Skin Barrier Function and Allergens
DEFF Research Database (Denmark)
Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan
2016-01-01
The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...
Permanent isolation surface barrier: Functional performance
International Nuclear Information System (INIS)
Wing, N.R.
1993-10-01
This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release
A chaos wolf optimization algorithm with self-adaptive variable step-size
Zhu, Yong; Jiang, Wanlu; Kong, Xiangdong; Quan, Lingxiao; Zhang, Yongshun
2017-10-01
To explore the problem of parameter optimization for complex nonlinear function, a chaos wolf optimization algorithm (CWOA) with self-adaptive variable step-size was proposed. The algorithm was based on the swarm intelligence of wolf pack, which fully simulated the predation behavior and prey distribution way of wolves. It possessed three intelligent behaviors such as migration, summons and siege. And the competition rule as "winner-take-all" and the update mechanism as "survival of the fittest" were also the characteristics of the algorithm. Moreover, it combined the strategies of self-adaptive variable step-size search and chaos optimization. The CWOA was utilized in parameter optimization of twelve typical and complex nonlinear functions. And the obtained results were compared with many existing algorithms, including the classical genetic algorithm, the particle swarm optimization algorithm and the leader wolf pack search algorithm. The investigation results indicate that CWOA possess preferable optimization ability. There are advantages in optimization accuracy and convergence rate. Furthermore, it demonstrates high robustness and global searching ability.
A study on the quantitative evaluation of skin barrier function
Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko
2015-03-01
We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Johan Agren
2010-01-01
Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.
A chaos wolf optimization algorithm with self-adaptive variable step-size
Directory of Open Access Journals (Sweden)
Yong Zhu
2017-10-01
Full Text Available To explore the problem of parameter optimization for complex nonlinear function, a chaos wolf optimization algorithm (CWOA with self-adaptive variable step-size was proposed. The algorithm was based on the swarm intelligence of wolf pack, which fully simulated the predation behavior and prey distribution way of wolves. It possessed three intelligent behaviors such as migration, summons and siege. And the competition rule as “winner-take-all” and the update mechanism as “survival of the fittest” were also the characteristics of the algorithm. Moreover, it combined the strategies of self-adaptive variable step-size search and chaos optimization. The CWOA was utilized in parameter optimization of twelve typical and complex nonlinear functions. And the obtained results were compared with many existing algorithms, including the classical genetic algorithm, the particle swarm optimization algorithm and the leader wolf pack search algorithm. The investigation results indicate that CWOA possess preferable optimization ability. There are advantages in optimization accuracy and convergence rate. Furthermore, it demonstrates high robustness and global searching ability.
Han, Seung Hoon; Park, Ji Woong
2017-11-01
The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor
DEFF Research Database (Denmark)
2016-01-01
Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...
Free energy barriers to evaporation of water in hydrophobic confinement.
Sharma, Sumit; Debenedetti, Pablo G
2012-11-08
We use umbrella sampling Monte Carlo and forward and reverse forward flux sampling (FFS) simulation techniques to compute the free energy barriers to evaporation of water confined between two hydrophobic surfaces separated by nanoscopic gaps, as a function of the gap width, at 1 bar and 298 K. The evaporation mechanism for small (1 × 1 nm(2)) surfaces is found to be fundamentally different from that for large (3 × 3 nm(2)) surfaces. In the latter case, the evaporation proceeds via the formation of a gap-spanning tubular cavity. The 1 × 1 nm(2) surfaces, in contrast, are too small to accommodate a stable vapor cavity. Accordingly, the associated free energy barriers correspond to the formation of a critical-sized cavity for sufficiently large confining surfaces, and to complete emptying of the gap region for small confining surfaces. The free energy barriers to evaporation were found to be of O(20kT) for 14 Å gaps, and to increase by approximately ~5kT with every 1 Å increase in the gap width. The entropy contribution to the free energy of evaporation was found to be independent of the gap width.
Water and contaminant movement: migration barriers
International Nuclear Information System (INIS)
Lane, L.J.; Nyhan, J.W.
1984-11-01
Migration barriers are used in shallow land burial facilities to slow or stop the movement of water and contaminants and are discussed here as a single component embedded in a complex environmental system. Analytical solutions to solute transport equations are used to approximate the behavior of migration barriers and to derive design criteria for control of subsurface water and contaminant migration. Various types of migration barriers are compared and design recommendations are made for shallow land burial trench caps and liners. Needed improvements and suggested field experiments for future designs of migration barriers are then discussed relative to the management of low-level radioactive wastes
Energy Technology Data Exchange (ETDEWEB)
Elrawemi, Mohamed, E-mail: Mohamed.elrawemi@hud.ac.uk [EPSRC Centre for Innovative Manufacturing in Advanced Metrology, School of Computing and Engineering, University of Huddersfield, Huddersfield (United Kingdom); Blunt, Liam; Fleming, Leigh [EPSRC Centre for Innovative Manufacturing in Advanced Metrology, School of Computing and Engineering, University of Huddersfield, Huddersfield (United Kingdom); Bird, David, E-mail: David.Bird@uk-cpi.com [Centre for Process Innovation Limited, Sedgefield, County Durham (United Kingdom); Robbins, David [Centre for Process Innovation Limited, Sedgefield, County Durham (United Kingdom); Sweeney, Francis [EPSRC Centre for Innovative Manufacturing in Advanced Metrology, School of Computing and Engineering, University of Huddersfield, Huddersfield (United Kingdom)
2014-11-03
Transparent barrier films such as Al{sub 2}O{sub 3} used for prevention of oxygen and/or water vapour permeation are the subject of increasing research interest when used for the encapsulation of flexible photovoltaic modules. However, the existence of micro-scale defects in the barrier surface topography has been shown to have the potential to facilitate water vapour ingress, thereby reducing cell efficiency and causing internal electrical shorts. Previous work has shown that small defects (≤ 3 μm lateral dimension) were less significant in determining water vapour ingress. In contrast, larger defects (≥ 3 μm lateral dimension) seem to be more detrimental to the barrier functionality. Experimental results based on surface topography segmentation analysis and a model presented in this paper will be used to test the hypothesis that the major contributing defects to water vapour transmission rate are small numbers of large defects. The model highlighted in this study has the potential to be used for gaining a better understanding of photovoltaic module efficiency and performance. - Highlights: • A model of water vapour permeation through barrier defects is presented. • The effect of the defects on the water vapour permeability is investigated. • Defect density correlates with water vapour permeability. • Large defects may dominate the permeation properties of the barrier film.
Evaluating the Performance of a Surface Barrier on Reducing Soil-Water Flow
Energy Technology Data Exchange (ETDEWEB)
Zhang, Z. F.; Strickland, Christopher E.; Field, Jim G.; Parker, Danny L.; Clayton, Ray E.
2012-08-31
One of the most common effective techniques for contaminant remediation in the vadose zone is to use a surface barrier to reduce or eliminate soil-water flow to reduce the contaminant flux to the underlying groundwater. Confirming the reduction of the soil-water flux rate is challenging because of the difficulty of determining the very low soil-water flux beneath the barrier. We propose a hydraulic-conductivity factor, fK, as a conservative indicator for quantifying the reduction of soil-water flow. The factor can be calculated using the measured soil-water content or pressure but does not require the knowledge of the saturated hydraulic conductivity or the hydraulic gradient. The formulas were tested by comparing with changes in hydraulic conductivity, K, from a drainage experiment. The pressure-based formula was further applied to evaluate the performance of the interim surface barrier at T Tank Farm on Hanford Site. Three years after barrier emplacement, the hydraulic conductivity decreased by a factor between 3.8 and 13.0 at the 1-, 2- and 5-m depths. The difference between the conductivity-reduction factor and the flux-rate-reduction factor, fq, was quantified with a numerical simulation. With the calculated fK, the numerically determined fK/fq ratio, and the assumed pre-barrier soil-water flux rate of 100 mm yr-1, the estimated soil-water flux rate 3 years after barrier emplacement was no more than 8.5 mm yr-1 at or above the 5-m depth.
Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.
Draelos, Zoe D
2005-01-01
The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.
Thiolated silicone oils as adhesive skin protectants for improved barrier function.
Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A
2016-06-01
The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier
Energy Technology Data Exchange (ETDEWEB)
Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.
2009-09-01
A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected
The important role of stratum corneum lipids for the cutaneous barrier function.
van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A
2014-03-01
The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Effects of industrial detergents on the barrier function of human skin
DEFF Research Database (Denmark)
Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner
2000-01-01
Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Jungerstedt, J; Hellgren, Lars; Drachmann, Tue
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...
A nuclide transfer model for barriers of the seabed repository using response function
International Nuclear Information System (INIS)
Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo
1996-01-01
A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)
Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina
2016-02-01
A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
A sea water barrier to coral gene flow.
Lessios, H A
2012-11-01
Land is not the only barrier to dispersal encountered by marine organisms. For sedentary shallow water species, there is an additional, marine barrier, 5000 km of uninterrupted deep-water stretch between the central and the eastern Pacific. This expanse of water, known as the ‘Eastern Pacific Barrier’, has been separating faunas of the two oceanic regions since the beginning of the Cenozoic. Species with larvae that cannot stay in the plankton for the time it takes to cross between the two sides have been evolving independently. That the eastern Pacific does not share species with the rest of the Pacific was obvious to naturalists two centuries ago (Darwin 1860). Yet, this rule has exceptions. A small minority of species are known to straddle the Eastern Pacific Barrier. One such exception is the scleractinian coral Porites lobata (Fig. 1). This species is spread widely throughout the Indo-Pacific, where it is one of the major reef-builders, but it is also encountered in the eastern Pacific. Are eastern and central Pacific populations of this coral connected by gene flow? In this issue of Molecular Ecology, Baums et al. (2012) use microsatellite data to answer this question. They show that P. lobata populations in the eastern Pacific are cut off from genetic influx from the rest of the Pacific. Populations within each of the two oceanic regions are genetically connected (though those in the Hawaiian islands are also isolated). Significantly, the population in the Clipperton Atoll, the westernmost island in the eastern Pacific, genetically groups with populations from the central Pacific, suggesting that crossing the Eastern Pacific Barrier by P. lobata propagules does occasionally occur.
Standards for the Protection of Skin Barrier Function.
Giménez-Arnau, Ana
2016-01-01
The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.
Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen
2014-07-01
The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.
Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K
2008-11-15
Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.
Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.
2003-01-01
Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and
Volynets, Valentina; Louis, Sandrine; Pretz, Dominik; Lang, Lisa; Ostaff, Maureen J; Wehkamp, Jan; Bischoff, Stephan C
2017-05-01
Background: The consumption of a Western-style diet (WSD) and high fructose intake are risk factors for metabolic diseases. The underlying mechanisms are largely unclear. Objective: To unravel the mechanisms by which a WSD and fructose promote metabolic disease, we investigated their effects on the gut microbiome and barrier function. Methods: Adult female C57BL/6J mice were fed a sugar- and fat-rich WSD or control diet (CD) for 12 wk and given access to tap water or fructose-supplemented water. The microbiota was analyzed with the use of 16S rRNA gene sequencing. Barrier function was studied with the use of permeability tests, and endotoxin, mucus thickness, and gene expressions were measured. Results: The WSD increased body weight gain but not endotoxin translocation compared with the CD. In contrast, high fructose intake increased endotoxin translocation 2.6- and 3.8-fold in the groups fed the CD + fructose and WSD + fructose, respectively, compared with the CD group. The WSD + fructose treatment also induced a loss of mucus thickness in the colon (-46%) and reduced defensin expression in the ileum and colon. The lactulose:mannitol ratio in the WSD + fructose mice was 1.8-fold higher than in the CD mice. Microbiota analysis revealed that fructose, but not the WSD, increased the Firmicutes:Bacteroidetes ratio by 88% for CD + fructose and 63% for WSD + fructose compared with the CD group. Bifidobacterium abundance was greater in the WSD mice than in the CD mice (63-fold) and in the WSD + fructose mice than in the CD + fructose mice (330-fold). Conclusions: The consumption of a WSD or high fructose intake differentially affects gut permeability and the microbiome. Whether these differences are related to the distinct clinical outcomes, whereby the WSD primarily promotes weight gain and high fructose intake causes barrier dysfunction, needs to be investigated in future studies. © 2017 American Society for Nutrition.
Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.
Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T
2012-01-01
Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.
Sphingosine 1-Phosphate (S1P) Carrier-dependent Regulation of Endothelial Barrier
Wilkerson, Brent A.; Grass, G. Daniel; Wing, Shane B.; Argraves, W. Scott; Argraves, Kelley M.
2012-01-01
Sphingosine 1-phosphate (S1P) is a blood-borne lysosphingolipid that acts to promote endothelial cell (EC) barrier function. In plasma, S1P is associated with both high density lipoproteins (HDL) and albumin, but it is not known whether the carriers impart different effects on S1P signaling. Here we establish that HDL-S1P sustains EC barrier longer than albumin-S1P. We showed that the sustained barrier effects of HDL-S1P are dependent on signaling by the S1P receptor, S1P1, and involve persistent activation of Akt and endothelial NOS (eNOS), as well as activity of the downstream NO target, soluble guanylate cyclase (sGC). Total S1P1 protein levels were found to be higher in response to HDL-S1P treatment as compared with albumin-S1P, and this effect was not associated with increased S1P1 mRNA or dependent on de novo protein synthesis. Several pieces of evidence indicate that long term EC barrier enhancement activity of HDL-S1P is due to specific effects on S1P1 trafficking. First, the rate of S1P1 degradation, which is proteasome-mediated, was slower in HDL-S1P-treated cells as compared with cells treated with albumin-S1P. Second, the long term barrier-promoting effects of HDL-S1P were abrogated by treatment with the recycling blocker, monensin. Finally, cell surface levels of S1P1 and levels of S1P1 in caveolin-enriched microdomains were higher after treatment with HDL-S1P as compared with albumin-S1P. Together, the findings reveal S1P carrier-specific effects on S1P1 and point to HDL as the physiological mediator of sustained S1P1-PI3K-Akt-eNOS-sGC-dependent EC barrier function. PMID:23135269
de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus
2015-09-15
The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.
The barrier to ice nucleation in monatomic water
Prestipino, Santi
2018-03-01
Crystallization from a supercooled liquid initially proceeds via the formation of a small solid embryo (nucleus), which requires surmounting an activation barrier. This phenomenon is most easily studied by numerical simulation, using specialized biased-sampling techniques to overcome the limitations imposed by the rarity of nucleation events. Here, I focus on the barrier to homogeneous ice nucleation in supercooled water, as represented by the monatomic-water model, which in the bulk exhibits a complex interplay between different ice structures. I consider various protocols to identify solidlike particles on a computer, which perform well enough for the Lennard-Jones model, and compare their respective impact on the shape and height of the nucleation barrier. It turns out that the effect is stronger on the nucleus size than on the barrier height. As a by-product of the analysis, I determine the structure of the nucleation cluster, finding that the relative amount of ice phases in the cluster heavily depends on the method used for classifying solidlike particles. Moreover, the phase which is most favored during the earlier stages of crystallization may happen, depending on the nucleation coordinate adopted, to be different from the stable polymorph. Therefore, the quality of a reaction coordinate cannot be assessed simply on the basis of the barrier height obtained. I explain how this outcome is possible and why it just points out the shortcoming of collective variables appropriate to simple fluids in providing a robust method of particle classification for monatomic water.
Beeswax–chitosan emulsion coated paper with enhanced water vapor barrier efficiency
International Nuclear Information System (INIS)
Zhang, Weiwei; Xiao, Huining; Qian, Liying
2014-01-01
Graphical abstract: - Highlights: • The water vapor barrier efficiency of paper was enhanced via green-based emulsion coating. • Extremely high lipid content in the emulsion coating layer was firstly utilized to reduce WVTR in emulsion-based film. • A controlled WVTR of beeswax–chitosan emulsion coating could be obtained by dying at specific temperature. - Abstract: For lipid–hydrocolloid emulsion based film, the increase of lipid amount would improve its water vapor barrier property, but also reduce the mechanical strength of the film in the meantime thus leading to a compromised lipid content in the film. However, when the emulsion is coated on paper surface, more lipid could be used for emulsion preparation to enhance the moisture resistance without considering the weakened strength of the film induced by lipid, because the mechanical properties of emulsion coated paper is mainly governed by the strength of base paper instead of the coating layer. In this study, beeswax–chitosan emulsion was first prepared and then coated on paper surface to improve paper's water vapor barrier and water resistance properties. The range and variance analysis of orthogonal test design showed that the order of priorities of the factors accordingly was beeswax solid content, drying temperature and chitosan concentration. The effect of drying temperature on water vapor transmission rate (WVTR) and water contact angle of coated paper was further investigated using 1.2 wt% chitosan and 96% beeswax solid content in the coating layer. The results indicated that water vapor barrier property was in accordance with the density of the coating layer. Atomic force microscope (AFM) was also used to characterize the surface morphology and explain the hydrophobicity of beeswax–chitosan coated paper. It was found that surface beeswax particles melted to wrinkle at high drying temperatures, while roughness values maintained at micro-scale over the temperature range investigated
White, Sian; Kuper, Hannah; Itimu-Phiri, Ambumulire; Holm, Rochelle; Biran, Adam
2016-01-01
Globally, millions of people lack access to improved water, sanitation and hygiene (WASH). Disabled people, disadvantaged both physically and socially, are likely to be among those facing the greatest inequities in WASH access. This study explores the WASH priorities of disabled people and uses the social model of disability and the World Health Organization's International Classification of Functioning, Disability and Health (ICF) framework to look at the relationships between impairments, contextual factors and barriers to WASH access. 36 disabled people and 15 carers from urban and rural Malawi were purposively selected through key informants. The study employed a range of qualitative methods including interviews, emotion mapping, free-listing of priorities, ranking, photo voice, observation and WASH demonstrations. A thematic analysis was conducted using nVivo 10. WASH access affected all participants and comprised almost a third of the challenges of daily living identified by disabled people. Participants reported 50 barriers which related to water and sanitation access, personal and hand hygiene, social attitudes and participation in WASH programs. No two individuals reported facing the same set of barriers. This study found that being female, being from an urban area and having limited wealth and education were likely to increase the number and intensity of the barriers faced by an individual. The social model proved useful for classifying the majority of barriers. However, this model was weaker when applied to individuals who were more seriously disabled by their body function. This study found that body function limitations such as incontinence, pain and an inability to communicate WASH needs are in and of themselves significant barriers to adequate WASH access. Understanding these access barriers is important for the WASH sector at a time when there is a global push for equitable access.
Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I
2000-08-01
The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.
200-BP-1 Prototype Hanford Barrier -- 15 Years of Performance Monitoring
Energy Technology Data Exchange (ETDEWEB)
Ward, Anderson L.; Draper, Kathryn E.; Link, Steven O.; Clayton, Ray E.
2011-09-30
Monitoring is an essential component of engineered barrier system design and operation. A composite capacitive cover, including a capillary break and an evapotranspiration (ET) barrier at the Hanford Site, is generating data that can be used to help resolve these issues. The prototype Hanford barrier was constructed over the 216-B-57 Crib in 1994 to evaluate surface-barrier constructability, construction costs, and physical and hydrologic performance at the field scale. The barrier has been routinely monitored between November 1994 and September 1998 as part of a Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) treatability test of barrier performance for the 200 BP 1 Operable Unit. Since FY 1998, monitoring has focused on a more limited set of key water balance, stability, and biotic parameters. In FY 2009, data collection was focused on: (1) water-balance monitoring, consisting of precipitation, runoff, soil moisture storage, and drainage measurements with evapotranspiration calculated by difference; (2) stability monitoring, consisting of asphalt-layer-settlement, basalt-side-slope-stability, and surface-elevation measurements; (3) vegetation dynamics; and (4) animal use. September 2009 marked 15 years since the start of monitoring and the collection of performance data. This report describes the results of monitoring activities during the period October 1, 2008, through September 30, 2009, and summarizes the 15 years of performance data collected from September 1994 through September 2009.
Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young
2017-08-23
A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.
Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.
Kawano, Ken-Ichi; Umemura, Kazuo
2013-05-01
The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.
Current practice and guidelines for the safe design of water barrier pillars
CSIR Research Space (South Africa)
Rangasamy, T
2001-08-01
Full Text Available adjacent to barrier pillars was conducted to ascertain the relationship between compartment water head, barrier pillar width and flow rates for combinations of roof bound, coal bound and floor bound flow. The results obtained from the instrumentation... pillars. A survey of South African Collieries revealed that water leakage associated with barrier pillars can be classed into seven predominant geotechnical flow categories. Through extensive numerical modelling and case history matching, barrier pillar...
The role of plants on isolation barrier systems
International Nuclear Information System (INIS)
Link, S.O.; Downs, J.L.; Waugh, W.J.
1994-11-01
Surface barriers are used to isolate buried wastes from the environment. Most have been built for short-term isolation. The need to isolate radioactive wastes from the environment requires that the functional integrity of a barrier be maintained for thousands of years. Barrier function strongly depends on vegetation. Plants reduce wind and water erosion and minimize drainage, but may transport contaminants if roots extend into buried wastes. Our review of the function of plants on surface barriers focuses on the role of plants across mesic to arid environments and gives special consideration to studies done at Hanford. The Hanford Barrier Development Program was created to design and test an earthen cover system to inhibit water infiltration, plant and animal intrusion, and wind and water erosion, while isolating buried wastes for at least 1000 years. Studies at the Hanford have shown that plants will significantly interact with the barrier. Plants transpire soil water back into the atmosphere. Deep-rooted perennials best recycle water; soil water may drain through the root zone of shallow-rooted annuals. Lysimeter studies indicate that a surface layer of fine soil with deep-rooted plants precludes drainage even with three times normal precipitation. The presence of vegetation greatly reduces water and wind erosion, but deep-rooted plants pose a threat of biointrusion and contaminant transport. The Hanford barrier includes a buried rock layer and asphalt layer to prevent biointrusion
Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya
2016-09-01
Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.
Photocured epoxy/graphene nanocomposites with enhanced water vapor barrier properties
Periolatto, M.; Sangermano, M.; Spena, P. Russo
2016-05-01
A transparent, water vapor barrier film made of an epoxy resin and graphene oxide (GO) was synthesized by photopolymerization process. The epoxy/GO film with just 0.05 wt% GO gives a 93% WVTR reduction with respect to the pristine polymer, reaching barrier properties better than other polymer composites containing higher amounts of graphene. The excellent water vapor barrier is attributed to the good dispersion of GO in the polymer matrix. Moreover, GO significantly enhances the toughness and the damping capacity of the epoxy resins. The hybrid film can have potential applications in anticorrosive coatings, electronic devices, pharmaceuticals and food packaging.
Photocured epoxy/graphene nanocomposites with enhanced water vapor barrier properties
Energy Technology Data Exchange (ETDEWEB)
Periolatto, M.; Spena, P. Russo [Faculty of Science and Technology, Free University of Bozen-Bolzano, Piazza Università 5, Bolzano (Italy); Sangermano, M. [Dipartimento di Scienza Applicata e Tecnologia, Politecnico di Torino, C.so Duca degli Abruzzi 24, Torino (Italy)
2016-05-18
A transparent, water vapor barrier film made of an epoxy resin and graphene oxide (GO) was synthesized by photopolymerization process. The epoxy/GO film with just 0.05 wt% GO gives a 93% WVTR reduction with respect to the pristine polymer, reaching barrier properties better than other polymer composites containing higher amounts of graphene. The excellent water vapor barrier is attributed to the good dispersion of GO in the polymer matrix. Moreover, GO significantly enhances the toughness and the damping capacity of the epoxy resins. The hybrid film can have potential applications in anticorrosive coatings, electronic devices, pharmaceuticals and food packaging.
Photocured epoxy/graphene nanocomposites with enhanced water vapor barrier properties
International Nuclear Information System (INIS)
Periolatto, M.; Spena, P. Russo; Sangermano, M.
2016-01-01
A transparent, water vapor barrier film made of an epoxy resin and graphene oxide (GO) was synthesized by photopolymerization process. The epoxy/GO film with just 0.05 wt% GO gives a 93% WVTR reduction with respect to the pristine polymer, reaching barrier properties better than other polymer composites containing higher amounts of graphene. The excellent water vapor barrier is attributed to the good dispersion of GO in the polymer matrix. Moreover, GO significantly enhances the toughness and the damping capacity of the epoxy resins. The hybrid film can have potential applications in anticorrosive coatings, electronic devices, pharmaceuticals and food packaging.
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
The intestinal barrier function and its involvement in digestive disease
Directory of Open Access Journals (Sweden)
Eloísa Salvo-Romero
2015-11-01
Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.
200-BP-1 Prototype Hanford Barrier Annual Monitoring Report for Fiscal Year 2004
Energy Technology Data Exchange (ETDEWEB)
Ward, Andy L.; Linville, Jenifer K.; Keller, Jason M.; Seedahmed, Gamal H.
2005-01-03
In FY 2004, monitoring of the prototype Hanford barrier focused on barrier stability, vegetative cover, evidence of plant and animal intrusion, and the main components of the water balance. Monitored water-balance components included precipitation, runoff, storage, drainage, and deep percolation. Precipitation in FY 2004 was 26 percent less than in FY 2003 but was still higher than normal. The seasonal distribution in precipitation was also different from the previous year with a 43 percent reduction in spring precipitation and a 46 percent increase in summer precipitation. The cumulative amount of water received from October 1994, through September 2004, was 2,559.58 mm on the northern half of the barrier, which is the formerly irrigated treatment, and 1,886.71 mm on the southern non-irrigated treatments. Water storage continued to show a cyclic pattern, increasing in the winter and declining in the spring and summer to a lower limit of about 100 mm in response to evapotranspiration. The 600-mm design storage has never been exceeded. Total drainage from the soil-covered plots range from 2.9E-4 mm to 0.22 mm or 0.003 6 0.004 percent of precipitation. Side-slope drainage was much higher at 20.9 6 2.3 percent of precipitation from the gravel and 18.6 6 5.1 percent from the riprap. There was no runoff from the barrier, but runoff from the BY tank farm following a thunderstorm in May eroded a 45-inch-deep channel into the structural fill at the toe of the riprap slope. Above-asphalt and below-asphalt moisture measurements show no evidence of deep percolation of water. Topographic surveys were conducted on the barrier surface, including the two settlement gauges and 12 creep gauges on the riprap slope using aerial photogrammetry (AP) and a global positioning system (GPS). Comparing the aerial photogrammetry (AP) and global positioning system (GPS) surveys with the traditional survey shows the barrier and side slopes to be stable. Both AP and GPS show potential for
A study on water infiltration barriers with compacted layered soils
International Nuclear Information System (INIS)
Umeda, Y.; Komori, K.; Fujiwara, A.
1993-01-01
In shallow-ground disposal of low-level radioactive wastes, water movements due to natural processes in the soil covering the disposal facility must be properly controlled. A capillary barrier with compacted layered soils can provide an effective means of controlling water movement in the soil covering placed on a low-level radioactive waste disposal facility. An experiment was performed to determine the effectiveness of a full-scale fill as a capillary barrier. The fill used in the experiment was constructed of compacted layers of clay, fine sand, and gravel. Man-made rain was caused to fall on the surfaces of the fill to observe the infiltration of rainwater into the fill and to measure the amount of water drained from within. The experiment established the effectiveness of the capillary barrier
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...
Functional barriers: Properties and evaluation
Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.
2005-01-01
Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of
Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua
2018-01-01
Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance
Ohno, Yusuke
2017-01-01
The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.
Proposing nanofiltration as acceptable barrier for organic contaminants in water reuse
Yangali-Quintanilla, Victor
2010-10-01
For water reuse applications, " tight" nanofiltration (NF) membranes (of polyamide) as an alternative to reverse osmosis (RO) can be an effective barrier against pharmaceuticals, pesticides, endocrine disruptors and other organic contaminants. The use of RO in existing water reuse facilities is addressed and questioned, taking into consideration that tight NF can be a more cost-effective and efficient technology to target the problem of organic contaminants. It was concluded that tight NF is an acceptable barrier for organic contaminants because its removal performance approaches that of RO, and because of reduced operation and maintenance (O&M) costs in long-term project implementation. Average removal of neutral compounds (including 1,4-dioxane) was about 82% and 85% for NF and RO, respectively, and average removal of ionic compounds was about 97% and 99% for NF and RO, respectively. In addition, " loose" NF after aquifer recharge and recovery (ARR) can be an effective barrier against micropollutants with removals over 90%. When there is the presence of difficult to remove organic contaminants such as NDMA and 1,4-dioxane; for 1,4-dioxane, source control or implementation of treatment processes in wastewater treatment plants will be an option; for NDMA, a good strategy is to limit its formation during wastewater treatment, but there is evidence that biodegradation of NDMA can be achieved during ARR. © 2010 Elsevier B.V.
Directory of Open Access Journals (Sweden)
van Doorn Ruben
2012-06-01
Full Text Available Abstract Background The sphingosine 1-phosphate (S1P receptor modulator FTY720P (Gilenya® potently reduces relapse rate and lesion activity in the neuroinflammatory disorder multiple sclerosis. Although most of its efficacy has been shown to be related to immunosuppression through the induction of lymphopenia, it has been suggested that a number of its beneficial effects are related to altered endothelial and blood–brain barrier (BBB functionality. However, to date it remains unknown whether brain endothelial S1P receptors are involved in the maintenance of the function of the BBB thereby mediating immune quiescence of the brain. Here we demonstrate that the brain endothelial receptor S1P5 largely contributes to the maintenance of brain endothelial barrier function. Methods We analyzed the expression of S1P5 in human post-mortem tissues using immunohistochemistry. The function of S1P5 at the BBB was assessed in cultured human brain endothelial cells (ECs using agonists and lentivirus-mediated knockdown of S1P5. Subsequent analyses of different aspects of the brain EC barrier included the formation of a tight barrier, the expression of BBB proteins and markers of inflammation and monocyte transmigration. Results We show that activation of S1P5 on cultured human brain ECs by a selective agonist elicits enhanced barrier integrity and reduced transendothelial migration of monocytes in vitro. These results were corroborated by genetically silencing S1P5 in brain ECs. Interestingly, functional studies with these cells revealed that S1P5 strongly contributes to brain EC barrier function and underlies the expression of specific BBB endothelial characteristics such as tight junctions and permeability. In addition, S1P5 maintains the immunoquiescent state of brain ECs with low expression levels of leukocyte adhesion molecules and inflammatory chemokines and cytokines through lowering the activation of the transcription factor NFκB. Conclusion Our
Directory of Open Access Journals (Sweden)
Pasricha J
1991-01-01
Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.
Manufacture and test of prototype water pipe chase barrier in ITER Magnet Feeder system
Energy Technology Data Exchange (ETDEWEB)
Lu, Kun, E-mail: lukun@ipp.ac.cn [Institute of Plasma Physics, Shushan Hu Road 350, Hefei, Anhui (China); Wen, Xinjie; Liu, Chen; Song, Yuntao [Institute of Plasma Physics, Shushan Hu Road 350, Hefei, Anhui (China); Niu, Erwu [ITER China, 15B Fuxing Road, Beijing 100862 (China); Gung, Chenyu; Su, Man [ITER Organization, Route de Vinon-sur-Verdon – CS 90046, 13067 St Paul-lez-Durance Cedex (France)
2016-11-01
The Magnet Feeder system in the International Thermonuclear Experimental Reactor (ITER) deploys electrical currents and supercritical helium to the superconducting magnets and the magnet diagnostic signals to the operators. In the current design, the feeders located in the upper L3 level of the Tokamak gallery penetrate the Tokamak coolant water system vault, the biological shield and the cryostat. As a secondary confinement to contain the activated coolant water in the vault in the case of water pipe burst accident, a water barrier is welded between the penetration in the water pipe chase outer wall and the mid-plane of the vacuum jacket of the Feeder Coil Terminal Box (CTB). A thin-wall stainless steel diaphragm with an omega shape profile is welded around the CTB as the water barrier to endure 2 bar hydraulic pressure. In addition, the barrier is designed as a flexible compensator to withstand a maximum of 15 mm of axial displacement of the CTB in case of helium leak accident without failure. This paper presents the detail configuration, the manufacturing and assembly processes of the water barrier. Test results of the prototype water barrier under simulated accident conditions are also reported. Successful qualification of the design and manufacturing process of the water barrier lays a good foundation for the series production of this subsystem.
Directory of Open Access Journals (Sweden)
Ivan Baxter
2009-05-01
Full Text Available Though central to our understanding of how roots perform their vital function of scavenging water and solutes from the soil, no direct genetic evidence currently exists to support the foundational model that suberin acts to form a chemical barrier limiting the extracellular, or apoplastic, transport of water and solutes in plant roots. Using the newly characterized enhanced suberin1 (esb1 mutant, we established a connection in Arabidopsis thaliana between suberin in the root and both water movement through the plant and solute accumulation in the shoot. Esb1 mutants, characterized by increased root suberin, were found to have reduced day time transpiration rates and increased water-use efficiency during their vegetative growth period. Furthermore, these changes in suberin and water transport were associated with decreases in the accumulation of Ca, Mn, and Zn and increases in the accumulation of Na, S, K, As, Se, and Mo in the shoot. Here, we present direct genetic evidence establishing that suberin in the roots plays a critical role in controlling both water and mineral ion uptake and transport to the leaves. The changes observed in the elemental accumulation in leaves are also interpreted as evidence that a significant component of the radial root transport of Ca, Mn, and Zn occurs in the apoplast.
Khoirunnisa, Assifa Rahma; Joni, I. Made; Panatarani, Camellia; Rochima, Emma; Praseptiangga, Danar
2018-02-01
This study aims to develop film for food packaging application with high UV-screening, transparency and water barrier properties. Semi refined iota carrageenan (SRiC) nanocomposite films prepared by addition of zinc oxide (ZnO) nanoparticles as nanofiller using solution casting method. The effect of nanofiller with different concentration (0%, 0.5%, 1.0%, 1.5% w/w carrageenan) on UV-screening, transparency and water barrier properties of films were tested. The water barrier properties of the films were studied by measuring water vapor permeability (WVP) and the optical properties of the films were studied by using UV-Vis spectrophotometer at 280 nm for UV-screening test and at 660 nm for transparency test. WVP value of carrageenan films with addition of ZnO is low compared to a control carrageenan film and the lowest WVP value was found for the film with addition of 1.5% of ZnO. These result indicate that the addition of ZnO had a positive effect on the water barrier properties of the carrageenan matrix. Increase in the concentration of nanofiller leads to an increase in the UV-screening properties. Among all the films, carrageenan film with 1.5% ZnO has the highest UV-screening. The result showed that adding 0.5% and 1.0% of ZnO was insignificantly affect transparency of the films, however the transparency decreased sligthly when 1.5% ZnO was added. In conclusion, incorporating no more than 1.0% of ZnO to the films can obtain films with high UV-screening, transparency and water barrier properties and suitable for food packaging application.
Zhang, Xun E; Adderley, Shaquria P; Breslin, Jerome W
2016-01-01
Compromised endothelial barrier function is a hallmark of inflammation. Rho family GTPases are critical in regulating endothelial barrier function, yet their precise roles, particularly in sphingosine-1-phosphate (S1P)-induced endothelial barrier enhancement, remain elusive. Confluent cultures of human umbilical vein endothelial cells (HUVEC) or human dermal microvascular endothelial cells (HDMEC) were used to model the endothelial barrier. Barrier function was assessed by determining the transendothelial electrical resistance (TER) using an electrical cell-substrate impedance sensor (ECIS). The roles of Rac1 and RhoA were tested in S1P-induced barrier enhancement. The results show that pharmacologic inhibition of Rac1 with Z62954982 failed to block S1P-induced barrier enhancement. Likewise, expression of a dominant negative form of Rac1, or knockdown of native Rac1 with siRNA, failed to block S1P-induced elevations in TER. In contrast, blockade of RhoA with the combination of the inhibitors Rhosin and Y16 significantly reduced S1P-induced increases in TER. Assessment of RhoA activation in real time using a fluorescence resonance energy transfer (FRET) biosensor showed that S1P increased RhoA activation primarily at the edges of cells, near junctions. This was complemented by myosin light chain-2 phosphorylation at cell edges, and increased F-actin and vinculin near intercellular junctions, which could all be blocked with pharmacologic inhibition of RhoA. The results suggest that S1P causes activation of RhoA at the cell periphery, stimulating local activation of the actin cytoskeleton and focal adhesions, and resulting in endothelial barrier enhancement. S1P-induced Rac1 activation, however, does not appear to have a significant role in this process.
Directory of Open Access Journals (Sweden)
Xun E Zhang
Full Text Available Compromised endothelial barrier function is a hallmark of inflammation. Rho family GTPases are critical in regulating endothelial barrier function, yet their precise roles, particularly in sphingosine-1-phosphate (S1P-induced endothelial barrier enhancement, remain elusive. Confluent cultures of human umbilical vein endothelial cells (HUVEC or human dermal microvascular endothelial cells (HDMEC were used to model the endothelial barrier. Barrier function was assessed by determining the transendothelial electrical resistance (TER using an electrical cell-substrate impedance sensor (ECIS. The roles of Rac1 and RhoA were tested in S1P-induced barrier enhancement. The results show that pharmacologic inhibition of Rac1 with Z62954982 failed to block S1P-induced barrier enhancement. Likewise, expression of a dominant negative form of Rac1, or knockdown of native Rac1 with siRNA, failed to block S1P-induced elevations in TER. In contrast, blockade of RhoA with the combination of the inhibitors Rhosin and Y16 significantly reduced S1P-induced increases in TER. Assessment of RhoA activation in real time using a fluorescence resonance energy transfer (FRET biosensor showed that S1P increased RhoA activation primarily at the edges of cells, near junctions. This was complemented by myosin light chain-2 phosphorylation at cell edges, and increased F-actin and vinculin near intercellular junctions, which could all be blocked with pharmacologic inhibition of RhoA. The results suggest that S1P causes activation of RhoA at the cell periphery, stimulating local activation of the actin cytoskeleton and focal adhesions, and resulting in endothelial barrier enhancement. S1P-induced Rac1 activation, however, does not appear to have a significant role in this process.
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
International Nuclear Information System (INIS)
Svenson, Ola
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
Energy Technology Data Exchange (ETDEWEB)
Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.
Liévin-Le Moal, Vanessa
2013-06-01
Some water-borne protozoan parasites induce diseases through their membrane-associated functional structures and virulence factors that hijack the host cellular molecules and signalling pathways leading to structural and functional lesions in the intestinal barrier. In this Microreview we analyse the insights on the mechanisms of pathogenesis of Entamoeba intestinalis, Giardia and Cryptosporidium observed in the human colon carcinoma fully differentiated colon cancer cell lines, cell subpopulations and clones expressing the structural and functional characteristics of highly specialized fully differentiated epithelial cells lining the intestinal epithelium and mimicking structurally and functionally an intestinal barrier. © 2013 John Wiley & Sons Ltd.
Adapting to climate change by water management organisations: Enablers and barriers
Azhoni, Adani; Jude, Simon; Holman, Ian
2018-04-01
Climate change will be particularly experienced though the medium of water. Water organisations, that are managing societal and ecological needs for water, are therefore likely to experience the impact the most. This study reviews the current literature regarding adaptation to climate change by water management organisations and associated barriers. Literature on adaptive capacity is growing and a general consensus is emerging on the determinants of adaptive capacity, although variations exist regarding how it is to be evaluated, enhanced and applied to policy making due to its dynamic, contextual and latent nature. Since adaptive capacity is hard to measure and successful adaptation difficult to define, some studies focus on the existence of adaptation attributes of organisations. Studies reporting successful adaptation are minimal and barriers of adaptation are being discovered as adaptation research transitions into implementation. But the root causes of these barriers are often overlooked and the interconnectedness of the barriers is poorly addressed. Increasingly, combining top-down and bottom-up approaches to adaptation is being recommended due to the limitations of each. However, knowledge regarding how organisations operating at different scales can enhance adaptive capacity of other organisations operating at another scale is lacking due to the few studies of inter-organisational networks across scales. Social networks among actors are recognised as a key factor to enable adaptation. However, network studies generally focus on individual actors and rarely between public agencies/organisations. Moreover, the current literature is inadequate to understand the relationship between adaptation enabling characteristics, barriers and adaptation manifestation. The review demonstrates that research on understanding the emergence and sustenance of barriers is urgently required. Addressing these knowledge gaps will help to improve the design of adaptation strategies
Measuring solvent barrier properties of paper
International Nuclear Information System (INIS)
Bollström, Roger; Saarinen, Jarkko J; Toivakka, Martti; Räty, Jukka
2012-01-01
New methods for measuring barrier properties against solvents, acids and bases on dispersion coated paper were developed and investigated. Usability, reliability and repeatability were compared both between the new methods and with the standardized method for measuring barrier properties against water vapor. Barrier properties could be measured with all methods and the results obtained by the different methods were in correlation with each other. A qualitative method based on a trace color provided an indicative result, whereas further developed methods also took into account the durability. The effective barrier lifetime could be measured by measuring the conductivity through the substrate as a function of time, or by utilizing a glass prism where the change in refractive index caused by penetrated liquid was monitored, also as a function of time. Barrier properties against water and humidity were also measured and were found not to be predictors for barrier properties against either solvents, or acids or bases, which supports the need to develop new methods
Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika
2017-07-01
Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Kai Wang
2016-05-01
Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.
Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers
International Nuclear Information System (INIS)
Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang
2006-01-01
The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied
The diffusion permeability to water of the rat blood-brain barrier
DEFF Research Database (Denmark)
Bolwig, T G; Lassen, N A
1975-01-01
The diffusion permeability to water of the rat blood-brain-barrier (BBB) was studied. Preliminary data obtained with the Oldendorf tissue uptake method (Oldendorf 1970) in seizure experiments suggested that the transfer from blood to brain of labelled water is diffusion-limited. More definite...... passage increased from 0.26 to 0.67 when the arterial carbon dioxide tension was changed from 15 to 85 mm Hg, a change increasing the cerebral blood flow about sixfold. This finding suggests that water does not pass the blood-brain barrier as freely as lipophilic gases....
Zhang, Shishuang; Zhi, Yongle; Li, Fei; Huang, Shan; Gao, Huabin; Han, Zhaoli; Ge, Xintong; Li, Dai; Chen, Fanglian; Kong, Xiaodong; Lei, Ping
2018-04-15
To date, the pathogenesis of Alzheimer's disease (AD) remains unclear. It is well-known that excessive deposition of Aβ in the brain is a crucial part of the pathogenesis of AD. In recent years, the AD neurovascular unit hypothesis has attracted much attention. Impairment of the blood-brain barrier (BBB) leads to abnormal amyloid-β (Aβ) transport, and chronic cerebral hypoperfusion causes Aβ deposition throughout the onset and progression of AD. Endothelial progenitor cells (EPCs) are the universal cells for repairing blood vessels. Our previous studies have shown that a reduced number of EPCs in the peripheral blood results in cerebral vascular repair disorder, cerebral hypoperfusion and neurodegeneration, which might be related to the cognitive dysfunction of AD patients. This study was designed to confirm whether EPCs transplantation could repair the blood-brain barrier, stimulate angiogenesis and reduce Aβ deposition in AD. The expression of ZO-1, Occludin and Claudin-5 was up-regulated in APP/PS1 transgenic mice after hippocampal transplantation of EPCs. Consistent with previous studies, EPC transplants also increased the microvessel density. We observed that Aβ senile plaque deposition was decreased and hippocampal cell apoptosis was reduced after EPCs transplantation. The Morris water maze test showed that spatial learning and memory functions were significantly improved in mice transplanted with EPCs. Consequently, EPCs could up-regulate the expression of tight junction proteins, repair BBB tight junction function, stimulate angiogenesis, promote Aβ clearance, and decrease neuronal loss, ultimately improve cognitive function. Taken together, these data demonstrate EPCs may play an important role in the therapeutic implications for vascular dysfunction in AD. Copyright © 2018 Elsevier B.V. All rights reserved.
Flexible barrier film, method of forming same, and organic electronic device including same
Blizzard, John; Tonge, James Steven; Weidner, William Kenneth
2013-03-26
A flexible barrier film has a thickness of from greater than zero to less than 5,000 nanometers and a water vapor transmission rate of no more than 1.times.10.sup.-2 g/m.sup.2/day at 22.degree. C. and 47% relative humidity. The flexible barrier film is formed from a composition, which comprises a multi-functional acrylate. The composition further comprises the reaction product of an alkoxy-functional organometallic compound and an alkoxy-functional organosilicon compound. A method of forming the flexible barrier film includes the steps of disposing the composition on a substrate and curing the composition to form the flexible barrier film. The flexible barrier film may be utilized in organic electronic devices.
International Nuclear Information System (INIS)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma
2010-01-01
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Energy Technology Data Exchange (ETDEWEB)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)
2010-07-02
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok
2004-03-01
Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.
Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J
2010-12-01
Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.
International Nuclear Information System (INIS)
Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.
1995-01-01
Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)
Uniting Control Lyapunov and Control Barrier Functions
Romdlony, Zakiyullah; Jayawardhana, Bayu
2014-01-01
In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on
Directory of Open Access Journals (Sweden)
Yue Yang
2011-01-01
Full Text Available The endothelial-blood/tissue barrier is critical for maintaining tissue homeostasis. The ear harbors a unique endothelial-blood/tissue barrier which we term "blood-labyrinth-barrier". This barrier is critical for maintaining inner ear homeostasis. Disruption of the blood-labyrinth-barrier is closely associated with a number of hearing disorders. Many proteins of the blood-brain-barrier and blood-retinal-barrier have been identified, leading to significant advances in understanding their tissue specific functions. In contrast, capillaries in the ear are small in volume and anatomically complex. This presents a challenge for protein analysis studies, which has resulted in limited knowledge of the molecular and functional components of the blood-labyrinth-barrier. In this study, we developed a novel method for isolation of the stria vascularis capillary from CBA/CaJ mouse cochlea and provided the first database of protein components in the blood-labyrinth barrier as well as evidence that the interaction of Na(+/K(+-ATPase α1 (ATP1A1 with protein kinase C eta (PKCη and occludin is one of the mechanisms of loud sound-induced vascular permeability increase.Using a mass-spectrometry, shotgun-proteomics approach combined with a novel "sandwich-dissociation" method, more than 600 proteins from isolated stria vascularis capillaries were identified from adult CBA/CaJ mouse cochlea. The ion transporter ATP1A1 was the most abundant protein in the blood-labyrinth barrier. Pharmacological inhibition of ATP1A1 activity resulted in hyperphosphorylation of tight junction proteins such as occludin which increased the blood-labyrinth-barrier permeability. PKCη directly interacted with ATP1A1 and was an essential mediator of ATP1A1-initiated occludin phosphorylation. Moreover, this identified signaling pathway was involved in the breakdown of the blood-labyrinth-barrier resulting from loud sound trauma.The results presented here provide a novel method for
Protective barrier development: Overview
International Nuclear Information System (INIS)
Wing, N.R.; Gee, G.W.
1990-01-01
Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed
Food Derived Bioactive Peptides and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Olga Martínez-Augustin
2014-12-01
Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.
Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Directory of Open Access Journals (Sweden)
Morten Graversgaard
2018-05-01
Full Text Available Diffuse Water Pollution from Agriculture (DWPA and its governance has received increased attention as a policy concern across the globe. Mitigation of DWPA is a complex problem that requires a mix of policy instruments and a multi-agency, broad societal response. In this paper, opportunities and barriers for developing co-governance, defined as collaborative societal involvement in the functions of government, and its suitability for mitigation of DWPA are reviewed using seven case studies in Europe (Poland, Denmark, Sweden, The Netherlands and UK, Australia (Murray-Darling Basin and North America (State of Minnesota. An analytical framework for assessing opportunities and barriers of co-governance was developed and applied in this review. Results indicated that five key issues constitute both opportunities and barriers, and include: (i pressure for change; (ii connected governance structures and allocation of resources and funding; (iii leadership and establishment of partnerships through capacity building; (iv use and co-production of knowledge; and (v time commitment to develop water co-governance.
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie
2017-12-01
Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Effect of Gallic acid on mechanical and water barrier properties of zein-oleic acid composite films.
Masamba, Kingsley; Li, Yue; Hategekimana, Joseph; Liu, Fei; Ma, Jianguo; Zhong, Fang
2016-05-01
In this study, the effect of gallic acid on mechanical and water barrier properties of zein-oleic acid 0-4 % composite films was investigated. Molecular weight distribution analysis was carried out to confirm gallic acid induced cross linking through change in molecular weight in fraction containing zein proteins. Results revealed that gallic acid treatment increased tensile strength from 17.9 MPa to 26.0 MPa, decreased water vapour permeability from 0.60 (g mm m(-2) h(-1) kPa(-1)) to 0.41 (g mm m(-2) h(-1) kPa(-1)), increased solubility from 6.3 % to 10.2 % and marginally increased elongation at break from 3.7 % to 4.2 % in zein films only. However, gallic acid treatment in zein-oleic composite films did not significantly influence mechanical and water barrier properties and in most instances irrespective of oleic acid concentration, the properties were negatively affected. Results from scanning electron microscopy showed that both gallic acid treated and untreated zein films and composite films containing 3 % oleic acid had a compact and homogeneous structure while those containing 4 % oleic acid had inhomogeneous structure. The findings have demonstrated that gallic acid treatment can significantly improve mechanical and water barrier properties especially in zein films only as opposed to when used in composite films using zein and oleic acid.
Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette
2013-11-07
The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.
Kubota, Takahiro
2012-06-01
Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents
Macdonald, Rachael K; Ridd, Peter V; Whinney, James C; Larcombe, Piers; Neil, David T
2013-09-15
Water turbidity and suspended sediment concentration (SSC) are commonly used as part of marine monitoring and water quality plans. Current management plans utilise threshold SSC values derived from mean-annual turbidity concentrations. Little published work documents typical ranges of turbidity for reefs within open coastal waters. Here, time-series turbidity measurements from 61 sites in the Great Barrier Reef (GBR) and Moreton Bay, Australia, are presented as turbidity exceedance curves and derivatives. This contributes to the understanding of turbidity and SSC in the context of environmental management in open-coastal reef environments. Exceedance results indicate strong spatial and temporal variability in water turbidity across inter/intraregional scales. The highest turbidity across 61 sites, at 50% exceedance (T50) is 15.3 NTU and at 90% exceedance (T90) 4.1 NTU. Mean/median turbidity comparisons show strong differences between the two, consistent with a strongly skewed turbidity regime. Results may contribute towards promoting refinement of water quality management protocols. Copyright © 2013 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Il' in, I E
1984-08-01
Contamination of water reservoirs is presently a multicomponent phenomenon because pesticides, fertilizers, petroleum products, dyes and surfactants may all be present in water. Efficiency of commonly-employed water purification methods was evaluated: sedimentation, chlorination, filtering, and its related effect or representative groups of agricultural chemicals. The most vulnerable link in the rural water purification system was the filtration; in presence of surfactants, the filtration effectiveness was reduced by 40-50%. The effectiveness of this hauling function of surfactants was related to chemical structure of the polluting compounds and to homologous characteristics of the detergents. The effectiveness of the precipitation of chemical impurities from polluted water depended on their solubility in water. 1 figure.
Directory of Open Access Journals (Sweden)
Pei Wang
2013-09-01
Full Text Available Background/Aims: The mechanisms involved in endothelial barrier dysfunction induced by hypoxia are incompletely understood. There is debate about the role of hypoxia-inducible factor-1α (HIF-1α in endothelial barrier disruption. The aim of this study was to investigate the effect of genetic overexpression of HIF-1α on barrier function and the underlying mechanisms in hypoxic endothelial cells. Methods: The plasmid pcDNA3.1/V5-His-HIF-1α was stably transfected into human endothelial cells. The cells were exposed to normoxia or hypoxia. The mRNA and protein expressions of HIF-1α were detected by RT-PCR and Western blot respectively. The barrier function was assessed by measuring the transendothelial electrical resistance (TER. The Western blot analysis was used to determine the protein expression of glucose transporter-1 (GLUT-1, zonular occludens-1 (ZO-1, occludin, and myosin light chain kinase (MLCK in endothelial cells. The mRNA expression of proinflammatory cytokines was detected by qRT-PCR. Results: Genetic overexpression of HIF-1α significantly increased the mRNA and protein expression of HIF-1α in endothelial cells. The overexpression of HIF-1α enhanced the hypoxia-induced increase of HIF-1α and GLUT-1 protein expression. HIF-1α overexpression not only exacerbated hypoxia-induced endothelial barrier dysfunction but also augmented hypoxia-induced up-regulation of MLCK protein expression. HIF-1α overexpression also enhanced IL-1β, IL-6 and TNF-α mRNA expression. Conclusion: We provide evidence that genetic overexpression of HIF-1α aggravates the hypoxia-induced endothelial barrier dysfunction via enhancing the up-regulation of MLCK protein expression caused by hypoxia, suggesting a potential role for HIF-1α in the pathogenesis of endothelial barrier dysfunction in hypoxia.
Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity
Directory of Open Access Journals (Sweden)
Harmit S. Ranhotra
2016-07-01
Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...
Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice
Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo
2013-01-01
The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809
Fasano, Alessio
2011-01-01
The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.
Directory of Open Access Journals (Sweden)
Benjamin B. Williams
2015-08-01
Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms
Crossing safety barriers: influence of children's morphological and functional variables.
Cordovil, Rita; Vieira, Filomena; Barreiros, João
2012-05-01
Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.
International Nuclear Information System (INIS)
1989-11-01
Performance assessment has been carried out for the near-field of a potential LLW/ILW repository in marl in Switzerland. The host rock is assumed to be characterised by a system with 'small fractures' and one with 'large fractures', the hydraulic conductivity ranges from 4.10 -10 -4.10 -9 [m.s -1 ] and the hydraulic gradient is 1 [m.m -1 ]. In the repository, low-and intermediate-level waste will be disposed. Waste in drums and concrete containers will be placed in concrete-lined caverns which will be filled with a porous backfill material. One option is to include an additional engineered hydraulic barrier in the repository system. Its effects on repository performance have been studied. The changes in physical and chemical properties of the barriers have been included in the assessment by calculating the leaching of mainly calcium from the concrete barriers. The hydraulic conductivities of the engineered barriers are assumed to vary between 10 -11 -10 -8 [m.s -1 ] after degradation. Radionuclide transport can be determined by both advection and diffusion, depending on the hydraulic conductivities in the near-field. The water flow rates within the barriers have been calculated. The results show that the water flow rates within the porous backfill may increase by more than one order of magnitude compared to the water flow rate in the undisturbed host rock. The water flow rate through the waste matrix is never significantly larger than that in the host rock because it has been assumed that the porous backfill always has higher hydraulic conductivity than the waste matrix. The water flow rates within the near-field have been used to calculate the fractional release rates of species with different sorption properties. (author) figs., tabs., 90 refs
Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.
Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard
2016-01-01
Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.
Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan
2015-11-01
Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.
A search for parameters of universal sub-barrier fusion excitation function
Energy Technology Data Exchange (ETDEWEB)
Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)
2016-11-15
Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)
Rawluk, Ashley A; Crow, Gary; Legesse, Getahun; Veira, Douglas M; Bullock, Paul R; González, Luciano A; Dubois, Melanie; Ominski, Kim H
2014-10-29
A study was conducted in 2009 at two locations in Manitoba (Killarney and Souris), Canada to determine the impact of off-stream waterers (OSW) with or without natural barriers on (i) amount of time cattle spent in the 10 m buffer created within the riparian area, referred to as the riparian polygon (RP), (ii) watering location (OSW or stream), and (iii) animal performance measured as weight gain. This study was divided into three 28-day periods over the grazing season. At each location, the pasture-which ranged from 21.0 ha to 39.2 ha in size-was divided into three treatments: no OSW nor barriers (1CONT), OSW with barriers along the stream bank to deter cattle from watering at the stream (2BARR), and OSW without barriers (3NOBARR). Cattle in 2BARR spent less time in the RP in Periods 1 (p = 0.0002), 2 (p = 0.1116), and 3 (p natural barriers on deterring cattle from the riparian area between periods and locations may be partly attributable to the environmental conditions present during this field trial as well as difference in pasture size and the ability of the established barriers to deter cattle from using the stream as a water source. Treatment had no significant effect (p > 0.05) on cow and calf weights averaged over the summer period. These results indicate that the presence of an OSW does not create significant differences in animal performance when used in extensive pasture scenarios such as those studied within the present study. Whereas the barriers did not consistently discourage watering at the stream, the results provide some indication of the efficacy of the OSW as well as the natural barriers on deterring cattle from the riparian area.
Hirao, Hajime; Cheong, Zhi Hao; Wang, Xiaoqing
2012-07-12
The importance of the mechanism-based inactivation (MBI) of enzymes, which has a variety of physiological effects and therapeutic implications, has been garnering appreciation. Density functional theory calculations were undertaken to gain a clear understanding of the MBI of a cytochrome P450 enzyme (CYP2B4) by tert-butylphenylacetylene (tBPA). The results of calculations suggest that, in accordance with previous proposals, the reaction proceeds via a ketene-type metabolic intermediate. Once an oxoiron(IV) porphyryn π-cation radical intermediate (compound I) of P450 is generated at the heme reaction site, ketene formation is facile, as the terminal acetylene of tBPA can form a C-O bond with the oxo unit of compound I with a relatively low reaction barrier (14.1 kcal/mol). Unexpectedly, it was found that the ketene-type intermediate was not very reactive. Its reaction with the hydroxyl group of a threonine (Thr302) to form an ester bond required a substantial barrier (38.2 kcal/mol). The high barrier disfavored the mechanism by which these species react directly. However, the introduction of a water molecule in the reaction center led to its active participation in the reaction. The water was capable of donating its proton to the tBPA molecule, while accepting the proton of threonine. This water-mediated mechanism lowered the reaction barrier for the formation of an ester bond by about 20 kcal/mol. Therefore, our study suggests that a water molecule, which can easily gain access to the threonine residue through the proton-relay channel, plays a critical role in enhancing the covalent modification of threonine by terminal acetylene compounds. Another type of MBI by acetylenes, N-alkylation of the heme prosthetic group, was less favorable than the threonine modification pathway.
The Drosophila blood-brain barrier: Development and function of a glial endothelium
Directory of Open Access Journals (Sweden)
Stefanie eLimmer
2014-11-01
Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.
The Drosophila blood-brain barrier: development and function of a glial endothelium.
Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian
2014-01-01
The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.
Suitability of polystyrene as a functional barrier layer in coloured food contact materials.
Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy
2015-01-01
Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.
Directory of Open Access Journals (Sweden)
Ashley A. Rawluk
2014-10-01
Full Text Available A study was conducted in 2009 at two locations in Manitoba (Killarney and Souris, Canada to determine the impact of off-stream waterers (OSW with or without natural barriers on (i amount of time cattle spent in the 10 m buffer created within the riparian area, referred to as the riparian polygon (RP, (ii watering location (OSW or stream, and (iii animal performance measured as weight gain. This study was divided into three 28-day periods over the grazing season. At each location, the pasture—which ranged from 21.0 ha to 39.2 ha in size—was divided into three treatments: no OSW nor barriers (1CONT, OSW with barriers along the stream bank to deter cattle from watering at the stream (2BARR, and OSW without barriers (3NOBARR. Cattle in 2BARR spent less time in the RP in Periods 1 (p = 0.0002, 2 (p = 0.1116, and 3 (p < 0.0001 at the Killarney site compared to cattle in 3NOBARR at the same site. Cattle in 2BARR at the Souris site spent more time in the RP in Period 1 (p < 0.0001 and less time in Period 2 (p = 0.0002 compared to cattle in 3NOBARR. Cattle did use the OSW, but not exclusively, as watering at the stream was still observed. The observed inconsistency in the effectiveness of the natural barriers on deterring cattle from the riparian area between periods and locations may be partly attributable to the environmental conditions present during this field trial as well as difference in pasture size and the ability of the established barriers to deter cattle from using the stream as a water source. Treatment had no significant effect (p > 0.05 on cow and calf weights averaged over the summer period. These results indicate that the presence of an OSW does not create significant differences in animal performance when used in extensive pasture scenarios such as those studied within the present study. Whereas the barriers did not consistently discourage watering at the stream, the results provide some indication of the efficacy of the OSW as well
Stabilization with guaranteed safety using Control Lyapunov–Barrier Function
Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu
2016-01-01
We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control
Crossing the entropy barrier of dynamical zeta functions
International Nuclear Information System (INIS)
Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.
1992-01-01
Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)
Crossing the entropy barrier of dynamical zeta functions
Energy Technology Data Exchange (ETDEWEB)
Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)
1992-01-01
Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).
HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction
Directory of Open Access Journals (Sweden)
Jacob Barbara A
2009-02-01
Full Text Available Abstract Background HIV-infected individuals are at increased risk for acute and chronic airway disease even though there is no evidence that the virus can infect the lung epithelium. Although HIV-related proteins including gp120 and Tat can directly cause oxidant stress and cellular dysfunction, their effects in the lung are unknown. The goal of this study was to determine the effects of HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayer permeability in vitro. Oxidant stress in the alveolar space was determined by measuring the glutathione redox couple by high performance liquid chromatography, and the expression and membrane localization of key tight junction proteins were assessed. Finally, the direct effects of the HIV-related proteins gp120 and Tat on alveolar epithelial barrier formation and tight junction protein expression were determined. Results HIV-1 transgene expression caused oxidant stress within the alveolar space and impaired epithelial barrier function even though there was no evidence of overt inflammation within the airways. The expression and membrane localization of the tight junction proteins zonula occludens-1 and occludin were decreased in alveolar epithelial cells from HIV-1 transgenic rats. Further, treating alveolar epithelial monolayers from wild type rats in vitro with recombinant gp120 or Tat for 24 hours reproduced many of the effects on zonula occludens-1 and occludin expression and membrane localization. Conclusion Taken together, these data indicate that HIV-related proteins cause oxidant stress and alter the expression of critical tight junction proteins in the alveolar epithelium, resulting in barrier dysfunction.
Song, Yixuan; Tzeng, Ping; Grunlan, Jaime C
2016-06-01
Biaxially oriented polypropylene (BOPP) is widely used in packaging. Although its orientation increases mechanical strength and clarity, BOPP suffers from a high oxygen transmission rate (OTR). Multilayer thin films are deposited from water using layer-by-layer (LbL) assembly. Polyethylenimine (PEI) is combined with either poly(acrylic acid) (PAA) or vermiculite (VMT) clay to impart high oxygen barrier. A 30-bilayer PEI/VMT nanocoating (226 nm thick) improves the OTR of 17.8 μm thick BOPP by more than 30X, rivaling most inorganic coatings. PEI/PAA multilayers achieve comparable barrier with only 12 bilayers due to greater thickness, but these films exhibit increased oxygen permeability at high humidity. The PEI/VMT coatings actually exhibit improved oxygen barrier at high humidity (and also improve moisture barrier by more than 40%). This high barrier BOPP meets the criteria for sensitive food and some electronics packaging applications. Additionally, this water-based coating technology is cost effective and provides an opportunity to produce high barrier polypropylene film on an industrial scale. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Field Soil Water Retention of the Prototype Hanford Barrier and Its Variability with Space and Time
Energy Technology Data Exchange (ETDEWEB)
Zhang, Z. F.
2015-08-14
Engineered surface barriers are used to isolate underlying contaminants from water, plants, animals, and humans. To understand the flow processes within a barrier and the barrier’s ability to store and release water, the field hydraulic properties of the barrier need to be known. In situ measurement of soil hydraulic properties and their variation over time is challenging because most measurement methods are destructive. A multiyear test of the Prototype Hanford Barrier (PHB) has yielded in situ soil water content and pressure data for a nine-year period. The upper 2 m layer of the PHB is a silt loam. Within this layer, water content and water pressure were monitored at multiple depths at 12 water balance stations using a neutron probe and heat dissipation units. Valid monitoring data from 1995 to 2003 for 4 depths at 12 monitoring stations were used to determine the field water retention of the silt loam layer. The data covered a wide range of wetness, from near saturation to the permanent wilt point, and each retention curve contained 51 to 96 data points. The data were described well with the commonly used van Genuchten water retention model. It was found that the spatial variation of the saturated and residual water content and the pore size distribution parameter were relatively small, while that of the van Genuchten alpha was relatively large. The effects of spatial variability of the retention properties appeared to be larger than the combined effects of added 15% w/w pea gravel and plant roots on the properties. Neither of the primary hydrological processes nor time had a detectible effect on the water retention of the silt loam barrier.
DEFF Research Database (Denmark)
Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis
2013-01-01
antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...
van Smeden, Jeroen; Bouwstra, Joke A
2016-01-01
Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to
Protective barrier systems for final disposal of Hanford Waste Sites
International Nuclear Information System (INIS)
Phillips, S.J.; Hartley, J.N.
1986-01-01
A protecting barrier system is being developed for potential application in the final disposal of defense wastes at the Hanford Site. The functional requirements for the protective barrier are control of water infiltration, wind erosion, and plant and animal intrusion into the waste zone. The barrier must also be able to function without maintenance for the required time period (up to 10,000 yr). This paper summarizes the progress made and future plans in this effort to design and test protective barriers at the Hanford Site
Patching, Simon G
2017-03-01
Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.
Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A
2009-08-01
The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.
Barriers to sustainable water resources management : Case study in Omnogovi province, Mongolia
Enkhtsetseg, Mandukhai
2017-01-01
This study examines the barriers to sustainable water resources management in water vulnerable, yet a mining booming area. The case study is conducted in Omnogovi province of Mongolia in Nov-Dec 2016. This study presents how the Omnogovi province manages its water with increased mining and examines what hinders the province from practicing sustainable water resources management and examines the involvement of residents in the water resources management of Omnogovi province. Qualitative approa...
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
DEFF Research Database (Denmark)
Hansen, Harald S.; Jensen, B.
1985-01-01
sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...
Directory of Open Access Journals (Sweden)
Golo Storch
2016-07-01
Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.
Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei
2016-01-01
Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.
Chan, Bun; Gilbert, Andrew T B; Gill, Peter M W; Radom, Leo
2014-09-09
We have examined the performance of a variety of density functional theory procedures for the calculation of complexation energies and proton-exchange barriers, with a focus on the Minnesota-class of functionals that are generally highly robust and generally show good accuracy. A curious observation is that M05-type and M06-type methods show an atypical decrease in calculated barriers with increasing proportion of Hartree-Fock exchange. To obtain a clearer picture of the performance of the underlying components of M05-type and M06-type functionals, we have investigated the combination of MPW-type and PBE-type exchange and B95-type and PBE-type correlation procedures. We find that, for the extensive E3 test set, the general performance of the various hybrid-DFT procedures improves in the following order: PBE1-B95 → PBE1-PBE → MPW1-PBE → PW6-B95. As M05-type and M06-type procedures are related to PBE1-B95, it would be of interest to formulate and examine the general performance of an alternative Minnesota DFT method related to PW6-B95.
Directory of Open Access Journals (Sweden)
Lefeng Wang
2017-01-01
Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.
Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice
Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong
2017-01-01
Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542
Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice
Directory of Open Access Journals (Sweden)
Siming Yang
2017-08-01
Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.
Wiltshire, Rachael; Nelson, Vicky; Kho, Dan Ting; Angel, Catherine E; O'Carroll, Simon J; Graham, E Scott
2016-01-27
Herein we show that S1P rapidly and acutely reduces the focal adhesion strength and barrier tightness of brain endothelial cells. xCELLigence biosensor technology was used to measure focal adhesion, which was reduced by S1P acutely and this response was mediated through both S1P1 and S1P2 receptors. S1P increased secretion of several pro-inflammatory mediators from brain endothelial cells. However, the magnitude of this response was small in comparison to that mediated by TNFα or IL-1β. Furthermore, S1P did not significantly increase cell-surface expression of any key cell adhesion molecules involved in leukocyte recruitment, included ICAM-1 and VCAM-1. Finally, we reveal that S1P acutely and dynamically regulates microvascular endothelial barrier tightness in a manner consistent with regulated rapid opening followed by closing and strengthening of the barrier. We hypothesise that the role of the S1P receptors in this process is not to cause barrier dysfunction, but is related to controlled opening of the endothelial junctions. This was revealed using real-time measurement of barrier integrity using ECIS ZΘ TEER technology and endothelial viability using xCELLigence technology. Finally, we show that these responses do not occur simply though the pharmacology of a single S1P receptor but involves coordinated action of S1P1 and S1P2 receptors.
200-BP-1 Prototype Hanford Barrier - 15 Years of Performance Monitoring
International Nuclear Information System (INIS)
Ward, Anderson L.; Link, Steven O.; Draper, Kathryn E.; Clayton, Ray E.
2009-01-01
Engineered surface barriers are recognized as a remedial alternative to the removal, treatment and disposal of near-surface contaminants at a variety of waste sites within the DOE complex. One issue impacting their acceptance by stakeholders the use of limited data to predict long-term performance. In 1994, a 2-ha multi-component barrier was constructed over an existing waste disposal site at Hanford using natural materials. Monitoring has been almost continuous for the last 15 yrs and has focused on barrier stability, vegetative cover, plant and animal intrusion, and the components of the water balance, including precipitation, runoff, storage, drainage, and percolation. The total precipitation received from October 1994 through August 2008 was 3311 mm on the northern half (formerly irrigated), and 2638 mm on the southern, non-irrigated half. Water storage in the fine-soil layer shows a cyclic pattern, increasing in the winter and decreasing in the spring and summer to a lower limit of around 100 mm, regardless of precipitation, in response to evapotranspiration. Topographic surveys show the barrier and side slopes to be stable and the pea-gravel admix has proven effective in minimizing erosion through the creation of a desert pavement during deflationary periods. Three runoff events have been observed but the 600-mm design storage capacity has never been exceeded. Total percolation ranged from near zero amounts under the soil-covered plots to over 600 mm under the side slopes. The asphaltic concrete prevented any of this water from reaching the buried waste thereby eliminating the driving force for the contaminant remobilization. Plant surveys show a relatively high coverage of native plants still persists after the initial revegetation although the number of species decreased from 35 in 1994 to 10 in 2009. Ample evidence of insect and small mammal use suggests that the barrier is behaving like a recovering ecosystem. In September 2008, the north half of the
200-BP-1 Prototype Hanford Barrier - 15 Years of Performance Monitoring
Energy Technology Data Exchange (ETDEWEB)
Ward, Anderson L.; Link, Steven O.; Draper, Kathryn E.; Clayton, Ray E.
2009-09-01
Engineered surface barriers are recognized as a remedial alternative to the removal, treatment and disposal of near-surface contaminants at a variety of waste sites within the DOE complex. One issue impacting their acceptance by stakeholders the use of limited data to predict long-term performance. In 1994, a 2-ha multi-component barrier was constructed over an existing waste disposal site at Hanford using natural materials. Monitoring has been almost continuous for the last 15 yrs and has focused on barrier stability, vegetative cover, plant and animal intrusion, and the components of the water balance, including precipitation, runoff, storage, drainage, and percolation. The total precipitation received from October 1994 through August 2008 was 3311 mm on the northern half (formerly irrigated), and 2638 mm on the southern, non-irrigated half. Water storage in the fine-soil layer shows a cyclic pattern, increasing in the winter and decreasing in the spring and summer to a lower limit of around 100 mm, regardless of precipitation, in response to evapotranspiration. Topographic surveys show the barrier and side slopes to be stable and the pea-gravel admix has proven effective in minimizing erosion through the creation of a desert pavement during deflationary periods. Three runoff events have been observed but the 600-mm design storage capacity has never been exceeded. Total percolation ranged from near zero amounts under the soil-covered plots to over 600 mm under the side slopes. The asphaltic concrete prevented any of this water from reaching the buried waste thereby eliminating the driving force for the contaminant remobilization. Plant surveys show a relatively high coverage of native plants still persists after the initial revegetation although the number of species decreased from 35 in 1994 to 10 in 2009. Ample evidence of insect and small mammal use suggests that the barrier is behaving like a recovering ecosystem. In September 2008, the north half of the
Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier
International Nuclear Information System (INIS)
Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.
2008-01-01
Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and
Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier
Energy Technology Data Exchange (ETDEWEB)
Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.
2008-09-29
Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and
Barrier functions for Pucci-Heisenberg operators and applications
Cutri , Alessandra; Tchou , Nicoletta
2007-01-01
International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...
200-BP-1 Prototype Hanford Barrier Annual Monitoring Report for Fiscal Years 2005 Through 2007
Energy Technology Data Exchange (ETDEWEB)
Ward, Andy L.; Link, Steven O.; Strickland, Christopher E.; Draper, Kathryn E.; Clayton, Ray E.
2008-02-01
A prototype Hanford barrier was deployed over the 216-B-57 Crib at the Hanford Site in 1994 to prevent percolation through the underlying waste and to minimize spreading of buried contaminants. This barrier is being monitored to evaluate physical and hydrologic performance at the field scale. This report summarizes data collected during the period FY 2005 through FY 2007. In FY 2007, monitoring of the prototype Hanford barrier focused on barrier stability, vegetative cover, evidence of plant and animal intrusion, and the main components of the water balance, including precipitation, runoff, storage, drainage, and deep percolation. Owing to a hiatus in funding in FY 2005 through 2006, data collected were limited to automated measurements of the water-balance components. For the reporting period (October 2004 through September 2007) precipitation amount and distribution were close to normal. The cumulative amount of water received from October 1994 through September 2007 was 3043.45 mm on the northern half of the barrier, which is the formerly irrigated treatment, and 2370.58 mm on the southern, non-irrigated treatments. Water storage continued to show a cyclic pattern, increasing in the winter and declining in the spring and summer to a lower limit of around 100 mm in response to evapotranspiration. The 600-mm design storage has never been exceeded. For the reporting period, the total drainage from the soil-covered plots ranged from near zero amounts under the soil-covered plots to almost 20 mm under the side slopes. Over the 13-yr monitoring period, side slope drainage accounted for about 20 percent of total precipitation while the soil-covered plots account for only 0.12 mm total. Above-asphalt and below-asphalt moisture measurements show no evidence of deep percolation of water. Topographic surveys show the barrier and protective side slopes to be stable. Plant surveys show a relatively high coverage of native plants still persists after the initial revegetation
Directory of Open Access Journals (Sweden)
Ling-Yun Chu
Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.
Hydrogen sulfide metabolism regulates endothelial solute barrier function
Directory of Open Access Journals (Sweden)
Shuai Yuan
2016-10-01
Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.
Directory of Open Access Journals (Sweden)
Xiang Ling
Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may
Safety barriers and safety functions a comparison of different applications
International Nuclear Information System (INIS)
Harms-Ringdahl, L.
1998-01-01
A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)
Hanford protective barriers program: Status of asphalt barrier studies - FY 1989
International Nuclear Information System (INIS)
Freeman, H.D.; Gee, G.W.
1989-11-01
The Hanford Protective Barrier Program is evaluating alternate barriers to provide a means of meeting stringent water infiltration requirements. One type of alternate barrier being considered is an asphalt-based layer, 1.3 to 15 cm thick. Evaluations of these barriers were initiated in FY 1988, and, based on laboratory studies, two asphalt formulations were selected for further testing in small-tube lysimeters: a hot rubberized asphalt and an admixture of cationic asphalt emulsion and concrete sand containing 24 wt% residual asphalt. Eight lysimeters containing asphalt seals were installed as part of the Small Tube Lysimeter Test Facility on the Hanford Site. Two control lysimeters containing Hanford sand with a surface gravel treatment were also installed for comparison. 5 refs., 13 figs., 1 tab
Satellite-Derived Photic Depth on the Great Barrier Reef: Spatio-Temporal Patterns of Water Clarity
Directory of Open Access Journals (Sweden)
Scarla Weeks
2012-11-01
Full Text Available Detecting changes to the transparency of the water column is critical for understanding the responses of marine organisms, such as corals, to light availability. Long-term patterns in water transparency determine geographical and depth distributions, while acute reductions cause short-term stress, potentially mortality and may increase the organisms’ vulnerability to other environmental stressors. Here, we investigated the optimal, operational algorithm for light attenuation through the water column across the scale of the Great Barrier Reef (GBR, Australia. We implemented and tested a quasi-analytical algorithm to determine the photic depth in GBR waters and matched regional Secchi depth (ZSD data to MODIS-Aqua (2002–2010 and SeaWiFS (1997–2010 satellite data. The results of the in situ ZSD/satellite data matchup showed a simple bias offset between the in situ and satellite retrievals. Using a Type II linear regression of log-transformed satellite and in situ data, we estimated ZSD and implemented the validated ZSD algorithm to generate a decadal satellite time series (2002–2012 for the GBR. Water clarity varied significantly in space and time. Seasonal effects were distinct, with lower values during the austral summer, most likely due to river runoff and increased vertical mixing, and a decline in water clarity between 2008–2012, reflecting a prevailing La Niña weather pattern. The decline in water clarity was most pronounced in the inshore area, where a significant decrease in mean inner shelf ZSD of 2.1 m (from 8.3 m to 6.2 m occurred over the decade. Empirical Orthogonal Function Analysis determined the dominance of Mode 1 (51.3%, with the greatest variation in water clarity along the mid-shelf, reflecting the strong influence of oceanic intrusions on the spatio-temporal patterns of water clarity. The newly developed photic depth product has many potential applications for the GBR from water quality monitoring to analyses of
Hawkins, Brian T; Grego, Sonia; Sellgren, Katelyn L
2015-05-22
Blood-brain barrier (BBB) function is regulated by dynamic interactions among cell types within the neurovascular unit, including astrocytes and endothelial cells. Co-culture models of the BBB typically involve astrocytes seeded on two-dimensional (2D) surfaces, which recent studies indicate cause astrocytes to express a phenotype similar to that of reactive astrocytes in situ. We hypothesized that the culture conditions of astrocytes would differentially affect their ability to modulate BBB function in vitro. Brain endothelial cells were grown alone or in co-culture with astrocytes. Astrocytes were grown either as conventional (2D) monolayers, or in a collagen-based gel which allows them to grow in a three-dimensional (3D) construct. Astrocytes were viable in 3D conditions, and displayed a marked reduction in their expression of glial fibrillary acidic protein (GFAP), suggesting reduced activation. Stimulation of astrocytes with transforming growth factor (TGF)β1 decreased transendothelial electrical resistance (TEER) and reduced expression of claudin-5 in co-cultures, whereas treatment of endothelial cells in the absence of astrocytes was without effect. The effect of TGFβ1 on TEER was significantly more pronounced in endothelial cells cultured with 3D astrocytes compared to 2D astrocytes. These results demonstrate that astrocyte culture conditions differentially affect their ability to modulate brain endothelial barrier function, and suggest a direct relationship between reactive gliosis and BBB permeability. Moreover, these studies demonstrate the potential importance of physiologically relevant culture conditions to in vitro modeling of disease processes that affect the neurovascular unit. Copyright © 2015 Elsevier B.V. All rights reserved.
Noninvasive evaluation of the barrier properties of the skin
Directory of Open Access Journals (Sweden)
Utz S.R.
2014-09-01
Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.
International Nuclear Information System (INIS)
Baig, M N; Khalid, F A
2014-01-01
Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating
Use of vegetable oil in a pilot-scale denitrifying barrier
Hunter, William J.
2001-12-01
Nitrate in drinking water is a hazard to both humans and animals. Contaminated water can cause methemoglobinemia and may pose a cancer risk. Permeable barriers containing innocuous oils, which stimulate denitrification, can remove nitrate from flowing groundwater. For this study, a sand tank (1.1×2.0×0.085 m in size) containing sand was used as a one-dimensional open-top scale model of an aquifer. A meter-long area near the center of the tank contained sand coated with soybean oil. This region served as a permeable denitrifying barrier. Water containing 20 mg l -1 nitrate-N was pumped through the barrier at a high flow rate, 1112 l week -1, for 30 weeks. During the 30-week study, the barrier removed 39% of the total nitrate-N present in the water. The barrier was most efficient during the first 10 weeks of the study when almost all of the nitrate and nitrogen was removed. Efficiency declined with time so that by week 30 almost no nitrate was removed by the system. Nitrite levels in the effluent water remained low throughout the study. Barriers could be used to protect groundwater from nitrate contamination or for the in situ treatment of contaminated water. At the low flow rates that exist in most aquifers, such barriers should be effective at removing nitrate from groundwater for a much longer period of time.
No runoff, no soil loss : soil and water conservation in hedgerow barrier systems
Kiepe, P.
1995-01-01
Land degradation by water erosion represents a serious, and fast increasing, environmental threat. Hedgerow barriers control water erosion through the presence of the tree stem and through an increase in infiltration beneath the hedgerow. The infiltration rate beneath hedgerows is 3-8 times
Vogt, Leonie M.; Meyer, Diederick; Pullens, Gerdie; Faas, Marijke M.; Venema, Koen; Ramasamy, Uttara; Schols, Henk A.; de Vos, Paul
Dietary fiber intake is associated with lower incidence and mortality from disease, but the underlying mechanisms of these protective effects are unclear. We hypothesized that beta 2 -> 1-fructan dietary fibers confer protection on intestinal epithelial cell barrier function via Toll-like receptor 2
Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa
2015-01-01
Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018
Directory of Open Access Journals (Sweden)
Hee Soon Shin
2015-01-01
Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.
Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R
2000-08-01
The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.
Barrier and system performances within a safety case: their functioning and evolution with time
International Nuclear Information System (INIS)
Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.
2002-01-01
The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)
This report presents an analysis of the cost of using permeable reactive barriers to remediate contaminated ground water. When possible, these costs are compared with the cost of pump-and-treat technology for similar situations. Permeable reactive barriers are no longer perceiv...
Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function
Directory of Open Access Journals (Sweden)
David eBueno
2014-10-01
Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.
Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice
Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua
2012-01-01
AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548
Long-Term Drainage from the Riprap Side Slope of a Surface Barrier
Energy Technology Data Exchange (ETDEWEB)
Zhang, Zhuanfang
2017-07-01
Surface barriers designed to isolate underground nuclear waste in place are expected to function for at least 1000 years. To achieve this long design life, such barriers need to be protected with side slopes against wind- and water-induced erosion and damage by natural or human activities. However, the side slopes are usually constructed with materials coarser than the barrier. Their hydrological characteristics must be understood so that any drainage from them is considered in the barrier design and will not compromise the barrier function. The Prototype Hanford Barrier, an evapotranspiration-capillary (ETC) barrier, was constructed in 1994 at the Hanford Site in southeastern Washington state, with a gravel side slope and a riprap side slope. The soil water content in the gravel side slope and drainage from both side slopes have been monitored since the completion of construction. The monitoring results show that under natural precipitation the annual drainage rates from the two types of side slopes were very similar and about 5 times the typical recharge from local soil with natural vegetation and 40 times the barrier design criterion. The higher recharge from the side slopes results in some of the drainage migrating laterally to the region beneath the ETC barrier. This edge effect of the enhanced drainage was evaluated for a period of 1000 years by numerical simulation. The edge effect was quantified by the amount of water across the barrier edges and the affecting distance of the barrier edges. These results indicate that design features can be adjusted to reduce the edge effect when necessary.
CORRIDOR-TYPE BAFFLED MIXING BASIN WITH CROSS POROUS BARRIERS
Directory of Open Access Journals (Sweden)
S. M. Epoyan
2018-02-01
Full Text Available Purpose. The paper hightlights the increase in operational efficiency of corridor-type baffled mixing basin by installing of cross porous barriers made of gravel (or other materials and epoxy resin, grade ED-20 (ED-16 with the hardener polyethylenepolyamine (PEPA, approved by Ukrainian Ministry of Health in systems of utility and drinking water supply. Methodology. The first stage of the experiments was performed on the model of the proposed mixer in scale 1:4 in order to determine the local resistance of the porous barrier, which is made of gravel with a size of 10-15 mm (average diameter 12.5 mm and thickness of 50 mm. The local resistance of the barrier was measured using piezometers installed before and after the porous barrier. The velocity of water motion in the corridor of the mixer was determined depending on the water consumption, incoming on the mixer accordingly to the water meter and by the volumetric method. Findings. In accordance with researches when the water flows at a velocity of 0.1 m/s in the corridor of the mixer, the head losses in the porous barrier is 17 cm (0.17 m, and at a velocity of 0.2 m/s–0.68 m. The resistance coefficient (ξ, which is equal to 333.2 for the investigated barrier, was determined experimentally. It allows determining the head losses in the porous barrier at other velocities of water motion. When the velocity of water motion in the corridors of the mixer is from 0.7 up to 0.5 m/s, head losses increase almost fourfold. The conducted researches allowed to develop a calculation methodology for corridor-type baffled mixing basin with porous polymer-concrete barriers. Originality. Authors developed and investigated the corridor-type baffled mixing basin with porous polymer-concrete barriers. These barriers allow increasing and regulating the intensity and time of reagents mixing with the initial water exactly in the barriers, improving the distribution of the flow through the section of the mixer
Barrier erosion control test plan: Gravel mulch, vegetation, and soil water interactions
Energy Technology Data Exchange (ETDEWEB)
Waugh, W.J.; Link, S.O. (Pacific Northwest Lab., Richland, WA (USA))
1988-07-01
Soil erosion could reduce the water storage capacity of barriers that have been proposed for the disposal of near-surface waste at the US Department of Energy's Hanford Site. Gravel mixed into the top soil surface may create a self-healing veneer that greatly retards soil loss. However, gravel admixtures may also enhance infiltration of rainwater, suppress plant growth and water extraction, and lead to the leaching of underlying waste. This report describes plans for two experiments that were designed to test hypotheses concerning the interactive effects of surface gravel admixtures, revegetation, and enhanced precipitation on soil water balance and plant abundance. The first experiment is a factorial field plot set up on the site selected as a soil borrow area for the eventual construction of barriers. The treatments, arranged in a a split-split-plot design structure, include two densities of gravel admix, a mixture of native and introduced grasses, and irrigation to simulate a wetter climate. Changes in soil water storage and plant cover are monitored with neutron moisture probes and point intercept sampling, respectively. The second experiment consists of an array of 80 lysimeters containing several different barrier prototypes. Surface treatments are similar to the field-plot experiment. Drainage is collected from a valve at the base of each lysimeter tube, and evapotranspiration is estimated by subtraction. The lysimeters are also designed to be coupled to a whole-plant gas exchange system that will be used to conduct controlled experiments on evapotranspiration for modeling purposes. 56 refs., 6 figs., 8 tabs.
Directory of Open Access Journals (Sweden)
Helen B. Stolp
2013-08-01
Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.
Sleep Restriction Impairs Blood–Brain Barrier Function
He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping
2014-01-01
The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222
Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L
2016-08-01
OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence. METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures. RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence. CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G
2002-10-01
Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.
International Nuclear Information System (INIS)
Moody, T.E.; Conca, J.
1996-09-01
Selected materials were tested to emulate a permeable barrier and to examine the (1) capture efficiency of these materials relating to the immobilization of strontium-90 and hexavalent chromium (Cr 6+ ) in Hanford Site groundwater; and (2) hydraulic conductivity of the barrier material relative to the surrounding area. The emplacement method investigated was a permeable reactive barrier to treat contaminated groundwater as it passes through the barrier. The hydraulic conductivity function was measured for each material, and retardation column experiments were performed for each material. Measurements determining the hydraulic conductivity at unsaturated through saturated water content were executed using the Unsaturated Flow Apparatus
Diversity and Activity of Diazotrophs in Great Barrier Reef Surface Waters.
Messer, Lauren F; Brown, Mark V; Furnas, Miles J; Carney, Richard L; McKinnon, A D; Seymour, Justin R
2017-01-01
Discrepancies between bioavailable nitrogen (N) concentrations and phytoplankton growth rates in the oligotrophic waters of the Great Barrier Reef (GBR) suggest that undetermined N sources must play a significant role in supporting primary productivity. One such source could be biological dinitrogen (N 2 ) fixation through the activity of "diazotrophic" bacterioplankton. Here, we investigated N 2 fixation and diazotroph community composition over 10° S of latitude within GBR surface waters. Qualitative N 2 fixation rates were found to be variable across the GBR but were relatively high in coastal, inner and outer GBR waters, reaching 68 nmol L -1 d -1 . Diazotroph assemblages, identified by amplicon sequencing of the nifH gene, were dominated by the cyanobacterium Trichodesmium erythraeum , γ-proteobacteria from the Gamma A clade, and δ-proteobacterial phylotypes related to sulfate-reducing genera. However, diazotroph communities exhibited significant spatial heterogeneity, correlated with shifts in dissolved inorganic nutrient concentrations. Specifically, heterotrophic diazotrophs generally increased in relative abundance with increasing concentrations of phosphate and N, while Trichodesmium was proportionally more abundant when concentrations of these nutrients were low. This study provides the first in-depth characterization of diazotroph community composition and N 2 fixation dynamics within the oligotrophic, N-limited surface waters of the GBR. Our observations highlight the need to re-evaluate N cycling dynamics within oligotrophic coral reef systems, to include diverse N 2 fixing assemblages as a potentially significant source of dissolved N within the water column.
The oxygen reduction reaction mechanism on Pt(111) from density functional theory calculations
DEFF Research Database (Denmark)
Tripkovic, Vladimir; Skulason, Egill; Siahrostami, Samira
2010-01-01
We study the oxygen reduction reaction (ORR) mechanism on a Pt(1 1 1) surface using density functional theory calculations We find that at low overpotentials the surface is covered with a half dissociated water layer We estimate the barrier for proton transfer to this surface and the barrier...
Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura
2015-01-13
Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.
CSIR Research Space (South Africa)
Page, D
2010-03-01
Full Text Available , using the same risk-based approach that is used for public water supplies. For each of the sites, the aquifer treatment barrier was assessed for its log10 removal capacity much like for other water treatment technologies. This information...
Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor
2017-02-08
Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.
Smajgl, A.; Larson, S.; Hug, B.; De Freitas, D. M.
2010-12-01
SummaryThis paper presents a tool for documenting and monitoring water use benefits in the Great Barrier Reef catchments that allows temporal and spatial comparison along the region. Water, water use benefits and water allocations are currently receiving much attention from Australian policy makers and conservation practitioners. Because of the inherent complexity and variability in water quality, it is essential that scientific information is presented in a meaningful way to policy makers, managers and ultimately, to the general public who have to live with the consequences of the decisions. We developed an inexpensively populated and easily understandable water use benefit index as a tool for community-based monitoring of water related trends in the Great Barrier Reef region. The index is developed based on a comparative list of selected water-related indices integrating attributes across physico-chemical, economic, social, and ecological domains currently used in the assessment of water quality, water quantity and water use benefits in Australia. Our findings indicate that the proposed index allows the identification of water performance indicators by temporal and spatial comparisons. Benefits for decision makers and conservation practitioners include a flexible way of prioritization towards the domain with highest concern. The broader community benefits from a comprehensive and user-friendly tool, communicating changes in water quality trends more effectively.
Rhim, Jong-Whan; Wang, Long-Feng
2013-07-01
Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Nørgaard, Jørgen Quvang Harck; Bentzen, Thomas Ruby; Larsen, Torben
2014-01-01
the increased risk of flooding in the estuary has revitalized the discussion whether this connection should be closed. In this paper, it is shown by numerical simulation that the establishment of a storm surge barrier across Thyborøn Channel can significantly reduce the peak water levels in the central...
Surface barrier research at the Hanford Site
International Nuclear Information System (INIS)
Gee, G.W.; Ward, A.L.; Fayer, M.J.
1997-01-01
At the DOE Hanford Site, a field-scale prototype surface barrier was constructed in 1994 over an existing waste site as a part of a CERCLA treatability test. The above-grade barrier consists of a fine-soil layer overlying coarse layers of sands, gravels, basalt rock (riprap), and a low permeability asphalt layer. Two sideslope configurations, clean-fill gravel on a 10:1 slope and basalt riprap on a 2:1 slope, were built and are being tested. Design considerations included: constructability; drainage and water balance monitoring, wind and water erosion control and monitoring; surface revegetation and biotic intrusion; subsidence and sideslope stability, and durability of the asphalt layer. The barrier is currently in the final year of a three-year test designed to answer specific questions related to stability and long-term performance. One half of the barrier is irrigated such that the total water applied, including precipitation, is 480 mm/yr (three times the long-term annual average). Each year for the past two years, an extreme precipitation event (71 mm in 8 hr) representing a 1,000-yr return storm was applied in late March, when soil water storage was at a maximum. While the protective sideslopes have drained significant amounts of water, the soil cover (2-m of silt-loam soil overlying coarse sand and rock) has never drained. During the past year there was no measurable surface runoff or wind erosion. This is attributed to extensive revegetation of the surface. In addition, the barrier elevation has shown a small increase of 2 to 3 cm that is attributed to a combination of root proliferation and freeze/thaw activity. Testing will continue through September 1997. Performance data from the prototype barrier will be used by DOE in site-closure decisions at Hanford
TREM-1 Promotes Pancreatitis-Associated Intestinal Barrier Dysfunction
Directory of Open Access Journals (Sweden)
Shengchun Dang
2012-01-01
Full Text Available Severe acute pancreatitis (SAP can cause intestinal barrier dysfunction (IBD, which significantly increases the disease severity and risk of mortality. We hypothesized that the innate immunity- and inflammatory-related protein-triggering receptor expressed on myeloid cells-1 (TREM-1 contributes to this complication of SAP. Thus, we investigated the effect of TREM-1 pathway modulation on a rat model of pancreatitis-associated IBD. In this study we sought to clarify the role of TREM-1 in the pathophysiology of intestinal barrier dysfunction in SAP. Specifically, we evaluated levels of serum TREM-1 and membrane-bound TREM-1 in the intestine and pancreas from an animal model of experimentally induced SAP. TREM-1 pathway blockade by LP17 treatment may suppress pancreatitis-associated IBD and ameliorate the damage to the intestinal mucosa barrier.
Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia
2017-08-01
Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lim, Jung Hoon; Kim, Jeong Ae; Ko, Jung A; Park, Hyun Jin
2015-11-01
Beeswax and a plasticizer (ATBC) were added to polylactic acid (PLA) films in order to enhance the water vapor barrier properties of the films. Beeswax improved the barrier properties; the water vapor permeability in the composite containing 1% beeswax was 58% lower than that of the neat PLA. Fourier transform infrared spectroscopy and X-ray diffraction analysis revealed that the incorporation of beeswax and ATBC had so little effect on the PLA structure. In addition, the structure of PLA did not vary substantially with the additions. The surfaces of the composites were examined by using field emission scanning electron microscopy. Differential scanning calorimetry results showed that the degree of crystallinity of the PLA films increased with the addition of beeswax and ATBC. However, the tensile strength and elongation at break of the composites containing beeswax were up to approximately 50% lower than those of the neat PLA. Although further study is needed to improve the mechanical properties, the aforementioned results showed that the PLA barrier properties can be improved by the incorporation of a small amount of beeswax and ATBC. The results of this study can be applied for the preparation of PLA composite films with improved barrier properties. Such biodegradable films are extremely useful for applications in the food packaging industry. © 2015 Institute of Food Technologists®
Sleep restriction impairs blood-brain barrier function.
He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong
2014-10-29
The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.
DEFF Research Database (Denmark)
Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.
2014-01-01
The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...
Investigation of pulsed barrier discharge in water-air gap
International Nuclear Information System (INIS)
Taran, V.S.; Krasnyj, V.V.; Lozina, A.S.; Shvets, O.M.
2013-01-01
This article presents the results of the use of a pulsed dielectric barrier discharge with water electrode and diaphragm. The spectroscopic and electrical investigations of such discharge were conducted. The ozone concentration in an aqueous solution comprised 0.7 mg/l with high-voltage pulsed power at 120 W. The discharge reviewed emission spectrum lines of molecular nitrogen and hydroxyl radicals in the range of 200...800 nm in the water-air gap. The intensity changing of luminescence lines of OH and N 2 singles depending on the applied voltage and discharge gap has been determined. Aqueous solution of indigo was used in order to determine the impact level on the organic material. Experiments on inactivation of test E. coli cultures have been carried out.
International Nuclear Information System (INIS)
Veeck, A.C.; Lawrence Livermore National Lab., CA; Lawrence Berkeley National Lab., CA
1996-08-01
Excitation functions have been measured for complex fragment emission from the compound nucleus 98 Mo, produced by the reaction of 86 Kr with 12 C. Mass asymmetric fission barriers have been obtained by fitting the excitation functions with a transition state formalism. The extracted barriers are ∼ 5.7 MeV higher, on average, than the calculations of the Rotating Finite Range Model (RFRM). These data clearly show an isospin dependence of the conditional barriers when compared with the extracted barriers from 90 Mo and 94 Mo. Eleven different liquid/liquid extractants were synthesized based upon the chelating moieties 3,2-HOPO and 3,4-HOPO; additionally, two liquid/liquid extractants based upon the 1,2-HOPO chelating moiety were obtained for extraction studies. The Pu(IV) extractions, quite surprisingly, yielded results that were very different from the Fe(III) extractions. The first trend remained the same: the 1,2-HOPOs were the best extractants, followed closely by the 3,2-HOPOs, followed by the 3,4-HOPOs; but in these Pu(IV) extractions the 3,4-HOPOs performed much better than in the Fe(III) extractions. 129 refs
Kumar, Ashutosh; Heilmann, M.; Latzel, Michael; Kapoor, Raman; Sharma, Intu; Göbelt, M.; Christiansen, Silke H.; Kumar, Vikram; Singh, Rajendra
2016-01-01
The electrical behaviour of Schottky barrier diodes realized on vertically standing individual GaN nanorods and array of nanorods is investigated. The Schottky diodes on individual nanorod show highest barrier height in comparison with large area diodes on nanorods array and epitaxial film which is in contrast with previously published work. The discrepancy between the electrical behaviour of nanoscale Schottky diodes and large area diodes is explained using cathodoluminescence measurements, surface potential analysis using Kelvin probe force microscopy and 1ow frequency noise measurements. The noise measurements on large area diodes on nanorods array and epitaxial film suggest the presence of barrier inhomogeneities at the metal/semiconductor interface which deviate the noise spectra from Lorentzian to 1/f type. These barrier inhomogeneities in large area diodes resulted in reduced barrier height whereas due to the limited role of barrier inhomogeneities in individual nanorod based Schottky diode, a higher barrier height is obtained. PMID:27282258
International Nuclear Information System (INIS)
Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.
1996-01-01
Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed
Functional Food Market Development in Serbia: Motivations and Barriers
Directory of Open Access Journals (Sweden)
Žaklina Stojanović
2013-11-01
Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.
Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.
2010-01-01
Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading
DEFF Research Database (Denmark)
Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.
2017-01-01
Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....
Institutional and structural barriers for implementing on-farm water saving irrigation systems
DEFF Research Database (Denmark)
Pedersen, Søren Marcus; Boesen, Mads Vejlby; Ørum, Jens Erik
2013-01-01
institutional and structural barriers for shifting to more water efficient technologies on farms. To deal with the lack of incentives, a holistic and multidisciplinary assessment approach has been taken to cover the various parameters that may influence farmers' choice of technology. A case study analysis has...
Barrier mechanisms in the Drosophila blood-brain barrier
Directory of Open Access Journals (Sweden)
Samantha Jane Hindle
2014-12-01
Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries
Huang, Jing-Kai
2018-01-04
Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.
Hosseini, Mostafa; Azamat, Jafar; Erfan-Niya, Hamid
2018-01-01
Molecular dynamics simulations were performed to investigate the water desalination performance of nanoporous graphene oxide (NPGO) membranes. The simulated systems consist of a NPGO as a membrane with a functionalized pore in its center immersed in an aqueous ionic solution and a graphene sheet as a barrier. The considered NPGO membranes are involved four types of pore with different size and chemistry. The results indicated that the NPGO membrane has effective efficiency in salt rejection as well as high performance in water flux. For all types of pore with the radius size of 2.9-4.5 Å, the NPGO shows salt rejection of >89%. Functional groups on the surface and edge of pores have a great effect on water flux. To precisely understand the effect of functional groups on the surface of nanostructured membranes, nanoporous graphene was simulated under the same condition for comparison. Hydrophilic groups on the surface make the NPGO as an ultra-permeable membrane. As a result, the obtained water flux for NPGO was about 77% greater than graphene. Also, it was found that the water flux of NPGO is 2-5 orders of magnitude greater than other existing reverse osmosis membranes. Therefore, the investigated systems can be recommended as a model for the water desalination.
Huang, Huey-Chun; Chang, Tsong-Min
2008-08-01
Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.
The Blood-Brain Barrier: An Engineering Perspective
Directory of Open Access Journals (Sweden)
Andrew eWong
2013-08-01
Full Text Available It has been more than 100 years since Paul Ehrlich reported that various water-soluble dyes injected into the circulation did not enter the brain. Since Ehrlich’s first experiments, only a small number of molecules, such as alcohol and caffeine have been found to cross the blood-brain barrier, and it remains the major roadblock to treatment of many central nervous system diseases. At the same time, many central nervous system diseases are associated with disruption of the blood-brain barrier that can lead to changes in permeability, modulation of immune cell transport, and trafficking of pathogens into the brain. Therefore advances in our understanding of the structure and function of the blood-brain barrier are key to advances in treatment of a wide range of central nervous system diseases. Over the past 10 years it has become recognized that the blood-brain barrier is a complex dynamic system that involves biomechanical and biochemical signaling between the vascular system and the brain. Here we reconstruct the structure, function, and transport properties of the blood-brain barrier from an engineering perspective. New insight into the physics of the blood-brain barrier could ultimately lead to clinical advances in the treatment of central nervous system diseases.
Hanford prototype-barrier status report FY 1996
Energy Technology Data Exchange (ETDEWEB)
Gee, G.W.; Ward, A.L.; Gilmore, B.G.; Link, S.O.; Dennis, G.W.; O`Neil, T.K.
1996-11-01
A prototype surface barrier is being evaluated as part of a treatability study at the 200-BP-1 Operable Unit in the 200 East Area of the Hanford Site. Tests include the application of irrigation water to the northern half of the barrier and subsequent measurement of water balance, wind and water erosion, subsidence, plant establishment,a nd plant and animal intrusion. The tests are designed to evaluate both irrigated and nonirrigated sideslope and vegetated surfaces over a period of 3 years. This report documents findings from the second year of testing.
Hanford prototype-barrier status report FY 1996
International Nuclear Information System (INIS)
Gee, G.W.; Ward, A.L.; Gilmore, B.G.; Link, S.O.; Dennis, G.W.; O'Neil, T.K.
1996-11-01
A prototype surface barrier is being evaluated as part of a treatability study at the 200-BP-1 Operable Unit in the 200 East Area of the Hanford Site. Tests include the application of irrigation water to the northern half of the barrier and subsequent measurement of water balance, wind and water erosion, subsidence, plant establishment,a nd plant and animal intrusion. The tests are designed to evaluate both irrigated and nonirrigated sideslope and vegetated surfaces over a period of 3 years. This report documents findings from the second year of testing
TRIMOLECULAR REACTIONS OF URANIUM HEXAFLUORIDE WITH WATER
Energy Technology Data Exchange (ETDEWEB)
Westbrook, M.; Becnel, J.; Garrison, S.
2010-02-25
The hydrolysis reaction of uranium hexafluoride (UF{sub 6}) is a key step in the synthesis of uranium dioxide (UO{sub 2}) powder for nuclear fuels. Mechanisms for the hydrolysis reactions are studied here with density functional theory and the Stuttgart small-core scalar relativistic pseudopotential and associated basis set for uranium. The reaction of a single UF{sub 6} molecule with a water molecule in the gas phase has been previously predicted to proceed over a relatively sizeable barrier of 78.2 kJ {center_dot} mol{sup -1}, indicating this reaction is only feasible at elevated temperatures. Given the observed formation of a second morphology for the UO{sub 2} product coupled with the observations of rapid, spontaneous hydrolysis at ambient conditions, an alternate reaction pathway must exist. In the present work, two trimolecular hydrolysis mechanisms are studied with density functional theory: (1) the reaction between two UF{sub 6} molecules and one water molecule, and (2) the reaction of two water molecules with a single UF{sub 6} molecule. The predicted reaction of two UF{sub 6} molecules with one water molecule displays an interesting 'fluorine-shuttle' mechanism, a significant energy barrier of 69.0 kJ {center_dot} mol{sup -1} to the formation of UF{sub 5}OH, and an enthalpy of reaction ({Delta}H{sub 298}) of +17.9 kJ {center_dot} mol{sup -1}. The reaction of a single UF{sub 6} molecule with two water molecules displays a 'proton-shuttle' mechanism, and is more favorable, having a slightly lower computed energy barrier of 58.9 kJ {center_dot} mol{sup -1} and an exothermic enthalpy of reaction ({Delta}H{sub 298}) of -13.9 kJ {center_dot} mol{sup -1}. The exothermic nature of the overall UF{sub 6} + 2 {center_dot} H{sub 2}O trimolecular reaction and the lowering of the barrier height with respect to the bimolecular reaction are encouraging; however, the sizable energy barrier indicates further study of the UF{sub 6} hydrolysis reaction
Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio
2014-12-01
Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Takeo Ebina
2001-05-01
Full Text Available Abstract: We report density functional electronic structure calculations to monitor the change in the surface characteristics of the Si (100-2x1 surface after fluorination followed by interaction with water. Embedded finite silicon clusters are used to model an extended Si (100-2x1 surface. Two high symmetry pathways and subsequent adsorption sites were examined: (i adsorption of an fluorine atom directing onto a silicon dangling bond to form a monocoordinated fluorine atom (ii adsorption of a fluorine atom directing on top of silicon dimer to form a bridging dicoordinated fluorine atom. However, in the later case we find that no barrier exists for the bridging fluorine atom to slide towards silicon dimer dangling bond to form more stable mono coordinated Si-F bond. We calculated activation barriers and equilibrium surface configuration as a function of fluorine coverage upto 2.0 ML. We compared the stability of the fluorinated surface. The results were compared with existing experimental and theoretical results. The reaction of water with HF treated Si surface is monitored. It produces, as a first step, the exchange of Si-F with water to form Si-OH groups reducing the concentration of the fluorine on the surface, followed by a rapture of Si-Si bonds and finally the Si-O-Si bridge formation in the lattice.
Use of element model to evaluate transmissibility reduction due to barriers
Energy Technology Data Exchange (ETDEWEB)
Svanes, T.; South, D.; Dronen, O.M. [Statoil, Bergen (Norway)
1997-08-01
Water breakthrough has been observed a year earlier than expected in the productive Oseberg Formation in the Veslefrikk Field. Production data revealed extensive water override, whereas the opposite situation was expected based on a homogeneous and coarse flow simulation model. A new model was developed to include geological heterogeneities using a simple upscaling method. The Oseberg Fm. consists of an upper homogeneous unit (zone 2) and a lower unit containing thin barriers of shale and calcite cemented sandstone (zone 1). The barrier content varies laterally. When barriers are distributed in a complex 3D pattern, they reduce the upscaled horizontal transmissibility more than what is obtained by multiplying the sand permeability by the net-to-gross ratio (N/G). However, the transmissibility reduction strongly depends on the spatial distribution of barriers and their geometry. Therefore, a fine scale element model was used to derive the average transmissibility reduction as a function of N/G for alternative geological descriptions of the barriers. A geo-statistical method called General Marked Point Process was used to generate the fine scale descriptions. This work has resulted in a simple upscaling routine for horizontal transmissibility, which represents an effective bridge between geological evaluation of uncertainties and fluid flow simulation. The method combines geo-statistical and deterministic modelling in an elegant manner, recognising that most often these methods complement one another.
T Tank Farm Interim Surface Barrier Demonstration -- Vadose Zone Monitoring FY07 Report
International Nuclear Information System (INIS)
Zhang, Z. F.; Strickland, Christopher E.; Keller, Jason M.; Wittreich, Curtis D.; Sydnor, Harold A.
2008-01-01
CH2M HILL Hanford Group, Inc. is currently in the process of constructing a temporary surface barrier over a portion of the T Tank Farm as part of the T farm Interim Surface Barrier Demonstration Project. The surface barrier is designed to prevent the infiltration of precipitation into the contaminated soil zone created by the Tank T-106 leak and minimize movement of the contamination. As part of the demonstration effort, vadose zone moisture monitoring is being performed to assess the effectiveness of the barrier at reducing soil moisture. A solar-powered and remotely-controlled system was installed to continuously monitor soil water conditions in four instrument nests (i.e., A, B, C, and D) and the site meteorological condition. Each instrument nest was composed of a capacitance probe with multiple sensors, multiple heat-dissipation units, a neutron probe access tube and a datalogger. Nests A and B also contained a drain gauge each. The principle variables monitored for this purpose are soil-water content, soil-water pressure, and soil-water flux. In addition to these, soil temperature, precipitation, and air temperature are measured. Data from each of the dataloggers were transmitted remotely to the receiving computer. The neutron probe access tube was used to perform quarterly manual measurements of soil-water content using a neutron probe. This monitoring system was used to assess the soil water conditions in the soil outside and within the footprint of the surface barrier to be emplaced in the Hanford T Tank Farm. Data to date is baseline under the condition without the interim surface barrier in place. All the instruments except the two drain gauges were functional in FY07. The capacitance-probe measurements showed that the soil-moisture content at relatively shallow depths (e.g., 0.6 and 0.9 m) was increasing since October 2006 and reached the highest in early January 2007 followed by a slight decrease. Soil-moisture contents at the depths of 1.3 m and
Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori
2016-10-01
A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.
Whelan, Jessica J; Willis, Karen
2007-01-01
Access to safe drinking water is essential to human life and wellbeing, and is a key public health issue. However, many communities in rural and regional parts of Australia are unable to access drinking water that meets national standards for protecting human health. The aim of this research was to identify the key issues in and barriers to the provision and management of safe drinking water in rural Tasmania, Australia. Semi-structured interviews were conducted with key local government employees and public health officials responsible for management of drinking water in rural Tasmania. Participants were asked about their core public health duties, regulatory responsibilities, perceptions and management of risk, as well as the key barriers that may be affecting the provision of safe drinking water. This research highlights the effect of rural locality on management and safety of fresh water in protecting public health. The key issues contributing to problems with drinking water provision and quality identified by participants included: poor and inadequate water supply infrastructure; lack of resources and staffing; inadequate catchment monitoring; and the effect of competing land uses, such as forestry, on water supply quality. This research raises issues of inequity in the provision of safe drinking water in rural communities. It highlights not only the increasing need for greater funding by state and commonwealth government for basic services such as drinking water, but also the importance of an holistic and integrated approach to managing drinking water resources in rural Tasmania.
Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.
Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B
2017-11-01
Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function
Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.
Crawford, Melissa; Dagnino, Lina
2017-10-02
The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.
Prédélus, Dieuseul; Coutinho, Artur Paiva; Lassabatere, Laurent; Bien, Le Binh; Winiarski, Thierry; Angulo-Jaramillo, Rafael
2015-10-01
It is well recognized that colloidal nanoparticles are highly mobile in soils and can facilitate the transport of contaminants through the vadose zone. This work presents the combined effect of the capillary barrier and soil layer slope on the transport of water, bromide and nanoparticles through an unsaturated soil. Experiments were performed in a lysimeter (1×1×1.6m(3)) called LUGH (Lysimeter for Urban Groundwater Hydrology). The LUGH has 15 outputs that identify the temporal and spatial evolution of water flow, solute flux and nanoparticles in relation to the soil surface conditions and the 3D system configuration. Two different soil structures were set up in the lysimeter. The first structure comprises a layer of sand (0-0.2cm, in diameter) 35cm thick placed horizontally above a layer of bimodal mixture also 35cm thick to create a capillary barrier at the interface between the sand and bimodal material. The bimodal material is composed of a mixture 50% by weight of sand and gravel (0.4-1.1cm, in diameter). The second structure, using the same amount of sand and bimodal mixture as the first structure represents an interface with a 25% slope. A 3D numerical model based on Richards equation for flow and the convection dispersion equations coupled with a mechanical module for nanoparticle trapping was developed. The results showed that under the effect of the capillary barrier, water accumulated at the interface of the two materials. The sloped structure deflects flow in contrast to the structure with zero slope. Approximately 80% of nanoparticles are retained in the lysimeter, with a greater retention at the interface of two materials. Finally, the model makes a good reproduction of physical mechanisms observed and appears to be a useful tool for identifying key processes leading to a better understanding of the effect of capillary barrier on nanoparticle transfer in an unsaturated heterogeneous soil. Copyright © 2015 Elsevier B.V. All rights reserved.
Nainiger, J. J.
1978-01-01
An analytical study was made of the performance of air, steam, and water-cooled gas-turbine/steam turbine combined-cycle systems with and without thermal-barrier coatings. For steam cooling, thermal barrier coatings permit an increase in the turbine inlet temperature from 1205 C (2200 F), resulting in an efficiency improvement of 1.9 percentage points. The maximum specific power improvement with thermal barriers is 32.4 percent, when the turbine inlet temperature is increased from 1425 C (2600 F) to 1675 C (3050 F) and the airfoil temperature is kept the same. For water cooling, the maximum efficiency improvement is 2.2 percentage points at a turbine inlet temperature of 1683 C (3062 F) and the maximum specific power improvement is 36.6 percent by increasing the turbine inlet temperature from 1425 C (2600 F) to 1730 C (3150 F) and keeping the airfoil temperatures the same. These improvements are greater than that obtained with combined cycles using air cooling at a turbine inlet temperature of 1205 C (2200 F). The large temperature differences across the thermal barriers at these high temperatures, however, indicate that thermal stresses may present obstacles to the use of coatings at high turbine inlet temperatures.
Brandsch, Rainer
2017-10-01
Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.
Zelong, ZHANG; Jie, SHEN; Cheng, CHENG; Zimu, XU; Weidong, XIA
2018-04-01
Atmospheric pressure helium/water dielectric barrier discharge (DBD) plasma is used to investigate the generation of reactive species in a gas-liquid interface and in a liquid. The emission intensity of the reactive species is measured by optical emission spectroscopy (OES) with different discharge powers at the gas-liquid interface. Spectrophotometry is used to analyze the reactive species induced by the plasma in the liquid. The concentration of OH radicals reaches 2.2 μm after 3 min of discharge treatment. In addition, the concentration of primary long-lived reactive species such as H2O2, {{{{NO}}}3}- and O3 are measured based on plasma treatment time. After 5 min of discharge treatment, the concentration of H2O2, {{{{NO}}}3}-, and O3 increased from 0 mg · L-1 to 96 mg · L-1, 19.5 mg · L-1, and 3.5 mg · L-1, respectively. The water treated by plasma still contained a considerable concentration of reactive species after 6 h of storage. The results will contribute to optimizing the DBD plasma system for biological decontamination.
International Nuclear Information System (INIS)
Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.
2004-01-01
Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)
Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji
2016-01-01
To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.
Thames barrier (flood protection barriers on the Thames)
International Nuclear Information System (INIS)
Ilkovic, J.
2005-01-01
In this paper the flood protection barriers on the Thames are presented. The flood protection system on the Thames in 1984 was commissioned. During two decades this barrier was used 54 times against to the high water and 34 times against storm-sewage. There is installed buttress type hydroelectric power plant
Directory of Open Access Journals (Sweden)
Constanza Ballesteros-Martinez
2017-10-01
Full Text Available Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1 is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in vascular permeability, causing great loss of intravascular volume in a short time. Nevertheless, the molecular basis remains unexplored on the vascular level. We investigated Rcan1 expression induced by histamine, platelet-activating factor (PAF, and epinephrine in primary human vein (HV-/artery (HA-derived endothelial cells (ECs and human dermal microvascular ECs (HMVEC-D. Vascular permeability was analyzed in vitro in human ECs with forced Rcan1 expression using Transwell migration assays and in vivo using Rcan1 knockout mice. Histamine, but neither PAF nor epinephrine, induced Rcan1-4 mRNA and protein expression in primary HV-ECs, HA-ECs, and HMVEC-D through histamine receptor 1 (H1R. These effects were prevented by pharmacological inhibition of calcineurin with cyclosporine A. Moreover, intravenous histamine administration increased Rcan1 expression in lung tissues of mice undergoing experimental anaphylaxis. Functional in vitro assays showed that overexpression of Rcan1 promotes barrier integrity, suggesting a role played by this molecule in vascular permeability. Consistent with these findings, in vivo models of subcutaneous and intravenous histamine-mediated fluid extravasation showed increased response in skin, aorta, and lungs of Rcan1-deficient mice compared with wild-type animals. These findings reveal that endothelial Rcan1 is synthesized in response to histamine through a calcineurin-sensitive pathway and may reduce barrier breakdown, thus contributing to the strengthening of the endothelium and resistance to anaphylaxis. These new insights underscore its potential role as a regulator of sensitivity to anaphylaxis in humans.
Water vapour loss measurements on human skin.
Valk, Petrus Gerardus Maria van der
1984-01-01
In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions
Dielectric Barrier Discharge based Mercury-free plasma UV-lamp for efficient water disinfection.
Prakash, Ram; Hossain, Afaque M; Pal, U N; Kumar, N; Khairnar, K; Mohan, M Krishna
2017-12-12
A structurally simple dielectric barrier discharge based mercury-free plasma UV-light source has been developed for efficient water disinfection. The source comprises of a dielectric barrier discharge arrangement between two co-axial quartz tubes with an optimized gas gap. The outer electrode is an aluminium baked foil tape arranged in a helical form with optimized pitch, while the inner electrode is a hollow aluminium metallic rod, hermetically sealed. Strong bands peaking at wavelengths 172 nm and 253 nm, along with a weak band peaking at wavelength 265 nm have been simultaneously observed due to plasma radiation from the admixture of xenon and iodine gases. The developed UV source has been used for bacterial deactivation studies using an experimental setup that is an equivalent of the conventional house-hold water purifier system. Deactivation studies for five types of bacteria, i.e., E. coli, Shigella boydii, Vibrio, Coliforms and Fecal coliform have been demonstrated with 4 log reductions in less than ten seconds.
Poraty-Gavra, Limor; Zimmermann, Philip; Haigis, Sabine; Bednarek, Paweł; Hazak, Ora; Stelmakh, Oksana Rogovoy; Sadot, Einat; Schulze-Lefert, Paul; Gruissem, Wilhelm; Yalovsky, Shaul
2013-01-01
How plants coordinate developmental processes and environmental stress responses is a pressing question. Here, we show that Arabidopsis (Arabidopsis thaliana) Rho of Plants6 (AtROP6) integrates developmental and pathogen response signaling. AtROP6 expression is induced by auxin and detected in the root meristem, lateral root initials, and leaf hydathodes. Plants expressing a dominant negative AtROP6 (rop6DN) under the regulation of its endogenous promoter are small and have multiple inflorescence stems, twisted leaves, deformed leaf epidermis pavement cells, and differentially organized cytoskeleton. Microarray analyses of rop6DN plants revealed that major changes in gene expression are associated with constitutive salicylic acid (SA)-mediated defense responses. In agreement, their free and total SA levels resembled those of wild-type plants inoculated with a virulent powdery mildew pathogen. The constitutive SA-associated response in rop6DN was suppressed in mutant backgrounds defective in SA signaling (nonexpresser of PR genes1 [npr1]) or biosynthesis (salicylic acid induction deficient2 [sid2]). However, the rop6DN npr1 and rop6DN sid2 double mutants retained the aberrant developmental phenotypes, indicating that the constitutive SA response can be uncoupled from ROP function(s) in development. rop6DN plants exhibited enhanced preinvasive defense responses to a host-adapted virulent powdery mildew fungus but were impaired in preinvasive defenses upon inoculation with a nonadapted powdery mildew. The host-adapted powdery mildew had a reduced reproductive fitness on rop6DN plants, which was retained in mutant backgrounds defective in SA biosynthesis or signaling. Our findings indicate that both the morphological aberrations and altered sensitivity to powdery mildews of rop6DN plants result from perturbations that are independent from the SA-associated response. These perturbations uncouple SA-dependent defense signaling from disease resistance execution. PMID
Energy Technology Data Exchange (ETDEWEB)
Veeck, A.C. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry]|[Lawrence Livermore National Lab., CA (United States). Glenn T. Seaborg Inst. for Transactinium Science]|[Lawrence Berkeley National Lab., CA (United States). Nuclear Science Div.
1996-08-01
Excitation functions have been measured for complex fragment emission from the compound nucleus {sup 98}Mo, produced by the reaction of {sup 86}Kr with {sup 12}C. Mass asymmetric fission barriers have been obtained by fitting the excitation functions with a transition state formalism. The extracted barriers are {approximately} 5.7 MeV higher, on average, than the calculations of the Rotating Finite Range Model (RFRM). These data clearly show an isospin dependence of the conditional barriers when compared with the extracted barriers from {sup 90}Mo and {sup 94}Mo. Eleven different liquid/liquid extractants were synthesized based upon the chelating moieties 3,2-HOPO and 3,4-HOPO; additionally, two liquid/liquid extractants based upon the 1,2-HOPO chelating moiety were obtained for extraction studies. The Pu(IV) extractions, quite surprisingly, yielded results that were very different from the Fe(III) extractions. The first trend remained the same: the 1,2-HOPOs were the best extractants, followed closely by the 3,2-HOPOs, followed by the 3,4-HOPOs; but in these Pu(IV) extractions the 3,4-HOPOs performed much better than in the Fe(III) extractions. 129 refs.
Design and performance evaluation of a 1000-year evapotranspiration-capillary surface barrier
Energy Technology Data Exchange (ETDEWEB)
Zhang, Zhuanfang Fred; Strickland, Christopher E.; Link, Steven O.
2017-02-01
Surface barrier technology is used to isolate radioactive waste and to reduce or eliminate recharge water to the waste zone for 1000 years or longer. However, the design and evaluation of such a barrier is challenging because of the extremely long design life. The Prototype Hanford Barrier (PHB) was designed as a 1000-year barrier with pre-determined design and performance objectives and demonstrated in field from 1994 to present. The barrier was tested to evaluate surface-barrier design and performance at the field scale under conditions of enhanced and natural precipitation and of no vegetation. The monitoring data demonstrate that the barrier satisfied nearly all key objectives. The PHB far exceeded the Resource Conservation and Recovery Act criteria, functioned in Hanford’s semiarid climate, limited drainage to well below the 0.5 mm yr-1 performance criterion, limited runoff, and minimized erosion. Given the two-decade record of successful performance and consideration of all the processes and mechanisms that could degrade the stability and hydrology in the future, the results suggest the PHB is very likely to perform for its 1000-year design life. This conclusion is based on two assumptions: (1) the exposed subgrade receives protection against erosion and (2) institutional controls prevent inadvertent human activity at the barrier. The PHB design can serve as the base for site-specific barriers over waste sites containing underground nuclear waste, uranium mine tailings, and hazardous mine waste.
Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions
Directory of Open Access Journals (Sweden)
Milos Mihajlovic
2017-11-01
Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.
International Nuclear Information System (INIS)
Hironaga, Michihiko
2008-01-01
The Central Research Institute of Electric Power Industry (CRIEPI) has researched and developed the long-term durability evaluation of engineered barrier materials for the facility of sub-surface disposal at intermediate depth. The important functions of engineered barrier are mechanical stability of construction, low hydraulic conductivity and diffusivity, and absorption of nuclide. A natural barrier plays an important part in nuclide transfer. Some examples of researches on the engineered barrier with cement and bentonite are reported. They contained the leaching test of hardened cement paste using X-ray microanalysis, relation between the dissociation rate of montmorillonite and pH from 15 to 70 deg C, and the mechanism of gas permeability of dense bentonite. The results of leaching test showed that the modified underground water leached smaller amount of ions than the ion exchanged water. The sediment was found on the surface of hardened paste. The dissociation rate of smectite under alkaline conditions showed almost the same values as neutral conditions at 15 deg C. (S.Y.)
Functions of an engineered barrier system for a nuclear waste repository in basalt
International Nuclear Information System (INIS)
Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.
1980-01-01
Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance
Concurrent bioremediation of perchlorate and 1,1,1-trichloroethane in an emulsified oil barrier
Borden, Robert C.
2007-10-01
A detailed field pilot test was conducted to evaluate the use of edible oil emulsions for enhanced in situ biodegradation of perchlorate and chlorinated solvents in groundwater. Edible oil substrate (EOS®) was injected into a line of ten direct push injection wells over a 2-day period to form a 15-m-long biologically active permeable reactive barrier (bio-barrier). Field monitoring results over a 2.5-year period indicate the oil injection generated strongly reducing conditions in the oil-treated zone with depletion of dissolved oxygen, nitrate, and sulfate, and increases in dissolved iron, manganese and methane. Perchlorate was degraded from 3100 to 20,000 μg/L to below detection (oil and adaptation of the in situ microbial community. Approximately 4 months after emulsion injection, concentrations of 1,1,1-trichloroethane (TCA), perchloroethene (PCE), trichloroethene (TCE) and their degradation products appeared to reach a quasi steady-state condition. During the period from 4 to 18 months, TCA was reduced from 30-70 μM to 0.2-4 μM during passage through the bio-barrier. However, 1-9 μM 1,1-dichloroethane (DCA) and 8-14 μM of chloroethane (CA) remained indicating significant amounts of incompletely degraded TCA were discharging from the oil-treated zone. During this same period, PCE and TCE were reduced with concurrent production of 1,2- cis-dichloroethene ( cis-DCE). However, very little VC or ethene was produced indicating reductive dechlorination slowed or stopped at cis-DCE. The incomplete removal of TCA, PCE and TCE is likely associated with the short (5-20 days) hydraulic retention time of contaminants in the oil-treated zone. The permeability of the injection wells declined by 39-91% (average = 68%) presumably due to biomass growth and/or gas production. However, non-reactive tracer tests and detailed monitoring of the perchlorate plume demonstrated that the permeability loss did not result in excessive flow bypassing around the bio-barrier
Design of dry barriers for containment of contaminants in unsaturated soils
International Nuclear Information System (INIS)
Morris, C.E.; Thomson, B.M.; Stormont, J.C.
1997-01-01
A dry barrier is a region of very dry conditions in unsaturated soil that prevents vertical migration of water created by circulating dry air through the formation. Dry soil creates a barrier to vertical water movement by decreasing the soil's hydraulic conductivity, a concept also used in capillary barriers. A dry barrier may be a viable method for providing containment of a contaminant plume in a setting with a thick unsaturated zone and dry climate. The principal factors which determine the feasibility of a dry barrier include: (1) an and environment, (2) thick vadose zone, and (3) the ability to circulate air through the vadose zone. This study investigated the technical and economic considerations associated with creating a dry barrier to provide containment of a hypothetical 1 ha aqueous contaminant plume. The concept appears to be competitive with other interim containment methods such as ground freezing
Directory of Open Access Journals (Sweden)
Simona F Spampinato
Full Text Available The ability of the Blood Brain Barrier (BBB to maintain proper barrier functions, keeping an optimal environment for central nervous system (CNS activity and regulating leukocytes' access, can be affected in CNS diseases. Endothelial cells and astrocytes are the principal BBB cellular constituents and their interaction is essential to maintain its function. Both endothelial cells and astrocytes express the receptors for the bioactive sphingolipid S1P. Fingolimod, an immune modulatory drug whose structure is similar to S1P, has been approved for treatment in multiple sclerosis (MS: fingolimod reduces the rate of MS relapses by preventing leukocyte egress from the lymph nodes. Here, we examined the ability of S1P and fingolimod to act on the BBB, using an in vitro co-culture model that allowed us to investigate the effects of S1P on endothelial cells, astrocytes, and interactions between the two. Acting selectively on endothelial cells, S1P receptor signaling reduced cell death induced by inflammatory cytokines. When acting on astrocytes, fingolimod treatment induced the release of a factor, granulocyte macrophage colony-stimulating factor (GM-CSF that reduced the effects of cytokines on endothelium. In an in vitro BBB model incorporating shear stress, S1P receptor modulation reduced leukocyte migration across the endothelial barrier, indicating a novel mechanism that might contribute to fingolimod efficacy in MS treatment.
Blood-aqueous Barrier Function in a Patient With Choroideremia
Directory of Open Access Journals (Sweden)
Muh-Shy Chen
2010-02-01
Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.
Sauer, Reine-Solange; Krug, Susanne M; Hackel, Dagmar; Staat, Christian; Konasin, Natalia; Yang, Shaobing; Niedermirtl, Benedikt; Bosten, Judith; Günther, Ramona; Dabrowski, Sebastian; Doppler, Kathrin; Sommer, Claudia; Blasig, Ingolf E; Brack, Alexander; Rittner, Heike L
2014-07-10
The blood-nerve barrier consists of the perineurium and endoneurial vessels. The perineurial barrier is composed of a basal membrane and a layer of perineurial cells sealed by tight junction proteins preventing e.g. application of analgesics for selective regional pain control. One of the barrier-sealing proteins in the blood-nerve barrier is claudin-1. Therefore, the claudin-1-peptidomimetics (C1C2), derived from the first extracellular loop (ECL1) on claudin-1 was developed. In this study, we further evaluated the expression of tight junction proteins in the perineurium in Wistar rats and characterized the specificity, in vivo applicability, mechanism of action as well as the biocompatibility of C1C2. In the perineurium, claudin-19, tricellulin and ZO-1, but no claudin-2, 3, 8 and -11 were expressed. C1C2 specifically bound to the ECL1 of claudin-1 and fluorescent 5,6-carboxytetramethylrhodamine-C1C2 was rapidly internalized. Opening the perineurium with C1C2 reduced the mRNA and protein expression of claudin-1 and increased small and macromolecule permeability into the peripheral nerve. Application of C1C2 facilitated regional analgesia using μ-opioid receptor agonists like DAMGO or morphine without motor impairment in naïve rats as well as rats with hind paw inflammation. In contrast the control peptide C2C2 derived from ECL1 on claudin-2 did neither open the barrier nor facilitated opioid-mediated regional analgesia. C1C2 delivery was well tolerated and caused no morphological and functional nerve damage. C1C2 effects could be reversed by interference with the wnt-signal-transduction pathway, specifically the homeobox transcription factor cdx2, using a glycogen-synthase-kinase-3 inhibitor. In summary, we describe the composition of and a pathway to open the perineurial barrier employing a peptide to deliver hydrophilic substances to the peripheral nerve. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Waugh, W.J.
1989-05-01
The purpose of this study is to measure the interactive effects of gravel admix and greater precipitation on soil water storage and plant abundance. The study is one of many tasks in the Protective Barrier Development Program for the disposal of Hanford defense waste. A factorial field-plot experiment was set up at the site selected as the borrow area for barrier topsoil. Gravel admix, vegetation, and enhanced precipitation treatments were randomly assigned to the plots using a split-split plot design structure. Changes in soil water storage and plant cover were monitored using neutron probe and point intercept methods, respectively. The first-year results suggest that water extraction by plants will offset gravel-caused increases in soil water storage. Near-surface soil water contents were much lower in graveled plots with plants than in nongraveled plots without plants. Large inherent variability in deep soil water storage masked any effects gravel may have had on water content below the root zone. In the future, this source of variation will be removed by differencing monthly data series and testing for changes in soil water storage. Tests of the effects of greater precipitation on soil water storage were inconclusive. A telling test will be possible in the spring of 1988, following the first wet season during which normal precipitation is doubled. 26 refs., 9 figs., 9 tabs
Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang
2014-01-01
In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.
Ni, Xiuqin; Epshtein, Yulia; Chen, Weiguo; Zhou, Tingting; Xie, Lishi; Garcia, Joe G N; Jacobson, Jeffrey R
2014-06-01
We previously reported sphingosine 1-phosphate (S1P) and hepatocyte growth factor (HGF) augment endothelial cell (EC) barrier function and attenuate murine acute lung inury (ALI). While the mechanisms underlying these effects are not fully understood, S1P and HGF both transactivate the S1P receptor, S1PR1 and integrin β4 (ITGB4) at membrane caveolin-enriched microdomains (CEMs). In the current study, we investigated the roles of S1PR2 and S1PR3 in S1P/HGF-mediated EC signaling and their associations with ITGB4. Our studies confirmed ITGB4 and S1PR2/3 are recruited to CEMs in human lung EC in response to either S1P (1 µM, 5 min) or HGF (25 ng/ml, 5 min). Co-immunoprecipitation experiments identified an S1P/HGF-mediated interaction of ITGB4 with both S1PR2 and S1PR3. We then employed an in situ proximity ligation assay (PLA) to confirm a direct ITGB4-S1PR3 association induced by S1P/HGF although a direct association was not detectable between S1PR2 and ITGB4. S1PR1 knockdown (siRNA), however, abrogated S1P/HGF-induced ITGB4-S1PR2 associations while there was no effect on ITGB4-S1PR3 associations. Moreover, PLA confirmed a direct association between S1PR1 and S1PR2 induced by S1P and HGF. Finally, silencing of S1PR2 significantly attenuated S1P/HGF-induced EC barrier enhancement as measured by transendothelial resistance while silencing of S1PR3 significantly augmented S1P/HGF-induced barrier enhancement. These results confirm an important role for S1PR2 and S1PR3 in S1P/HGF-mediated EC barrier responses that are associated with their complex formation with ITGB4. Our findings elucidate novel mechanisms of EC barrier regulation that may ultimately lead to new therapeutic targets for disorders characterized by increased vascular permeability including ALI. © 2013 Wiley Periodicals, Inc.
Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y
2010-01-01
Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.
Lipids and skin barrier function - a clinical perspective
DEFF Research Database (Denmark)
Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.
2008-01-01
The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...
Chaotic correlations in barrier billiards with arbitrary barriers
International Nuclear Information System (INIS)
Osbaldestin, A H; Adamson, L N C
2013-01-01
We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)
Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo
2016-06-01
Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.
International Nuclear Information System (INIS)
Savio, Andrea; Poncet, Alain
2011-01-01
In this work, we compute the Wigner distribution function on one-dimensional devices from wave functions generated by solving the Schroedinger equation. Our goal is to investigate certain issues that we encountered in implementing Wigner transport equation solvers, such as the large discrepancies observed between the boundary conditions and the solution in the neighborhood of the boundaries. By evaluating the Wigner function without solving the Wigner transport equation, we intend to ensure that the actual boundary conditions are consistent with those commonly applied in literature. We study both single- and double-barrier unbiased structures. We use simple potential profiles, so that we can compute the wave functions analytically for better accuracy. We vary a number of structure geometry, material, meshing, and numerical parameters, among which are the contact length, the barrier height, the number of incident wave functions, and the numerical precision used for the computations, and we observe how the Wigner function at the device boundaries is affected. For the double-barrier structures, we look at the density matrix function and we study a model for the device transmission spectrum which helps explain the lobelike artifacts that we observe on the Wigner function.
Anderson, C. P.; Carter, G. A.; Mooneyhan, D.
2013-12-01
Carlton P. Anderson, Gregory Carter, and David Mooneyhan University of Southern Mississippi Gulf Coast Geospatial Center Department of Geography and Geology Carlton.p.anderson@eagles.usm.edu The Mississippi-Alabama (MS-AL) barrier island chain consist of dynamic depositional landforms that constantly undergo changes in their evolutionary processes through changes in sea level, sediment supply, and weather events. These complex landscapes of the Northern Gulf of Mexico (NGOM) provide a chance to study their geomorphological progressions, which have been produced by sea level rise and fluvial processes throughout the Holocene. Studies on the freshwater lens of barriers have mainly concentrated on carbonate island settings with minimal focus to barriers with siliciclastic geology. The purpose of this study is to examine the relationship beach dune topography plays in the development and sustainability of the fresh water lens of Cat Island, Mississippi. Cat Island offers the opportunity to research a siliciclastic barrier along the NGOM where minimal anthropogenic activities have taken place. To determine the effect dune topography has on the fresh water lens, a transect of permanent water wells were used in conjunction with test wells at different sites throughout the north spit of the island, to establish the water table height above the ellipsoid (WGS 84), with vertical accuracies of 2 cm. Cross-sectional profiles of the dunes were also performed utilizing purposeful transects that intersected fresh water ponds in the dune-swale systems. These ponds provide water table elevations at the surface which were interpolated across the dunes for areas that lacked permanent well sites. To obtain survey-grade accuracies, a Trimble TSC3 receiver coupled with a R8 antennae RTK system were used. Salinity measurements were taken at test sites to determine the salt-to-freshwater interface. Results provide insights into how dune topography influences the fresh water lens of a
García de la Vega, J M; Omar, S; San Fabián, J
2017-04-01
Spin-spin coupling constants in water monomer and dimer have been calculated using several wave function and density functional-based methods. CCSD, MCSCF, and SOPPA wave functions methods yield similar results, specially when an additive approach is used with the MCSCF. Several functionals have been used to analyze their performance with the Jacob's ladder and a set of functionals with different HF exchange were tested. Functionals with large HF exchange appropriately predict 1 J O H , 2 J H H and 2h J O O couplings, while 1h J O H is better calculated with functionals that include a reduced fraction of HF exchange. Accurate functionals for 1 J O H and 2 J H H have been tested in a tetramer water model. The hydrogen bond effects on these intramolecular couplings are additive when they are calculated by SOPPA(CCSD) wave function and DFT methods. Graphical Abstract Evaluation of the additive effect of the hydrogen bond on spin-spin coupling constants of water using WF and DFT methods.
Richards Barrier LA Reference Design Feature Evaluation
International Nuclear Information System (INIS)
N.E. Kramer
1999-01-01
The Richards Barrier is one of the design features of the repository to be considered for the License Application (LA), Richards was a soil scientist who first described the diversion of moisture between two materials with different hydrologic properties. In this report, a Richards Barrier is a special type of backfill with a fine-grained material (such as sand) overlaying a coarse-grained material (such as gravel). Water that enters an emplacement drift will first encounter the fine-grained material and be transported around the coarse-grained material covering the waste package, thus protecting the waste package from contact with most of the groundwater. The objective of this report is to discuss the benefits and liabilities to the repository by the inclusion of a Richards Barrier type backfill in emplacement drifts. The Richards Barrier can act as a barrier to water flow, can reduce the waste package material dissolution rate, limit mobilization of the radionuclides, and can provide structural protection for the waste package. The scope of this report is to: (1) Analyze the behavior of barrier materials following the intrusion of groundwater for influxes of 1 to 300 mm per year. The report will demonstrate diversion of groundwater intrusions into the barrier over an extended time period when seismic activity and consolidation may cause the potential for liquefaction and settlement of the Richards Barrier. (2) Review the thermal effects of the Richards Barrier on material behavior. (3) Analyze the effect of rockfall on the performance of the Richards Barrier and the depth of the barrier required to protect waste packages under the barrier. (4) Review radiological and heating conditions on placement of multiple layers of the barrier. Subsurface Nuclear Safety personnel will perform calculations to determine the radiation reduction-time relationship and shielding capacity of the barrier. (5) Evaluate the effects of ventilation on cooling of emplacement drifts and
Treatment of EDTA contained reactor coolant using water dielectric barrier discharge plasma
International Nuclear Information System (INIS)
Song, Sang Heon; Kwon, Daniel; Kim, Gon Ho
2005-01-01
EDTA (Ethylene Diamine Tetraacetic Acid) is used as a main absorbent for the metal ion in the secondary loop of the nuclear reactor. Dissolving the wasted EDTA with low cost, therefore, is important issue for the maintenance of the nuclear power reactor and the protection of environment. EDTA is not easily biodegradable, furthermore these methods could make remained another pollutant as complex chemical compounds. Compared to chemical method, the physical methods, using the energetic particles and UVs, are more favorable because they dissociate the bonds of organic compounds directly without the secondary chemical reactions during the treatment. Recently, high energy electron beam, the plasma torch, and the water breakdown by high voltage pulse are applied to treatment of the waste water contained chemicals. Here consideration is narrow down to improve the interaction between the plasma and the chemical bonds of EDTA because the energetic particles; activated radicals, and UVs, are abundant in plasmas. The new method adapted of the water DBD (dielectric barrier discharge) which plasma generates directly on the top of the water contained EDTA is proposed. The application of DBD plasmas has been extended for cleaning the organic compounds from the contaminated surface and also for removing volatile organic chemicals (VOC) such as NO x and SO x from the exhausted gases. Here, the water DBD reactor (SEMTECH, SD-DWG-04-1) is consisted that the one electrode is a ceramic insulator and another one is the water itself. Interestingly, the one electrode, the water, is not the solid dielectric electrode. In this study, therefore, the characteristics with driving frequency are considered and the feasibility of this new method for the DBD treatment of EDTA contained water is demonstrated
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Azhoni, Adani; Holman, Ian; Jude, Simon
2017-01-15
Research on adaptation barriers is increasing as the need for climate change adaptation becomes evident. However, empirical studies regarding the emergence, causes and sustenance of adaptation barriers remain limited. This research identifies key contextual causes of adaptation barriers in water institutions in the mountainous Himalayan state of Himachal Pradesh in northern India. Semi-structured interviews were carried out with representatives from twenty-six key governmental, non-governmental, academic and research institutions in the State with responsibilities spanning domestic water supply, irrigation and hydropower generation, environmental monitoring and research. It identified low knowledge capacity and resources, policy implementation gaps, normative attitudes, and unavailability and inaccessibility of data and information compounded with weak interinstitutional networks as key adaptation barriers. Although these barriers are similar to those reported elsewhere, they have important locally-contextual root causes. For instance, inadequate resources result from fragmented resources allocation due to competing developmental priorities and the desire of the political leadership to please diverse electors, rather than climate scepticism. The identified individual barriers are found to be highly inter-dependent and closely intertwined which enables the identification of leverage points for interventions to maximise barrier removal. For instance, breaking down key barriers hindering accessibility to data and information, which are shaped by systemic bureaucracies and cultural attitudes, will involve attitudinal change through sensitisation to the importance of accurate and accessible data and information and the building trust between different actors, in addition to institutional structural changes through legislation and inter-institutional agreements. Approaching barriers as a system of contextually interconnected cultural, systemic, geographical and political
Jekel, Martin; Ruhl, Aki Sebastian; Meinel, Felix; Zietzschmann, Frederik; Pflugmacher Lima, Stephan; Baur, Nina; Wenzel, Melanie; Gnierß, Regina; Sperlich, Alexander; Dünnbier, Uwe; Böckelmann, Uta; Hummelt, Daniel; van Baar, Patricia; Wode, Florian; Petersohn, Dietmar
2013-01-01
First published by Springer: Jekel, Martin et al.: Anthropogenic organic micro-pollutants and pathogens in the urban water cycle: assessment, barriers and risk communication (ASKURIS). - In: Environmental Sciences Europe. - ISSN 2190-4715 (online). - 25 (2013), art. 20. - doi:10.1186/2190-4715-25-20. In urban areas, water often flows along a partially closed water cycle in which treated municipal wastewater is discharged into surface waters which are one source of raw waters used for dr...
Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier
Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.
2016-01-01
Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403
PILOT-SCALE EVALUATION OF ENGINEERED BARRIER SYSTEMS FOR THE YUCCA MOUNTAIN PROJECT
International Nuclear Information System (INIS)
Webb, S.W.; George, J.T.; Finley, R.E.
2001-01-01
This paper describes two quarter-scale experiments (1.4 m diameter) and associated numerical analyses on granular backfill engineered barrier systems in support of the Yucca Mountain Project for the potential repository. The two configurations include a sloped capillary barrier and a plain backfill. The tests involve application of dyed water as a constant line infiltration source along the top of the test set-up, monitoring water movement through the test, and measuring water exiting the experiments. A complete water balance estimate is made for each test, and observed water movement is compared with (1) detailed numerical analyses conducted using the TOUGH2 code for unsaturated flow in porous media and (2) posttest observations. The results of the testing and analyses show that for the injection rates and configuration applied, the capillary barrier design diverts a significant amount of all injected water and the TOUGH2 pretest predictions show qualitative and quantitative agreement with the experimental data
Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.
2014-01-01
Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982
Hanford prototype-barrier status report: FY 1997
International Nuclear Information System (INIS)
Ward, A.L.; Gee, G.W.; Link, S.O.
1997-12-01
An above-grade surface barrier consisting of a vegetated soil-cover, surrounded by gravel and rock side slopes, is being tested for the US Department of Energy (DOE). It is part of a treatability study at the 200-BP-1 Operable Unit in the 200 East Area of the Hanford Site, near Richland, Washington. The surface barrier, constructed in 1994, covers 2.5 ha (6.9 acre) of land surface and is situated over an inactive liquid-waste disposal crib. A set of under drains, built into the barrier using curbed asphalt, allows precise measurement of drainage from the soil cover and the side slopes. The treatability test includes measurements of water balance, wind and water erosion, subsidence, plant growth, and plant and animal intrusion. The test compares the performance of the barrier under ambient and simulated climate change (elevated precipitation) conditions. This report documents findings from the third year of testing
Directory of Open Access Journals (Sweden)
Adriaan A Van Beek
2016-10-01
Full Text Available Although it is clear that probiotics improve intestinal barrier function, little is known about the effects of probiotics on the aging intestine. We investigated effects of 10-wk bacterial supplementation of Lactobacillus plantarum WCFS1, Lactobacillus casei BL23, or Bifidobacterium breve DSM20213 on gut barrier and immunity in 16-week-old accelerated aging Ercc1-/Δ7 mice, which have a median lifespan of ~20wk, and their wild-type littermates. The colonic barrier in Ercc1-/Δ7 mice was characterized by a thin (<10µm mucus layer. L. plantarum prevented this decline in mucus integrity in Ercc1-/Δ7 mice, whereas B. breve exacerbated it. Bacterial supplementations affected the expression of immune-related genes, including Toll-like receptor 4. Regulatory T cell frequencies were increased in the mesenteric lymph nodes of L. plantarum- and L. casei-treated Ercc1-/Δ7 mice. L. plantarum- and L. casei-treated Ercc1-/Δ7 mice showed increased specific antibody production in a T cell-dependent immune response in vivo. By contrast, the effects of bacterial supplementation on wild-type control mice were negligible. Thus, supplementation with L. plantarum – but not with L. casei and B. breve – prevented the decline in the mucus barrier in Ercc1-/Δ7 mice. Our data indicate that age is an important factor influencing beneficial or detrimental effects of candidate probiotics. These findings also highlight the need for caution in translating beneficial effects of probiotics observed in young animals or humans to the elderly.
The two-pore domain K+ channel TASK-1 is closely associated with brain barriers and meninges.
Kanjhan, Refik; Pow, David V; Noakes, Peter G; Bellingham, Mark C
2010-12-01
Impairment of the blood-brain barrier (BBB), the blood-cerebrospinal fluid (CSF) barrier and brain-CSF barrier has been implicated in neuropathology of several brain disorders, such as amyotrophic lateral sclerosis, cerebral edema, multiple sclerosis, neural inflammation, ischemia and stroke. Two-pore domain weakly inward rectifying K+ channel (TWIK)-related acid-sensitive potassium (TASK)-1 channels (K2p3.1; KCNK3) are among the targets that contribute to the development of these pathologies. For example TASK-1 activity is inhibited by acidification, ischemia, hypoxia and several signaling molecules released under pathologic conditions. We have used immuno-histochemistry to examine the distribution of the TASK-1 protein in structures associated with the BBB, blood-CSF barrier, brain-CSF barrier, and in the meninges of adult rat. Dense TASK-1 immuno-reactivity (TASK-1-IR) was observed in ependymal cells lining the fourth ventricle at the brain-CSF interface, in glial cells that ensheath the walls of blood vessels at the glio-vascular interface, and in the meninges. In these structures, TASK-1-IR often co-localized with glial fibrillary associated protein (GFAP) or vimentin. This study provides anatomical evidence for localization of TASK-1 K+ channels in cells that segregate distinct fluid compartments within and surrounding the brain. We suggest that TASK-1 channels, in coordination with other ion channels (e.g., aquaporins and chloride channels) and transporters (e.g., Na+-K+-ATPase and Na+-K+-2Cl⁻ and by virtue of its heterogeneous distribution, may differentially contribute to the varying levels of K+ vital for cellular function in these compartments. Our findings are likely to be relevant to recently reported roles of TASK-1 in cerebral ischemia, stroke and inflammatory brain disorders.
Barriers and post-closure monitoring (AL121125)
International Nuclear Information System (INIS)
Bostick, K.V.; Janecky, D.
1995-01-01
This project focuses on the rapid implementation of near-surface barriers, biotreatment, and post-closure monitoring technology. It uses water-permeable and biologic barriers that chemically capture and/or degrade contaminants without significantly altering the natural water flow regime. Barrier approaches are being tested for two different applications. The first is the use of barriers for confinement of chemical contaminants for in-trench treatments with leach systems or an in-place bioreactor. The second is an enhancement of the current practice of emplacing grout or clay slurry walls into direct horizontal surface and subsurface water flows around a contaminated area by integrating permeable reactive barriers and petroleum reservoir gel/foam/polymer technology
Energy Technology Data Exchange (ETDEWEB)
Uzunova, Ellie L., E-mail: ellie@svr.igic.bas.bg [Institute of General and Inorganic Chemistry, Bulgarian Academy of Sciences, Sofia 1113 (Bulgaria); Mikosch, Hans [Institute for Chemical Technologies and Analytics, Vienna University of Technology, Getreidemarkt 9/E164-EC, 1060 Vienna (Austria)
2014-07-28
The iron sulfide dimers (FeS){sub 2} and their persulfide isomers with S–S bonds are studied with the B3LYP density functional as bare clusters and as hexacarbonyls. The disulfides are more stable than the persulfides as bare clusters and the persulfide ground state lies at 3.2 eV above the global minimum, while in the hexacarbonyl complexes this order is reversed: persulfides are more stable, but the energy gap between disulfides and persulfides becomes much smaller and the activation barrier for the transition persulfide → disulfide is 1.11 eV. Carbonylation also favors a non-planar Fe{sub 2}S{sub 2} ring for both the disulfides and the persulfides and high electron density in the Fe{sub 2}S{sub 2} core is induced. The diamagnetic ordering is preferred in the hexacarbonyls, unlike the bare clusters. The hexacarbonyls possess low-lying triplet excited states. In the persulfide, the lowest singlet-to-triplet state excitation occurs by electron transition from the iron centers to an orbital located predominantly at S{sub 2} via metal-to-ligand charge transfer. In the disulfide this excitation corresponds to ligand-to-metal charge transfer from the sulfur atoms to an orbital located at the iron centers and the Fe–Fe bond. Water splitting occurs on the hexacarbonyls, but not on the bare clusters. The singlet and triplet state reaction paths were examined and activation barriers were determined: 50 kJ mol{sup −1} for HO–H bond dissociation and 210 kJ mol{sup −1} for hydrogen evolution from the intermediate sulfoxyl-hydroxyl complexes Fe{sub 2}S(OH)(SH)(CO){sub 6} formed. The lowest singlet-singlet excitations in the hexacarbonyls, the water adsorption complexes and in the reaction intermediates, formed prior to dihydrogen release, fall in the visible light region. The energy barrier of 210 kJ mol{sup −1} for the release of one hydrogen molecule corresponds to one visible photon of 570 nm. The dissociation of a second water molecule, followed by H{sub 2
Directory of Open Access Journals (Sweden)
Selina Beasley
2014-01-01
Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.
Model assessment of protective barrier designs
International Nuclear Information System (INIS)
Fayer, M.J.; Conbere, W.; Heller, P.R.; Gee, G.W.
1985-11-01
A protective barrier is being considered for use at the Hanford site to enhance the isolation of previously disposed radioactive wastes from infiltrating water, and plant and animal intrusion. This study is part of a research and development effort to design barriers and evaluate their performance in preventing drainage. A fine-textured soil (the Composite) was located on the Hanford site in sufficient quantity for use as the top layer of the protective barrier. A number of simulations were performed by Pacific Northwest Laboratory to analyze different designs of the barrier using the Composite soil as well as the finer-textured Ritzville silt loam and a slightly coarser soil (Coarse). Design variations included two rainfall rates (16.0 and 30.1 cm/y), the presence of plants, gravel mixed into the surface of the topsoil, an impermeable boundary under the topsoil, and moving the waste form from 10 to 20 m from the barrier edge. The final decision to use barriers for enhanced isolation of previously disposed wastes will be subject to decisions resulting from the completion of the Hanford Defense Waste Environmental Impact Statement, which addresses disposal of Hanford defense high-level and transuranic wastes. The one-dimensional simulation results indicate that each of the three soils, when used as the top layer of the protective barrier, can prevent drainage provided plants are present. Gravel amendments to the upper 30 cm of soil (without plants) reduced evaporation and allowed more water to drain
Moeser, Adam J; Borst, Luke B; Overman, Beth L; Pittman, Jeremy S
2012-10-01
The objective of this study was to investigate intestinal function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Jejunum and distal ileum from control and pigs exhibiting PFTS was harvested at weaning, 4 and 11 days post-weaning (PW) for intestinal barrier function studies and histological analyses (n=6 pigs per group). Marked disturbances in intestinal barrier function was observed in PFTS pigs, compared with controls, indicated by lower (p<0.05) TER and increased (p<0.01) permeability to FITC dextran (4 kDa). Intestines from weaned pigs, subjected to a 4-day fast, exhibited minor disturbances in intestinal barrier function. Villus atrophy and crypt hyperplasia were observed in the PFTS intestine compared with control and fasted pigs. These data demonstrate that PFTS is associated with profound disturbances in intestinal epithelial barrier function and alterations in mucosal and epithelial morphology in which anorexia is not the sole factor. Copyright © 2012 Elsevier Ltd. All rights reserved.
Design and performance evaluation of a 1000-year evapotranspiration-capillary surface barrier.
Zhang, Zhuanfang Fred; Strickland, Christopher E; Link, Steven O
2017-02-01
Surface barrier technology is used to isolate radioactive waste and to reduce or eliminate recharge water to the waste zone for 1000 years or longer. However, the design and evaluation of such a barrier is challenging because of the extremely long design life. After establishing a set of design and performance objectives, a package of design solutions was developed for 1000-year surface barriers over nuclear waste sites. The Prototype Hanford Barrier (PHB) was then constructed in 1994 in the field over an existing waste site as a demonstration. The barrier was tested to evaluate surface-barrier design and performance at the field scale under conditions of enhanced and natural precipitation and of no vegetation. The monitoring data demonstrate that the barrier satisfied nearly all objectives in the past two decades. The PHB far exceeded the Resource Conservation and Recovery Act criteria, functioned in Hanford's semiarid climate, limited drainage to well below the 0.5 mm yr -1 performance criterion, limited runoff, and minimized erosion and bio-intrusion. Given the two-decade record of successful performance and consideration of the processes and mechanisms that could affect barrier stability and hydrology in the future, the results suggest the PHB is very likely to perform for its 1000-year design life. This conclusion is based on two assumptions: (1) the exposed subgrade receives protection against erosion and (2) institutional controls prevent inadvertent human activity at the barrier. The PHB design can serve as the basis for site-specific barriers over waste sites containing underground nuclear waste, uranium mine tailings, and hazardous mine waste. Copyright © 2016 Elsevier Ltd. All rights reserved.
Modelling of migration from multi-layers and functional barriers: Estimation of parameters
Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.
2006-01-01
Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment
Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro
2018-01-01
We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.
Model assessment of protective barrier designs: Part 2
International Nuclear Information System (INIS)
Fayer, M.J.
1987-11-01
Protective barriers are being considered for use at the Hanford Site to enhance the isolation of radioactive wastes from water, plant, and animal intrusion. This study assesses the effectiveness of protective barriers for isolation of wastes from water. In this report, barrier designs are reviewed and several barrier modeling assumptions are tested. 20 refs., 16 figs., 6 tabs
Mechanical Barriers Restrict Invasion of Herpes Simplex Virus 1 into Human Oral Mucosa.
Thier, Katharina; Petermann, Philipp; Rahn, Elena; Rothamel, Daniel; Bloch, Wilhelm; Knebel-Mörsdorf, Dagmar
2017-11-15
human oral mucosa to explore how HSV can enter its target tissue. Our results demonstrate that intact mucosa samples and even compromised tissue allow only very limited access of HSV to keratinocytes. Detailed understanding of barrier functions is an essential precondition to unravel how HSV bypasses the barriers and approaches its receptors in tissue and why it is beneficial for the virus to use a cell-cell adhesion molecule, such as nectin-1, as a receptor. Copyright © 2017 American Society for Microbiology.
Schuster, Ann-Christin; Burghardt, Markus; Alfarhan, Ahmed; Bueno, Amauri; Hedrich, Rainer; Leide, Jana; Thomas, Jacob; Riederer, Markus
2016-01-01
Maintaining the integrity of the cuticular transpiration barrier even at elevated temperatures is of vital importance especially for hot-desert plants. Currently, the temperature dependence of the leaf cuticular water permeability and its relationship with the chemistry of the cuticles are not known for a single desert plant. This study investigates whether (i) the cuticular permeability of a desert plant is lower than that of species from non-desert habitats, (ii) the temperature-dependent increase of permeability is less pronounced than in those species and (iii) whether the susceptibility of the cuticular permeability barrier to high temperatures is related to the amounts or properties of the cutin or the cuticular waxes. We test these questions with Rhazya stricta using the minimum leaf water vapour conductance (gmin) as a proxy for cuticular water permeability. gmin of R. stricta (5.41 × 10(-5) m s(-1) at 25 °C) is in the upper range of all existing data for woody species from various non-desert habitats. At the same time, in R. stricta, the effect of temperature (15-50 °C) on gmin (2.4-fold) is lower than in all other species (up to 12-fold). Rhazya stricta is also special since the temperature dependence of gmin does not become steeper above a certain transition temperature. For identifying the chemical and physical foundation of this phenomenon, the amounts and the compositions of cuticular waxes and cutin were determined. The leaf cuticular wax (251.4 μg cm(-2)) is mainly composed of pentacyclic triterpenoids (85.2% of total wax) while long-chain aliphatics contribute only 3.4%. In comparison with many other species, the triterpenoid-to-cutin ratio of R. stricta (0.63) is high. We propose that the triterpenoids deposited within the cutin matrix restrict the thermal expansion of the polymer and, thus, prevent thermal damage to the highly ordered aliphatic wax barrier even at high temperatures. Published by Oxford University Press on behalf of the
The blood-brain barrier and oncology : new insights into function and modulation
Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE
2000-01-01
The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the
Energy Technology Data Exchange (ETDEWEB)
Looney, Brian B. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jackson, Dennis G. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Truex, Michael J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Johnson, Christian D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2015-02-23
TEPCO is implementing a number of water countermeasures to limit the releases and impacts of contaminated water to the surrounding environment. The diverse countermeasures work together in an integrated manner to provide different types, and several levels, of protection. In general, the strategy represents a comprehensive example of a “defense in depth” concept that is used for nuclear facilities around the world. One of the key countermeasures is a frozen soil barrier encircling the damaged reactor facilities. The frozen barrier is intended to limit the flow of water into the area and provide TEPCO the ability to reduce the amount of contaminated water that requires treatment and storage. The National Laboratory team supports the selection of artificial ground freezing and the incorporation of the frozen soil barrier in the contaminated water countermeasures -- the technical characteristics of a frozen barrier are relatively well suited to the Fukushima-specific conditions and the need for inflow reduction. Further, our independent review generally supports the TEPCO/Kajima design, installation strategy and operation plan.
Stress dependence of the Peierls barrier of 1/2〈1 1 1〉 screw dislocations in bcc metals
International Nuclear Information System (INIS)
Gröger, R.; Vitek, V.
2013-01-01
The recently formulated constrained nudged elastic band method with atomic relaxations (NEB + r) (Gröger R, Vitek V. Model Simul Mater Sci Eng 2012;20:035019) is used to investigate the dependence of the Peierls barrier of 1/2〈1 1 1〉 screw dislocations in body-centered cubic metals on non-glide stresses. These are the shear stresses parallel to the slip direction acting in the planes of the 〈1 1 1〉 zone different from the slip plane, and the shear stresses perpendicular to the slip direction. Both these shear stresses modify the structure of the dislocation core and thus alter both the Peierls barrier and the related Peierls stress. Understanding of this effect of loading is crucial for the development of mesoscopic models of thermally activated dislocation motion via formation and propagation of pairs of kinks. The Peierls stresses and related choices of the glide planes determined from the Peierls barriers agree with the results of molecular statics calculations (Gröger R, Bailey AG, Vitek V. Acta Mater 2008;56:5401), which demonstrates that the NEB + r method is a reliable tool for determining the variation in the Peierls barrier with the applied stress. However, such calculations are very time consuming, and it is shown here that an approximate approach of determining the stress dependence of the Peierls barrier (proposed in Gröger R, Vitek V. Acta Mater 2008;56:5426) can be used, combined with test calculations employing the NEB + r method
Directory of Open Access Journals (Sweden)
Jerome Mauris
Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.
International Nuclear Information System (INIS)
Lowe, S.S.
1993-01-01
The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers
International Nuclear Information System (INIS)
Preter, P. de; Lalieux, Ph.
2002-01-01
In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)
Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott
2017-09-21
Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.
The Effects of Anthrax Lethal Toxin on Host Barrier Function
Directory of Open Access Journals (Sweden)
David M. Frucht
2011-06-01
Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.
Milani, Massimo; Sparavigna, Adele
2017-01-01
Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid
Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun
2015-10-01
Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.
Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed
2015-10-01
The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.
DEFF Research Database (Denmark)
Karunarathna, Anurudda Kumara; Kawamoto, Ken; Møldrup, Per
2010-01-01
Soil-water content (θ) and soil organic carbon (SOC) are key factors controlling the occurrence and magnitude of soil-water repellency (WR). Although expressions have recently been proposed to describe the nonlinear variation of WR with θ, the inclusion of easily measurable parameters in predictive...... conditions for 19 soils were used to test the model. The beta function successfully reproduced all the measured soil-water repellency characteristic, α(θ), curves. Significant correlations were found between model parameters and SOC content (1%-14%). The model was independently tested against data...
Fingolimod promotes blood-nerve barrier properties in vitro.
Nishihara, Hideaki; Maeda, Toshihiko; Sano, Yasuteru; Ueno, Maho; Okamoto, Nana; Takeshita, Yukio; Shimizu, Fumitaka; Koga, Michiaki; Kanda, Takashi
2018-04-01
The main effect of fingolimod is thought to be functional antagonism of lymphocytic S1P1 receptors and the prevention of lymphocyte egress from lymphoid tissues, thereby reducing lymphocyte infiltration into the nervous system. However, a growing number of reports suggest that fingolimod also has a direct effect on several cell types in the nervous system. Although we previously reported that fingolimod enhances blood-brain barrier (BBB) functions, there have been no investigations regarding the blood-nerve barrier (BNB). In this study, we examine how fingolimod affects the BNB. An immortalized human peripheral nerve microvascular endothelial cell line (HPnMEC) was used to evaluate BNB barrier properties. We examined tight junction proteins and barrier functions of HPnMECs in conditioned medium with or without fingolimod-phosphate and blood sera from patients with typical chronic inflammatory demyelinating polyneuropathy (CIDP). Incubation with fingolimod-phosphate increased levels of claudin-5 mRNA and protein as well as TEER values in HPnMECs. Conversely, typical CIDP sera decreased claudin-5 mRNA/protein levels and TEER values in HPnMECs; however, pretreatment with fingolimod-phosphate inhibited the effects of the typical CIDP sera. Fingolimod-phosphate directly modifies the BNB and enhances barrier properties. This mechanism may be a viable therapeutic target for CIDP, and fingolimod may be useful in patients with typical CIDP who have severe barrier disruption.
MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.
Directory of Open Access Journals (Sweden)
Victor Chatterjee
Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.
Barriers to activity and participation for stroke survivors in rural China.
Zhang, Lifang; Yan, Tiebin; You, Liming; Li, Kun
2015-07-01
To investigate environmental barriers reported by stroke survivors in the rural areas of China and to determine the impact of environmental barriers on activity and participation relative to demographic characteristics and body functioning. Cross-sectional survey. Structured interviews in the participants' homes. Community-dwelling stroke survivors in the rural areas of China (N=639). Not applicable. Activity and participation (Chinese version of the World Health Organization Disability Assessment Schedule 2.0), environmental barriers (Craig Hospital Inventory of Environmental Factors), neurological function (Canadian Neurological Scale), cognitive function (Abbreviated Mental Test), and depression (6-item Hamilton Rating Scale for Depression). Physical/structural barriers are the major impediment to activity and participation for these participants (odds ratio, 1.86 and 1.99 for activity and participation, respectively; Penvironmental barriers to be decreased and eliminated first. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Pizarro-Barraza, Claudia [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States); Gustin, Mae Sexauer, E-mail: mgustin@cabnr.unr.edu [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States); Peacock, Mary [Department of Biology, University of Nevada-Reno, Reno, NV 89557 (United States); Miller, Matthieu [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States)
2014-04-01
The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ{sup 15}N and δ{sup 13}C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno–Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury
International Nuclear Information System (INIS)
Pizarro-Barraza, Claudia; Gustin, Mae Sexauer; Peacock, Mary; Miller, Matthieu
2014-01-01
The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ 15 N and δ 13 C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno–Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury contaminated
Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I
2015-10-01
Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular
Directory of Open Access Journals (Sweden)
Shimon Bershtein
2015-10-01
Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the
Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng
2017-07-06
The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.
Hydraulic barrier against seawater intrusion in the main aquifer of Delta del Llobregat
International Nuclear Information System (INIS)
Ortuno Gobern, F.; Ninerola Pla, J. M.; Fraile, J.; Juarez, I.; Molinero Huguet, J.; Arcos, D.; Pitarch, J. L.
2009-01-01
The main aquifer of Delta del Llobregat (Barcelona, Spain) is affected by seawater intrusion from 1970. For stopping its advance, the Catalan Water Agency is carrying out the construction of a positive hydraulic barrier through the injection of water in 14 wells. This is the first project of these characteristic that it is carried out in Spain and pioneer in Europe. The barrier elevates the groundwater level of the aquifer near the coast and avoids that the seawater penetrates inland, using reclaimed water of Baix Llobregat WWTP with several treatments. The first phase brings already more than 2 years of functioning, with highly positive results since a substantial improvement of the quality of the groundwater has been observed. The second phase is at present under construction. (Author)
Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn
2015-04-01
Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Time evolution of the Clay Barrier Chemistry in a HLW deep geological disposal in granite
International Nuclear Information System (INIS)
Font, I.; Miguel, M. J.; Juncosa, R.
2000-01-01
The main goal of a high level waste geological disposal is to guarantee the waste isolation from the biosphere, locking them away into very deep geological formations. The best way to assure the isolation is by means of a multiple barrier system. These barriers, in a serial disposition, should assure the confinement function of the disposal system. Two kinds of barriers are considered: natural barriers (geological formations) and engineered barriers (waste form, container and backfilling and sealing materials). Bentonite is selected as backfilling and sealing materials for HLW disposal into granite formations, due to its very low permeability and its ability to fill the remaining spaces. bentonite has also other interesting properties, such as, the radionuclide retention capacity by sorption processes. Once the clay barrier has been placed, the saturation process starts. The granite groundwater fills up the voids of the bentonite and because of the chemical interactions, the groundwater chemical composition varies. Near field processes, such as canister corrosion, waste leaching and radionuclide release, strongly depends on the water chemical composition. Bentonite pore water composition is such a very important feature of the disposal system and its determination and its evolution have great relevance in the HLW deep geological disposal performance assessment. The process used for the determination of the clay barrier pore water chemistry temporal evolution, and its influence on the performance assessment, are presented in this paper. (Author)
Wu, Xiaowu; Dubick, Michael A; Schwacha, Martin G; Cap, Andrew P; Darlington, Daniel N
2017-04-01
Severe trauma, hemorrhage, and resuscitation can lead to a trauma-related acute lung injury that involves rapid infiltration of immune cells and platelets. This infiltration involves exymatic degradation of matrix proteins, including plasmin, and causes loss of barrier function. Since tranexamic acid (TXA) inhibits plasminogen/ plasmin binding to target substrates, it may attenuate loss of barrier function after severe trauma, hemorrhage, and resuscitation. Sprague-Dawley rats were subjected to polytrauma (laparotomy, and trauma to intestines, liver, right leg skeletal muscle, and right femur fracture), then bled 40% of their blood volume. One hour after completion of polytrauma and hemorrhage, resuscitation was begun with fresh whole blood (FWB) or FWB with prior bolus administration of TXA (10 mg/kg in 0.2 mL). Polytrauma, hemorrhage, and resuscitation with FWB led to an elevation in lung water content that was significantly reduced with TXA administration. Polytrauma and hemorrhage led to rise in the number of neutrophils/monocytes and platelets in the lungs, and a rise in myeloperoxidase (MPO), neutrophil elastase and complement C5a content. While resuscitation with FWB significantly reduced the cellular infiltrate and MPO, FWB/TXA further reduced the levels of neutrophil/monocytes, neutrophil elastase, and complement C5a. Polytrauma and hemorrhage led to rise in lung plasmin activity that was significantly reduced with either FWB or FWB/TXA resuscitation. Severe trauma and hemorrhage leads to increases in lung water content, and immune cell, platelets, MPO, elastase, and C5a content in lung tissue, all markers of inflammation and acute lung injury. The addition of TXA to FWB resuscitation markedly attenuated the rise in these parameters suggesting its utility in treating acute lung injury.
Reflectionlessness, kurtosis and top curvature of potential barriers
International Nuclear Information System (INIS)
Ahmed, Zafar
2006-01-01
Apart from the rectangular barrier, other barriers having a single maximum generally display reflectivity, R(E), as a smoothly decreasing function of energy. We conjecture that symmetric potential barriers with a single maximum entail zeros or sharp minima in R(E) provided they have either their coefficient of kurtosis lying in the range (1.8, 3.0), or their top curvature as zero, or both
International Nuclear Information System (INIS)
Morrison, S.J.; Spangler, R.R.; Morris, S.A.
1996-01-01
A chemical barrier is a permeable zone of reactive materials emplaced in the subsurface to remove ground-water contaminants while allowing clean ground water to pass through. Because dissolved ferric chloride hydrolyzes to amorphous ferric oxyhydroxide when it contacts calcite (CaCO 3 ), it may be viable to emplace a zone of amorphous ferric oxyhydroxide (an absorbent for U, Mo, and other inorganic contaminants) into calcite-bearing geologic units by injecting ferric chloride through wells. For a chemical barrier to be successful, it must remain permeable and must be immobile. This investigation monitored chemical compositions, hydraulic conductivity, and iron mobility in laboratory columns and in a two-dimensional tank to determine the viability of injecting ferric chloride to form an amorphous ferric oxyhydroxide chemical barrier. The authors introduced a ferric chloride solution (1,345 mg/1[0.024 m] Fe) to calcite-bearing alluvial gravel to form a chemical barrier of amorphous ferric oxyhydroxide, followed by solutions contaminated with U and Mo. The simulated chemical barriers decreased U and Mo concentrations to less than 0.05 mg/l (2.1 x 10 -7 m) and 0.01 (1.0 x 10 -7 m), respectively; however, the breakthrough front is spread out with concentrations increasing to more than regulatory guideline values sooner than predicted. The hydraulic conductivity of calcite-bearing alluvial gravel decreased substantially during ferric chloride introduction because of the formation of carbon dioxide but increased to within factors of 1 to 5 of the original value as synthetic ground water flowed through the system. Amorphous ferric oxyhydroxide that formed in these experiments remained immobile at flow rates exceeding those typical of ground water. These laboratory results, in conjunction with site-specific characterization data, can be used to design chemical barriers emplaced by injection of ferric chloride
Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J
2018-04-18
Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.
Hanford Site Long-term Surface Barrier Development Program: Fiscal year 1994 highlights
International Nuclear Information System (INIS)
Petersen, K.L.; Link, S.O.; Gee, G.W.
1995-08-01
The Hanford Site Surface Barrier Development Program was organized in 1985 to test the effectiveness of various barrier designs in minimizing the effects of water infiltration; plant, animal and human intrusion; and wind and water erosion on buried wastes, plus preventing or minimizing the emanation of noxious gases. A team of scientists from the Pacific Northwest Laboratory (PNL) and engineers from Westinghouse Hanford Company (WHC) direct the barrier development effort. ICF Kaiser Hanford Company, in conjunction with WHC and PNL, developed design drawings and construction specifications for a 5-acre prototype barrier. The highlight of efforts in FY 1994 was the construction of the prototype barrier. The prototype barrier was constructed on the Hanford Site at the 200 BP-1 Operable Unit of the 200 East Area. Construction was completed in August 1994 and monitoring instruments are being installed so experiments on the prototype barrier can begin in FY 1995. The purpose of the prototype barrier is to provide insights and experience with issues regarding barrier design, construction, and performance that have not been possible with individual tests and experiments conducted to date. Additional knowledge and experience was gained in FY 1994 on erosion control, physical stability, water infiltration control, model testing, Resource Conservation and Recovery Act (RCRA) comparisons, biointrusion control, long-term performance, and technology transfer
International Nuclear Information System (INIS)
Petersen, K.L.; Chatters, J.C.; Waugh, W.J.
1993-05-01
The Hanford Site Permanent Isolation Barrier Development Program (Barrier Development Program) was organized to develop the technology needed to provide an in-place disposal capability for low-level nuclear waste for the US Department of Energy at the Hanford Site in south-central Washington. The goal of the Barrier Development Program is to provide defensible evidence that final barrier design(s) will adequately control water infiltration, plant and animal intrusion, and wind and water erosion for a minimum of 1,000 yr; to isolate wastes from the accessible environment; and to use markers to warn inadvertent human intruders. Evidence for barrier performance will be obtained by conducting laboratory experiments, field tests, computer modeling, and other studies that establish confidence in the barrier's ability to meet its 1,000-yr design life
Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J
2017-01-01
A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.
Ranathunge, Kosala; Kim, Yangmin X; Wassmann, Friedrich; Kreszies, Tino; Zeisler, Viktoria; Schreiber, Lukas
2017-03-01
Roots have complex anatomical structures, and certain localized cell layers develop suberized apoplastic barriers. The size and tightness of these barriers depend on the growth conditions and on the age of the root. Such complex anatomical structures result in a composite water and solute transport in roots. Development of apoplastic barriers along barley seminal roots was detected using various staining methods, and the suberin amounts in the apical and basal zones were analysed using gas chromatography-mass spectometry (GC-MS). The hydraulic conductivity of roots ( Lp r ) and of cortical cells ( Lp c ) was measured using root and cell pressure probes. When grown in hydroponics, barley roots did not form an exodermis, even at their basal zones. However, they developed an endodermis. Endodermal Casparian bands first appeared as 'dots' as early as at 20 mm from the apex, whereas a patchy suberin lamellae appeared at 60 mm. The endodermal suberin accounted for the total suberin of the roots. The absolute amount in the basal zone was significantly higher than in the apical zone, which was inversely proportional to the Lp r . Comparison of Lp r and Lp c suggested that cell to cell pathways dominate for water transport in roots. However, the calculation of Lp r from Lp c showed that at least 26 % of water transport occurs through the apoplast. Roots had different solute permeabilities ( P sr ) and reflection coefficients ( σ sr ) for the solutes used. The σ sr was below unity for the solutes, which have virtually zero permeability for semi-permeable membranes. Suberized endodermis significantly reduces Lp r of seminal roots. The water and solute transport across barley roots is composite in nature and they do not behave like ideal osmometers. The composite transport model should be extended by adding components arranged in series (cortex, endodermis) in addition to the currently included components arranged in parallel (apoplastic, cell to cell pathways). © The
Huang, Shuning; Farrar, Christian T; Dai, Guangping; Kwon, Seon Joo; Bogdanov, Alexei A; Rosen, Bruce R; Kim, Young R
2013-04-01
The integrity of the blood-brain barrier (BBB) is critical to normal brain function. Traditional techniques for the assessment of BBB disruption rely heavily on the spatiotemporal analysis of extravasating contrast agents. However, such methods based on the leakage of relatively large molecules are not suitable for the detection of subtle BBB impairment or for the performance of repeated measurements in a short time frame. Quantification of the water exchange rate constant (WER) across the BBB using strictly intravascular contrast agents could provide a much more sensitive method for the quantification of the BBB integrity. To estimate WER, we have recently devised a powerful new method using a water exchange index (WEI) biomarker and demonstrated BBB disruption in an acute stroke model. Here, we confirm that WEI is sensitive to even very subtle changes in the integrity of the BBB caused by: (i) systemic hypercapnia and (ii) low doses of a hyperosmolar solution. In addition, we have examined the sensitivity and accuracy of WEI as a biomarker of WER using computer simulation. In particular, the dependence of the WEI-WER relation on changes in vascular blood volume, T1 relaxation of cellular magnetization and transcytolemmal water exchange was explored. Simulated WEI was found to vary linearly with WER for typically encountered exchange rate constants (1-4 Hz), regardless of the blood volume. However, for very high WER (>5 Hz), WEI became progressively more insensitive to increasing WER. The incorporation of transcytolemmal water exchange, using a three-compartment tissue model, helped to extend the linear WEI regime to slightly higher WER, but had no significant effect for most physiologically important WERs (WER < 4 Hz). Variation in cellular T1 had no effect on WEI. Using both theoretical and experimental approaches, our study validates the utility of the WEI biomarker for the monitoring of BBB integrity. Copyright © 2012 John Wiley & Sons, Ltd.
Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David
2014-01-01
We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895
Thiyahuddin, M I; Thambiratnam, D P; Gu, Y T
2014-10-01
Portable water-filled barriers (PWFBs) are roadside appurtenances that prevent vehicles from penetrating into temporary construction zones on roadways. PWFBs are required to satisfy the strict regulations for vehicle re-direction in tests. However, many of the current PWFBs fail to re-direct the vehicle at high speeds due to the inability of the joints to provide appropriate stiffness. The joint mechanism hence plays a crucial role in the performance of a PWFB system at high speed impacts. This paper investigates the desired features of the joint mechanism in a PWFB system that can re-direct vehicles at high speeds, while limiting the lateral displacement to acceptable limits. A rectangular "wall" representative of a 30m long barrier system was modeled and a novel method of joining adjacent road barriers was introduced through appropriate pin-joint connections. The impact response of the barrier "wall" and the vehicle was obtained and the results show that a rotational stiffness of 3000kNm/rad at the joints seems to provide the desired features of the PWFB system to re-direct impacting vehicles and restrict the lateral deflection. These research findings will be useful to safety engineers and road barrier designers in developing a new generation of PWFBs for increased road safety. Copyright © 2014 Elsevier Ltd. All rights reserved.
Study on the saturating and swelling behavior of an engineering bentonite barrier using a test model
International Nuclear Information System (INIS)
Nakajima, Makoto; Kobayashi, Ichizo; Toida, Masaru; Fujisaki, Katsutoshi
2007-01-01
The conceptual design of a disposal facility with additional buffer depth for radioactive waste is mainly constituted from the multi-barrier system that is constructed around the waste form so that it prevents radionuclide transfer to the biosphere. The engineered bentonite barrier is one of the elements of the multi-barrier system and is constructed with homogeneous bentonite-containing material compacted to a high density so that there are no voids. Due to the swelling characteristics of the bentonite material, the self-sealing function which is an important function of the bentonite barrier can work, but at the same time it mechanically affects the neighboring structures. Therefore, an experimental study was implemented in order to evaluate the mechanical effect of the bentonite swelling behavior throughout the construction, emplacement operations and closure re-saturation phase. In this article, the results of swelling tests to obtain the mechanical properties of the bentonite and three types of test model experiments performed for the event observations in the different saturation processes are described. As a result, the effects of a seepage pattern of ground water and a variation in the density produced by construction on the swelling pressure distribution of the bentonite barrier could be reproduced and validated. It is thought that they will be important events when ground water permeates the bentonite layer of a multiple barrier system. (author)
Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.
Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars
2018-04-24
In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.
Shao, Yujing; Guo, Yuming; Wang, Zhong
2013-07-01
This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.
Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)
Takahashi, H.; Hisaoka, S.; Nitta, T.
2002-09-01
Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.
Biointrusion test plan for the Permanent Isolation Surface Barrier Prototype
International Nuclear Information System (INIS)
Link, S.O.; Cadwell, L.L.; Brandt, C.A.; Downs, J.L.; Rossi, R.E.; Gee, G.W.
1994-04-01
This document provides a testing and monitoring plan for the biological component of the prototype barrier slated for construction at the Hanford Site. The prototype barrier is an aboveground structure engineered to demonstrate the basic features of an earthen cover system. It is designed to permanently isolate waste from the biosphere. The features of the barrier include multiple layers of soil and rock materials and a low-permeability asphalt sublayer. The surface of the barrier consists of silt loam soil, covered with plants. The barrier sides are reinforced with rock or coarse earthen-fill to protect against wind and water erosion. The sublayers inhibit plant and animal intrusion and percolation of water. A series of tests will be conducted on the prototype barrier over the next several years to evaluate barrier performance under extreme climatic conditions. Plants and animals will play a significant role in the hydrologic and water and wind erosion characteristics of the prototype barrier. Studies on the biological component of the prototype barrier will include work on the initial revegetation of the surface, continued monitoring of the developing plant community, rooting depth and dispersion in the context of biointrusion potential, the role of plants in the hydrology of the surface and toe regions of the barrier, the role of plants in stabilizing the surface against water and wind erosion, and the role of burrowing animals in the hydrology and water and wind erosion of the barrier
Barrier mechanisms in the Drosophila blood-brain barrier.
Hindle, Samantha J; Bainton, Roland J
2014-01-01
The invertebrate blood-brain barrier (BBB) field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through G-protein coupled receptor signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate BBB has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many BBB mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the BBB can govern whole animal physiologies. This includes novel functions of BBB gap junctions in orchestrating synchronized neuroblast proliferation, and of BBB secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate BBB anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Performance characteristics of a self-sealing/self-healing barrier
International Nuclear Information System (INIS)
McGregor, R.G.; Stegemann, J.A.
1997-01-01
Environment Canada and the Netherlands Energy Research Foundation are co-developers of a patented Self-Sealing/Self-Healing (SS/SH) Barrier system for containment of wastes which is licensed to Water Technology International Corporation. The SS/SH Barrier is intended for use as either a liner or cover for landfills, contaminated sites, secondary containment areas, etc., in the industrial, chemical, mining and municipal sectors, and also as a barrier to hydraulic flow for the transportation and construction industry. The SS/SH Barrier's most significant feature is its capability for self-repair in the event of a breach. By contrast, conventional barrier systems, such as clay, geomembrane, or geosynthetic clay liners can not be repaired without laborious excavation and reconstruction. Laboratory investigations have shown that the SS/SH Barrier concept will function with a variety of reactive materials. Self-Sealing/Self-Healing Barriers are cost competitive and consistently exhibit hydraulic conductivities ranging from 10 -9 to 10 -13 m/s, which decrease with time. These measurements meet or exceed the recommended hydraulic conductivity required by EPA for clay liners ( -9 m/s) used in landfills and hazardous waste sites. Results of mineralogical examination of the seal, diffusion testing, hydraulic conductivity measurement, and durability testing, including wet/dry, freeze/thaw cycling and leachate compatibility are also presented
Evapotranspiration studies for protective barriers: Experimental plans
International Nuclear Information System (INIS)
Link, S.O.; Waugh, W.J.
1989-11-01
This document describes a general theory and experimental plans for predicting evapotranspiration in support of the Protective Barrier Program. Evapotranspiration is the combined loss of water from plants and soil surfaces to the atmosphere. 45 refs., 1 fig., 4 tabs
Functional Anatomy and Oncologic Barriers of the Larynx.
Mor, Niv; Blitzer, Andrew
2015-08-01
Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.
Permeable reactive barrier - innovative technology for ground-water remediation
International Nuclear Information System (INIS)
Vidic, D.R.
2002-01-01
Significant advances in the application of permeable reactive barriers (PRBs) for ground-water remediation have been witnessed in the last 5 years. From only a few full-scale systems and pilot-scale demonstrations, there are currently at least 38 full-scale PRBs using zero-valent iron (ZVI) as a reactive material. Of those, 26 are continuous reactive walls, 9 are funnel-and- gate systems and 3 are in situ reactive vessels. Most of the PRB systems have used granular iron media and have been applied to address the control of contamination caused by chlorinated volatile organic compounds or heavy metals. Many regulatory agencies have expressed interest in PRB systems and are becoming more comfortable in issuing permits. The main advantage of PRB systems is that the installation costs are comparable with those of other ground-water remediation technologies, while the O and M costs are significantly lower and are mostly due to monitoring requirements, which are required for all remediation approaches. In addition, the land use can resume after the installation of the PRB systems, since there are few visible signs of the installation above grounds except for the monitoring wells. It is difficult to make any definite conclusions about the long-term performance of PRB systems because there is no more than 5 years of the record of performance that can be used for such analysis. The two main challenges still facing this technology are: (1) evaluating the longevity (geochemistry) of a PRB; and (2) ensuring/verifying hydraulic performance. A number of public/private partnerships have been established in recent years that are working together to resolve some of these problems. This organized approach by combining the efforts of several government agencies and private companies will likely result in better understanding and, hopefully, better acceptance of this technology in the future. (author)
Abl family kinases regulate endothelial barrier function in vitro and in mice.
Directory of Open Access Journals (Sweden)
Elizabeth M Chislock
Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use
Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique
2017-05-19
The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.
Directory of Open Access Journals (Sweden)
Rudolf eLucas
2013-08-01
Full Text Available The integrity of epithelial and endothelial barriers in the lower airspaces of the lungs has to be tightly regulated, in order to prevent leakage and to assure efficient gas exchange between the alveoli and capillaries. Both G- and G+ bacterial toxins, such as LPS and pneumolysin, respectively, can be released in high concentrations within the pulmonary compartments upon antibiotic treatment of patients suffering from acute respiratory distress syndrome (ARDS or severe pneumonia. These toxins are able to impair endothelial barrier function, either directly, or indirectly, by induction of pro-inflammatory mediators and neutrophil sequestration. Toxin-induced endothelial hyperpermeability can involve myosin light chain phosphorylation and/or microtubule rearrangement. Endothelial nitric oxide synthase (eNOS was proposed to be a guardian of basal barrier function, since eNOS knock-out mice display an impaired expression of inter-endothelial junction proteins and as such an increased vascular permeability, as compared to wild type mice. The enzyme arginase, the activity of which can be regulated by the redox status of the cell, exists in two isoforms - arginase 1 (cytosolic and arginase 2 (mitochondrial - both of which can be expressed in lung microvascular endothelial cells. Upon activation, arginase competes with eNOS for the substrate L-arginine, as such impairing eNOS-dependent NO generation and promoting ROS generation by the enzyme. This mini-review will discuss recent findings regarding the interaction between bacterial toxins and arginase during acute lung injury and will as such address the role of arginase in bacterial toxin-induced pulmonary endothelial barrier dysfunction.
Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees
2005-10-01
The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.
Directory of Open Access Journals (Sweden)
Silvia Gazzin
2011-01-01
Full Text Available Accumulation of unconjugated bilirubin (UCB in the brain causes bilirubin encephalopathy. Pgp (ABCb1 and Mrp1 (ABCc1, highly expressed in the blood-brain barrier (BBB and blood-cerebrospinal fluid barrier (BCSFB respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj Gunn rats compared to heterozygous, not jaundiced (Jj littermates at different developmental stages (2, 9, 17 and 60 days after birth. BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16-27% of adult values, despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17-P60, respectively; Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60-70% of the adult values in both jj and Jj at P2, but was markedly (50% down-regulated in jj pups starting at P9, particularly in the 4(th ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity.
Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma
Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.
2017-07-01
The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.
Structural and functional significance of water permeation through cotransporters
DEFF Research Database (Denmark)
Zeuthen, Thomas; Gorraitz, Edurne; Her, Ka
2016-01-01
Membrane transporters, in addition to their major role as specific carriers for ions and small molecules, can also behave as water channels. However, neither the location of the water pathway in the protein nor their functional importance is known. Here, we map the pathway for water and urea...... through the intestinal sodium/glucose cotransporter SGLT1. Molecular dynamics simulations using the atomic structure of the bacterial transporter vSGLT suggest that water permeates the same path as Na+ and sugar. On a structural model of SGLT1, based on the homology structure of vSGLT, we identified...... to be due to alterations in steric hindrance to water and urea, and/or changes in protein folding caused by mismatching of side chains in the water pathway. Water permeation through SGLT1 and other transporters bears directly on the structural mechanism for the transport of polar solutes through...
Directory of Open Access Journals (Sweden)
C Lehner
2016-05-01
Full Text Available Tissue barriers function as “gate keepers” between different compartments (usually blood and tissue and are formed by specialised membrane-associated proteins, localising to the apicolateral plasma membrane domain of epithelial and endothelial cells. By sealing the paracellular space, the free diffusion of solutes and molecules across epithelia and endothelia is impeded. Thereby, tissue barriers contribute to the establishment and maintenance of a distinct internal and external environment, which is crucial during organ development and allows maintenance of an organ-specific homeostatic milieu. So far, various epithelial and endothelial tissue barriers have been described, including the blood-brain barrier, the blood-retina barrier, the blood-testis barrier, the blood-placenta barrier, and the cerebrospinal fluid (CSF-brain barrier, which are vital for physiological function and any disturbance of these barriers can result in severe organ damage or even death. Here, we describe the identification of a novel barrier, located in the vascular bed of tendons, which we term the blood-tendon barrier (BTB. By using immunohistochemistry, transmission electron microscopy, and tracer studies we demonstrate the presence of a functional endothelial barrier within tendons restricting the passage of large blood-borne molecules into the surrounding tendon tissue. We further provide in vitro evidence that the BTB potentially contributes to the creation of a distinct internal tissue environment impacting upon the proliferation and differentiation of tendon-resident cells, effects which might be fundamental for the onset of tendon pathologies.
Pedotransfer functions to estimate soil water content at field capacity ...
Indian Academy of Sciences (India)
20
Soil water retention, Dry lands, Western India, Pedotransfer functions, Soil moisture calculator. 1. 2. 3. 4 ..... samples although it is known that structure and macro-porosity of the sample affect water retention (Unger ..... and OC content has positive influence on water retention whereas interaction of clay and OC has negative ...
Neretti, G.; Taglioli, M.; Colonna, G.; Borghi, C. A.
2017-01-01
In this work a low-temperature plasma source for the generation of plasma activated water (PAW) is developed and characterized. The plasma reactor was operated by means of an atmospheric-pressure air dielectric barrier discharge (DBD). The plasma generated is in contact with the water surface and is able to chemically activate the liquid medium. Electrodes were supplied by both sinusoidal and nanosecond-pulsed voltage waveforms. Treatment times were varied from 2 to 12 min to increase the energy dose released to the water by the DBD plasma. The physics of the discharge was studied by means of electrical, spectroscopic and imaging diagnostics. The interaction between the plasma and the liquid was investigated as well. Temperature and composition of the treated water were detected. Images of the discharges showed a filamentary behaviour in the sinusoidal case and a more homogeneous behaviour in the nanosecond-pulsed one. The images and the electrical measurements allowed to evaluate an average electron number density of about 4 × 1019 and 6 × 1017 m-3 for the sinusoidal and nanosecond-pulsed discharges respectively. Electron temperatures in the range of 2.1÷2.6 eV were measured by using spectroscopic diagnostics. Rotational temperatures in the range of 318-475 K were estimated by fitting synthetic spectra with the measured ones. Water temperature and pH level did not change significantly after the exposure to the DBD plasma. The production of ozone and hydrogen peroxide within the water was enhanced by increasing the plasma treatment time and the energy dose. Numerical simulations of the nanosecond-pulsed discharge were performed by using a self-consistent coupling of state-to-state kinetics of the air mixture with the Boltzmann equation of free electron kinetics. Temporal evolution of the electron energy distribution function shows departure from the Maxwellian distribution especially during the afterglow phase of the discharge. When
Nakada, Tsutomu; Kwee, Ingrid L; Igarashi, Hironaka; Suzuki, Yuji
2017-08-18
The unique properties of brain capillary endothelium, critical in maintaining the blood-brain barrier (BBB) and restricting water permeability across the BBB, have important consequences on fluid hydrodynamics inside the BBB hereto inadequately recognized. Recent studies indicate that the mechanisms underlying brain water dynamics are distinct from systemic tissue water dynamics. Hydrostatic pressure created by the systolic force of the heart, essential for interstitial circulation and lymphatic flow in systemic circulation, is effectively impeded from propagating into the interstitial fluid inside the BBB by the tightly sealed endothelium of brain capillaries. Instead, fluid dynamics inside the BBB is realized by aquaporin-4 (AQP-4), the water channel that connects astrocyte cytoplasm and extracellular (interstitial) fluid. Brain interstitial fluid dynamics, and therefore AQP-4, are now recognized as essential for two unique functions, namely, neurovascular coupling and glymphatic flow, the brain equivalent of systemic lymphatics.
Oxygen- and water-induced degradation of an inverted polymer solar cell: the barrier effect
DEFF Research Database (Denmark)
Vesterager Madsen, Morten; Norrman, Kion; Krebs, Frederik C
2011-01-01
The work focuses on the degradation of performance induced by both water and oxygen in an inverted geometry organic photovoltaic device with emphasis on the accumulated barrier effect of the layers comprising the layer stack. By studying the exchange of oxygen in the zinc oxide (ZnO) layer...... in the humid atmosphere, correlating well with a long observed lifetime in the same atmosphere.© 2011 Society of Photo-Optical Instrumentation Engineers....
Directory of Open Access Journals (Sweden)
Svitlana Garbuzova-Davis
2007-11-01
Full Text Available The blood-brain barrier (BBB, blood-spinal cord barrier (BSCB, and blood-cerebrospinal fluid barrier (BCSFB control cerebral/spinal cord homeostasis by selective transport of molecules and cells from the systemic compartment. In the spinal cord and brain of both ALS patients and animal models, infiltration of T-cell lymphocytes, monocyte-derived macrophages and dendritic cells, and IgG deposits have been observed that may have a critical role in motor neuron damage. Additionally, increased levels of albumin and IgG have been found in the cerebrospinal fluid in ALS patients. These findings suggest altered barrier permeability in ALS. Recently, we showed disruption of the BBB and BSCB in areas of motor neuron degeneration in the brain and spinal cord in G93A SOD1 mice modeling ALS at both early and late stages of disease using electron microscopy. Examination of capillary ultrastructure revealed endothelial cell degeneration, which, along with astrocyte alteration, compromised the BBB and BSCB. However, the effect of these alterations upon barrier function in ALS is still unclear. The aim of this study was to determine the functional competence of the BSCB in G93A mice at different stages of disease.Evans Blue (EB dye was intravenously injected into ALS mice at early or late stage disease. Vascular leakage and the condition of basement membranes, endothelial cells, and astrocytes were investigated in cervical and lumbar spinal cords using immunohistochemistry. Results showed EB leakage in spinal cord microvessels from all G93A mice, indicating dysfunction in endothelia and basement membranes and confirming our previous ultrastructural findings on BSCB disruption. Additionally, downregulation of Glut-1 and CD146 expressions in the endothelial cells of the BSCB were found which may relate to vascular leakage.Results suggest that the BSCB is compromised in areas of motor neuron degeneration in ALS mice at both early and late stages of the disease.
Potential barrier classification by short-time measurement
International Nuclear Information System (INIS)
Granot, Er'el; Marchewka, Avi
2006-01-01
We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function
Potential barrier classification by short-time measurement
Granot, Er'El; Marchewka, Avi
2006-03-01
We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function.
Berardesca, E; Herbst, R; Maibach, H
1993-01-01
The purpose of the study was to develop an in vivo model to study the effects of lipid removal on skin barrier. 16 subjects (age 41 +/- 8) were delipidized in vivo on the volar forearm using respectively ether/acetone (EA; 1:1) and chloroform/methanol (CM; 2:1). A third site served as control. Water holding capacity (WHC) was measured according to the plastic occlusion stress test (POST) procedure: the water desorption curve after removal of the occlusion was recorded in terms of skin surface water loss (SSWL) using an evaporimeter for 30 min. In the central part of the evaporation curve (bound water) the CM-treated site is significantly different from control and EA-treated sites (p rate of water from SC are higher in the CM-treated site (p evaporation of free water. We conclude that polar lipids have a key role in modulating barrier function and WHC of the stratum corneum. The POST can represent a useful in vivo model to study the effects of lipid extraction on skin function.
International Nuclear Information System (INIS)
Go, K.G.; Lammertsma, A.A.; Paans, A.M.; Vaalburg, W.; Woldring, M.G.
1981-01-01
By external detection, the influence of arterial blood pressure (BP), osmolarity, and cold-induced blood-brain barrier damage was assessed on the extraction of water labeled with oxygen 15 during single-capillary transit in the rat. There was an inverse relation between arterial BP and extraction that was attributable to the influence of arterial BP on cerebral blood flow (CBF) and the relation between CBF and extraction. Neither arterial BP nor osmolarity of the injected bolus had any direct effect on extraction of water 15O, signifying that the diffusional exchange component (determined by blood flow) of extraction greatly surpasses the convection flow contribution by hydrostatic or osmotic forces. Damage to the blood-brain barrier did not change its permeability to water
Fernando, Antonio T; Consedine, Nathan S
2017-06-01
Compassion is an expectation of patients, regulatory bodies, and physicians themselves. Most research has, however, studied compassion fatigue rather than compassion itself and has concentrated on the role of the physician. The Transactional Model of Physician Compassion suggests that physician, patient, external environment, and clinical factors are all relevant. Because these factors vary both across different specialities and among physicians with differing degrees of experience, barriers to compassion are also likely to vary. We describe barriers to physician compassion as a function of specialization (psychiatry, general practice, surgery, internal medicine, and pediatrics) and physician experience. We used a cross-sectional study using demographic data, specialization, practice parameters, and the Barriers to Physician Compassion Questionnaire. Nonrandom convenience sampling was used to recruit 580 doctors, of whom 444 belonged to the targeted speciality groups. The sample was characterized before conducting a factorial Multivariate Analysis of Covariance and further post hoc analyses. A 5 (speciality grouping) × 2 (more vs. less physician experience) Multivariate Analysis of Covariance showed that the barriers varied as a function of both speciality and experience. In general, psychiatrists reported lower barriers, whereas general practitioners and internal medicine specialists generally reported greater barriers. Barriers were generally greater among less experienced doctors. Documenting and investigating barriers to compassion in different speciality groups have the potential to broaden current foci beyond the physician and inform interventions aimed at enhancing medical compassion. In addition, certain aspects of the training or practice of psychiatry that enhance compassion may mitigate barriers to compassion in other specialities. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Osburn, F.G.
1985-01-01
A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)
Energy Technology Data Exchange (ETDEWEB)
Osburn, F G
1985-06-12
A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.
Tight junction proteins contribute to barrier properties in human pleura.
Markov, Alexander G; Voronkova, Maria A; Volgin, George N; Yablonsky, Piotr K; Fromm, Michael; Amasheh, Salah
2011-03-15
The permeability of pleural mesothelium helps to control the volume and composition of the liquid lubricating pleural surfaces. Information on pleural barrier function in health and disease, however, is scarce. Tissue specimens of human pleura were mounted in Ussing chambers for measurement of transmesothelial resistance. Expression of tight junction (TJ) proteins was studied by Western blots and immune fluorescence confocal microscopy. Both visceral and parietal pleura showed barrier properties represented by transmesothelial resistance. Occludin, claudin-1, -3, -5, and -7, were detected in visceral pleura. In parietal pleura, the same TJ proteins were detected, except claudin-7. In tissues from patients with pleural inflammation these tightening claudins were decreased and in visceral pleura claudin-2, a paracellular channel former, became apparent. We report that barrier function in human pleura coincides with expression of claudins known to be key determinants of epithelial barrier properties. In inflamed tissue, claudin expression indicates a reduced barrier function. Copyright © 2010 Elsevier B.V. All rights reserved.
End Functionalized Nonionic Water-Dispersible Conjugated Polymers.
Zhan, Ruoyu; Liu, Bin
2017-09-01
2,7-Dibromofluorene monomers carrying two or four oligo(ethylene glycol) (OEG) side chains are synthesized. Heck coupling between the monomers and 1,4-divinylbenzene followed by end capping with [4-(4-bromophenoxy)butyl]carbamic acid tert-butyl ester leads to two nonionic water-dispersible poly(fluorene-alt-1,4-divinylenephenylene)s end-functionalized with amine groups after hydrolysis. In water, the polymer with a lower OEG density (P1) has poor water dispersibility with a quantum yield of 0.24, while the polymer with a higher OEG density (P2) possesses excellent water-dispersibility with a high quantum yield of 0.45. Both polymers show fluorescence enhancement and blue-shifted absorption and emission maxima in the presence of surfactant sodium dodecyl sulfate and dodecyltrimethylammonium bromide. The polymers are also resistant to ionic strength with minimal nonspecific interactions to bovine serum albumin. When biotin is incorporated into the end of the polymer backbones through N-hydroxysuccinimide/amine coupling reaction, the biotinylated polymers interact specifically with streptavidin on solid surface. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The "1"2C("1"6O,γ"2"8Si) radiative capture reaction at sub-barrier energies
International Nuclear Information System (INIS)
Goasduff, A.; Courtin, S.; Haas, F.; Lebhertz, D.; Jenkins, D.G.; Fallis, J.; Ruiz, C.; Hutcheon, D.A.; Amandruz, P.A.; Davis, C.; Hager, U.; Ottewell, D.; Ruprecht, G.
2014-01-01
The heavy-ion radiative capture "1"2C("1"6O,γ"2"8Si) was measured at the sub-Coulomb barrier bombarding energy E(lab) = 15.7 MeV, which corresponds to the lowest important resonance observed in the "1"2C + "1"6O fusion excitation function. Thanks to combination of the bismuth germanate (BGO) γ-ray array and the 0 degree DRAGON electromagnetic spectrometer at TRIUMF, the γ-decay spectrum from the entrance channel down to the ground state of "2"8Si was measured. Comparisons of the experimental spectrum to γ spectrum extracted from Monte-Carlo simulations of the complete setup suggest a J"π = 2"+ spin-parity assignment to the entrance channel and yield the radiative capture cross section σ(RC) = 0.22 ± 0.04 μb. Combining this present spin assignment with previous data on radiative capture, a J (J + 1) systematics was constructed, and it indicated a moment of inertia commensurate with the "1"2C+"1"6O grazing angular momentum. Strong dipole transitions are observed from the entrance channel to T = 1 states around 11.5 MeV and are found to result from enhanced M1_I_V transitions to states exhausting a large part of the M1 sum rule built on the ground state of "2"8Si. This specific decay was also reported at bombarding energies close to the Coulomb barrier in our previous study of the "1"2C("1"2C,γ"2"4Mg) heavy-ion radiative capture reaction. Similarities between both systems are investigated. (authors)
Xue, Meilan; Ji, Xinqiang; Liang, Hui; Liu, Ying; Wang, Bing; Sun, Lingling; Li, Weiwei
2018-02-21
Recent research studies have shown that the intestinal flora are related to the occurrence and progress of breast cancer. This study investigates the effect of fucoidan on intestinal flora and intestinal barrier function in rats with 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancers. Sixty female Sprague-Dawley rats were randomly assigned to the control group, the model group, and the F1 and F2 groups, which were fed fucoidan at concentrations of 200 and 400 mg per kg bw (body weight), respectively. Intestinal histopathological analysis was performed and 16S rDNA high-throughput sequencing was used to provide an overview of the intestinal flora composition. The contents of d-lactic acid (d-LA), diamine oxidase (DAO) and endotoxin in plasma were detected by ELISA. Expression levels of the tight junction (TJ) proteins, phosphorylated p38 MAPK and ERK1/2 were measured using western blotting. Our results suggested that the intestinal wall of the model group was damaged. However, after fucoidan intervention, the villi were gradually restored. ELISA showed that the levels of plasma endotoxin, d-LA and DAO decreased in the F1 and F2 groups compared to those in the model group. Fucoidan treatment also increased the expressions of ZO-1, occludin, claudin-1 and claudin-8. Furthermore, the expression levels of phosphorylated p38 MAPK and ERK1/2 were upregulated in fucoidan treatment groups. The results of 16S rDNA high-throughput sequencing indicated that fucoidan increased the diversity of the intestinal microbiota and induced changes in microbial composition, with the increased Bacteroidetes/Firmicutes phylum ratio. In conclusion, the supplement of fucoidan could improve the fecal microbiota composition and repair the intestinal barrier function. The study suggested the use of fucoidan as an intestinal flora modulator for potential prevention of breast cancer.
Field Lysimeter Test Facility: Protective barrier test results (FY 1990, the third year)
International Nuclear Information System (INIS)
Campbell, M.D.; Gee, G.W.
1990-11-01
The Field Lysimeter Test Facility (FLTF) was constructed to test protective barriers for isolating low-level radioactive and hazardous wastes from the biosphere. Protective barriers are specially configured earth materials placed over near-surface wastes to prevent intrusion of water, plants, and animals. Low-level radioactive waste is stored in near-surface repositories at the Hanford Site and can be transported into the biosphere by water, plants, and animals. The purpose of the FLTF is to measure water balance within barriers as precipitation is partitioned to evaporation (including transpiration), storage, and drainage. Runoff was prevented by raised edges on the lysimeters. Water balance in protective barriers depends on the water-holding capacity of the soil, the gradient of a potential, and the conductivity of the underlying capillary barrier. Current barrier design uses soil with a high water storage capacity and a capillary barrier underlying the soil to increase its water storage capacity. This increased storage capacity is to hold water, which would normally drain, near the the surface where evaporation can cycle it back to the atmosphere. 7 refs., 23 figs., 5 tabs
Water formation via HCl oxidation on Cu(1 0 0)
Energy Technology Data Exchange (ETDEWEB)
Suleiman, Ibrahim A., E-mail: isuleman@taibahu.edu.sa [College of Engineering, Taibah University, Yanbu 41911 (Saudi Arabia); Radny, Marian W. [School of Mathematical and Physical Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Institute of Physics, Poznan University of Technology, 62-956 Poznan (Poland); Gladys, Michael J.; Smith, Phillip V. [School of Mathematical and Physical Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Mackie, John C. [School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); School of Chemistry, The University of Sydney (Australia); Stockenhuber, Michael; Kennedy, Eric M. [School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); Dlugogorski, Bogdan Z. [School of Engineering, The University of Newcastle, Callaghan, NSW 2308 (Australia); School of Engineering and Information Technology, Murdoch University, Perth (Australia)
2014-04-01
Graphical abstract: This work investigates water formation on the Cu(1 0 0) surface via HCl oxidation using density functional theory and periodic slabs. We show that there are two different pathways for water formation on the surface depending on the temperature and oxygen coverage. - Highlights: • Pre-adsorbed chlorine increases the stability of water on Cu(1 0 0). • Two different pathways describe water formation on Cu(1 0 0) via HCl oxidation. • The mechanism of H{sub 2}O formation depends on the temperature and oxygen coverage. - Abstract: Using density functional theory and periodic slabs, we have studied water formation via HCl oxidation on the Cu(1 0 0) surface. We show that while adsorbed chlorine increases the stability of water on the Cu(1 0 0) surface, water molecules dissociate immediately when located next to an oxygen atom. We also show that these competing interactions, when arising from HCl reacting with oxygen on Cu(1 0 0), lead to water formation according to two different pathways depending on the temperature and oxygen coverage.
Lorentz, C Adam; Liang, Zhe; Meng, Mei; Chen, Ching-Wen; Yoseph, Benyam P; Breed, Elise R; Mittal, Rohit; Klingensmith, Nathan J; Farris, Alton B; Burd, Eileen M; Koval, Michael; Ford, Mandy L; Coopersmith, Craig M
2017-06-07
Sepsis-induced intestinal hyperpermeability is mediated by disruption of the epithelial tight junction, which is closely associated with the peri-junctional actin-myosin ring. Myosin light chain kinase (MLCK) phosphorylates the myosin regulatory light chain, resulting in increased permeability. The purpose of this study was to determine whether genetic deletion of MLCK would alter gut barrier function and survival from sepsis. MLCK -/- and wild type (WT) mice were subjected to cecal ligation and puncture and assayed for both survival and mechanistic studies. Survival was significantly increased in MLCK -/- mice (95% vs. 24%, p<0.0001). Intestinal permeability increased in septic WT mice compared to unmanipulated mice. In contrast, permeability in septic MLCK -/- mice was similar to that seen in unmanipulated animals. Improved gut barrier function in MLCK -/- mice was associated with increases in the tight junction mediators ZO-1 and claudin 15 without alterations in claudin 1, 2, 3, 4, 5, 7, 8, 13, occludin or JAM-A. Other components of intestinal integrity (apoptosis, proliferation and villus length) were unaffected by MLCK deletion as were local peritoneal inflammation and distant lung injury. Systemic IL-10 was decreased greater than 10-fold in MLCK -/- mice; however, survival was similar between septic MLCK -/- mice given exogenous IL-10 or vehicle. These data demonstrate that deletion of MLCK improves survival following sepsis, associated with normalization of intestinal permeability and selected tight junction proteins.
Numerical simulations of capillary barrier field tests
International Nuclear Information System (INIS)
Morris, C.E.; Stormont, J.C.
1997-01-01
Numerical simulations of two capillary barrier systems tested in the field were conducted to determine if an unsaturated flow model could accurately represent the observed results. The field data was collected from two 7-m long, 1.2-m thick capillary barriers built on a 10% grade that were being tested to investigate their ability to laterally divert water downslope. One system had a homogeneous fine layer, while the fine soil of the second barrier was layered to increase its ability to laterally divert infiltrating moisture. The barriers were subjected first to constant infiltration while minimizing evaporative losses and then were exposed to ambient conditions. The continuous infiltration period of the field tests for the two barrier systems was modelled to determine the ability of an existing code to accurately represent capillary barrier behavior embodied in these two designs. Differences between the field test and the model data were found, but in general the simulations appeared to adequately reproduce the response of the test systems. Accounting for moisture retention hysteresis in the layered system will potentially lead to more accurate modelling results and is likely to be important when developing reasonable predictions of capillary barrier behavior
Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.
Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.
2001-01-01
Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,
Directory of Open Access Journals (Sweden)
Yajie Hu
2018-04-01
Full Text Available Enterovirus 71 (EV-A71 and coxsackievirus A16 (CV-A16 remain the predominant etiological agents of hand, foot, and mouth disease (HFMD. The clinical manifestations caused by the two viruses are obviously different. CV-A16 usually triggers a repeated infection, and airway epithelial integrity is often the potential causative factor of respiratory repeated infections. Our previous studies have demonstrated that there were some differentially expressed miRNAs involved in the regulation of adhesion function of epithelial barrier in EV-A71 and CV-A16 infections. In this study, we compared the differences between EV-A71 and CV-A16 infections on the airway epithelial barrier function in human bronchial epithelial (16HBE cells and further screened the key miRNA which leaded to the formation of these differences. Our results showed that more rapid proliferation, more serious destruction of 16HBE cells permeability, more apoptosis and disruption of intercellular adhesion-associated molecules were found in CV-A16 infection as compared to EV-A71 infection. Furthermore, we also identified that microRNA-4516 (miR-4516, which presented down-regulation in EV-A71 infection and up-regulation in CV-A16 infection was an important regulator of intercellular junctions by targeting Poliovirus receptor related protein 1(PVRL1. The expressions of PVRL1, claudin4, ZO-1 and E-cadherin in CV-A16-infected cells were significantly less than those in EV-A71-infected cells, while the expressions of these proteins were subverted when pre-treated with miR-4516-overexpression plasmid in EV-A71 infected and miR-4516-knockdown plasmid in CV-A16 infected 16HBE cells. Thus, these data suggested that the opposite expression of miR-4516 in EV-A71 and CV-A16 infections might be the initial steps leading to different epithelial impairments of 16HBE cells by destroying intercellular adhesion, which finally resulted in different outcomes of EV-A71 and CV-A16 infections.
This report contains a review of the long-term groundwater monitoring network for the Permeable Reactive Barrier (PRB) and Soil Remedy Areas at the Clare Water Supply Superfund Site in Clare, Michigan.
Martins, Mónia A R; Neves, Catarina M S S; Kurnia, Kiki A; Carvalho, Pedro J; Rocha, Marisa A A; Santos, Luís M N B F; Pinho, Simão P; Freire, Mara G
2016-01-15
In order to evaluate the impact of the alkyl side chain length and symmetry of the cation on the thermophysical properties of water-saturated ionic liquids (ILs), densities and viscosities as a function of temperature were measured at atmospheric pressure and in the (298.15 to 363.15) K temperature range, for systems containing two series of bis(trifluoromethylsulfonyl)imide-based compounds: the symmetric [C n C n im][NTf 2 ] (with n = 1-8 and 10) and asymmetric [C n C 1 im][NTf 2 ] (with n = 2-5, 7, 9 and 11) ILs. For water-saturated ILs, the density decreases with the increase of the alkyl side chain length while the viscosity increases with the size of the aliphatic tails. The saturation water solubility in each IL was further estimated with a reasonable agreement based on the densities of water-saturated ILs, further confirming that for the ILs investigated the volumetric mixing properties of ILs and water follow a near ideal behaviour. The water-saturated symmetric ILs generally present lower densities and viscosities than their asymmetric counterparts. From the experimental data, the isobaric thermal expansion coefficient and energy barrier were also estimated. A close correlation between the difference in the energy barrier values between the water-saturated and pure ILs and the water content in each IL was found, supporting that the decrease in the viscosity of ILs in presence of water is directly related with the decrease of the energy barrier.
Numerical simulation of flood barriers
Srb, Pavel; Petrů, Michal; Kulhavý, Petr
This paper deals with testing and numerical simulating of flood barriers. The Czech Republic has been hit by several very devastating floods in past years. These floods caused several dozens of causalities and property damage reached billions of Euros. The development of flood measures is very important, especially for the reduction the number of casualties and the amount of property damage. The aim of flood control measures is the detention of water outside populated areas and drainage of water from populated areas as soon as possible. For new flood barrier design it is very important to know its behaviour in case of a real flood. During the development of the barrier several standardized tests have to be carried out. Based on the results from these tests numerical simulation was compiled using Abaqus software and some analyses were carried out. Based on these numerical simulations it will be possible to predict the behaviour of barriers and thus improve their design.
Directory of Open Access Journals (Sweden)
Gregor Wolbring
2012-11-01
Full Text Available Resolution A/HRC/RES/16/2 adopted by the UN Human Rights Council on 8 April 2011 declared access to safe drinking water and sanitation a human right. However many people around the globe including people with disabilities do not have access to safe drinking water, hygiene or sanitation facilities. Inaccessibility of clean water sources, hygiene and sanitation facilities negatively impacts among others health, education, the ability to work, and the ability to partake in social activities. This paper looks at the benefits of, and access barriers to, clean water and sanitation for people with disabilities.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...
Removal of caffeine from water by combining dielectric barrier discharge (DBD plasma with goethite
Directory of Open Access Journals (Sweden)
Jian Wang
2017-07-01
Full Text Available In this research, dielectric barrier discharge plasma was developed to cooperate with goethite for removing caffeine in aqueous solution. Goethite was characterized by X-ray diffraction and scanning electron microscopy. The effects of input power, initial concentration and catalysts concentration on the removal efficiency of caffeine were evaluated. Furthermore, the degradation pathways of caffeine were also discussed preliminarily. In the case of caffeine concentration at 50 mg L−1, the degradation efficiency of caffeine was improved from 41% to 94% after 24 min on the conditions of input power of 75 W by combining goethite catalysts (2.5 g L−1, while the energy efficiency could be enhanced 1.6–2.3 times compared to the single DBD reactor. The reaction mechanism experiments demonstrated that attack by hydroxyl radical and ozone was the main degradation process of caffeine in aqueous solution. These studies also provided a theoretical and practical basis for the application of DBD-goethite in treatment of caffeine from water.
Inactivation of Escherichia coli in water by pulsed dielectric barrier discharge in coaxial reactor.
Hernández-Arias, A N; Rodríguez-Méndez, B G; López-Callejas, R; Alcántara-Díaz, D; Valencia-Alvarado, R; Mercado-Cabrera, A; Peña-Eguiluz, R; Muñoz-Castro, A E; Barocio, S R; de la Piedad-Beneitez, A
2012-09-01
An experimental study of ATCC (American Type Culture Collection) 8739 Escherichia coli bacteria inactivation in water by means of pulsed dielectric barrier discharge (PDBD) atmospheric pressure plasmas is presented. Plasma is generated by an adjustable power source capable of supplying high voltage 25 kV pulses, ∼30 μs long and at a 500 Hz frequency. The process was conducted in a ∼152 cm(3) cylindrical stainless steel coaxial reactor, endowed with a straight central electrode and a gas inlet. The bacterial concentration in water was varied from 10(3) up to 10(8) E. coli cells per millilitre. The inactivation was achieved without gas flow in the order of 82% at 10(8) colony-forming units per millilitre (CFU mL(-1)) concentrations in 600 s. In addition, oxygen was added to the gas supply in order to increase the ozone content in the process, raising the inactivation percentage to the order of 90% in the same treatment time. In order to reach a higher efficiency however, oxygen injection modulation is applied, leading to inactivation percentages above 99.99%. These results are similarly valid for lower bacterial concentrations.
K-Basin isolation barrier seal
International Nuclear Information System (INIS)
Ruff, E.S.
1994-10-01
This report documents various aspects of the design, analysis, procurement, and fabrication of the hydraulic seal on the isolation barriers to be installed in the 100-K Area spent nuclear fuel basin. The isolation barrier is used to keep water in the basin in the event of an earthquake
Monitoring the Vadose Zone Moisture Regime Below a Surface Barrier
Zhang, Z. F.; Strickland, C. E.; Field, J. G.
2009-12-01
A 6000 m2 interim surface barrier has been constructed over a portion of the T Tank Farm in the Depart of Energy’s Hanford site. The purpose of using a surface barrier was to reduce or eliminate the infiltration of meteoric precipitation into the contaminated soil zone due to past leaks from Tank T-106 and hence to reduce the rate of movement of the plume. As part of the demonstration effort, vadose zone moisture is being monitored to assess the effectiveness of the barrier on the reduction of soil moisture flow. A vadose zone monitoring system was installed to measure soil water conditions at four horizontal locations (i.e., instrument Nests A, B, C, and D) outside, near the edge of, and beneath the barrier. Each instrument nest consists of a capacitance probe with multiple sensors, multiple heat-dissipation units, and a neutron probe access tube used to measure soil-water content and soil-water pressure. Nest A serves as a control by providing subsurface conditions outside the influence of the surface barrier. Nest B provides subsurface measurements to assess barrier edge effects. Nests C and D are used to assess the impact of the surface barrier on soil-moisture conditions beneath it. Monitoring began in September 2006 and continues to the present. To date, the monitoring system has provided high-quality data. Results show that the soil beneath the barrier has been draining from the shallower depth. The lack of climate-caused seasonal variation of soil water condition beneath the barrier indicates that the surface barrier has minimized water exchange between the soil and the atmosphere.
Directory of Open Access Journals (Sweden)
ali pazhuhan
2016-11-01
The present study was aimed at analyzing the barriers against wheat farmers' participation in the formation of water users association within the framework of a descriptive survey. The sample of this study included 375 wheat farmers in Dez irrigation system who were selected through random cluster sampling and were studied through a questionnaire. The reliability index of this questionnaire was estimated to be 0.89. The content validity of the questionnaire was confirmed by the experts and scholars in the field. After the participants filled the questionnaires and the data were collected, the SPSS software package was used to analyze the data. In addition, the results of factor analysis related to the items of barriers led to the extraction of four barriers. These barriers, in order of importance, include the lack of proper infrastructures and economic facilities, social barriers, inadequate structural characteristics and lack of risk-taking, local organizations and lack of attention to extension activities that explain 60.78 percent of the variance of all the barriers.
Climate change impacts on water barriers and possibilities
DEFF Research Database (Denmark)
Frederiksen, Peter
in precipitation in 2100 and regional warming. Peak run-off will be displaced from spring to winter, run-off may be reduced by more than 40 % because of warming and rivers in the driest valleys may become intermittent streams with no water for irrigation except if minor reservoirs are constructed. In conclusion......The purpose is to elucidate climate change impacts on water related to precipitation, catchment hydrology, water management and land development in fruit export regions at the desert margin in Chile. The case is a region exposed to intense globalization and severe climate change. A timeline (past......, present, future) was applied to four valleys for comparative purposes. Data collection included field observations, semi-structured interviews, archives and library investigations. Precipitation decreased during the last century and varied as a function of El Niño Southern Oscillation impacts...
Jin, Xiaoyan; Yan, Yu; Shi, Wenjing; Bi, Shuping
2011-12-01
The structures and water-exchange reactions of aqueous aluminum-oxalate complexes are investigated using density functional theory. The present work includes (1) The structures of Al(C(2)O(4))(H(2)O)(4)(+) and Al(C(2)O(4))(2)(H(2)O)(2)(-) were optimized at the level of B3LYP/6-311+G(d,p). The geometries obtained suggest that the Al-OH(2) bond lengths trans to C(2)O(4)(2-) ligand in Al(C(2)O(4))(H(2)O)(4)(+) are much longer than the Al-OH(2) bond lengths cis to C(2)O(4)(2-). For Al(C(2)O(4))(2)(H(2)O)(2)(-), the close energies between cis and trans isomers imply the coexistence in aqueous solution. The (27)Al NMR and (13)C NMR chemical shifts computed with the consideration of sufficient solvent effect using HF GIAO method and 6-311+G(d,p) basis set are in agreement with the experimental values available, indicating the appropriateness of the applied models; (2) The water-exchange reactions of Al(III)-oxalate complexes were simulated at the same computational level. The results show that water exchange proceeds via dissociative pathway and the activation energy barriers are sensitive to the solvent effect. The energy barriers obtained indicate that the coordinated H(2)O cis to C(2)O(4)(2-) in Al(C(2)O(4))(H(2)O)(4)(+) is more labile than trans H(2)O. The water-exchange rate constants (k(ex)) of trans- and cis-Al(C(2)O(4))(2)(H(2)O)(2)(-) were estimated by four methods and their respective characteristics were explored; (3) The significance of the study on the aqueous aluminum-oxalate complexes to environmental chemistry is discussed. The influences of ubiquitous organic ligands in environment on aluminum chemistry behavior can be elucidated by extending this study to a series of Al(III)-organic system.
Directory of Open Access Journals (Sweden)
Cara L Sherwood
Full Text Available Arsenic is a lung toxicant that can lead to respiratory illness through inhalation and ingestion, although the most common exposure is through contaminated drinking water. Lung effects reported from arsenic exposure include lung cancer and obstructive lung disease, as well as reductions in lung function and immune response. As part of their role in innate immune function, airway epithelial cells provide a barrier that protects underlying tissue from inhaled particulates, pathogens, and toxicants frequently found in inspired air. We evaluated the effects of a five-day exposure to environmentally relevant levels of arsenic {<4μM [~300 μg/L (ppb] as NaAsO2} on airway epithelial barrier function and structure. In a primary mouse tracheal epithelial (MTE cell model we found that both micromolar (3.9 μM and submicromolar (0.8 μM arsenic concentrations reduced transepithelial resistance, a measure of barrier function. Immunofluorescent staining of arsenic-treated MTE cells showed altered patterns of localization of the transmembrane tight junction proteins claudin (Cl Cl-1, Cl-4, Cl-7 and occludin at cell-cell contacts when compared with untreated controls. To better quantify arsenic-induced changes in tight junction transmembrane proteins we conducted arsenic exposure experiments with an immortalized human bronchial epithelial cell line (16HBE14o-. We found that arsenic exposure significantly increased the protein expression of Cl-4 and occludin as well as the mRNA levels of Cl-4 and Cl-7 in these cells. Additionally, arsenic exposure resulted in altered phosphorylation of occludin. In summary, exposure to environmentally relevant levels of arsenic can alter both the function and structure of airway epithelial barrier constituents. These changes likely contribute to the observed arsenic-induced loss in basic innate immune defense and increased infection in the airway.
Meeting the challenge of constructing a uniquely difficult barrier wall
International Nuclear Information System (INIS)
Stamnes, R.L.; Orlean, H.M.; Thompson, N.E.
1997-01-01
A soil-bentonite vertical barrier wall with intersecting and round corners was constructed in complex geology and steep terrain to enclose and dewater a 1.4 hectare (3.5 acre) area once used for hazardous waste lagoons and landfills at the Queen City Farms (QCF) Superfund site in Maple Valley, Washington. The barrier system, including cap and barrier wall, was designed to contain light non-aqueous phase liquid (LNAPL), in addition to subsurface soil and ground water contaminated with chromium, polychlorinated biphenyls, polyaromatic hydrocarbons, trichloroethylene, dichloroethylene and vinyl chloride in the dissolved-phase. These contaminants threaten a drinking water aquifer beneath the site. Constructing the vertical barrier was a challenge due to steep slopes of 20 percent along the alignment (19.2 meter elevation change in the top of the wall), a 22.5 meter (75 foot) design wall depth, heavily consolidated clays and silts, open works gravels (gravel without finer soils), and geologic discontinuity. The barrier wall is keyed into either a glacial till or thin clayey-silt aquitard. Extensive earth moving, stepped walls and many construction techniques were used to enable construction of this barrier wall. Commonly accepted constructability criteria would have discouraged the construction of this wall
International Nuclear Information System (INIS)
Sena, P.A.
1986-01-01
The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper
Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema
DEFF Research Database (Denmark)
Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM
2010-01-01
chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Directory of Open Access Journals (Sweden)
Henrique Silva
2015-03-01
Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.
Benbettaïeb, Nasreddine; Kurek, Mia; Bornaz, Salwa; Debeaufort, Frédéric
2014-09-01
The increased use of synthetic packaging films has led to a high ecological problem due to their total non-biodegradability. Thus, there is a vital need to develop renewable and environmentally friendly bio-based polymeric materials. Films and coatings made from polysaccharide polymers, particularly chitosans and gelatins have good gas barrier properties and are envisaged more and more for applications in the biomedical and food fields, as well as for packaging. In this study a casting method was used to develop an edible plasticised film from chitosan and gelatin. Aiming to develop a blend film with enhanced properties, the effects of mixing chitosan (CS) and gelatin (G) in different proportions (CS:G, 75:25, 50:50, 25:75, w/w) on functional and physico-chemical properties have been studied. Mean film thickness increased linearly (R2 =0.999) with surface density of the film forming solution. An enhancement of mechanical properties by increasing the tensile strength (38.7±11 MPa for pure chitosan and 76.8±9 MPa for pure gelatin film) was also observed in blends, due to gelatin content.When the gelatin content in blend filmswas increased an improvement of both water vapour barrier properties [(4±0.3)×10(-10) g m(-1) s(-1) Pa(-1) for pure chitosan and (2.5±0.14)×10(-10) g m(-1) s(-1) Pa(-1) for pure gelatin, at 70% RH gradient] and oxygen barrier properties ((822.62±90.24)×10(-12) g m(-1) s(-1) Pa(-1) for blend film chitosan:gelatin (25:75 w/w) and (296.67±18.76)×10(-12) g m(-1) s(-1) Pa(-1) for pure gelatin was observed. Fourier transform infrared spectra of blend films showed a shift in the peak positions related to the amide groups (amide-I and amide-III) indicating interactions between biopolymers. Addition of gelatin in chitosan induced greater functional properties (mechanical, barrier) due to chemical interactions, suggesting an inter-penetrated network. © 2014 Society of Chemical Industry.
Liu, Li; Zhang, Jing; Dong, Shaonan; Zhang, Fuping; Wang, Ye; Bi, Shuping
2018-03-07
Density functional theory (DFT) calculations combined with cluster models are performed at the B3LYP/6-311+G(d,p) level for investigating the solvent effects in Al(H 2 O) 6 3+ water-exchange reactions. A "One-by-one" method is proposed to obtain the most representative number and arrangement of explicit H 2 Os in the second hydration sphere. First, all the possible ways to locate one explicit H 2 O in second sphere (N m ' = 1) based on the gas phase structure (N m ' = 0) are examined, and the optimal pathway (with the lowest energy barrier) for N m ' = 1 is determined. Next, more explicit H 2 Os are added one by one until the inner-sphere is fully hydrogen bonded. Finally, the optimal pathways with N m ' = 0-7 are obtained. The structural and energetic parameters as well as the lifetimes of the transition states are compared with the results obtained with the "Independent-minimum" method and the "Independent-average" method, and all three methods show that the pathway with N m ' = 6 may be representative. Our results give a new idea for finding the representative pathway for water-exchange reactions in other hydrated metal ion systems.
Study on the application of permeable reactive barriers for remediation of uranium mine pit water
International Nuclear Information System (INIS)
Li Na'na; Zhu Yucheng
2012-01-01
Permeable reactive barrier (PRB) is economical and convenient on in suit remediation of polluted groundwater. In this paper, according to characteristics of uranium mine pit water, laboratory-scale PRB reactors were designed with the mixture of valent iron, active carbon, hydrated lime and quartz sands as reaction media. The feasibility and effectiveness of treating uranium mine pit water by PRB were tested under 3 different proportions of contaminants through dynamic simulation tests, which came out the optimal proportion of contaminants. The result indicated that the remediation effect of reactor B was the best, whose average removal rate to U was up to 99%. The quality of effluent attained the relevant standards, which indicated that the PRB technology is a feasible method for the treatment of uranium mine pit water. (authors)
Bourlieu, C; Guillard, V; Vallès-Pamiès, B; Guilbert, S; Gontard, N
2009-05-01
Control of moisture transfer inside composite food products or between food and its environment remains today a major challenge in food preservation. A wide rage of film-forming compounds is now available and facilitates tailoring moisture barriers with optimized functional properties. Despite these huge potentials, a realistic assessment of the film or coating efficacy is still critical. Due to nonlinear water sorption isotherms, water-dependent diffusivities, and variations of physical state, modelling transport phenomena through edible barriers is complex. Water vapor permeability can hardly be considered as an inherent property of films and only gives a relative indication of the barrier efficacy. The formal or mechanistic models reported in literature that describe the influence of testing conditions on the barrier properties of edible films are reviewed and discussed. Most of these models have been validated on a narrow range of conditions. Conversely, few original predictive models based on Fick's Second Law have been developed to assess shelf-life extension of food products including barriers. These models, assuming complex and realistic hypothesis, have been validated in various model foods. The development of nondestructive methods of moisture content measurement should speed up model validation and allow a better comprehension of moisture transfer through edible films.
How hormones influence composition and physiological function of the brain-blood barrier.
Hampl, R; Bičíková, M; Sosvorová, L
2015-01-01
Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.
Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio
2016-05-01
Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.
Permanent isolation surface barrier development plan
International Nuclear Information System (INIS)
Wing, N.R.
1994-01-01
The exhumation and treatment of wastes may not always be the preferred alternative in the remediation of a waste site. In-place disposal alternatives, under certain circumstances, may be the most desirable alternatives to use in the protection of human health and the environment. The implementation of an in-place disposal alternative will likely require some type of protective covering that will provide long-term isolation of the wastes from the accessible environment. Even if the wastes are exhumed and treated, a long-term barrier may still be needed to adequately dispose of the treated wastes or any remaining waste residuals. Currently, no open-quotes provenclose quotes long-term barrier is available. The Hanford Site Permanent Isolation Surface Barrier Development Program (BDP) was organized to develop the technology needed to provide a long-term surface barrier capability for the Hanford Site. The permanent isolation barrier technology also could be used at other sites. Permanent isolation barriers use engineered layers of natural materials to create an integrated structure with redundant protective features. Drawings of conceptual permanent isolation surface barriers are shown. The natural construction materials (e.g., fine soil, sand, gravel, riprap, asphalt) have been selected to optimize barrier performance and longevity. The objective of current designs is to use natural materials to develop a maintenance-free permanent isolation surface barrier that isolates wastes for a minimum of 1,000 years by limiting water drainage to near-zero amounts; reducing the likelihood of plant, animal, and human intrusion; controlling the exhalation of noxious gases; and minimizing erosion-related problems
Permanent isolation surface barrier development plan
Energy Technology Data Exchange (ETDEWEB)
Wing, N.R.
1994-01-01
The exhumation and treatment of wastes may not always be the preferred alternative in the remediation of a waste site. In-place disposal alternatives, under certain circumstances, may be the most desirable alternatives to use in the protection of human health and the environment. The implementation of an in-place disposal alternative will likely require some type of protective covering that will provide long-term isolation of the wastes from the accessible environment. Even if the wastes are exhumed and treated, a long-term barrier may still be needed to adequately dispose of the treated wastes or any remaining waste residuals. Currently, no {open_quotes}proven{close_quotes} long-term barrier is available. The Hanford Site Permanent Isolation Surface Barrier Development Program (BDP) was organized to develop the technology needed to provide a long-term surface barrier capability for the Hanford Site. The permanent isolation barrier technology also could be used at other sites. Permanent isolation barriers use engineered layers of natural materials to create an integrated structure with redundant protective features. Drawings of conceptual permanent isolation surface barriers are shown. The natural construction materials (e.g., fine soil, sand, gravel, riprap, asphalt) have been selected to optimize barrier performance and longevity. The objective of current designs is to use natural materials to develop a maintenance-free permanent isolation surface barrier that isolates wastes for a minimum of 1,000 years by limiting water drainage to near-zero amounts; reducing the likelihood of plant, animal, and human intrusion; controlling the exhalation of noxious gases; and minimizing erosion-related problems.
Is water really a barrier for the house mouse? A comparative study of two mouse subspecies
Czech Academy of Sciences Publication Activity Database
Hiadlovská, Zuzana; Strnadová, Markéta; Macholán, Miloš; Vošlajerová Bímová, Barbora
2012-01-01
Roč. 61, 3-4 (2012), s. 319-329 ISSN 0139-7893 R&D Projects: GA ČR GA206/08/0640; GA ČR GAP506/11/1792 Institutional support: RVO:68081766 ; RVO:67985904 Keywords : dispersal * Mus musculus domesticus * Mus musculus musculus * swimming * water barrier Subject RIV: EG - Zoology; EB - Genetics ; Molecular Biology (UZFG-Y) Impact factor: 0.494, year: 2012
Kovacs-Kasa, Anita; Kim, Kyung Mi; Cherian-Shaw, Mary; Black, Stephen M; Fulton, David J; Verin, Alexander D
2018-08-01
We have previously shown that Gs-coupled adenosine receptors (A2a) are primarily involved in adenosine-induced human pulmonary artery endothelial cell (HPAEC) barrier enhancement. However, the downstream events that mediate the strengthening of the endothelial cell (EC) barrier via adenosine signaling are largely unknown. In the current study, we tested the overall hypothesis that adenosine-induced Rac1 activation and EC barrier enhancement is mediated by Gs-dependent stimulation of cAMP-dependent Epac1-mediated signaling cascades. Adenoviral transduction of HPAEC with constitutively-active (C/A) Rac1 (V12Rac1) significantly increases transendothelial electrical resistance (TER) reflecting an enhancement of the EC barrier. Conversely, expression of an inactive Rac1 mutant (N17Rac1) decreases TER reflecting a compromised EC barrier. The adenosine-induced increase in TER was accompanied by activation of Rac1, decrease in contractility (MLC dephosphorylation), but not Rho inhibition. Conversely, inhibition of Rac1 activity attenuates adenosine-induced increase in TER. We next examined the role of cAMP-activated Epac1 and its putative downstream targets Rac1, Vav2, Rap1, and Tiam1. Depletion of Epac1 attenuated the adenosine-induced Rac1 activation and the increase in TER. Furthermore, silencing of Rac1 specific guanine nucleotide exchange factors (GEFs), Vav2 and Rap1a expression significantly attenuated adenosine-induced increases in TER and activation of Rac1. Depletion of Rap1b only modestly impacted adenosine-induced increases in TER and Tiam1 depletion had no effect on adenosine-induced Rac1 activation and TER. Together these data strongly suggest that Rac1 activity is required for adenosine-induced EC barrier enhancement and that the activation of Rac1 and ability to strengthen the EC barrier depends, at least in part, on cAMP-dependent Epac1/Vav2/Rap1-mediated signaling. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Ji, Xu; Zhu, Yuan; Chen, Mingming; Su, Longxing; Chen, Anqi; Zhao, Chengchun; Gui, Xuchun; Xiang, Rong; Huang, Feng; Tang, Zikang
2014-01-01
Surface water molecules induced grain boundaries (GBs) barrier modification was investigated in ZnO and ZnMgO/ZnO films. Tunable electronic transport properties of the samples by water were characterized via a field effect transistor (FET) device structure. The FETs fabricated from polar C-plane ZnO and ZnMgO/ZnO films that have lots of GBs exhibited obvious double Schottky-like current-voltage property, whereas that fabricated from nonpolar M-plane samples with GBs and ZnO bulk single-crystal had no obvious conduction modulation effects. Physically, these hallmark properties are supposed to be caused by the electrostatical coupling effect of crystal polar field and molecular dipole on GBs barrier.
High Throughput Plasma Water Treatment
Mujovic, Selman; Foster, John
2016-10-01
The troublesome emergence of new classes of micro-pollutants, such as pharmaceuticals and endocrine disruptors, poses challenges for conventional water treatment systems. In an effort to address these contaminants and to support water reuse in drought stricken regions, new technologies must be introduced. The interaction of water with plasma rapidly mineralizes organics by inducing advanced oxidation in addition to other chemical, physical and radiative processes. The primary barrier to the implementation of plasma-based water treatment is process volume scale up. In this work, we investigate a potentially scalable, high throughput plasma water reactor that utilizes a packed bed dielectric barrier-like geometry to maximize the plasma-water interface. Here, the water serves as the dielectric medium. High-speed imaging and emission spectroscopy are used to characterize the reactor discharges. Changes in methylene blue concentration and basic water parameters are mapped as a function of plasma treatment time. Experimental results are compared to electrostatic and plasma chemistry computations, which will provide insight into the reactor's operation so that efficiency can be assessed. Supported by NSF (CBET 1336375).
Directory of Open Access Journals (Sweden)
Budhendra Singh
2012-11-01
Full Text Available In some way or another, all levels of government in Canada and First Nations share responsibility to implement multi-barrier protection of drinking water. The goal is to protect water from source to tap to minimize risk so that people have access to adequate and safe drinking water. The federal government has committed to assist First Nations achieve comparable levels of service standards available to non-First Nation communities. However, several recent reports on the status of drinking water services standards in First Nations indicate that people in these communities often experience greater health risks than those living off reserves. Using the federal drinking water risk evaluation guidelines, the capacities of First Nations and non-First Nations in Ontario to implement multi-barrier protection of their drinking water systems are compared. The Risk Level Evaluation Guidelines for Water and Wastewater Treatment in First Nation Communities rank drinking water systems as low, medium, or high risk based on information about source water, system design, system operation, reporting, and operator expertise. The risk evaluation scores for First Nations drinking water systems were obtained from Aboriginal Affairs and Northern Development Canada. A survey based on the federal Risk Level Evaluation Guidelines was sent to non-First Nation communities throughout Ontario with 54 communities responding. The capacity among First Nations was variable throughout the province, whereas all of the municipalities were in the low risk category, even small and northern non-First Nation community water systems. It is clear that the financial and technological capacity issues should be addressed regardless of the legislative and regulatory regime that is established. The current governance and management structure does not appear to be significantly reducing the gap in service standards despite financial investment. Exploring social or other underlying determinants
Pulsed dielectric barrier discharge for Bacillus subtilis inactivation in water
Hernández-Arias, A. N.; Rodríguez-Méndez, B. G.; López-Callejas, R.; Valencia-Alvarado, R.; Mercado-Cabrera, A.; Peña-Eguiluz, R.; Barocio, S. R.; Muñoz-Castro, A. E.; de la Piedad Beneitez, A.
2012-06-01
The inactivation of Bacillus subtilis bacteria in water has been experimentally studied by means of a pulsed dielectric barrier discharge (PDBD) in a coaxial reactor endowed with an alumina dielectric. The plasma source is capable of operating at atmospheric pressure with gas, water or hybrid gas-liquid media at adjustable 25 kV pulses, 30 μs long and at a 500 Hz frequency. In order to evaluate the inactivation efficiency of the system, a set of experiments were designed on the basis of oxygen flow control. The initial data have showed a significant bacterial rate reduction of 103-107 CFU/mL. Additional results proved that applying an oxygen flow for a few seconds during the PDBD treatment inactivates the Bacillus subtilis population with 99.99% effectiveness. As a reference, without gas flow but with the same exposure times, this percentage is reduced to ~90%. The analysis of the relationship between inactivation rate and chemical species in the discharge has been carried out using optical emission spectroscopy as to identifying the main reactive species. Reactive oxygen species such as atomic oxygen and ozone tuned out to be the dominant germicidal species. Some proposed inactivation mechanisms of this technique are discussed.
Pulsed dielectric barrier discharge for Bacillus subtilis inactivation in water
International Nuclear Information System (INIS)
Hernández-Arias, A N; López-Callejas, R; De la Piedad Beneitez, A; Rodríguez-Méndez, B G; Valencia-Alvarado, R; Mercado-Cabrera, A; Peña-Eguiluz, R; Barocio, S R; Muñoz-Castro, A E
2012-01-01
The inactivation of Bacillus subtilis bacteria in water has been experimentally studied by means of a pulsed dielectric barrier discharge (PDBD) in a coaxial reactor endowed with an alumina dielectric. The plasma source is capable of operating at atmospheric pressure with gas, water or hybrid gas-liquid media at adjustable 25 kV pulses, 30 μs long and at a 500 Hz frequency. In order to evaluate the inactivation efficiency of the system, a set of experiments were designed on the basis of oxygen flow control. The initial data have showed a significant bacterial rate reduction of 10 3 -10 7 CFU/mL. Additional results proved that applying an oxygen flow for a few seconds during the PDBD treatment inactivates the Bacillus subtilis population with 99.99% effectiveness. As a reference, without gas flow but with the same exposure times, this percentage is reduced to ∼90%. The analysis of the relationship between inactivation rate and chemical species in the discharge has been carried out using optical emission spectroscopy as to identifying the main reactive species. Reactive oxygen species such as atomic oxygen and ozone tuned out to be the dominant germicidal species. Some proposed inactivation mechanisms of this technique are discussed.
Haluska, J. D.
2017-12-01
Shoreline change along the Eastern Atlantic shore of Virginia has been studied for the individual barrier islands but not as an integrated system. This study combines the Atlantic shoreline locations for eleven barrier islands obtained from LANDSAT 5, 7, and 8 images. Approximately 250 shoreline locations over a 24-year period from Jan 1990 to Dec 2014 were extracted from the digitized shoreline data at 338 transects. The resulting 338 by 250 matrix was analyzed by the empirical orthogonal function (EOF) technique. The first four principal components (PC) explained 86 percent of the sample variance. Since the data was not detrended, the first PC was the overall trend of the data with a discontinuity in 2004-2005. The 2004-2005 interval included storm events and large shoreline changes. PCs 2 to 4 reflect the effects of El Nino events and tropical and non-tropical storms. Eigenvectors 1 to 4 all show the effects of the nine inlets in the island group. Eigenvector (EV) 1 explains 59 percent of the shoreline spatial variance and shows the largest changes at the northern and southern island ends. EVs 2 to 4 reflect the pattern of EV1 but at sequentially smaller percentages of the spatial variance. As a group, the eleven islands are losing ocean side shoreline. The lone exception is Hog Island. Sea level had the strongest correlation with the shoreline loss trend of PC1. The coefficient of determination was 0.41. The NAO and MEI also correlated with PC1 with correlations of determination of 0.05 and 0.12 respectively. These confidence level for the three factors was better than 99 percent. Sea level also correlated with PC3 and PC4. The PCs as a group show that the year intervals 2004-2005 and 2009-2010 had large effects on the shoreline change pattern for the island group. EVs 1 to 4 had the highest range of shoreline change at the island ends indicating the effect the changes of the inlets have on the adjacent islands. The smaller islands as a group had a higher level
Li, Wen-Qiang; Zhang, Min-Juan; Gan, Peng-Fei; Qiao, Lei; Yang, Shuai-Qi; Miao, Hai; Wang, Gang-Feng; Zhang, Mao-Mao; Liu, Wen-Ting; Li, Hai-Feng; Shi, Chun-Hai; Chen, Kun-Ming
2017-12-01
Leaf rolling is considered as one of the most important agronomic traits in rice breeding. It has been previously reported that SEMI-ROLLED LEAF 1 (SRL1) modulates leaf rolling by regulating the formation of bulliform cells in rice (Oryza sativa); however, the regulatory mechanism underlying SRL1 has yet to be further elucidated. Here, we report the functional characterization of a novel leaf-rolling mutant, curled leaf and dwarf 1 (cld1), with multiple morphological defects. Map-based cloning revealed that CLD1 is allelic with SRL1, and loses function in cld1 through DNA methylation. CLD1/SRL1 encodes a glycophosphatidylinositol (GPI)-anchored membrane protein that modulates leaf rolling and other aspects of rice growth and development. The cld1 mutant exhibits significant decreases in cellulose and lignin contents in secondary cell walls of leaves, indicating that the loss of function of CLD1/SRL1 affects cell wall formation. Furthermore, the loss of CLD1/SRL1 function leads to defective leaf epidermis such as bulliform-like epidermal cells. The defects in leaf epidermis decrease the water-retaining capacity and lead to water deficits in cld1 leaves, which contribute to the main cause of leaf rolling. As a result of the more rapid water loss and lower water content in leaves, cld1 exhibits reduced drought tolerance. Accordingly, the loss of CLD1/SRL1 function causes abnormal expression of genes and proteins associated with cell wall formation, cuticle development and water stress. Taken together, these findings suggest that the functional roles of CLD1/SRL1 in leaf-rolling regulation are closely related to the maintenance of cell wall formation, epidermal integrity and water homeostasis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Michal Šoltés
2015-12-01
Full Text Available This paper investigates hedging analysis against an underlying price drop by using the Nova 1 strategy formed by standard vanilla and barrier options. There are used European down and knock-in put options together with barrier call options. Derived income functions from the secured positions in analytical expressions are presented. Based on the theoretical results, the hedged portfolio is applied to SPDR SandP Oil and Gas Exploration and Production ETF. The proposed hedging variants are analysed and compared with the recommendation of the best possibilities for investors.
Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W
2013-11-01
The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Kierkegaard, Marie; Harms-Ringdahl, Karin; Widén Holmqvist, Lotta; Tollbäck, Anna
2009-06-01
The purpose of this study was to describe and analyse self-rated perceived functioning, disability and environmental facilitators/barriers with regard to disease severity, using the International Classification of Functioning, Disability and Health (ICF) checklist, in adults with myotonic dystrophy type 1. Cross-sectional design. Forty-one women and 29 men with myotonic dystrophy type 1. A modified ICF checklist was used for self-rating of perceived problems in 29 body-function categories, difficulties in 52 activity and participation categories, and facilitators/barriers in 23 environmental-factor categories according to the verbal anchors of the ICF qualifiers. Disease severity classification was based on the muscular impairment rating scale. Of the persons with myotonic dystrophy type 1, 80% perceived problems of excessive daytime sleepiness, 76% of muscle power, and 66% of energy and drive functions, while over 59% perceived difficulties in physically demanding mobility activities. Disabilities in mobility, self-care and domestic life were more frequently reported by persons with severe disease. Support from the immediate family, medicines and social security services were perceived as facilitators for 50-60% of the participants. Disabilities and important environmental facilitators in adults with myotonic dystrophy type 1 were identified, and this clinically-relevant information can be used for developing health services for people with this condition.
Ang-(1-7) exerts protective role in blood-brain barrier damage by the balance of TIMP-1/MMP-9.
Wu, Jitao; Zhao, Duo; Wu, Shuang; Wang, Dan
2015-02-05
Cerebrovascular disease (CVD) ranks as the top three health risks, specially cerebral ischemia characterized with the damage of blood-brain barrier (BBB). The angiotensin Ang-(1-7) was proven to have a protective effect on cerebrovascular diseases. However, its role on blood-brain barrier and the underlying molecular mechanism remains unclear. In this study, Ang-(1-7) significantly relieved damage of ischemia reperfusion injury on blood-brain barrier in cerebral ischemia reperfusion injury (IRI) rats. Furthermore, its treatment attenuated BBB permeability and brain edema. Similarly, Ang-(1-7) also decreased the barrier permeability of brain endothelial cell line RBE4. Further analysis showed that Ang-(1-7) could effectively restore tight junction protein (claudin-5 and zonula occludens ZO-1) expression levels both in IRI-rats and hypoxia-induced RBE4 cells. Furthermore, Ang-(1-7) stimulation down-regulated hypoxia-induced matrix metalloproteinase-9 (MMP-9) levels, whose silencing with (matrix metalloproteinase-9 hemopexin domain) MMP9-PEX inhibitor significantly increased the expression of claudin-5 and ZO-1. Further mechanism analysis demonstrated that Ang-(1-7) might junction protein levels by tissue inhibitor of metalloproteinase 1 (TIMP1)-MMP9 pathway, because Ang-(1-7) enhanced TIMP1 expression, whose silencing obviously attenuated the inhibitor effect of Ang-(1-7) on MMP-9 levels and decreased Ang-(1-7)-triggered increase in claudin-5 and ZO-1. Together, this study demonstrated a protective role of Ang-(1-7) in IRI-induced blood-brain barrier damage by TIMP1-MMP9-regulated tight junction protein expression. Accordingly, Ang-(1-7) may become a promising therapeutic agent against IRI and its complications. Copyright © 2014 Elsevier B.V. All rights reserved.
Hysteresis of Soil Point Water Retention Functions Determined by Neutron Radiography
Perfect, E.; Kang, M.; Bilheux, H.; Willis, K. J.; Horita, J.; Warren, J.; Cheng, C.
2010-12-01
Soil point water retention functions are needed for modeling flow and transport in partially-saturated porous media. Such functions are usually determined by inverse modeling of average water retention data measured experimentally on columns of finite length. However, the resulting functions are subject to the appropriateness of the chosen model, as well as the initial and boundary condition assumptions employed. Soil point water retention functions are rarely measured directly and when they are the focus is invariably on the main drying branch. Previous direct measurement methods include time domain reflectometry and gamma beam attenuation. Here we report direct measurements of the main wetting and drying branches of the point water retention function using neutron radiography. The measurements were performed on a coarse sand (Flint #13) packed into 2.6 cm diameter x 4 cm long aluminum cylinders at the NIST BT-2 (50 μm resolution) and ORNL-HFIR CG1D (70 μm resolution) imaging beamlines. The sand columns were saturated with water and then drained and rewetted under quasi-equilibrium conditions using a hanging water column setup. 2048 x 2048 pixel images of the transmitted flux of neutrons through the column were acquired at each imposed suction (~10-15 suction values per experiment). Volumetric water contents were calculated on a pixel by pixel basis using Beer-Lambert’s law in conjunction with beam hardening and geometric corrections. The pixel rows were averaged and combined with information on the known distribution of suctions within the column to give 2048 point drying and wetting functions for each experiment. The point functions exhibited pronounced hysteresis and varied with column height, possibly due to differences in porosity caused by the packing procedure employed. Predicted point functions, extracted from the hanging water column volumetric data using the TrueCell inverse modeling procedure, showed very good agreement with the range of point
Pohorille, Andrew; Wilson, Michael A.
1995-01-01
Molecular dynamics computer simulations of the structure and functions of a simple membrane are performed in order to examine whether membranes provide an environment capable of promoting protobiological evolution. Our model membrane is composed of glycerol 1-monooleate. It is found that the bilayer surface fluctuates in time and space, occasionally creating thinning defects in the membrane. These defects are essential for passive transport of simple ions across membranes because they reduce the Born barrier to this process by approximately 40%. Negative ions are transferred across the bilayer more readily than positive ions due to favorable interactions with the electric field at the membrane-water interface. Passive transport of neutral molecules is, in general, more complex than predicted by the solubility-diffusion model. In particular, molecules which exhibit sufficient hydrophilicity and lipophilicity concentrate near membrane surfaces and experience 'interfacial resistance' to transport. The membrane-water interface forms an environment suitable for heterogeneous catalysis. Several possible mechanisms leading to an increase of reaction rates at the interface are discussed. We conclude that vesicles have many properties that make them very good candidates for earliest protocells. Some potentially fruitful directions of experimental and theoretical research on this subject are proposed.
Neurobehavioral function in school-age children exposed to manganese in drinking water.
Oulhote, Youssef; Mergler, Donna; Barbeau, Benoit; Bellinger, David C; Bouffard, Thérèse; Brodeur, Marie-Ève; Saint-Amour, Dave; Legrand, Melissa; Sauvé, Sébastien; Bouchard, Maryse F
2014-12-01
Manganese neurotoxicity is well documented in individuals occupationally exposed to airborne particulates, but few data are available on risks from drinking-water exposure. We examined associations of exposure from concentrations of manganese in water and hair with memory, attention, motor function, and parent- and teacher-reported hyperactive behaviors. We recruited 375 children and measured manganese in home tap water (MnW) and hair (MnH). We estimated manganese intake from water ingestion. Using structural equation modeling, we estimated associations between neurobehavioral functions and MnH, MnW, and manganese intake from water. We evaluated exposure-response relationships using generalized additive models. After adjusting for potential confounders, a 1-SD increase in log10 MnH was associated with a significant difference of -24% (95% CI: -36, -12%) SD in memory and -25% (95% CI: -41, -9%) SD in attention. The relations between log10 MnH and poorer memory and attention were linear. A 1-SD increase in log10 MnW was associated with a significant difference of -14% (95% CI: -24, -4%) SD in memory, and this relation was nonlinear, with a steeper decline in performance at MnW > 100 μg/L. A 1-SD increase in log10 manganese intake from water was associated with a significant difference of -11% (95% CI: -21, -0.4%) SD in motor function. The relation between log10 manganese intake and poorer motor function was linear. There was no significant association between manganese exposure and hyperactivity. Exposure to manganese in water was associated with poorer neurobehavioral performances in children, even at low levels commonly encountered in North America.
Abdullah Al, Mamun; Gao, Yangyang; Xu, Guangjian; Wang, Zheng; Warren, Alan; Xu, Henglong
2018-04-01
Vertical variations in trophic-functional patterns of biofilm-dwelling ciliates were studied in coastal waters of the Yellow Sea, northern China. A total of 50 species were identified and assigned to four trophic-functional groups (TFgrs): algivores (A), bacterivorous (B), non-selective (N) and raptors (R). The trophic-functional structures of the ciliate communities showed significant variability among different water depths: (1) with increasing water depth, relative species numbers and relative abundances of groups A and R decreased sharply whereas those of groups B and N increased gradually; (2) in terms of the frequency of occurrences, group A dominated at depths of 1-3.5 m whereas group B dominated at 5 m, while in terms of the probability density function of the trophic-functional spectrum, group A was the highest contributor at 1 m and group B was highest at the other three depths; (3) distance-based redundancy analyses revealed significant differences in trophic-functional patterns among the four depths, except between 2 and 3.5 m (P > 0.05); and (4) the trophic-functional trait diversity increased from 1 to 3.5 m and decreased sharply at 5 m. Our results suggest that the biofilm-dwelling ciliates maintain a stable trophic-functional pattern and high biodiversity at depths of 1-3.5 m. Copyright © 2018 Elsevier GmbH. All rights reserved.
An evaluation of the fire barrier system thermo-lag 330-1
International Nuclear Information System (INIS)
Nowlen, S.P.
1994-09-01
This report presents the results of three fire endurance tests and one ampacity derating test set of the fire barrier system Thermo-Lag 330-1 Subliming Coating. Each test was performed using cable tray specimens protected by a nominal three-hour fire barrier envelope comprised of two layers of nominal 1/2 inch thick material. The fire barrier systems for two of the three fire endurance test articles and for the ampacity derating test article were installed in accordance with the manufacturer's installations procedures. The barrier system for the third fire endurance test article was a full reproduction of one of the original manufacturer's qualification test articles. This final test article included certain installation enhancements not considered typical of current nuclear power plant installations. The primary criteria for fire endurance performance evaluation was based on cable circuit integrity testing. Secondary consideration was also given to the temperature rise limits set forth in the ASTM E119 standard fire barrier test procedure. All three of the fire endurance specimens failed prematurely. Circuit integrity failures for the two fire endurance test articles with procedures-based installations were recorded at approximately 76 and 59 minutes into the exposures for a 6 inch wide and 12 inch wide cable tray respectively. Temperature excursion failures (single point) for these two test articles were noted at approximately 65 and 56 minutes respectively. The first circuit integrity failure for the full reproduction test article was recorded approximately 119 minutes into the exposure, and the first temperature excursion failure for this test article was recorded approximately 110 minutes into the exposure
Gas Diffusion Barriers Prepared by Spatial Atmospheric Pressure Plasma Enhanced ALD.
Hoffmann, Lukas; Theirich, Detlef; Pack, Sven; Kocak, Firat; Schlamm, Daniel; Hasselmann, Tim; Fahl, Henry; Räupke, André; Gargouri, Hassan; Riedl, Thomas
2017-02-01
In this work, we report on aluminum oxide (Al 2 O 3 ) gas permeation barriers prepared by spatial ALD (SALD) at atmospheric pressure. We compare the growth characteristics and layer properties using trimethylaluminum (TMA) in combination with an Ar/O 2 remote atmospheric pressure plasma for different substrate velocities and different temperatures. The resulting Al 2 O 3 films show ultralow water vapor transmission rates (WVTR) on the order of 10 -6 gm -2 d -1 . In notable contrast, plasma based layers already show good barrier properties at low deposition temperatures (75 °C), while water based processes require a growth temperature above 100 °C to achieve equally low WVTRs. The activation energy for the water permeation mechanism was determined to be 62 kJ/mol.
Therapeutic benefits of enhancing permeability barrier for atopic eczema
Directory of Open Access Journals (Sweden)
George Man
2015-06-01
Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Pederzolli, Rae-Leigh A; Van Kessel, Andrew G; Campbell, John; Hendrick, Steve; Wood, Katie M; Penner, Gregory B
2018-02-15
The objective of this study was to determine effect of ruminal acidosis (RA) and low feed intake [LFI] on the regional barrier function of the gastrointestinal tract. Twenty-one Holstein steers were fed for ad libitum intake for 5 d (control [CON]), fed at 25% of ad libitum intake for 5 d (LFI), or provided 2 d of ad libitum intake followed by 1-d of feed restriction (25% of ad libitum intake), 1 d where 30% of ad libitum dry matter intake (DMI) was provided as pelleted barley followed by the full allocation (RA) and fed for ad libitum intake the following day. Tissues and digesta from the rumen, omasum, duodenum, jejunum, ileum, cecum, proximal, and distal colon were collected. Permeability was assessed using the mucosal-to-serosal flux of inulin (JMS-inulin) and mannitol (JMS-mannitol). Digesta pH was 0.81, 0.63, and 0.42 pH units less for RA than CON in the rumen, cecum, and proximal colon; while, LFI had pH that was 0.47 and 0.36 pH units greater in the rumen and proximal colon compared to CON. Total ruminal short-chain fatty acid (SCFA) concentration were less for LFI (92 mM; P = 0.010) and RA (87 mM; P = 0.007) than CON (172 mM) steers. In the proximal colon, the proportion of butyrate (P = 0.025 and P = 0.022) and isobutyrate (P = 0.019 and P = 0.019) were greater, and acetate (P = 0.028 and P = 0.028) was less for LFI and RA, respectively, when compared to CON steers. Ruminal papillae length, width, perimeter, and surface area were 1.21 mm, 0.78 mm, 3.84 mm, and 11.15 mm2 less for LFI than CON; while, RA decreased papillae width by 0.52 mm relative to CON. The JMS-mannitol was less for LFI steers than CON in the proximal colon (P = 0.041) and in the distal colon (P = 0.015). Increased gene expression for claudin 1, occludin, tight-cell junction protein 1 and 2, and toll-like receptor 4 were detected for LFI relative to CON in the rumen, jejunum, and proximal colon. For RA steers, expression of toll-like receptor 4 in the rumen, and occludin and tight
Directory of Open Access Journals (Sweden)
Shen J
2017-09-01
Full Text Available Junyi Shen, Zhiming Zhao, Wei Shang, Chunli Liu, Beibei Zhang, Lingjie Zhao, Hui Cai Department of Integrated Traditional and Western Medicine, Jinling Hospital, School of Medicine, Nanjing University, Nanjing, China Abstract: Diabetic cerebral infarction is with poorer prognosis and high rates of mortality. Ginsenoside Rg1 (Rg1 has a wide variety of therapeutic values for central nervous system (CNS diseases for the neuron protective effects. However, the blood–brain barrier (BBB restricts Rg1 in reaching the CNS. In this study, we investigated the therapeutic effects of Rg1 nanoparticle (PHRO, fabricated with γ-PGA, L-PAE (H, Rg1, and OX26 antibody, targeting transferrin receptor, on the diabetes rats complicated with diabetic cerebral infarction in vitro and in vivo. Dynamic light scattering analysis shows the average particle size of PHRO was 79±18 nm and the polydispersity index =0.18. The transmission electron microscope images showed that all NPs were spherical in shape with diameters of 89±23 nm. PHRO released Rg1 with sustained release manner and could promote the migration of cerebrovascular endothelial cells and tube formation and even penetrated the BBB in vitro. PHRO could penetrate the BBB with high concentration in brain tissue to reduce the cerebral infarction volume and promote neuronal recovery in vivo. PHRO was promising to be a clinical treatment of diabetes mellitus with cerebral infarction. Keywords: poly-γ-glutamic acid, ginsenoside Rg1, OX26, blood–brain barrier
Bassett, Ingrid V; Coleman, Sharon M; Giddy, Janet; Bogart, Laura M; Chaisson, Christine E; Ross, Douglas; Flash, Moses J E; Govender, Tessa; Walensky, Rochelle P; Freedberg, Kenneth A; Losina, Elena
2017-04-01
Prompt entry into HIV care is often hindered by personal and structural barriers. Our objective was to evaluate the impact of self-perceived barriers to health care on 1-year mortality among newly diagnosed HIV-infected individuals in Durban, South Africa. Before HIV testing at 4 outpatient sites, adults (≥18 years) were surveyed regarding perceived barriers to care including (1) service delivery, (2) financial, (3) personal health perception, (4) logistical, and (5) structural. We assessed deaths via phone calls and the South African National Population Register. We used multivariable Cox proportional hazards models to determine the association between number of perceived barriers and death within 1 year. One thousand eight hundred ninety-nine HIV-infected participants enrolled. Median age was 33 years (interquartile range: 27-41 years), 49% were females, and median CD4 count was 192/μL (interquartile range: 72-346/μL). One thousand fifty-seven participants (56%) reported no, 370 (20%) reported 1-3, and 460 (24%) reported >3 barriers to care. By 1 year, 250 [13%, 95% confidence interval (CI): 12% to 15%] participants died. Adjusting for age, sex, education, baseline CD4 count, distance to clinic, and tuberculosis status, participants with 1-3 barriers (adjusted hazard ratio: 1.49, 95% CI: 1.06 to 2.08) and >3 barriers (adjusted hazard ratio: 1.81, 95% CI: 1.35 to 2.43) had higher 1-year mortality risk compared with those without barriers. HIV-infected individuals in South Africa who reported perceived barriers to medical care at diagnosis were more likely to die within 1 year. Targeted structural interventions, such as extended clinic hours, travel vouchers, and streamlined clinic operations, may improve linkage to care and antiretroviral therapy initiation for these people.
Institute of Scientific and Technical Information of China (English)
Zongyi Xie; Weiwei Shen; Ying Ma; Yuan Cheng
2008-01-01
BACKGROUND: Recent studies have indicated that blood-brain barrier (BBB) disruption following subarachnoid hemorrhage (SAH) significantly correlates with the development of brain injury and poor prognosis of patients subjected to SAH. OBJECTIVE: To investigate both functional and structural changes related to BBB in various phases after SAH in rats through quantitative and qualitative methods.DESIGN, TIME AND SETTING: This experiment, a completely randomized design and controlled experiment, was performed at the Department of Neurosurgery, the Second Affiliated Hospital of Chongqing University of Medical Sciences from June 2006 to March 2007.MATERIALS: A total of 128 female, healthy, Sprague-Dawley rats were selected for this study. Main reagents and instruments: Evans Blue dye (Sigma Company, USA), fluorescence spectrophotometer (Shimadzu Company, Japan), and transmission electron microscope (Olympus Company, Japan). MAIN OUTCOME MEASURES: Brain tissue water content was determined by the wet-dry method. BBB permeability in the cerebral cortex was determined by Evans Blue dye and fluorescent spectrophotometer. The ultrastructural changes in BBB were observed with transmission electron microscope.RESULTS: Compared with the sham-operated group, SAH induced a significant increase in brain water content between 24 and 60 hours (F = 888.32, P 0.05). Electron microscopy demonstrated only a mild perivascular edema at 24 hours after SAH. By 36 hours, a notable perivascular edema was associated with a collapse of the capillary. Astrocytic endfeet surrounding the capillary were prominently swollen in the edematous areas. The above-mentioned abnormal ultrastructural changes in the BBB were reversed by 72 hours after SAH. No obvious morphological changes in the BBB were detected in the sham-operated rats.CONCLUSION: These results directly suggest that SAH could induce rapid changes in BBB function and structure during the acute phases of BBB breakdown. Moreover, these dynamic
Sturgeon, Craig; Fasano, Alessio
2016-01-01
Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.
Storm impacts on small barrier islands
DEFF Research Database (Denmark)
Kroon, Aart; Fruergaard, Mikkel
The shorelines of the Baltic Sea and the inner coastal waters in Denmark consist of many barrier islands. These sandy barrier islands were mainly formed in the Holocene and are still very dynamic. The present day changes in the morphology are dominantly governed by storm waves and associated high...
Directory of Open Access Journals (Sweden)
Mohamed Ragab Abdel Gawwad
2013-09-01
Full Text Available Aquaporins are channel proteins found in plasma membranes and intercellular membranes of different cellular compartments, facilitate the water flux, solutes and gases across the cellular plasma membranes. The present study highlights the sub-family plasma membrane intrinsic protein (PIP predicting the 3-D structure and analyzing the functional interactome of it homologs. PIP1 homologs integrate with many proteins with different plant physiological roles in Arabidopsis thaliana including; PIP1A and PIP1B: facilitate the transport of water, diffusion of amino acids and/or peptides from the vacuolar compartment to the cytoplasm, play a role in the control of cell turgor and cell expansion and involved in root water uptake respectively. In addition we found that PIP1B plays a defensive role against Pseudomonas syringae infection through the interaction with the plasma membrane Rps2 protein. Another substantial function of PIP1C via the interaction with PIP2E is the response to nematode infection. Generally, PIP1 sub-family interactome controlling many physiological processes in plant cell like; osmoregulation in plants under high osmotic stress such as under a high salt, response to nematode, facilitate the transport of water across cell membrane and regulation of floral initiation in Arabidopsis thaliana.
Frapper, Gilles; Bachmann, Christian; Gu, Yanlong; Coval De Sousa, Rodolphe; Jérôme, François
2011-01-14
The role of water in a multicomponent domino reaction (MCR) involving styrene, 2,4-pentanedione, and formaldehyde was studied. Whereas anhydrous conditions produced no reaction, the MCR successfully proceeded in the presence of water, affording the targeted dihydropyran derivatives with good yield. The mechanism of this MCR (Knoevenagel hetero Diels-Alder sequence) was studied with and without explicit water molecules using the SMD continuum solvation model in combination with the B3LYP density functional and the 6-311++G** basis set to compute the water and acetone (aprotic organic solvent) solution Gibbs free energies. In the Knoevenagel step, we found that water acted as a proton relay to favor the formation of more flexible six-membered ring transition state structures both in concerted (direct H(2)O elimination) and stepwise (keto-enol tautomerization and dehydration) pathways. The inclusion of a water molecule in our model resulted in a significant decrease (-8.5 kcal mol(-1)ΔG(water)(‡)) of the direct water elimination activation barrier. Owing to the presence of water, all chemical steps involved in the MCR mechanism had activation free energies barriers lower than 39 kcal mol(-1) at 25 °C in aqueous solvent (ZPE corrected electronic energies barriers). Consequently, the MCR proceeded without the assistance of any catalyst.
Myosin Light Chain Kinase Mediates Intestinal Barrier Disruption following Burn Injury
Chen, Chuanli; Wang, Pei; Su, Qin; Wang, Shiliang; Wang, Fengjun
2012-01-01
Background Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC) phosphorylation mediated by MLC kinase (MLCK) is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. Methodology/Principal Findings Male balb/c mice were assigned randomly to either sham burn (control) or 30% total body surface area (TBSA) full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg), an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC)-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. Conclusions/Significance The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury. PMID:22529961
Feasibility study of tank leakage mitigation using subsurface barriers. Revision 1
International Nuclear Information System (INIS)
Treat, R.L.; Peters, B.B.; Cameron, R.J.
1995-01-01
This document reflects the evaluations and analyses performed in response to Tri-Party Agreement Milestone M-45-07A - open-quotes Complete Evaluation of Subsurface Barrier Feasibilityclose quotes (September 1994). In addition, this feasibility study was revised reflecting ongoing work supporting a pending decision by the DOE Richland Operations Office, the Washington State Department of Ecology, and the US Environmental Protection Agency regarding further development of subsurface barrier options for SSTs and whether to proceed with demonstration plans at the Hanford Site (Tri-Party Agreement Milestone M-45-07B). Analyses of 14 integrated SST tank farm remediation alternatives were conducted in response to the three stated objectives of Tri-Party Agreement Milestone M-45-07A. The alternatives include eight with subsurface barriers and six without. Technologies used in the alternatives include three types of tank waste retrieval, seven types of subsurface barriers, a method of stabilizing the void space of emptied tanks, two types of in situ soil flushing, one type of surface barrier, and a clean-closure method. A no-action alternative and a surface-barrier-only alternative were included as nonviable alternatives for comparison. All other alternatives were designed to result in closure of SST tank farms as landfills or in clean-closure. Revision 1 incorporates additional analyses of worker safety, large leak scenarios, and sensitivity to the leach rates of risk controlling constituents. The additional analyses were conducted to support TPA Milestone M-45-07B
Acceptance test procedure for the 105-KW isolation barrier leak rate
International Nuclear Information System (INIS)
McCracken, K.J.
1995-01-01
This acceptance test procedure shall be used to: First establish a basin water loss rate prior to installation of the two isolation barriers between the main basin and the discharge chute in K-Basin West. Second, perform an acceptance test to verify an acceptable leakage rate through the barrier seals. This Acceptance Test Procedure (ATP) has been prepared in accordance with CM-6-1 EP 4.2, Standard Engineering Practices
Controlling the hydration of the skin though the application of occluding barrier creams.
Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard
2013-03-06
The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.
Directory of Open Access Journals (Sweden)
Markus Schmid
2012-01-01
Full Text Available In case of food packaging applications, high oxygen and water vapour barriers are the prerequisite conditions for preserving the quality of the products throughout their whole lifecycle. Currently available polymers and/or biopolymer films are mostly used in combination with barrier materials derived from oil based plastics or aluminium to enhance their low barrier properties. In order to replace these non-renewable materials, current research efforts are focused on the development of sustainable coatings, while maintaining the functional properties of the resulting packaging materials. This article provides an introduction to food packaging requirements, highlights prior art on the use of whey-based coatings for their barriers properties, and describes the key properties of an innovative packaging multilayer material that includes a whey-based layer. The developed whey protein formulations had excellent barrier properties almost comparable to the ethylene vinyl alcohol copolymers (EVOH barrier layer conventionally used in food packaging composites, with an oxygen barrier (OTR of <2 [cm³(STP/(m²d bar] when normalized to a thickness of 100 μm. Further requirements of the barrier layer are good adhesion to the substrate and sufficient flexibility to withstand mechanical load while preventing delamination and/or brittle fracture. Whey-protein-based coatings have successfully met these functional and mechanical requirements.
Safety barriers on oil and gas platforms. Means to prevent hydrocarbon releases
Energy Technology Data Exchange (ETDEWEB)
Sklet, Snorre
2005-12-15
The main objective of the PhD project has been to develop concepts and methods that can be used to define, illustrate, analyse, and improve safety barriers in the operational phase of offshore oil and gas production platforms. The main contributions of this thesis are; Clarification of the term safety barrier with respect to definitions, classification, and relevant attributes for analysis of barrier performance Development and discussion of a representative set of hydrocarbon release scenarios Development and testing of a new method, BORA-Release, for qualitative and quantitative risk analysis of hydrocarbon releases Safety barriers are defined as physical and/or non-physical means planned to prevent, control, or mitigate undesired events or accidents. The means may range from a single technical unit or human actions, to a complex socio-technical system. It is useful to distinguish between barrier functions and barrier systems. Barrier functions describe the purpose of safety barriers or what the safety barriers shall do in order to prevent, control, or mitigate undesired events or accidents. Barrier systems describe how a barrier function is realized or executed. If the barrier system is functioning, the barrier function is performed. If a barrier function is performed successfully, it should have a direct and significant effect on the occurrence and/or consequences of an undesired event or accident. It is recommended to address the following attributes to characterize the performance of safety barriers; a) functionality/effectiveness, b) reliability/ availability, c) response time, d) robustness, and e) triggering event or condition. For some types of barriers, not all the attributes are relevant or necessary in order to describe the barrier performance. The presented hydrocarbon release scenarios include initiating events, barrier functions introduced to prevent hydrocarbon releases, and barrier systems realizing the barrier functions. Both technical and human
International Nuclear Information System (INIS)
Aoshima, I.; Nishibayashi, K.; Souma, I.; Murayama, A.; Oka, Y.
2006-01-01
Spin injection from diluted magnetic semiconductor (DMS) barriers of Cd 1- x Mn x Te into a quantum well (QW) of CdTe is studied, by means of pump-probe absorption spectroscopy in magnetic fields. Fast decay characteristics of circularly polarized differential absorbances of spin-polarized excitons in the DMS barrier show the exciton injection time of 6 ps from the barriers into the QW. In accordance with the fast relaxation of the spin-polarized excitons from the barrier, we observe the rise of circular polarization degree for the differential absorption of the CdTe QW in magnetic fields, evidently indicating the spin injection. In addition, the circular polarization degree up to 0.3 is developed in the well immediately after pumping, originating from the fast relaxation of a heavy hole (hh) spin less than 0.2 ps, due to the giant Zeeman effect caused by the penetration of the hh wave function into the DMS barriers
Frozen Soil Barrier. Subsurface Contaminants Focus Area. OST Reference No. 51
International Nuclear Information System (INIS)
1999-01-01
Problem: Hazardous and radioactive materials have historically been disposed of at the surface during operations at Department of Energy facilities. These contaminants have entered the subsurface, contaminating soils and groundwater resources. Remediation of these groundwater plumes using the baseline technology of pump and treat is expensive and takes a long time to complete. Containment of these groundwater plumes can be alternative or an addition to the remediation activities. Standard containment technologies include slurry walls, sheet piling, and grouting. These are permanent structures that once installed are difficult to remove. How It Works: Frozen Soil Barrier technology provides a containment alternative, with the key difference being that the barrier can be easily removed after a period of time, such as after the remediation or removal of the source is completed. Frozen Soil Barrier technology can be used to isolate and control the migration of underground radioactive or other hazardous contaminants subject to transport by groundwater flow. Frozen Soil Barrier technology consists of a series of subsurface heat transfer devices, known as thermoprobes, which are installed around a contaminant source and function to freeze the soil pore water. The barrier can easily be maintained in place until remediation or removal of the contaminants is complete, at which time the barrier is allowed to thaw.
Energy Technology Data Exchange (ETDEWEB)
Yang Ji, E-mail: yangji@ecust.edu.cn [School of Resources and Environmental Engineering, State Environmental Protection Key Laboratory of Environmental Risk Assessment and Control on Chemical Process, East China University of Science and Technology, Shanghai 200237 (China); Cao Limei; Guo Rui; Jia Jinping [School of Environmental Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)
2010-12-15
Granular activated carbon was modified with dimethyl dichlorosilane to improve its surface hydrophobicity, and therefore to improve the performance of permeable reactive barrier constructed with the modified granular activated carbon and elemental iron. X-ray photoelectron spectroscopy shows that the surface silicon concentration of the modified granular activated carbon is higher than that of the original one, leading to the increased surface hydrophobicity. Although the specific surface area decreased from 895 to 835 m{sup 2} g{sup -1}, the modified granular activated carbon could adsorb 20% more 2,4-dichlorophenol than the original one did in water. It is also proven that the permeable reactive barrier with the modified granular activated carbon is more efficient at 2,4-dichlorophenol dechlorination, in which process 2,4-dichlorophenol is transformed to 2-chlorophenol or 4-chlorophenol then to phenol, or to phenol directly.
International Nuclear Information System (INIS)
Yang Ji; Cao Limei; Guo Rui; Jia Jinping
2010-01-01
Granular activated carbon was modified with dimethyl dichlorosilane to improve its surface hydrophobicity, and therefore to improve the performance of permeable reactive barrier constructed with the modified granular activated carbon and elemental iron. X-ray photoelectron spectroscopy shows that the surface silicon concentration of the modified granular activated carbon is higher than that of the original one, leading to the increased surface hydrophobicity. Although the specific surface area decreased from 895 to 835 m 2 g -1 , the modified granular activated carbon could adsorb 20% more 2,4-dichlorophenol than the original one did in water. It is also proven that the permeable reactive barrier with the modified granular activated carbon is more efficient at 2,4-dichlorophenol dechlorination, in which process 2,4-dichlorophenol is transformed to 2-chlorophenol or 4-chlorophenol then to phenol, or to phenol directly.
Energy Technology Data Exchange (ETDEWEB)
Gill, Lance [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Beste, Ariana [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Joint Institute for Computational Sciences (JIBS); Univ. of Tennessee, Knoxville, TN (United States); Chen, Banghao [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Li, Meijun [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Mann, Amanda K. P. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Overbury, Steven H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Hagaman, Edward W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division
2017-03-22
1H nuclear magnetic resonance (NMR) spectroscopy was used to study hydroxylic surface species on ceria nanocubes, a crystalline, high-surface-area CeO2 that presents mostly (100) facets. Water adsorption and desorption experiments in combination with fast magic angle spinning (MAS, 20–40 kHz) 1H NMR provide high-resolution 1H spectra that allow the observation of ten resonance bands (water or hydroxyl) on or under the (100) surface. Assignments were made using a combination of adsorption and temperature-programmed desorption, quantitative spin counting, deuterium exchange, spin–lattice (T1) and spin–spin (T2) relaxation, and DFT calculations. In air, the (100) surface exists as a fully hydroxylated surface. Water adsorption and dissociation on dry ceria surfaces occur first at oxygen vacancies, but Ce3+ centers are not required since water dissociation is barrier-less on the fully oxidized surface. Surface $-$OH functionality occurs in two resolved bands representing isolated $-$OH (1 ppm) and hydrogen-bonded $-$OH (9 ppm), the latter being dominant. Deuterium exchange of surface hydroxyls with D2O does not occur under mild or forcing conditions. Despite large differences in the T1 of surface hydroxyls and physisorbed water, surface hydroxyl T1 values are independent of the presence or absence of physisorbed water, demonstrating that the protons within these two functional group pools are not in intimate contact. These observations show that, once hydroxylated, the surface $-$OH functionality preferentially forms hydrogen bonds with surface lattice oxygen, i.e., the hydroxylated (100) surface of ceria is hydrophobic. Near this surface it is energetically more favorable for physisorbed water to hydrogen bond to itself rather than to the surface. DFT calculations support this notion. Impurity Na+ remaining in incompletely washed ceria nanocubes
Surface pre-treatment for barrier coatings on polyethylene terephthalate
Bahre, H.; Bahroun, K.; Behm, H.; Steves, S.; Awakowicz, P.; Böke, M.; Hopmann, Ch; Winter, J.
2013-02-01
Polymers have favourable properties such as light weight, flexibility and transparency. Consequently, this makes them suitable for food packaging, organic light-emitting diodes and flexible solar cells. Nonetheless, raw plastics do not possess sufficient barrier functionality against oxygen and water vapour, which is of paramount importance for most applications. A widespread solution is to deposit thin silicon oxide layers using plasma processes. However, silicon oxide layers do not always fulfil the requirements concerning adhesion and barrier performance when deposited on films. Thus, plasma pre-treatment is often necessary. To analyse the influence of a plasma-based pre-treatment on barrier performance, different plasma pre-treatments on three reactor setups were applied to a very smooth polyethylene terephthalate film before depositing a silicon oxide barrier layer. In this paper, the influence of oxygen and argon plasma pre-treatments towards the barrier performance is discussed examining the chemical and topological change of the film. It was observed that a short one-to-ten-second plasma treatment can reduce the oxygen transmission rate by a factor of five. The surface chemistry and the surface topography change significantly for these short treatment times, leading to an increased surface energy. The surface roughness rises slowly due to the development of small spots in the nanometre range. For very long treatment times, surface roughness of the order of the barrier layer's thickness results in a complete loss of barrier properties. During plasma pre-treatment, the trade-off between surface activation and roughening of the surface has to be carefully considered.
Surface pre-treatment for barrier coatings on polyethylene terephthalate
International Nuclear Information System (INIS)
Bahre, H; Böke, M; Winter, J; Bahroun, K; Behm, H; Hopmann, Ch; Steves, S; Awakowicz, P
2013-01-01
Polymers have favourable properties such as light weight, flexibility and transparency. Consequently, this makes them suitable for food packaging, organic light-emitting diodes and flexible solar cells. Nonetheless, raw plastics do not possess sufficient barrier functionality against oxygen and water vapour, which is of paramount importance for most applications. A widespread solution is to deposit thin silicon oxide layers using plasma processes. However, silicon oxide layers do not always fulfil the requirements concerning adhesion and barrier performance when deposited on films. Thus, plasma pre-treatment is often necessary. To analyse the influence of a plasma-based pre-treatment on barrier performance, different plasma pre-treatments on three reactor setups were applied to a very smooth polyethylene terephthalate film before depositing a silicon oxide barrier layer. In this paper, the influence of oxygen and argon plasma pre-treatments towards the barrier performance is discussed examining the chemical and topological change of the film. It was observed that a short one-to-ten-second plasma treatment can reduce the oxygen transmission rate by a factor of five. The surface chemistry and the surface topography change significantly for these short treatment times, leading to an increased surface energy. The surface roughness rises slowly due to the development of small spots in the nanometre range. For very long treatment times, surface roughness of the order of the barrier layer's thickness results in a complete loss of barrier properties. During plasma pre-treatment, the trade-off between surface activation and roughening of the surface has to be carefully considered. (paper)
Azhoni, Adani; Holman, Ian; Jude, Simon
2016-04-01
Research on adaptation barriers is gaining increasing prominence as the need for climate change adaptation becomes evident. This research seeks to identify and understand the reasons for key barriers preventing water institutions in the mountainous Himalayan state of Himachal Pradesh in northern India from adapting to climate change. Semi-structured interviews were carried out in January & February 2015 with representatives from twenty-seven key governmental, academic, NGO and commercial institutions in the State, with responsibilities spanning from municipal water supply to irrigation and hydropower generation in addition to environmental conservation. Empirical analysis of the transcripts found that inadequate knowledge capacity, poor implementation of policies, inadequate resources, normative work culture, weak governance, unavailability and inaccessibility of data & information and limited inter-institutional networks are key barriers for adaptation. Although these generic barriers are similar to those reported elsewhere in literature, they are identified as having locally-contextual root causes. For example, the inadequate resources are identified to be occurring as a consequence of the fragmentation of resources allocation among others. This is due to competing developmental priorities and the desire of the political leadership to please the maximum number of electors rather than the more-usual inadequate budgetary allocation and climate scepticism. The identified individual barriers are found to be highly inter-dependent and closely intertwined which enables the identification of leverage points of interventions that can maximise removal of barriers. For example, breaking down key barriers for data and information accessibility will have to involve normative attitudinal change, through sensitisation of the larger picture of the role of accurate and accessible data; changes in working style involving moving from paper-based data management to digital; and
Rotational Spectrum and Internal Rotation Barrier of 1-Chloro-1,1-difluoroethane
Alonso, José L.; López, Juan C.; Blanco, Susana; Guarnieri, Antonio
1997-03-01
The rotational spectra of 1-chloro-1,1-difluoroethane (HCFC-142b) has been investigated in the frequency region 8-115 GHz with Stark, waveguide Fourier transform (FTMW), and millimeter-wave spectrometers. Assignments in large frequency regions with the corresponding frequency measurements have been made for the ground andv18= 1 (CH3torsion) vibrational states of the35Cl isotopomer and for the ground state of the37Cl species. Accurate rotational, quartic centrifugal distortion, and quadrupole coupling constants have been determined from global fits considering all these states. SmallA-Einternal rotation splittings have been observed for thev18= 1 vibrational state using FTMW spectroscopy. The barrier height for the internal rotation of the methyl group has been determined to be 3751 (4) cal mol-1, in disagreement with the previous microwave value of 4400 (100) cal mol-1reported by G. Graner and C. Thomas [J. Chem. Phys.49,4160-4167 (1968)].
Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha
2018-01-02
Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.
Energy Technology Data Exchange (ETDEWEB)
Quiroz V, V. E.; Lopez C, R.; Rodriguez M, B. G.; Pena E, R.; Mercado C, A.; Valencia A, R.; Hernandez A, A. N.; Barocio, S. R.; Munoz C, A. E. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); De la Piedad B, A., E-mail: regulo.lopez@inin.gob.mx [Instituto Tecnologico de Toluca, Av. Tecnologico s/n, Ex-Rancho La Virgen, 52140 Metepec, Estado de Mexico (Mexico)
2013-07-01
The design and instrumentation intended for ATTC8739 Escherichia coli (E. coli) bacteria elimination in water, based on non thermal plasma generation at room pressure have been carried out by means of dielectric pulsed discharges. The latter have been produced by a power supply capable of providing voltages up to the order of 45 kV, 1-500 {mu}s pulse widths and variable frequencies between 100 Hz to 2000 Hz. This supply feeds a coaxial discharge reactor of the simple dielectric barrier type. The adequate operation of the system has been tested with the elimination of E. coli at 10{sup 4} and 10{sup 6} bacteria/ml concentrations, leading to reductions up to 85.3% and 95.1%, respectively, during the first 30 min of treatment. (Author)
Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies
Directory of Open Access Journals (Sweden)
Singh Varinderjit
2015-01-01
Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.
Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.
McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L
2014-04-01
This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.
Portella, Guillem; Pohl, Peter; de Groot, Bert L
2007-06-01
We investigated the structural and energetic determinants underlying water permeation through peptidic nanopores, motivated by recent experimental findings that indicate that water mobility in single-file water channels displays nonlinear length dependence. To address the molecular mechanism determining the observed length dependence, we studied water permeability in a series of designed gramicidin-like channels of different length using atomistic molecular dynamics simulations. We found that within the studied range of length the osmotic water permeability is independent of pore length. This result is at variance with textbook models, where the relationship is assumed to be linear. Energetic analysis shows that loss of solvation rather than specific water binding sites in the pore form the main energetic barrier for water permeation, consistent with our dynamics results. For this situation, we propose a modified expression for osmotic permeability that fully takes into account water motion collectivity and does not depend on the pore length. Different schematic barrier profiles are discussed that explain both experimental and computational interpretations, and we propose a set of experiments aimed at validation of the presented results. Implications of the results for the design of peptidic channels with desired permeation characteristics are discussed.
Hanford Site Protective Barrier Development Program: Fiscal year 1990 highlights
International Nuclear Information System (INIS)
Cadwell, L.L.
1991-09-01
The Hanford Site Protective Barrier Development Program was jointly developed by Pacific Northwest Laboratory (PNL) and Westinghouse Hanford Company (WHC) to design and test an earthen cover system(s) that can be used to inhibit water infiltration; plant, animal, and human intrusion; and wind and water erosion. The joint PNL/WHC program was initiated in FY 1986. To date, research findings support the initial concepts of barrier designs for the Hanford Site. A fine-soil surface is planned to partition surface water into runoff and temporary storage. Transpiration by vegetation that grows in the fine-soil layer will return stored water to the atmosphere as will surface evaporation. A capillary break created by the interface of the fine-soil layer and coarser textured materials below will further limit the downward migration of surface water, making it available over a longer period of time for cycling to the atmosphere. Should water pass the interface, it will drain laterally through a coarse textured sand/gravel layer. Tested barrier designs appear to work adequately to prevent drainage under current and postulated wetter-climate (added precipitation) conditions. Wind and water erosion tasks are developing data to predict the extent of erosion on barrier surfaces. Data collected during the last year confirm the effectiveness of small burrowing animals in removing surface water. Water infiltrating through burrows of larger mammals was subsequently lost by natural processes. Natural analog and climate change studies are under way to provide credibility for modeling the performance of barrier designs over a long period of time and under shifts in climate. 10 refs., 30 figs
Hanford Site Protective Barrier Development Program: Fiscal year 1990 highlights
Energy Technology Data Exchange (ETDEWEB)
Cadwell, L.L. (ed.)
1991-09-01
The Hanford Site Protective Barrier Development Program was jointly developed by Pacific Northwest Laboratory (PNL) and Westinghouse Hanford Company (WHC) to design and test an earthen cover system(s) that can be used to inhibit water infiltration; plant, animal, and human intrusion; and wind and water erosion. The joint PNL/WHC program was initiated in FY 1986. To date, research findings support the initial concepts of barrier designs for the Hanford Site. A fine-soil surface is planned to partition surface water into runoff and temporary storage. Transpiration by vegetation that grows in the fine-soil layer will return stored water to the atmosphere as will surface evaporation. A capillary break created by the interface of the fine-soil layer and coarser textured materials below will further limit the downward migration of surface water, making it available over a longer period of time for cycling to the atmosphere. Should water pass the interface, it will drain laterally through a coarse textured sand/gravel layer. Tested barrier designs appear to work adequately to prevent drainage under current and postulated wetter-climate (added precipitation) conditions. Wind and water erosion tasks are developing data to predict the extent of erosion on barrier surfaces. Data collected during the last year confirm the effectiveness of small burrowing animals in removing surface water. Water infiltrating through burrows of larger mammals was subsequently lost by natural processes. Natural analog and climate change studies are under way to provide credibility for modeling the performance of barrier designs over a long period of time and under shifts in climate. 10 refs., 30 figs.
Scientific investigation plan for initial engineered barrier system field tests
International Nuclear Information System (INIS)
Wunan Lin.
1993-02-01
The purpose of this Scientific Investigation Plan (SIP) is to describe tests known as Initial Engineered Barrier System Field Tests (IEBSFT) and identified by Work Breakdown Structure as WBS 1.2.2.2.4. The IEBSFT are precursors to the Engineered Barrier System Field Test (EBSFT), WBS 1.2.2.2.4, to be conducted in the Exploratory Study Facility (ESF) at Yucca Mountain. The EBSFT and IEBSFT are designed to provide information on the interaction between waste packages (simulated by heated containers) and the surrounding rock mass, its vadose water, and infiltrated water. Heater assemblies will be installed in drifts or boreholes openings and heated to measure moisture movement during heat-up and subsequent cool-down of the rock mass. In some of the tests, infiltration of water into the heated rock mass will be studied. Throughout the heating and cooling cycle, instruments installed in the rock will monitor such parameters as temperature, moisture content, concentration of some chemical species, and stress and strain. Rock permeability measurements, rock and fluid (water and gas) sampling, and fracture pattern measurements will also be made before and after the test
Alteration of intestinal barrier function during activity-based anorexia in mice.
Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse
2014-12-01
Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
International Nuclear Information System (INIS)
Au-Yang, M.K.; Brenneman, B.; Raj, D.
1995-01-01
A 1:9 scale model of a proposed advanced water reactor was tested for flow-induced vibration. The main objectives of this test were: (1) to derive an empirical equation for the turbulence forcing function which can be applied to the full-sized prototype; (2) to study the effect of viscosity on the turbulence; (3) to verify the ''superposition'' assumption widely used in dynamic analysis of weakly coupled fluid-shell systems; and (4) to measure the shell responses to verify methods and computer programs used in the flow-induced vibration analysis of the prototype. This paper describes objectives (1), (2), and (3); objective (4) will be discussed in a companion paper.The turbulence-induced fluctuating pressure was measured at 49 locations over the surface of a thick-walled, non-responsive scale model of the reactor vessel/core support cylinders. An empirical equation relating the fluctuating pressure, the frequency, and the distance from the inlet nozzle center line was derived to fit the test data. This equation involves only non-dimensional, fluid mechanical parameters that are postulated to represent the full-sized, geometrically similar prototype. While this postulate cannot be verified until similar measurements are taken on the full-sized unit, a similar approach using a 1:6 scale model of a commercial pressurized water reactor was verified in the mid-1970s by field measurements on the full-sized reactor. (orig.)
Hanford Permanent Isolation Barrier Program: Asphalt technology test plan
Energy Technology Data Exchange (ETDEWEB)
Freeman, H.D.; Romine, R.A.
1994-05-01
The Hanford Permanent Isolation Barriers use engineered layers of natural materials to create an integrated structure with backup protective features. The objective of current designs is to develop a maintenance-free permanent barrier that isolates wastes for a minimum of 1000 years by limiting water drainage to near-zero amounts. Asphalt is being used as an impermeable water diversion layer to provide a redundant layer within the overall barrier design. Data on asphalt barrier properties in a buried environment are not available for the required 100-year time frame. The purpose of this test plan is to outline the activities planned to obtain data with which to estimate performance of the asphalt layers.
Hanford Permanent Isolation Barrier Program: Asphalt technology test plan
International Nuclear Information System (INIS)
Freeman, H.D.; Romine, R.A.
1994-05-01
The Hanford Permanent Isolation Barriers use engineered layers of natural materials to create an integrated structure with backup protective features. The objective of current designs is to develop a maintenance-free permanent barrier that isolates wastes for a minimum of 1000 years by limiting water drainage to near-zero amounts. Asphalt is being used as an impermeable water diversion layer to provide a redundant layer within the overall barrier design. Data on asphalt barrier properties in a buried environment are not available for the required 100-year time frame. The purpose of this test plan is to outline the activities planned to obtain data with which to estimate performance of the asphalt layers
Model assessment of protective barriers: Part 4, Status of FY 1992 work
International Nuclear Information System (INIS)
Fayer, M.J.
1993-03-01
Protective barriers are being considered for use at the Hanford Site to enhance the isolation of radioactive wastes from water, plant, and animal intrusion. This study is part of an ongoing effort to assess the effectiveness of protective barriers for isolation of wastes from water. Part I of this study was the original modeling assessment by Pacific Northwest Laboratory of various protective barrier designs (e.g., soil type, vegetation). In Part 11 of this study, additional barrier designs were reviewed and several barrier modeling assumptions were tested. A test plan was then produced that detailed the requirement for hydrologic modeling of protective barriers. Part III of this study summarized the status of work in FY 1990 dealing with two-dimensional flow beneath the barrier and with validation testing using lysimeter data. This report (Part IV) addresses the application of a calibrated model to a much longer data set, the application of the calibrated model to a lysimeter that received a different treatment, and the effect of hysteresis on the behavior of water in the protective barrier
The Barrier code for predicting long-term concrete performance
International Nuclear Information System (INIS)
Shuman, R.; Rogers, V.C.; Shaw, R.A.
1989-01-01
There are numerous features incorporated into a LLW disposal facility that deal directly with critical safety objectives required by the NRC in 10 CFR 61. Engineered barriers or structures incorporating concrete are commonly being considered for waste disposal facilities. The Barrier computer code calculates the long-term degradation of concrete structures in LLW disposal facilities. It couples this degradation with water infiltration into the facility, nuclide leaching from the waste, contaminated water release from the facility, and associated doses to members of the critical population group. The concrete degradation methodology of Barrier is described
A Tracer Test to Characterize Treatment of TCE in a Permeable Reactive Barrier
A tracer test was conducted to characterize the flow of ground water surrounding a permeable reactive barrier constructed with plant mulch (a biowall) at the OU-1 site on Altus Air Force Base, Oklahoma. This biowall is intended to intercept and treat ground water contaminated by ...
The blood-brain barrier in migraine treatment
DEFF Research Database (Denmark)
Edvinsson, L; Tfelt-Hansen, P
2008-01-01
Salient aspects of the anatomy and function of the blood-barrier barrier (BBB) are reviewed in relation to migraine pathophysiology and treatment. The main function of the BBB is to limit the access of circulating substances to the neuropile. Smaller lipophilic substances have some access...
Lo, Hsi-wen; Tai, Yu-Chong
2007-01-01
We present a simple method to characterize parylene as a water barrier for soaking tests. The key component is the buried-in pentacene moisture sensor, which is a thin-film transistor sandwiched between two layers of parylene C. This pentacene thin-film transistor takes bottom contact configuration and uses parylene C as the gate dielectric material. Parylene films containing pentacene moisture sensors are soaked in saline at room temperature and the saturation drain curr...
Directory of Open Access Journals (Sweden)
Ran Wei
2018-05-01
Full Text Available To solve the drawbacks of poor dispersion and weak interface in gas barrier nanocomposites, a novel epoxy-diamine adduct (DDA was synthesized by reacting epoxy monomer DGEBA with curing agent D400 to functionalize montmorillonite (MMT, which could provide complete compatibility and reactivity with a DGEBA/D400 epoxy matrix. Thereafter, sodium type montmorillonite (Na-MMT and organic-MMTs functionalized by DDA and polyether amines were incorporated with epoxy to manufacture nanocomposites. The effects of MMT functionalization on the morphology and gas barrier property of nanocomposites were evaluated. The results showed that DDA was successfully synthesized, terminating with epoxy and amine groups. By simulating the small-angle neutron scattering data with a sandwich structure model, the optimal dispersion/exfoliation of MMT was observed in a DDA-MMT/DGEBA nanocomposite with a mean radius of 751 Å, a layer thickness of 30.8 Å, and only two layers in each tactoid. Moreover, the DDA-MMT/DGEBA nanocomposite exhibited the best N2 barrier properties, which were about five times those of neat epoxy. Based on a modified Nielsen model, it was clarified that this excellent gas barrier property was due to the homogeneously dispersed lamellas with almost exfoliated structures. The improved morphology and barrier property confirmed the superiority of the adduct, which provides a general method for developing gas barrier nanocomposites.
Hanford prototype-barrier status report: FY 1995
International Nuclear Information System (INIS)
Gee, G.W.; Ward, A.L.; Gilmore, B.G.; Ligotke, M.W.; Link, S.O.
1995-11-01
Surface barriers (or covers) have been proposed for use at the Hanford Site as a means to isolate certain waste sites that, for reasons of cost or worker safety or both, may not be exhumed. Surface barriers are intende to isolated the wastes from the accessible environment and to provide long-term protection to future populations that might use the Hanford Site. Currently, no ''proven'' long-term barrier system is available. For this reason, the Hanford Site Permanent Isolation Surface-Barrier Development Program (BDP) was organized to develop the technology needed to provide long-term surface barrier capability for the Hanford Site for the US Department of Energy (DOE). Designs have been proposed to meet the most stringent needs for long-term waste disposal. The objective of the current barrier design is to use natural materials to develop a protective barrier system that isolates wastes for at least 1000 years by limiting water, plant, animal, and human intrusion; and minimizing erosion. The design criteria for water drainage has been set at 0.5 mm/yr. While other design criteria are more qualitative, it is clear that waste isolation for an extended time is the prime objective of the design. Constructibility and performance. are issues that can be tested and dealt with by evaluating prototype designs prior to extensive construction and deployment of covers for waste sites at Hanford
Miselis, Jennifer L.; Andrews, Brian D.; Nicholson, Robert S.; Defne, Zafer; Ganju, Neil K.; Navoy, Anthony S.
2016-01-01
Assessments of coupled barrier island-estuary storm response are rare. Hurricane Sandy made landfall during an investigation in Barnegat Bay-Little Egg Harbor estuary that included water quality monitoring, geomorphologic characterization, and numerical modeling; this provided an opportunity to characterize the storm response of the barrier island-estuary system. Barrier island morphologic response was characterized by significant changes in shoreline position, dune elevation, and beach volume; morphologic changes within the estuary were less dramatic with a net gain of only 200,000 m3 of sediment. When observed, estuarine deposition was adjacent to the back-barrier shoreline or collocated with maximum estuary depths. Estuarine sedimentologic changes correlated well with bed shear stresses derived from numerically simulated storm conditions, suggesting that change is linked to winnowing from elevated storm-related wave-current interactions rather than deposition. Rapid storm-related changes in estuarine water level, turbidity, and salinity were coincident with minima in island and estuarine widths, which may have influenced the location of two barrier island breaches. Barrier-estuary connectivity, or the transport of sediment from barrier island to estuary, was influenced by barrier island land use and width. Coupled assessments like this one provide critical information about storm-related coastal and estuarine sediment transport that may not be evident from investigations that consider only one component of the coastal system.
Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery
Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.
2010-01-01
Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044
Water erosion field tests for Hanford protective barriers: FY 1992 status report
International Nuclear Information System (INIS)
Gilmore, B.G.; Walters, W.H.
1993-11-01
Pacific Northwest Laboratory (PNL) conducted this study for the Office of Technology Development and the Office of Environmental Restoration of the US Department of Energy. The purpose of the study was to investigate the erosion potential of barrier soil covers from high-intensity rainfall events and to propose erosion mitigation criteria for the soil cover. Two sets of field plots were used in the testing program. Small plots (1 m 2 ) were used initially for scoping studies and larger plots (32.5 m 2 ) were used for a more comprehensive study of soil cover erosion. The study investigated the use of pea gravel admix and naturally established vegetation to reduce erosion of barrier soil covers
Myosin light chain kinase mediates intestinal barrier disruption following burn injury.
Directory of Open Access Journals (Sweden)
Chuanli Chen
Full Text Available BACKGROUND: Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC phosphorylation mediated by MLC kinase (MLCK is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. METHODOLOGY/PRINCIPAL FINDINGS: Male balb/c mice were assigned randomly to either sham burn (control or 30% total body surface area (TBSA full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg, an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. CONCLUSIONS/SIGNIFICANCE: The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury.
105K West Isolation Barrier Acceptance Test results
International Nuclear Information System (INIS)
McCracken, K.J.; Irwin, J.J.
1995-01-01
The objective of this document is to report and interpret the findings of the isolation barrier acceptance tests performed in 105KW/100K. The tests were performed in accordance with the test plan and acceptance test procedure. The test report contains the test data. This document compares the test data against the criteria. A discussion of the leak rate analytical characterization describes how the flow characteristics flow rate will be determined using the test data from the test report. Two modes of water loss were considered; basin and/or discharge chute leakage, and evaporation. An initial test established baseline leakage data and instrumentation performance. Test 2 evaluated the sealing performance of the isolation barrier by inducing an 11 in. (27.9 cm) level differential across the barrier. The leak rate at this 11 in. (27.9 cm) level is extrapolated to the 16 ft. (4.9 m) level differential postulated in the DBE post seismic event. If the leak rate, adjusted for evaporation and basin leakage (determined from Test 1), is less than the SAR limit of 1,500 gph (5,680 lph) at a 16 ft (4.9 m) level differential, the barriers pass the acceptance test
Energy Technology Data Exchange (ETDEWEB)
Hijosa-Valsero, María, E-mail: mhijv@unileon.es [Instituto de Diagnóstico Ambiental y Estudios del Agua (IDAEA), CID, CSIC, C/Jordi Girona 18-26, E-08034 Barcelona (Spain); Molina, Ricardo, E-mail: ricardo.molina@cid.csic.es [Instituto de Química Avanzada de Cataluña (IQAC), CID, CSIC, C/Jordi Girona 18-26, E-08034 Barcelona (Spain); Schikora, Hendrik, E-mail: hendrik.schikora@igb.fraunhofer.de [Fraunhofer IGB, Nobelstraße 12, 70569 Stuttgart (Germany); Müller, Michael, E-mail: michael.mueller@igb.fraunhofer.de [Fraunhofer IGB, Nobelstraße 12, 70569 Stuttgart (Germany); Bayona, Josep M., E-mail: josep.bayona@cid.csic.es [Instituto de Diagnóstico Ambiental y Estudios del Agua (IDAEA), CID, CSIC, C/Jordi Girona 18-26, E-08034 Barcelona (Spain)
2013-11-15
Highlights: • DBD plasma reactors were used to remove pollutants from aqueous solutions. • Atrazine, chlorfenvinfos, 2,4-dibromophenol and lindane were studied. • First-order degradation kinetics were observed for all the compounds. • Degradation by-products were identified by GC–MS. • Treatment efficiencies were lower in industrial wastewater than in pure water. -- Abstract: Two different nonthermal plasma reactors at atmospheric pressure were assessed for the removal of organic micropollutants (atrazine, chlorfenvinfos, 2,4-dibromophenol, and lindane) from aqueous solutions (1–5 mg L{sup −1}) at laboratory scale. Both devices were dielectric barrier discharge (DBD) reactors; one was a conventional batch reactor (R1) and the other a coaxial thin-falling-water-film reactor (R2). A first-order degradation kinetics was proposed for both experiments. The kinetic constants (k) were slightly faster in R1 (0.534 min{sup −1} for atrazine; 0.567 min{sup −1} for chlorfenvinfos; 0.802 min{sup −1} for 2,4-dibromophenol; 0.389 min{sup −1} for lindane) than in R2 (0.104 min{sup −1} for atrazine; 0.523 min{sup −1} for chlorfenvinfos; 0.273 min{sup −1} for 2,4-dibromophenol; 0.294 min{sup −1} for lindane). However, energy efficiencies were about one order of magnitude higher in R2 (89 mg kW{sup −1} h{sup −1} for atrazine; 447 mg kW{sup −1} h{sup −1} for chlorfenvinfos; 47 mg kW{sup −1} h{sup −1} for 2,4-dibromophenol; 50 mg kW{sup −1} h{sup −1} for lindane) than in R1. Degradation by-products of all four compounds were identified in R1. As expected, when the plasma treatment (R1) was applied to industrial wastewater spiked with atrazine or lindane, micropollutant removal was also achieved, although at a lower rate than with aqueous solutions (k = 0.117 min{sup −1} for atrazine; k = 0.061 min{sup −1} for lindane)
The development of permanent isolation surface barriers: Hanford Site, Richland, Washington, U.S.A
International Nuclear Information System (INIS)
Wing, N.R.; Gee, G.W.
1993-01-01
Permanent isolation surface barriers are being developed to isolate wastes disposed of in situ (in place) at the US Department of Energy's Hanford Site in Washington State (USA). The current focus of development efforts is to design barriers that will function in a semiarid to subhumid climate, Emit infiltration and percolation of water through the waste zone to near-zero amounts, be maintenance free, and last up to 1000 years or more. A series of field tests, experiments, and lysimeter studies have been conducted for several years. The results of tests to date confirm that the Hanford barrier concepts are valid for both present and wetter climatic conditions. The data collected also have provided the foundation for the design of a large prototype barrier to be constructed later in 1993. This paper presents the results of some of the field tests, experiments, and lysimeter studies
Bentonite. Geotechnical barrier and source for microbial life
International Nuclear Information System (INIS)
Matschiavelli, Nicole; Kluge, Sindy; Cherkouk, Andrea; Steglich, Jennifer
2017-01-01
Due to their properties, namely a high swelling capacity and a low hydraulic conductivity, Bentonites fulfil as geotechnical barrier a sealing and buffering function in the nuclear waste repository. Depending on the mineral composition Bentonites contain many suitable electron-donors and -acceptors, enabling potential microbial life. For the potential repository of highly radioactive waste the microbial mediated transformation of Bentonite could influence its properties as a barrier material. Microcosms were set up containing Bentonite and anaerobic synthetic Opalinus-clay-pore water solution under an N_2/CO_2-atmosphere to elucidate the microbial potential within selected Bentonites. Substrates like acetate and lactate were supplemented to stimulate potential microbial activity. First results show that bentonites represent a source for microbial life, demonstrated by the consumption of lactate and the formation of pyruvate. Furthermore, microbial iron-reduction was determined, which plays a crucial role in Betonite-transformation.
Bentonite. Geotechnical barrier and source for microbial life
Energy Technology Data Exchange (ETDEWEB)
Matschiavelli, Nicole; Kluge, Sindy; Cherkouk, Andrea [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). HZDR Young Investigator Group; Steglich, Jennifer
2017-06-01
Due to their properties, namely a high swelling capacity and a low hydraulic conductivity, Bentonites fulfil as geotechnical barrier a sealing and buffering function in the nuclear waste repository. Depending on the mineral composition Bentonites contain many suitable electron-donors and -acceptors, enabling potential microbial life. For the potential repository of highly radioactive waste the microbial mediated transformation of Bentonite could influence its properties as a barrier material. Microcosms were set up containing Bentonite and anaerobic synthetic Opalinus-clay-pore water solution under an N{sub 2}/CO{sub 2}-atmosphere to elucidate the microbial potential within selected Bentonites. Substrates like acetate and lactate were supplemented to stimulate potential microbial activity. First results show that bentonites represent a source for microbial life, demonstrated by the consumption of lactate and the formation of pyruvate. Furthermore, microbial iron-reduction was determined, which plays a crucial role in Betonite-transformation.
International Nuclear Information System (INIS)
Verna, B.J.
1993-01-01
This article deals with problems associated with a thermal barrier material called Thermo-Lag 330. Typically in nuclear applications this material is used to provide either 1 hour (1/2 inch thick) or 3 hour (1 inch thick) barriers to prevent the spread of fires between redundant safety systems, and to protect cable trays and conduit. The article reviews concerns within the nuclear industry as to the proper handling of the material, how to interpret the data available on the material, the apparant conflicting assessments of the material when tested by different groups, etc. Research is ongoing on the suitability of the material, but the article points out that the manufacturer feels it should be installed by properly trained installers, the joints sealed with a grouting material, properly bundled to maintain its integrity, have a complete stress skin, and not be walked on after installation in order to function properly
International Nuclear Information System (INIS)
Squier, C.A.; Hall, B.K.
1985-01-01
The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material
Homoepitaxial graphene tunnel barriers for spin transport (Presentation Recording)
Friedman, Adam L.
2015-09-01
Tunnel barriers are key elements for both charge-and spin-based electronics, offering devices with reduced power consumption and new paradigms for information processing. Such devices require mating dissimilar materials, raising issues of heteroepitaxy, interface stability, and electronic states that severely complicate fabrication and compromise performance. Graphene is the perfect tunnel barrier. It is an insulator out-of-plane, possesses a defect-free, linear habit, and is impervious to interdiffusion. Nonetheless, true tunneling between two stacked graphene layers is not possible in environmental conditions (magnetic field, temperature, etc.) usable for electronics applications. However, two stacked graphene layers can be decoupled using chemical functionalization. Here, we demonstrate homoepitaxial tunnel barrier devices in which graphene serves as both the tunnel barrier and the high mobility transport channel. Beginning with multilayer graphene, we fluorinate or hydrogenate the top layer to decouple it from the bottom layer, so that it serves as a single monolayer tunnel barrier for both charge and spin injection into the lower graphene transport channel. We demonstrate successful tunneling by measuring non-linear IV curves, and a weakly temperature dependent zero bias resistance. We perform lateral transport of spin currents in non-local spin-valve structures and determine spin lifetimes with the non-local Hanle effect to be commensurate with previous studies (~200 ps). However, we also demonstrate the highest spin polarization efficiencies (~45%) yet measured in graphene-based spin devices [1]. [1] A.L. Friedman, et al., Homoepitaxial tunnel barriers with functionalized graphene-on-graphene for charge and spin transport, Nat. Comm. 5, 3161 (2014).
Systems study on engineered barriers: barrier performance analysis
International Nuclear Information System (INIS)
Stula, R.T.; Albert, T.E.; Kirstein, B.E.; Lester, D.H.
1980-09-01
A performance assessment model for multiple barrier packages containing unreprocessed spent fuel has been modified and applied to several package designs. The objective of the study was to develop information to be used in programmatic decision making concerning engineered barrier package design and development. The assessment model, BARIER, was developed in previous tasks of the System Study on Engineered Barriers (SSEB). The new version discussed in this report contains a refined and expanded corrosion rate data base which includes pitting, crack growth, and graphitization as well as bulk corrosion. Corrosion rates for oxic and anoxic conditions at each of the two temperature ranges are supplied. Other improvements include a rigorous treatment of radionuclide release after package failure which includes resistance of damaged barriers and backfill, refined temperature calculations that account for convection and radiation, a subroutine to calculate nuclear gamma radiation field at each barrier surface, refined stress calculations with reduced conservatism and various coding improvements to improve running time and core usage. This report also contains discussion of alternative scenarios to the assumed flooded repository as well as the impact of water exclusion backfills. The model was used to assess post repository closure performance for several designs which were all variation of basic designs from the Spent Unreprocessed Fuel (SURF) program. Many designs were found to delay the onset of leaching by at least a few hundreds of years in all geologic media. Long delay times for radionuclide release were found for packages with a few inches of sorption backfill. Release of uranium, plutonium, and americium was assessed
Systems study on engineered barriers: barrier performance analysis
Energy Technology Data Exchange (ETDEWEB)
Stula, R.T.; Albert, T.E.; Kirstein, B.E.; Lester, D.H.
1980-09-01
A performance assessment model for multiple barrier packages containing unreprocessed spent fuel has been modified and applied to several package designs. The objective of the study was to develop information to be used in programmatic decision making concerning engineered barrier package design and development. The assessment model, BARIER, was developed in previous tasks of the System Study on Engineered Barriers (SSEB). The new version discussed in this report contains a refined and expanded corrosion rate data base which includes pitting, crack growth, and graphitization as well as bulk corrosion. Corrosion rates for oxic and anoxic conditions at each of the two temperature ranges are supplied. Other improvements include a rigorous treatment of radionuclide release after package failure which includes resistance of damaged barriers and backfill, refined temperature calculations that account for convection and radiation, a subroutine to calculate nuclear gamma radiation field at each barrier surface, refined stress calculations with reduced conservatism and various coding improvements to improve running time and core usage. This report also contains discussion of alternative scenarios to the assumed flooded repository as well as the impact of water exclusion backfills. The model was used to assess post repository closure performance for several designs which were all variation of basic designs from the Spent Unreprocessed Fuel (SURF) program. Many designs were found to delay the onset of leaching by at least a few hundreds of years in all geologic media. Long delay times for radionuclide release were found for packages with a few inches of sorption backfill. Release of uranium, plutonium, and americium was assessed.
Yang, Ji; Cao, Limei; Guo, Rui; Jia, Jinping
2010-12-15
Granular activated carbon was modified with dimethyl dichlorosilane to improve its surface hydrophobicity, and therefore to improve the performance of permeable reactive barrier constructed with the modified granular activated carbon and elemental iron. X-ray photoelectron spectroscopy shows that the surface silicon concentration of the modified granular activated carbon is higher than that of the original one, leading to the increased surface hydrophobicity. Although the specific surface area decreased from 895 to 835 m(2)g(-1), the modified granular activated carbon could adsorb 20% more 2,4-dichlorophenol than the original one did in water. It is also proven that the permeable reactive barrier with the modified granular activated carbon is more efficient at 2,4-dichlorophenol dechlorination, in which process 2,4-dichlorophenol is transformed to 2-chlorophenol or 4-chlorophenol then to phenol, or to phenol directly. Copyright © 2010 Elsevier B.V. All rights reserved.
Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.
Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee
2017-08-01
Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rantakokko, Merja; Törmäkangas, Timo; Rantanen, Taina; Haak, Maria; Iwarsson, Susanne
2013-08-28
Environmental barriers are associated with disability-related outcomes in older people but little is known of the effect of environmental barriers on mortality. The aim of this study was to examine whether objectively measured barriers in the outdoor, entrance and indoor environments are associated with mortality among community-dwelling 80- to 89-year-old single-living people. This longitudinal study is based on a sample of 397 people who were single-living in ordinary housing in Sweden. Participants were interviewed during 2002-2003, and 393 were followed up for mortality until May 15, 2012.Environmental barriers and functional limitations were assessed with the Housing Enabler instrument, which is intended for objective assessments of Person-Environment (P-E) fit problems in housing and the immediate outdoor environment. Mortality data were gathered from the public national register. Cox regression models were used for the analyses. A total of 264 (67%) participants died during follow-up. Functional limitations increased mortality risk. Among the specific environmental barriers that generate the most P-E fit problems, lack of handrails in stairs at entrances was associated with the highest mortality risk (adjusted RR 1.55, 95% CI 1.14-2.10), whereas the total number of environmental barriers at entrances and outdoors was not associated with mortality. A higher number of environmental barriers indoors showed a slight protective effect against mortality even after adjustment for functional limitations (RR 0.98, 95% CI 0.96-1.00). Specific environmental problems may increase mortality risk among very-old single-living people. However, the association may be confounded by individuals' health status which is difficult to fully control for. Further studies are called for.
Treatment of barrier evolution: the SKB perspective
International Nuclear Information System (INIS)
Hedin, A.
2002-01-01
This paper serves as a point of departure for the discussions to be held within the Working Group of Technical Topic entitled 'Barriers and System Performances within a safety case: Their functioning and Evolution with Time'. The paper gives the SKB perspective of the issues to be discussed within the Working Group for this Topic. The following issues to be discussed by the Working Group are: What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? What is the requested or required performance versus the expected or realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? What is the issue associated with the geosphere stability for different geological systems? How is barriers and system performances as a function of time evaluated (and presented and communicated) in a safety case? What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)
Infiltration barrier demonstration at Maxey Flats, Kentucky
International Nuclear Information System (INIS)
Mills, D.; Razor, J.
1983-01-01
At the 1982 DOE LLWMP meeting, the Kentucky Natural Resources and Environmental Protection Cabinet presented a history of the Maxey Flats Waste Disposal Facility, its status, and current Commonwealth activities leading toward stabilization and decommissioning. Information was presented at that time on the purpose of the DOE Trench Moisture Barrier Demonstration Grant and the early phases of construction and implementation. In this paper, final construction and implementation of the trench moisture barrier demonstration are discussed. Data including trench water level measurements, lateral liquid flow in experimental sections, and soil moisture measurements are presented and discussed. The Paper is completed with a brief discussion of remediation activities currently being implemented at Maxey Flats. 9 references, 7 figures, 1 table
International Nuclear Information System (INIS)
Petersen, K.L.; Chatters, J.C.; Waugh, W.J.
1992-07-01
The Hanford Site Permanent Isolation Barrier Development Program (Barrier Development Program) was organized to develop the technology needed to provide an in-place disposal capability for the Hanford Site (Adams and Wing 1986; Wig and Gee 1990). The goal of the Barrier Development Program is to provide defensible evidence that final barrier design(s) will adequately control water infiltration; plant and animal intrusion; and wind and water erosion for a minimum of 1,000 yr and isolate wastes from the accessible environment and warm inadvertent human intruders using markers. This document describes the long-term climate change studies planned to support the Barrier Development Program. The plan outlines a multi-year and multi-discipline approach to assess long-term climate change issues and to help optimize the design of the permanent isolation barriers. A multi-disciplinary approach to climatic data acquisition will be responsible for obtaining needed information for concurrent barrier tasks and for developing a local climate forecast model. This model will couple past climate patterns with models of regional and global climate drivers to provide bounding conditions for barrier performance assessment analyses
Directory of Open Access Journals (Sweden)
Hyosun Jang
2018-01-01
Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.
18 CFR Table 1 to Part 301 - Functionalization and Escalation Codes
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Functionalization and Escalation Codes 1 Table 1 to Part 301 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS FOR FEDERAL POWER MARKETING ADMINISTRATIONS AVERAGE SYSTEM COST...
CSIR Research Space (South Africa)
Angelstam, P
2017-05-01
Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...
Synthesis and properties of amino acid functionalized water-soluble perylene diimides
Energy Technology Data Exchange (ETDEWEB)
Ma, Yongshan; Li, Xuemei; Wei, Xiaofeng; Jiang, Tianyi; Wu, Junsen; Ren, Huixue [Shandong Jianzhu University, Jinan (China)
2015-07-15
We prepared amino acid functionalized water-soluble perylene diimides: N,N'-bi(L-glutamic acid)-perylene-3,4;9,10-dicarboxylic diimide (1), N,N'-bi(L-phenylalanine acid)-perylene-3,4;9,10-dicarboxylic diimide (2), N,N'-bi(Lglutamic amine)-perylene-3,4;9,10-dicarboxylic diimide (3) and N,N'-bi(L-phenylalanine amine)-perylene-3,4;9,10-dicarboxylic diimide (4). The structures of 3 and 4 were confirmed by {sup 1}H NMR, FT-IR and MS. The maximal absorption bands of compound 1 and 2 in concentrated sulfuric acid were red-shifted for about 48 and 74 nm, respectively, compared with that of Perylene-3,4,9,10-tetracarboxylic acid dianhydride (PTCDA). Nearly no fluorescence was observed for compounds 1 and 2 in water, while compounds 3 and 4 were significantly water-soluble and had very high fluorescent quantum. The mechanism of the optical properties change was discussed, and the π-π stacking caused by H{sup +} led to the changes of fluorescence spectrum and absorption spectrum. The calculated molecular orbital energies and the frontier molecular orbital maps of compounds 1-2 based on density function theory (DFT) calculations were reported. Owing to the high water-soluble, the perylene derivatives 3 and 4 were successfully applied as high-performance fluorochromes for living hela cells imaging.
Composite of microgels and lipids as biofilm to restore skin barrier function
Oudshoorn, M.H.M.
2008-01-01
The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential
Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.
Mitragotri, Samir
2013-01-01
Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.
Sudhakaran, Sairam; Maeng, Sungkyu; Amy, Gary L.
2013-01-01
). With the depletion of water resources and high demand for power and chemical usage, efforts need to be made to judiciously use advanced treatment processes. There is a new interest in multiple barriers with synergies in which two coupled processes can function as a
DEFF Research Database (Denmark)
Christensen, Pernille M; Liu, Catherine H; Swendeman, Steven L
2016-01-01
Apolipoprotein M (ApoM) transports sphingosine-1-phosphate (S1P) in plasma, and ApoM-deficient mice (Apom(-/-)) have ∼50% reduced plasma S1P levels. There are 5 known S1P receptors, and S1P induces adherens junction formation between endothelial cells through the S1P1 receptor, which in turn...... suppresses vascular leak. Increased vascular permeability is a hallmark of inflammation. The purpose of this study was to explore the relationships between vascular leakage in ApoM deficiency and S1P1 function in normal physiology and in inflammation. Vascular permeability in the lungs was assessed...... by accumulation of dextran molecules (70 kDa) and was increased ∼40% in Apom(-/-) mice compared to WT (C57Bl6/j) mice. Reconstitution of plasma ApoM/S1P or treatment with an S1P1 receptor agonist (SEW2871) rapidly reversed the vascular leakage to a level similar to that in WT mice, suggesting that it is caused...
Energy Technology Data Exchange (ETDEWEB)
Xie, Jiazhuo; Zhang, Kun; Zhao, Qinghua [College of Chemistry and Material Science, Shandong Agricultural University, 61 Daizong Street, Tai' an 271018 (China); Wang, Qingguo, E-mail: wqgyyy@126.com [College of Food Science and Engineering, Shandong Agricultural University, 61 Daizong Street, Tai' an 271018 (China); Xu, Jing, E-mail: jiaxu@sdau.edu.cn [College of Chemistry and Material Science, Shandong Agricultural University, 61 Daizong Street, Tai' an 271018 (China)
2016-11-15
Novel LDH intercalated with organic aliphatic long-chain anion was large-scale synthesized innovatively by high-energy ball milling in one pot. The linear low density polyethylene (LLDPE)/layered double hydroxides (LDH) composite films with enhanced heat retention, thermal, mechanical, optical and water vapor barrier properties were fabricated by melt blending and blowing process. FT IR, XRD, SEM results show that LDH particles were dispersed uniformly in the LLDPE composite films. Particularly, LLDPE composite film with 1% LDH exhibited the optimal performance among all the composite films with a 60.36% enhancement in the water vapor barrier property and a 45.73 °C increase in the temperature of maximum mass loss rate compared with pure LLDPE film. Furthermore, the improved infrared absorbance (1180–914 cm{sup −1}) of LLDPE/LDH films revealed the significant enhancement of heat retention. Therefore, this study prompts the application of LLDPE/LDH films as agricultural films with superior heat retention. - Graphical abstract: The fabrication process of LLDPE/LDH composite films. - Highlights: • LDH with basal spacing of 4.07 nm was synthesized by high-energy ball milling. • LLDPE composite films with homogeneous LDH dispersion were fabricated. • The properties of LLDPE/LDH composite films were improved. • LLDPE/LDH composite films show superior heat retention property.
International Nuclear Information System (INIS)
Xie, Jiazhuo; Zhang, Kun; Zhao, Qinghua; Wang, Qingguo; Xu, Jing
2016-01-01
Novel LDH intercalated with organic aliphatic long-chain anion was large-scale synthesized innovatively by high-energy ball milling in one pot. The linear low density polyethylene (LLDPE)/layered double hydroxides (LDH) composite films with enhanced heat retention, thermal, mechanical, optical and water vapor barrier properties were fabricated by melt blending and blowing process. FT IR, XRD, SEM results show that LDH particles were dispersed uniformly in the LLDPE composite films. Particularly, LLDPE composite film with 1% LDH exhibited the optimal performance among all the composite films with a 60.36% enhancement in the water vapor barrier property and a 45.73 °C increase in the temperature of maximum mass loss rate compared with pure LLDPE film. Furthermore, the improved infrared absorbance (1180–914 cm −1 ) of LLDPE/LDH films revealed the significant enhancement of heat retention. Therefore, this study prompts the application of LLDPE/LDH films as agricultural films with superior heat retention. - Graphical abstract: The fabrication process of LLDPE/LDH composite films. - Highlights: • LDH with basal spacing of 4.07 nm was synthesized by high-energy ball milling. • LLDPE composite films with homogeneous LDH dispersion were fabricated. • The properties of LLDPE/LDH composite films were improved. • LLDPE/LDH composite films show superior heat retention property.
International Nuclear Information System (INIS)
Gaus, I.
2015-01-01
The radioactive materials have a wide range of applications ranging from nuclear reactors to the use of isotopes in industries, medicine or research centres. These technologies generate waste whose disposal systems are becoming more sophisticated, to the point of using artificial barriers able to isolate them from contact with other materials, precipitation, surface water and groundwater subsurface. In this context, the European project long term Performance of the engineered Barrier Systems (PeBS), funded by the seventh framework (Fp7) Euratom and has counted with the participation of ENRESA, reviewed the evolution of the performance of sealing and barrier systems of artificial barriers in relevant time scales through the development of a comprehensive method that includes experiments, models, and a consideration of the potential impacts of long-term security functions. (Author)
International Nuclear Information System (INIS)
Fuller, J.L.; Wolford, J.
2001-01-01
Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense
Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.
Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti
2016-01-01
Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.
Heteren, S. van
2015-01-01
Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change
Chandran, Kumar; Hampton, Karla E.; Hecht, Kenneth; Grumbach, Jacob M.; Kimura, Amanda T.; Braff-Guajardo, Ellen; Brindis, Claire D.
2012-01-01
Introduction Recent legislation requires schools to provide free drinking water in food service areas (FSAs). Our objective was to describe access to water at baseline and student water intake in school FSAs and to examine barriers to and strategies for implementation of drinking water requirements. Methods We randomly sampled 24 California Bay Area public schools. We interviewed 1 administrator per school to assess knowledge of water legislation and barriers to and ideas for policy implementation. We observed water access and students’ intake of free water in school FSAs. Wellness policies were examined for language about water in FSAs. Results Fourteen of 24 schools offered free water in FSAs; 10 offered water via fountains, and 4 provided water through a nonfountain source. Four percent of students drank free water at lunch; intake at elementary schools (11%) was higher than at middle or junior high schools (6%) and high schools (1%). In secondary schools when water was provided by a nonfountain source, the percentage of students who drank free water doubled. Barriers to implementation of water requirements included lack of knowledge of legislation, cost, and other pressing academic concerns. No wellness policies included language about water in FSAs. Conclusion Approximately half of schools offered free water in FSAs before implementation of drinking water requirements, and most met requirements through a fountain. Only 1 in 25 students drank free water in FSAs. Although schools can meet regulations through installation of fountains, more appealing water delivery systems may be necessary to increase students’ water intake at mealtimes. PMID:22765930
Teeples, Ronald; Glyer, David
1987-05-01
Both policy and technical analysis of water delivery systems have been based on cost functions that are inconsistent with or are incomplete representations of the neoclassical production functions of economics. We present a full-featured production function model of water delivery which can be estimated from a multiproduct, dual cost function. The model features implicit prices for own-water inputs and is implemented as a jointly estimated system of input share equations and a translog cost function. Likelihood ratio tests are performed showing that a minimally constrained, full-featured production function is a necessary specification of the water delivery operations in our sample. This, plus the model's highly efficient and economically correct parameter estimates, confirms the usefulness of a production function approach to modeling the economic activities of water delivery systems.
Nuhu, Abdulmumin A; Basheer, Chanbasha; Abu-Thabit, Nedal Y; Alhooshani, Khalid; Al-Arfaj, Abdul Rahman
2011-12-15
In this study, functionalized polysulfone membrane has been utilized as a sorbent for the extraction of chlorinated hydrocarbons (CHCs) in water samples. Two different functionalized polysulfones (i) phosphonic acid functionalized polysulfone (PPSU-A) with different forms (cross-linked and non cross-linked) membranes and (ii) phosphonic ester functionalized polysulfone (PPSU-E) with different forms (cross-linked and non cross-linked) were evaluated for the extraction of CHCs in water. A 10 ml of spiked water sample was extracted with 50mg piece of the functionalized membrane. After extraction, the membrane was desorbed by organic solvent and the extract was analyzed by gas chromatography-mass spectrometry. Eight CHCs, 1,3,5-trichlorobenzene (1,3,5-TCB), 1,2,3-trichlorobenzene (1,2,3-TCB), 1,1,2,3,4,4-hexachloro-1,3-butadiene (HCBD), 1,2,4-trichloro-3-methylbenzene (TCMB), 1,2,3,4-tetrachlorobenzene (1,2,3,4-TeCB), 1,2,4,5-tetrachlorobenzene (1,2,4,5-TeCB), pentachlorobenzene (PeCB) and hexachlorobenzene (HCB) were used as model compounds. Experimental parameters such as extraction time, desorption time, types of polymer membrane as well the nature of desorption solvent were optimized. Using optimum extraction conditions calibration curves were linear with coefficients of determination between 0.9954 and 0.9999 over wide range of concentrations (0.05-100 μgl(-1)). The method detection limits (at a signal-to-noise ratio of 3) were in the range of 0.4-3.9 ng l(-1). The proposed method was evaluated for the determination of CHCs in drinking water samples. Copyright © 2011 Elsevier B.V. All rights reserved.
A framework for understanding semi-permeable barrier effects on migratory ungulates
Sawyer, Hall; Kauffman, Matthew J.; Middleton, Arthur D.; Morrison, Thomas A.; Nielson, Ryan M.; Wyckoff, Teal B.
2013-01-01
1. Impermeable barriers to migration can greatly constrain the set of possible routes and ranges used by migrating animals. For ungulates, however, many forms of development are semi-permeable, and making informed management decisions about their potential impacts to the persistence of migration routes is difficult because our knowledge of how semi-permeable barriers affect migratory behaviour and function is limited. 2. Here, we propose a general framework to advance the understanding of barrier effects on ungulate migration by emphasizing the need to (i) quantify potential barriers in terms that allow behavioural thresholds to be considered, (ii) identify and measure behavioural responses to semi-permeable barriers and (iii) consider the functional attributes of the migratory landscape (e.g. stopovers) and how the benefits of migration might be reduced by behavioural changes. 3. We used global position system (GPS) data collected from two subpopulations of mule deer Odocoileus hemionus to evaluate how different levels of gas development influenced migratory behaviour, including movement rates and stopover use at the individual level, and intensity of use and width of migration route at the population level. We then characterized the functional landscape of migration routes as either stopover habitat or movement corridors and examined how the observed behavioural changes affected the functionality of the migration route in terms of stopover use. 4. We found migratory behaviour to vary with development intensity. Our results suggest that mule deer can migrate through moderate levels of development without any noticeable effects on migratory behaviour. However, in areas with more intensive development, animals often detoured from established routes, increased their rate of movement and reduced stopover use, while the overall use and width of migration routes decreased. 5. Synthesis and applications. In contrast to impermeable barriers that impede animal movement
Scherrer, Dominik; Schilling, Mauro; Luber, Sandra; Fox, Thomas; Spingler, Bernhard; Alberto, Roger; Richmond, Craig J
2016-12-06
Two ruthenium complexes containing the tetradentate ligand [1,1'-biisoquinoline]-3,3'-dicarboxylic acid, and 4-picoline or 6-bromoisoquinoline as axial ligands have been prepared. The complexes have been fully characterised and initial studies on their potential to function as molecular water oxidation catalysts have been performed. Both complexes catalyse the oxidation of water in acidic media with Ce IV as a stoichiometric chemical oxidant, although turnover numbers and turnover frequencies are modest when compared with the closely related Ru-bda and Ru-pda analogues. Barriers for the water nucleophilic attack and intermolecular coupling pathways were obtained from density functional theory calculations and the crucial influence of the ligand framework in determining the most favourable reaction pathway was elucidated from a combined analysis of the theoretical and experimental results.
Energy Technology Data Exchange (ETDEWEB)
Cummins, K.W.; Klug, M.J.
1976-07-01
Progress is reported on the following research projects: characterization of functional groups of running water organisms, particularly macroconsumers; studies on relationship of functional groups to qualitative and quantitative characteristics of organic inputs to stream ecosystems; studies on relationship of functional groups to thermal regimes; and dimensioning the control of feeding and growth by temperature and food quality and quantity and determining the extent of compensatory action of each. (HLW)
Energy Technology Data Exchange (ETDEWEB)
1968-05-06
This floating barrier consists of relatively long elements which can be connected to form a practically continuous assembly. Each element consists of an inflatable tube with an apron of certain height, made of impregnated fabric which is resistant to ocean water and also to hydrocarbons. Means for connecting one element to the following one, and means for attaching ballast to the apron are also provided.
The effect of desiccation on UMTRA Project radon barrier materials
International Nuclear Information System (INIS)
1990-11-01
The proposed US Environmental Protection Agency (EPA) groundwater standards (40 CFR 192) require that Uranium Mill Tailings Remedial Action (UMTRA) Project remedial action designs meet low numerical limits for contaminants contained in water or vapors exiting the disposal cell embankments. To meet the standards, a cover of compacted, fine-grained soil is placed over UMTRA Project embankments. One of the functions of this cover is to limit infiltration into the disposal cell . The hydraulic conductivity of this infiltration barrier must be low in order to reduce the resultant seepage from the base of the cell to the extent necessary to comply with the proposed EPA groundwater standards. Another function of this cover is to limit the emission of radon gas. The air permeability of the cover must be low in order to reduce radon emissions to comply with EPA standards. Fine-grained soils exposed to evaporation will dry. Continued exposure will cause shrinking that, if allowed to continue, will eventually result in the development of cracks. The results of the cracking could be an increase in the hydraulic conductivity and an increase in the air permeability. This could then allow additional infiltration and increased radon emissions. Cracking of the radon barrier has been noted at one UMTRA Project location. The potential for cracking of the radon barrier during construction has been addressed by requiring moistening of previously compacted surfaces prior to placing additional lifts. The efficacy of these treatments has not been verified. The potential for cracking after construction of the cover is completed has also not been examined. The purpose of this study is to evaluate the potential for cracking of the radon barrier both during construction and after completion of the cover. The effect of shrinkage cracking on the performance of the radon barrier will also be examined
K West basin isolation barrier leak rate test
International Nuclear Information System (INIS)
Whitehurst, R.; McCracken, K.; Papenfuss, J.N.
1994-01-01
This document establishes the procedure for performing the acceptance test on the two isolation barriers being installed in K West basin. This acceptance test procedure shall be used to: First establish a basin water loss rate prior to installation of the two isolation barriers between the main basin and the discharge chute in K-Basin West. Second, perform an acceptance test to verify an acceptable leakage rate through the barrier seals
Regulatory analysis for the use of underground barriers at the Hanford Site tank farms
International Nuclear Information System (INIS)
Hampsten, K.L.
1994-01-01
Sixty-seven of the single-shell tanks at the Hanford Site, Richland, Washington, are assumed to have leaked in the past. Some of the waste retrieval options being considered, such as past-practice sluicing (a process that uses hot water to dislodge waste for subsequent removal by pumping), have the potential for increasing releases of dangerous waste from these tanks. Underground barrier systems are being evaluated as a method to mitigate releases of tank waste to the soil and groundwater that may occur during retrieval activities. The following underground barrier system options are among those being evaluated to determine whether their construction at the Single-Shell Tank Farms is viable. (1) A desiccant barrier would be created by circulating air through the subsurface soil to lower and then maintain the water saturation below the levels required for liquids to flow. (2) An injected materials barrier would be created by injecting materials such as grout or silica into the subsurface soils to form a barrier around and under a given tank or tank farm. (3) A cryogenic barrier would be created by freezing subsurface soils in the vicinity of a tank or tank farm. An analysis is provided of the major regulatory requirements that may impact full scale construction and operation of an underground barrier system and a discussion of factors that should be considered throughout the barrier selection process, irrespective of the type of underground barrier system being considered. However, specific barrier systems will be identified when a given regulation will have significant impact on a particular type of barrier technology. Appendix A provides a matrix of requirements applicable to construction and operation of an underground barrier system
Structural barriers to coping with Type 1 Diabetes Mellitus in Ghana ...
African Journals Online (AJOL)
Structural barriers to coping with Type 1 Diabetes Mellitus in Ghana: Experiences of diabetic youth and their families. ... Methods: Qualitative study conducted with families with a child with T1DM, receiving care in the greater Accra area. Total of 17 individuals ... Social support networks need to be explored and strengthened.
Permeability Barrier Generation in the Martian Lithosphere
Schools, Joe; Montési, Laurent
2015-11-01
Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability
DEFF Research Database (Denmark)
Lykke, Kasper; Assentoft, Mette; Hørlyck, Sofie
2018-01-01
The blood-brain barrier (BBB) is involved in brain water and salt homeostasis. Blood osmolarity increases during dehydration and water is osmotically extracted from the brain. The loss of water is less than expected from pure osmotic forces, due to brain electrolyte accumulation. Although...... dehydration, we employed a tight in vitro co-culture BBB model with primary cultures of brain endothelial cells and astrocytes. The Na+/K+-ATPase and the NKCC1 were both functionally dominant in the abluminal membrane. Exposure of the in vitro BBB model to conditions mimicking systemic dehydration, i...... isozymes. Abluminally expressed endothelial Na+/K+-ATPase, and not NKCC1, may therefore counteract osmotic brain water loss during systemic dehydration by promoting brain Na+ accumulation....
Permeable bio-reactive barriers for hydrocarbon remediation in Antarctica
Energy Technology Data Exchange (ETDEWEB)
Mumford, K.A.; Stevens, G.W.; Gore, D.B. [Melbourne Univ., Victoria (Australia). Dept. of Chemical and Biomoleculuar Engineering, Particulate Fluids Processing Centre; Snape, I.; Rayner, J.L. [Australian Antarctic Div., Kingston, Tasmania (Australia); Gore, D.B. [Macquarie Univ., Sydney, NSW (Australia). Dept. of Environmental Science
2010-07-01
This study assessed the performance of a permeable bio-reactive barrier designed to treat contaminated water. The bio-reactive barrier was installed at a fuel spill site located in the Windmill Islands, Antarctica. A funnel and gate design was used to prevent contaminant migration beyond the barrier location as well as to ensure controlled nutrient delivery. The study also investigated the performance of the bio-reactive barrier in regions with freeze-thaw conditions. The 4-year project was also conducted to assess optimal conditions for enhancing the barrier's ability to degrade hydrocarbons.
The effects of river run-off on water clarity across the central Great Barrier Reef.
Fabricius, K E; Logan, M; Weeks, S; Brodie, J
2014-07-15
Changes in water clarity across the shallow continental shelf of the central Great Barrier Reef were investigated from ten years of daily river load, oceanographic and MODIS-Aqua data. Mean photic depth (i.e., the depth of 10% of surface irradiance) was related to river loads after statistical removal of wave and tidal effects. Across the ∼25,000 km(2) area, photic depth was strongly related to river freshwater and phosphorus loads (R(2)=0.65 and 0.51, respectively). In the six wetter years, photic depth was reduced by 19.8% and below water quality guidelines for 156 days, compared to 9 days in the drier years. After onset of the seasonal river floods, photic depth was reduced for on average 6-8 months, gradually returning to clearer baseline values. Relationships were strongest inshore and midshelf (∼12-80 km from the coast), and weaker near the chronically turbid coast. The data show that reductions in river loads would measurably improve shelf water clarity, with significant ecosystem health benefits. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kozulin, E. M.
2009-01-01
The subbarrier fusion enhancement in reactions with heavy ions were explained by taking into account coupling between relative motion and intrinsic degrees of freedom of interacting nuclei. The coupling of reaction channels manifests itself in the potential barrier between interacting nuclei giving rise to a distribution of fusion barrier instead of single barrier.Capture and quasi-elastic scattering excitation functions at backward angles were measured for 3 6S , 4 8C a, 6 4N i+2 38U reactions systems at energies close and below the Coulomb barrier (i.e. when the influence of the shell effects on the fusion and characteristics of the decay of the composite system is considerable). Representations of the barrier distributions were extracted from both capture and quasi-elastic data. The experimental representations of barrier distributions were compared with coupled-channel calculations using CCFULL code. The major part of these experiments has been performed at the U-400 accelerator of the Flerov Laboratory of Nuclear Reactions (JINR, Dubna); at the TANDEM-ALPI accelerator of the LNL (INFN, Legnaro, Italy) and at the Accelerator Laboratory of University of Jyvaeskylae (JYFL, Finland) using a time-of-flight spectrometer of fission fragments CORSET (CORrelation SET-up.) The extraction of the masses and Total Kinetic Energy (TKE) of the binary reaction products is based upon the analysis of the two-body velocity In the case of the fusion-fission and quasi-fission processes, the observed peculiarities of mass and energy distributions of the fragments, the ratio between the fusion-fission and quasi-fission cross sections are determined deformations of interaction nuclei and angular momentum carried in the di-nuclear system and the shell structure of the formed fragments. In this work, the high-precision capture and quasi-elastic scattering excitation function data are presented.The influence of projectile and target excitations and nucleon transfer on fusion barrier
Guilfoyle, Shanna M; Goebel, Jens W; Pai, Ahna L H
2011-03-01
The alarming rates of medication nonadherence and its detrimental effect on long-term graft survival in pediatric kidney transplantation has called attention to identifying modifiable factors that promote better adherence and subsequent transplant outcomes. In a sample of 45 adolescent kidney transplant recipients (14.7 ± 3.3 years, 77.8% Caucasian, 39.5% female) and their primary caregivers, study aims included: 1) identifying sociodemographic and medical correlates of both caregiver- and patient-reported general family functioning (i.e., efficacy, flexibility, and communication) and 2) determining the unique contributions of these family functioning indices to perceived posttransplant adherence barriers. During a routine clinic visit, caregivers completed a sociodemographic form and questionnaire on general family functioning. Both caregivers and the adolescents completed a measure on perceived medication adherence barriers. Data identified household income and family structure as persistent correlates of family functioning. Familial efficacy and flexibility contributed significant variance to perceived adherence barriers. Family-based interventions enhancing modifiable family factors, such as flexibility and efficacy, in overcoming medication adherence barriers would likely promote more optimal health outcomes in the pediatric kidney transplant population. (c) 2011 APA, all rights reserved
Barrier properties of cultured retinal pigment epithelium.
Rizzolo, Lawrence J
2014-09-01
The principal function of an epithelium is to form a dynamic barrier that regulates movement between body compartments. Each epithelium is specialized with barrier functions that are specific for the tissues it serves. The apical surface commonly faces a lumen, but the retinal pigment epithelium (RPE) appears to be unique by a facing solid tissue, the sensory retina. Nonetheless, there exists a thin (subretinal) space that can become fluid filled during pathology. RPE separates the subretinal space from the blood supply of the outer retina, thereby forming the outer blood-retinal barrier. The intricate interaction between the RPE and sensory retina presents challenges for learning how accurately culture models reflect native behavior. The challenge is heightened by findings that detail the variation of RPE barrier proteins both among species and at different stages of the life cycle. Among the striking differences is the expression of claudin family members. Claudins are the tight junction proteins that regulate ion diffusion across the spaces that lie between the cells of a monolayer. Claudin expression by RPE varies with species and life-stage, which implies functional differences among commonly used animal models. Investigators have turned to transcriptomics to supplement functional studies when comparing native and cultured tissue. The most detailed studies of the outer blood-retinal barrier have focused on human RPE with transcriptome and functional studies reported for human fetal, adult, and stem-cell derived RPE. Copyright © 2014 Elsevier Ltd. All rights reserved.
Del Bigio, Marc R; Slobodian, Ili; Schellenberg, Angela E; Buist, Richard J; Kemp-Buors, Tanya L
2011-08-11
Hydrocephalus is associated with enlargement of cerebral ventricles. We hypothesized that magnetic resonance (MR) imaging parameters known to be influenced by tissue water content would change in parallel with ventricle size in young rats and that changes in blood-brain barrier (BBB) permeability would be detected. Hydrocephalus was induced by injection of kaolin into the cisterna magna of 4-week-old rats, which were studied 1 or 3 weeks later. MR was used to measure longitudinal and transverse relaxation times (T1 and T2) and apparent diffusion coefficients in several regions. Brain tissue water content was measured by the wet-dry weight method, and tissue density was measured in Percoll gradient columns. BBB permeability was measured by quantitative imaging of changes on T1-weighted images following injection of gadolinium diethylenetriamine penta-acetate (Gd-DTPA) tracer and microscopically by detection of fluorescent dextran conjugates. In nonhydrocephalic rats, water content decreased progressively from age 3 to 7 weeks. T1 and T2 and apparent diffusion coefficients did not exhibit parallel changes and there was no evidence of BBB permeability to tracers. The cerebral ventricles enlarged progressively in the weeks following kaolin injection. In hydrocephalic rats, the dorsal cortex was more dense and the white matter less so, indicating that the increased water content was largely confined to white matter. Hydrocephalus was associated with transient elevation of T1 in gray and white matter and persistent elevation of T2 in white matter. Changes in the apparent diffusion coefficients were significant only in white matter. Ventricle size correlated significantly with dorsal water content, T1, T2, and apparent diffusion coefficients. MR imaging showed evidence of Gd-DTPA leakage in periventricular tissue foci but not diffusely. These correlated with microscopic leak of larger dextran tracers. MR characteristics cannot be used as direct surrogates for water
Directory of Open Access Journals (Sweden)
Del Bigio Marc R
2011-08-01
Full Text Available Abstract Background Hydrocephalus is associated with enlargement of cerebral ventricles. We hypothesized that magnetic resonance (MR imaging parameters known to be influenced by tissue water content would change in parallel with ventricle size in young rats and that changes in blood-brain barrier (BBB permeability would be detected. Methods Hydrocephalus was induced by injection of kaolin into the cisterna magna of 4-week-old rats, which were studied 1 or 3 weeks later. MR was used to measure longitudinal and transverse relaxation times (T1 and T2 and apparent diffusion coefficients in several regions. Brain tissue water content was measured by the wet-dry weight method, and tissue density was measured in Percoll gradient columns. BBB permeability was measured by quantitative imaging of changes on T1-weighted images following injection of gadolinium diethylenetriamine penta-acetate (Gd-DTPA tracer and microscopically by detection of fluorescent dextran conjugates. Results In nonhydrocephalic rats, water content decreased progressively from age 3 to 7 weeks. T1 and T2 and apparent diffusion coefficients did not exhibit parallel changes and there was no evidence of BBB permeability to tracers. The cerebral ventricles enlarged progressively in the weeks following kaolin injection. In hydrocephalic rats, the dorsal cortex was more dense and the white matter less so, indicating that the increased water content was largely confined to white matter. Hydrocephalus was associated with transient elevation of T1 in gray and white matter and persistent elevation of T2 in white matter. Changes in the apparent diffusion coefficients were significant only in white matter. Ventricle size correlated significantly with dorsal water content, T1, T2, and apparent diffusion coefficients. MR imaging showed evidence of Gd-DTPA leakage in periventricular tissue foci but not diffusely. These correlated with microscopic leak of larger dextran tracers. Conclusions MR
ESKIMO1 disruption in Arabidopsis alters vascular tissue and impairs water transport.
Directory of Open Access Journals (Sweden)
Valérie Lefebvre
Full Text Available Water economy in agricultural practices is an issue that is being addressed through studies aimed at understanding both plant water-use efficiency (WUE, i.e. biomass produced per water consumed, and responses to water shortage. In the model species Arabidopsis thaliana, the ESKIMO1 (ESK1 gene has been described as involved in freezing, cold and salt tolerance as well as in water economy: esk1 mutants have very low evapo-transpiration rates and high water-use efficiency. In order to establish ESK1 function, detailed characterization of esk1 mutants has been carried out. The stress hormone ABA (abscisic acid was present at high levels in esk1 compared to wild type, nevertheless, the weak water loss of esk1 was independent of stomata closure through ABA biosynthesis, as combining mutant in this pathway with esk1 led to additive phenotypes. Measurement of root hydraulic conductivity suggests that the esk1 vegetative apparatus suffers water deficit due to a defect in water transport. ESK1 promoter-driven reporter gene expression was observed in xylem and fibers, the vascular tissue responsible for the transport of water and mineral nutrients from the soil to the shoots, via the roots. Moreover, in cross sections of hypocotyls, roots and stems, esk1 xylem vessels were collapsed. Finally, using Fourier-Transform Infrared (FTIR spectroscopy, severe chemical modifications of xylem cell wall composition were highlighted in the esk1 mutants. Taken together our findings show that ESK1 is necessary for the production of functional xylem vessels, through its implication in the laying down of secondary cell wall components.
Water response to ganglioside GM1 surface remodelling.
Brocca, P; Rondelli, V; Mallamace, F; Di Bari, M T; Deriu, A; Lohstroh, W; Del Favero, E; Corti, M; Cantu', L
2017-01-01
Gangliosides are biological glycolipids participating in rafts, structural and functional domains of cell membranes. Their headgroups are able to assume different conformations when packed on the surface of an aggregate, more lying or standing. Switching between different conformations is possible, and is a collective event. Switching can be induced, in model systems, by concentration or temperature increase, then possibly involving ganglioside-water interaction. In the present paper, the effect of GM1 ganglioside headgroup conformation on the water structuring and interactions is addressed. Depolarized Rayleigh Scattering, Raman Scattering, Quasielastic Neutron Scattering and NMR measurements were performed on GM1 ganglioside solutions, focusing on solvent properties. All used techniques agree in evidencing differences in the structure and dynamics of solvent water on different time-and-length scales in the presence of either GM1 headgroup conformations. In general, all results indicate that both the structural properties of solvent water and its interactions with the sugar headgroups of GM1 respond to surface remodelling. The extent of this modification is much higher than expected and, interestingly, ganglioside headgroups seem to turn from cosmotropes to chaotropes upon collective rearrangement from the standing- to the lying-conformation. In a biological perspective, water structure modulation could be one of the physico-chemical elements contributing to the raft strategy, both for rafts formation and persistence and for their functional aspects. In particular, the interaction with approaching bodies could be favoured or inhibited or triggered by complex-sugar-sequence conformational switch. This article is part of a Special Issue entitled "Science for Life" Guest Editor: Dr. Austen Angell, Dr. Salvatore Magazù and Dr. Federica Migliardo. Copyright © 2016 Elsevier B.V. All rights reserved.
Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia
2016-03-15
Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.
Experimental methods and transport models for drug delivery across the blood-brain barrier.
Fu, Bingmei M
2012-06-01
The blood-brain barrier (BBB) is a dynamic barrier essential for maintaining the micro-environment of the brain. Although the special anatomical features of the BBB determine its protective role for the central nervous system (CNS) from blood-born neurotoxins, however, the BBB extremely limits the therapeutic efficacy of drugs into the CNS, which greatly hinders the treatment of major brain diseases. This review summarized the unique structures of the BBB, described a variety of in vivo and in vitro experimental methods for determining the transport properties of the BBB, e.g., the permeability of the BBB to water, ions, and solutes including nutrients, therapeutic agents and drug carriers, and presented newly developed mathematical models which quantitatively correlate the anatomical structures of the BBB with its barrier functions. Finally, on the basis of the experimental observations and the quantitative models, several strategies for drug delivery through the BBB were proposed.
Large-scale field testing on flexible shallow landslide barriers
Bugnion, Louis; Volkwein, Axel; Wendeler, Corinna; Roth, Andrea
2010-05-01
the thickness of the failure layer and the width of the possible failure are essential for the required barrier design parameter height and width. First results of the calculated drag coefficients of dynamic impact pressure measurements showed that the dynamic coefficient cw is much lower than 1.0 which is contradictory to most of existing dimensioning property protection guidelines. It appears to us that special adaptation to the system like smaller mesh sizes and special ground-barrier interface compared to normal rock-fall barriers and channelised debris flow barriers are necessary to improve the retention behavior of shallow landslide barriers. Detailed analysis of the friction coefficient in relationship with pore water pressure measurements gives interesting insights into the dynamic of fluid-solid mixed flows. Impact pressures dependencies on flow features are analyzed and discussed with respect to existing models and guidelines for shallow landslides.
Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van
2015-01-01
Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual
DEFF Research Database (Denmark)
Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana
2006-01-01
most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...
Blood-CNS Barrier Impairment in ALS Patients versus an Animal Model
Directory of Open Access Journals (Sweden)
Svitlana eGarbuzova-Davis
2014-02-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a severe neurodegenerative disease with a compli-cated and poorly understood pathogenesis. Recently, alterations in the blood-Central Nervous System barrier (B-CNS-B have been recognized as a key factor possibly aggravating motor neuron damage. The majority of findings on ALS microvascular pathology have been deter-mined in mutant SOD1 rodent models, identifying barrier damage during disease develop-ment which might similarly occur in familial ALS patients carrying the SOD1 mutation. However, our knowledge of B-CNS-B competence in sporadic ALS (SALS has been limited. We recently showed structural and functional impairment in postmortem gray and white mat-ter microvessels of medulla and spinal cord tissue from SALS patients, suggesting pervasive barrier damage. Although numerous signs of barrier impairment (endothelial cell degenera-tion, capillary leakage, perivascular edema, downregulation of tight junction proteins, and microhemorrhages are indicated in both mutant SOD1 animal models of ALS and SALS pa-tients, other pathogenic barrier alterations have as yet only been identified in SALS patients. Pericyte degeneration, perivascular collagen IV expansion, and white matter capillary abnor-malities in SALS patients are significant barrier related pathologies yet to be noted in ALS SOD1 animal models. In the current review, these important differences in blood-CNS barrier damage between ALS patients and animal models, which may signify altered barrier transport mechanisms, are discussed. Understanding discrepancies in barrier condition between ALS patients and animal models may be crucial for developing effective therapies.
Directory of Open Access Journals (Sweden)
Judith Radloff
2017-08-01
Full Text Available The pig represents a preferred model for the analysis of intestinal immunology. However, the barrier of the follicle-associated epithelium (FAE covering porcine Peyer's patches (PP has not yet been characterized in detail. This study aimed to perform this characterization in order to pave the way toward an understanding of the functional contribution of epithelial barrier properties in gut immunology. Porcine tissue specimens were taken from the distal small intestine in order to obtain electrophysiological data of PP FAE and neighboring villous epithelium (VE, employing the Ussing chamber technique. Transepithelial resistance (TER and paracellular fluorescein flux were measured, and tissues were morphometrically compared. In selfsame tissues, expression and localization of major tight junction (TJ proteins (claudin-1, -2, -3, -4, -5, and -8 were analyzed. PP FAE specimens showed a higher TER and a lower apparent permeability for sodium fluorescein than VE. Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. The results are in accordance with the physiological function of the FAE, which strongly regulates and limits antigen uptake determining a mandatory transcellular route for antigen presentation, highlighting the importance of this structure for the first steps of the intestinal immune response. Thus, this study provides detailed insights into the specific barrier properties of the porcine FAE covering intestinal PP, at the interface of intestinal immunology and barriology.
Kim, Yunyoung; Kim, Dong-Min; Kim, Ji Yeon
2017-05-01
The beneficial effects of ginger in the management of gastrointestinal disturbances have been reported. In this study, the anti-inflammatory potential of ginger extract was assessed in a cellular model of gut inflammation. In addition, the effects of ginger extract and its major active compounds on intestinal barrier function were evaluated. The response of Caco-2 cells following exposure to a mixture of inflammatory mediators [interleukin [IL]-1β, 25 ng/mL; lipopolysaccharides [LPS], 10 ng/mL; tumor necrosis factor [TNF]-α, 50 ng/mL; and interferon [INF]-γ, 50 ng/mL] were assessed by measuring the levels of secreted IL-6 and IL-8. In addition, the mRNA levels of cyclooxygenase-2 and inducible nitric oxide synthase were measured. Moreover, the degree of nuclear factor (NF)-κB inhibition was examined, and the intestinal barrier function was determined by measuring the transepithelial electrical resistance (TEER) and fluorescein isothiocyanate (FITC)-dextran transfer. It was observed that ginger extract and its constituents improved inflammatory responses by decreasing the levels of nitrite, PGE2, IL-6, and IL-8 via NF-κB inhibition. The ginger extract also increased the TEER and decreased the transfer of FITC-dextran from the apical side of the epithelium to the basolateral side. Taken together, these results show that ginger extract may be developed as a functional food for the maintenance of gastrointestinal health. © 2017 Institute of Food Technologists®.
McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John
2017-10-01
While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.
Depression Care for the Elderly: Reducing Barriers to Evidence Based Practice
Ell, Kathleen
2006-01-01
This paper provides an overview of five key bodies of evidence identifying: 1) Characteristics of depression among older adults - its prevalence, risk factors and illness course, and impact on functional status, mortality, use of health services, and health care costs; 2) Effective Interventions, including pharmacologic, psychotherapies, care management, and combined intervention models; 3) Known Barriers to depression care including patient, provider and service system barriers; 4) Effective...
Atomic origins of water-vapour-promoted alloy oxidation.
Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K; Baer, Donald R; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M; Xu, Zhijie; Wang, Chongmin
2018-05-07
The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion 1-4 . Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys 5,6 . However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.
An oncological view on the blood-testis barrier
Bart, J; Groen, HJM; van der Graaf, WTA; Hollema, H; Hendrikse, NH; Vaalburg, W; Sleijfer, DT; de Vries, EGE
The function of the blood-testis barrier is to protect germ cells from harmful influences; thus, it also impedes the delivery of chemotherapeutic drugs to the testis. The barrier has three components: first, a physicochemical barrier consisting of continuous capillaries, Sertoli cells in the tubular
Benthic Foraminifera as ecological indicators for water quality on the Great Barrier Reef
Uthicke, Sven; Nobes, Kristie
2008-07-01
Benthic foraminifera are established indicators for Water Quality (WQ) in Florida and the Caribbean. However, nearshore coral reefs of the Great Barrier Reef (GBR) and other Pacific regions are also subjected to increased nutrient and sediment loads. Here, we investigate the use of benthic foraminifera as indicators to assess status and trends of WQ on GBR reefs. We quantified several sediment parameters and the foraminiferan assemblage composition on 20 reefs in four geographic regions of the GBR, and along a water column nutrient and turbidity gradient. Twenty-seven easily recognisable benthic foraminiferan taxa (>63 μm) were distinguished. All four geographic regions differed significantly ( p turbid inner shelf towards clearer outer shelf reefs. A RDA separated symbiotic and aposymbiotic (heterotrophic) taxa. In addition, total suspended solid and water column chlorophyll a concentrations were negatively correlated, and optical depth and distance to the mainland were positively correlated, with the abundance of symbiont-bearing taxa. Several large foraminifera were identified as indicators for offshore, clear water conditions. In contrast, heterotrophic rotaliids and a species retaining plastids ( Elphidium sp.) where highly characteristic for low light, higher nutrient conditions. Application of the FORAM index to GBR assemblage composition showed a significant increase in the value of this index with increased distance from the mainland in the Whitsunday region ( r2 = 0.75, p < 0.001), and therefore with increasing light and decreased nutrient availability. We conclude that it will be possible to apply this index to GBR and possibly other Pacific reefs after some adaptations and additional experimental work on species-specific limiting factors.
Energy Technology Data Exchange (ETDEWEB)
Petersen, K.L. [Westinghouse Hanford Co., Richland, WA (US); Chatters, J.C. [Pacific Northwest Lab., Richland, WA (US)
1993-07-01
The Hanford Site Permanent Isolation Barrier Development Program (Barrier Development Program) was organized (Adams and Wing 1986) to develop the technology needed to provide an in-place disposal capability for the US Department of Energy at the Hanford Site in southeastern Washington. The goals of the Barrier Development Program are to provide defensible evidence that final barrier design(s) will adequately control water infiltration, plant and animal intrusion, and wind and water erosion for a minimum of 1,000 years; to isolate wastes from the accessible environment; and to use markers to warn inadvertent human intruders. Evidence for barrier performance will be obtained by conducting laboratory experiments, field tests, computer modeling, and other studies that establish confidence in the barrier`s ability to meet its 1,000-year design life. The performance and stability of natural barrier analogs that have existed for several millennia and the reconstruction of climate changes during the past 10,000 to 125,000 years also will provide insight into bounding conditions of possible future changes and increase confidence in the barriers design. In the following discussion the term {open_quotes}long-term{close_quotes} references periods of time up to 1000`s of years, distinguishing it from {open_quotes}short-term{close_quotes} weather patterns covering a decade or less. Specific activities focus on planning and conducting a series of studies and tests required to confirm key aspects of the barrier design. The effort is a collaborative one between scientists and engineers from Westinghouse Hanford Company (Westinghouse Hanford) and Pacific Northwest Laboratory (PNL) to design barriers to limit movement of radionuclides and other contaminants to the accessible environment for at least 1,000 years. These activities have been divided into 14 groups of tasks that aid in the complete development of protective barrier and warning marker system.
Directory of Open Access Journals (Sweden)
Adam Paré
Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.
Control of water infiltration into near surface LLW disposal units
International Nuclear Information System (INIS)
Schulz, R.K.; Ridky, R.W.; O'Donnell, E.
1992-10-01
The project objective is to assess means for controlling waste infiltration through waste disposal unit covers in humid regions. Experimental work is being performed in large scale lysimeters (70inch x 45inch x lOinch) at Beltsville, MD and results of the assessment are applicable to disposal of LLW, uranium mill tailings, hazardous waste, and sanitary landfills. Three concepts are under investigation: (1) resistive layer barrier, (2) conductive layer barrier, and bioengineering water management. The resistive layer barrier consists of compacted earth (clay). The conductive layer barrier is a special case of the capillary barrier and it requires a flow layer (e.g. fine sandy loam) over a capillary break. As long as unsaturated conditions am maintained water is conducted by the flow layer to below the waste. This barrier is most efficient at low flow rates and is thus best placed below a resistive layer barrier. Such a combination of the resistive layer over the conductive layer barrier promises to be highly effective provided there is no appreciable subsidence. Bioengineering water management is a surface cover that is designed to accommodate subsidence. It consists of impermeable panels which enhance run-off and limit infiltration. Vegetation is planted in narrow openings between panels to transpire water from below the panels. TWs system has successfully dewatered two lysimeters thus demonstrating that this procedure could be used for remedial action (''drying out'') existing water-logged disposal sites at low cost
Linking plant functional trait plasticity and the large increase in forest water use efficiency
Mastrotheodoros, Theodoros; Pappas, Christoforos; Molnar, Peter; Burlando, Paolo; Keenan, Trevor F.; Gentine, Pierre; Gough, Christopher M.; Fatichi, Simone
2017-09-01
Elevated atmospheric CO2 concentrations are expected to enhance photosynthesis and reduce stomatal conductance, thus increasing plant water use efficiency. A recent study based on eddy covariance flux observations from Northern Hemisphere forests showed a large increase in inherent water use efficiency (IWUE). Here we used an updated version of the same data set and robust uncertainty quantification to revisit these contemporary IWUE trends. We tested the hypothesis that the observed IWUE increase could be attributed to interannual trends in plant functional traits, potentially triggered by environmental change. We found that IWUE increased by 1.3% yr-1, which is less than previously reported but still larger than theoretical expectations. Numerical simulations with the Tethys-Chloris ecosystem model using temporally static plant functional traits cannot explain this increase. Simulations with plant functional trait plasticity, i.e., temporal changes in model parameters such as specific leaf area and maximum Rubisco capacity, match the observed trends in IWUE. Our results show that trends in plant functional traits, equal to 1.0% yr-1, can explain the observed IWUE trends. Thus, at decadal or longer time scales, trait plasticity could potentially influence forest water, carbon, and energy fluxes with profound implications for both the monitoring of temporal changes in plant functional traits and their representation in Earth system models.
Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W
2012-11-01
Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.
Energy Technology Data Exchange (ETDEWEB)
Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal
2015-09-15
Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP
International Nuclear Information System (INIS)
Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul
2010-01-01
One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.
Energy Technology Data Exchange (ETDEWEB)
Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)
2010-01-01
One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.
Directory of Open Access Journals (Sweden)
Bo Young Choi
2014-10-01
Full Text Available EAAC1 is important in modulating brain ischemic tolerance. Mice lacking EAAC1 exhibit increased susceptibility to neuronal oxidative stress in mice after transient cerebral ischemia. EAAC1 was first described as a glutamate transporter but later recognized to also function as a cysteine transporter in neurons. EAAC1-mediated transport of cysteine into neurons contributes to neuronal antioxidant function by providing cysteine substrates for glutathione synthesis. Here we evaluated the effects of EAAC1 gene deletion on hippocampal blood vessel disorganization after transient cerebral ischemia. EAAC1−/− female mice subjected to transient cerebral ischemia by common carotid artery occlusion for 30 min exhibited twice as much hippocampal neuronal death compared to wild-type female mice as well as increased reduction of neuronal glutathione, blood–brain barrier (BBB disruption and vessel disorganization. Pre-treatment of N-acetyl cysteine, a membrane-permeant cysteine prodrug, increased basal glutathione levels in the EAAC1−/− female mice and reduced ischemic neuronal death, BBB disruption and vessel disorganization. These findings suggest that cysteine uptake by EAAC1 is important for neuronal antioxidant function under ischemic conditions.
Power supply instrumentation for pulsed dielectric barrier discharges
International Nuclear Information System (INIS)
Quiroz Velázquez, V E; López Callejas, R; De la Piedad Beneitez, A; Rodríguez Méndez, B G; Peña Eguiluz, R; Muñoz Castro, A E; Barocio, S R; Mercado Cabrera, A; Valencia Alvarado, R
2012-01-01
The design and implementation of a pulsed high voltage supply intended to the production and control of pulsed dielectric barrier discharges are reported. The instrumentation includes three independently built DC sources coupled to Flyback-like converters using three 1:50 high voltage transformers. The system is capable of supplying voltages up to 70 kV at a 100-2000 Hz repetition rate, delivering 1-500 μs wide pulses. The system has been applied to the development of pulsed dielectric barrier discharges in a stainless steel coaxial reactor 30 cm long and with a 2.54 cm diameter. The inner nickel electrode diameter is 0.005 cm and is embedded in alumina. The discharges have been carried out in room pressure air. Discharges have been implemented. The discharge is made is a water environment for purposes of bacterial elimination.
Tunnelling through a Gaussian random barrier
International Nuclear Information System (INIS)
Bezak, Viktor
2008-01-01
A thorough analysis of the tunnelling of electrons through a laterally inhomogeneous rectangular barrier is presented. The barrier height is defined as a statistically homogeneous Gaussian random function. In order to simplify calculations, we assume that the electron energy is low enough in comparison with the mean value of the barrier height. The randomness of the barrier height is defined vertically by a constant variance and horizontally by a finite correlation length. We present detailed calculations of the angular probability density for the tunnelled electrons (i.e. for the scattering forwards). The tunnelling manifests a remarkably diffusive character if the wavelength of the electrons is comparable with the correlation length of the barrier
The 'wet mind': water and functional neuroimaging
International Nuclear Information System (INIS)
Le Bihan, Denis
2007-01-01
Functional neuroimaging has emerged as an important approach to study the brain and the mind. Surprisingly, although they are based on radically different physical approaches both positron emission tomography (PET) and magnetic resonance imaging (MRI) make brain activation imaging possible through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the principle that neuronal activation and blood flow are coupled through metabolism. However, a new paradigm has emerged to look at brain activity through the observation with MRI of the molecular diffusion of water. In contrast with the former approaches diffusion MRI has the potential to reveal changes in the intrinsic water physical properties during brain activation, which could be more intimately linked to the neuronal activation mechanisms and lead to an improved spatial and temporal resolution. However, this link has yet to be fully confirmed and understood. To shed light on the possible relationship between water and brain activation, this introductory paper reviews the most recent data on the physical properties of water and on the status of water in biological tissues, and evaluates their relevance to brain diffusion MRI. The biophysical mechanisms of brain activation are then reassessed to reveal their intimacy with the physical properties of water, which may come to be regarded as the 'molecule of the mind'. (invited topical review)
International Nuclear Information System (INIS)
Kim, Namsu; Graham, Samuel
2013-01-01
A flexible thin-film encapsulation architecture for organic electronics was built and consisted of a silicon oxide/alumina and parylene layer deposited over Ca sensors on a barrier-coated polyethylene terephthalate substrate. The film's effective water vapor transmission rate was 2.4 ± 1.5 × 10 −5 g/m 2 /day at 20 °C and 50% relative humidity. Flexural tests revealed that for films deposited on the polyethylene terephthalate substrate, the barrier layer failed due to cracking at a curvature radius of 6.4 mm, corresponding to a strain of 0.8%. Adding an epoxy top coat of suitable thickness shifted the neutral axis toward the encapsulation layer, reducing the induced strain. Barrier performance was maintained under the 6.4 mm radius of curvature in this encapsulation structure. Thus, shifting the neutral axis via device structural design is an effective method of extending the flexibility of thin-film encapsulation structure without compromising the performance loss as a barrier layer. - Highlights: • High performance barrier is fabricated on flexible substrate. • The water vapor transmission rate is 2.4 ± 1.5 × 10 −5 g/m 2 /day. • The structure maintains its performance under a small radius of bending curvature