it is a testimony that the creatures-the elements-are already praising God, and a prayer that He should let Himself be praised by the creatures. Also in line with this weak perception is the fact that the creatures are praised just as they communicate themselves to Francis: as bodies. The theology of this song is that the creatures through their bodies resonate (strengthen, and colour the blessings that come from God, thereby making His blessing present here on earth. Francis’ role is to give a voice and a language to the heavenly praises as they resound in his environment. The transformative power of this song is that we, whether consciously or not, do the same thing when we participate in this song.
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Hydraulic Turbines: The Francis Turbine. Technical Terminology Bulletin. Terminotech, Vol. 2, No. 2.
General Electric Co. of Canada, Ltd., Montreal, Quebec.
This issue of a bulletin of technological terminology is devoted to the Francis turbine. A brief narrative on the subject is presented in both French and English. An English-French dictionary of terms comprises the bulk of the document. An explanatory illustration is appended. (JB)
Dynamic stresses in a Francis model turbine at deep part load
Weber, Wilhelm; von Locquenghien, Florian; Conrad, Philipp; Koutnik, Jiri
2017-04-01
A comparison between numerically obtained dynamic stresses in a Francis model turbine at deep part load with experimental ones is presented. Due to the change in the electrical power mix to more content of new renewable energy sources, Francis turbines are forced to operate at deep part load in order to compensate stochastic nature of wind and solar power and to ensure grid stability. For the extension of the operating range towards deep part load improved understanding of the harsh flow conditions and their impact on material fatigue of hydraulic components is required in order to ensure long life time of the power unit. In this paper pressure loads on a model turbine runner from unsteady two-phase computational fluid dynamics simulation at deep part load are used for calculation of mechanical stresses by finite element analysis. Therewith, stress distribution over time is determined. Since only few runner rotations are simulated due to enormous numerical cost, more effort has to be spent to evaluation procedure in order to obtain objective results. By comparing the numerical results with measured strains accuracy of the whole simulation procedure is verified.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Different methods and metaphysics in early molecular genetics--a case of disparity of research?
Deichmann, Ute
2008-01-01
The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
Experimental investigations of the unsteady flow in a Francis turbine draft tube cone
International Nuclear Information System (INIS)
Baya, A; Muntean, S; Campian, V C; Cuzmos, A; Diaconescu, M; Balan, G
2010-01-01
Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.
Experimental investigations of the unsteady flow in a Francis turbine draft tube cone
Energy Technology Data Exchange (ETDEWEB)
Baya, A [Department of Hydraulic Machinery, ' Politehnica' University of Timisoara Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Campian, V C; Cuzmos, A [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta. Traian Vuia 1-4, RO-320085, Resita (Romania); Diaconescu, M; Balan, G, E-mail: abaya@mh.mec.upt.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A. Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)
2010-08-15
Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.
The Power of the Word and the Mastery of Nature: Renaissance Magic and Francis Bacon
Czech Academy of Sciences Publication Activity Database
Špelda, Daniel
19/43/, - (2005), s. 7-36. ISBN 80-7007-236-9. ISSN 0231-5955 Institutional research plan: CEZ:AV0Z90090514 Keywords : magic * renaissance philosophy * Francis Bacon Subject RIV: AA - Philosophy ; Religion
Transient CFD simulation of a Francis turbine startup
International Nuclear Information System (INIS)
Nicolle, J; Morissette, J F; Giroux, A M
2012-01-01
To assess the life expectancy of hydraulic turbines, it is essential to obtain the loading on the blades, especially during transient operations known to be the most damaging. This paper presents a simplified CFD setup to model the startup phase of a Francis turbine while it goes from rest to speed no-load condition. The fluid domain included one distributor sector coupled with one runner passage. The guide vane motion and change in the angular velocity were included in a commercial code with user functions. Comparisons between numerical results and measurements acquired on a full-size turbine showed that most of the flow physics occurring during startup were captured.
Eichhorn, M.; Taruffi, A.; Bauer, C.
2017-04-01
The operators of hydropower plants are forced to extend the existing operating ranges of their hydraulic machines to remain competitive on the energy market due to the rising amount of wind and solar power. Faster response times and a higher flexibility towards part- and low-load conditions enable a better electric grid control and assure therefore an economic operation of the power plant. The occurring disadvantage is a higher dynamic excitation of affected machine components, especially Francis turbine runners, due to pressure pulsations induced by unsteady flow phenomena (e.g. draft tube vortex ropes). Therefore, fatigue analysis becomes more important even in the design phase of the hydraulic machines to evaluate the static and dynamic load in different operating conditions and to reduce maintenance costs. An approach including a one-way coupled fluid-structure interaction has been already developed using unsteady CFD simulations and transient FEM computations. This is now applied on two Francis turbines with different specific speeds and power ranges, to obtain the load spectra of both machines. The results are compared to strain gauge measurements on the according Francis turbines to validate the overall procedure.
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Detection of mutations in genes by specific LNA primers
DEFF Research Database (Denmark)
2001-01-01
acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...
Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms
2009-05-01
base pair) Watson ‐ Crick strand pairs that bind perfectly within pairs, but poorly across pairs. A variety of DNA strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE
DNA nanovehicles and the biological barriers
DEFF Research Database (Denmark)
Okholm, Anders Hauge; Kjems, Jørgen
2016-01-01
DNA is emerging as a smart material to construct nanovehicles for targeted drug delivery. The programmability of Watson-Crick base paring enables construction of defined and dynamic DNA nanostructures of almost arbitrary shape and DNA can readily be functionalized with a variety of molecular...... be overcome. Here, we highlight recent strategies for DNA nanostructures in drug delivery, DNA nanovehicles, to facilitate targeting and crossing of the biological barriers. In light of this, we discuss future solutions and challenges for DNA nanovehicles to unravel their great potential to facilitate...
Directory of Open Access Journals (Sweden)
Mei-Yu LEE
2014-11-01
Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.
Influence of the rotor-stator interaction on the dynamic stresses of Francis runners
International Nuclear Information System (INIS)
Guillaume, R; Scolaro, D; Deniau, J L; Colombet, C
2012-01-01
Thanks to advances in computing capabilities and Computational Fluid Dynamics (CFD) techniques, it is now possible to calculate realistic unsteady pressure fields in Francis turbines. This paper will explain methods to calculate the structural loads and the dynamic behaviour in order to optimize the turbine design and maximize its reliability and lifetime. Depending on the operating conditions of a Francis turbine, different hydraulic phenomena may impact the mechanical behaviour of the structure. According to their nature, these highly variable phenomena should be treated differently and specifically in order to estimate the potential risks arising on submerged structures, in particular the runner. The operating condition studied thereafter is the point at maximum power with the maximum head. Under this condition, the runner is excited by only one dynamic phenomenon named the Rotor-Stator Interaction (RSI). The origin of the phenomenon is located on the radial gap of the turbine and is the source of pressure fluctuations. A fluid-structure analysis is performed to observe the influence of that dynamic pressure field on the runner behaviour. The first part of the paper deals with the unsteady fluid computation. The RSI phenomenon is totally unsteady so the fluid simulation must take into account the entire machine and its rotation movement, in order to obtain a dynamic pressure field. In the second part of the paper, a method suitable for the RSI study is developed. It is known that the fluctuating pressure in this gap can be described as a sum of spatial components. By evaluating these components in the CFD results and on the scale model, it is possible to assess the relevance of the numerical results on the whole runner. After this step, the numerical pressure field can be used as the dynamic load of the structure. The final part of the paper presentsthe mechanical finite element calculations. A modal analysis of the runner in water and a harmonic analysis of its
The Norwegian translation of the Francis Scale of Attitude toward Christianity.
Francis, Leslie J; Enger, Trond
2002-12-01
This paper reviews the development of the Francis Scale of Attitude toward Christianity and then examines the psychometric properties of the Norwegian translation of this instrument among a sample of 479 young people between the ages of 11 and 18 years attending secondary school. The data support the reliability of this instrument and commend it for further validation studies and for wider general use among young people in Norway.
The McLean-Watson line strength formula and its implementation
International Nuclear Information System (INIS)
Hey, J D
2009-01-01
We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.
Inventing Citizens, Imagining Gender Justice: The Suffrage Rhetoric of Virginia and Francis Minor
Ray, Angela G.; Richards, Cindy Koenig
2007-01-01
From the late 1860s through the mid-1870s, woman suffrage activists developed an ingenious legal argument, claiming that the U.S. Constitution already enfranchised women citizens. The argument, first articulated by St. Louis activists Virginia and Francis Minor, precipitated rhetorical performances by movement activists on public platforms and in…
The design of an enzyme: a chronology on the controversy.
Buc, Henri
2013-05-13
After the publication of the Monod-Wyman-Changeux model, a controversy arose between Jacques Monod, Francis Crick and Jeffries Wyman about the comparison of the regulatory performances of an oligomer undergoing a concerted transition between two states and a monomer having the same composition and subjected to a similar conformational equilibrium. The controversy took place between September 1965 and March 1966. It gave rise to several unpublished notes. Numerous misunderstandings between the participants were not fully dissipated as the controversy abruptly ended. Copyright © 2013 Elsevier Ltd. All rights reserved.
Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season
Directory of Open Access Journals (Sweden)
Lina Affifatusholihah
2017-04-01
In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
O duplo legado de Francis Poulenc
Directory of Open Access Journals (Sweden)
Joana Resende
2009-12-01
Full Text Available Déjàvu,or better,déjà écouté is an appropriate expression to describe an audition of certain works by Francis Poulenc (1899-1963. A sui-generis character in 20th century music, Poulenc has questioned the whole heritage that came before him, French or not, according to the premises of the group he belonged to, Les Six, although not always reaching similar results. His main concern was to make good music, an ideal not far from that of Debussy, “music should humbly seek to please” (Harry Halbreich. This article approaches the use of quotation and other processes of allusion in the works by Poulenc, as seen in his voice and piano mélodies cycle La fraîcheur et le feu, identifying thematic, melodic, and harmonic, origins used coherently in several pieces. and helping to solidly build his musical language.
Validez y confiabilidad de la escala breve de Francis para actitud ante el cristianismo
Directory of Open Access Journals (Sweden)
Zuleima Cogollo
2012-04-01
Resultados. La escala Francis-5 mostró una estructura unidimensional, con un valor propio de 3,681 que dio cuenta del 73,6% de la varianza. Las mujeres puntuaron significativamente mayor que los varones, 18,5 (DE=2,7 vs. 17,9 (DE=3,3 (t = 4,3; p
[Sir Francis Galton: the father of eugenics].
Aubert-Marson, Dominique
2009-01-01
Not only was Sir Francis Galton a famous geographer and statistician, he also invented "eugenics" in 1883. Eugenics, defined as the science of improving racial stock, was developed from a new heredity theory, conceived by Galton himself, and from the evolution theory of Charles Darwin, transposed to human society by Herbert Spencer. Galton's eugenics was a program to artificially produce a better human race through regulating marriage and thus procreation. Galton put particular emphasis on "positive eugenics", aimed at encouraging the physically and mentally superior members of the population to choose partners with similar traits. In 1904, he presented his ideas in front of a vast audience of physicians and scientists in London. His widely-publicized lecture served as the starting point for the development of eugenics groups in Europe and the United States during the first half of the 20th century.
Experimental vibration level analysis of a Francis turbine
International Nuclear Information System (INIS)
Bucur, D M; Dunca, G; Calinoiu, C
2012-01-01
In this study the vibration level of a Francis turbine is investigated by experimental work in site. Measurements are carried out for different power output values, in order to highlight the influence of the operation regimes on the turbine behavior. The study focuses on the turbine shaft to identify the mechanical vibration sources and on the draft tube in order to identify the hydraulic vibration sources. Analyzing the vibration results, recommendations regarding the operation of the turbine, at partial load close to minimum values, in the middle of the operating domain or close to maximum values of electric power, can be made in order to keep relatively low levels of vibration. Finally, conclusions are drawn in order to present the real sources of the vibrations.
Idili, Andrea; Plaxco, Kevin W; Vallée-Bélisle, Alexis; Ricci, Francesco
2013-12-23
Naturally occurring chemoreceptors almost invariably employ structure-switching mechanisms, an observation that has inspired the use of biomolecular switches in a wide range of artificial technologies in the areas of diagnostics, imaging, and synthetic biology. In one mechanism for generating such behavior, clamp-based switching, binding occurs via the clamplike embrace of two recognition elements onto a single target molecule. In addition to coupling recognition with a large conformational change, this mechanism offers a second advantage: it improves both affinity and specificity simultaneously. To explore the physics of such switches we have dissected here the thermodynamics of a clamp-switch that recognizes a target DNA sequence through both Watson-Crick base pairing and triplex-forming Hoogsteen interactions. When compared to the equivalent linear DNA probe (which relies solely on Watson-Crick interactions), the extra Hoogsteen interactions in the DNA clamp-switch increase the probe's affinity for its target by ∼0.29 ± 0.02 kcal/mol/base. The Hoogsteen interactions of the clamp-switch likewise provide an additional specificity check that increases the discrimination efficiency toward a single-base mismatch by 1.2 ± 0.2 kcal/mol. This, in turn, leads to a 10-fold improvement in the width of the "specificity window" of this probe relative to that of the equivalent linear probe. Given these attributes, clamp-switches should be of utility not only for sensing applications but also, in the specific field of DNA nanotechnology, for applications calling for a better control over the building of nanostructures and nanomachines.
Energy Technology Data Exchange (ETDEWEB)
Fedi, M.E. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)], E-mail: fedi@fi.infn.it; Cartocci, A.; Taccetti, F.; Mando, P.A. [Dipartimento di Fisica dell' Universita di Firenze and INFN Sezione di Firenze, via Sansone 1, 50019 Sesto Fiorentino (Italy)
2008-05-15
Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.
International Nuclear Information System (INIS)
Fedi, M.E.; Cartocci, A.; Taccetti, F.; Mando, P.A.
2008-01-01
Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics
Fedi, M. E.; Cartocci, A.; Taccetti, F.; Mandò, P. A.
2008-05-01
Since natural textiles usually originate from short-lived organisms, they can represent a useful material to date samples from historical periods with a good accuracy. In this work, we present a set of radiocarbon measurements on medieval textile relics: two woollen habits and a pillow traditionally associated with St. Francis of Assisi, the saint patron of Italy. The strategy in choosing samples for radiocarbon dating is first discussed and the procedures for measurements - performed at the 3 MV Tandetron accelerator of Laboratorio di Tecniche Nucleari per i Beni Culturali (LABEC), Florence - are described; AMS results for the two frocks showed that only one of them, presently kept in the church of St. Francis in Cortona, is compatible with the Saint's period of life, as is the pillow also kept in Cortona. Another frock attributed to St. Francis appears to date from at least 80 years after his death. However, the goal of these measurements was not a bare authentication/disconfirmation of the relics; they just represent an example of how scientific analysis can integrate with humanistic studies. Indeed, AMS results, combined with a thorough analysis of the textiles typologies, confirmed the historical hypotheses based on documentary studies and on tradition. The overall conclusions contributed to the decisions taken for conservation, and have as a whole enhanced the religious importance of the relics.
Prediction Method for the Complete Characteristic Curves of a Francis Pump-Turbine
Directory of Open Access Journals (Sweden)
Wei Huang
2018-02-01
Full Text Available Complete characteristic curves of a pump-turbine are essential for simulating the hydraulic transients and designing pumped storage power plants but are often unavailable in the preliminary design stage. To solve this issue, a prediction method for the complete characteristics of a Francis pump-turbine was proposed. First, based on Euler equations and the velocity triangles at the runners, a mathematical model describing the complete characteristics of a Francis pump-turbine was derived. According to multiple sets of measured complete characteristic curves, explicit expressions for the characteristic parameters of characteristic operating point sets (COPs, as functions of a specific speed and guide vane opening, were then developed to determine the undetermined coefficients in the mathematical model. Ultimately, by combining the mathematical model with the regression analysis of COPs, the complete characteristic curves for an arbitrary specific speed were predicted. Moreover, a case study shows that the predicted characteristic curves are in good agreement with the measured data. The results obtained by 1D numerical simulation of the hydraulic transient process using the predicted characteristics deviate little from the measured characteristics. This method is effective and sufficient for a priori simulations before obtaining the measured characteristics and provides important support for the preliminary design of pumped storage power plants.
D.M. Amatya; T.J. Callahan; A. Radecki-Pawlik; P. Drewes; C. Trettin; W.F. Hansen
2008-01-01
The re-initiation of a 7,260 ha forested watershed study on Turkey Creek, a 3rd order stream, within the Francis Marion National forest in South Carolina, completes the development of a multi-scale hydrology and ecosystem monitoring framework in the Atlantic Coastal Plain. Hydrology and water quality monitoring began on the Santee Experimental...
Biotecnología: una ciencia moderna para una institución centenaria
Pineda Priego, Manuel
2011-01-01
Biotecnología es “toda aplicación tecnológica que utilice sistemas biológicos y organismos vivos o sus derivados para la creación o modificación de productos o procesos para usos específicos” (Convenio sobre Diversidad Biológica de la Naciones Unidas, 1992). La Biotecnología moderna está basada en la estructura de la molécula de ADN (Watson y Crick, 1953) y el descubrimiento de las enzimas de restricción y de las técnicas de transformación celular. El primer ejemplo exitoso de ...
Modelos de computación lógica con ADN
Sainz de Murieta Fuentes, Iñaki
2011-01-01
La computación molecular es una disciplina que se ocupa del diseño e implementación de dispositivos para el procesamiento de información sobre un sustrato biológico, como el ácido desoxirribonucleico (ADN), el ácido ribonucleico (ARN) o las proteínas. Desde que Watson y Crick descubrieron en los años cincuenta la estructura molecular del ADN en forma de doble hélice, se desencadenaron otros descubrimientos como las enzimas que cortan el ADN o la reacción en cadena de la polimerasa (PCR), cont...
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
An interview with James Briscoe.
Brown, Katherine
2018-03-27
James Briscoe is a group leader at The Francis Crick Institute in London. His lab's research focusses on the developing vertebrate spinal cord, with a particular interest in how sonic hedgehog gradients, and the downstream signal transduction and transcriptional networks, regulate the development of this tissue. In September 2018, James will become the new Editor-in-Chief of Development. We met with James to discuss his career and research interests, the importance of interdisciplinary thinking in developmental biology, and his views on the current state and future opportunities in scientific publishing. © 2018. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Luciane Favero
2009-01-01
Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las
Francis Bacon: constructing natural histories of the invisible.
Rusu, Doina-Cristina
2012-01-01
The natural histories contained in Francis Bacon's Historia naturalis et experimentalis seem to differ from the model presented in De augmentis scientiarum and the Descriptio globi intellectualis in that they are focused on the defining properties of matter, its primary schematisms and the spirits. In this respect, they are highly speculative. In this paper I aim to describe the Historia naturalis et experimentalis as a text about matter theory, the histories of which are ascending from what is most evident to the senses to what is least accessible to them. Moreover, the Latin natural histories are parts of a methodological procedure in which the provisional rules and axioms obtained in one history can be used as theoretical assumptions for another history, thereby permitting one to delve ever more profoundly into the structure of nature.
Francis Bacon's Valerius Terminus and the Voyage to the "Great Instauration".
Serjeantson, Richard
2017-01-01
Francis Bacon's earliest surviving natural philosophical treatise (composed circa 1603) bears the title Valerius Terminus of the Interpretation of Nature. This study, resting on fresh attention to the surviving authorial manuscript, has three goals. It begins by identifying a lost precursor work apparently entitled "Of Active Knowledge." It then examines the significance of the pseudonyms Bacon chose to introduce his ideas, considering especially his invocation of Erasmus's emblem, the Roman deity Terminus. Finally, it shows how the Valerius Terminus's global vision of contemporary knowledge ultimately helped shape the iconography of Bacon's published Instauratio magna.
78 FR 59913 - Revision of the Land Management Plan for the Francis Marion National Forest
2013-09-30
... telecommunication devices for the deaf (TDD) may call the Federal Information Relay Service (FIRS) at 1-800- 877... planning process can also be found on the Francis Marion National Forest Web site at www.fs.usda.gov/goto/scnfs/fmplan . SUPPLEMENTARY INFORMATION: Pursuant to the 2012 Forest Planning Rule (36 CFR Part 219...
A highly efficient Francis turbine designed for energy recovery in cooling towers
Directory of Open Access Journals (Sweden)
Daqing Zhou
2015-03-01
Full Text Available In China, cooling water entering cooling towers still retains surplus pressure between 39,240 and 147,150 Pa. In order to utilize this wasted energy, it is suggested that the surplus water energy can be harnessed to drive a type of hydroturbine installed in the inner platform of cooling tower and make the fan rotate via its coupled shafts. However, conventional hydroturbines are not suited for this job because of their low efficiency or unmatched rotating speed with that of the fan under the operating conditions of cooling towers. In this article, according to the requirements of turbine work environment in cooling towers, a new type of hydroturbine, Francis turbine with ultra-low specific speed (ns = 50 m.kW, was designed to replace the fan motor in a cooling tower. Primarily, the shape, position, and number of runner blades were designed and optimized through theoretical analyses and computational fluid dynamics simulations. Additionally, metal elliptical volute and single-row ring guide vanes were applied to scale down the structural dimensions. Finally, the optimal scheme of the new Francis turbine was proven to have a high efficiency of 88% and good operation stability through testing of a physical model and can achieve the goal of harvesting renewable energy in the cooling tower.
Codon Distribution in Error-Detecting Circular Codes.
Fimmel, Elena; Strüngmann, Lutz
2016-03-15
In 1957, Francis Crick et al. suggested an ingenious explanation for the process of frame maintenance. The idea was based on the notion of comma-free codes. Although Crick's hypothesis proved to be wrong, in 1996, Arquès and Michel discovered the existence of a weaker version of such codes in eukaryote and prokaryote genomes, namely the so-called circular codes. Since then, circular code theory has invariably evoked great interest and made significant progress. In this article, the codon distributions in maximal comma-free, maximal self-complementary C³ and maximal self-complementary circular codes are discussed, i.e., we investigate in how many of such codes a given codon participates. As the main (and surprising) result, it is shown that the codons can be separated into very few classes (three, or five, or six) with respect to their frequency. Moreover, the distribution classes can be hierarchically ordered as refinements from maximal comma-free codes via maximal self-complementary C(3) codes to maximal self-complementary circular codes.
Francis Bacon's natural history and the Senecan natural histories of early modern Europe.
Jalobeanu, Dana
2012-01-01
At various stages in his career, Francis Bacon claimed to have reformed and changed traditional natural history in such a way that his new "natural and experimental history" was unlike any of its ancient or humanist predecessors. Surprisingly, such claims have gone largely unquestioned in Baconian scholarship. Contextual readings of Bacon's natural history have compared it, so far, only with Plinian or humanist natural history. This paper investigates a different form of natural history, very popular among Bacon's contemporaries, but yet unexplored by contemporary students of Bacon's works. I have provisionally called this form of natural history'Senecan' natural history, partly because it took shape in the Neo-Stoic revival of the sixteenth-century, partly because it originates in a particular cosmographical reading of Seneca's Naturales quaestiones. I discuss in this paper two examples of Senecan natural history: the encyclopedic and cosmographical projects of Pierre de la Primaudaye (1546-1619) and Samuel Purchas (1577-1626). I highlight a number of similarities between these two projects and Francis Bacon's natural history, and argue that Senecan natural history forms an important aspect in the historical and philosophical background that needs to be taken into consideration if we want to understand the extent to which Bacon's project to reform natural history can be said to be new.
Directory of Open Access Journals (Sweden)
Guangtao Zhang
2015-01-01
Full Text Available In the field of hydropower station transient process simulation (HSTPS, characteristic graph-based iterative hydroturbine model (CGIHM has been widely used when large disturbance hydroturbine modeling is involved. However, by this model, iteration should be used to calculate speed and pressure, and slow convergence or no convergence problems may be encountered for some reasons like special characteristic graph profile, inappropriate iterative algorithm, or inappropriate interpolation algorithm, and so forth. Also, other conventional large disturbance hydroturbine models are of some disadvantages and difficult to be used widely in HSTPS. Therefore, to obtain an accurate simulation result, a simple method for hydroturbine modeling is proposed. By this method, both the initial operating point and the transfer coefficients of linear hydroturbine model keep changing during simulation. Hence, it can reflect the nonlinearity of the hydroturbine and be used for Francis turbine simulation under large disturbance condition. To validate the proposed method, both large disturbance and small disturbance simulations of a single hydrounit supplying a resistive, isolated load were conducted. It was shown that the simulation result is consistent with that of field test. Consequently, the proposed method is an attractive option for HSTPS involving Francis turbine modeling under large disturbance condition.
Alligné, S.; Nicolet, C.; Béguin, A.; Landry, C.; Gomes, J.; Avellan, F.
2017-04-01
The prediction of pressure and output power fluctuations amplitudes on Francis turbine prototype is a challenge for hydro-equipment industry since it is subjected to guarantees to ensure smooth and reliable operation of the hydro units. The European FP7 research project Hyperbole aims to setup a methodology to transpose the pressure fluctuations induced by the cavitation vortex rope from the reduced scale model to the prototype generating units. A Francis turbine unit of 444MW with a specific speed value of ν = 0.29, is considered as case study. A SIMSEN model of the power station including electrical system, controllers, rotating train and hydraulic system with transposed draft tube excitation sources is setup. Based on this model, a frequency analysis of the hydroelectric system is performed for all technologies to analyse potential interactions between hydraulic excitation sources and electrical components. Three technologies have been compared: the classical fixed speed configuration with Synchronous Machine (SM) and the two variable speed technologies which are Doubly Fed Induction Machine (DFIM) and Full Size Frequency Converter (FSFC).
Francis Bacon's behavioral psychology.
MacDonald, Paul S
2007-01-01
Francis Bacon offers two accounts of the nature and function of the human mind: one is a medical-physical account of the composition and operation of spirits specific to human beings, the other is a behavioral account of the character and activities of individual persons. The medical-physical account is a run-of-the-mill version of the late Renaissance model of elemental constituents and humoral temperaments. The other, less well-known, behavioral account represents an unusual position in early modern philosophy. This theory espouses a form of behavioral psychology according to which (a) supposed mental properties are "hidden forms" best described in dispositional terms, (b) the true character of an individual can be discovered in his observable behavior, and (c) an "informed" understanding of these properties permits the prediction and control of human behavior. Both of Bacon's theories of human nature fall under his general notion of systematic science: his medical-physical theory of vital spirits is theoretical natural philosophy and his behavioral theory of disposition and expression is operative natural philosophy. Because natural philosophy as a whole is "the inquiry of causes and the production of effects," knowledge of human nature falls under the same two-part definition. It is an inquisition of forms that pertains to the patterns of minute motions in the vital spirits and the production of effects that pertains both to the way these hidden motions produce behavioral effects and to the way in which a skillful agent is able to produce desired effects in other persons' behavior. (c) 2007 Wiley Periodicals, Inc.
Ferreira, Ana Veríssimo; Neto, Félix
2002-12-01
To facilitate use of the adult form of the Francis Scale of Attitude Towards Christianity in cross-cultural studies, the psychometric characteristics of the translated scale were examined among 323 university students in Portugal (130 men and 193 women). Their ages ranged from 18 to 31 years. Analysis supported the unidimensionality, internal consistency, and construct validity of this scale in this sample of Portuguese university students.
Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia
Directory of Open Access Journals (Sweden)
Roberta Maria Savieto
2016-03-01
Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hua Hong
2015-03-01
Full Text Available As the key component of a hydroelectric power generation system, hydraulic turbine plays a decisive role in the overall performance of the system. There are many sandy rivers in the world, and turbines working in these rivers are seriously damaged. Therefore, the research of flow in sandy water has great theoretical significance and practical value. Based on the specific hydrological conditions of a hydropower station, the solid–liquid two-phase flow in the whole flow passage of a Francis turbine with splitter blades in sandy water was numerically studied. A geometric model of the whole flow passage of the Francis turbine was established on the basis of given design parameters. The solid–liquid two-phase turbulent flows in Francis turbine runner under three different loads were numerically analyzed by using this model. The three different loads are as follows: Condition 1: single unit with 1/4 load, Condition 2: single unit with 1/2 load, and Condition 3: single unit with full load. The distributions of pressure and sand concentration on the leading side and the suction side of the runner blades, as well as the velocity vector distribution of water and sand on the horizontal section of the runner, were obtained under different load conditions. Therefore, the damages to various flow passage components by sand can be qualitatively predicated under various conditions. To guarantee the safety and stability of the unit, the adverse conditions shall be avoided, which can provide certain reference for plant operation.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
The Culture of Science and the Rhetoric of Scientism: From Francis Bacon to the Darwin Fish
Lessl, Thomas M.
2007-01-01
The culture of modern science continues to establish its public identity by appealing to values and historical conceptions that reflect its appropriation of various religious ideals during its formative period, most especially in the rhetoric of Francis Bacon. These elements have persisted because they continue to achieve similar goals, but the…
International Nuclear Information System (INIS)
Bleiker, J.; Knapp, K.M.; Hopkins, S.; Johnston, G.
2016-01-01
Compassion is elemental in the care of a patient during their medical imaging (MI) procedure and is highly topical in the light of the Francis Report. The patient–practitioner interaction is an amalgam of context, communication and individual differences, and whilst compassion is a term in common parlance in the media, policy and radiographers' professional documents, its meaning and manifestation in radiography recruitment, education and practice are less clearly articulated. A review of the existing literature was undertaken, including a small scale study exploring patients' experiences in diagnostic medical imaging. Themes from the study included communication; competence; emotions; attitudes and relationships, but notably absent was any mention of compassion per se. Radiography research would benefit from further exploratory work into the nature of compassionate patient care in the unique context of the medical imaging encounter; offering an evidence-based contribution to radiography in the light of the Francis Report. - Highlights: • An increased focus on compassion was recommended in the Francis Report. • Best compassionate care is a requirement in radiographers' Code of Professional Conduct. • The meaning of compassionate patient care in radiography is not well understood. • Equally neither is the expression of compassion in radiography. • Research into compassion will contribute to evidence-based practice in radiography.
George Gamow: a most talented and creative scientist
International Nuclear Information System (INIS)
Yang Qingyu
2002-01-01
As one of the most prominent scientists of the 20th century, George Gamow made notable contributions to many fields of science in his life time. In nuclear physics he proposed the well known 'nuclear potential barrier channel effect' and the Gamow-Teller transition probability of beta decay. In cosmology he did his almost to advocate the 'big bang' theory. Through extraordinary intuition he proposed a theory about how genetic codes work in molecular biology, which was later verified by Watson, Crick and Nirenbery. Gamow's unique style of research and his spirit of bringing forth new ideas in interdisciplinary subjects has greatly benefited scientific research
Schroedinger and the wave mechanics
International Nuclear Information System (INIS)
Bassalo, J.M.F.
1987-01-01
In commemoration of the centennial of Schroedinger's birth, in 1987, we show in this paper some aspects of his academic life, and his philosophical and scientific work. Among Schroedinger's innumerable contributions to almost all areas of philosophy and science, we choose here the creation of quantum mechanics (1926), considered one of the pillars of Modern quantum theory, and the importance of his philosophical essay What is life (1944). This publication was responsible for a great in the studies of biology, culminating in the discovery of the DNA molecular structure, in 1953, by Crick and Watson, thanks to the X-rays diffraction technique of the DNA developed by Wilkens. (author) [pt
Lo molecular no es invisible a los ojos
Lizaraso Caparó, Frank; Facultad de Medicina Humana, Universidad de San Martín de Porres, Lima, Perú; Fujita, Ricardo; Facultad de Medicina Humana de la USMP. Lima, Perú.
2017-01-01
La Biología Molecular empieza su “Era de Oro” con la identificación de la molécula del DNA (ADN) por Watson y Crick en 1953 que explica la estructura y función del material genético, su mecanismo de expresión (en RNA) y el de traducción (en proteínas) (1, 2). Las numerosas enzimas involucradas (para polimerizar moléculas, copiar, cortar, pegar, borrar, etc.) fueron aisladas y usadas In Vitro para manipular las moléculas. Ello dio lugar a la tecnología de la amplificación PCR, la secuenciación...
Francis Bacon: teory, method and contributions to the education
Directory of Open Access Journals (Sweden)
Roberto Carlos Simões Galvão
2007-04-01
Full Text Available In the present article, we propose a brief analysis of Francis Bacon’s thought (1561-1626 and his contributions to the Education. With Bacon, the old religious or metaphysical character of knowledge was substituted by the objectivity of the experimental science, something unknown until then. The science started to represent a means in search of an end, i.e., man’s control over nature. The desire of Bacon to promote a reorganization of the power of the human knowledge, not based on the old scholastic knowledge, but in the new scientific knowledge, was shared by educators, philosophers and statesmen of his time. The role of the school would be to assure the dissemination of this new knowledge which, properly unified, would be within reach of all the children
Goll, Yael; Atlan, Gal; Citri, Ami
2015-08-01
The claustrum is a mysterious thin sheet of neurons lying between the insular cortex and the striatum. It is reciprocally connected with almost all cortical areas, including motor, somatosensory, visual, auditory, limbic, associative, and prefrontal cortices. In addition, it receives neuromodulatory input from subcortical structures. A decade ago, Sir Francis Crick and Christof Koch published an influential review proposing the claustrum as the 'seat of consciousness', spurring a revival of interest in the claustrum. We review the literature on the claustrum, emphasizing recent discoveries, and develop a detailed hypothesis describing a role for the claustrum in the segregation of attention. Copyright © 2015 Elsevier Ltd. All rights reserved.
The double helix revisited: a paradox of science and a paradigm of human behaviour
Directory of Open Access Journals (Sweden)
Argüelles, Juan Carlos
2007-06-01
Full Text Available In the modern history of Science, few breakthroughs have caused an impact comparative to the Double Helix, the three-dimensional structure of DNA proposed by Watson & Crick in 1953, an event whose 50th anniversary was widely celebrated in the non-specialist media, three years ago. Although the discovery had little transcendence at the time, it has unquestionably been of great importance ever since. The Double Helix has underlined the true biological value of nucleic acids compared with proteins, demonstrating that genes are not amorphous entities but have a specific chemical composition and adopt an ordered spatial folding pattern. Elucidation of this key configuration made it possible to establish a direct relationship between the structure and the function of macromolecules, a relationship which is not so clear in the case of proteins. During these last fifty years much has been written and argued about the circumstances surrounding the discovery and about the behaviour and attitudes of many of the protagonists. Besides Watson & Crick, other scientists, whose contribution has not been adequately recognised, played an important part in solving the Double Helix mystery. This article contains some ethical and scientific reflections which revise some of these essential contributions and throws light on the role played in history by these comparatively «unknown soldiers» of science. The Double Helix story is undoubtedly a manifestation of the human side of science and many scientists believe that the available evidence taken as a whole permits an alternative story to be written.
En la desarrollo histórico de la Ciencia moderna, pocos descubrimientos han causado un impacto comparativo a las repercusiones de la Doble Hélice, la estructura tridimensional del ADN, propuesta por Watson y Crick en 1953. El 50º aniversario de aquel evento fue ampliamente celebrado hace tres años, incluso por los medios no especializados en informaci
Directory of Open Access Journals (Sweden)
Sonia Borges
2013-02-01
Full Text Available A partir da perspectiva psicanalítica, a autora aborda a obra de Francis Bacon se utilizando de uma concepção estética que a reconhece como uma realidade ontológica. Dessa forma, considera que como obra de arte, são seus próprios elementos constitutivos, numa tensão interna, que são capazes de provocar efeitos ou as sensações que são o seu objetivo último conforme defendia Bacon. Em sua análise a autora examina e discute a dialética “tempo - espaço”, revelada pelo poeta pintor, como sendo de especial interesse para a clínica psicanalítica na medida em que esclarece importantes questões relativas ao Real como impossível, tal como o compreendeu Lacan. A pintura de Bacon examinada como referência à “sublimação criacionista da pulsão de morte” permite, segundo a autora, vislumbrarmos o para além da cadeia significante. Conclui que a arte, assim como a clínica psicanalítica, supõe deslocamentos subjetivos que implicam corte - rompimento com a tendência unificadora e pacificadora de Eros.
Sigmund Freud and the Crick-Koch hypothesis. A footnote to the history of consciousness studies.
Smith, D L
1999-06-01
The author describes Crick and Koch's recently developed theory of the neurophysiological basis of consciousness as synchronised neural oscillations. The thesis that neural oscillations provide the neurophysiological basis for consciousness was anticipated by Sigmund Freud in his 1895 'Project for a scientific psychology'. Freud attempted to solve his neuropsychological 'problem of quality' by means of the hypothesis that information concerning conscious sensory qualities is transmitted through the mental apparatus by means of neural 'periods'. Freud believed that information carried by neural oscillations would proliferate across 'contact-barriers' (synapses) without inhibition. Freud's theory thus appears to imply that synchronised neural oscillations are an important component of the neurophysiological basis of consciousness. It is possible that Freud's thesis was developed in response to the experimental research of the American neuroscientist M. M. Garver.
Francis, Leslie J.; Laycock, Patrick; Crea, Giuseppe
2017-01-01
Drawing on the classic model of balanced affect, the Francis Burnout Inventory (FBI) conceptualised good work-related psychological health among clergy in terms of negative affect being balanced by positive affect. In the FBI negative affect is assessed by the Scale of Emotional Exhaustion in Ministry (SEEM) and positive affect is assessed by the Satisfaction in Ministry Scale (SIMS). In support of the idea of balanced affect, previous work had shown a significant interaction between the effe...
Campo-Arias, Adalberto; Oviedo, Heidi Celina; Díaz, Carmen Elena; Cogollo, Zuleima
2006-12-01
This study evaluated the internal consistency of a Spanish version of the short form of the Francis Scale of Attitude Toward Christianity based on responses of 405 Colombian adolescent students ages 13 to 17 years. This translated short-form version of the scale had an internal consistency of .80. This estimate indicates suitable internal consistency reliability for research use in this population.
International Nuclear Information System (INIS)
Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.
2010-01-01
By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .
Vagnoni, E.; Andolfatto, L.; Avellan, F.
2017-04-01
Hydropower plants may be required to operate in synchronous condenser mode in order to supply reactive power to the grid for compensating the fluctuations introduced by the intermittent renewable energies such wind and solar. When operating in this mode, the tail water in the Francis turbine or pump-turbine is depressed below the runner by injecting pressurized air in order to spin in air to reduce the power consumption. Many air-water interaction phenomena occur in the machine causing air losses and a consequent power consumption to recover the air lost. In this paper, the experimental investigation of the sloshing motion in the cone of a dewatered Francis turbine performed by image visualization and pressure measurements is presented. The developed image post processing method for identifying the amplitude and frequency of the oscillation of the free surface is described and the results obtained are illustrated and discussed.
Study on stress characteristics of Francis hydraulic turbine runner based on two-way FSI
International Nuclear Information System (INIS)
Zhu, W R; Xiao, R F; Yang, W; Wang, F J; Liu, J
2012-01-01
In recent years, cracking phenomenon occurs in many large-sized turbines both nationally and internationally, which has threatened the stable operation of hydraulic turbines. Consequently, Stress characteristics calculation and analysis of a Francis hydraulic turbine runner by application of fluid-structure interaction (FSI) technology become significantly important. In order to introduce two-way coupling technology to hydraulic machinery, two-way FSI technology is applied in this article to calculate and analyze stress characteristics. Through coordinate system transformation, the continuity equations and Navier-Stokes equations in the Cartesian coordinates system are firstly transformed to ALE coordinates system. The fluid field control equations are then constructed and discrete equations can be obtained by using flow-condition-based interpolation (FBIC-C). The structure static mechanics equations used are established in rotation coordinate system, and modeled with the finite method. Two-way coupling is computed by using iteration method. The fluid equations and structure equations are iterated until coupling coefficients converge. According to structure result, the maximum stress, displacement as well as its location can be found. As a result, the most easily wear position can be discovered which provides valuable basis for optimized design and stable operation of Francis hydraulic turbines. After comparing the results with that of one-way coupling, it is discovered that displacements is the key factors which affects the results of one-way and two-way coupling.
Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs
Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.
2018-02-01
For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.
Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs
Directory of Open Access Journals (Sweden)
Ol'ha O. Brovarets'
2018-02-01
Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.
Chawla, Mohit
2018-02-23
We employ density functional theory (DFT) and time-dependent DFT (TDDFT) calculations to investigate the structural, energetic and optical properties of a new computationally designed RNA alphabet, where the nucleobases,tsA, tsG, tsC, and tsU (ts-bases), have been derived by replacing sulfur with selenium in the previously reported tz-bases, based on the isothiazolo[4.3-d]pyrimidine heterocycle core. We find out that the modeled non-natural bases have minimal impact on the geometry and energetics of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared to their natural counterparts. We also focus on the photophysical properties of the non-natural bases and correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital. It is indeed stabilized by roughly 1.1-1.6 eV as compared to the natural analogues, resulting in a reduction of the gap between the highest occupied and the lowest unoccupied molecular orbital from 5.3-5.5 eV in the natural bases to 3.9-4.2 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. Overall, our analysis clearly indicates that the newly modelled ts-bases are expected to exhibit better fluorescent properties as compared to the previously reported tz-bases, while retaining similar H-bonding properties. In addition, we show that a new RNA alphabet based on size-extended benzo-homologated ts-bases can also form stable Watson-Crick base pairs with the natural complementary nucleobases.
Analysis of stacking overlap in nucleic acid structures: algorithm and application.
Pingali, Pavan Kumar; Halder, Sukanya; Mukherjee, Debasish; Basu, Sankar; Banerjee, Rahul; Choudhury, Devapriya; Bhattacharyya, Dhananjay
2014-08-01
RNA contains different secondary structural motifs like pseudo-helices, hairpin loops, internal loops, etc. in addition to anti-parallel double helices and random coils. The secondary structures are mainly stabilized by base-pairing and stacking interactions between the planar aromatic bases. The hydrogen bonding strength and geometries of base pairs are characterized by six intra-base pair parameters. Similarly, stacking can be represented by six local doublet parameters. These dinucleotide step parameters can describe the quality of stacking between Watson-Crick base pairs very effectively. However, it is quite difficult to understand the stacking pattern for dinucleotides consisting of non canonical base pairs from these parameters. Stacking interaction is a manifestation of the interaction between two aromatic bases or base pairs and thus can be estimated best by the overlap area between the planar aromatic moieties. We have calculated base pair overlap between two consecutive base pairs as the buried van der Waals surface between them. In general, overlap values show normal distribution for the Watson-Crick base pairs in most double helices within a range from 45 to 50 Å(2) irrespective of base sequence. The dinucleotide steps with non-canonical base pairs also are seen to have high overlap value, although their twist and few other parameters are rather unusual. We have analyzed hairpin loops of different length, bulges within double helical structures and pseudo-continuous helices using our algorithm. The overlap area analyses indicate good stacking between few looped out bases especially in GNRA tetraloop, which was difficult to quantitatively characterise from analysis of the base pair or dinucleotide step parameters. This parameter is also seen to be capable to distinguish pseudo-continuous helices from kinked helix junctions.
Suseela, Y V; Narayanaswamy, Nagarjun; Pratihar, Sumon; Govindaraju, Thimmaiah
2018-02-05
The structural diversity and functional relevance of nucleic acids (NAs), mainly deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable for almost all living organisms, with minute aberrations in their structure and function becoming causative factors in numerous human diseases. The standard structures of NAs, termed canonical structures, are supported by Watson-Crick hydrogen bonding. Under special physiological conditions, NAs adopt distinct spatial organisations, giving rise to non-canonical conformations supported by hydrogen bonding other than the Watson-Crick type; such non-canonical structures have a definite function in controlling gene expression and are considered as novel diagnostic and therapeutic targets. Development of molecular probes for these canonical and non-canonical DNA/RNA structures has been an active field of research. Among the numerous probes studied, probes with turn-on fluorescence in the far-red (600-750 nm) region are highly sought-after due to minimal autofluorescence and cellular damage. Far-red fluorescent probes are vital for real-time imaging of NAs in live cells as they provide good resolution and minimal perturbation of the cell under investigation. In this review, we present recent advances in the area of far-red fluorescent probes of DNA/RNA and non-canonical G-quadruplex structures. For the sake of continuity and completeness, we provide a brief overview of visible fluorescent probes. Utmost importance is given to design criteria, characteristic properties and biological applications, including in cellulo imaging, apart from critical discussion on limitations of the far-red fluorescent probes. Finally, we offer current and future prospects in targeting canonical and non-canonical NAs specific to cellular organelles, through sequence- and conformation-specific far-red fluorescent probes. We also cover their implications in chemical and molecular biology, with particular focus on decoding various disease
1H-1H correlations across N-H···N hydrogen bonds in nucleic acids
International Nuclear Information System (INIS)
Majumdar, Ananya; Gosser, Yuying; Patel, Dinshaw J.
2001-01-01
In 2H J NN -COSY experiments, which correlate protons with donor/acceptor nitrogens across N d ···HN a bonds, the receptor nitrogen needs to be assigned in order to unambiguously identify the hydrogen bond. For many situations this is a non-trivial task which is further complicated by poor dispersion of (N a ,N d ) resonances. To address these problems, we present pulse sequences to obtain direct, internucleotide correlations between protons in uniformly 13 C/ 15 N labeled nucleic acids containing N d ···HN a hydrogen bonds. Specifically, the pulse sequence H2(N1N3)H3 correlates H2(A,ω 1 ):H3(U,ω 2 ) protons across Watson-Crick A-U and mismatched G·A base pairs, the sequences H5(N3N1)H1/H6(N3N1)H1 correlate H5(C,ω 1 )/H6(C,ω 1 ):H1(G,ω 2 ) protons across Watson-Crick G-C base pairs, and the H 2 (N2N7)H8 sequence correlates NH 2 (G,A,C;ω 1 ):H8(G,A;ω 2 ) protons across G·G, A·A, sheared G·A and other mismatch pairs. These 1 H- 1 H connectivities circumvent the need for independent assignment of the donor/acceptor nitrogen and related degeneracy issues associated with poorly dispersed nitrogen resonances. The methodology is demonstrated on uniformly 13 C/ 15 N labeled samples of (a) an RNA regulatory element involving the HIV-1 TAR RNA fragment, (b) a multi-stranded DNA architecture involving a G·(C-A) triad-containing G-quadruplex and (c) a peptide-RNA complex involving an evolved peptide bound to the HIV-1 Rev response element (RRE) RNA fragment
On the performance of a high head Francis turbine at design and off-design conditions
International Nuclear Information System (INIS)
Aakti, B; Amstutz, O; Casartelli, E; Romanelli, G; Mangani, L
2015-01-01
In the present paper, fully 360 degrees transient and steady-state simulations of a Francis turbine were performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL), using different numerical approaches for the pressure-velocity coupling. The simulation domain includes the spiral casing with stay and guide vanes, the runner and the draft tube. The main target of the investigations is the numerical prediction of the overall performance of the high head Francis turbine model as well as local and integral quantities of the complete machine in different operating conditions. All results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with a new in-house, 3D, unstructured, object-oriented finite volume code within the framework of the open source OpenFOAM library. The novel fully coupled pressure-based solver is designed to solve the incompressible RANS- Equations and is capable of handling multiple references of frame (MRF). The obtained results show that the overall performance is well captured by the simulations. Regarding the local flow distributions within the inlet section of the draft-tube, the axial velocity is better estimated than the circumferential component
Francis, Leslie J.; Brockett, Adrian; Village, Andrew
2013-01-01
Alongside a family of instruments designed to measure the attitudinal dimension of religion within specific faith contexts (Christianity, Hinduism, Islam, and Judaism), the Astley-Francis Scale of Attitude toward Theistic Faith was designed to assess the attitudinal dimension of religion within a multifaith context. Drawing on a sample of 4338…
Energy Technology Data Exchange (ETDEWEB)
Rosado Tamariz, Erick
2007-06-15
In the analysis of fluid behavior through hydraulic turbines, two basic methodologies for flow analysis and optimization processes in turbines are used, which are: a) modeled of flow through the entire turbine (joint), or modeled one of each component separately, obtaining satisfactory results by both methodologies. The analysis of computational fluids dynamics (CFD) to geometries improved by means of finite volume method (FVM) with their corresponding initials and boundary conditions is made, to solve a system differential equations of second order that correspond to the flow around the dominion of runner blades; considering nonviscous flow and the implementation of the two equations models for the solution of the equations that govern the turbulent flow. Also, used parameterization techniques based in a parametric geometry an objective function and the diminution of cavitation. This work presents the optimization of a runner from a Francis hydro turbine for a 75 MW considering three different load conditions (75%, 85% and 100%) through CFD as a part of the hydraulic analysis for modernization of the actual condition of a power generation unit. Francis runner optimization is made, through a previous analysis of CFD by means of the FVM, considering the viscous effects of the fluid and the model of turbulence developed by Sparlart and Allmaras; modeling the wicket and runner separately. Later the generation of a parametric model of the runner is made and the simulation for the generation of data base is formed. Finally an objective function is considered to develop the optimal geometry of the runner blades. The results are presented in a graphic form in such a way, that it shows the distributions of pressure and speed around the blades runner, the geometrical and performance (efficiency and power) comparison between original and optimized model. [Spanish] En el analisis del comportamiento del fluido a traves de turbinas hidraulicas, se emplean dos metodologias
Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang
2012-02-01
The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.
Anthropic principle in biology and radiation biology
International Nuclear Information System (INIS)
Akif'ev, A. P.; Degtyarev, S.V.
1999-01-01
It was suggested to add the anthropic principle of the Universe according to which the physical constants of fundamental particles of matter and the laws of their counteraction are those that an appearance of man and mind becomes possible and necessary, with some biological constants to the set of fundamental constants. With reparation of DNA as an example it was shown how a cell ran some parameters of Watson-Crick double helix. It was pointed that the concept of the anthropic principle of the Universe in its full body including biological constants was a key to developing of a unified theory of evolution of the Universe within the limits of scientific creationism [ru
Energy loss function for biological material: poly(CSP)
International Nuclear Information System (INIS)
Fung, A.Y.C.; Zaider, M.
1994-01-01
In this paper calculated cross sections are presented for the interaction of electrons with poly(CSP), a single-stranded chain that contains one cytosine sugar phosphate unit in the elementary cell. To model a single strand of helical DNA (e.g. the base stacking), the Watson-Crick model for the geometry of poly(CSP) has been used. The use, for computational simplicity, of a single, rather than a double stranded polynucleotide may be justified on the basis of previous calculations indicating that -to a good approximation - the electronic structure (other than excitation states) of complementary base pairs may be described as a superposition of the corresponding structures of the individual components. (Author)
Wu, Cuichen; Wan, Shuo; Hou, Weijia; Zhang, Liqin; Xu, Jiehua; Cui, Cheng; Wang, Yanyue; Hu, Jun; Tan, Weihong
2015-03-04
Nucleic acid-based logic devices were first introduced in 1994. Since then, science has seen the emergence of new logic systems for mimicking mathematical functions, diagnosing disease and even imitating biological systems. The unique features of nucleic acids, such as facile and high-throughput synthesis, Watson-Crick complementary base pairing, and predictable structures, together with the aid of programming design, have led to the widespread applications of nucleic acids (NA) for logic gate and computing in biotechnology and biomedicine. In this feature article, the development of in vitro NA logic systems will be discussed, as well as the expansion of such systems using various input molecules for potential cellular, or even in vivo, applications.
Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art
Pinheiro, Catarina; Dias, Maria João; Rosa, Alda
2009-01-01
Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.
Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art
Catarina Pinheiro; Maria João Dias; Alda Rosa
2014-01-01
Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.
Welsh, Richard L.
2008-01-01
The author discusses the pivotal roles of Sir Francis Campbell (1832-1914) and members of his family, especially his son Charles Campbell, in the evolution of the blindness field to a professional and reason-based service.
Fred Hoyle, Le Nuage noir ; James Lequeux, « Et si c’était possible »
Chabot, Hugues
2014-01-01
Fred Hoyle (1915-2001), un des plus brillants astronomes du vingtième siècle, est resté célèbre pour ses contributions à l’astrophysique nucléaire et pour avoir défendu toute sa vie une cosmologie alternative à la théorie du Grand Boum (Big Bang), théorie qu’il avait d’ailleurs lui-même baptisée ainsi par dérision. Son nom figure aux côtés de ceux de Francis Crick (1916-2004) ou de Richard Feynman (1918-1988) dans le très sélectif New Dictionary of Scientific Biography publié par Noretta Koer...
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Special article: Francis Hoeffer McMechan, MD: creator of modern anesthesiology?
Bacon, Douglas R
2012-12-01
If one person can be credited with the creation of the infrastructure of modern anesthesiology, that individual would be Francis Hoeffer McMechan. He has been largely forgotten since his death in 1939 despite his remarkable and enduring accomplishments. McMechan edited the first national journal devoted to anesthesiology, created and managed almost all of the national and regional societies devoted to the specialty between 1912 and his death, and created the first international physician certification as a specialist in anesthesiology. His accomplishments are even more amazing given the severe arthritis that left him wheelchair-bound for almost his entire professional life and denied him the ability to practice anesthesia. Our specialty owes an incredible debt to this largely unknown and unsung hero.
International Nuclear Information System (INIS)
Zhang, Z; Titzschkau, M
2012-01-01
A calculation method has been presented to accurately estimate the characteristics of a Francis turbine. Both the shock loss at the impeller inlet and the swirling flow loss at the Impeller exit have been confirmed to dominantly influence the turbine characteristics and particularly the hydraulic efficiency. Both together totally govern the through flow of water through the impeller being at the rest. Calculations have been performed for the flow rate, the shaft torque and the hydraulic efficiency and compared with the available measurements on a model turbine. Excellent agreements have been achieved. Some other interesting properties of the turbine characteristics could also be derived from the calculations and verified by experiments. For this reason and because of not using any unreliable assumptions the calculation method has been confirmed to be self-validated. The operational instability in the upper range of the rotational speed, known as the S-shape instability, is ascribed to the total flow separation and stagnation at the impeller inlet. In that range of the rotational speed, the operation of the Francis turbine oscillates between pump and turbine mode.
Prediction of dynamic blade loading of the Francis-99 turbine
International Nuclear Information System (INIS)
Nicolle, J; Cupillard, S
2015-01-01
CFD simulations focusing on capturing dynamic fluctuations of the flow for three operating points were performed for a scale model of a high head Francis turbine. A mesh sensitivity study showed an influence of the near wall resolution, consequently a low Reynolds mesh with a SST turbulence model was used. Rotor/stator fluctuations are well reproduced with the full turbine simulation at all operating points. Velocity contours and average velocity profiles from LDV measurements in the draft tube confirm that the flow physics is generally well reproduced. Simplified approaches such as profile transform and Fourier transform underestimated the measured fluctuations. As full turbine simulations were time-consuming, a simulation with only the draft tube was performed at part load to predict the fluctuations in the draft tube cone. The SAS-SST turbulence model was able to capture the vortex rope behavior
Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art
Directory of Open Access Journals (Sweden)
Catarina Pinheiro
2014-06-01
Full Text Available Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.
Landrum, Asheley R; Lull, Robert B; Akin, Heather; Hasell, Ariel; Jamieson, Kathleen Hall
2017-09-01
Previous research suggests that when individuals encounter new information, they interpret it through perceptual 'filters' of prior beliefs, relevant social identities, and messenger credibility. In short, evaluations are not based solely on message accuracy, but also on the extent to which the message and messenger are amenable to the values of one's social groups. Here, we use the release of Pope Francis's 2015 encyclical as the context for a natural experiment to examine the role of prior values in climate change cognition. Based on our analysis of panel data collected before and after the encyclical's release, we find that political ideology moderated views of papal credibility on climate change for those participants who were aware of the encyclical. We also find that, in some contexts, non-Catholics who were aware of the encyclical granted Pope Francis additional credibility compared to the non-Catholics who were unaware of it, yet Catholics granted the Pope high credibility regardless of encyclical awareness. Importantly, papal credibility mediated the conditional relationships between encyclical awareness and acceptance of the Pope's messages on climate change. We conclude by discussing how our results provide insight into cognitive processing of new information about controversial issues. Copyright © 2017 Elsevier B.V. All rights reserved.
Thapa, B. S.; Dahlhaug, O. G.; Thapa, B.
2016-11-01
In Francis turbine, a small clearance gap between the guide vanes and the cover plates is usually required to pivot guide vanes as a part of governing system. Deflection of cover plates and erosion of mating surfaces causes this gap to increase from its design value. The clearance gap induces the secondary flow in the distributor system. This effects the main flow at the runner inlet, which causes losses in efficiency and instability. A guide vane cascade of a low specific speed Francis turbine has been developed for experimental investigations. The test setup is able to produce similar velocity distributions at the runner inlet as that of a reference prototype turbine. The setup is designed for particle image velocimetry (PIV) measurements from the position of stay vane outlet to the position of runner inlet. In this study, velocity and pressure measurements are conducted with 2 mm clearance gap on one side of guide vane. Leakage flow is observed and measured together with pressure measurements. It is concluded that the leakage flow behaves as a jet and mixes with the main flow in cross-wise direction and forms a vortex filament. This causes non-uniform inlet flow conditions at runner blades.
The Rule of Three for Prizes in Science and the Bold Triptychs of Francis Bacon.
Goldstein, Joseph L
2016-09-22
For many scientific awards, such as Nobels and Laskers, the maximum number of recipients is three. This Rule of Three forces selection committees to make difficult decisions that increase the likelihood of singling out those individuals who open a new field and continue to lead it. The Rule of Three is reminiscent of art's three-panel triptych, a form that the modern master Francis Bacon used to distill complex stories in a bold way. Copyright © 2016 Elsevier Inc. All rights reserved.
Fukuyama, Francis
2005-01-01
Francis Fukuyama sõnul vajab riik oma arenguks esmajoones head valitsemist. Kõige olulisem on, et oleks toimiv riik, mis suudab tagada julgeoleku ja majandusarengu elementaarsed tingimused. Iraagi praeguste probleemide põhjus on selles, et USA ei suutnud ette näha, kuidas riik Saddami kukkudes kokku variseb, kuid tuleb mõista, et aeg-ajalt on USA ja kogu maailma huvides kusagil maailma nurgas riigi ehitamine tõsiselt ette võtta, ütleb autor
Modelling and Internal Fuzzy Model Power Control of a Francis Water Turbine
Directory of Open Access Journals (Sweden)
Klemen Nagode
2014-02-01
Full Text Available This paper presents dynamic modelling of a Francis turbine with a surge tank and the control of a hydro power plant (HPP. Non-linear and linear models include technical parameters and show high similarity to measurement data. Turbine power control with an internal model control (IMC is proposed, based on a turbine fuzzy model. Considering appropriate control responses in the entire area of turbine power, the model parameters of the process are determined from a fuzzy model, which are further included in the internal model controller. The results are compared to a proportional-integral (PI controller tuned with an integral absolute error (IAE objective function, and show an improved response of internal model control.
The Welcoming Pope: Images of Pope Francis in the Catholicism under mediatization
Directory of Open Access Journals (Sweden)
Tatiane MILANI
2017-12-01
Full Text Available In the context of the society in mediatization more and more the social fields are inserted in an ambiance in which borders are constantly tensioned, meaning that social practices are crossed by the logic of other fields, rather than their own place of knowing. It is perceived that the social/political/religious conjuncture interpenetrates with the logic of mediatization, and this phenomenon arouses transformations in all Christianity. The objective of this work is to analyze the circulation of Pope Francis' images in the media which formulate, in the collective imaginary, a mediated totem image of the Pope of embrace or of the welcoming Pope, what adheres to the new media technologies.
Mahmoudi, Yazdan
2016-01-01
The present paper is supposed to compare and contrast three of these masterpieces written the Renaissance period. The epyllions under study are Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus." Bush believes that "the influence…
Simulations of Steady Cavitating Flow in a Small Francis Turbine
Directory of Open Access Journals (Sweden)
Ahmed Laouari
2016-01-01
Full Text Available The turbulent flow through a small horizontal Francis turbine is solved by means of Ansys-CFX at different operating points, with the determination of the hydrodynamic performance and the best efficiency point. The flow structures at different regimes reveal a large flow eddy in the runner and a swirl in the draft tube. The use of the mixture model for the cavity/liquid two-phase flow allowed studying the influence of cavitation on the hydrodynamic performance and revealed cavitation pockets near the trailing edge of the runner and a cavitation vortex rope in the draft tube. By maintaining a constant dimensionless head and a distributor vane opening while gradually increasing the cavitation number, the output power and efficiency reached a critical point and then had begun to stabilize. The cavitation number corresponding to the safety margin of cavitation is also predicted for this hydraulic turbine.
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
International Nuclear Information System (INIS)
Chary, K.V.R.; Rastogi, V.K.; Govil, Girjesh
1994-01-01
Almost complete 1 H and 31 P resonance assignments of two coexisting conformers, duplex and an hairpin, of d-GGTACIAGTACC at 1.25mM concentration and 305 K have been achieved. The results demonstrate that the hairpin conformer has a structure with two purines I6 and A7 forming a two-base loop on a B-DNA stem. Stacking is continued on the 5'-side of the loop, with the I6 stacked upon C5. The base A7, on the 3'-side of the loop stacks partially with I6. The glycosidic angle for G8 is in the anti domain and it maintains normal Watson-Crick base-pairing with the opposite C5. (author). 28 refs., 7 figs., 2 tabs
Synthesis and AFM visualization of DNA nanostructures
International Nuclear Information System (INIS)
Mizuno, Rika; Haruta, Hirotaka; Morii, Takashi; Okada, Takao; Asakawa, Takeshi; Hayashi, Kenshi
2004-01-01
We propose a novel bottom-up approach for the fabrication of various desired nanostructures, based on self-assembly of oligonucleotides governed by Watson-Crick base pairing. Using this approach, we designed Y-shaped, closed Y-shaped, H-shaped, and hexagonal structures with oligonucleotides. These structures were autonomously fabricated simply by mixing equimolar solutions of oligonucleotides and performing hybridization. After synthesis of the nanostructures, we confirmed their validity by agarose gel electrophoresis and atomic force microscope (AFM) visualization. We detected bands of the desired molecular sizes in the gel electrophoresis and observed the desired structures by AFM analysis. We concluded that the synthesized structures were consistent with our intended design and that AFM visualization is a very useful tool for the observation of nanostructures
Chemical evolution. XXIX - Pyrimidines from hydrogen cyanide
Ferris, J. P.; Joshi, P. C.; Lawless, J. G.
1978-01-01
Compounds obtained by hydrolysis of HCN oligomers formed by allowing pH 9.2, 0.1 M cyanide to stand at room temperature for 4 to 12 months were analyzed. Hydrolysis of HCN oligomers yielded 4,5-dihydroxypyrimidine and 5-hydroxyuracil; orotic acid was detected after hydrolysis at pH 8.5. A unified pathway from diaminofumaronitrile to the pyrimidines observed is suggested. As purines, pyrimidines and amino acids are released by hydrolysis of HCN oligomers in either acidic or mildly basic aqueous solutions, they could have been formed on the primitive earth in spite of fluctuations in pH. 4,5-dihydroxypyrimidines appear to be likely candidates for incorporation into primitive nucleic acids, as they should undergo Watson-Crick hydrogen bonding with adenine.
Adam Smith e Francis Ysidro Edgeworth: uma crítica do utilitarismo
Directory of Open Access Journals (Sweden)
Solange Regina Marin
2012-01-01
Full Text Available Sugerimos, nesse trabalho, a investigação das concepções de Adam Smith e a de Francis Ysidro Edgeworth do utilitarismo. Ambas as concepções foram utilizadas para desenvolver a Ciência Econômica. Porém, também apresentaram as limitações da teoria econômica, cujas fronteiras vislumbradas pelos autores remetem para a necessidade de avaliar as ações e condutas humanas com teoria moral diferente do utilitarismo. Entendemos que a teoria moral de Adam Smith, esquecida pela história do pensamento econômico, se apresenta como alternativa e, em decorrência, uma ideia promissora para aperfeiçoar o estudo das ações e condutas ditas econômicas.
Stability of the Spanish version of the five-item Francis Scale of Attitude toward Christianity.
Miranda-Tapia, Giskar Alonso; Cogollo, Zuleima; Herazo, Edwin; Campo-Arias, Adalberto
2010-12-01
The aim of this study was to establish test-retest reliability of a Spanish version of the Francis Scale of Attitude toward Christianity (Campo-Arias, Oviedo, & Cogollo, 2009) among adolescent students in Cartagena, Colombia. A group of ninth grade students from two public schools in Colombia (N = 157) completed the five-item scale. Cronbach's alphas were .74 and .76 in the first and second administrations, respectively. Both Pearson's rho and intra-class correlation coefficient were .69. A Spanish translation of the 5-item scale had consistent stability over four weeks.
A bouquet of DNA structures: Emerging diversity
Directory of Open Access Journals (Sweden)
Mahima Kaushik
2016-03-01
Full Text Available Structural polymorphism of DNA has constantly been evolving from the time of illustration of the double helical model of DNA by Watson and Crick. A variety of non-canonical DNA structures have constantly been documented across the globe. DNA attracted worldwide attention as a carrier of genetic information. In addition to the classical Watson–Crick duplex, DNA can actually adopt diverse structures during its active participation in cellular processes like replication, transcription, recombination and repair. Structures like hairpin, cruciform, triplex, G-triplex, quadruplex, i-motif and other alternative non-canonical DNA structures have been studied at length and have also shown their in vivo occurrence. This review mainly focuses on non-canonical structures adopted by DNA oligonucleotides which have certain prerequisites for their formation in terms of sequence, its length, number and orientation of strands along with varied solution conditions. This conformational polymorphism of DNA might be the basis of different functional properties of a specific set of DNA sequences, further giving some insights for various extremely complicated biological phenomena. Many of these structures have already shown their linkages with diseases like cancer and genetic disorders, hence making them an extremely striking target for structure-specific drug designing and therapeutic applications.
The Visual Shock of Francis Bacon: An essay in neuroesthetics
Directory of Open Access Journals (Sweden)
Semir eZeki
2013-12-01
Full Text Available In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a visual shock. We explore what this means in terms of brain activity and what insights into the brain’s visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs and cars. We show that viewing face and house stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his visual shock because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.
The "Visual Shock" of Francis Bacon: an essay in neuroesthetics.
Zeki, Semir; Ishizu, Tomohiro
2013-01-01
In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a "visual shock."We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his "visual shock" because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.
A Journey in Science: Cell-Cycle Control.
Nurse, Paul
2017-05-24
Real innovations in medicine and science are historic and singular; the stories behind each occurrence are precious. At Molecular Medicine we have established the Anthony Cerami Award in Translational Medicine to document and preserve these histories. The monographs recount the seminal events as told in the voice of the original investigators who provided the crucial early insight. These essays capture the essence of discovery, chronicling the birth of ideas that created new fields of research; and launched trajectories that persisted and ultimately influenced how disease is prevented, diagnosed, and treated. In this volume, the Cerami Award Monograph is by Paul Nurse, Director, The Francis Crick Institute in London, UK. A visionary in the field of cell biology, this is the story of Dr. Nurse's scientific journey.
On the upper part load vortex rope in Francis turbine: Experimental investigation
International Nuclear Information System (INIS)
Nicolet, C; Zobeiri, A; Maruzewski, P; Avellan, F
2010-01-01
The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and
On the upper part load vortex rope in Francis turbine: Experimental investigation
Energy Technology Data Exchange (ETDEWEB)
Nicolet, C [Power Vision Engineering sarl Ch. des Champs-Courbes 1, CH-1024 Ecublens (Switzerland); Zobeiri, A; Maruzewski, P; Avellan, F, E-mail: christophe.nicolet@powervision-eng.c [Laboratory for Hydraulic Machines, Ecole polytechnique federale de Lausanne, EPFL Av. de Cour 33bis, CH-1007 Lausanne (Switzerland)
2010-08-15
The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and
On the physical mechanisms governing self-excited pressure surge in Francis turbines
International Nuclear Information System (INIS)
Müller, A; Favrel, A; Landry, C; Yamamoto, K; Avellan, F
2014-01-01
The required operating range for hydraulic machines is continually extended in an effort to integrate renewable energy sources with unsteady power outputs into the existing electrical grid. The off-design operation however brings forth unfavorable flow patterns in the machine, causing dynamic problems involving cavitation, which may represent a limiting factor to the energy production. In Francis turbines it is observed that the self-excited oscillation of a vortex rope in the draft tube cone prevents the delivery of maximum power when required. This phenomenon is referred to as full load pressure surge and has been the object of extensive research during the past decades. Several contributions deepened its understanding through measurement and simulation of the local flow properties and the global stability parameters. The draft tube pressure level and the runner outlet swirl are identified as key variables in the modelling of the vortex rope dynamics. Recently, a cyclic appearance of blade cavitation has been observed at overload conditions in a multiphase numerical simulation coupling the runner and the draft tube. From the analysis of the simulation it becomes obvious that the cyclic appearance of blade cavitation has a direct effect on the runner outlet swirl, thus introducing an additional interaction mechanism that is not accounted for in formerly published models. For the presented work, the results of this numerical study are confirmed experimentally on a reduced scale model of a Francis turbine. Several wall pressure measurements in the draft tube cone are performed, together with high speed visualizations of the vortex rope and the blade cavitation. The flow swirl is calculated based on Laser Doppler Velocimetry measurements. A possible mechanism explaining the coupling between the self-excited pressure and vortex rope oscillation and the cyclic appearance of the blade cavitation is proposed. Furthermore, the streamwise propagation speed of the flow
On the upper part load vortex rope in Francis turbine: Experimental investigation
Nicolet, C.; Zobeiri, A.; Maruzewski, P.; Avellan, F.
2010-08-01
The swirling flow developing in Francis turbine draft tube under part load operation leads to pressure fluctuations usually in the range of 0.2 to 0.4 times the runner rotational frequency resulting from the so-called vortex breakdown. For low cavitation number, the flow features a cavitation vortex rope animated with precession motion. Under given conditions, these pressure fluctuations may lead to undesirable pressure fluctuations in the entire hydraulic system and also produce active power oscillations. For the upper part load range, between 0.7 and 0.85 times the best efficiency discharge, pressure fluctuations may appear in a higher frequency range of 2 to 4 times the runner rotational speed and feature modulations with vortex rope precession. It has been pointed out that for this particular operating point, the vortex rope features elliptical cross section and is animated of a self-rotation. This paper presents an experimental investigation focusing on this peculiar phenomenon, defined as the upper part load vortex rope. The experimental investigation is carried out on a high specific speed Francis turbine scale model installed on a test rig of the EPFL Laboratory for Hydraulic Machines. The selected operating point corresponds to a discharge of 0.83 times the best efficiency discharge. Observations of the cavitation vortex carried out with high speed camera have been recorded and synchronized with pressure fluctuations measurements at the draft tube cone. First, the vortex rope self rotation frequency is evidenced and the related frequency is deduced. Then, the influence of the sigma cavitation number on vortex rope shape and pressure fluctuations is presented. The waterfall diagram of the pressure fluctuations evidences resonance effects with the hydraulic circuit. The time evolution of the vortex rope volume is compared with pressure fluctuations time evolution using image processing. Finally, the influence of the Froude number on the vortex rope shape and
The medical philosophy of Francis Bacon (1561-1626).
Boss, J
1978-01-01
Francis Bacon's view of man is dualistic but, although he takes note of mental faculties, he makes the relation between mind and body, rather than the substance of mind, the basis for enquiry into mental processes and, more particularly, for the medically relevant study of mind. (He uses "mind" and "soul" as equivalent terms.) The healing of the body requires study of the body, and the ineffectiveness of physicians is due to their failure in this respect rather than to the body's complexity. To learn about the body requires clinical observation and recording, together with the comparison of bodies, experiments on living animals and attention to pathological changes. The aims of medicine should include not only the restoration of health but also the relief of suffering and they are not to be limited by putting aside a disease as incurable. To learn from treatment it must be fixed in its ordering with controlled and limited variation. Bacon has no separation of medicine from natural science; his philosophy of medicine is his general philosophy of the advancement of knowledge, but limited to a particular field of application. If medicine is separated from natural philosophy it is changed wholly or greatly into empiricism.
Francis, L J; Hermans, C A
2000-02-01
A sample of 1,021 young people attending Years 7, 8, 9, 10, and 11 at Catholic secondary schools within the state-maintained sector completed the Dutch translation of the Francis Scale of Attitude toward Christianity. The data support its reliability and validity and commend it for further use in studies conducted among young people in The Netherlands.