Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario
2018-05-01
In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.
Horii-Hayashi, Noriko; Nishi, Mayumi
2018-02-27
Although the hypothalamus is classified into more than 10 compartments, it still contains uncharacterized areas. In this study, we identified a new triangular-shaped area between the paraventricular hypothalamic nucleus (PVN) and the fornix area in the mouse anterior hypothalamus, which is enriched in chondroitin sulfate proteoglycans (CSPGs). We designated this region as the perifornical area of the anterior hypothalamus (PeFAH) based on its anatomical location. As evidenced by Nissl staining, the PeFAH was distinguishable as an area of relatively low density. Immunohistochemical and DNA microarray analyses indicated that PeFAH contains sparsely distributed calretinin-positive neurons and densely clustered enkephalin-positive neurons. Furthermore, the PeFAH was shown to have bidirectional neural connections with the lateral septum. Indeed, we confirmed enkephalinergic projections from PeFAH neurons to the lateral septum, and inversely, calbindin-positive lateral septum neurons as afferents to the PeFAH. Finally, c-Fos expression analysis revealed that the activity of certain PeFAH neuronal populations tended to be increased by psychological stressors, but not that of enkephalinergic neurons. We proposed PeFAH as a new region in the AH.
Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.
Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim
2016-03-01
Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.
[ZHU Lian's New Acupuncture Academic System and acupuncture science initialization].
Zhang, Shujian; Zhang, Lijian
2015-11-01
Acupuncture scientization was a consensus of most of acupuncture scholars who had long-term perspectives in the 20th century, among them Ms. ZHULian was the important one. Ms. ZHU Lian built a systemic new acupuncture" academic structure in practice and theory aspects. At the same time, as the main architect of Institute of Acupuncture-moxibustion of China Academy of Traditional Chinese Medicine, Ms. ZHU Lian was the first one who began to carry out the acupuncture clinical trail and laboratory experiment in modern way, which meant "acupuncture therapy" was transformed into "acupuncture science" by Ms. ZHULian's endeavor.
[Mutation analysis of FAH gene in patients with tyrosinemia type 1].
Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She
2013-04-01
To investigate the clinical features and mutations of the FAH gene. Clinical records of two cases were collected, and diagnosis was made according to the diagnostic criteria of the International Organization for Rare Disorders (NORD). Genomic DNA was extracted from peripheral blood leukocytes with QIAamp DNA Mini Kit. The DNA extracts were subjected to direct sequencing for 14 exons together with adjacent fragments of FAH gene using ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) after PCR based on genomic DNA. The mutation source was verified by analyzing parents' exons corresponding to patients' mutation exons. The homology between human FAH enzyme and that of other species was surveyed using software Clustal X(European Bioinformatics Institute, Hinxton, Saffron Walde, UK). Polyphen (Polymorphism Phenotyping), available online, were used to predict possible impact of an amino acid substitution on structure and function of FAH enzyme. Polyphen calculates position-specific independent counts (PISC) scores for two amino acid variants in polymorphic position. A PISC scores that differ by > 2 were regarded as indicating the probability of damaging variants. Patient 1 was a 5 months and 21 days-old boy who suffered from persistent diarrhea, hepatomegaly, ascites; Alpha-fetoprotein > 1210 µg/L, levels of tyrosine in blood and succinylacetone in urine were 110.8 µmol/L and 83.7 µmol/L. His sister suffered from tyrosinemia type 1. Direct sequencing showed a G to A transition in CDS position 455 and 1027. He was compound heterozygous for the mutation c.455G > A/c.1027G > A, which predicts a change from tryptophan to a stop codon (TGG > TAG) at position 152 (W152X) and a change from glycine to arginine (GGG > AGG) at position 343 respectively. Patient 2 was a 6 year and 1 month-old girl with late-onset rickets who had signs of hepatosplenomegaly, rachitic rosary, windswept knees. Hypophosphatemia and alkaline phosphatase 1620 IU/L were detected
Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F. J.; Balestra, Dario
2018-01-01
In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying
Accessing HEP Collaboration documents using WWW and WAIS
International Nuclear Information System (INIS)
Nguyen, T.D.; Buckley-Geer, E.; Ritchie, D.J.
1995-09-01
WAIS stands for Wide Area Information Server. It is a distributed information retrieval system. A WAIS system has a client-server architecture which consists of clients talking to a server via a TCP/IP network using the ANSI standard Z39-50 VI protocol. A freely available version (FreeWAIS) is supported by the Clearinghouse for Networked Information Discovery and Retrieval, also known as CNIDR. FreeWAIS-sf, which is the software the authors are using at Fermilab, is an extension of FreeWAIS. FreeWAIS-sf supports all the functionalities which FreeWAIS offers as well as additional indexing and searching capabilities for structured fields. World Wide Web (WWW) was originally developed by Tim Berners-Lee at CERN and is now the backbone for serving information on Internet. Here, the authors describe a system for accessing HEP collaboration documents using WWW and WAIS
Accessing HEP Collaboration documents using WWW and WAIS
Energy Technology Data Exchange (ETDEWEB)
Nguyen, T.D.; Buckley-Geer, E.; Ritchie, D.J.
1995-09-01
WAIS stands for Wide Area Information Server. It is a distributed information retrieval system. A WAIS system has a client-server architecture which consists of clients talking to a server via a TCP/IP network using the ANSI standard Z39-50 VI protocol. A freely available version (FreeWAIS) is supported by the Clearinghouse for Networked Information Discovery and Retrieval, also known as CNIDR. FreeWAIS-sf, which is the software the authors are using at Fermilab, is an extension of FreeWAIS. FreeWAIS-sf supports all the functionalities which FreeWAIS offers as well as additional indexing and searching capabilities for structured fields. World Wide Web (WWW) was originally developed by Tim Berners-Lee at CERN and is now the backbone for serving information on Internet. Here, the authors describe a system for accessing HEP collaboration documents using WWW and WAIS.
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Translations of Poems by Yang Lian
Directory of Open Access Journals (Sweden)
Mabel Lee
2007-01-01
Full Text Available Biographical note on Yang Lian Yang Lian grew up in Beijing and began to establish his credentials as a poet from 1979. His early collections in China include Ritualisation of the Soul (1985, Desolate Soul (1986, Yellow (1989 and his long poem Yi that was first published under the title Sun and Man (1991. His poetry began to appear in English translations by John Minford, Sean Golden and Alisa Joyce in the Hong Kong translation magazine Renditions (1983 and 1985. He travelled to Australia in 1988, and then to New Zealand in 1989. After the June 4 events in Tiananmen Square, Beijing, he sought and obtained New Zealand citizenship. In 1991 he relocated to London where he now lives. His poems, essays and criticism have been collected in Yang Lian’s Works, 1982–1997 (1998 in two volumes and amounting to over 1000 pages, and in Yang Lian’s New Works, 1998-2002 (2003. Yang Lian’s major collections in English include: Masks and Crocodile (1990, The Dead in Exile (1990 and Yi (2002, translated by Mabel Lee; Non-Person Singular (1996, Where the Sea Stands Still (1999, Notes of a Blissful Ghost (2002, Concentric Circles (2005, translated by Brian Holton; and Unreal City: A Chinese Poet in Auckland (2006, translated by Jacob Edmond and Hilary Chung. Selections of his poems have been translated in over thirty languages, and have enabled him to travel regularly to literary festivals all over the world. In 1999 he won the Flaiano International Prize for Poetry.
Benson, Nicholas; Hulac, David M.; Kranzler, John H.
2010-01-01
Published empirical evidence for the Wechsler Adult Intelligence Scale--Fourth Edition (WAIS-IV) does not address some essential questions pertaining to the applied practice of intellectual assessment. In this study, the structure and cross-age invariance of the latest WAIS-IV revision were examined to (a) elucidate the nature of the constructs…
Benson, Nicholas; Hulac, David M; Kranzler, John H
2010-03-01
Published empirical evidence for the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) does not address some essential questions pertaining to the applied practice of intellectual assessment. In this study, the structure and cross-age invariance of the latest WAIS-IV revision were examined to (a) elucidate the nature of the constructs measured and (b) determine whether the same constructs are measured across ages. Results suggest that a Cattell-Horn-Carroll (CHC)-inspired structure provides a better description of test performance than the published scoring structure does. Broad CHC abilities measured by the WAIS-IV include crystallized ability (Gc), fluid reasoning (Gf), visual processing (Gv), short-term memory (Gsm), and processing speed (Gs), although some of these abilities are measured more comprehensively than are others. Additionally, the WAIS-IV provides a measure of quantitative reasoning (QR). Results also suggest a lack of cross-age invariance resulting from age-related differences in factor loadings. Formulas for calculating CHC indexes and suggestions for interpretation are provided. PsycINFO Database Record (c) 2010 APA, all rights reserved.
Tang, Yongjie; Zheng, Zhuo; Chen, Cong; Wang, Mengyuan; Chen, Bishan
2018-04-01
The coastal basin deposit in the Lian River plain is among the thickest Quaternary sequences along the southeastern coast of China. The clastic sediment accumulated in a variety of environmental settings including fluvial, channel, estuary/coastal and marine conditions. Detailed investigation of lithofacies, grain-size distributions, magnetic susceptibility, microfossils and chronology of marine core CN01, compared with regional cores, and combined with offshore seismic reflection profiles, has allowed us to correlate the spatial stratigraphy in the inner and outer plain and the seismic units. Grain size distribution analysis of core CN-01 through compositional data analysis and multivariate statistics were applied to clastic sedimentary facies and sedimentary cycles. Results show that these methods are able to derive a robust proxy information for the depositional environment of the Lian River plain. We have also been able to reconstruct deltaic evolution in response to marine transgressions. On the basis of dating results and chronostratigraphy, the estimated age of the onset of deposition in the Lian River coastal plain was more than 260 kyr BP. Three transgressive sedimentary cycles revealed in many regional cores support this age model. Detailed lithological and microfossil studies confirm that three marine (M3, M2 and M1) and three terrestrial (T3, T2 and T1) units can be distinguished. Spatial correlation between the inner plain, outer plain (typical cores characterized by marine transgression cycles) and offshore seismic reflectors reveals coherent sedimentary sequences. Two major boundaries (unconformity and erosion surfaces) can be recognized in the seismic profiles, and these correspond to weathered reddish and/or variegated clay in the study core, suggesting that Quaternary sediment changes on the Lian River plain were largely controlled by sea-level variations and coastline shift during glacial/interglacial cycles.
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
Zhu, Liqiang; Zhang, Hong; Shi, Fusheng; Yi, Dong; Zhu, Guangjun
2015-03-01
The objective of this study was to investigate the epidemiological characteristics of scalds induced by "guo lian kang" (literally "stove connected to bed") in children. The demographic, burn features, outcome, and other information of 0-14-year-old children with "guo lian kang"-induced scalds admitted to the burn treatment center of the 322 Hospital of the People's Liberation Army in Datong from 30 September 2001 to 31 December 2011 were analyzed. Among the 1993 children clearly documented with scalds due to hot liquid in vessels, 795 (39.89%) had burns due to "guo lian kang." The proportion of the pediatric burns caused by "guo lian kang" was 55.56% in 2002 and 37.30% in 2011, with a decreasing trend. One-year-old children accounted for the highest proportion of children with burns due to "guo lian kang" (male:female=1.54:1). Scalding mostly occurred from October to May; the most common times were around 8:00 AM, 11:00 AM, and 7:00 PM. Most scalds occurred on the upper limbs, 90.22% of which were dermal burns. The median burn area was 11% of the total body surface area. The burn agent was mainly hot water in pots. Scalding mostly occurred when the children accidentally sat on, or fell or stepped into the pot while playing. Among the children with "guo lian kang"-induced scalds, up to 42.26% of the children did not receive any treatment before hospital admission, and 18.86% of the children were admitted to the hospital ≥6h after the occurrence of burns. In addition, 74.97% of the children's families can afford the medical expenses, while 5.28% abandoned treatment because of financial difficulties. There were no significant differences between children with scalds caused by "guo lian kang" and scalds caused due to other reasons considering the age and sex. Compared to scalds due to other reasons, children with "guo lian kang"-induced scalds had greater burn area and depth, shock incidence, surgery rate, blood transfusion rate, length of hospital stay, and
A Comparison of the Interest Accuracy of Two Short Forms of the WAIS-R.
Cella, David F.; And Others
1985-01-01
Examined relative efficacy of two short forms of Wechsler Adult Intelligence Scale-Revised (WAIS-R) with respect to accurate subtest profile scatter (N=50). Subtest scores of both split-half Satz-Mogel short form and criterion referenced Modified WAIS-R (WAIS-RM) short form were found to differ significantly from full-length WAIS-R subtest scores.…
Effects of Gan Lian Yuping Feng powder on the antibody titers to ...
African Journals Online (AJOL)
The study was conducted in order to investigate the immuno-enhancing property of the Chinese herbal formula, Gan lian Yu ping feng powder. Three hundred and thirty six 45-day-old chicks were randomly divided into eight groups. The chicks in groups A, B, C were orally given 0.25 g/mL (low-)C0.5 g/mL (middle-) and 1.0 ...
Directory of Open Access Journals (Sweden)
Dan-Dan Wei
2018-05-01
Full Text Available Huang-Lian-Jie-Du-Decoction, a traditional Chinese formula, has been reported to protect liver from various injuries. Two cholestasis models of rats induced by thioacetamide and by bile duct ligation were established and treated with Huang-Lian-Jie-Du-Decoction. Nuclear Magnetic Resonance-based urinary metabolic profiles were analyzed by orthogonal partial least squares discriminant analysis and univariate analysis to excavate differential metabolites associated with the injuries of the two models and the treatment effects of Huang-Lian-Jie-Du-Decoction. The two cholestatic models shared common metabolic features of excessive fatty acid oxidation, insufficient glutathione regeneration and disturbed gut flora, with specific characteristics of inhibited urea cycle and DNA damage in thioacetamide-intoxicated model, and perturbed Kreb's cycle and inhibited branched chain amino acid oxidation in bile duct ligation model. With good treatment effects, Huang-Lian-Jie-Du-Decoction could regain the balance of the disturbed metabolic status common in the two cholestasis injuries, e.g., unbalanced redox system and disturbed gut flora; and perturbed urea cycle in thioacetamide-intoxicated model and energy crisis (disturbed Kreb's cycle and oxidation of branched chain amino acid in bile duct ligation model, respectively.
Miragall, Marta; Baños, Rosa M; Cebolla, Ausiàs; Botella, Cristina
2015-01-01
This study examines the psychometric properties of the Working Alliance Inventory-Short (WAI-S) adaptation to Virtual Reality (VR) and Augmented Reality (AR) therapies (WAI-VAR). The relationship between the therapeutic alliance (TA) with VR and AR and clinically significant change (CSC) is also explored. Seventy-five patients took part in this study (74.7% women, M age = 34.41). Fear of flying and adjustment disorder patients received VR therapy, and cockroach phobia patients received AR therapy. Psychometric properties, CSC, one-way ANOVA, Spearman's Correlations and Multiple Regression were calculated. The WAI-VAR showed a unidimensional structure, high internal consistency and adequate convergent validity. "Not changed" patients scored lower on the WAI-VAR than "improved" and "recovered" patients. Correlation between the WAI-VAR and CSC was moderate. The best fitting model for predicting CSC was a linear combination of the TA with therapist (WAI-S) and the TA with VR and AR (WAI-VAR), due to the latter variable slightly increased the percentage of variability accounted for in CSC. The WAI-VAR is the first validated instrument to measure the TA with VR and AR in research and clinical practice. This study reveals the importance of the quality of the TA with technologies in achieving positive outcomes in the therapy.
Psychometric properties of the Thai version of the work ability index (Thai WAI).
Kaewboonchoo, Orawan; Ratanasiripong, Paul
2015-01-01
The purpose of this research was to develop and test the psychometric properties of the Thai version of the Work Ability Index (WAI). Forward translation and back-translation of the WAI were performed by seven bilingual professionals to ensure that the Thai WAI was culturally relevant and conceptually accurate. To ensure generalizability of the Thai WAI, a sample of 2,744 Thai workers from 19 different enterprises in five regions of Thailand completed the Thai version of the WAI along with the General Health Questionnaire. The 19 enterprises were from the following industries: canned food, snack food, cooking oil, footwear, pharmaceutical, ceramics, toy, steel, petrochemical, and auto parts. The results from exploratory factor analysis supported a 3-factor model, accounting for 53.49% of the total variance. The results also provided evidence for adequate test-retest reliability and internal consistency of the Thai WAI. The internal consistency of the Thai WAI was found to be slightly low due to the newness of the concept of work ability, which is not a common term used in the Thai language; therefore, explanation of the meaning of work ability is needed to increase understanding of workers. By providing early recognition of workers' health risks as well as risks of early termination, the WAI can help Thai human resources managers respond better to the needs of workers and be proactive in their efforts to retain workers in their organizations. Occupational health professionals could also utilize the WAI to evaluate the work ability of Thai workers in order to help organizations recognize early signs of their workers' health risks and possible early terminations and respond appropriately.
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
External validity of the Indonesian Wechsler Adult Intelligence Scale - Fourth edition (WAIS-IV-ID)
Suwartono, C.; Hidajat, L.L.; Halim, M.S.; Hendriks, M.P.H.; Kessels, R.P.C.
2016-01-01
The Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV-ID) has been adapted and proved to be valid for its internal structure for Indonesian population. The same structure found as in the American WAIS-IV (WAIS-IV-US; Suwartono, Hendriks, Hidajat, Halim, & Kessels, 2015). Despite its strong
Identification of Novel Mutations in FAH Gene and Prenatal Diagnosis of Tyrosinemia in Indian Family
Directory of Open Access Journals (Sweden)
Jayesh J. Sheth
2012-01-01
Full Text Available Carrier of tyrosinemia type I was diagnosed by sequencing FAH (fumarylacetoacetate hydrolase gene. It leads to the identification of heterozygous status for both c.648C>G (p.Ile216Met and c.1159G>A (p.Gly387Arg mutations in exons 8 and 13, respectively, in the parents. The experimental program PolyPhen, SIFT, and MT predicts former missense point mutation as “benign” that creates a potential donor splice site and later one as “probably damaging” which disrupts secondary structure of protein.
Test Review: Advanced Clinical Solutions for WAIS-IV and WMS-IV
Chu, Yiting; Lai, Mark H. C.; Xu, Yining; Zhou, Yuanyuan
2012-01-01
The authors review the "Advanced Clinical Solutions for WAIS-IV and WMS-IV". The "Advanced Clinical Solutions (ACS) for the Wechsler Adult Intelligence Scale-Fourth Edition" (WAIS-IV; Wechsler, 2008) and the "Wechsler Memory Scale-Fourth Edition" (WMS-IV; Wechsler, 2009) was published by Pearson in 2009. It is a…
Structural Validity of the Dutch-Language Version of the WAIS-III in a Psychiatric Sample
Heijden, P.T. van der; Bos, P. van den; Mol, B.A.W.; Kessels, R.P.C.
2013-01-01
The Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV; Wechsler, 2008) no longer provides the traditional Verbal IQ and Performance IQ deviation scores. In the current study, we investigated the structural validity of these scores in the scale's predecessor, the WAIS-Third Edition (WAIS-III;
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Directory of Open Access Journals (Sweden)
Elizabeth do Nascimento
2007-12-01
Full Text Available Diante da escassez de pesquisas nacionais e de testes psicológicos destinados a avaliar pessoas cegas, desenvolveu-se um estudo psicométrico com as escalas verbais dos testes WISC-III e WAIS-III. Após as adaptações de alguns estímulos e das instruções, os testes foram aplicados em crianças (N = 120 e adultos (N = 52 residentes em Belo Horizonte. Os resultados indicaram que as escalas verbais modificadas apresentam uma boa consistência interna (alfa> 0,80. Além disso, a investigação da validade fatorial identifica a presença clara de apenas um componente. Este componente explica 81% e 64% para o WISC-III e WAIS-III, respectivamente. Conclui-se que as adaptações a que se procedeu não afetaram a estrutura fatorial das escalas. Deste modo, os profissionais poderão utilizar as escalas modificadas para avaliar a inteligência de pessoas cegas.Frente a la escasez de investigaciones nacionales asi como la ausencia de tests psicológicos que evaluen personas ciegas, se ha desarrollado un estudio psicometrico com la escalas verbales del WISC-III y WAIS-III. Posteriormente a las adaptaciones de algunos estímulos y de las instrucciones, las escalas fueron aplicadas a una muestra de niños (n=120 y de adultos (n=52 residentes en la ciudad de Belo Horizonte-Brasil. Los resultados indican que las escalas verbales modificadas presentan una alta fiabilidad (alpha >0,80 asi como la presencia clara de un unico componente responsable por 81% y 64% de la variancia del WIC-III e WAIS-III respectivamente. Se ha concluido que las modificaciones efectuadas no han comprometido la estructura factorial de las escalas verbales. Por tanto, los profesionales psicólogos pueden utilizar las escalas modificadas para la evaluación de la inteligencia de personas portadoras de ceguera.Owing to the almost lack of a national research on psychological testing for the evaluation of blind people, a psychometric study has been developed with the WISC-III and WAIS
[The essence of Professor Wu Lian-Zhong's acupuncture manipulation].
Liu, Jing; Guo, Yi; Wu, Lian-Zhong
2014-05-01
The painless needle insertion technique, summarized by Professor WU Lian-zhong during his decades of acupuncture clinical practice is introduced in this article, which is characterized as soft, flexible, fast, plucking and activating antipathogenic qi. The Sancai (three layers) lifting and thrusting manipulation technique is adopted by Professor WU for getting the qi sensation. And features of 10 kinds of needling sensation such as soreness, numbness, heaviness, distension, pain, cold, hot, radiation, jumping and contracture are summarized. Finger force, amplitude, speed and time length are also taken as the basis of reinforcing and reducing manipulations. Moreover, examples are also given to explain the needling technique on some specific points which further embodies Professor WU's unique experiences and understandings on acupuncture.
Similarity of WISC-R and WAIS-R Scores at Age 16.
Sandoval, Jonathan; And Others
1988-01-01
Examined similarity of scores of 30 learning disabled students (aged 16 and 17) on the Wechsler Intelligence Scale for Children-Revised (WISC-R) and the Wechsler Adult Intelligence Scale-Revised (WAIS-R). Results documented similarity between WISC-R and WAIS-R for 16 year-olds who were learning disabled and had average intellectual ability.…
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
WAIS Searching of the Current Contents Database
Banholzer, P.; Grabenstein, M. E.
The Homer E. Newell Memorial Library of NASA's Goddard Space Flight Center is developing capabilities to permit Goddard personnel to access electronic resources of the Library via the Internet. The Library's support services contractor, Maxima Corporation, and their subcontractor, SANAD Support Technologies have recently developed a World Wide Web Home Page (http://www-library.gsfc.nasa.gov) to provide the primary means of access. The first searchable database to be made available through the HomePage to Goddard employees is Current Contents, from the Institute for Scientific Information (ISI). The initial implementation includes coverage of articles from the last few months of 1992 to present. These records are augmented with abstracts and references, and often are more robust than equivalent records in bibliographic databases that currently serve the astronomical community. Maxima/SANAD selected Wais Incorporated's WAIS product with which to build the interface to Current Contents. This system allows access from Macintosh, IBM PC, and Unix hosts, which is an important feature for Goddard's multiplatform environment. The forms interface is structured to allow both fielded (author, article title, journal name, id number, keyword, subject term, and citation) and unfielded WAIS searches. The system allows a user to: Retrieve individual journal article records. Retrieve Table of Contents of specific issues of journals. Connect to articles with similar subject terms or keywords. Connect to other issues of the same journal in the same year. Browse journal issues from an alphabetical list of indexed journal names.
Long term survival with whole abdominopelvic irradiation (WAI) in platinum-refractory ovarian cancer
International Nuclear Information System (INIS)
Cmelak, Anthony J.; Cox, Richard S.; Kapp, Daniel S.
1996-01-01
Purpose: To evaluate the efficacy and toxicity of WAI in persistent or recurrent epithelial ovarian carcinoma after initial chemotherapy. Methods and Materials: Between 1970 and 1995, 41 women with persistent or recurrent ovarian carcinoma after initial surgical debulking and chemotherapy were treated with WAI. Median age was 57 years (range 27-75). Initial FIGO stages were I and II - 5 patients (12%), III - 26 (64%), and IV - 10 (24%). Tumor grade was 1 - 4 (10%), II - 16 (39%), and III - 20 (49%). Four to eighteen (median eight) cycles of chemotherapy had been given prior to WAI. Thirty-one patients had received platinum-based regimens, and 22 of these had failed within six months after completion of chemotherapy (platinum-refractory). Prior to WAI, 11 (27%) patients had microscopic residual disease, 21 (51%) had gross residual disease up to 1.5 cm, and 9 (22%) had tumors greater than 1.5 cm in maximal diameter. Median doses of 28 Gy to the abdomen and 48 Gy to the pelvis were delivered using an open-field technique with appropriate liver and kidney shielding. Results: With follow-up of 1 month to 16.5 years, the 5-year actuarial disease specific survival was 47% in all 41 patients, and 49% in 22 platinum-refractory patients. Both disease bulk at WAI (p -4 ) and initial stage (p=0.005) were of prognostic value. Five-year disease specific survivals were stage I and II - 100%, stage III - 55%, and stage IV - 27%. Five-year disease specific survival of all nonbulky (less than 1.5 cm) patients was 40%; 0% for patients with disease greater than 1.5 cm. Five-year disease specific survival for grade I - 66%, II - 59%, and III - 33%. Stage I, II, or III patients with residual disease bulk of 1.5 cm or less before WAI had a 10-year actuarial disease specific survival of 50%. Twelve patients (29%) failed to complete the planned course of WAI due to acute toxicity (most often due to prolonged thrombocytopenia). Late bowel toxicity included obstruction in one patient and
Factors associated with work ability index (WAI) among intensive care units' (ICUs') nurses.
Rostamabadi, Akbar; Zamanian, Zahra; Sedaghat, Zahra
2017-03-28
Work ability is a crucial occupational health issue in health care settings where a high physical and psychosocial work capacity is required and a high risk of disabling injuries and illnesses is predictable. This study aims to examine the association between the work ability index (WAI) and individual characterizations, workload, fatigue, and diseases among intensive care units' (ICUs') nurses. The study sample included 214 nurses selected by a random sampling method from a target population consisting of 321 registered nurses working in eight ICUs. Multiple linear regression analysis was used to test the association between WAI scores and each of the independent variables. Results of multivariate analysis revealed a strong and negative association between WAI scores and diseases (B=-5.82, 95% CI=-7.16, -4.48, Pindex (BMI) was significantly and inversely associated with WAI scores. A significant and negative association was also found between WAI scores and dimensions of MFI-20, such as general fatigue (B=-0.31, 95% CI=-0.53, -0.09, P=0.005) and physical fatigue (B=-0.44, 95% CI=-0.65, -0.23, Pwork environment characterized by a well-structured preventive attitude toward controlling diseases, and a well-designed organizational framework toward increasing the level of performance and motivation, reducing the level of fatigue, as well as reducing the workload, is necessary to promote work ability among ICUs' nurses.
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Are Cross-National Differences in IQ Profiles Stable? A Comparison of Finnish and U.S. WAIS Norms
Roivainen, Eka
2013-01-01
To study the concept of national IQ profile, we compared U.S. and Finnish WAIS, WAIS-R, and WAIS III nonverbal and working memory subtest norms. The U.S. standardization samples had consistently higher scores on the Coding and Digit span subtests, while the Finnish samples had higher scores on the Block design subtest. No stable cross-national…
Rostamabadi, Akbar; Mazloumi, Adel; Rahimi Foroushani, Abbas
2014-01-01
This study aimed to determine the Work Ability Index (WAI) and examine the influence of health dimensions and demographic variables on the work ability of Iranian farmers working in small farm enterprises. A cross-sectional study was conducted among 294 male farmers. The WAI and SF-36 questionnaires were used to determine work ability and health status. The effect of demographics variables on the work ability index was investigated with the independent samples t-test and one-way ANOVA. Also, multiple linear regression analysis was used to test the association between the mean WAI score and the SF-36 scales. The mean WAI score was 35.1 (SD=10.6). One-way ANOVA revealed a significant relationship between the mean WAI and age. Multiple linear regression analysis showed that work ability was more influenced by physical scales of the health dimensions, such as physical function, role-physical, and general health, whereas a lower association was found for mental scales such as mental health. The average WAI was at a moderate work ability level for the sample population of farmers in this study. Based on the WAI guidelines, improvement of work ability and identification of factors affecting it should be considered a priority in interventional programs. Given the influence of health dimensions on WAI, any intervention program for preservation and promotion of work ability among the studied farmers should be based on balancing and optimizing the physical and psychosocial work environments, with a special focus on reducing physical work load.(J Occup Health 2014; 56: 478-484).
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
Silverman, Wayne; Miezejeski, Charles; Ryan, Robert; Zigman, Warren; Krinsky-McHale, Sharon; Urv, Tiina
2010-01-01
Stanford-Binet and Wechsler Adult Intelligence Scale (WAIS) IQs were compared for a group of 74 adults with intellectual disability (ID). In every case, WAIS Full Scale IQ was higher than the Stanford-Binet Composite IQ, with a mean difference of 16.7 points. These differences did not appear to be due to the lower minimum possible score for the Stanford-Binet. Additional comparisons with other measures suggested that the WAIS might systematically underestimate severity of intellectual impairm...
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
Structural validity of the Dutch-language version of the WAIS-III in a psychiatric sample
Heijden, P. van der; Bos, P. van den; Mol, B.; Kessels, R.P.C.
2013-01-01
The Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV; Wechsler, 2008 ) no longer provides the "traditional" Verbal IQ and Performance IQ deviation scores. In the current study, we investigated the structural validity of these scores in the scale's predecessor, the WAIS-Third Edition
The psychometric properties of an Iranian translation of the Work Ability Index (WAI) questionnaire.
Abdolalizadeh, M; Arastoo, A A; Ghsemzadeh, R; Montazeri, A; Ahmadi, K; Azizi, A
2012-09-01
This study was carried out to evaluate the psychometric properties of an Iranian translation of the Work Ability Index (WAI) questionnaire. In this methodological study, nurses and healthcare workers aged 40 years and older who worked in educational hospitals in Ahvaz (236 workers) in 2010, completed the questionnaire and 60 of the workers filled out the WAI questionnaire for the second time to ensure test-retest reliability. Forward-backward method was applied to translate the questionnaire from English into Persian. The psychometric properties of the Iranian translation of the WAI were assessed using the fallowing tests: Internal consistency (to test reliability), test-retest analysis, exploratory factor analysis (construct validity), discriminate validity by comparing the mean WAI score in two groups of the employees that had different levels of sick leave, criterion validity by determining the correlation between the Persian version of short form health survey (SF-36) and WAI score. Cronbach's alpha coefficient was estimated to be 0.79 and it was concluded that the internal consistency was high enough. The intraclass correlation coefficient was recognized to be 0.92. Factor analysis indicated three factors in the structure of the work ability including self-perceived work ability (24.5% of the variance), mental resources (22.23% of the variance), and presence of disease and health related limitation (18.55% of the variance). Statistical tests showed that this questionnaire was capable of discriminating two groups of employees who had different levels of sick leave. Criterion validity analysis showed that this instrument and all dimensions of the Iranian version of SF-36 were correlated significantly. Item correlation corrective for overlap showed the items tests had a good correlation except for one. The finding of the study showed that the Iranian version of the WAI is a reliable and valid measure of work ability and can be used both in research and practical
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Li, Rongyu; Qiu, Guo Yu; Chai, Minwei; Shen, Xiaoxue; Zan, Qijie
2018-06-23
Mangroves are often converted into gei wai ponds for aquaculture, but how such conversion affects the accumulation and behavior of heavy metals in sediments is not clear. The present study aims to quantify the concentration and speciation of heavy metals in sediments in different habitats, including gei wai pond, mangrove marsh dominated by Avicennia marina and bare mudflat, in a mangrove nature reserve in South China. The results showed that gei wai pond acidified the sediment and reduced its electronic conductivity and total organic carbon (TOC) when compared to A. marina marsh and mudflat. The concentrations of Cd, Cu, Zn and Pb at all sediment depths in gei wai pond were lower than the other habitats, indicating gei wai pond reduced the fertility and the ability to retain heavy metals in sediment. Gei wai pond sediment also had a lower heavy metal pollution problem according to multiple evaluation methods, including potential ecological risk coefficient, potential ecological risk index, geo-accumulation index, mean PEL quotients, pollution load index, mean ERM quotients and total toxic unit. Heavy metal speciation analysis showed that gei wai pond increased the transfer of the immobilized fraction of Cd and Cr to the mobilized one. According to the acid-volatile sulfide (AVS) and simultaneously extracted metals (SEM) analysis, the conversion of mangroves into gei wai pond reduced values of ([SEM] - [AVS])/f oc , and the role of TOC in alleviating heavy metal toxicity in sediment. This study demonstrated the conversion of mangrove marsh into gei wai pond not only reduced the ecological purification capacity on heavy metal contamination, but also enhanced the transfer of heavy metals from gei wai pond sediment to nearby habitats.
Li, R.; Qiu, G.; Chai, M.; Li, R.
2017-12-01
Gei wai ponds act as important component in mangrove ecosystem, but the conversion of mangroves into gei wai ponds and its ecological function on heavy metal accumulation is still not clear. The study quantified the sediment heavy metal concentration and speciation in gei wai pond, Avicennia marina marsh and mudflat in Futian mangrove wetlands, South China. The results showed that gei wai pond acidified the sediment and reduced its fertility due to reduced pH, electronic conductivity (EC) and total organic carbon (TOC) compared to A. marina marsh and mudflat. The concentrations of Cd, Cu, Zn and Pb at all depth in gei wai pond sediment were also lower than other sites, indicating reduced storage function on heavy metals. Multiple analysis implied that heavy metals in all sites could be attributed to anthropogenic sources, with Cr as natural and anthropogenic sources in gei wai pond. Gei wai pond sediment had lower heavy metal pollution based on multiple evaluation methods, including potential ecological risk coefficient (Eir), potential ecological risk index (RI), geo-accumulation index (Igeo), mean PEL quotients (m-PEL-q), pollution load index (PLI), mean ERM quotients (m-ERM-q) and total toxic unit (∑TU). Heavy metal speciation analysis indicated that gei wai pond improved the conversion from the immobilized Cd and Cr to the mobilized fraction. SEM-AVS analysis indicated no adverse toxicity occurred in all sites, and the role of TOC in relieving sediment heavy metal toxicity of gei wai pond is limited.
WAIS-III IQs, Horn's Theory, and Generational Changes from Young Adulthood to Old Age.
Kaufman, Alan S.
2001-01-01
Examined age changes in intellectual ability in the range from 16 to 89 years through 2 studies that involved IQs on the Wechsler Adult Intelligence Scale III (WAIS-III). Results are interpreted in the context of the fluid-crystallized intelligence theory of J. Horn. Studies used WAIS-III standardization data for 2,450 adults and longitudinal data…
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Energy Consumption and Greenhouse Gas Emission Evaluation Scenarios of Mea Fah Luang University
Directory of Open Access Journals (Sweden)
Laingoen Onn
2016-01-01
Full Text Available In Thailand, quantity of the educational institutes building shared one fourth of commercial building. Among the energy consumption and conservation in the building in Thailand are mostly study in typical office and resident building. Mea Fah Luang University (MFU was selected to represent the educational institutes building where located in the northern part of Thailand. The average temperature in the northern is lower than other parts of Thailand. This study was firstly collected the data about quantity and behaviour of energy consumption in MFU based on the energy audit handbook. Although MFU is located in the northern of Thailand. The highest energy consumption is in the part of air condition. When the energy efficiency appliances and energy conservation building are implemented, the cost of energy will be saved around 15,867,960 Baht. Furthermore, the greenhouse gas emission is also reduced about 72.01 kg CO2, equivalent/m2/year.
Mazloumi, Adel; Rostamabadi, Akbar; Nasl Saraji, Gabraeil; Rahimi Foroushani, Abbas
2012-01-01
In recent decades, work ability index (WAI) has been a common practical tool to measure individuals' work ability in many European, Asian and South American countries. However, there is no study concerning work ability in Iran. The aim of this study was to determine the work ability index in an Iranian petrochemical job setting and to examine its relationship with psychosocial factors. A cross-sectional study was conducted among 420 male workers in various occupations. Work ability was evaluated using the WAI questionnaire developed by FIOH; the Job content questionnaire (JCQ) was used to assess psychosocial factors. The mean WAI score was 39.1 (SD=5.7) among workers in the studied petrochemical industry. Multiple linear regression analysis revealed a significant association between mean WAI score and age, job tenure, educational level, rest and sleep status and vocational education. Moreover, the results showed that skill discretion, coworker support and supervisor support were positively associated with the mean WAI score. On the other hand, it was inversely associated with job demands, job strain and job insecurity. This study was the first research to determine WAI in an important industry in Iran. Overall, work ability was in the "Good" category among the workers in the studied field. On the basis of the WAI guidelines, this level should be maintained and promoted to excellent level by providing supportive countermeasures. The WAI score was significantly associated with psychosocial factors. The results showed that even in heavy physical work, factors such as job insecurity, skill discretion, job strain and social support play an important role in maintaining work ability. A positive combination of "psychosocial characteristics" of the job with "individual resources" can promote work ability in such occupations.
Comparison of the WAIS-III and WISC-IV in 16-Year-Old Special Education Students
Gordon, Shirley; Duff, Simon; Davidson, Terry; Whitaker, Simon
2010-01-01
Background: Previous research with earlier versions of the WISC and WAIS has demonstrated that when administered to people who have intellectual disabilities, the WAIS produced higher IQ scores than the WISC. The aim of this study was to examine whether these differences still exist. A comparison of the Wechsler Adult Intelligence Scale-Third…
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
Silverman, Wayne; Miezejeski, Charles; Ryan, Robert; Zigman, Warren; Krinsky-McHale, Sharon; Urv, Tiina
2010-03-01
Stanford-Binet and Wechsler Adult Intelligence Scale (WAIS) IQs were compared for a group of 74 adults with intellectual disability (ID). In every case, WAIS Full Scale IQ was higher than the Stanford-Binet Composite IQ, with a mean difference of 16.7 points. These differences did not appear to be due to the lower minimum possible score for the Stanford-Binet. Additional comparisons with other measures suggested that the WAIS might systematically underestimate severity of intellectual impairment. Implications of these findings are discussed regarding determination of disability status, estimating prevalence of ID, assessing dementia and aging-related cognitive declines, and diagnosis of ID in forensic cases involving a possible death penalty.
Gomez, Francisco C., Jr.; And Others
1992-01-01
The standardization of the Escala de Inteligencia Wechsler para Adultos (EIWA) and the original Wechsler Adult Intelligence Scale (WAIS) were subjected to principal components analysis to examine their comparability for 616 EIWA subjects and 800 WAIS subjects. Similarity of factor structures of both scales is supported. (SLD)
Directory of Open Access Journals (Sweden)
Wenyan Feng
2016-11-01
Full Text Available Lian 4 fault block is located in the northwest of Fushan sag, Beibuwan Basin. It is a high-saturated condensate gas reservoir with rich condensate oil held by three faults. In order to seek an enhanced condensate oil recovery technology that is suitable for this condensate gas reservoir at its later development stage, it is necessary to analyze its reserve producing degree and remaining development potential after depletion production, depending on the supercritical fluid phase behavior and depletion production performance characteristics. The supercritical fluid theories and multiple reservoir engineering dynamic analysis methods were adopted comprehensively, such as dynamic reserves, production decline, liquid-carrying capacity of a production well, and remaining development potential analysis. It is shown that, at its early development stage, the condensate in Lian 4 fault block presented the features of supercritical fluid, and the reservoir pressure was lower than the dew point pressure, so retrograde condensate loss was significant. Owing to the retrograde condensate effect and the fast release of elastic energy, the reserve producing degree of depletion production is low in Lian 4 fault block, and 80% of condensate oil still remains in the reservoir. So, the remaining development potential is great. The supercritical condensate in Lian 4 fault block is of high density. Based on the optimization design by numerical simulation of compositional model, it is proposed to inject CO2 at the top and build up pressure by alternating production and injection, so that the secondary gas cap is formed while the gravity-stable miscible displacement is realized. In this way, the recovery factor of condensate reservoirs can be improved by means of the secondary development technology.
Directory of Open Access Journals (Sweden)
Xuc Lin
2009-05-01
Full Text Available Article depicted woman’s difficulties in maintaining her life as well as her aggressiveness in the patrilineal society in Chinese feudal time. Article analyzed Song Lian’s bad fate. She was the main character of qi qie chenqun novel, written by Su Tong. Article analysis consisted of three parts. The first part described Song Lian’s background of life and her becoming a mistress. The second part indicated Song Lian’s attacking behavior to other woman because of defending her life. His third part analyzed some causes that made Song Lian did not survive in life. It can be concluded that the fact, Song Lian is able to be survive but she decides to be a mistress caused by both personal and o social reasons. Song Lian’s attacking other woman is caused by her anger representing her unsuccessful life. Principally, Song Lian’s failure in the feudal life is caused by her unsuccessful in becoming a respected woman. If she had been a respected woman, she would have also competed with other women in achieving a better life.
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
Confirmatory Factor Analysis of WAIS-IV in a Clinical Sample: Examining a Bi-Factor Model
Directory of Open Access Journals (Sweden)
Rachel Collinson
2016-12-01
Full Text Available There have been a number of studies that have examined the factor structure of the Wechsler Adult Intelligence Scale IV (WAIS-IV using the standardization sample. In this study, we investigate its factor structure on a clinical neuropsychology sample of mixed aetiology. Correlated factor, higher-order and bi-factor models are all tested. Overall, the results suggest that the WAIS-IV will be suitable for use with this population.
Macroscopic Neural Theories of Cognition
2014-03-01
studies of working memory in schizophrenia . Human Brain Mapping, 25(1), 60-69. Goertzel, B., Lian, R. T., Arel, I., de Garis, H., & Chen, S...organization of behavior; a neuropsychological theory. New York: Wiley. Heil, J. (2003). Mental causation. In S. P. Stich & T. A. Warfield (Eds.), The...531-536. Plaut, D. C. (1995). Double dissociation without modularity: Evidence from connectionist neuropsychology . Journal of Clinical and
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Math anxiety differentially affects WAIS-IV arithmetic performance in undergraduates.
Buelow, Melissa T; Frakey, Laura L
2013-06-01
Previous research has shown that math anxiety can influence the math performance level; however, to date, it is unknown whether math anxiety influences performance on working memory tasks during neuropsychological evaluation. In the present study, 172 undergraduate students completed measures of math achievement (the Math Computation subtest from the Wide Range Achievement Test-IV), math anxiety (the Math Anxiety Rating Scale-Revised), general test anxiety (from the Adult Manifest Anxiety Scale-College version), and the three Working Memory Index tasks from the Wechsler Adult Intelligence Scale-IV Edition (WAIS-IV; Digit Span [DS], Arithmetic, Letter-Number Sequencing [LNS]). Results indicated that math anxiety predicted performance on Arithmetic, but not DS or LNS, above and beyond the effects of gender, general test anxiety, and math performance level. Our findings suggest that math anxiety can negatively influence WAIS-IV working memory subtest scores. Implications for clinical practice include the utilization of LNS in individuals expressing high math anxiety.
WAIS-III index score profiles in the Canadian standardization sample.
Lange, Rael T
2007-01-01
Representative index score profiles were examined in the Canadian standardization sample of the Wechsler Adult Intelligence Scale-Third Edition (WAIS-III). The identification of profile patterns was based on the methodology proposed by Lange, Iverson, Senior, and Chelune (2002) that aims to maximize the influence of profile shape and minimize the influence of profile magnitude on the cluster solution. A two-step cluster analysis procedure was used (i.e., hierarchical and k-means analyses). Cluster analysis of the four index scores (i.e., Verbal Comprehension [VCI], Perceptual Organization [POI], Working Memory [WMI], Processing Speed [PSI]) identified six profiles in this sample. Profiles were differentiated by pattern of performance and were primarily characterized as (a) high VCI/POI, low WMI/PSI, (b) low VCI/POI, high WMI/PSI, (c) high PSI, (d) low PSI, (e) high VCI/WMI, low POI/PSI, and (f) low VCI, high POI. These profiles are potentially useful for determining whether a patient's WAIS-III performance is unusual in a normal population.
Silverman, Wayne; Miezejeski, Charles; Ryan, Robert; Zigman, Warren; Krinsky-McHale, Sharon; Urv, Tiina
2010-01-01
Stanford-Binet and Wechsler Adult Intelligence Scale (WAIS) IQs were compared for a group of 74 adults with intellectual disability (ID). In every case, WAIS Full Scale IQ was higher than the Stanford-Binet Composite IQ, with a mean difference of 16.7 points. These differences did not appear to be due to the lower minimum possible score for the…
Davis, Todd McLin; Rodriguez, Vene L.
1979-01-01
Compared vocabulary and block design subtests of the Wechsler Adult Intelligence Scale (WAIS) and its Puerto Rican counterpart, the Escala de Inteligencia Wechsler para Adultos (EIWA), in hospitalized Latins and Trans-Caribbean Blacks. EIWA scores were significantly higher than WAIS scores. Equivalence of EIWA and WAIS estimates is questioned.…
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
WAIS Performance in Unincarcerated Groups of MMPI-Defined Sociopaths and Normal Controls
Allain, Albert N.
1974-01-01
This investigation examines WAIS performance in groups of 32 sociopaths and 33 normal controls defined by Minnesota Multiphasic Personality Inventory criteria. Sociopaths and normal controls show no differences in overall level of intellectual functioning. (Author)
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Directory of Open Access Journals (Sweden)
Latife Yazigi
2011-01-01
Full Text Available This study aimed at identifying what aspects of personality are modified after one and two years of psychoanalytic psychotherapy in adults attending a free university healthcare service in São Paulo, Brazil. The instruments were the Rorschach and the WAIS-III tests which were administered before and after one and two years of treatment. The participants were 34 adult individuals, both genders. After one year of psychotherapy in the Rorschach method there was an increase in effective and adaptive interpersonal relationship, an enhancement in sensitiveness related to the capacity of modulating affect, the need for close contact as well as the arousal of feelings of discomfort associated with intensification of self-regard, and a decrease in narcissistic tendencies. As well as in WAIS-III, there was an increase in motivation, attention and speed processing.O estudo teve por objetivo identificar quais aspectos da personalidade são modificados após um e dois anos de psicoterapia psicanalítica em adultos atendidos em um serviço público de saúde mental de uma universidade em São Paulo, no Brasil. Os instrumentos utilizados foram o Rorschach e a Escala de Inteligência Wechsler para adultos (WAIS-III, os quais foram administrados antes e após um e dois anos de tratamento. Os participantes foram 34 indivíduos adultos, de ambos os sexos. No Rorschach, após um ano de psicoterapia, ocorreu melhora da relação interpessoal adaptada e efetiva, melhora na sensibilidade relacionada à capacidade de modular afeto e da necessidade de contato mais próximo, e surgimento de sentimentos de desconforto associados à intensificação de auto-observação e diminuição de tendências narcisistas. No WAIS-III houve aumento de motivação, melhora atencional e de velocidade de processamento.
Directory of Open Access Journals (Sweden)
Flávia Wagner
2010-08-01
Full Text Available Objetivou-se avaliar a viabilidade de estimar o Quociente de Inteligência (QI de adultos por meio de duas estratégias que utilizam uma forma curta constituída pelos subtestes Vocabulário e Cubos da Escala Wechsler de Inteligência para Adultos (WAIS-III. Participaram do estudo 77 homens e mulheres, com idade média de 39,1 anos (dp=13,4. Foi aplicada a WAIS-III e questionários para cumprir os critérios de inclusão dos participantes sem prejuízos neurológicos e psiquiátricos. Para avaliar a concordância entre as duas estratégias de estimar o QI, utilizou-se o método estatístico proposto por Bland e Altman. Como resultado, encontrou-se que as estimativas de QI geradas pelas duas estratégias apresentam concordância com a medida do QI realizada pela aplicação da escala completa apenas em alguns dos casos avaliados. Sugere-se cautela na utilização dessas estratégias para estimar o QI de adultos.The aim of this study was to evaluate the feasibility of estimating the Intelligence Quotient (IQ in adults based on two strategies that use Vocabulary and Block Design subtests of Wechsler Adult Intelligence Scale (WAIS-III. Seventy-seven men and women participated of the study, with mean age of 39.1 (sd=13.4. WAIS-III subtests were administered and questionnaires were used to verify inclusion criteria for participants without neurological or psychiatric impairments. A statistical method proposed by Bland and Altman was used to evaluate the agreement between both strategies to estimate IQ. Results suggest that IQ estimates derived from both strategies only agree with the IQ derived from the full battery in a few cases of the sample. Considering these findings, caution is suggested when using these strategies to estimate adults' IQ.
Canivez, Gary L; Watkins, Marley W
2010-12-01
The present study examined the factor structure of the Wechsler Adult Intelligence Scale--Fourth Edition (WAIS-IV; D. Wechsler, 2008a) standardization sample using exploratory factor analysis, multiple factor extraction criteria, and higher order exploratory factor analysis (J. Schmid & J. M. Leiman, 1957) not included in the WAIS-IV Technical and Interpretation Manual (D. Wechsler, 2008b). Results indicated that the WAIS-IV subtests were properly associated with the theoretically proposed first-order factors, but all but one factor-extraction criterion recommended extraction of one or two factors. Hierarchical exploratory analyses with the Schmid and Leiman procedure found that the second-order g factor accounted for large portions of total and common variance, whereas the four first-order factors accounted for small portions of total and common variance. It was concluded that the WAIS-IV provides strong measurement of general intelligence, and clinical interpretation should be primarily at that level.
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Dijk, M.J.A.M. van; Claassen, T.; Suwartono, C.; Veld, W.M. van der; Heijden, P.T. van der; Hendriks, M.P.H.
2017-01-01
Objective: Since the publication of the WAIS-IV in the U.S. in 2008, efforts have been made to explore the structural validity by applying factor analysis to various samples. This study aims to achieve a more fine-grained understanding of the structure of the Dutch language version of the WAIS-IV
Fernaeus, Sven-Erik; Hellström, Åke
2017-09-18
Wechsler Adult Intelligence Scale (WAIS) subscale Similarities have been classified as a test of either verbal comprehension or of inductive reasoning. The reason may be that items divide into two categories. We tested the hypothesis of heterogeneity of items in WAIS-Similarities. Consecutive patients at a memory clinic and healthy controls participated in the study. White-matter hyperintensities (WMHs) and normalized temporal lobe volumes were measured based on Magnetic resonance Imaging (MRI), and tests of verbal memory and attention were used in addition to WAIS-Similarities to collect behavioural data. Factor analysis supported the hypothesis that two factors are involved in the performance of WAIS-similarities: (1) semiautomatic lexical access and (2) conceptual elaboration. These factors were highly correlated but provided discriminative diagnostic information: In logistic regression analyses, scores of the lexical access factor and of the conceptual elaboration factor discriminated patients with mild cognitive impairment from Alzheimer's disease patients and from healthy controls, respectively. High scores of WMH, indicating periventricular white-matter lesions, predicted factor scores of direct lexical access but not those of conceptual elaboration, which were predicted only by medial and lateral temporal lobe volumes.
Ultra-trace Measurements in the WAIS Divide 06A Ice Core, Version 1
National Aeronautics and Space Administration — These data contain the results of gas chromatography mass spectrometry (GC-MS) analysis of 207 samples from the WAIS Divide 06A ice core. The trace gases found in...
Directory of Open Access Journals (Sweden)
Elce de Seixas Nascimento
2012-12-01
Full Text Available Objective: To understand the effects of Lian Gong in hypertensive users of Family Health Unity. Methods: A descriptive qualitative study, involving 20 volunteers, regardless of gender, aged 45 to 70 years residing in the city of Parnaíba-PI, Brazil. The intervention was performed in quiet and noise-free environment, from August to September 2011, three times per week, with a total of 30 sessions. We used the tool Focus Group at the beginning and end of the intervention. We applied the technique of thematic analysis of the Collective Subject Discourse (CSD using three methodological approaches: main idea, key expressions and CSD. Basic statistics operations were used (percentages to quantify the lines. Results: Before the intervention, the group reported having hypertension perceived by the manifestation of physical symptoms and / or psychic symptoms based on the diagnosis and treatment rejection, revealing a superficial level of knowledge or misinformation about the disease. After the intervention, improvement in physical and emotional symptoms, social relationships and family was reported, as well as the difficulty of changing habits, which can be alleviated with the interdisciplinary support and continuation of exercise. Final Thoughts: The practice of Lian Gong was effective for improving the physical and emotional state of hypertensive patients and may be an adjuvant therapy to control hypertension in primary health care.
Relationship of Education and IQ in the WAIS-R Standardization Sample.
Matarazzo, Joseph D.; Herman, David O.
1984-01-01
Analyzed the total number of years of schooling completed against the Verbal IQ (VIQ), Performance IQ (PIQ), and Full Scale IQ (FSIQ) of the 1,880 individuals who were used to standardize the Wechsler Adult Intelligence Scale-Revised (WAIS-R). Analysis revealed a progressive increase in mean FSIQ with increasing education. (JAC)
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Elizabeth do Nascimento; Carmen Elvira Flores-Mendoza
2007-01-01
Diante da escassez de pesquisas nacionais e de testes psicológicos destinados a avaliar pessoas cegas, desenvolveu-se um estudo psicométrico com as escalas verbais dos testes WISC-III e WAIS-III. Após as adaptações de alguns estímulos e das instruções, os testes foram aplicados em crianças (N = 120) e adultos (N = 52) residentes em Belo Horizonte. Os resultados indicaram que as escalas verbais modificadas apresentam uma boa consistência interna (alfa> 0,80). Além disso, a investigação da vali...
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
'Ike Wai Professional Development Model for Students and Post-docs
Bruno, B. C.
2016-12-01
'Ike Wai: Securing Hawaii's Water Future, funded by NSF EPSCoR, is an interdisciplinary research collaboration among geophysicists, geochemists, engineers, microbiologists, computational modelers, data scientists and social scientists. Key questions include: How much water is there? How does it flow? How long will it last? Undergraduate students, graduate students and post-docs are actively involved in the research, and their professional development is a key part of the project. An underlying principle is that students assume responsibility for their own learning and professional development. Based on the model created by the NSF Center for Microbial Oceanography: Research and Education (C-MORE) (Bruno et al, 2008; Guannel et al 2014, Bottjer et al 2014), the 'Ike Wai professional development program includes (1) Leadership. Each student and post-doc creates an Individualized Professional Development plan, which includes leadership training (provided by external facilitators) and assuming leadership roles (such as developing and implementing trainings for their peers). (2) EDventures. Based on the C-MORE model, EDventures combines proposal-writing training with the incentive of seed money. Rather than providing training a priori, the EDventures model encourages students and post-docs to write a proposal based on guidelines provided. Training occurs during a two-stage review stage: proposers respond to panel reviews and resubmit their proposal within a single review cycle. C-MORE EDventures alumni self-report statistically significant confidence gains on all questions posed. Their subsequent proposal success is envious: of the 12 proposals submitted by to NSF, 50% were funded. (Wood Charlson & Bruno, 2015) (3) Layered Mentoring Network. All ´Ike Wai participants serve as both mentor and mentee. Students are matched with a non-research mentor in addition to their advisor to promote a holistic approach to career development. They will also serve as mentors to more
Éliane Viennot, La France, les femmes et le pouvoir. Et la Modernité fut masculine (1789-1804)
Leroux, Flavie; Moskowski, Pauline
2018-01-01
Et la modernité fut masculine est le troisième opus d’une série de cinq volumes questionnant « l’exception française », qui concerne le rapport entre femmes et pouvoir dans le contexte particulier de la France. Éliane Viennot fait ici le choix de placer la construction masculine de la modernité, et donc de l’État, au centre de sa réflexion, laissant une large place à l’histoire politique du genre en Révolution. La clarté, la richesse et les nuances qui caractérisent le propos en rendent la le...
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
Dari Mianzi Dan Lian Menuju Face: Dari Kearifan Lokal Cina Menuju Teori Kesantunan Yang Mendunia
Directory of Open Access Journals (Sweden)
Agung Pramujiono
2012-11-01
Full Text Available The politeness theory of Brown and Levinson (1987 about face is regarded as one very influential. In fact, it was rooted from Eastern local wisdom (ancient China, that is “mianzi” and “lian”. Mianzi represents social perceptions of one’s self-esteem built through lian as one’s morality. Politeness and limao have the same pragmatic basis but they can be perceived differently due to the varied cultural contexts underlying a speech community. In the intercultural pragmatics study, the differences should not form the sources of conflict but they should even be considered as varieties of pluralities about which the interactants should be understood in order that interpersonal communication activities can run harmoniously and can be avoided from all kinds of conflict and friction.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
van Dijk, Marjolein J A M; Claassen, Tom; Suwartono, Christiany; van der Veld, William M; van der Heijden, Paul T; Hendriks, Marc P H
Since the publication of the WAIS-IV in the U.S. in 2008, efforts have been made to explore the structural validity by applying factor analysis to various samples. This study aims to achieve a more fine-grained understanding of the structure of the Dutch language version of the WAIS-IV (WAIS-IV-NL) by applying an alternative analysis based on causal modeling in addition to confirmatory factor analysis (CFA). The Bayesian Constraint-based Causal Discovery (BCCD) algorithm learns underlying network structures directly from data and assesses more complex structures than is possible with factor analysis. WAIS-IV-NL profiles of two clinical samples of 202 patients (i.e. patients with temporal lobe epilepsy and a mixed psychiatric outpatient group) were analyzed and contrasted with a matched control group (N = 202) selected from the Dutch standardization sample of the WAIS-IV-NL to investigate internal structure by means of CFA and BCCD. With CFA, the four-factor structure as proposed by Wechsler demonstrates acceptable fit in all three subsamples. However, BCCD revealed three consistent clusters (verbal comprehension, visual processing, and processing speed) in all three subsamples. The combination of Arithmetic and Digit Span as a coherent working memory factor could not be verified, and Matrix Reasoning appeared to be isolated. With BCCD, some discrepancies from the proposed four-factor structure are exemplified. Furthermore, these results fit CHC theory of intelligence more clearly. Consistent clustering patterns indicate these results are robust. The structural causal discovery approach may be helpful in better interpreting existing tests, the development of new tests, and aid in diagnostic instruments.
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
Application of hierarchical genetic models to Raven and WAIS subtests: a Dutch twin study
Rijsdijk, F.V.; Vernon, P.A.; Boomsma, D.I.
2002-01-01
Hierarchical models of intelligence are highly informative and widely accepted. Application of these models to twin data, however, is sparse. This paper addresses the question of how a genetic hierarchical model fits the Wechsler Adult Intelligence Scale (WAIS) subtests and the Raven Standard
Accuracy of WISC-III and WAIS-IV short forms in patients with neurological disorders
van Ool, Jans S.; Hurks, Petra P.M.; Snoeijen-Schouwenaars, Francesca M.; Tan, In Y.; Schelhaas, Helenius J.; Klinkenberg, Sylvia; Aldenkamp, Albert P.; Hendriksen, Jos G.M.
2018-01-01
The assessment of intellectual abilities is intensive, time-consuming, and might be considered burdensome for patients. We examined psychometric qualities of short forms (SFs) of the Wechsler Intelligence Scales for Children (WISC-third edition) and for adults (WAIS-fourth edition), in children (n =
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
van Duijvenbode, Neomi; Didden, Robert; van den Hazel, Teunis; Engels, Rutger C M E
2016-01-01
To investigate the reliability and validity of a Wechsler Abbreviated Scale of Intelligence-based Wechsler Adult Intelligence Scale - third edition (WAIS-III) short form (SF) in a sample of individuals with mild to borderline intellectual disability (MBID) (N = 117; M(IQ) = 71.34; SD(IQ) = 8.00, range: 52-85). A full WAIS-III was administered as a standard procedure in the diagnostic process. The results indicate an excellent reliability (r = 0.96) and a strong, positive correlation with the full WAIS-III (r = 0.89). The SF correctly identified ID in general and the correct IQ category more specifically in the majority of cases (97.4% and 86.3% of cases, respectively). In addition, 82.1% of the full scale IQ (FSIQ) estimates fell within the 95% confidence interval of the original score. We conclude that the SF is a reliable and valid measure to estimate FSIQ. It can be used in clinical and research settings when global estimates of intelligence are sufficient.
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
Egeland, Jens
2015-01-01
The Wechsler Adult Intelligence Scale (WAIS) is one of the most frequently used tests among psychologists. In the fourth edition of the test (WAIS-IV), the subtests Digit Span and Letter-Number Sequencing are expanded for better measurement of working memory (WM). However, it is not clear whether the new extended tasks contribute sufficient complexity to be sensitive measures of manipulation WM, nor do we know to what degree WM capacity differs between the visual and the auditory modality because the WAIS-IV only tests the auditory modality. Performance by a mixed sample of 226 patients referred for neuropsychological examination on the Digit Span and Letter-Number Sequencing subtests from the WAIS-IV and on Spatial Span from the Wechsler Memory Scale-Third Edition was analyzed in two confirmatory factor analyses to investigate whether a unitary WM model or divisions based on modality or level/complexity best fit the data. The modality model showed the best fit when analyzing summed scores for each task as well as scores for the longest span. The clinician is advised to apply tests with higher manipulation load and to consider testing visual span as well before drawing conclusions about impaired WM from the WAIS-IV.
Comparison of WAIS-III Short Forms for Measuring Index and Full-Scale Scores
Girard, Todd A.; Axelrod, Bradley N.; Wilkins, Leanne K.
2010-01-01
This investigation assessed the ability of the Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) short forms to estimate both index and IQ scores in a large, mixed clinical sample (N = 809). More specifically, a commonly used modification of Ward's seven-subtest short form (SF7-A), a recently proposed index-based SF7-C and eight-subtest…
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
Directory of Open Access Journals (Sweden)
S.S. Kharat
2012-06-01
Full Text Available Freshwater fish fauna of the Krishna River at Wai, and the Dhom reservoir upstream of Wai, was studied. Fifty one species belonging to 14 families and 33 genera were recorded; 13 endemic to the Western Ghats and two to the Krishna River system. Moderate to rare populations were found for six globally threatened species: Gonoproktopterus curmuca, Labeo potail, Schismatorhynchos nukta, Tor khudree, T. mussullah and Parapsilorhynchus discophorus. Fish in this area are under threat due to two introduced species and five transplanted species, and due to other anthropogenic activities such as overfishing and organic and inorganic pollution of the river. Site based conservation action plans are needed for conservation of rare and threatened fish in this area.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
Costa, Ana Filipa; Puga-Leal, Rogério; Nunes, Isabel L
2011-01-01
The objective of this paper is to present a study on the assessment of the work ability of a group of aged computers workers. The study was developed with the goal of creating a decision making framework oriented towards the maintenance of the health and working ability of aged workers. Fifty computer workers participated in this study. They were administrative secretaries and computer technicians working mainly with office computers. The method used to assess the work ability was the Work Ability Index (WAI). 78% of the participants had good or excellent work ability and only 2% a poor one. The average WAI score was 40.5 (SD=5.761; min=27; max=49). This study confirms the decrease in work ability of workers while aging. The group overall work ability was slightly higher than the reference values develop by the Finnish Institute of Occupational Health. The assessment of work ability is fundamental to make age-friendly workplaces. WAI is one tool designed to perform such assessment. The results obtained could assist the early identification of situations where employees are struggling with their work ability, thus helping to prioritize ergonomic interventions devoted to improve the working conditions, and allowing the continued employment of aging workers on their current job.
Measuring Components of Intelligence: Mission Impossible?
Gregoire, Jacques
2013-01-01
The two studies conducted by Weiss, Keith, Zhu, and Chen in 2013 on the Wechsler Adult Intelligence Scale (WAIS-IV) and the Wechsler Intelligence Scale for Children (WISC-IV), respectively, provide strong evidence for the validity of a four-factor solution corresponding to the current hierarchical model of both scales. These analyses support the…
Heinly, Matthew T.; Greve, Kevin W.; Bianchini, Kevin J.; Love, Jeffrey M.; Brennan, Adrianne
2005-01-01
The present study determined specificity and sensitivity to malingered neurocognitive dysfunction (MND) in traumatic brain injury (TBI) for several Wechsler Adult Intelligence Scale (WAIS) Digit Span scores. TBI patients (n = 344) were categorized into one of five groups: no incentive, incentive only, suspect, probable MND, and definite MND.…
Directory of Open Access Journals (Sweden)
Kate eCockcroft
2015-03-01
Full Text Available There is debate regarding the appropriate use of Western cognitive measures with individuals from very diverse backgrounds to that of the norm population. Given the dated research in this area and the considerable socio-economic changes that South Africa has witnessed over the past 20 years, this paper reports on the use of the Wechsler Adult Intelligence Scale Third Edition (WAIS-III, the most commonly used measure of intelligence, with an English second language, multilingual, low socio-economic group of black, South African university students. Their performance on the WAIS-III was compared to that of a predominantly white, British, monolingual, higher socio-economic group. A multi-group confirmatory factor analysis showed that the WAIS-III lacks measurement invariance between the two groups, suggesting that it may be tapping different constructs in each group. The UK group significantly outperformed the SA group on the knowledge-based verbal, and some nonverbal subtests, while the SA group performed significantly better on measures of processing speed. The groups did not differ significantly on the Matrix Reasoning subtest and on those working memory subtests with minimal reliance on language, which appear to be the least culturally biased. Group differences were investigated further in a set of principal components analyses, which revealed that the WAIS-III scores loaded differently for the UK and SA groups. While the SA group appeared to treat the processing speed subtests differently to those measuring perceptual organisation and nonverbal reasoning, the UK group seemed to approach all of these subtests similarly. These results have important implications for the cognitive assessment of individuals from culturally, linguistically and socio-economically diverse circumstances.
Cockcroft, Kate; Alloway, Tracy; Copello, Evan; Milligan, Robyn
2015-01-01
There is debate regarding the appropriate use of Western cognitive measures with individuals from very diverse backgrounds to that of the norm population. Given the dated research in this area and the considerable socio-economic changes that South Africa has witnessed over the past 20 years, this paper reports on the use of the Wechsler Adult Intelligence Scale Third Edition (WAIS-III), the most commonly used measure of intelligence, with an English second language, multilingual, low socio-economic group of black, South African university students. Their performance on the WAIS-III was compared to that of a predominantly white, British, monolingual, higher socio-economic group. A multi-group confirmatory factor analysis showed that the WAIS-III lacks measurement invariance between the two groups, suggesting that it may be tapping different constructs in each group. The UK group significantly outperformed the SA group on the knowledge-based verbal, and some non-verbal subtests, while the SA group performed significantly better on measures of Processing Speed (PS). The groups did not differ significantly on the Matrix Reasoning subtest and on those working memory subtests with minimal reliance on language, which appear to be the least culturally biased. Group differences were investigated further in a set of principal components analyses, which revealed that the WAIS-III scores loaded differently for the UK and SA groups. While the SA group appeared to treat the PS subtests differently to those measuring perceptual organization and non-verbal reasoning, the UK group seemed to approach all of these subtests similarly. These results have important implications for the cognitive assessment of individuals from culturally, linguistically, and socio-economically diverse circumstances.
Spencer, Robert J; Reckow, Jaclyn; Drag, Lauren L; Bieliauskas, Linas A
2016-12-01
We assessed the validity of a brief incidental learning measure based on the Similarities and Vocabulary subtests of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). Most neuropsychological assessments for memory require intentional learning, but incidental learning occurs without explicit instruction. Incidental memory tests such as the WAIS-III Symbol Digit Coding subtest have existed for many years, but few memory studies have used a semantically processed incidental learning model. We conducted a retrospective analysis of 37 veterans with traumatic brain injury, referred for outpatient neuropsychological testing at a Veterans Affairs hospital. As part of their evaluation, the participants completed the incidental learning tasks. We compared their incidental learning performance to their performance on traditional memory measures. Incidental learning scores correlated strongly with scores on the California Verbal Learning Test-Second Edition (CVLT-II) and Brief Visuospatial Memory Test-Revised (BVMT-R). After we conducted a partial correlation that controlled for the effects of age, incidental learning correlated significantly with the CVLT-II Immediate Free Recall, CVLT-II Short-Delay Recall, CVLT-II Long-Delay Recall, and CVLT-II Yes/No Recognition Hits, and with the BVMT-R Delayed Recall and BVMT-R Recognition Discrimination Index. Our incidental learning procedures derived from subtests of the WAIS-IV Edition are an efficient and valid way of measuring memory. These tasks add minimally to testing time and capitalize on the semantic encoding that is inherent in completing the Similarities and Vocabulary subtests.
Major Ion Concentrations in WDC05Q and WDC06A Ice Cores (WAIS Divide), Version 1
National Aeronautics and Space Administration — This data set contains major ion concentrations from the chemical analysis of two WAIS Divide ice cores (WDC05Q, 0-114 m; WDC06A, 0-129 m). The analytical technique...
Sellers, Kristin K.; Mellin, Juliann M.; Lustenberger, Caroline M.; Boyle, Michael R.; Lee, Won Hee; Peterchev, Angel V.; Frohlich, Flavio
2015-01-01
Transcranial direct current stimulation (tDCS) modulates excitability of motor cortex. However, there is conflicting evidence about the efficacy of this non-invasive brain stimulation modality to modulate performance on cognitive tasks. Previous work has tested the effect of tDCS on specific facets of cognition and executive processing. However, no randomized, double-blind, sham-controlled study has looked at the effects of tDCS on a comprehensive battery of cognitive processes. The objective of this study was to test if tDCS had an effect on performance on a comprehensive assay of cognitive processes, a standardized intelligence quotient (IQ) test. The study consisted of two substudies and followed a double-blind, between-subjects, sham-controlled design. In total, 41 healthy adult participants completed the Wechsler Adult Intelligence Scale, Fourth Edition (WAIS-IV) as a baseline measure. At least one week later, participants in substudy 1 received either bilateral tDCS (anodes over both F4 and F3, cathode over Cz, 2mA at each anode for 20 minutes) or active sham tDCS (2mA for 40 seconds), and participants in substudy 2 received either right or left tDCS (anode over either F4 or F3, cathode over Cz, 2mA for 20 minutes). In both studies, the WAIS-IV was immediately administered following stimulation to assess for performance differences induced by bilateral and unilateral tDCS. Compared to sham stimulation, right, left, and bilateral tDCS reduced improvement between sessions on Full Scale IQ and the Perceptual Reasoning Index. This demonstration that frontal tDCS selectively degraded improvement on specific metrics of the WAIS-IV raises important questions about the often proposed role of tDCS in cognitive enhancement. PMID:25934490
Application of hierarchical genetic models to Raven and WAIS subtests: a Dutch twin study.
Rijsdijk, Frühling V; Vernon, P A; Boomsma, Dorret I
2002-05-01
Hierarchical models of intelligence are highly informative and widely accepted. Application of these models to twin data, however, is sparse. This paper addresses the question of how a genetic hierarchical model fits the Wechsler Adult Intelligence Scale (WAIS) subtests and the Raven Standard Progressive test score, collected in 194 18-year-old Dutch twin pairs. We investigated whether first-order group factors possess genetic and environmental variance independent of the higher-order general factor and whether the hierarchical structure is significant for all sources of variance. A hierarchical model with the 3 Cohen group-factors (verbal comprehension, perceptual organisation and freedom-from-distractibility) and a higher-order g factor showed the best fit to the phenotypic data and to additive genetic influences (A), whereas the unique environmental source of variance (E) could be modeled by a single general factor and specifics. There was no evidence for common environmental influences. The covariation among the WAIS group factors and the covariation between the group factors and the Raven is predominantly influenced by a second-order genetic factor and strongly support the notion of a biological basis of g.
Carlozzi, Noelle E; Kirsch, Ned L; Kisala, Pamela A; Tulsky, David S
2015-01-01
This study examined the clinical utility of the Wechsler Adult Intelligence Scales-Fourth Edition (WAIS-IV) in individuals with complicated mild, moderate or severe TBI. One hundred individuals with TBI (n = 35 complicated mild or moderate TBI; n = 65 severe TBI) and 100 control participants matched on key demographic variables from the WAIS-IV normative dataset completed the WAIS-IV. Univariate analyses indicated that participants with severe TBI had poorer performance than matched controls on all index scores and subtests (except Matrix Reasoning). Individuals with complicated mild/moderate TBI performed more poorly than controls on the Working Memory Index (WMI), Processing Speed Index (PSI), and Full Scale IQ (FSIQ), and on four subtests: the two processing speed subtests (SS, CD), two working memory subtests (AR, LN), and a perceptual reasoning subtest (BD). Participants with severe TBI had significantly lower scores than the complicated mild/moderate TBI on PSI, and on three subtests: the two processing speed subtests (SS and CD), and the new visual puzzles test. Effect sizes for index and subtest scores were generally small-to-moderate for the group with complicated mild/moderate and moderate-to-large for the group with severe TBI. PSI also showed good sensitivity and specificity for classifying individuals with severe TBI versus controls. Findings provide support for the clinical utility of the WAIS-IV in individuals with complicated mild, moderate, and severe TBI.
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
Ryan, Joseph J; Swopes-Willhite, Nicole; Franklin, Cassi; Kreiner, David S
2015-01-01
This study utilized a sample of 50 college students to assess the possibility that responding to the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) Symbol Search subtest items with an "x" instead of a "single slash mark" would affect performance. A second sample of 50 college students was used to assess the impact on WAIS-IV Block Design performance of presenting all the items with only red surfaces facing up. The modified Symbol Search and Block Design administrations yielded mean scaled scores and raw scores that did not differ significantly from mean scores obtained with standard administrations. Findings should not be generalized beyond healthy, well-educated young adults.
Sellers, Kristin K; Mellin, Juliann M; Lustenberger, Caroline M; Boyle, Michael R; Lee, Won Hee; Peterchev, Angel V; Fröhlich, Flavio
2015-09-01
Transcranial direct current stimulation (tDCS) modulates excitability of motor cortex. However, there is conflicting evidence about the efficacy of this non-invasive brain stimulation modality to modulate performance on cognitive tasks. Previous work has tested the effect of tDCS on specific facets of cognition and executive processing. However, no randomized, double-blind, sham-controlled study has looked at the effects of tDCS on a comprehensive battery of cognitive processes. The objective of this study was to test if tDCS had an effect on performance on a comprehensive assay of cognitive processes, a standardized intelligence quotient (IQ) test. The study consisted of two substudies and followed a double-blind, between-subjects, sham-controlled design. In total, 41 healthy adult participants were included in the final analysis. These participants completed the Wechsler Adult Intelligence Scale, Fourth Edition (WAIS-IV) as a baseline measure. At least one week later, participants in substudy 1 received either bilateral tDCS (anodes over both F4 and F3, cathode over Cz, 2 mA at each anode for 20 min) or active sham tDCS (2 mA for 40 s), and participants in substudy 2 received either right or left tDCS (anode over either F4 or F3, cathode over Cz, 2 mA for 20 min). In both studies, the WAIS-IV was immediately administered following stimulation to assess for performance differences induced by bilateral and unilateral tDCS. Compared to sham stimulation, right, left, and bilateral tDCS reduced improvement between sessions on Full Scale IQ and the Perceptual Reasoning Index. This demonstration that frontal tDCS selectively degraded improvement on specific metrics of the WAIS-IV raises important questions about the often proposed role of tDCS in cognitive enhancement. Copyright © 2015 Elsevier B.V. All rights reserved.
Greve, Kevin W.; Springer, Steven; Bianchini, Kevin J.; Black, F. William; Heinly, Matthew T.; Love, Jeffrey M.; Swift, Douglas A.; Ciota, Megan A.
2007-01-01
This study examined the sensitivity and false-positive error rate of reliable digit span (RDS) and the WAIS-III Digit Span (DS) scaled score in persons alleging toxic exposure and determined whether error rates differed from published rates in traumatic brain injury (TBI) and chronic pain (CP). Data were obtained from the files of 123 persons…
DEFF Research Database (Denmark)
Posthuma, Daniëlle; Baare, Wim F.C.; Hulshoff Pol, Hilleke E.
2003-01-01
We recently showed that the correlation of gray and white matter volume with full scale IQ and the Working Memory dimension are completely mediated by common genetic factors (Posthuma et al., 2002). Here we examine whether the other WAIS III dimensions (Verbal Comprehension, Perceptual Organization......, Processing Speed) are also related to gray and white matter volume, and whether any of the dimensions are related to cerebellar volume. Two overlapping samples provided 135 subjects from 60 extended twin families for whom both MRI scans and WAIS III data were available. All three brain volumes are related...... to Working Memory capacity (r = 0.27). This phenotypic correlation is completely due to a common underlying genetic factor. Processing Speed was genetically related to white matter volume (r(g) = 0.39). Perceptual Organization was both genetically (r(g) = 0.39) and environmentally (r(e) = -0.71) related...
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Hopwood, Christopher J.; Richard, David C. S.
2005-01-01
Research on the Wechsler Adult Intelligence Scale-Revised and Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) suggests that practicing clinical psychologists and graduate students make item-level scoring errors that affect IQ, index, and subtest scores. Studies have been limited in that Full-Scale IQ (FSIQ) and examiner administration,…
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Duijvenbode, N. van; Didden, H.C.M.; Hazel, T. van den; Engels, R.C.M.E.
2016-01-01
Objective: To investigate the reliability and validity of a Wechsler Abbreviated Scale of Intelligence-based Wechsler Adult Intelligence Scale - third edition (WAIS-III) short form (SF) in a sample of individuals with mild to borderline intellectual disability (MBID) (N=117; M-IQ=71.34; SDIQ=8.00,
Golay, Philippe; Lecerf, Thierry
2011-01-01
According to the most widely accepted Cattell-Horn-Carroll (CHC) model of intelligence measurement, each subtest score of the Wechsler Intelligence Scale for Adults (3rd ed.; WAIS-III) should reflect both 1st- and 2nd-order factors (i.e., 4 or 5 broad abilities and 1 general factor). To disentangle the contribution of each factor, we applied a…
El universo plástico y sensorial de La mano (Wong Kar Wai, 2004
Directory of Open Access Journals (Sweden)
Melendo, Ana
2012-04-01
Full Text Available En español: Con el presente artículo, queremos mostrar cómo Wong Kar Wai, heredero de un cine muy vinculado a la modernidad cinematográfica, plantea en el cortometraje La mano (2004 temas como la soledad, la actitud melancólica o la necesidad de ensimismamiento. Estos, junto al estudio de la geometría, los colores saturados y las calidades pictóricas, y bajo el prisma de un realismo metafísico, dan lugar a situaciones ópticas, sonoras y táctiles puras. Es así como en el film del cineasta chino se ponen de manifiesto, a través de la presencia del fragmento corporal y la metonimia, las texturas, coloreadas y sonoras, que configuran los espacios sensoriomotrices del submundo en el que acontece la historia. In english: In this article, we show how Wong Kar Wai, heir to a filmography closely linked to cinematographic modernity, explores themes such as loneliness, melancholy, or self-absorption in his short film The Hand (2004. These themes, together with his study of geometry, saturated colours and pictorial qualities through the prism of metaphysical realism, give rise to purely optical, sonorous and tactile situations. In this way, the Chinese film director reveals, through the presence of a body fragment and metonymy, the colourful and sonorous textures that form the sensory-motor spaces of the underworld in which the story is set.
Directory of Open Access Journals (Sweden)
Haiyang Fang
2013-01-01
Full Text Available Huang-Lian-Jie-Du-Tang (HLJDT is a classic TCM formula to clear “heat” and “poison” that exhibits antirheumatic activity. Here we investigated the therapeutic mechanisms of HLJDT at protein network level using bioinformatics approach. It was found that HLJDT shares 5 target proteins with 3 types of anti-RA drugs, and several pathways in immune system and bone formation are significantly regulated by HLJDT’s components, suggesting the therapeutic effect of HLJDT on RA. By defining an antirheumatic effect score to quantitatively measure the therapeutic effect, we found that the score of each HLJDT’s component is very low, while the whole HLJDT achieves a much higher effect score, suggesting a synergistic effect of HLJDT achieved by its multiple components acting on multiple targets. At last, topological analysis on the RA-associated PPI network was conducted to illustrate key roles of HLJDT’s target proteins on this network. Integrating our findings with TCM theory suggests that HLJDT targets on hub nodes and main pathway in the Hot ZENG network, and thus it could be applied as adjuvant treatment for Hot-ZENG-related RA. This study may facilitate our understanding of antirheumatic effect of HLJDT and it may suggest new approach for the study of TCM pharmacology.
Posthuma, D.; Baare, W.F.C.; Hulshoff Pol, H.E.; Kahn, R.S.; Boomsma, D.I.; de Geus, E.J.C.
2003-01-01
We recently showed that the correlation of gray and white matter volume with full scale IQ and the Working Memory dimension are completely mediated by common genetic factors (Posthuma et al., 2002). Here we examine whether the other WAIS III dimensions (Verbal Comprehension, Perceptual Organization,
Directory of Open Access Journals (Sweden)
Bertin Dominique
2016-01-01
Full Text Available The Liane River is a small costal river, famous for its floods, which can affect the city of Boulogne-sur-Mer. Due to the complexity of land cover and hydrologic processes, a black-box non-linear modelling was chosen using neural networks. The multilayer perceptron model, known for its property of universal approximation is thus chosen. Four models were designed, each one for one forecasting horizon using rainfall forecasts: 24h, 12h, 6h, 3h. The desired output of the model is original: it represents the maximal value of the water level respectively 24h, 12h, 6h, 3h ahead. Working with best forecasts of rain (the observed ones during the event in the past, on the major flood of the database in test set, the model provides excellent forecasts. Nash criteria calculated for the four lead times are 0.98 (3h, 0.97 (6h, 0.91 (12h, 0.89 (24h. Designed models were thus estimated as efficient enough to be implemented in a specific tool devoted to real time operational use. The software tool is described hereafter: designed in Java, it presents a friendly interface allowing applying various scenarios of future rainfalls, and a graphical visualization of the predicted maximum water levels and their associated real time observed values.
Fegyveresi, John M.; Alley, R.B.; Spencer, M.K.; Fitzpatrick, J.J.; Steig, E.J.; White, J.W.C.; McConnell, J.R.; Taylor, K.C.
2011-01-01
A surface cooling of ???1.7??C occurred over the ???two millennia prior to ???1700 CE at the West Antarctic ice sheet (WAIS) Divide site, based on trends in observed bubble number-density of samples from the WDC06A ice core, and on an independently constructed accumulation-rate history using annual-layer dating corrected for density variations and thinning from ice flow. Density increase and grain growth in polar firn are both controlled by temperature and accumulation rate, and the integrated effects are recorded in the number-density of bubbles as the firn changes to ice. Numberdensity is conserved in bubbly ice following pore close-off, allowing reconstruction of either paleotemperature or paleo-accumulation rate if the other is known. A quantitative late-Holocene paleoclimate reconstruction is presented for West Antarctica using data obtained from the WAIS Divide WDC06A ice core and a steady-state bubble number-density model. The resultant temperature history agrees closely with independent reconstructions based on stable-isotopic ratios of ice. The ???1.7??C cooling trend observed is consistent with a decrease in Antarctic summer duration from changing orbital obliquity, although it remains possible that elevation change at the site contributed part of the signal. Accumulation rate and temperature dropped together, broadly consistent with control by saturation vapor pressure.
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Directory of Open Access Journals (Sweden)
Gutembergue Livramento
Full Text Available Este ensaio traz elementos da medicina ocidental, da medicina tradicional chinesa e da sociologia do trabalho para reflexão sobre o Qi Gong - exercícios terapêuticos, um dos pilares da Medicina Tradicional Chinesa (MTC - como importante meio de prevenção da LER/DORT e recuperação da saúde. Considerando a natureza interdisciplinar e diversos níveis de prevenção, aborda aspectos sociológicos sobre as condições de trabalho frequentemente relacionadas com este tipo de adoecimento e categorias de trabalhadores mais acometidos. Focaliza aspectos médicos sobre a LER/DORT e as Síndromes de Bloqueio na MTC, estabelecendo canais de articulação e contribuição entre esses campos de conhecimento sobre a saúde humana. Ressalta o Qi Gong como importante prática terapêutica e preventiva na MTC e sua adequação à LER/DORT. No âmbito do Qi Gong, focaliza o Lian Gong Shi Ba Fa - Lian Gong em 18 Terapias, já amplamente experimentado na China e divulgado, inclusive no Brasil, para tratar e prevenir síndromes de dor em região cervical, ombros, membros superiores, membros inferiores e região lombar. À guisa de conclusão, são apresentadas algumas reflexões sobre a propriedade e a importância do Qi Gong na reabilitação e na prevenção da LER/DORT.
Zhu, Huaxu; Qian, Zhilei; Li, Huan; Guo, Liwei; Pan, Linmei; Zhang, Qichun; Tang, Yuping
2012-05-07
Huang-Lian-Jie-Du-Tang (HLJDT, or Oren-gedoku-to in Japanese), an important multi-herb remedy in China and other Asia countries, has been used clinically to treat cerebral ischemia for decades. According to the previous studies we have reported, an HPLC method was developed and validated for determination of berberine, palmatine, baicalin, baicalein and geniposide simultaneously in MCAO rat plasma after administration of HLJDT aqueous extract. A classified integral pharmacokinetic method was put forward after having compared the integrated concentration-time profile with that of single component. An AUC based weighting approach was used for integrated principle. The results indicated the classified integral pharmacokinetic profile of index components from HLJDT could reveal the pharmacokinetic behavior of original components, and was corresponding to the holistic pharmacological effects of anti-ischemia with HLJDT. This study was aimed to explore an approach that could be applied to integrate the pharmacokinetic behavior of different components derived from HLJDT. The integrated pharmacokinetic results also provided more information for further understanding of the clinical cerebrovascular disease in use of HLJDT. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
El universo plástico y sensorial de la mano (Wong Kar Wai, 2004
Directory of Open Access Journals (Sweden)
Ana MELENDO CRUZ
2014-10-01
Full Text Available In this article, we show how Wong Kar Wai, heir to a filmography closely linked to cinematographic modernity, explores themes such as loneliness, melancholy, or self-absorption in his short film The Hand (2004. These themes, together with his study of geometry, saturated colours and pictorial qualities through the prism of metaphysical realism, give rise to purely optical, sonorous and tactile situations. In this way, the Chinese film director reveals, through the presence of a body fragment and metonymy, the colourful and sonorous textures that form the sensory-motor spaces of the underworld in which the story is set
Novel pharmacokinetic studies of the Chinese formula Huang-Lian-Jie-Du-Tang in MCAO rats.
Zhu, Huaxu; Qian, Zhilei; He, Feng; Liu, Mengzhu; Pan, Linmei; Zhang, Qichun; Tang, Yuping
2013-07-15
Our previous studies showed that after oral administration of an Huang-Lian-Jie-Du-Tang (HLJDT) decoction, there is a higher concentration of the pure components, berberine, baicalin and gardenoside in the plasma of Middle cerebral artery occlusion (MCAO) rats than in sham-operated rats, The aim of the present study was to determine whether these components could be reliably measured in MCAO rat tissues. First, the plasma concentration-time profiles of berberine, palmatine, baicalin, baicalein and gardenoside were characterised in MCAO rats after oral administration of the aqueous extract of HLJDT. Subsequently, liver, lung and kidney tissues were obtained from sudden death MCAO rats in the absorption phase (0.25 h), the distribution phase (1.0 h) and the elimination phase (8.0 h) after administration of the HLJDT aqueous extract. An HPLC method was developed and validated for the determination of the distribution characteristics of berberine, palmatine, baicalin, baicalein and gardenoside simultaneously from the above-mentioned rat tissues. The results indicated that berberine, palmatine, baicalin and baicalein distributed rapidly and accumulated at high levels in the lung, while gardenoside distributed widely in the lung and the kidney. To the best of our knowledge, this is the first report to describe the distribution of the active ingredients derived from HLJDT in MCAO rat tissues. The tissue distribution results provide a biopharmaceutical basis for the design of the clinic application of HLJDT in cerebrovascular disease. Copyright © 2012 Elsevier GmbH. All rights reserved.
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Goldie Roth unchained: risk and its management in Lian Tanner’s Museum of Thieves
Directory of Open Access Journals (Sweden)
Wood, Danielle
2014-06-01
Full Text Available In her children’s action adventure novel Museum of Thieves, Lian Tanner overtly critiques adult risk-aversion and the over-protection of children. The protagonist is Goldie, an unruly child who escapes the oppressive regime of the City of Jewel where children up to the age of 12 are chained, for their own safety, to adult companions. Goldie escapes Jewel’s power structures and enters a mysterious museum housing the city’s unwanted wildness and danger. In its opening chapter Museum of Thieves establishes a subversive schema that problematises concepts of safety and order and glorifies chaos and risk, but this paper argues that as the novel progresses the author finds the schema increasingly difficult to control. It is tempting to read the museum as a “time out” zone such as CS Lewis’s Narnia, L Frank Baum’s Oz, and Maurice Sendak’s “place where the wild things are”: a space in which child characters can gain self-knowledge and skills before returning to an adult-dominated order. However, because of the degree to which Jewel and its structures are pathologised, Tanner finds she cannot bring Goldie back from “time out”. But rather than being a transgressive text, Museum of Thieves ends in a much less subversive place than it sets out to reach; the museum is revealed as a tightly controlled space and Goldie is well-protected, both within the diegesis by the museum’s special features, and beyond the diegesis by the author and the author’s cognisance of contemporary publishing industry expectations about the depiction of risk in children’s fiction.
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
WISC-III e WAIS-III na avaliação da inteligência de cegos
Nascimento, Elizabeth do; Flores-Mendoza, Carmen Elvira
2007-01-01
Diante da escassez de pesquisas nacionais e de testes psicológicos destinados a avaliar pessoas cegas, desenvolveu-se um estudo psicométrico com as escalas verbais dos testes WISC-III e WAIS-III. Após as adaptações de alguns estímulos e das instruções, os testes foram aplicados em crianças (N = 120) e adultos (N = 52) residentes em Belo Horizonte. Os resultados indicaram que as escalas verbais modificadas apresentam uma boa consistência interna (alfa> 0,80). Além disso, a investigação da vali...
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
Duangtep, Yuwadee; Narksawat, Kulaya; Chongsuwat, Rawadee; Rojanavipart, Peungchon
2010-05-01
An unhealthy lifestyle may lead to hypertension which can cause strokes and cardiovascular disease. The aim of this study was to identify the specific unhealthy lifestyle practices which could cause hypertension among hill tribe populations in Mae Fah Luang District of Chiang Rai Province, Thailand. In 2006, 196 patients with hypertension were selected from 2 district hospitals and 13 health centers as cases, and 196 normotensive subjects from a local neighborhood were chosen as controls. Trained health personnel collected data by interviewing subjects from both groups regarding unhealthy lifestyles and other factors. All participants had a physical examination at the time of interview. The results from multiple logistic regression analysis show the factors associated with hypertension among the hill tribe people studied were smoking (OR 2.48; 95% CI 1.43-4.30, p = 0.001), no or irregular exercise (OR 1.84; 95% CI 1.16-2.99, p = 0.005), being overweight (OR 2.96; 95% CI 1.69-5.18, p lifestyle changes in regards to smoking, eating habits and leisure time exercise programs. The adoption of such lifestyle changes would result in a reduced chance of being hypertensive, which could later reduce cardiovascular morbidity and mortality.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Low-res d15N and d18O of O2 in the WAIS Divide 06A Deep Core, Version 1
National Aeronautics and Space Administration — This data set is a low-resolution set of measurements of d15N of N2 and d18O of O2, along with dO2/N and dAr/N2 supporting data, in the WAIS Divide 3405 m long ice...
Kanai, Chieko; Tani, Masayuki; Hashimoto, Ryuichiro; Yamada, Takashi; Ota, Haruhisa; Watanabe, Hiromi; Iwanami, Akira; Kato, Nobumasa
2012-01-01
Little is known about the cognitive profiles of high-functioning Pervasive Developmental Disorders (PDD) in adults based on the Wechsler Intelligence Scale III (WAIS-III). We examined cognitive profiles of adults with no intellectual disability (IQ greater than 70), and in adults with Asperger's disorder (AS; n = 47), high-functioning autism (HFA;…
López, Enrique; Steiner, Alexander J; Hardy, David J; IsHak, Waguih W; Anderson, W Brantley
2016-01-01
This study explored within-subjects differences in the performance of 40 bilingual participants on the English and Spanish versions of the Wechsler Adult Intelligence Scale (WAIS) Digit Span task. To test the linguistic hypothesis that individuals would perform worse in Spanish because of its syllabic demand, we compared the number of syllables correctly recalled by each participant for every correct trial. Our analysis of the correct number of syllables remembered per trial showed that participants performed significantly better (i.e., recalling more syllables) in Spanish than in English on the total score. Findings suggest the Spanish version of the Digit Span (total score) was significantly more difficult than the English version utilizing traditional scoring methods. Moreover, the Forward Trial, rather than the Backward Trial, was more likely to show group differences between both language versions. Additionally, the Spanish trials of the Digit Span were correlated with language comprehension and verbal episodic memory measures, whereas the English trials of the Digit Span were correlated with confrontational naming and verbal fluency tasks. The results suggest that more research is necessary to further investigate other cognitive factors, rather than just syllabic demand, that might contribute to performance and outcome differences on the WAIS Digit Span in Spanish-English bilinguals.
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
Directory of Open Access Journals (Sweden)
Chenze Zhang
2016-08-01
Full Text Available Compounds in the form of precipitation (CFP are universally formed during the decocting of Chinese prescriptions, such as Huang-Lian-Jie-Du-Tang (HLJDT. The formation rate of HLJDT CFP even reached 2.63% ± 0.20%. The identification by liquid chromatography mass spectrometry (LC-MSn proved that the main chemical substances of HLJDT CFP are baicalin and berberine, which is coincident with the theory that the CFP might derive from interaction between acidic and basic compounds. To investigate the formation mechanism of HLJDT CFP, baicalin and berberine were selected to synthesize a simulated precipitation and then the baicalin–berberine complex was obtained. Results indicated that the melting point of the complex interposed between baicalin and berberine, and the UV absorption, was different from the mother material. In addition, 1H-NMR integral and high-resolution mass spectroscopy (HR-MS can validate that the binding ratio was 1:1. Compared with baicalin, the chemical shifts of H and C on glucuronide had undergone significant changes by 1H-, 13C-NMR, which proved that electron transfer occurred between the carboxylic proton and the lone pair of electrons on the N atom. Both HLJDT CFP and the baicalin–berberine complex showed protective effects against cobalt chloride-induced neurotoxicity in differentiated PC12 cells. It is a novel idea, studying the material foundation of CFP in Chinese prescriptions.
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
2011-12-06
... Unit, room 7046, of the main Commerce building. In addition, a complete version of the Decision... Producer (percent) Shanghai Lian Li Paper Products Shanghai Lian Li 94.91 Co., Ltd. Paper Products Co., Ltd. Shanghai Lian Li Paper Products Sentian Paper 94.91 Co., Ltd. Products Co., Ltd. Shanghai Lian Li Paper...
Posthuma, Daniëlle; Baaré, Wim F C; Hulshoff Pol, Hilleke E; Kahn, René S; Boomsma, Dorret I; De Geus, Eco J C
2003-04-01
We recently showed that the correlation of gray and white matter volume with full scale IQ and the Working Memory dimension are completely mediated by common genetic factors (Posthuma et al., 2002). Here we examine whether the other WAIS III dimensions (Verbal Comprehension, Perceptual Organization, Processing Speed) are also related to gray and white matter volume, and whether any of the dimensions are related to cerebellar volume. Two overlapping samples provided 135 subjects from 60 extended twin families for whom both MRI scans and WAIS III data were available. All three brain volumes are related to Working Memory capacity (r = 0.27). This phenotypic correlation is completely due to a common underlying genetic factor. Processing Speed was genetically related to white matter volume (r(g) = 0.39). Perceptual Organization was both genetically (r(g) = 0.39) and environmentally (r(e) = -0.71) related to cerebellar volume. Verbal Comprehension was not related to any of the three brain volumes. It is concluded that brain volumes are genetically related to intelligence which suggests that genes that influence brain volume may also be important for intelligence. It is also noted however, that the direction of causation (i.e., do genes influence brain volume which in turn influences intelligence, or alternatively, do genes influence intelligence which in turn influences brain volume), or the presence or absence of pleiotropy has not been resolved yet.
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Directory of Open Access Journals (Sweden)
Sérgio Henrique Almeida da Silva Junior
2011-06-01
Full Text Available Este artigo estima a validade e a confiabilidade do índice de capacidade para o trabalho (ICT em 1.436 trabalhadores de enfermagem de três hospitais públicos do Rio de Janeiro, Brasil. Foi estimada a validade dimensional, por meio de análise fatorial exploratória e também a validade correlacional, relacionando o ICT com construtos teoricamente relevantes. A confiabilidade foi avaliada pela análise de consistência interna utilizando o coeficiente alfa de Cronbach e ômega de McDonald. A análise fatorial indicou uma estrutura bidimensional, explicando 52,8% da variância acumulada para os componentes principais e 42% para os eixos principais. As hipóteses teóricas da validade de construto foram confirmadas com correlação direta e significativa do ICT com os escores de recompensa, controle e autoavaliação do estado de saúde; correlação inversa e significativa com a escala de necessidade de recuperação após o trabalho, distúrbios psíquicos menores, esforço, excesso de comprometimento e demanda. Concluiu-se que o ICT apresentou propriedades psicométricas adequadas.This article assesses the validity and reliability of the work ability index (WAI for 1,436 nurses in three public hospitals in Rio de Janeiro, Brazil. The study estimated the dimensional validity by means of exploratory factor analysis, as well as correlational validity, relating WAI to theoretically relevant constructs. Reliability was evaluated by internal consistency analysis, using Cronbach's alpha and McDonald's omega. Factor analysis indicated a two-dimensional structure explaining 52.8% of the accumulated variance for the principal components and 42% for the principal axes. The theoretical hypotheses for the construct's validity were confirmed, with direct and significant correlation between the WAI and the reward, control, and self-rated health scores; an inverse and significant correlation with the scale on need for recovery after work, minor psychological
Richardson, John C.
This paper presents a study regarding the correlation of the Stanford-Binet: 4th Edition Intelligence Quotient (IQ) scores with the Wechsler Adult Intelligence Scale-Revised (WAIS-R) IQ scores for the purpose of improving the identification process for educable mentally handicapped (EMH) school age adolescents and young adults. The sample included…
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
DEFF Research Database (Denmark)
Posthuma, Daniëlle; Baare, Wim F.C.; Hulshoff Pol, Hilleke E.
2003-01-01
We recently showed that the correlation of gray and white matter volume with full scale IQ and the Working Memory dimension are completely mediated by common genetic factors (Posthuma et al., 2002). Here we examine whether the other WAIS III dimensions (Verbal Comprehension, Perceptual Organization...... to Working Memory capacity (r = 0.27). This phenotypic correlation is completely due to a common underlying genetic factor. Processing Speed was genetically related to white matter volume (r(g) = 0.39). Perceptual Organization was both genetically (r(g) = 0.39) and environmentally (r(e) = -0.71) related...
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
National Oceanic and Atmospheric Administration, Department of Commerce — This dataset focuses on studies of water quality in the Ala Wai Canal in order to determine its role of point and non point source disharge into Mamala Bay. The...
Buczylowska, Dorota; Petermann, Franz
2017-01-01
Data from five subtests of the Executive Functions Module of the German Neuropsychological Assessment Battery (NAB) and all ten core subtests of the German Wechsler Adult Intelligence Scale - Fourth Edition (WAIS-IV) were used to examine the relationship between executive functions and intelligence in a comparison of two age groups: individuals aged 18-59 years and individuals aged 60-88 years. The NAB subtests Categories and Word Generation demonstrated a consistent correlation pattern for both age groups. However, the NAB Judgment subtest correlated more strongly with three WAIS-IV indices, the Full Scale IQ (FSIQ), and the General Ability Index (GAI) in the older adult group than in the younger group. Additionally, in the 60-88 age group, the Executive Functions Index (EFI) was more strongly correlated with the Verbal Comprehension Index (VCI) than with the Perceptual Reasoning Index (PRI). Both age groups demonstrated a strong association of the EFI with the FSIQ and the Working Memory Index (WMI). The results imply the potential diagnostic utility of the Judgment subtest and a significant relationship between executive functioning and crystallized intelligence at older ages. Furthermore, it may be concluded that there is a considerable age-independent overlap between the EFI and general intelligence, as well as between the EFI and working memory.
Directory of Open Access Journals (Sweden)
Ana Carolina Zeferino Menezes
2011-01-01
Full Text Available Dados indicam que o envelhecimento, ainda que saudável, acarreta um declínio normal no desempenho intelectual. O presente estudo teve por objetivo investigar o desenvolvimento intelectual de idosos em diferentes domínios avaliados pela WAIS-III. A partir de um delineamento longitudinal, 47 participantes foram divididos em duas faixas etárias: idosos-jovens (até 74 anos e idosos-idosos (acima de 75 anos e seus desempenhos foram comparados após oito anos de intervalo. Resultados mostraram que idosos-jovens apresentaram ganhos nas habilidades avaliadas, embora em apenas dois índices estes tenham sido estatisticamente significativos. Com relação às capacidades de compreensão verbal e linguagem, os ganhos eram esperados. Já Memória, Organização Perceptual, Velocidade de Processamento, QI de Execução e Total não se comportaram como grande parte dos estudos reporta. Resultados para os idosos-idosos estão de acordo com a literatura: habilidades vulneráveis (organização perceptual, aprendizagem, memória, resolução de problemas e velocidade de processamento tiveram decréscimos após os oito anos entre as avaliações. Embora nem todos os resultados tenham sido significativos, corroboram dados de pesquisas que definem a idade de declínios significativos após os 75 anos. Concluindo, os resultados indicaram que os idosos não apresentaram declínio nas habilidades intelectuais avaliadas até a idade de 74 anos, a partir de quando alguma perda foi encontrada. A velocidade de processamento foi a única habilidade que apresentou declínio significativo. Portanto, as variações nos desempenhos não caracterizam um padrão de declínio generalizado, ou seja, não ocorrem em todas as habilidades e variam conforme a idade.Data have indicated that aging, even if in a healthy process, lead to a normal decrease in cognitive performance. The current study aims at investigating the intellectual development of elderly people in different
Directory of Open Access Journals (Sweden)
Elce de Seixas Nascimento
2013-07-01
Full Text Available Objetivo: Conhecer os efeitos do Lian Gong em pacientes hipertensos usuários da Unidade de Saúde da Família. Métodos: Estudo qualitativo descritivo, envolvendo 20 voluntários, independente do sexo, com idade entre 45 e 70 anos, residentes no município de ParnaíbaPI, Brasil. A intervenção foi realizada em ambiente calmo e livre de ruídos, no período de agosto a setembro de 2011, três vezes por semana, com um total de 30 sessões. Utilizouse a ferramenta Grupo Focal no início e ao final da intervenção. Aplicou-se a técnica de análise temática do discurso do sujeito coletivo (DSC, utilizando três figuras metodológicas: ideia central, expressões-chave e DSC. Foram utilizadas operações estatísticas simples (percentagens para quantificar as falas. Resultados: Antes da intervenção, o grupo referiu ter percebido a hipertensão pela manifestação de sintomas físicos e/ou psíquicos a partir do diagnóstico e da rejeição ao tratamento, revelando ter um nível superficial de conhecimento ou informações equivocadas acerca da doença. Após a intervenção, foi referido melhora dos sintomas físicos e emocionais, nas relações sociais e familiares, bem como na dificuldade de mudanças de hábitos, que pode ser atenuada com o apoio multiprofissional e a continuação dos exercícios físicos. Considerações finais: A prática de Lian Gong se mostrou eficaz para a melhoria do estado físico e emocional de pacientes hipertensos, podendo ser uma terapia coadjuvante ao controle da hipertensão arterial sistêmica na atenção primária à saúde.
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Directory of Open Access Journals (Sweden)
Laura L. Wayne
2013-11-01
Full Text Available Ricinoleic acid, a hydroxylated fatty acid (HFA present in castor (Ricinus communis seeds, is an important industrial commodity used in products ranging from inks and paints to polymers and fuels. However, due to the deadly toxin ricin and allergens also present in castor, it would be advantageous to produce ricinoleic acid in a different agricultural crop. Unfortunately, repeated efforts at heterologous expression of the castor fatty acid hydroxylase (RcFAH12 in the model plant Arabidopsis thaliana have produced only 17-19% HFA in the seed triacylglycerols (TAG, whereas castor seeds accumulate up to 90% ricinoleic acid in the endosperm TAG. RcFAH12 requires an electron supply from NADH:cytochrome b5 reductase (CBR1 and cytochrome b5 (Cb5 to synthesize ricinoleic acid. Previously, our laboratory found a mutation in the Arabidopsis CBR1 gene, cbr1-1, that caused an 85% decrease in HFA levels in the RcFAH12 Arabidopsis line. These results raise the possibility that electron supply to the heterologous RcFAH12 may limit the production of HFA. Therefore, we hypothesized that by heterologously expressing RcCb5, the reductant supply to RcFAH12 would be improved and lead to increased HFA accumulation in Arabidopsis seeds. Contrary to this proposal, heterologous expression of the top three RcCb5 candidates did not increase HFA accumulation. Furthermore, coexpression of RcCBR1 and RcCb5 in RcFAH12 Arabidopsis also did not increase in HFA levels compared to the parental lines. These results demonstrate that the Arabidopsis electron transfer system is supplying sufficient reductant to RcFAH12 and that there must be other bottlenecks limiting the accumulation of HFA.
Predictors of WAIS-R vocabulary in late life: Differences by race.
Morin, Ruth T; Midlarsky, Elizabeth
2017-11-01
Vocabulary scores tend to be significantly related to education in heterogeneous groups of older adults, even after controlling for confounding variables. However, there may be other factors that impinge on cognitive functioning for certain demographic groups, particularly those whose educational opportunities were limited, and who may have experienced considerable stress as a result of their minority status. This study sought to explore possible predictors of vocabulary scores among African American and White older adults. In this study, samples of African American (N = 165) and White (N = 146) community-dwelling older adults reported their level of education, perceived health status, and number of stressful life events, and were administered the Wechsler Adult Intelligence Scale-Revised (WAIS-R) Vocabulary subtest. Among the White participants, level of education was the only significant predictor of vocabulary score after controlling for perceived health and exposure to stress. Among African American participants, education was also a significant predictor of vocabulary score. However perceived health and number of stressful life events were also significantly predictors of vocabulary score. Findings indicate that for certain cohorts of older adults, especially those who may have experienced stressful life circumstances and health disparities as a result of racial inequality, education may not be the only variable that predicts verbal intelligence. The importance of investigating cognitive functioning within a broader sociocultural context is discussed.
Yin, Shufei; Zhu, Xinyi; Huang, Xin; Li, Juan
2015-01-01
Visuospatial deficits have long been recognized as a potential predictor of dementia, with visuospatial ability decline having been found to accelerate in later stages of dementia. We, therefore, believe that the visuospatial performance of patients with mild cognitive impairment (MCI) and dementia (Dem) might change with varying visuospatial task difficulties. This study administered the Wechsler Adult Intelligence Scale-Revised (WAIS-R) Block Design Test (BDT) to determine whether visuospatial ability can help discriminate between MCI patients from Dem patients and normal controls (NC). Results showed that the BDT could contribute to the discrimination between MCI and Dem. Specifically, simple BDT task scores could best distinguish MCI from Dem patients, while difficult BDT task scores could contribute to discriminating between MCI and NC. Given the potential clinical value of the BDT in the diagnosis of Dem and MCI, normative data stratified by age and education for the Chinese elderly population are presented for use in research and clinical settings.
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Directory of Open Access Journals (Sweden)
Chen XY
2015-04-01
Full Text Available Xiu-Ying Chen,1–3 Wu-Lian Chen,4 Min Ma,1–3 Chao Gu,1,2 Xi-Rong Xiao,1,2 Bin Li1,2 1Obstetrics and Gynecology Hospital, Fudan University, 2Department of Obstetrics and Gynecology of Shanghai Medical College, Fudan University, 3Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, 4State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Fudan University, Shanghai, People’s Republic of ChinaAbstract: The use of triptolide (TP is limited by its poor water solubility and severe toxicity. In this study, we developed an active drug delivery system (TP-loaded nanoparticles that could help improve the water solubility of TP and decrease its toxicity. Then, we investigated whether TP-loaded nanoparticles could be used to establish a novel premature ovarian insufficiency mouse model. The mice treated with TP-loaded nanoparticles for 35 days displayed normal growth, decreased serum antimullerian hormone, prominent ovarian fibrosis and vacuolar changes, fewer follicles and corpus lutea, increased collapsed oocytes and follicle apoptosis, and sterility. In conclusion, this model appears to show the reproductive characteristics associated with premature ovarian insufficiency in women and will allow us to study the mechanism of the effects of traditional Chinese medicine on gonadal toxicity. Keywords: peptide, nanoparticles, drug delivery, premature ovarian insufficiency, animal model
Directory of Open Access Journals (Sweden)
Chen Z
2016-08-01
Full Text Available Zhanfei Chen,1,* Fen Lian,1,* Xiaoqian Wang,1 Yanling Chen,1,2 Nanhong Tang1,2 1Fujian Institute of Hepatobiliary Surgery, Fujian Medical University Union Hospital, 2Key Laboratory of Ministry of Education for Gastrointestinal Cancer, Research Center for Molecular Medicine, Fujian Medical University, Fuzhou, People’s Republic of China *These authors contributed equally to this work Abstract: The polyamidoamine (PAMAM dendrimer, a type of macromolecule material, has been used in spheroidal cell culture and drug delivery in recent years. However, PAMAM is not involved in the study of hepatic cell-spheroid culture or its biological activity, particularly in detoxification function. Here, we constructed a PAMAM-dendrimer conjugate decorated by an integrin ligand: arginine–glycine–aspartic acid (RGD peptide. Our studies demonstrate that RGD–polyethylene glycol (PEG–PAMAM conjugates can promote singly floating hepatic cells to aggregate together in a sphere-like growth with a weak reactive oxygen species. Moreover, RGD-PEG-PAMAM conjugates can activate the AKT–MAPK pathway in hepatic cells to promote cell proliferation and improve basic function and ammonia metabolism. Together, our data support the hepatocyte sphere treated by RGD-PEG-PAMAM conjugates as a potential source of hepatic cells for a biological artificial liver system. Keywords: dendrimer, arginine–glycine–aspartic acid (RGD, liver cell, spheroid culture, ammonia metabolism
Directory of Open Access Journals (Sweden)
Thomas Kelahan
2018-01-01
Full Text Available Chan Sin-wai is a professor and chairman of the Department of Translation at the Chinese University of Hong Kong, Shenzhen. Additionally, he is the director of the Center for Translation Technology as well as the university’s MA Program in Computer-aided translation. In 2016, he published A New Comprehensive Chinese-English Dictionary, Routledge Encyclopedia of Translation Technology and Routledge Encyclopedia of the Chinese Language. His newest book, The Future of Translation Technology: Towards a World without Babel, is described as “an essential read for scholars and researchers of translation studies and computational linguistics, and a guide to system users and professionals.”
Directory of Open Access Journals (Sweden)
C. A. Silva
2000-09-01
Full Text Available Este estudo avaliou o peso molecular estimado (PM e as proporções de frações ácidos húmicos (FAH e frações ácidos fúlvicos (FAF presentes em substâncias húmicas (SH, extraídas com NaOH 0,1 M e resina trocadora de íons, originárias de Latossolo Vermelho-Escuro sob floresta e cultivado com laranja, em áreas com e sem calagem, por meio da cromatografia de exclusão por tamanho de alta eficiência (CETAE. Na calibração do PM com o tempo de retenção de diferentes compostos na coluna cromatográfica, utilizaram-se moléculas de sulfonato de poliestireno de sódio (SPS e acetona. A análise das substâncias húmicas revelou que as FAFs e FAHs dos materiais de solo apresentaram tempo de eluição e, portanto, pesos moleculares muito similares àqueles determinados para os ácidos padrões. Os cromatogramas obtidos mostraram que o uso e o manejo do solo não introduziram mudanças no PM e na relação FAF:FAH das substâncias húmicas. Por outro lado, o método de extração influenciou, de forma marcante, as proporções de FAH e FAF, com mais FAH nos materiais extraídos com a resina trocadora de íons e maiores proporções de FAF nas substâncias húmicas extraídas com NaOH. As proporções de FAF e FAH obtidas por meio do método proposto pela SISH estiveram muito próximas àquelas determinadas com a CETAE, no material húmico extraído com a resina Chelex, demonstrando o potencial desta técnica na determinação do PM e das proporções de FAH e FAF em substâncias húmicas originárias de solos.
Directory of Open Access Journals (Sweden)
Wei Ren
Full Text Available Huang-Lian-Jie-Du Decoction (HLJDD is a classical Traditional Chinese Medicine (TCM formula with heat-dissipating and detoxifying effects. It is used to treat inflammation-associated diseases. However, no systematic pharmacokinetic (PK and pharmacodynamic (PD data concerning the activity of HLJDD under inflammatory conditions is available to date. In the present study, the concentration-time profiles and the hepatic clearance rates (HCR of 41 major components in rat plasma in response to the oral administration of a clinical dose of HLJDD were investigated by LC-QqQ-MS using a dynamic multiple reaction monitoring (DMRM method. Additionally, the levels of 7 cytokines (CKs in the plasma and the body temperature of rats were analyzed. Furthermore, a PK-PD model was established to describe the time course of the hemodynamic and anti-inflammatory effects of HLJDD. As one of the three major active constituents in HLJDD, iridoids were absorbed and eliminated more easily and quickly than alkaloids and flavonoids. Compared with the normal controls, the flavonoids, alkaloids and iridoids in inflamed rats exhibited consistently changing trends of PK behaviors, such as higher bioavailability, slower elimination, delays in reaching the maximum concentration (Tmax and longer substantivity. The HCR of iridoids was different from that of alkaloids and flavonoids in inflamed rats. Furthermore, excellent pharmacodynamic effects of HLJDD were observed in inflamed rats. The levels of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, IL-1β, IL-10, and macrophage inflammatory protein-2 (MIP-2 and body temperature significantly decreased after the administration of HLJDD. Based on PK-PD modeling with the three-phase synchronous characterization of time-concentration-effect, flavonoids exhibited one mechanism of action in the anti-inflammatory process, while iridoids and alkaloids showed another mechanism of action. Taken together, the results demonstrated that
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
Fink, David; Storey, Bryan; Hood, David; Joy, Kurt; Shulmeister, James
2010-05-01
Quantitative assessment of the spatial and temporal scale of ice volume change of the West Antarctic ice sheet (WAIS) and Ross Ice Shelf since the last glacial maximum (LGM) ~20 ka is essential to accurately predict ice sheet response to current and future climate change. Although global sea level rose by approximately 120 metres since the LGM, the contribution of polar ice sheets is uncertain and the timing of any such contribution is controversial. Mackintosh et al (2007) suggest that sectors of the EAIS, similar to those studied at Framnes Mountains where the ice sheet slowly calves at coastal margins, have made marginal contributions to global sea-level rise between 13 and 7 ka. In contrast, Stone et al (2003) document continuing WAIS decay during the mid-late Holocene, raising the question of what was the response of the WAIS since LGM and into the Holocene. Terrestrial evidence is restricted to sparse coastal oasis and ice free mountains which archive limits of former ice advances. Mountain ranges flanking the Darwin-Hatherton glaciers exhibit well-defined moraines, weathering signatures, boulder rich plateaus and glacial tills, which preserve the evidence of advance and retreat of the ice sheet during previous glacial cycles. Previous studies suggest a WAIS at the LGM in this location to be at least 1,000 meters thicker than today. As part of the New Zealand Latitudinal Gradient Project along the Transantarctic, we collected samples for cosmogenic exposure dating at a) Lake Wellman area bordering the Hatherton Glacier, (b) Roadend Nunatak at the confluence of the Darwin and Hatherton glaciers and (c) Diamond Hill which is positioned at the intersection of the Ross Ice Shelf and Darwin Glacier outlet. While the technique of exposure dating is very successful in mid-latitude alpine glacier systems, it is more challenging in polar ice-sheet regions due to the prevalence of cold-based ice over-riding events and absence of outwash processes which removes
ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R
Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia
Generation of healthy mice from gene-corrected disease-specific induced pluripotent stem cells.
Directory of Open Access Journals (Sweden)
Guangming Wu
2011-07-01
Full Text Available Using the murine model of tyrosinemia type 1 (fumarylacetoacetate hydrolase [FAH] deficiency; FAH⁻/⁻ mice as a paradigm for orphan disorders, such as hereditary metabolic liver diseases, we evaluated fibroblast-derived FAH⁻/⁻-induced pluripotent stem cells (iPS cells as targets for gene correction in combination with the tetraploid embryo complementation method. First, after characterizing the FAH⁻/⁻ iPS cell lines, we aggregated FAH⁻/⁻-iPS cells with tetraploid embryos and obtained entirely FAH⁻/⁻-iPS cell-derived mice that were viable and exhibited the phenotype of the founding FAH⁻/⁻ mice. Then, we transduced FAH cDNA into the FAH⁻/⁻-iPS cells using a third-generation lentiviral vector to generate gene-corrected iPS cells. We could not detect any chromosomal alterations in these cells by high-resolution array CGH analysis, and after their aggregation with tetraploid embryos, we obtained fully iPS cell-derived healthy mice with an astonishing high efficiency for full-term development of up to 63.3%. The gene correction was validated functionally by the long-term survival and expansion of FAH-positive cells of these mice after withdrawal of the rescuing drug NTBC (2-(2-nitro-4-fluoromethylbenzoyl-1,3-cyclohexanedione. Furthermore, our results demonstrate that both a liver-specific promoter (transthyretin, TTR-driven FAH transgene and a strong viral promoter (from spleen focus-forming virus, SFFV-driven FAH transgene rescued the FAH-deficiency phenotypes in the mice derived from the respective gene-corrected iPS cells. In conclusion, our data demonstrate that a lentiviral gene repair strategy does not abrogate the full pluripotent potential of fibroblast-derived iPS cells, and genetic manipulation of iPS cells in combination with tetraploid embryo aggregation provides a practical and rapid approach to evaluate the efficacy of gene correction of human diseases in mouse models.
Directory of Open Access Journals (Sweden)
Kvittingen Eli-Anne
2009-12-01
Full Text Available Abstract A male patient, born to unrelated Belgian parents, presented at 4 months with epistaxis, haematemesis and haematochezia. On physical examination he presented petechiae and haematomas, and a slightly enlarged liver. Serum transaminases were elevated to 5-10 times upper limit of normal, alkaline phosphatases were 1685 U/L (180 s ( Fumarylacetoacetase (FAH protein and activity in cultured fibroblasts and liver tissue were decreased but not absent. 4-hydroxyphenylpyruvate dioxygenase activity in liver was normal, which is atypical for tyrosinemia type I. A novel mutation was found in the FAH gene: c.103G>A (Ala35Thr. In vitro expression studies showed this mutation results in a strongly decreased FAH protein expression. Dietary treatment with phenylalanine and tyrosine restriction was initiated at 4 months, leading to complete clinical and biochemical normalisation. The patient, currently aged 12 years, shows a normal physical and psychomotor development. This is the first report of mild tyrosinemia type I disease caused by an Ala35Thr mutation in the FAH gene, presenting atypically without increase of the diagnostically important toxic metabolites succinylacetone and succinylacetoacetate.
Temps, Espace et la Eeprésentation de la Subjectivité Dans les Films de Wong Kar-wai
Directory of Open Access Journals (Sweden)
MOREIRA MACEDO, Ludmila
2006-12-01
Full Text Available Given the importance of the filmmaker Wong Kar-wai not only in the panorama of the cinema of Hong Kong, but in the contemporary cinematographic production as a whole, this paper proposes an analysis of his work concentrated on the problem of the identity of his characters. What we may call the «wongian subject” can be analyzed through various elements such as the tension between past, present and future, the relationship to public and private space, the changes of the perception of time and memory. Another important question that is analyzed is the relationship of the films with the social and political context of contemporary Hong Kong, because the topics of love, loneliness and alienation which invade the protagonists find relation in the transnational character of the Asian cinema and the fusion – often problematic – between Orient and Occident.
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
WANNABES (PERSONAS QUE DESEAN SER AMPUTADAS. EVALUACIÓN NEUROPSICOLÓGICA CON EL WAIS III
Directory of Open Access Journals (Sweden)
Carolina Mora
2017-01-01
Full Text Available La presente investigación tiene tres objetivos: en primer lugar,dar a conocer el fenómeno Wannabe, queen los contextos académicos es conocido como Apotemnofilia, Xenomelia y/o Desorden de la Identidad de la Integridad Corporal(BIID por sus siglas en inglés,que se caracteriza por el deseo manifiesto de un sujeto cuyas extremidades están sanas por convertirse en una persona amputada. Ensegundo lugar, presentar el caso de un Wannabeque deseaamputarse la pierna izquierda, 4 dedos por debajo de la rodilla, se trata de un joven de 31 años, con formación universitaria y sin psicopatología identificable a partir del perfil de personalidad arrojado por el Test de Personalidad MMPI-2. En tercer lugar, presentar los resultados de un informe neuropsicológico elaborado con base en el WAIS III, a fin de detectar la posible disfuncióndel lóbuloparietal derecho, que frecuentemente se ha sugerido como la causa del fenómeno.Los resultados obtenidos indican que aunque el puntaje obtenido en la sub prueba llamada “Ensamblaje de Objetos” puede estar relacionadocon la disfunción en este lóbulo, no se cuenta con la evidencia clínica y conductual suficiente para aseverar que ella exista.
Directory of Open Access Journals (Sweden)
Adierson Gilvani Ebeling
2011-04-01
Full Text Available A dinâmica e os atributos da matéria orgânica do solo (MOS há muito vêm sendo estudados em solos minerais. Entretanto, em condições tropicais, poucos estudos envolvem os solos orgânicos e a caracterização das substâncias húmicas (SH, ou sua relação com atributos químicos relevantes, para avaliar o potencial agrícola. Os objetivos deste estudo foram: avaliar atributos químicos de Organossolos Háplicos de diferentes regiões do Brasil; quantificar o teor de C orgânico no solo e nas frações da MOS; e avaliar as relações entre esses atributos em cada ambiente de formação. Foram avaliados os atributos químicos e quantificados os teores de C orgânico total e das frações da MOS (ácido fúlvico - C-FAF, ácido húmico - C-FAH e humina - C-HUM, bem como as relações C-FAH/C-FAF, C-EA/C-HUM, em que C-EA (carbono do extrato alcalino é obtido pelo somatório de C-FAF e C-FAH. Os Organossolos apresentaram elevada acidez, saturação por bases abaixo de 50 % e elevada capacidade de troca catiônica potencial (T, embora com valores altos de Ca2+ e Mg2+ e de soma de bases, na maioria dos perfis. Os teores de C nas frações húmicas apresentaram correlação significativa com diferentes atributos dos solos, como entre os valores de C-FAH e de C-HUM e os teores de N, H+ e T. O C-HUM e o C-FAH predominaram sobre o C-FAF. A relação C-FAH/C-FAF foi menor nos horizontes mais superficiais, dos perfis com maior intensidade de uso ou efeito de queimadas, assim como os teores de matéria orgânica, C-HUM e C-FAH. Os atributos químicos e os teores de C nas substâncias húmicas refletiram o grau de transformação da MOS e alterações pelo uso agrícola, indicando a vulnerabilidade dos Organossolos.
Oceanic response to changes in the WAIS and astronomical forcing during the MIS31 superinterglacial
Directory of Open Access Journals (Sweden)
F. Justino
2017-09-01
Full Text Available Marine Isotope Stage 31 (MIS31, between 1085 and 1055 ka was characterized by higher extratropical air temperatures and a substantial recession of polar glaciers compared to today. Paleoreconstructions and model simulations have increased the understanding of the MIS31 interval, but questions remain regarding the role of the Atlantic and Pacific oceans in modifying the climate associated with the variations in Earth's orbital parameters. Multi-century coupled climate simulations, with the astronomical configuration of the MIS31 and modified West Antarctic Ice Sheet (WAIS topography, show an increase in the thermohaline flux and northward oceanic heat transport (OHT in the Pacific Ocean. These oceanic changes are driven by anomalous atmospheric circulation and increased surface salinity in concert with a stronger meridional overturning circulation (MOC. The intensified northward OHT is responsible for up to 85 % of the global OHT anomalies and contributes to the overall reduction in sea ice in the Northern Hemisphere (NH due to Earth's astronomical configuration. The relative contributions of the Atlantic Ocean to global OHT and MOC anomalies are minor compared to those of the Pacific. However, sea ice changes are remarkable, highlighted by decreased (increased cover in the Ross (Weddell Sea but widespread reductions in sea ice across the NH.
Mak, Chloe Miu; Lam, Ching-Wan; Chim, Stella; Siu, Tak-Shing; Ng, King-Fai; Tam, Sidney
2013-01-01
Tyrosinemia type I is an autosomal recessive disorder in tyrosine metabolism. In areas without expanded newborn screening, patients present with acute hepatorenal failure in early infancy. Diagnosis can be elusive when clinical presentation is non-specific and biochemical abnormalities are masked by secondary changes. This is the first Hong Kong Chinese report. A two-month-old Chinese male infant with unremarkable antenatal and postnatal history presented with progressive abdominal distension for three days. He suffered from end-stage liver failure, hypoglycemia and hepatic encephalopathy. Diagnostic work-up was complicated starting from rule-out sepsis, intestinal obstruction, volvulus, peritonitis, septic ileus, poisoning to metabolic diseases. Clinical, biochemical and genetic data was described. The patient showed increases in multiple plasma amino acids including tyrosine, phenylalanine and methionine, and hyper-excretions of 4-hydroxyphenyl-acetate, -pyruvate, and -lactate, as well as N-acetyltyrosine which could be seen in liver failure due to both tyrosinemia type I and non-metabolic conditions. Because of the volatile nature, succinylacetone was almost undetectable. The diagnosis was confirmed by genetic analysis of FAH with two novel mutations, viz. NM_000137.2:c.1063-1G>A and NM_000137.2:c.1035_1037del. Living-related liver transplantation was done. However, the patient still suffered many complications after the severe metabolic insult with hypoxic ischemic encephalopathy, cerebral atrophy, global developmental delay and cortical visual impairment. Because of the lack of expanded newborn screening in Hong Kong, this child unfortunately presented in the most severe form of tyrosinemia type I. Expanded newborn screening can save life and reduce the burden of diagnostic complexity. This illustrates the need for expanded newborn screening in Hong Kong. Copyright © 2012 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights
Zhang, Qichun; Bian, Huimin; Li, Yu; Guo, Liwei; Tang, Yuping; Zhu, Huaxu
2014-06-11
Huang-Lian-Jie-Du-Tang (HLJDT) is a classical heat-clearing and detoxicating formula of traditional Chinese medicine that is widely used to treat stroke. The present study was designed to investigate the effects of HLJDT preconditioning on neurons under oxygen and glucose deprivation (OGD) and rats subjected to middle cerebral artery occlusion (MCAO). A stroke model of rats was obtained through MCAO. Following HLJDT preconditioning, the cerebral infarction volume, cerebral water content, and neurological deficient score were determined. Cerebral cortical neurons cultured in vitro were preconditioned with HLJDT and then subjected to OGD treatment. The release of lactate dehydrogenase (LDH) from neurons was detected. The levels of hypoxia-inducible factor-1α (HIF-1α) and PI3K/Akt signaling were analyzed by western blotting, and the levels of erythropoietin (EPO) and vascular endothelial growth factor (VEGF) in the supernatant of the neurons and the plasma of MCAO rats were measured through a radioimmunological assay. The apoptosis and proliferation of neurons were analyzed by immunohistochemistry. HLJDT preconditioning significantly reduced the cerebral infarction volume and cerebral water content and ameliorated the neurological deficient score of MCAO rats. In addition, HLJDT preconditioning protected neurons against OGD. Increased HIF-1α, EPO, and VEGF levels and the activation of PI3K/Akt signaling were observed as a result of HLJDT preconditioning. Furthermore, HLJDT preconditioning was found to inhibit ischemia-induced neuron apoptosis and to promote neuron proliferation under conditions of ischemia/reperfusion. Both rats and neurons subjected to HLJDT preconditioning were able to resist ischemia/reperfusion or hypoxia injury through the inhibition of apoptosis and the enhancement of proliferation, and these effects were primarily dependent on the activation of the PI3K/Akt signaling pathway and HIF-1α. Copyright © 2014 Elsevier Ireland Ltd. All rights
Baxendale, Sallie; McGrath, Katherine; Thompson, Pamela J
2014-01-01
We examined Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) General Ability Index (GAI) and Full Scale Intelligence Quotient (FSIQ) discrepancies in 100 epilepsy patients; 44% had a significant GAI > FSIQ discrepancy. GAI-FSIQ discrepancies were correlated with the number of antiepileptic drugs taken and duration of epilepsy. Individual antiepileptic drugs differentially interfere with the expression of underlying intellectual ability in this group. FSIQ may significantly underestimate levels of general intellectual ability in people with epilepsy. Inaccurate representations of FSIQ due to selective impairments in working memory and reduced processing speed obscure the contextual interpretation of performance on other neuropsychological tests, and subtle localizing and lateralizing signs may be missed as a result.
Energy Technology Data Exchange (ETDEWEB)
Anderson, Nickolas; Bonawitz, Nicholas D.; Nyffeler, Kayleigh E.; Chapple, Clint
2015-06-05
Phenylpropanoids are phenylalanine-derived specialized metabolites and include important structural components of plant cell walls, such as lignin and hydroxycinnamic acids, as well as ultraviolet and visible light-absorbing pigments, such as hydroxycinnamate esters (HCEs) and anthocyanins. Previous work has revealed a remarkable degree of plasticity in HCE biosynthesis, such that most Arabidopsis (Arabidopsis thaliana) mutants with blockages in the pathway simply redirect carbon flux to atypical HCEs. In contrast, the ferulic acid hydroxylase1 (fah1) mutant accumulates greatly reduced levels of HCEs, suggesting that phenylpropanoid biosynthesis may be repressed in response to the loss of FERULATE 5-HYDROXYLASE (F5H) activity. Here, we show that in fah1 mutant plants, the activity of HCE biosynthetic enzymes is not limiting for HCE accumulation, nor is phenylpropanoid flux diverted to the synthesis of cell wall components or flavonol glycosides. We further show that anthocyanin accumulation is also repressed in fah1 mutants and that this repression is specific to tissues in which F5H is normally expressed. Finally, we show that repression of both HCE and anthocyanin biosynthesis in fah1 mutants is dependent on the MED5a/5b subunits of the transcriptional coregulatory complex Mediator, which are similarly required for the repression of lignin biosynthesis and the stunted growth of the phenylpropanoid pathway mutant reduced epidermal fluorescence8. Taken together, these observations show that the synthesis of HCEs and anthocyanins is actively repressed in a MEDIATOR-dependent manner in Arabidopsis fah1 mutants and support an emerging model in which MED5a/5b act as central players in the homeostatic repression of phenylpropanoid metabolism.
International Nuclear Information System (INIS)
Landry, L.G.; Last, R.L.; Chapple, C.C.S.
1995-01-01
We have assessed ultraviolet-B (UV-B)-induced injury in wild-type Arabidopsis thaliana and two mutants with altered aromatic secondary product biosynthesis. Arabidopsis mutants defective in the ability to synthesize UV-B-absorbing compounds (flavonoids in transparent testa 5 [tt5] and sinapate esters in ferulic acid hydroxylase 1 [fah 1]) are more sensitive to UV-B than is the wild-type Landsberg erecta. Despite its ability to accumulate UV-absorptive flavonoid compounds, the ferulic acid hydroxylase mutant fah1 exhibits more physiological injury (growth inhibition and foliar lesions) than either wild type or tt5. The extreme UV-B sensitivity of fah1 demonstrates the importance of hydroxycinnamate esters as UV-B protectants. Consistent with the whole-plant response, the highest levels of lipid and protein oxidation products were seen in fah1. Ascorbate peroxidase enzyme activity was also increased in the leaves of UV-B-treated plants in a dose- and genotype-dependent manner. These results demonstrate that, in A. thaliana, hydryoxycinnamates are more effective UV-B protectants than flavonoids. The data also indicate that A. thaliana responds to UV-B as an oxidative stress, and sunscreen compounds reduce the oxidative damage caused by UV-B. 36 refs., 6 figs
Directory of Open Access Journals (Sweden)
Mingxing Guo
2014-01-01
Full Text Available Shuang-huang-lian injection (SHLI is a famous Chinese patent medicine, which has been wildly used in clinic to treat acute respiratory tract infection, pneumonia, influenza, and so forth. Despite the widespread clinical application, the prototype components and metabolites of SHLI have not been fully elucidated, especially in human body. To discover and screen the constituents or metabolites of Chinese medicine in biofluids tends to be more and more difficult due to the complexity of chemical compositions, metabolic reactions and matrix effects. In this work, a metabolomic strategy to comprehensively elucidate the prototype components and metabolites of SHLI in human serum conducted by UPLC-Q-TOF/MS was developed. Orthogonal partial least squared discriminant analysis (OPLS-DA was applied to distinguish the exogenous, namely, drug-induced constituents, from endogenous in human serum. In the S-plot, 35 drug-induced constituents were found, including 23 prototype compounds and 12 metabolites which indicated that SHLI in human body mainly caused phase II metabolite reactions. It was concluded that the metabolomic strategy for identification of herbal constituents and metabolites in biological samples was successfully developed. This identification and structural elucidation of the chemical compounds provided essential data for further pharmacological and pharmacokinetics study of SHLI.
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Xu, Chunxiao; Yamamoto, Toshiki; Zhou, Tianlun; Aldrich, Carol E.; Frank, Katy; Cullen, John M.; Jilbert, Allison R.; Mason, William S.
2007-01-01
The livers of woodchucks chronically infected with woodchuck hepatitis virus (WHV) contain foci of morphologically altered hepatocytes (FAH) with “basophilic”, “amphophilic” and “clear cell” phenotypes, which are possibly pre-neoplastic in nature. Interestingly, most fail to express detectable levels of WHV proteins and nucleic acids. We studied sections of WHV-infected liver tissue to determine if all foci of hepatocytes that failed to express detectable levels of WHV, as assessed by immunoperoxidase staining for WHV core antigen, could be classified morphologically as FAH. We found that at least half of the foci of WHV core antigen negative hepatocytes did not show clear morphological differences in either H&E or PAS (periodic acid Schiff) stained sections from surrounding hepatocytes, and were therefore not designated as FAH. In the second approach, we assayed core antigen negative foci for the presence of fetuin B, a serum protein produced by normal hepatocytes, but not by neoplastic hepatocytes in hepatocellular carcinomas. Basophilic and amphophilic FAH had reduced levels of fetuin B compared to hepatocytes present in the surrounding liver; fetuin B staining was detected in clear cell FAH but the level could not be accurately assessed because of the displacement of fetuin B to the cell periphery by accumulated glycogen. The foci of morphologically normal WHV core antigen negative hepatocytes had similar levels of fetuin B to that of the surrounding hepatocytes. The co-existence of at least four types of WHV core antigen negative foci, including those with no obvious morphologic changes, raises the possibility that the different foci arise from distinct primary events. We hypothesize that a common event is loss of the ability to express WHV, allowing these hepatocytes to escape immune mediated cell death and to undergo clonal expansion to form distinct foci. PMID:17078989
Cas9-nickase-mediated genome editing corrects hereditary tyrosinemia in rats.
Shao, Yanjiao; Wang, Liren; Guo, Nana; Wang, Shengfei; Yang, Lei; Li, Yajing; Wang, Mingsong; Yin, Shuming; Han, Honghui; Zeng, Li; Zhang, Ludi; Hui, Lijian; Ding, Qiurong; Zhang, Jiqin; Geng, Hongquan; Liu, Mingyao; Li, Dali
2018-05-04
Hereditary tyrosinemia type I (HTI) is a metabolic genetic disorder caused by mutation of fumarylacetoacetate hydrolase (FAH). Because of the accumulation of toxic metabolites, HTI causes severe liver cirrhosis, liver failure, and even hepatocellular carcinoma. HTI is an ideal model for gene therapy, and several strategies have been shown to ameliorate HTI symptoms in animal models. Although CRISPR/Cas9-mediated genome editing is able to correct the Fah mutation in mouse models, WT Cas9 induces numerous undesired mutations that have raised safety concerns for clinical applications. To develop a new method for gene correction with high fidelity, we generated a Fah mutant rat model to investigate whether Cas9 nickase (Cas9n)-mediated genome editing can efficiently correct the Fah First, we confirmed that Cas9n rarely induces indels in both on-target and off-target sites in cell lines. Using WT Cas9 as a positive control, we delivered Cas9n and the repair donor template/single guide (sg)RNA through adenoviral vectors into HTI rats. Analyses of the initial genome editing efficiency indicated that only WT Cas9 but not Cas9n causes indels at the on-target site in the liver tissue. After receiving either Cas9n or WT Cas9-mediated gene correction therapy, HTI rats gained weight steadily and survived. Fah-expressing hepatocytes occupied over 95% of the liver tissue 9 months after the treatment. Moreover, CRISPR/Cas9-mediated gene therapy prevented the progression of liver cirrhosis, a phenotype that could not be recapitulated in the HTI mouse model. These results strongly suggest that Cas9n-mediated genome editing is a valuable and safe gene therapy strategy for this genetic disease. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
2013-06-10
... be treated as part of the PRC-wide entity; Shanghai Lian Li Paper Products Co., Ltd. (``Lian Li... Hwa Fuh Plastics Co., Ltd./Li Teng Plastics (Shenzhen) Co., Ltd. (``Hwa Fuh/Li Teng'') could not be... Central Records Unit (``CRU''), room 7046 of the main Department of Commerce building. In addition, a...
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
The “Wireless Sensor Networks for City-Wide Ambient Intelligence (WISE-WAI)” Project
Casari, Paolo; Castellani, Angelo P.; Cenedese, Angelo; Lora, Claudio; Rossi, Michele; Schenato, Luca; Zorzi, Michele
2009-01-01
This paper gives a detailed technical overview of some of the activities carried out in the context of the “Wireless Sensor networks for city-Wide Ambient Intelligence (WISE-WAI)” project, funded by the Cassa di Risparmio di Padova e Rovigo Foundation, Italy. The main aim of the project is to demonstrate the feasibility of large-scale wireless sensor network deployments, whereby tiny objects integrating one or more environmental sensors (humidity, temperature, light intensity), a microcontroller and a wireless transceiver are deployed over a large area, which in this case involves the buildings of the Department of Information Engineering at the University of Padova. We will describe how the network is organized to provide full-scale automated functions, and which services and applications it is configured to provide. These applications include long-term environmental monitoring, alarm event detection and propagation, single-sensor interrogation, localization and tracking of objects, assisted navigation, as well as fast data dissemination services to be used, e.g., to rapidly re-program all sensors over-the-air. The organization of such a large testbed requires notable efforts in terms of communication protocols and strategies, whose design must pursue scalability, energy efficiency (while sensors are connected through USB cables for logging and debugging purposes, most of them will be battery-operated), as well as the capability to support applications with diverse requirements. These efforts, the description of a subset of the results obtained so far, and of the final objectives to be met are the scope of the present paper. PMID:22408513
Takeda, Mihoko; Nakaya, Makoto; Kikuchi, Yoko; Inoue, Sayaka; Kamata, Tomoyuki
2018-01-01
We investigated the Japanese WAIS-III short form utility in mild neurocognitive disorder and dementia. Our sample consisted of 108 old patients (ages: 65-89; mean age = 78.3). Fifteen short forms (SFs) and full-scale (FS) IQs were compared. The SFs included Dyads (SF1, SF2), Triads (SF3), Tetrads (SF4, SF5, SF6, SF7), Pentad (SF8), Six-subtest (SF9), Seven-subtests (SF10(a)(b), SF11(a)(b), SF12), and Nine-subtest (SF13). Correlations between SFIQs and FSIQ were all significant. Significant differences also were found in paired t-test between FSIQ and 5 SFIQs (SF2: t = -4.16, SF5: t = -7.06, SF7; t = 2.59, SF10(a): t = 2.56, SF12: t = -4.82; p Arithmetic, Digit Span, Information, Picture Completion, Digit Symbol-Coding, and Matrix Reasoning (Ryan & Ward, 1999), and the formula (Axelrod et al., 2001) should be adopted to convert scaled scores into estimated IQ scores. Copyright © 2017 Elsevier B.V. All rights reserved.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
Zhou, Wei; Zhu, Xuan Xuan; Yin, Ai Ling; Cai, Bao Chang; Wang, Hai Dan; Di, Liuqing; Shan, Jin Jun
2014-01-01
Forsythoside A (FTA), one of the main active ingredients in Shuang-Huang-Lian (SHL), possesses strong antibacterial, antioxidant and antiviral effects, and its pharmacological effects was higher than that of other ingredients, but the absolute bioavailability orally was approximately 0.72%, which was significantly low, influencing clinical efficacies of its oral preparations seriously. In vitro Caco-2 cell and in vivo pharmacokinetics study were simultaneously performed to investigate the effects of absorption enhancers based on tight junctions: sodium caprate and water-soluble chitosan on the intestinal absorption of FTA, and the eventual mucosal epithelial damage resulted from absorption enhancers was evaluated by MTT test and morphology observation, respectively. The pharmacological effects such as antivirus activity improvement by absorption enhancers were verified by MDCK damage inhibition rate after influenza virus propagation. The observations from in vitro Caco-2 cell showed that the absorption of FTA in SHL could be improved by absorption enhancers. Meanwhile, the absorption enhancing effect of water-soluble chitosan may be almost saturable up to 0.0032% (w/v), and sodium caprate at concentrations up to 0.64 mg/mL was safe, but water-soluble chitosan at different concentrations was all safe for these cells. In pharmacokinetics study, water-soluble chitosan at dosage of 50 mg/kg improved the bioavailability of FTA in SHL to the greatest extent, and was safe for gastrointestine from morphological observation. Besides, treatment with SHL with water-soluble chitosan at dosage of 50 mg/kg prevented MDCK damage after influenza virus propagation better significantly than that of control. Water-soluble chitosan at dosage of 50 mg/kg might be safe and effective absorption enhancer for improving the bioavailability of FTA and the antivirus activity in vitro in SHL.
Wang, Peng-Ran; Wang, Jun-Song; Zhang, Chao; Song, Xing-Fang; Tian, Na; Kong, Ling-Yi
2013-08-26
Huang-Lian-Jie-Du-Decotion (HLJDD, Hwangryun-Hae-Dok-Decotion in Japan), an ancient antipyretic and detoxifying traditional Chinese medicine formula, was reported to have protective effect on ischemic stroke. To investigate the therapeutic effect of HLJDD on ischemic stroke and explore its mode of action. A model of ischemic stroke in the rat was established after transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Rats were assigned randomly to groups of control, sham, transient ischemia/reperfusion (I/R), and three treatment groups by HLJDD at 2.5, 5.0, 10.0mg/kg. The neurological deficit, the cerebral infarct size, morphology abnormality, biochemical parameters were examined, and the levels of relevant proteins were determined by immunoblotting analysis to evaluate the protective effects of HLJDD on ischemic stroke and explore the underlying mechanism. Compared with I/R group, HLJDD significantly ameliorated neurological deficit and histopathology changes, decreased infarct area, and restored the levels of biochemical indicators including nitric oxide (NO), malondialdehyde (MDA), glutathione (GSH), glutathione disulfide (GSSG), total superoxide dismutase (T-SOD), Cu/Zn-SOD, Mn-SOD and glutathione peroxidase (GSH-PX). HLJDD also notably elevated the levels of microtubule-associated protein 1 light chain 3 (LC3), Beclin-1, and other autophagy related genes (Atgs), promoted the activation of extracellular signal-regulated kinases (ERK), protein kinase B (Akt), 3-phosphoinositide-dependent kinase (PDK1), and inhibited the activation of mammalian target of rapamycin (mTOR), c-Jun N-terminal protein kinases (JNK), p38, phosphatase and tensin homolog (PTEN). HLJDD showed neuroprotective effects on ischemic stroke, at least in part to the induced protective autophagy via the regulation of mitogen-activated protein kinase (MAPK) signals. This Akt-independent protective autophagy is favorable in the treatment of stroke, avoiding unfavorable side
Exploratory Topology Modelling of Form-Active Hybrid Structures
DEFF Research Database (Denmark)
Holden Deleuran, Anders; Pauly, Mark; Tamke, Martin
2016-01-01
The development of novel form-active hybrid structures (FAHS) is impeded by a lack of modelling tools that allow for exploratory topology modelling of shaped assemblies. We present a flexible and real-time computational design modelling pipeline developed for the exploratory modelling of FAHS...... that enables designers and engineers to iteratively construct and manipulate form-active hybrid assembly topology on the fly. The pipeline implements Kangaroo2's projection-based methods for modelling hybrid structures consisting of slender beams and cable networks. A selection of design modelling sketches...
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Breton, D. J.; Koffman, B. G.; Kreutz, K. J.; Hamilton, G. S.
2010-12-01
Paleoclimate data are often extracted from ice cores by careful geochemical analysis of meltwater samples. The analysis of the microparticles found in ice cores can also yield unique clues about atmospheric dust loading and transport, dust provenance and past environmental conditions. Determination of microparticle concentration, size distribution and chemical makeup as a function of depth is especially difficult because the particle size measurement either consumes or contaminates the meltwater, preventing further geochemical analysis. Here we describe a microcontroller-based ice core melting system which allows the collection of separate microparticle and chemistry samples from the same depth intervals in the ice core, while logging and accurately depth-tagging real-time electrical conductivity and particle size distribution data. This system was designed specifically to support microparticle analysis of the WAIS Divide WDC06A deep ice core, but many of the subsystems are applicable to more general ice core melting operations. Major system components include: a rotary encoder to measure ice core melt displacement with 0.1 millimeter accuracy, a meltwater tracking system to assign core depths to conductivity, particle and sample vial data, an optical debubbler level control system to protect the Abakus laser particle counter from damage due to air bubbles, a Rabbit 3700 microcontroller which communicates with a host PC, collects encoder and optical sensor data and autonomously operates Gilson peristaltic pumps and fraction collectors to provide automatic sample handling, melt monitor control software operating on a standard PC allowing the user to control and view the status of the system, data logging software operating on the same PC to collect data from the melting, electrical conductivity and microparticle measurement systems. Because microparticle samples can easily be contaminated, we use optical air bubble sensors and high resolution ice core density
Lauric Acid Hybridizing Fly Ash Composite for Thermal Energy Storage
Directory of Open Access Journals (Sweden)
Dawei Xu
2018-04-01
Full Text Available Fly ash includes different mineral phases. This paper reported on the preparation of a novel lauric acid (LA/fly ash (FA composite by vacuum impregnation as a form-stable phase change material (PCM for thermal energy, and especially investigated the effect of the hydrochloric acid-treated fly ash (FAh on the thermal energy storage performance of the composites. The morphology, crystalline structure, and porous textures of the samples were characterized by scanning electron microscopy (SEM, X-ray diffraction (XRD, Brunauer–Emmett–Teller (BET, X-ray fluorescence (XRF, and differential scanning calorimetry (DSC. The results indicated that hydrochloric acid treatment was beneficial to the increase of loading capacity and crystallinity of LA in the LA/FAh composite, which caused an enhanced thermal storage capacity with latent heats for melting and freezing of LA/FAh (80.94 and 77.39 J/g, higher than those of LA/FA (34.09 and 32.97 J/g, respectively. Furthermore, the mechanism of enhanced thermal storage properties was investigated in detail.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Implementation of Bridge Management System on Interurban Bridge in Maluku Province
Directory of Open Access Journals (Sweden)
Erwin Marasabessy
2015-05-01
Full Text Available Bridges as transport infrastructures play a vital role in smoothing traffic flows. The success of a bridge in playing its role and serving its function depends on its management. The Directorate General of Highways of the Ministry of Public Work has used a system to manage bridges known as the Bridge Management System (BMS. The system allows a systematic plan and provides a uniform procedure for all bridge operation activities on the national and provincial level. Data from Implementation Agency of National Inter-Urban Roads of Area IX, Northern Maluku in 2011 indicates that the total length of national roads in Maluku Province is 15,238.01 M, with a total of 562 bridges. In Ambon Island, especially, there are 52 bridges totaling 1,176.25 m in length. The study was conducted at several inter-urban bridges in Maluku Province of Ambon Island: Wai Batu Merah, Wai Ruhu, Wai Lawa, Wai Yari and Wai Tua bridges. Assessment of bridge structure conditions was conducted visually to determine the conditions of the existing bridges comprehensively by referring to the Bridge Management System (BMS complemented with a computer-based Bridge Management Information System (BMIS. Condition scores for the five bridges—Wai Batu Merah, Wai Ruhu, Wai Lawa, Wai Yari, and Wai Tua, according to Bridge Management System, are 2, 1, 2, 1, and 2 respectively. The scores of the five bridges indicate that their physical condition can be categorized as good or with minor defects. Based on technical screening, the proposed treatment for Wai Batu Merah, Wai Ruhu, Wai Lawa, dan Wai Tua bridges is the rehabilitation of their sub-elements. As for the Wai Yari Bridge, the treatment will be maintained regularly. The defect repair costs are IDR 149,138,238.00, IDR 81,048,000.00, IDR 174,579,106.10, IDR 79,233,324.01 and IDR 238,323,258.60 for Wai Batu, Wai Ruhu, Wai Lawa, Wai Yari, and Wai Tua Bridges, respectively.
Mallinckrodt, Brent; Tekie, Yacob T
2016-11-01
The Working Alliance Inventory (WAI) has made great contributions to psychotherapy research. However, studies suggest the 7-point response format and 3-factor structure of the client version may have psychometric problems. This study used Rasch item response theory (IRT) to (a) improve WAI response format, (b) compare two brief 12-item versions (WAI-sr; WAI-s), and (c) develop a new 16-item Brief Alliance Inventory (BAI). Archival data from 1786 counseling center and community clients were analyzed. IRT findings suggested problems with crossed category thresholds. A rescoring scheme that combines neighboring responses to create 5- and 4-point scales sharply reduced these problems. Although subscale variance was reduced by 11-26%, rescoring yielded improved reliability and generally higher correlations with therapy process (session depth and smoothness) and outcome measures (residual gain symptom improvement). The 16-item BAI was designed to maximize "bandwidth" of item difficulty and preserve a broader range of WAI sensitivity than WAI-s or WAI-sr. Comparisons suggest the BAI performed better in several respects than the WAI-s or WAI-sr and equivalent to the full WAI on several performance indicators.
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Bright, Peter; Hale, Emily; Gooch, Vikki Jayne; Myhill, Thomas; van der Linde, Ian
2018-09-01
Since publication in 1982, the 50-item National Adult Reading Test (NART; Nelson, 1982; NART-R; Nelson & Willison, 1991) has remained a widely adopted method for estimating premorbid intelligence both for clinical and research purposes. However, the NART has not been standardised against the most recent revisions of the Wechsler Adult Intelligence Scale (WAIS-III; Wechsler, 1997, and WAIS-IV; Wechsler, 2008). Our objective, therefore, was to produce reliable standardised estimates of WAIS-IV IQ from the NART. Ninety-two neurologically healthy British adults were assessed and regression equations calculated to produce population estimates of WAIS-IV full-scale IQ (FSIQ) and constituent index scores. Results showed strong NART/WAIS-IV FSIQ correlations with more moderate correlations observed between NART error and constituent index scores. FSIQ estimates were closely similar to the published WAIS and WAIS-R estimates at the high end of the distribution, but at the lower end were approximately equidistant from the highly discrepant WAIS (low) and WAIS-R (high) values. We conclude that the NART is likely to remain an important tool for estimating the impact of neurological damage on general cognitive ability. We advise caution in the use of older published WAIS and/or WAIS-R estimates for estimating premorbid WAIS-IV FSIQ, particularly for those with low NART scores.
Directory of Open Access Journals (Sweden)
Ademir Fontana
2010-08-01
Full Text Available As informações obtidas pela distribuição das frações húmicas podem ser utilizadas em estudos pedológicos brasileiros como atributo diagnóstico ou característica diferencial e, assim, contribuir para a evolução do Sistema Brasileiro de Classificação de Solos (SiBCS. Os objetivos deste trabalho foam quantificar o C orgânico das frações húmicas de horizontes diagnósticos superficiais e subsuperficiais de solos e propor a utilização no Sistema Brasileiro de Classificação de Solos. Foram utilizados 169 horizontes diagnósticos distribuídos entre O hístico, H hístico, A chernozêmico, A húmico e B espódico. Eles foram avaliados quanto à composição química e física. Quantificaram-se os teores de C orgânico nas frações: ácidos fúlvicos (C-FAF, ácidos húmicos (C-FAH e humina (C-HUM. Foram calculadas as relações C-FAH/C-FAF, C-EA/C-HUM e C-EA/COT (C-EA = C-FAF + C-FAH e o percentual de cada fração em relação a C orgânico total (COT, %FAF, %FAH, %HUM e %EA (extrato alcalino. Os horizontes O e H hístico apresentaram predomínio do C-HUM, seguido do C-FAH; o A chernozêmico, dominância absoluta do C-HUM; o A húmico, predomínio da C-HUM, seguido do C-FAH; e o B espódico, maior expressividade de C-FAH ou do C-FAF. Com base na avaliação da distribuição das frações húmicas, propõe-se o uso das seguintes características diferenciais para os níveis de família e série do SiBCS: matéria orgânica estável (horizontes minerais superficiais - C-EA/C-HUM ( 2,0; e potencial de lixiviação (sistema ou solo - C-FAH/C-FAF e C-EA/C-HUM (> 1,0.The information obtained through the humic fractions distribution can be used in brazilian soil studies as a diagnostic attribute or differential characteristic and therefore, contribute to the evolution of Brazilian System of Soil Classification (SiBCS. The objective of this study was to quantify the organic carbon in humic fractions of surface and subsurface diagnostic
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Retrospective beryllium exposure assessment at the Rocky Flats Environmental Technology site
International Nuclear Information System (INIS)
Barnard, A.E.; Torma-Krajewski, J.; Viet, S.M.
1997-01-01
Since the 1960's, beryllium machining was performed to make nuclear weapon components at the Department of Energy (DOE) Rocky Flats Plant. Beryllium exposure was assessed via fixed airhead (FAH) sampling in which the filter cassette was affixed to the machine, generally within a few feet of the worker's breathing zone. Approximately 500,000 FAH samples were collected for beryllium over three decades. From 1984 to 1987, personal breathing zone (PBZ) samples were also collected as part of the evaluation of a new high velocity/low volume local exhaust ventilation (HV/LV LEV) system. The purpose of this study was to determine how the two types of sampling data could be used for an exposure assessment in the beryllium shop
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
Israel, Sabine
2016-03-05
The article explores in how far financial accessibility of healthcare (FAH) is restricted for low-income groups and identifies social protection policies that can supplement health policies in guaranteeing universal access to healthcare. The article is aimed to advance the literature on comparative European social epidemiology by focussing on income-related barriers of healthcare take-up. The research is carried out on the basis of multi-level cross-sectional analyses using 2012 EU-SILC data for 30 European countries. The social policy data stems from EU-SILC beneficiary information. It is argued that unmet medical needs are a reality for many individuals within Europe - not only due to direct user fees but also due to indirect costs such as waiting time, travel costs, time not spent working. Moreover, low FAH affects not only the lowest income quintile but also the lower middle income class. The study observes that social allowance increases the purchasing power of both household types, thereby helping them to overcome financial barriers to healthcare uptake. Alongside healthcare system reform aimed at improving the pro-poor availability of healthcare facilities and financing, policies directed at improving FAH should aim at providing a minimum income base to the low-income quintile. Moreover, categorical policies should address households exposed to debt which form the key vulnerable group within the low-income classes.
Inter-laboratory comparison of turkey in ovo carcinogenicity assessment (IOCA) of hepatocarcinogens.
Enzmann, H; Brunnemann, K; Iatropoulos, M; Shpyleva, S; Lukyanova, N; Todor, I; Moore, M; Spicher, K; Chekhun, V; Tsuda, H; Williams, G
2013-09-01
In three independent laboratories carcinogens (diethylnitrosamine, DEN, 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone, NNK) and non-carcinogens (N-nitrosoproline, nicotine) were evaluated in turkey eggs for in ovo carcinogenicity assessment (IOCA). Compounds were injected into aseptic fertilized eggs. After incubation for 24 days, foci of altered hepatocytes (FAH), some with a pseudoglandular structure and/or signs of compression of the surrounding tissue were observed in the fetal liver. All laboratories were able to distinguish unequivocally the hepatocarcinogen-exposed groups from those exposed to non-carcinogens or the vehicle controls, based on the pre-specified evaluation parameters: tumor-like lesions, pseudoglandular areas and FAH. In addition to focal changes, only the carcinogens induced hepatocellular karyomegaly. Lower doses of the carcinogens, which did not induce FAH, were sufficient to induce hepatocellular karyomegaly. After exposure to 4 mg DEN, gall bladder agenesis was observed in all fetuses. The IOCA may be a valuable tool for early investigative studies on carcinogenicity and since it does not use rodents may complement chronic rat or mouse bioassays. Test substances that are positive in both rodents and fertilized turkey eggs are most probably trans-species carcinogens with particular significance for humans. The good concordance observed among the three laboratories demonstrates that the IOCA is a reliable and robust method. Copyright © 2012 Elsevier GmbH. All rights reserved.
Fegyveresi, John M.; Alley, Richard B.; Muto, Atsuhiro; Orsi, Anaïs J.; Spencer, Matthew K.
2018-01-01
Observations at the West Antarctic Ice Sheet (WAIS) Divide site show that near-surface snow is strongly altered by weather-related processes such as strong winds and temperature fluctuations, producing features that are recognizable in the deep ice core. Prominent glazed surface crusts develop frequently at the site during summer seasons. Surface, snow pit, and ice core observations made in this study during summer field seasons from 2008-2009 to 2012-2013, supplemented by automated weather station (AWS) data with short- and longwave radiation sensors, revealed that such crusts formed during relatively low-wind, low-humidity, clear-sky periods with intense daytime sunshine. After formation, such glazed surfaces typically developed cracks in a polygonal pattern likely from thermal contraction at night. Cracking was commonest when several clear days occurred in succession and was generally followed by surface hoar growth; vapor escaping through the cracks during sunny days may have contributed to the high humidity that favored nighttime formation of surface hoar. Temperature and radiation observations show that daytime solar heating often warmed the near-surface snow above the air temperature, contributing to upward mass transfer, favoring crust formation from below, and then surface hoar formation. A simple surface energy calculation supports this observation. Subsequent examination of the WDC06A deep ice core revealed that crusts are preserved through the bubbly ice, and some occur in snow accumulated during winters, although not as commonly as in summertime deposits. Although no one has been on site to observe crust formation during winter, it may be favored by greater wintertime wind packing from stronger peak winds, high temperatures and steep temperature gradients from rapid midwinter warmings reaching as high as -15 °C, and perhaps longer intervals of surface stability. Time variations in crust occurrence in the core may provide paleoclimatic information
Directory of Open Access Journals (Sweden)
J. M. Fegyveresi
2018-01-01
Full Text Available Observations at the West Antarctic Ice Sheet (WAIS Divide site show that near-surface snow is strongly altered by weather-related processes such as strong winds and temperature fluctuations, producing features that are recognizable in the deep ice core. Prominent glazed surface crusts develop frequently at the site during summer seasons. Surface, snow pit, and ice core observations made in this study during summer field seasons from 2008–2009 to 2012–2013, supplemented by automated weather station (AWS data with short- and longwave radiation sensors, revealed that such crusts formed during relatively low-wind, low-humidity, clear-sky periods with intense daytime sunshine. After formation, such glazed surfaces typically developed cracks in a polygonal pattern likely from thermal contraction at night. Cracking was commonest when several clear days occurred in succession and was generally followed by surface hoar growth; vapor escaping through the cracks during sunny days may have contributed to the high humidity that favored nighttime formation of surface hoar. Temperature and radiation observations show that daytime solar heating often warmed the near-surface snow above the air temperature, contributing to upward mass transfer, favoring crust formation from below, and then surface hoar formation. A simple surface energy calculation supports this observation. Subsequent examination of the WDC06A deep ice core revealed that crusts are preserved through the bubbly ice, and some occur in snow accumulated during winters, although not as commonly as in summertime deposits. Although no one has been on site to observe crust formation during winter, it may be favored by greater wintertime wind packing from stronger peak winds, high temperatures and steep temperature gradients from rapid midwinter warmings reaching as high as −15 °C, and perhaps longer intervals of surface stability. Time variations in crust occurrence in the core may provide
Directory of Open Access Journals (Sweden)
Wallis James G
2007-07-01
Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at
Araujo, Amanda Costa; Filho, Rúben Negrão; Oliveira, Crystian B; Ferreira, Paulo H; Pinto, Rafael Z
2017-01-01
In the low back pain (LBP) field, therapeutic alliance is considered a non-specific factor of interventions associated with improvements in clinical outcomes. However, there is a paucity of studies aimed to evaluate measurement properties of tools used to objectively quantify the alliance between therapist and patients, such as the Working Alliance Inventory (WAI) and Session Rating Scale (SRS). To translate and cross-culturally adapt the short-form version of WAI - therapist and SRS into Brazilian Portuguese; to investigate the measurement properties, of the WAI-Patient, WAI-Therapist and SRS in patients with LBP and their physical therapists, respectively. One hundred patients with LBP and 18 physical therapists were recruited from physical therapy clinics in Brazil. Therapeutic alliance measures were collected at the initial assessment, prior to the second session, and at 2-month follow-up. The measurement properties investigated were reproducibility, internal consistency, ceiling/floor effects and responsiveness. Although WAI-Patient, WAI-Therapist and SRS were considered to have acceptable test-retest reliability (ICC2,1 > 0.70), these questionnaires showed problems with other measurement properties. WAI-Patient showed problems with internal consistency (i.e. Cronbach's alpha 15% of participants with the maximum score) and poor internal responsiveness were found for the WAI-Patient (Effect size = 0.15; 84% CI: 0.04 to 0.29) and for the SRS (Effect size = 0.05; 84% CI: -0.22 to 0.11). The WAI-Therapist revealed slightly better measurement properties. We identified psychometric limitations with most measurement properties of the WAI questionnaires and SRS. Future studies are needed to refine these tools.
Directory of Open Access Journals (Sweden)
Oili Kettunen
2014-04-01
Full Text Available Objectives: This study’s objective was to assess the effects of a 12-month physical exercise intervention on work ability (WAI and cardiorespiratory fitness (CRF in healthy working adults. Methods: The study group had 371 participants, of which 338 (212 women and 126 men were allocated in the exercise group and 33 (17 women and 16 men in the control group. The exercise group underwent a 12-month exercise program followed by a 12-month follow-up. WAI and CRF were evaluated at baseline, and at 4, 8, 12, and 24 study months, in both exercise and control groups. The exercise group was divided into subgroups according to baseline WAI classifications (poor/moderate, good, excellent. Results: During the 12-month exercise intervention, the exercise group increased their leisure-time physical activity by 71% (p = 0.016 and improved the mean WAI by 3% and CRF by 7% (p < 0.0001, in both, while WAI and CRF decreased in the control group (ANCOVA using age, sex and BMI as covariates, for WAI, p = 0.013 and for CRF, p = 0.008. The changes in WAI and CRF between the exercise group and control group were significantly different during the intervention (baseline vs. 12-months, p = 0.028 and p = 0.007 and after the follow-up (p = 0.001 and p = 0.040, respectively. A light positive correlation between the changes in WAI and in CRF (r = 0.19, p < 0.01 existed. WAI improvement was the highest (13%, p < 0.0001 in the subgroup having poor/moderate WAI at baseline (ANCOVA, p < 0.001. Conclusions: The improvement of WAI associated with CRF. These results suggest that a physical exercise intervention may improve work ability.
Journal for Islamic Studies - Vol 33 (2013)
African Journals Online (AJOL)
Sexing Islamic Theology: Theorising Women's Experience and Gender through ʿabd-Allah and khalīfah · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. N Hoel, S Shaikh, 127-150 ...
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
The Prognostic Value of the Work Ability Index for Sickness Absence among Office Workers.
Directory of Open Access Journals (Sweden)
Kerstin G Reeuwijk
Full Text Available The work ability index (WAI is a frequently used tool in occupational health to identify workers at risk for a reduced work performance and for work-related disability. However, information about the prognostic value of the WAI to identify workers at risk for sickness absence is scarce.To investigate the prognostic value of the WAI for sickness absence, and whether the discriminative ability differs across demographic subgroups.At baseline, the WAI (score 7-49 was assessed among 1,331 office workers from a Dutch financial service company. Sickness absence was registered during 12-months follow-up and categorised as 0 days, 0
Is health, measured by work ability index, affected by 12-hour rotating shift schedules?
Yong, Mei; Nasterlack, Michael; Pluto, Rolf-Peter; Elmerich, Kathrin; Karl, Dorothee; Knauth, Peter
2010-07-01
Two forms of continuously forward rotating 12-h shift schedules exist at BASF's Ludwigshafen site. These shift schedules were compared with a daytime working system to investigate potential differential effects on employee's health status assessed with the Work Ability Index (WAI). In the 3 x 12 system, a 12-h day shift is followed 24 h later by a 12-h night shift, and after a day off the employee returns to the day shift. The 4 x 12 schedule follows the same pattern except that there are 2 days off between the night and next day shift. A total of 924 participants (278 3 x 12 and 321 4 x 12 shiftworkers and 325 day workers) were recruited. A self-administered questionnaire was used to obtain information about shiftwork schedule, demographic characteristics, and lifestyle and social factors, and the WAI was applied. The outcomes of interest were the WAI sum score and its seven dimensions. In examining the relationship with the WAI categories, a Proportional Odds Model (POM) was used to identify the potential determinants. Logistic regression models were used to estimate the impact of age on single dimensions of WAI after adjustment for potential confounding factors. Increasing age and obesity (BMI > or = 30) were the only significant determinants of poorer WAI. Although a positive association was found linking the second WAI dimension (work ability in relation to job demands) with age, an inverse association was demonstrated consistently between age and the third and fourth WAI dimensions, i.e., number of diagnosed diseases and estimated work impairment due to disease, after adjustment for potential confounders. The age-dependency was moderate overall, but seemed to be stronger among shift- than day workers, although this difference did not reach statistical significance. There was no significant differential impact of the working time systems on the WAI sum score or on the individual WAI dimensions. Thus, there is no indication of an excessive adverse health impact
Habibi, Ehsanollah; Dehghan, Habibollah; Zeinodini, Mohhamad; Yousefi, Hosseinali; Hasanzadeh, Akbar
2012-11-01
The purpose of this research is to establish the ability of employees by work ability index (WAI), physical work capacity (PWC), and finding the correlation between them. Establishing the PWC index with attention to WAI values for the purpose of saving in costs and time of PWC measurements is another aim of this project. The present research is an analytic cross-sectional and one-trail study. The study population consists of 228 randomly selected registered nurses from hospitals in Isfahan (Iran). The WAI and PWC were established through WAI questionnaire and Fax equation and by using ergometer bicycle, respectively. The resulting data were analyzed using SPSS 16 software. Average WAI and PWC among the study population were 38.25±4.4 and 4.45±0.7, respectively. Pearson test results showed no significant correlation between PWC and WAI in different age groups (r=0.3 and P>0.05). Multiple linear regression analysis showed that the variables of age and diagnosed diseases were the most effective factors of WAI (β=0.18 and P>0.05). Pearson test revealed a significant correlation between the number of diagnosed diseases and PWC index in age groups of 40-49 years. Average WAI in this research, like other studies on similar jobs is in the acceptable level of >36. Work ability index and PWC index in different age groups did not show a significant correlation and this suggests that there are essential discrepancies in work ability evaluations made by each index and it is not possible to predict PWC index using WAI values. Given the PWC results and the level of nursing staff's activity (low, medium) the WAI is a suitable instrument to establish the professionals' abilities. This study revealed that 27.6% of individuals were subject to medium-low work ability risk (WAIworking and increased working hours.
Schouten, Lianne S; Bültmann, Ute; Heymans, Martijn W; Joling, Catelijne I; Twisk, Jos W R; Roelen, Corné A M
2016-04-01
The Work Ability Index (WAI) identifies non-sicklisted workers at risk of future long-term sickness absence (LTSA). The WAI is a complicated instrument and inconvenient for use in large-scale surveys. We investigated whether shortened versions of the WAI identify non-sicklisted workers at risk of LTSA. Prospective study including two samples of non-sicklisted workers participating in occupational health checks between 2010 and 2012. A heterogeneous development sample (N= 2899) was used to estimate logistic regression coefficients for the complete WAI, a shortened WAI version without the list of diseases, and single-item Work Ability Score (WAS). These three instruments were calibrated for predictions of different (≥2, ≥4 and ≥6 weeks) LTSA durations in a validation sample of non-sicklisted workers (N= 3049) employed at a steel mill, differentiating between manual (N= 1710) and non-manual (N= 1339) workers. The discriminative ability was investigated by receiver operating characteristic analysis. All three instruments under-predicted the LTSA risks in both manual and non-manual workers. The complete WAI discriminated between individuals at high and low risk of LTSA ≥2, ≥4 and ≥6 weeks in manual and non-manual workers. Risk predictions and discrimination by the shortened WAI without the list of diseases were as good as the complete WAI. The WAS showed poorer discrimination in manual and non-manual workers. The WAI without the list of diseases is a good alternative to the complete WAI to identify non-sicklisted workers at risk of future LTSA durations ≥2, ≥4 and ≥6 weeks. © The Author 2015. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.
Schouten, Lianne S.; Bultmann, Ute; Heymans, Martijn W.; Joling, Catelijne I.; Twisk, Jos W. R.; Roelen, Corne A. M.
2016-01-01
Background: The Work Ability Index (WAI) identifies non-sicklisted workers at risk of future long-term sickness absence (LTSA). The WAI is a complicated instrument and inconvenient for use in large-scale surveys. We investigated whether shortened versions of the WAI identify non-sicklisted workers
Wang, Yetang; Thomas, Elizabeth R.; Hou, Shugui; Huai, Baojuan; Wu, Shuangye; Sun, Weijun; Qi, Shanzhong; Ding, Minghu; Zhang, Yulun
2017-11-01
This study uses a set of 37 firn core records over the West Antarctic Ice Sheet (WAIS) to test the performance of the twentieth century from the European Centre for Medium-Range Weather Forecasts (ERA-20C) reanalysis for snow accumulation and quantify temporal variability in snow accumulation since 1900. The firn cores are allocated to four geographical areas demarcated by drainage divides (i.e., Antarctic Peninsula (AP), western WAIS, central WAIS, and eastern WAIS) to calculate stacked records of regional snow accumulation. Our results show that the interannual variability in ERA-20C precipitation minus evaporation (P - E) agrees well with the corresponding ice core snow accumulation composites in each of the four geographical regions, suggesting its skill for simulating snow accumulation changes before the modern satellite era (pre-1979). Snow accumulation experiences significantly positive trends for the AP and eastern WAIS, a negative trend for the western WAIS, and no significant trend for the central WAIS from 1900 to 2010. The contrasting trends are associated with changes in the large-scale moisture transport driven by a deepening of the low-pressure systems and anomalies of sea ice in the Amundsen Sea Low region.
The Prognostic Value of the Work Ability Index for Sickness Absence among Office Workers.
Reeuwijk, Kerstin G; Robroek, Suzan J W; Niessen, Maurice A J; Kraaijenhagen, Roderik A; Vergouwe, Yvonne; Burdorf, Alex
2015-01-01
The work ability index (WAI) is a frequently used tool in occupational health to identify workers at risk for a reduced work performance and for work-related disability. However, information about the prognostic value of the WAI to identify workers at risk for sickness absence is scarce. To investigate the prognostic value of the WAI for sickness absence, and whether the discriminative ability differs across demographic subgroups. At baseline, the WAI (score 7-49) was assessed among 1,331 office workers from a Dutch financial service company. Sickness absence was registered during 12-months follow-up and categorised as 0 days, 0performed for separate WAI dimensions, and subgroup analyses for demographic groups. A lower WAI was associated with sickness absence (≥15 days vs. 0 days: per point lower WAI score OR=1.27; 95%CI 1.21-1.33). The WAI showed reasonable ability to discriminate between categories of sickness absence (ORC=0.65; 95%CI 0.63-0.68). Highest discrimination was found for comparing workers with ≥15 sick days with 0 sick days (AUC=0.77) or with 1-5 sick days (AUC=0.69). At the cut-off for poor work ability (WAI≤27) the sensitivity to identify workers at risk for ≥15 sick days was 7.5%, the specificity 99.6%, and the positive predictive value 82%. The performance was similar across demographic subgroups. The WAI could be used to identify workers at high risk for prolonged sickness absence. However, due to low sensitivity many workers will be missed. Hence, additional factors are required to better identify workers at highest risk.
International Nuclear Information System (INIS)
Boess, Franziska; Lenz, Barbara; Funk, Juergen; Niederhauser, Urs; Bassett, Simon; Zhang, Jitao David; Singer, Thomas; Roth, Adrian B.
2017-01-01
Highlights: • RG3487 induced foci of altered hepatocytes and subsequent liver tumors in rats. • Early phenotypic markers preceding foci appearance in rats were identified. • These early foci markers could be recapitulated in cellular rat liver models. • A species comparison using rat, mouse and dog liver cell models qualified the approach. • In vitro human data support non-human-relevance for RG3487 induced foci formation. - Abstract: Foci of altered hepatocytes (FAH) are considered putative, pre-neoplastic lesions that can occur spontaneously in aging rodents, but can also be induced by chemicals or drugs. Progression of FAH to hepatocellular neoplasms has been reported repeatedly but increases in foci in rodents do not necessarily lead to tumors in carcinogenicity studies and the relevance for humans often remains unclear. Here we present the case of RG3487, a molecule which induced FAH and, later on, tumors in rats. Because the molecule was negative in genotoxicity assays it was classified as a non-genotoxic carcinogen. In order to assess the potential for liver tumor formation in humans, we analyzed treatment-induced changes in vivo to establish a possible mode of action (MoA). In vivo and in vitro gene expression analysis revealed that nuclear receptor signaling was unlikely to be the relevant MoA and no other known mechanism could be established. We therefore took an approach comparing phenotypic markers, including mRNA changes, proliferation and glycogen accumulation, in vitro using cells of different species to assess the human relevance of this finding. Since the alterations observed in rats were not seen in the liver of mice or dogs in vivo, we could validate the relevance of the cell models chosen by use of hepatocytes from these species in vitro. This ultimately allowed for a cross-species comparison, which suggested that the formation of FAH and liver tumors was rat specific and unlikely to translate to human. Our work showed that phenotypic
Bethge, Matthias; Radoschewski, Friedrich Michael; Gutenbrunner, Christoph
2012-11-01
To evaluate the predictive value of the Work Ability Index (WAI) for different indicators of the need for rehabilitation at 1-year follow-up. Cohort study. Data were obtained from the Second German Sociomedical Panel of Employees, a large-scale cohort study with postal surveys in 2009 and 2010. A total of 457 women and 579 men were included. Confirmatory factor analysis confirmed the one-dimensionality of the WAI. Regression analyses showed that poor and moderate baseline WAI scores were associated with lower health-related quality of life and more frequent use of primary healthcare 1 year later. Subjects with poor baseline work ability had 4.6 times higher odds of unemployment and 12.2 times higher odds of prolonged sick leave than the reference group with good or excellent baseline work ability. Moreover, the odds of subjectively perceived need for rehabilitation, intention to request rehabilitation and actual use of rehabilitation services were 9.7, 5.7 and 3 times higher in the poor baseline WAI group and 5.5, 4 and 1.8 times higher in the moderate baseline WAI group, respectively. A WAI score ≤ 37 was identified as the optimal cut-off to predict the need for rehabilitation. The WAI is a valid screening tool for identifying the need for rehabilitation.
2013-11-25
...) Shanghai Shuang Qiang Embroidery Factory, (13) Shangyu Baoxiang Metal Manufactured Co. Ltd., (14) Shang... Metal Products Co. Ltd., 3. Shanghai Lian Development Co. Ltd., 4. Shanghai Shuang Qiang Embroidery...
Wang, Jing; Williams, Margaret; Rush, Elaine; Crook, Nic; Forouhi, Nita G; Simmons, David
2010-07-01
Uptake of advice for lifestyle change for obesity and diabetes prevention requires access to affordable 'healthy' foods (high in fibre/low in sugar and fat). The present study aimed to examine the availability and accessibility of 'healthy' foods in rural and urban New Zealand. We identified and visited ('mapped') 1230 food outlets (473 urban, 757 rural) across the Waikato/Lakes areas (162 census areas within twelve regions) in New Zealand, where the Te Wai O Rona: Diabetes Prevention Strategy was underway. At each site, we assessed the availability of 'healthy' foods (e.g. wholemeal bread) and compared their cost with those of comparable 'regular' foods (e.g. white bread). Healthy foods were generally more available in urban than rural areas. In both urban and rural areas, 'healthy' foods were more expensive than 'regular' foods after adjusting for the population and income level of each area. For instance, there was an increasing price difference across bread, meat, poultry, with the highest difference for sugar substitutes. The weekly family cost of a 'healthy' food basket (without sugar) was 29.1% more expensive than the 'regular' basket ($NZ 176.72 v. $NZ 136.84). The difference between the 'healthy' and 'regular' basket was greater in urban ($NZ 49.18) than rural areas ($NZ 36.27) in adjusted analysis. 'Healthy' foods were more expensive than 'regular' choices in both urban and rural areas. Although urban areas had higher availability of 'healthy' foods, the cost of changing to a healthy diet in urban areas was also greater. Improvement in the food environment is needed to support people in adopting healthy food choices.
2010-06-28
... reasons. OnTime Electronics Technology Company and Tam Wai Tak, a.k.a., Thomsom Tam, are being added due... June 5, 2008, OnTime Electronics Technology Company and Tam Wai Tak were indicted in the Southern... Commercial Center, 28 Ferry Street, Jordon, Kowloon, Hong Kong; and (2) Tam Wai Tak, a.k.a., Thomsom Tam...
Duped by the Frailty Myth: USMC Gender Based Physical Fitness Standards
2012-05-07
by modifying the PFT on three occasions (see figure 1). Today the PFT for women consists of a three-mile run, abdominal crunches, and the FAH (see...TECOM, Quantico, VA, August 1-5, 2012. Mitchell, Brian. Weak link: The Feminization of the American Military. Washington D.C
Across the nightingale floor. Lian Hearn
Hearn, Lian
2017-01-01
... is one of treachery, of honour and loyalty, of beauty and magic. It is also a journey of self-discovery, as he learns of talents he did not know he had: preternatural hearing, invisibility and the ...
Yong, Mei; Fischer, Dorothee; Germann, Christina; Lang, Stefan; Vetter, Céline; Oberlinner, Christoph
The present study investigates the impact of chronotype, social jetlag and sleep duration on self-perceived health, measured by Work Ability Index (WAI), within an industrial setting. Between 2011 and 2013, 2474 day and shift workers participated in a health check offered by an occupational health promotion program and filled out the Munich ChronoType Questionnaire (adapted to the rotational 12-h schedule for shift workers) and the WAI. We computed sleep duration on work and free days, chronotype, and social jetlag. We used linear regression models to examine chronotype, sleep duration and social jetlag for association with the WAI sum score, and proportional odds models to estimate the combined effect of social jetlag and sleep duration. Participants reported an average daily sleep duration of 7.35 h (SD: 1.2 h), had an average chronotype of 3:08 a.m. (SD: 1 h), and the average social jetlag corresponded to 1.96 h (SD: 2.05 h). Increasing social jetlag and shorter sleep duration were independently associated with a decreasing WAI, while chronotype per se was not associated with WAI. Short sleep duration combined with high social jetlag significantly increased the risk of poor WAI (OR = 1.36; 95% CI: 1.09-1.72), while long sleep duration and high social jetlag were not associated with poor WAI (OR = 1.09; 95% CI: 0.88-1.35). Our results add to a growing body of literature, suggesting that circadian misalignment, but not chronotype per se, may be critical for health. Our results indicate that longer sleep may override the adverse effects of social jetlag on WAI.
Psychological variables and Wechsler Adult Intelligence Scale-IV performance.
Gass, Carlton S; Gutierrez, Laura
2017-01-01
The MMPI-2 and WAIS-IV are commonly used together in neuropsychological evaluations yet little is known about their interrelationships. This study explored the potential influence of psychological factors on WAIS-IV performance in a sample of 180 predominantly male veteran referrals that underwent a comprehensive neuropsychological examination in a VA Medical Center. Exclusionary criteria included failed performance validity testing and self-report distortion on the MMPI-2. A Principal Components Analysis was performed on the 15 MMPI-2 content scales, yielding three broader higher-order psychological dimensions: Internalized Emotional Dysfunction (IED), Externalized Emotional Dysfunction (EED), and Fear. Level of IED was not related to performance on the WAIS-IV Full Scale IQ or its four indexes: (Verbal Comprehension, Perceptual Reasoning, Working Memory, and Processing Speed). EED was not related to WAIS-IV performance. Level of Fear, which encompasses health preoccupations (HEA) and distorted perceptions (BIZ), was significantly related to WAIS-IV Full Scale IQ and Verbal Comprehension. These results challenge the common use of high scores on the MMPI-2 IED measures (chiefly depression and anxiety) to explain deficient WAIS-IV performance. In addition, they provide impetus for further investigation of the relation between verbal intelligence and Fear.
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
Habets, Petra; Jeandarme, Inge; Uzieblo, Kasia; Oei, Karel; Bogaerts, Stefan
2015-05-01
A stable assessment of cognition is of paramount importance for forensic psychiatric patients (FPP). The purpose of this study was to compare repeated measures of IQ scores in FPPs with and without intellectual disability. Repeated measurements of IQ scores in FPPs (n = 176) were collected. Differences between tests were computed, and each IQ score was categorized. Additionally, t-tests and regression analyses were performed. Differences of 10 points or more were found in 66% of the cases comparing WAIS-III with RAVEN scores. Fisher's exact test revealed differences between two WAIS-III scores and the WAIS categories. The WAIS-III did not predict other IQs (WAIS or RAVEN) in participants with intellectual disability. This study showed that stability or interchangeability of scores is lacking, especially in individuals with intellectual disability. Caution in interpreting IQ scores is therefore recommended, and the use of the unitary concept of IQ should be discouraged. © 2014 John Wiley & Sons Ltd.
Hillenbrand, C. D.; Smith, J.; Klages, J. P.; Kuhn, G.; Maher, B.; Moreton, S.; Wacker, L.; Frederichs, T.; Wiers, S.; Jernas, P.; Anderson, J. B.; Ehrmann, W. U.; Graham, A. G. C.; Gohl, K.; Larter, R. D.
2016-02-01
Satellite data and in-situ measurements show that today considerable mass loss is occurring from the Amundsen Sea sector of the West Antarctic Ice Sheet (WAIS). The observational record only spans the past four decades, and until recently the long-term context of the current deglaciation was poorly constrained. This information is, however, crucial for understanding WAIS dynamics, evaluating the role of forcing mechanisms for ice-sheet melting, and testing and calibrating ice-sheet models that attempt to predict future WAIS behavior and its impact on global sea level. Over the past decade several multinational marine expeditions and terrestrial fieldwork campaigns have targeted the Amundsen Sea shelf and its hinterland to reconstruct the WAIS configuration during the Last Glacial Maximum (LGM) and its subsequent deglacial history. The resulting studies succeeded in shedding light on the maximum WAIS extent at the LGM and the style, pattern and speed of its retreat and thinning thereafter. Despite this progress, however, significant uncertainties and discrepancies between marine and terrestrial reconstructions remain, which may arise from difficulties in dating sediment cores from the Antarctic shelf, especially their deglacial sections. Resolving these issues is crucial for understanding the WAIS' contribution to post-LGM sea-level rise, its sensitivity to different forcing mechanisms and its future evolution. Here we present chronological constraints on WAIS advance in the Amundsen Sea and its retreat from 20 ka BP into the Holocene that were obtained by various techniques, such as 14C dating of large ( 10 mg) and small (sample aliquots of calcareous microfossils, 14C dating of acid-insoluble organic matter combusted at low (300 °C) and high (800 °C) temperatures and dating of sediment cores by using geomagnetic paleointensity. We will compare the different age constraints and discuss their reliability, applicability and implications for WAIS history.
The Global and Local Climatic Response to the Collapse of the West Antarctic Ice Sheet
Huybers, K. M.; Singh, H.; Steiger, N. J.; Frierson, D. M.; Steig, E. J.; Bitz, C. M.
2014-12-01
Glaciologists have suggested that a relatively small external forcing may compromise the stability of the West Antarctic Ice Sheet (WAIS). Further, there is compelling physical evidence that the WAIS has collapsed in the past, at times when the mean global temperature was only a few degrees warmer than it is today. In addition to a rapid increase in global sea level, the collapse of the WAIS could also affect the global circulation of the atmosphere. Ice sheets are some of the largest topographic features on Earth, causing large regional anomalies in albedo and radiative balance. Our work uses idealized aquaplanet models in tandem with a fully coupled ocean/atmosphere/sea-ice model (CCSM4) to compare the atmospheric, radiative, and oceanic response to a complete loss of the WAIS. Initial findings indicate that the loss of the WAIS leads to a weakening and equator-ward shift of the zonal winds, a development of strong zonal asymmetries in the meridional wind, and a northward migration of the Intertropical Convergence Zone. We aim to characterize how the local and global climate is affected by the presence of the WAIS, and how changes in the distribution of Southern Hemisphere ice may be represented in the proxy record.
Searching for a neurologic injury's Wechsler Adult Intelligence Scale-Third Edition profile.
Gonçalves, Marta A; Moura, Octávio; Castro-Caldas, Alexandre; Simões, Mário R
2017-01-01
This study aimed to investigate the presence of a Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) cognitive profile in a Portuguese neurologic injured sample. The Portuguese WAIS-III was administered to 81 mixed neurologic patients and 81 healthy matched controls selected from the Portuguese standardization sample. Although the mixed neurologic injury group performed significantly lower than the healthy controls for the majority of the WAIS-III scores (i.e., composite measures, discrepancies, and subtests), the mean scores were within the normal range and, therefore, at risk of being unobserved in a clinical evaluation. ROC curves analysis showed poor to acceptable diagnostic accuracy for the WAIS-III composite measures and subtests (Working Memory Index and Digit Span revealed the highest accuracy for discriminating between participants, respectively). Multiple regression analysis showed that both literacy and the presence of brain injury were significant predictors for all of the composite measures. In addition, multiple regression analysis also showed that literacy, age of injury onset, and years of survival predicted all seven composite measures for the mixed neurologic injured group. Despite the failure to find a WAIS-III cognitive profile for mixed neurologic patients, the results showed a significant influence of brain lesion and literacy in the performance of the WAIS-III.
demobilisation and the post-war employment of the white union
African Journals Online (AJOL)
most important demobilisation benefit ... decided here, Recommends suitable work. ... lian life,6. Thissurvey revealed 46 475 men and. 9 615 women required ... laws to ensure that volunteers were re- ... ment to return to, were retained on.
Is work engagement related to work ability beyond working conditions and lifestyle factors?
Airila, Auli; Hakanen, Jari; Punakallio, Anne; Lusa, Sirpa; Luukkonen, Ritva
2012-11-01
To examine the associations of age, lifestyle and work-related factors, and particularly work engagement with the work ability index (WAI) and its sub-dimensions. Step-wise regression analysis with a sample of Finnish firefighters (n = 403) was used. The outcome variables were the WAI and its six sub-dimensions. The independent variables consisted of age, lifestyle variables (alcohol consumption, BMI, smoking, physical exercise, and sleep problems), working conditions (job demands, physical workload, supervisory relations, and task resources), and work engagement. The outcome variables and all the variables related to lifestyle, working conditions, and work engagement were measured in 2009. Work ability at baseline 10 years earlier was adjusted for in the models. Work engagement, age, physical exercise, sleep problems, and physical workload were associated with the WAI. All independent variables, except BMI and alcohol consumption, were associated with at least one sub-dimension of the WAI after controlling the baseline WAI. Lifestyle variables, working conditions, and work engagement were more strongly related to the subjective WAI sub-dimensions than to the two more objective WAI sub-dimensions. Work engagement was significantly associated with work ability even after adjusting for various factors, indicating its importance in promoting work ability. Other key factors for good work ability were frequent exercise, good sleep, non-smoking, low job demands, low physical workload, and high task resources. More specifically, this study suggests that in maintaining work ability, it is valuable not only to promote lifestyle factors or working conditions, but also to enhance employees' positive state of work engagement.
Predictive validity of the Work Ability Index and its individual items in the general population.
Lundin, Andreas; Leijon, Ola; Vaez, Marjan; Hallgren, Mats; Torgén, Margareta
2017-06-01
This study assesses the predictive ability of the full Work Ability Index (WAI) as well as its individual items in the general population. The Work, Health and Retirement Study (WHRS) is a stratified random national sample of 25-75-year-olds living in Sweden in 2000 that received a postal questionnaire ( n = 6637, response rate = 53%). Current and subsequent sickness absence was obtained from registers. The ability of the WAI to predict long-term sickness absence (LTSA; ⩾ 90 consecutive days) during a period of four years was analysed by logistic regression, from which the Area Under the Receiver Operating Characteristic curve (AUC) was computed. There were 313 incident LTSA cases among 1786 employed individuals. The full WAI had acceptable ability to predict LTSA during the 4-year follow-up (AUC = 0.79; 95% CI 0.76 to 0.82). Individual items were less stable in their predictive ability. However, three of the individual items: current work ability compared with lifetime best, estimated work impairment due to diseases, and number of diagnosed current diseases, exceeded AUC > 0.70. Excluding the WAI item on number of days on sickness absence did not result in an inferior predictive ability of the WAI. The full WAI has acceptable predictive validity, and is superior to its individual items. For public health surveys, three items may be suitable proxies of the full WAI; current work ability compared with lifetime best, estimated work impairment due to diseases, and number of current diseases diagnosed by a physician.
Work Ability Index as tool to identify workers at risk of premature work exit.
Roelen, Corné A M; Heymans, Martijn W; Twisk, Jos W R; van der Klink, Jac J L; Groothoff, Johan W; van Rhenen, Willem
2014-12-01
To investigate the Work Ability Index (WAI) as tool for identifying workers at risk of premature work exit in terms of disability pension, unemployment, or early retirement. Prospective cohort study of 11,537 male construction workers (mean age 45.5 years), who completed the WAI at baseline and reported their work status (employed, unemployed, disability pension, or retired) after mean 2.3 years of follow-up. Associations between WAI scores and work status were investigated by multinomial logistic regression analysis. The ability of the WAI to discriminate between workers at high and low risk of premature work exit was analyzed by the area (AUC) under the receiver operating characteristic curve. 9,530 (83 %) construction workers had complete data for analysis. At follow-up, 336 (4 %) workers reported disability pension, 125 (1 %) unemployment, and 255 (3 %) retirement. WAI scores were prospectively associated with the risk of disability pension at follow-up, but not with the risk of unemployment and early retirement. The WAI showed fair discrimination to identify workers at risk of disability pension [AUC = 0.74; 95 % confidence interval (CI) 0.70-0.77]. The discriminative ability decreased with age from AUC = 0.78 in workers aged 30-39 years to AUC = 0.69 in workers ≥50 years of age. Discrimination failed for unemployment (AUC = 0.51; 95 % CI 0.47-0.55) and early retirement (AUC = 0.58; 95 % CI 0.53-0.61). The WAI can be used to identify construction workers <50 years of age at increased risk of disability pension and invite them for preventive interventions.
Ahlstrom, Linda; Grimby-Ekman, Anna; Hagberg, Mats; Dellve, Lotta
2010-09-01
This study investigated the association between the work ability index (WAI) and the single-item question on work ability among women working in human service organizations (HSO) currently on long-term sick leave. It also examined the association between the WAI and the single-item question in relation to sick leave, symptoms, and health. Predictive values of the WAI, the changed WAI, the single-item question and the changed single-item question were investigated for degree of sick leave, symptoms, and health. This cohort study comprised 324 HSO female workers on long-term (>60 days) sick leave, with follow-ups at 6 and 12 months. Participants responded to questionnaires. Data on work ability, sick leave, health, and symptoms were analyzed with regard to associations and predictability. Spearman correlation and mixed-model analysis were performed for repeated measurements over time. The study showed a very strong association between the WAI and the single-item question among all participants. Both the WAI and the single-item question showed similar patterns of associations with sick leave, health, and symptoms. The predictive value for the degree of sick leave and health-related quality of life (HRQoL) was strong for both the WAI and the single-item question, and slightly less strong for vitality, neck pain, both self-rated general and mental health, and behavioral and current stress. This study suggests that the single-item question on work ability could be used as a simple indicator for assessing the status and progress of work ability among women on long-term sick leave.
Research Article Special Issue
African Journals Online (AJOL)
pc
2017-11-10
Nov 10, 2017 ... Officers Training Team (PALAPES) after underwent three years of ... Pek Lian et al., [7], co-curriculum can provide many benefits to students. ... At institute of higher education there are several uniformed forces established for.
Institute of Scientific and Technical Information of China (English)
杨茂发; 李子忠
2001-01-01
In this paper three new species of the genus Anatkina are described from Guizhou,China.All the type specimens are deposited in the Agricultural College of Guizhou University. 1 Anatkina livimacula sp.nov. (Figs.1-7) Length(incl.teg.):♂ 9.6?mm,♀9.0-9.3?mm. This species resembles A.xanthomacula Kuoh in appearance,but can be distinguished from the latter by its crown with three distinct black markings;pronotum with four or two brown spots near anterior margin and a transverse black band in posterior portion;scutellum uniform black;forewing red with a blue marking on claval base and a pink marking in middle part of costal area;the shape of male pygofer process,subgenital plate,aedeagus and style also distinctly different. Holotype ♂,Guizhou:Maolan(25°30′N,108°10′E),30 May 1998,collected by LI Zi-Zhong.Paratype 1♀,same location as holotype,18 May 1995,by CHEN Xiang-Sheng;1♀,Guizhou:Ziyun,18 Jul. 1988,by WEI Lian-Meng. 2 Anatkina rubipennis sp.nov. (Figs.8-16) Length (incl.teg.):♂ 13.2?mm. This species is similar to A.nigriventris Li,but can be easily distinguished from the latter by the pronotum black-brown without distinct black spots;forewing dark red with a black spot in base of clavus and confluent dark markings bordering base of apical cells;the end of male paraphysis furcate,pygofer process smooth,subgenital plate curved abruptly dorsad with macrosetae not uniseriate. Holotype ♂,Guizhou:Maolan (25°30′N,108°10′E),19 May 1995,collected by CHEN Xiang-Sheng. 3 Anatkina bistriata sp.nov. (Figs.17-25) Length (incl.teg.):♂10.0?mm-10.6?mm,♀10.0?mm. This species has unique colour pattern on head and pronotum,forewing black with two red stripes in basal half,which are different from those of any other species of the genus. Holotype ♂,Guizhou:Maolan(25°30′N,108°10′E),21 May 1995,by CHEN Xiang-Sheng.Paratypes 2 ♂♂,1♀,same data as holotype
Generation and electric control of spin-valley-coupled circular photogalvanic current in WSe2
Yuan, Hongtao; Hwang, Harold Y.; Cui, Yi
2015-03-01
Compared to the weak spin-orbit-interaction (SOI) in graphene, layered transitionmetal chalcogenides MX2 have heavy 4d/5d elements with strong atomic SOI, providing a unique way to extend functionalities of novel spintronics and valleytronics devices. Such a valley polarization achieved via valley-selective circular dichroism has been predicted theoretically and demonstrated with optical experiments in MX2 systems. Despite the exciting progresses, the generation of a valley/spin current by valley polarization in MX2 remains elusive and a great challenge. A spin/valley current in MX2 compounds caused by such a valley polarization has never been observed, nor its electric-field control. In this talk, we demonstrated, within an electric-double-layer transistor based on WSe2, the manipulation of a spin-coupled valley photocurrent whose direction and magnitude depend on the degree of circular polarization of the incident radiation and can be further greatly modulated with an external electric field. Such room temperature generation and electric control of valley/spin photocurrent provides a new property of electrons in MX2 systems, thereby enabling new degrees of control for quantum-confined spintronics devices. (In collaboration with S.C. Zhang, Y.L. Chen, Z.X. Shen, B Lian, H.J. Zhang, G Xu, Y Xu, B Zhou, X.Q. Wang, B Shen X.F. Fang) Acknowledge the support from DoE, BES, Division of MSE under contract DE-AC02-76SF00515. Acknowledge the support from DoE, BES, Division of MSE under contract DE-AC02-76SF00515.
Directory of Open Access Journals (Sweden)
Wu J
2013-08-01
Full Text Available Jun Wu1, Wei He2, Wei-min Chen1, Lian Zhu21Key Laboratory of Optoelectronic Technology and Systems, 2State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing, People’s Republic of ChinaAbstract: The real-time monitoring of intracranial pressure (ICP is very important for craniocerebrally critically ill patients, but it is very difficult to realize long-time monitoring for the traditional invasive method, which very easily infects patients. Many noninvasive methods have emerged, but these have not been able to monitor ICP for long periods in real time, and they are not ready for clinical application. In order to realize long-time, online, real-time, noninvasive monitoring for ICP, a new method based on acoustoelasticity of ultrasound is herein proposed. Experimental models were devised to research the new method for experiment and simulation. Polymethyl methacrylate and hydrogel were adopted for the experiment, and their mechanical properties were very close to the real brain. A numerical solution for acoustoelasticity theory was acquired by simulating calculation based on a finite-element method. This was compared to the experimental value. The results showed a consistent match between theoretical solution and experimental value, with maximum error at most 5%. Thus, the effectiveness of the new method was verified. Theoretical and practical foundation is provided for this new method, and it could be used for animal experimentation or clinical testing in further research.Keywords: medical instruments, noninvasive, intracranial pressure, ultrasonic, acoustoelasticity, biomechanics
Umphress, Thomas B
2008-06-01
Twenty people with suspected intellectual disability took the Reynolds Intellectual Assessment Scales (RIAS; C. R. Reynolds & R. W. Kamphaus, 1998) and the Wechsler Adult Intelligence Scale-3rd Edition (WAIS-III; D. Wechsler, 1997) to see if the 2 IQ tests produced comparable results. A t test showed that the RIAS Composite Intelligence Index scores were significantly higher than WAIS-III Full Scale IQ scores at the alpha level of .01. There was a significant difference between the RIAS Nonverbal Intelligence and WAIS-III Performance Scale, but there was no significant difference between the RIAS Verbal Intelligence Index and the WAIS-III Verbal Scale IQ. The results raise questions concerning test selection for diagnosing intellectual disability and the use of the correlation statistic for comparing intelligence tests.
Two electrophoreses in different pH buffers to purify forest soil DNA ...
African Journals Online (AJOL)
USER
2010-04-19
Apr 19, 2010 ... forest soil DNA contaminated with humic substances. Weiguo Hou1,2, Bin Lian1* ... weight, and may be soluble or insoluble in water. Similar ..... changes of turnover ecosystems traced by stable carbon isotopes. Chinese J.
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. PING-YING TANG1 GUO-HUA HUANG1 QING-LIAN XIE1 JIAN-YING LI1. Key Laboratory of New Electric Functional Materials of Guangxi Colleges and Universities, Guangxi Teachers Education University, Nanning 530023, China ...
Forensic aspects of intellectual disabilities and autism spectrum disorders
Nugent, Stella
2016-01-01
Overview This thesis reviewed forensic aspects of Intellectual Disabilities (ID) and Autism Spectrum Disorder (ASD). Chapter two was a case study where an individual with ID and ASD who exhibited forensic/Challenging Behaviour (CB) was assessed and intervention offered. Chapter three then focussed on the assessment of people with ID and ASD by critiquing the Wechsler Adult Intelligence Scale (WAIS), version 3 and 4 (WAIS-III & WAIS-IV) (Wechsler, 1997; Wechsler, 2008a, 2008b, 2008c) and ...
Directory of Open Access Journals (Sweden)
Levoshko Svetlana
2016-01-01
Full Text Available This article analyzes results of an unique experience of the Dao Wai historic district renovation project in Harbin of the 2010th. It includes an interpretation of the stylistic features of the Dao Wai building. Also, there was made a presumptive conclusion about the origins of the “Chinese Baroque”, which is now famous Dao Wai, combining European order architecture and far Eastern decorative tradition. Presumptive conclusion was based on the construction area observing in 2011-2016 and on the Chinese sources. As a result of renovation, there was formed a new public space with high tourism potential. Social value and status of the Dao Wai has significantly grown. The significant cost increase of real estate and provided services is an essential consequence of the gentrification method. There are were noted increased problems of the native people forced to move from the center to the outskirts of the city. Also, this article analyzes the current stage of the second phase design of Dao Wai renovation project and the perspectives for its implementation.
Therapeutic alliance in dietetic practice for weight loss: Insights from health coaching.
Nagy, Annaliese; McMahon, Anne; Tapsell, Linda; Deane, Frank; Arenson, Danielle
2018-02-13
The psychological construct of 'therapeutic alliance' can be used to better understand the effectiveness of consultations, particularly goal setting for weight management. We analysed audio-recorded health coaching sessions during a weight loss trial to explore relationships between therapeutic alliance and various contextual factors. Audio recordings of 50 health coaching sessions were analysed. After assessing fidelity to the protocol, therapeutic alliance was measured using an adapted Working Alliance Inventory Observer-rated Short Version (WAI-O-S), and examined by (i) identifying relationships between contextual factors and WAI-O-S scores (Spearman's coefficients); (ii) testing the impact of preparatory exercises and body mass index on WAI-O-S scores (one-way analysis of variance and least-squared differences tests) and (iii) comparing differences in WAI-O-S scores based on relationship status, gender and follow-up session completion (independent samples t-tests). Fidelity was high (mean 88%). WAI-O-S total scores ranged from 55 to 70 (out of 84). Session duration was significantly correlated with WAI-O-S component of 'Bond' (r = 0.42, P = 0.002). Those who completed preparatory exercises had significantly higher total WAI-O-S scores, 'Goal' and 'Task' scores. Participants who completed the follow-up session scored significantly higher for 'Goal' compared to no follow-up. Spending more time in a session appears related to increased bonding, a key component of therapeutic alliance. Preparatory work may help build therapeutic alliance and agreement on goals appears to influence follow-up completion. These exploratory findings provide directions for research addressing the professional relationship in dietetic consultations for weight loss. © 2018 Dietitians Association of Australia.
Whole-abdomen radiotherapy for non-Hodgkin's lymphoma using twice-daily fractionation
International Nuclear Information System (INIS)
Liauw, Stanley L.; Yeh, Alexander M.; Morris, Christopher G.; Olivier, Kenneth R.; Mendenhall, Nancy Price
2006-01-01
Purpose: To report the tolerability and efficacy of twice-daily whole-abdomen irradiation (WAI) for non-Hodgkin's lymphoma (NHL). Methods and Materials: Of 123 patients treated for NHL with WAI, 37% received previous chemotherapy, 28% received WAI as part of comprehensive lymphatic irradiation (CLI), and 32% received WAI for palliation. The median dose to the whole abdomen was 25.0 Gy, followed by a median tumor boost of 9.8 Gy in 58 patients. Fractionation was 1.0 Gy once daily (54%) or 0.8 Gy twice daily (46%). Blood counts were measured weekly. Results: At a median follow-up of 4.3 years, local control was 72% and overall survival was 55% at 5 years. Median time of WAI was 42 days for once-daily treatment and 32 days for twice-daily treatment. Patients receiving twice-daily WAI did not have a significantly higher rate of acute side effects (e.g., nausea, diarrhea, platelet or red blood cell toxicity). Overall, acute thrombocytopenia was the most frequent side effect of treatment; 24 of 96 patients (25%) with available hematologic data had Grade 3+ toxicity. There was no acute Grade 3 gastrointestinal toxicity and no late small bowel obstruction. Multiple regression indicated that patients with four or less involved sites and disease size ≤6 cm had improved local control and overall survival. Conclusions: Twice-daily WAI using 0.8 Gy/fraction does not appear to have any greater toxicity compared with once-daily treatment using 1 Gy/fraction. Small doses per fraction (0.8-1 Gy/fx) are effective, tolerated well in the acute setting, and associated with a low rate of late toxicity
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Hong Zhang Teng-Long Guo Qing-Lian Wang · More Details Abstract Fulltext PDF. Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton.
Ng, Jacky Y K; Chan, Alan H S
2018-05-14
The shortage in Hong Kong of construction workers is expected to worsen in future due to the aging population and increasing construction activity. Construction work is dangerous and to help reduce the premature loss of construction workers due to work-related disabilities, this study measured the work ability of 420 Hong Kong construction workers with a Work Ability Index (WAI) which can be used to predict present and future work performance. Given the importance of WAI, in this study the effects of individual and work-related factors on WAI were examined to develop and validate a WAI model to predict how individual and work-related factors affect work ability. The findings will be useful for formulating a pragmatic intervention program to improve the work ability of construction workers and keep them in the work force.
Microstructure and mechanical properties of carbon fiber reinforced ...
Indian Academy of Sciences (India)
68
Alumina; composites; carbon fiber reinforcement; sol; mechanical properties. 1. Introduction ... The reinforcement was 3D carbon fiber (T300 3k, ex-PAN carbon fiber ... where f(a/H) = 2.9(a/H)1/2 – 4.6(a/H)3/2 + 21.8(a/H)5/2. – 37.6(a/H)7/2 + ...
IntelliCable Interface Specification
2016-07-14
44 Offset 00 – Battery Data Block size ...in case of an emergency (Primary Batteries ) 03 – 05 Low – Can be periodically refilled but has limit capacity /fuel (Fuel Cells) 06 – 10 Renewable...includes (solar blankets, AC Adapters, Primary Batteries , etc. Offset Size Values Description Notes 00 1 Byte Block Dependant (fah max) Source
El Fassi, Mehdi; Bocquet, Valery; Majery, Nicole; Lair, Marie Lise; Couffignal, Sophie; Mairiaux, Philippe
2013-01-01
Background Public authorities in European countries are paying increasing attention to the promotion of work ability throughout working life and the best method to monitor work ability in populations of workers is becoming a significant question. The present study aims to compare the assessment of work ability based on the use of the Work Ability Index (WAI), a 7-item questionnaire, with another one based on the use of WAI?s first item, which consists in the worker?s self-assessment of his/he...
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Molecular characterisation of canine parvovirus strains circulating in ...
African Journals Online (AJOL)
STORAGESEVER
2010-07-19
Jul 19, 2010 ... Canine parvovirus (CPV) was first isolated at 1978 in the USA. Analysis of ... Japan, Australia, Italy and Africa although the proportions of CPV-2a ... T/A clone PCR product cloning Kit (Takara, DaLian, China). Sequencing was ...
Jääskeläinen, Anne; Kausto, Johanna; Seitsamo, Jorma; Ojajärvi, Anneli; Nygård, Clas-Håkan; Arjas, Elja; Leino-Arjas, Päivi
2016-06-01
We analyzed the work ability index (WAI) and its first item (work ability score, WAS) - and subsequent four-year changes thereof - as predictors of disability pension (DP). We linked survey responses of 5251 Finnish municipal employees, aged 44-58 years, to pension and death register data until 2009. Job content (physical, mental, or mixed) was based on observation. Baseline (1981) WAI was divided into poor (37) and WAS into poor (0-5), moderate (6-7), and good/excellent (8-10). Four-year changes in these scores were classified as strong decline (
Holt, M S; Neal, K; Eun, J-S; Young, A J; Hall, J O; Nestor, K E
2013-10-01
This experiment was conducted to determine the effects of corn silage (CS) hybrids and quality of alfalfa hay (AH) in high-forage dairy diets on N utilization, ruminal fermentation, and lactational performance by early-lactating dairy cows. Eight multiparous Holstein cows were used in a duplicated 4 × 4 Latin square experiment with a 2 × 2 factorial arrangement of dietary treatments. The 8 cows (average days in milk = 23 ± 11.2) were surgically fitted with ruminal cannula, and the 2 squares were conducted simultaneously. Within square, cows were randomly assigned to a sequence of 4 diets: conventional CS (CCS) or brown midrib CS (BMR) was combined with fair-quality AH [FAH: 46.7% neutral detergent fiber (NDF) and 18.4% crude protein (CP)] or high-quality AH (HAH: 39.2% NDF and 20.7% CP) to form 4 treatments: CCS with FAH, CCS with HAH, BMR with FAH, and BMR with HAH. Diets were isonitrogenous across treatments, averaging 15.9% CP. Each period lasted a total of 21 d, with 14 d for treatment adaptation and 7d for data collection and sampling. Intake of DM and milk yield did not differ in response to CS hybrids or AH quality. Although feeding BMR-based diets decreased urinary N output by 24%, it did not affect fecal N output. Feeding HAH decreased urinary N output by 15% but increased fecal N output by 20%. Nitrogen efficiency [milk N (g/d)/intake N (g/d)] tended to increase for BMR treatments. Ruminal ammonia-N concentration was lower for cows fed BMR-based diets than for those fed CCS-based diets but was not affected by quality of AH. Feeding BMR-based diets or HAH decreased milk urea N concentration by 23 or 15%, respectively, compared with CCS-based diets or FAH. Total volatile fatty acid concentration increased with HAH but was not influenced by CS hybrids. Feeding BMR-based diets decreased urinary N-to-fecal N ratio (UN:FN), and it was further reduced by feeding HAH. Although cows fed the BMR-based diets tended to increase milk N-to-manure N ratio, the
Ng, Jacky Y. K.
2018-01-01
The shortage in Hong Kong of construction workers is expected to worsen in future due to the aging population and increasing construction activity. Construction work is dangerous and to help reduce the premature loss of construction workers due to work-related disabilities, this study measured the work ability of 420 Hong Kong construction workers with a Work Ability Index (WAI) which can be used to predict present and future work performance. Given the importance of WAI, in this study the effects of individual and work-related factors on WAI were examined to develop and validate a WAI model to predict how individual and work-related factors affect work ability. The findings will be useful for formulating a pragmatic intervention program to improve the work ability of construction workers and keep them in the work force. PMID:29758018
Dori, Galit A; Chelune, Gordon J
2004-06-01
The Wechsler Adult Intelligence Scale--Third Edition (WAIS-III; D. Wechsler, 1997a) and the Wechsler Memory Scale--Third Edition (WMS-III; D. Wechsler, 1997b) are 2 of the most frequently used measures in psychology and neuropsychology. To facilitate the diagnostic use of these measures in the clinical decision-making process, this article provides information on education-stratified, directional prevalence rates (i.e., base rates) of discrepancy scores between the major index scores for the WAIS-III, the WMS-III, and between the WAIS-III and WMS-III. To illustrate how such base-rate data can be clinically used, this article reviews the relative risk (i.e., odds ratio) of empirically defined "rare" cognitive deficits in 2 of the clinical samples presented in the WAIS-III--WMS-III Technical Manual (The Psychological Corporation, 1997). ((c) 2004 APA, all rights reserved)
On the symmetry algebra of the discrete states in d<2 closed string theory
International Nuclear Information System (INIS)
Panda, S.; Roy, S.
1993-01-01
The symmetry charges associated with the Lian-Zuckerman states for d<2 closed string theory are constructed. Unlike in the open string case, it is shown here that the symmetry charges commute among themselves and act trivially on all the physical states. (author). 19 refs
Anand Raj; Cynthia Lian; Wen-Ly Chin
2015-01-01
There is still some way for Malaysia to go and the lack of merger control (for the foreseeable future) remains a significant shortcoming in the Malaysian competition law regime at this stage. Anand Raj, Cynthia Lian, & Wen-Ly Chin (Shearn Delamore & Co., Kuala Lumpur)
Erdodi, Laszlo A; Abeare, Christopher A; Lichtenstein, Jonathan D; Tyson, Bradley T; Kucharski, Brittany; Zuccato, Brandon G; Roth, Robert M
2017-02-01
Research suggests that select processing speed measures can also serve as embedded validity indicators (EVIs). The present study examined the diagnostic utility of Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) subtests as EVIs in a mixed clinical sample of 205 patients medically referred for neuropsychological assessment (53.3% female, mean age = 45.1). Classification accuracy was calculated against 3 composite measures of performance validity as criterion variables. A PSI ≤79 produced a good combination of sensitivity (.23-.56) and specificity (.92-.98). A Coding scaled score ≤5 resulted in good specificity (.94-1.00), but low and variable sensitivity (.04-.28). A Symbol Search scaled score ≤6 achieved a good balance between sensitivity (.38-.64) and specificity (.88-.93). A Coding-Symbol Search scaled score difference ≥5 produced adequate specificity (.89-.91) but consistently low sensitivity (.08-.12). A 2-tailed cutoff on the Coding/Symbol Search raw score ratio (≤1.41 or ≥3.57) produced acceptable specificity (.87-.93), but low sensitivity (.15-.24). Failing ≥2 of these EVIs produced variable specificity (.81-.93) and sensitivity (.31-.59). Failing ≥3 of these EVIs stabilized specificity (.89-.94) at a small cost to sensitivity (.23-.53). Results suggest that processing speed based EVIs have the potential to provide a cost-effective and expedient method for evaluating the validity of cognitive data. Given their generally low and variable sensitivity, however, they should not be used in isolation to determine the credibility of a given response set. They also produced unacceptably high rates of false positive errors in patients with moderate-to-severe head injury. Combining evidence from multiple EVIs has the potential to improve overall classification accuracy. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Demographic and occupational determinants of the work ability of firemen.
Firoozeh, Marjan; Saremi, Mahnaz; Kavousi, Amir; Maleki, Azam
2017-01-24
Firefighters tackle various stressors that affect their health and job performance; therefore, assessment of their work ability is necessary. This study aimed to investigate the demographic and occupational determinants of the work ability of firemen. In this cross-sectional study, 375 firemen working in Tehran Fire Department were randomly selected. Demographic, occupational, and work ability index (WAI) questionnaires were applied as research tools. The mean firemen's WAI score was relatively high. There were significant relationships between WAI and age, body mass index, work experience, and weekly leisure-time physical exercise hours. Single employees, those who did not have extra jobs and did not smoke, had greater scores compared to their counterparts. Poisson regression revealed that age and weekly leisure-time physical exercise hours could affect WAI significantly. Although Iranian firemen revealed good work ability, recognizing factors affecting this ability and preparing facilities to promote their function is necessary.
Roelen, Corné A M; van Rhenen, Willem; Groothoff, Johan W; van der Klink, Jac J L; Twisk, Jos W R; Heymans, Martijn W
2014-07-01
Work ability predicts future disability pension (DP). A single-item work ability score (WAS) is emerging as a measure for work ability. This study compared single-item WAS with the multi-item work ability index (WAI) in its ability to identify workers at risk of DP. This prospective cohort study comprised 11 537 male construction workers, who completed the WAI at baseline and reported DP after a mean 2.3 years of follow-up. WAS and WAI were calibrated for DP risk predictions with the Hosmer-Lemeshow (H-L) test and their ability to discriminate between high- and low-risk construction workers was investigated with the area under the receiver operating characteristic curve (AUC). At follow-up, 336 (3%) construction workers reported DP. Both WAS [odds ratio (OR) 0.72, 95% confidence interval (95% CI) 0.66-0.78] and WAI (OR 0.57, 95% CI 0.52-0.63) scores were associated with DP at follow-up. The WAS showed miscalibration (H-L model χ (�)=10.60; df=3; P=0.01) and poorly discriminated between high- and low-risk construction workers (AUC 0.67, 95% CI 0.64-0.70). In contrast, calibration (H-L model χ �=8.20; df=8; P=0.41) and discrimination (AUC 0.78, 95% CI 0.75-0.80) were both adequate for the WAI. Although associated with the risk of future DP, the single-item WAS poorly identified male construction workers at risk of DP. We recommend using the multi-item WAI to screen for risk of DP in occupational health practice.
Indian Academy of Sciences (India)
Home; Journals; Pramana – Journal of Physics. BAONAN SUN. Articles written in Pramana – Journal of Physics. Volume 90 Issue 2 February 2018 pp 23 Research Article. Rogue waves in the multicomponent Mel'nikov system and multicomponent Schrödinger–Boussinesq system · BAONAN SUN ZHAN LIAN.
The importance of measurement invariance in neurocognitive ability testing
Wicherts, J.
2016-01-01
Objective: Neurocognitive test batteries such as recent editions of the Wechsler’s Adult Intelligence Scale (WAIS-III/WAIS-IV) typically use nation-level population-based norms. The question is whether these batteries function in the same manner across different subgroups based on gender, age,
Longitudinal associations between stressors and work ability in hospital workers.
Carmen Martinez, Maria; da Silva Alexandre, Tiago; Dias de Oliveira Latorre, Maria do Rosario; Marina Fischer, Frida
This study sought to assess associations between work stressors and work ability in a cohort (2009-2012) of 498 hospital workers. Time-dependent variables associated with the Work Ability Index (WAI) were evaluated using general linear mixed models. Analyses included effects of individual and work characteristics. Except for work demands, the work stressors (job control, social support, effort-reward imbalance, overcommitment and work-related activities that cause pain/injury) were associated with WAI (p work and morning shift work were associated with decreased WAI (p Work stressors negatively affected work ability over time independently of other variables.
Directory of Open Access Journals (Sweden)
Fu Z
2015-09-01
Full Text Available Zhenhong Fu,1,* Geng Qian,1,* Hao Xue,1,* Jun Guo,1 Lian Chen,1 Xia Yang,1 Mingzhi Shen,2 Wei Dong,1 Yundai Chen11Department of Cardiology, Chinese People’s Liberation Army General Hospital, Beijing, People’s Republic of China; 2Department of Cardiology, Hainai Branch of Chinese People’s Liberation Army General Hospital, Sanya, Hainan, People’s Republic of China*These authors contributed equally to this workObjective: To evaluate the prognostic value of homocysteine (Hcy in Chinese acute coronary syndrome (ACS octogenarians.Methods: The study cohort comprised 660 consecutive ACS octogenarians who underwent coronary angiography. We classified the patients into three groups according to Hcy tertiles. Kaplan–Meier method was performed for survival and major adverse cardiac events (MACE rates. Multivariate Cox regression was performed to identify mortality predictors. Receiver operating characteristic curve analysis was performed to predict the cutoff value of Hcy for all-cause mortality.Results: The follow-up period was 28 (inter-quartile range: 16–38 months. Diastolic blood pressure, ratios of male, renal failure and old myocardial infarction in high plasma level Hcy (H-Hcy group were higher than those in low (L-Hcy and middle (M-Hcy plasma level of Hcy groups (P<0.05. The Hcy level was positively correlated with uric acid level (r=0.211, P=0.001 and Cystatin C (Cys C level (r=0.212, P=0.001 and negatively correlated with estimated glomerular filtration rate (r=−0.148, P=0.018. For the long-term outcomes, the cumulative survival rate of H-Hcy group was significantly lower than that of L-Hcy and M-Hcy groups (P=0.006. All-cause mortality and MACE of H-Hcy group were higher than those of L-Hcy and M-Hcy group (P=0.0001, P=0.0008. Hcy is an independent predictor for long-term all-cause mortality (odds ratio =2.26, 95% CI=1.23–4.16, P=0.023 and MACE (odds ratio =1.91, 95% CI=1.03–3.51, P=0.039. Receiver operating characteristic
Mokarami, Hamidreza; Mortazavi, Seyed Bagher; Asgari, Ali; Choobineh, Alireza; Stallones, Lorann
2017-09-01
The present study was designed to investigate the simultaneous effects of physical, psychosocial and other work-related risk factors on the work ability index (WAI) score among industrial workers. This study used a cross-sectional design with a questionnaire survey. A total of 280 workers were included in the study. Data were collected using three questionnaires including the Persian version of the WAI, the Persian version of the job content questionnaire and an author-developed measure (to assess work-related factors, health-related factors and socio-demographic characteristics). The majority of the participants were young, but they had poor WAI scores (mean 37.3 ± 6.4) and 44.3% of them had poor or moderate work ability. Occupational accidents and injuries were found to be the strongest predictors of WAI scores. Additionally, there was a strong association between WAI scores and supervisor support, skill discretion, occupational training, sleep quality, work nature and educational level. Intervention programs should focus on improving supervisor support, sleep quality, job skills and knowledge and on decreasing physical and mental work demands. Additionally, implementing a comprehensive occupational health and ergonomics program for controlling and reducing hazardous working environments and occupational injury rates should be considered.
Effects of Work-Related Stress on Work Ability Index among Iranian Workers.
Gharibi, Vahid; Mokarami, Hamidreza; Taban, Abrahim; Yazdani Aval, Mohsen; Samimi, Kazem; Salesi, Mahmood
2016-03-01
Work Ability Index (WAI) is a well-known and valid self-report tool that has been widely used in various studies to identify and avoid early retirement and work-related disability. Nevertheless, very few studies have been carried out to evaluate work ability in Iran. We aimed to investigate the WAI and the effect of work-related stress on it among Iranian workers. A cross-sectional, descriptive and analytic study was carried out among 449 workers from five working sectors in three big cities of Iran. Work ability and work-related stress were measured using the Persian version of WAI and the Persian version of Health and Safety Executive Stress Indicator Tool. More than a third of the workers surveyed (34.70%) did not have an appropriate level of work ability (WAI work-related stress and the mean score of WAI. Furthermore, the variables of body mass index, sleep quality, exercise activity, job tenure, and three subscales of work-related stress including demands, supervisor support, and role were significant predictors of WAI. According to the results of this study, the interventional programs must be focused on improving supervisors support, eliminating ambiguity and conflicts in the role of workers in their job and organization, reducing job demands, improving sleep quality, and increasing exercise activity.
RELASI LAKI-LAKI DAN PEREMPUAN DALAM AL-QUR’AN MENURUT AMINA WADUD
Directory of Open Access Journals (Sweden)
M. Rusydi
2014-11-01
Full Text Available This writing analyzes Amina Wadud’s view on gender in Islam. The issue put forward is on the question of Wadud’s reading method on gender in the Qur’an. This paper reveals that according to Wadud there are three main principles to solve gender problems, namely, tauhîd, taqwa and khalîfah. The principles of tauhîd and taqwa show equality because al-Qur’an prescribes that no one is being having more self-esteem except with the quality of taqwa. Wadud calls these principles as tauhidic paradigm. While the principle of khalîfah in al-Qur’an requires Muslim, both man and woman alike, to become an agent of moral custodian to maintain the harmony of the world. She also urges that the Qur’an be interpreted holistically by considering three aspects; the context of revelation, stylistic and grammar of text, as well as weltanschauung or worldview of the text. As such she designates her methodology as a tauhidic hermeneutic, since upon this methodology, it can be argued that the Qur’an looks at man and woman equally.
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Work ability index among healthcare personnel in a university hospital in Tehran, Iran.
Mehrdad, R; Mazloumi, A; Arshi, S; Kazemi, Z
2016-03-09
Work ability is an important issue from a social point of view, as it is essential for workers health and welfare. This study aimed to determine work ability among healthcare personnel and to investigate its relationship with demographic and lifestyle-related factors. Data were collected using the Work Ability Index (WAI) questionnaire among 517 personnel of a hospital in Tehran, Iran. Findings showed a mean WAI of 40.3 (±5.2) for the study population. Work ability was significantly lower in the older personnel and higher for men. A significant correlation was observed between BMI and exercise activity and WAI score. Moreover, employees with experience of less than five years had significant higher work ability than those with 16-20 years of service. Considering the young study population, it seems the mean WAI is not as desirable. The use of lifestyle promoting programs, besides workplace interventions, can be an effective strategy to increase work ability among healthcare workers.
Ingram, Nicolette S; Diakoumakos, Jessica V; Sinclair, Erin R; Crowe, Simon F
2016-01-01
This study investigated proactive and retroactive interference effects between the Wechsler Memory Scale-Fourth Edition (WMS-IV) using the flexible approach, and the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). One hundred and eighty nonclinical participants were assigned to a four (visual interference, verbal interference, visual and verbal interference, vs. no interference) by two (retroactive vs. proactive) between-subjects design. The administration order of the tests was counterbalanced (i.e., administration of the WAIS-IV prior to the WMS-IV, and the WAIS-IV administered during the delay interval of the WMS-IV). The WAIS-IV produced significant retroactive interference effects on the WMS-IV; however, no proactive interference effect was observed. The retroactive interference effect was dependent on material specificity. The results indicate that material presented within the delay of the WMS-IV can have a significant effect on subsequent delayed recall. Clinicians should carefully consider the effects associated with carry-over effects of these tests when using them in combination.
Early Identification of Skill Needs in Europe. CEDEFOP Reference Series.
Schmidt, Susanne Liane, Ed.; Schomann, Klaus, Ed.; Tessaring, Manfred, Ed.
This document contains the following papers: "Early Recognition of Skill Needs in Europe: European Conference, Berlin, 30/31 May 2002" (Susanne Liane Schmidt, Klaus Schomann, Manfred Tessaring); "Welcome and Opening of the European Conference 'Early Recognition of Skill Needs in Europe,' 30 May 2002, Social Sciences Research Center…
Work Ability Index as Tool to Identify Workers at Risk of Premature Work Exit
Roelen, Corne A. M.; Heymans, Martijn W.; Twisk, Jos W. R.; van der Klink, Jac J. L.; Groothoff, Johan W.; van Rhenen, Willem
2014-01-01
Purpose To investigate the Work Ability Index (WAI) as tool for identifying workers at risk of premature work exit in terms of disability pension, unemployment, or early retirement. Methods Prospective cohort study of 11,537 male construction workers (mean age 45.5 years), who completed the WAI at
Work ability index as tool to identify workers at risk of premature work exit
Roelen, C.A.M.; Heymans, M.W.; Twisk, J.W.R.; van der Klink, J.J.L.; Groothoff, J.W.; van Rhenen, W.
2014-01-01
Purpose To investigate the Work Ability Index (WAI) as tool for identifying workers at risk of premature work exit in terms of disability pension, unemployment, or early retirement. Methods Prospective cohort study of 11,537 male construction workers (mean age 45.5 years), who completed the WAI at
Bethge, Matthias; Gutenbrunner, Christoph; Neuderth, Silke
2013-11-01
To determine whether the Work Ability Index (WAI), a short 7-item self-report questionnaire addressing issues of perceived disability, impairment, and expectations for resuming work, predicts application for disability pension, recommendations for further treatment, and other adverse work-related criteria in patients with chronic back pain after rehabilitation. Cohort study with 3-month follow-up. Seven inpatient rehabilitation centers. Patients (N=294; 168 women; mean age, 49.9y) with chronic back pain. The WAI was completed at the beginning of rehabilitation. All patients were treated according to the German rehabilitation guidelines for chronic back pain and work-related medical rehabilitation. Application for disability pension, as assessed by a postal questionnaire 3 months after discharge. Receiver operating characteristic curve analysis of the association between the WAI at baseline and subsequent application for disability pension revealed an area under the curve of .80 (95% confidence interval [CI], .62-.97). Youden index was highest when the WAI cutoff value was ≤20 points (sensitivity, 72.7%; specificity, 82.2%; total correct classification, 81.7%). After adjusting for age and sex, persons with a baseline WAI score of ≤20 points had 15.6 times (95% CI, 3.6-68.2) higher odds of subsequent application for disability pension, 4.9 times (95% CI, 1.5-16.8) higher odds of unemployment, and 6 times (95% CI, 2.4-15.2) higher odds of long-term sick leave at follow-up. The WAI could help rehabilitation professionals identify patients with back pain with a high risk of a subsequent application for disability pension. Copyright © 2013 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Validity of the Working Alliance Inventory within Child Protection Services
Killian, Michael; Forrester, Donald; Westlake, David; Antonopoulou, Paraskevi
2017-01-01
The Working Alliance Inventory remains a widely studied measure of quality of therapeutic relationships between the practitioner and client. No prior study has examined the psychometrics and validity of the Working Alliance Inventory-Short (WAI-S) in a sample of families, social workers, and trained observers within child protection services.…
2011-09-19
... Group based on evidence on the record indicating that Leo/Denmax, Lian Li, and the Watanabe Group had no...; Address books; Columnar pads & tablets, with or without covers, primarily suited for the recording of... denier polyester, coated on the backside with PVC (poly vinyl chloride) coating, and extending the entire...
Investigation of the Relationship between Work Ability and Work-related Quality of Life in Nurses.
Abbasi, Milad; Zakerian, Abolfazl; Akbarzade, Arash; Dinarvand, Nader; Ghaljahi, Maryam; Poursadeghiyan, Mohsen; Ebrahimi, Mohammad Hossein
2017-10-01
Work ability of nurses is an index of their job satisfaction and is a crucial factor in job quality and security. This study aimed to investigate the association between work ability and quality of working life and to determine the effective demographic and background variables, among nurses. The present study was conducted among nurses, working in educational hospitals under the supervision of Tehran University of Medical Sciences in 2014. Work Ability Index (WAI) and Work-related Quality of Life (WRQoL) were used. The mean WAI was significantly associated with total WRQoL score and the two of its sub-items including Stress at Work, and General Well-Being ( P -value=0.001). Moreover, the results showed a significant correlation between total WRQoL and WAI Subscales including mental resources ( P -value=0.001), number of current diseases ( P- value=0.02), and work ability in relation to the job demands ( P -value=0.04). The WRQoL and WAI showed significant associations with age and job experience ( P -value=0.001). The average score of WAI and WRQoL was statistically different among various working units ( P -value=0.001). Overall, results support the association between nurses work ability and WRQoL. Monitoring the WRQoL and work ability of employees would help organizations to know their status and take measures to ameliorate the working conditions.
Dumenden, Iris E.
2011-01-01
Current research into the experiences of refugee students in mainstream secondary schools in Australia indicates that for these students, schools are places of social and academic isolation and failure. This article introduces one such student, Lian, who came to Australia as a refugee from Burma, and whom the author tutored and mentored…
Kilcolgan Nursing Home, Kilcolgan, Galway.
LENUS (Irish Health Repository)
Donnelly, Vidis
2011-11-10
Abstract Background There is some evidence that when mental health commitment hearings are held in accordance with therapeutic jurisprudence principles they are perceived as less coercive, and more just in their procedures leading to improved treatment adherence and fewer hospital readmissions. This suggests an effect of the hearing on therapeutic relationships. We compared working alliance and interpersonal trust in clinicians and forensic patients, whose continued detentions were reviewed by two different legal review bodies according to their legal category. Methods The hearings were rated as positive or negative by patients and treating psychiatrists using the MacArthur scales for perceived coercion, perceived procedural justice (legal and medical) and for the impact of the hearing. We rated Global assessment of Function (GAF), Positive and Negative Symptom Scale (PANSS), Working Alliance Inventory (WAI) and Interpersonal Trust in Physician (ITP) scales six months before the hearing and repeated the WAI and ITP two weeks before and two weeks after the hearing, for 75 of 83 patients in a forensic medium and high secure hospital. Results Psychiatrists agreed with patients regarding the rating of hearings. Patients rated civil hearings (MHTs) more negatively than hearings under insanity legislation (MHRBs). Those reviewed by MHTs had lower scores for WAI and ITP. However, post-hearing WAI and ITP scores were not different from baseline and pre-hearing scores. Using the receiver operating characteristic, baseline WAI and ITP scores predicted how patients would rate the hearings, as did baseline GAF and PANSS scores. Conclusions There was no evidence that positively perceived hearings improved WAI or ITP, but some evidence showed that negatively perceived hearings worsened them. Concentrating on functional recovery and symptom remission remains the best strategy for improved therapeutic relationships.
Working alliance, interpersonal trust and perceived coercion in mental health review hearings
Directory of Open Access Journals (Sweden)
Donnelly Vidis
2011-11-01
Full Text Available Abstract Background There is some evidence that when mental health commitment hearings are held in accordance with therapeutic jurisprudence principles they are perceived as less coercive, and more just in their procedures leading to improved treatment adherence and fewer hospital readmissions. This suggests an effect of the hearing on therapeutic relationships. We compared working alliance and interpersonal trust in clinicians and forensic patients, whose continued detentions were reviewed by two different legal review bodies according to their legal category. Methods The hearings were rated as positive or negative by patients and treating psychiatrists using the MacArthur scales for perceived coercion, perceived procedural justice (legal and medical and for the impact of the hearing. We rated Global assessment of Function (GAF, Positive and Negative Symptom Scale (PANSS, Working Alliance Inventory (WAI and Interpersonal Trust in Physician (ITP scales six months before the hearing and repeated the WAI and ITP two weeks before and two weeks after the hearing, for 75 of 83 patients in a forensic medium and high secure hospital. Results Psychiatrists agreed with patients regarding the rating of hearings. Patients rated civil hearings (MHTs more negatively than hearings under insanity legislation (MHRBs. Those reviewed by MHTs had lower scores for WAI and ITP. However, post-hearing WAI and ITP scores were not different from baseline and pre-hearing scores. Using the receiver operating characteristic, baseline WAI and ITP scores predicted how patients would rate the hearings, as did baseline GAF and PANSS scores. Conclusions There was no evidence that positively perceived hearings improved WAI or ITP, but some evidence showed that negatively perceived hearings worsened them. Concentrating on functional recovery and symptom remission remains the best strategy for improved therapeutic relationships.
Working alliance, interpersonal trust and perceived coercion in mental health review hearings.
LENUS (Irish Health Repository)
Donnelly, Vidis
2011-11-10
Abstract Background There is some evidence that when mental health commitment hearings are held in accordance with therapeutic jurisprudence principles they are perceived as less coercive, and more just in their procedures leading to improved treatment adherence and fewer hospital readmissions. This suggests an effect of the hearing on therapeutic relationships. We compared working alliance and interpersonal trust in clinicians and forensic patients, whose continued detentions were reviewed by two different legal review bodies according to their legal category. Methods The hearings were rated as positive or negative by patients and treating psychiatrists using the MacArthur scales for perceived coercion, perceived procedural justice (legal and medical) and for the impact of the hearing. We rated Global assessment of Function (GAF), Positive and Negative Symptom Scale (PANSS), Working Alliance Inventory (WAI) and Interpersonal Trust in Physician (ITP) scales six months before the hearing and repeated the WAI and ITP two weeks before and two weeks after the hearing, for 75 of 83 patients in a forensic medium and high secure hospital. Results Psychiatrists agreed with patients regarding the rating of hearings. Patients rated civil hearings (MHTs) more negatively than hearings under insanity legislation (MHRBs). Those reviewed by MHTs had lower scores for WAI and ITP. However, post-hearing WAI and ITP scores were not different from baseline and pre-hearing scores. Using the receiver operating characteristic, baseline WAI and ITP scores predicted how patients would rate the hearings, as did baseline GAF and PANSS scores. Conclusions There was no evidence that positively perceived hearings improved WAI or ITP, but some evidence showed that negatively perceived hearings worsened them. Concentrating on functional recovery and symptom remission remains the best strategy for improved therapeutic relationships.
St Francis Nursing Home, Kilkerrin, Ballinasloe, Galway.
LENUS (Irish Health Repository)
Donnelly, Vidis
2011-11-10
Abstract Background There is some evidence that when mental health commitment hearings are held in accordance with therapeutic jurisprudence principles they are perceived as less coercive, and more just in their procedures leading to improved treatment adherence and fewer hospital readmissions. This suggests an effect of the hearing on therapeutic relationships. We compared working alliance and interpersonal trust in clinicians and forensic patients, whose continued detentions were reviewed by two different legal review bodies according to their legal category. Methods The hearings were rated as positive or negative by patients and treating psychiatrists using the MacArthur scales for perceived coercion, perceived procedural justice (legal and medical) and for the impact of the hearing. We rated Global assessment of Function (GAF), Positive and Negative Symptom Scale (PANSS), Working Alliance Inventory (WAI) and Interpersonal Trust in Physician (ITP) scales six months before the hearing and repeated the WAI and ITP two weeks before and two weeks after the hearing, for 75 of 83 patients in a forensic medium and high secure hospital. Results Psychiatrists agreed with patients regarding the rating of hearings. Patients rated civil hearings (MHTs) more negatively than hearings under insanity legislation (MHRBs). Those reviewed by MHTs had lower scores for WAI and ITP. However, post-hearing WAI and ITP scores were not different from baseline and pre-hearing scores. Using the receiver operating characteristic, baseline WAI and ITP scores predicted how patients would rate the hearings, as did baseline GAF and PANSS scores. Conclusions There was no evidence that positively perceived hearings improved WAI or ITP, but some evidence showed that negatively perceived hearings worsened them. Concentrating on functional recovery and symptom remission remains the best strategy for improved therapeutic relationships.
LED-Band basiertes Interaktionskonzept für ein integratives Fahrerassistenzsystem
Dziennus, Marc; Kelsch, Johann
2015-01-01
Ein Zweck moderner Fahrerassistenzsysteme besteht in einer optimalen Unterstützung des Fah-rers bei Ausführung der Fahraufgabe, der frühzeitigen Kommunikation kritischer Situationen oder dem Eingriff in die Fahrzeugführung in Notfallsituation. Hierfür müssen unterschied-lichste Assistenzfunktionen, die jeweils einen spezifischen Teilbereich abdecken (Spurverlas-senswarnung, Toter Winkel Assistent etc.), zeitgleich und parallel arbeiten. Problematisch wird hierbei die oft unterschiedlich gesta...
The effects of work-related and individual factors on the Work Ability Index: a systematic review.
van den Berg, T I J; Elders, L A M; de Zwart, B C H; Burdorf, A
2009-04-01
This paper systematically reviews the scientific literature on the effects of individual and work-related factors on the Work Ability Index (WAI). Studies on work ability published from 1985 to 2006 were identified through a structured search in PubMed, and Web of Science. Studies were included if the WAI was used as measure of work ability and if quantitative information was presented on determinants of work ability. In total, 20 studies were included with 14 cross-sectional studies and six longitudinal studies. Factors associated with poor work ability, as defined by WAI, were lack of leisure-time vigorous physical activity, poor musculoskeletal capacity, older age, obesity, high mental work demands, lack of autonomy, poor physical work environment, and high physical work load. The WAI is associated with individual characteristics, lifestyle, demands at work, and physical condition. This multifactorial nature of work ability should be taken into account in health promotion programmes aimed at maintaining and promoting the participation of the labour force and improvement of the performance at work.
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
Renteria, Laura; Li, Susan Tinsley; Pliskin, Neil H
2008-05-01
The utility of the Spanish WAIS-III was investigated by examining its reliability and validity among 100 Spanish-speaking participants. Results indicated that the internal consistency of the subtests was satisfactory, but inadequate for Letter Number Sequencing. Criterion validity was adequate. Convergent and discriminant validity results were generally similar to the North American normative sample. Paired sample t-tests suggested that the WAIS-III may underestimate ability when compared to the criterion measures that were utilized to assess validity. This study provides support for the use of the Spanish WAIS-III in urban Hispanic populations, but also suggests that caution be used when administering specific subtests, due to the nature of the Latin America alphabet and potential test bias.
International Nuclear Information System (INIS)
Sasoh, Masayuki
1999-01-01
In order to evaluate the relation between neuropsychological functions and hemodynamic cerebral ischemia, the author analyzed neuropsychological examination and the cerebral blood flow and metabolism of patients before and after bypass surgery. Twenty-five patients were defined by clinical and laboratory criteria as suffering from hemodynamic cerebral ischemia. All patients had one or more episodes of focal cerebral ischemia due to unilateral internal carotid or middle cerebral artery occlusion. Computerized tomography scans either were normal or showed evidence of watershed infarction. Based on these criteria, superficial temporal artery-proximal middle cerebral artery anastomosis was performed. The baseline cerebral blood flow (CBF), oxygen extraction fraction (OEF), cerebral metabolic rate of oxygen (CMRO 2 ) and cerebrovascular reserve capacity (CVRC) were studied using positron emission computerized tomography (PET) and the acetazolamide test. Neuropsychological evaluations including Hasegawa Dementia Scale-Revised, Mini-Mental State and Wechsler Adult Intelligence Scale-Revised (WAIS-R), and PET study were completed one month after the last ischemic event and 3-6 months after the operation. A significant negative correlation was observed between OEF and neuropsychological functions. Postoperative neuropsychological functions showed significant improvement. Significant correlations were observed for ΔWAIS-R (preoperative WAIS-R postoperative WAIS-R) versus preoperative CMRO 2 (r=0.52), for ΔWAIS-R versus preoperative OEF (r=0.47). In view of these findings, the author concludes that elevation of OEF impairs neuropsychological functions and bypass surgery improves neuropsychological functions in patients with normal CMRO 2 and elevated OEF. (author)
Physical exercise at the workplace prevents deterioration of work ability among healthcare workers
DEFF Research Database (Denmark)
Jakobsen, Markus D; Sundstrup, Emil; Brandt, Mikkel
2015-01-01
BACKGROUND: Imbalance between individual resources and work demands can lead to musculoskeletal disorders and reduced work ability. The purpose of this study was to investigate the effect of workplace- versus home-based physical exercise on work ability among healthcare workers. METHODS: Two...... hundred female healthcare workers (Age: 42.0, BMI: 24.1, work ability index [WAI]: 43.1) from 18 departments at three Danish hospitals participated (Copenhagen, Denmark, Aug 2013-Jan 2014). Participants were randomly allocated at the cluster level to 10 weeks of: 1) workplace physical exercise (WORK...... of lifting aides. The main outcome measure was the change from baseline to 10-week follow-up in WAI. RESULTS: Significant group by time interaction was observed for WAI (p effect size (Cohens'd = 0...
2013-05-22
Center EAC Emergency Action Committee (DoS) FAH Foreign Affairs Handbook FAM Foreign Affairs Manual FARC Fuerzas Armadas Revolucionarias de...in accordance with JP 5-0 and ADP 5-0, the author limited the tools and detail normally used in war-gaming. However, the author will invite numerous...exceeded the combat search and rescue capabilities of that component and requires the efforts of two or more components of the joint force. Normally
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
Occupational stress perception and its potential impact on work ability.
Yong, Mei; Nasterlack, Michael; Pluto, Rolf-Peter; Lang, Stefan; Oberlinner, Christoph
2013-01-01
To examine perceived stress across employees with different occupational status, to investigate the impact of stress on work ability and to derive conclusions regarding health promotion activities. A comprehensive survey combining questionnaire and medical examination was offered in one division in BASF Ludwigshafen. Among 867 voluntary participants, 653 returned complete questionnaires. The questions were directed at perception of safety at the workplace, self-rated health status, frequency of stress symptoms, unrealistic job demands, time pressure and maladjustment of work life balance. The outcome of interest was self-estimated health measured by the Work Ability Index (WAI). Occupational stressors were perceived differently across occupational status groups. Frontline operators had more health concerns due to workplace conditions, while professional and managerial staff reported higher frequencies of perceived tension, time pressure, and maladjustment of work life balance. After adjustment for occupational status, demographic and lifestyle factors, perceived stress was associated with a modest to strong decline in WAI scores. While perceived occupational stress had an apparent impact on WAI, and WAI has been demonstrated to be predictive of early retirement, more intensive and employee group-specific stress management interventions are being implemented beyond traditional strategies of routine occupational medical surveillance.
Whole abdomen irradiation in epithelial ovarian cancer - state of the art
International Nuclear Information System (INIS)
Gocheva, L.
2009-01-01
Epithelial ovarian cancer (OC) as a malignancy which poses multiple challenges has led to growing attention and concern during recent years. The not very noteworthy treatment results achieved during the last three decades with contemporary chemotherapeutic schemes have led to the need for research and development of new therapeutic approaches, as well as to a resurgence of interest in radiotherapy (RT) as part of a combined modality approach and as salvage therapy for patients with small volume persistent disease after primary cytoreductive surgery and chemotherapy. This article reviews the state of the art of whole abdomen irradiation (WAI) (excluding the moving strip field technique) as part of the complex treatment of epithelial OC. The prognostic factors and risk groups of epithelial OC are discussed as indicators for WAI, giving in detail the applied treatment modalities, fractionation and total doses. Toxicity and second primary malignancies following WAI are analyzed. The clinical experience accumulated during the last decades, as adjuvant, consolidative, salvage and palliative WAI in combined treatment of epithelial OC, is presented. Current issues in the radiotherapeutic management are discussed along with ideas for future clinical research directions. (author)
Sundstrup, Emil; Jakobsen, Markus D; Brandt, Mikkel; Jay, Kenneth; Persson, Roger; Aagaard, Per; Andersen, Lars L
2014-05-01
Imbalance between work demands and individual resources can lead to musculoskeletal disorders and reduced work ability. The aim of this study was to evaluate the effect of two contrasting interventions on work ability among slaughterhouse workers with chronic pain and work disability. Sixty-six slaughterhouse workers with upper-limb chronic pain and work disability were randomly allocated to 10 weeks of either strength training for the shoulder, arm, and hand muscles (3 times per week, 10 minutes per session) or ergonomic training (usual care control group) from September to December 2012. The outcome measure was the change from baseline to 10-week follow-up in the work ability index (WAI). A priori hypothesis testing showed a group×time interaction for WAI (Ptraining group, WAI increased 2.3 [95% confidence interval (95% CI) 0.9-3.7] in the strength training group corresponding to a moderate effect size (Cohen's d 0.52). Within-group changes indicated that between-group differences were mainly caused by a reduction in WAI in the ergonomic group. Of the 7 items of WAI, item 2 (work ability in relation to the demands of the job) and item 7 (mental resources) increased following strength training compared with ergonomic training (Ptraining at the workplace prevents deterioration of work ability among manual workers with chronic pain and disability exposed to forceful and repetitive job tasks. Thus, strength training performed at the workplace may in fact be regarded as a complex biopsychosocial intervention modality that reaches further than the specific physiological benefits of training per se.
Energy Technology Data Exchange (ETDEWEB)
Sasoh, Masayuki [Iwate Medical Univ., Morioka (Japan). School of Medicine
1999-08-01
In order to evaluate the relation between neuropsychological functions and hemodynamic cerebral ischemia, the author analyzed neuropsychological examination and the cerebral blood flow and metabolism of patients before and after bypass surgery. Twenty-five patients were defined by clinical and laboratory criteria as suffering from hemodynamic cerebral ischemia. All patients had one or more episodes of focal cerebral ischemia due to unilateral internal carotid or middle cerebral artery occlusion. Computerized tomography scans either were normal or showed evidence of watershed infarction. Based on these criteria, superficial temporal artery-proximal middle cerebral artery anastomosis was performed. The baseline cerebral blood flow (CBF), oxygen extraction fraction (OEF), cerebral metabolic rate of oxygen (CMRO{sub 2}) and cerebrovascular reserve capacity (CVRC) were studied using positron emission computerized tomography (PET) and the acetazolamide test. Neuropsychological evaluations including Hasegawa Dementia Scale-Revised, Mini-Mental State and Wechsler Adult Intelligence Scale-Revised (WAIS-R), and PET study were completed one month after the last ischemic event and 3-6 months after the operation. A significant negative correlation was observed between OEF and neuropsychological functions. Postoperative neuropsychological functions showed significant improvement. Significant correlations were observed for {delta}WAIS-R (preoperative WAIS-R postoperative WAIS-R) versus preoperative CMRO{sub 2} (r=0.52), for {delta}WAIS-R versus preoperative OEF (r=0.47). In view of these findings, the author concludes that elevation of OEF impairs neuropsychological functions and bypass surgery improves neuropsychological functions in patients with normal CMRO{sub 2} and elevated OEF. (author)
Jakobsen, Markus D; Sundstrup, Emil; Brandt, Mikkel; Jay, Kenneth; Aagaard, Per; Andersen, Lars L
2015-11-25
Imbalance between individual resources and work demands can lead to musculoskeletal disorders and reduced work ability. The purpose of this study was to investigate the effect of workplace- versus home-based physical exercise on work ability among healthcare workers. Two hundred female healthcare workers (Age: 42.0, BMI: 24.1, work ability index [WAI]: 43.1) from 18 departments at three Danish hospitals participated (Copenhagen, Denmark, Aug 2013-Jan 2014). Participants were randomly allocated at the cluster level to 10 weeks of: 1) workplace physical exercise (WORK) performed during working hours for 5x10 min per week and up to 5 group-based coaching sessions on motivation for regular physical exercise, or 2) home-based physical exercise (HOME) performed during leisure time for 5x10 min per week. Both groups received ergonomic counseling on patient handling and use of lifting aides. The main outcome measure was the change from baseline to 10-week follow-up in WAI. Significant group by time interaction was observed for WAI (p WORK compared with HOME corresponding to a small effect size (Cohens'd = 0.24). Within-group changes indicated that between-group differences were mainly caused by a reduction in WAI in HOME. Of the seven items of WAI, item 2 (work ability in relation to the demands of the job) and item 5 (sickness absence during the past year) were improved in WORK compared with HOME (P work ability among female healthcare workers. ClinicalTrials.gov NCT01921764 . Registered 10 August 2013.
Neuropsychological factors related to returning to work in patients with higher brain dysfunction.
Kai, Akiko; Hashimoto, Manabu; Okazaki, Tetsuya; Hachisuka, Kenji
2008-12-01
We conducted neuropsychological tests of patients with higher brain dysfunction to examine the characteristics of barriers to employment. We tested 92 patients with higher brain dysfunction (average age of 36.3 +/- 13.8 years old, ranging between 16 and 63 years old, with an average post-injury period of 35.6 +/- 67.8 months) who were hospitalized at the university hospital between February 2002 and June 2007 for further neuropsychological evaluation, conducting the Wechsler Adult Intelligence Scale-Revised (WAIS-R), Wechsler Memory Scale-Revised (WMS-R), the Rivermead Behavioral Memory Test (RBMT), Frontal Assessment Battery (FAB) and Behavioral Assessment of Dysexecutive Syndrome (BADS). The outcomes after discharge were classified between competitive employment, sheltered employment and non-employment, and the three groups were compared using one-way analysis of variance and the Scheffe test. The WAIS-R subtests were mutually compared based on the standard values of significant differences described in the WAIS-R manual. Verbal performance and full scale Intelligence Quotient (IQ) of WAIS-R were 87.7 +/- 15.6 (mean +/- standard deviation), 78.5 +/- 18.1 and 81.0 +/- 17.2, respectively, and verbal memory, visual memory, general memory, attention/concentration and delayed recall were 74.6 +/- 20.0, 76.6 +/- 21.4, 72.0 +/- 20.4, 89.0 +/- 16.5 and 65.2 +/- 20.8, respectively. The competitive employment group showed significantly higher scores in performance IQ and full IQ on the WAIS-R and verbal memory, visual memory, general memory and delayed recall on the WMS-R and RBMT than the non-employment group. The sheltered employment group showed a significantly higher score in delayed recall than the non-employment group. No difference was observed in the FAB or BADS between the three groups. In the subtests of the WAIS-R, the score for Digit Symbol-Coding was significantly lower than almost all the other subtests. For patients with higher brain dysfunction, IQ (full
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Smith, Billy L; McChristian, Chrystal L; Smith, Teresa D; Meaux, Julie
2009-08-01
The purpose of this study was to compare scores on the Reynolds Intellectual Assessment Scales (RIAS) with scores on the Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) in a group of college students diagnosed with a Learning Disability, Attention-Deficit Hyperactivity Disorder (ADHD), or a combination of the two. The RIAS Composite Index score was significantly higher than the WAIS-III Full Scale IQ, although scores on both tests were in the average range. Correlations between the two tests were significant on all measures. Male students were significantly higher than female students on both the RIAS Composite Index and on the WAIS-III Full Scale IQ. Although the ADHD group was higher on IQ than the Learning Disabled and combined disorder groups on all IQ measures, no significant differences were found.
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
2016-10-01
non -periodical, one-time publications. Nothing to Report Other publications, conference papers, and presentations. An overview of our Army work...alcoholic beverages/day and were less likely to be current smokers 1. In 2013, our study team competed the Army funded project “The Effectiveness of... never ) to 7 (always). The WAI has strong published support for reliability and validity. The WAI was administered to both subjects and clinicians
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
Behrendt, John C.
2013-01-01
The West Antarctic Ice Sheet (WAIS) flows through the volcanically active West Antarctic Rift System (WARS). The aeromagnetic method has been the most useful geophysical tool for identification of subglacial volcanic rocks, since 1959–64 surveys, particularly combined with 1978 radar ice-sounding. The unique 1991–97 Central West Antarctica (CWA) aerogeophysical survey covering 354,000 km2 over the WAIS, (5-km line-spaced, orthogonal lines of aeromagnetic, radar ice-sounding, and aerogravity measurements), still provides invaluable information on subglacial volcanic rocks, particularly combined with the older aeromagnetic profiles. These data indicate numerous 100–>1000 nT, 5–50-km width, shallow-source, magnetic anomalies over an area greater than 1.2 × 106 km2, mostly from subglacial volcanic sources. I interpreted the CWA anomalies as defining about 1000 “volcanic centers” requiring high remanent normal magnetizations in the present field direction. About 400 anomaly sources correlate with bed topography. At least 80% of these sources have less than 200 m relief at the WAIS bed. They appear modified by moving ice, requiring a younger age than the WAIS (about 25 Ma). Exposed volcanoes in the WARS are The present rapid changes resulting from global warming, could be accelerated by subglacial volcanism.
Tierney, Mary C; Moineddin, Rahim; Morra, Angela; Manson, Judith; Blake, Jennifer
2010-01-01
Long-term physical activity may affect risk of cognitive impairment but few studies have examined later life cognition in relation to intensity of life-long physical activity. We examined the associations between the intensity of long-term recreational physical activity and neuropsychological functioning in 90 healthy postmenopausal women on tests found to be useful in the early identification of dementia. Information was collected about their participation in strenuous and moderate activities between high school and menopause. Summary measures of long-term strenuous and moderate activity were constructed for each participant. All analyses were adjusted for relevant covariates. The six linear regression analyses showed significant positive associations between moderate activity and Wechsler Adult Intelligence Scale Revised (WAIS-R), Digit Span backward, WAIS-R Digit Symbol, and Trail Making Test Part B. Significant negative relationships were found between strenuous activity and Rey Auditory Verbal Learning Test delayed verbal recall, Complex Figure Test delayed visual memory, WAIS-R Digit Span backward, category fluency, and WAIS-R Digit Symbol. The associations found in the present study suggest that while moderate activity may be protective, long-term strenuous activity before menopause may lower cognitive performance later in life. These results support further investigation of the effects of life-long exercise intensity on cognition in later life.
Sumiyoshi, Chika; Uetsuki, Miki; Suga, Motomu; Kasai, Kiyoto; Sumiyoshi, Tomiki
2013-12-30
Short forms (SF) of the Wechsler Intelligence Scale have been developed to enhance its practicality. However, only a few studies have addressed the Wechsler Intelligence Scale Revised (WAIS-R) SFs based on data from patients with schizophrenia. The current study was conducted to develop the WAIS-R SFs for these patients based on the intelligence structure and predictability of the Full IQ (FIQ). Relations to demographic and clinical variables were also examined on selecting plausible subtests. The WAIS-R was administered to 90 Japanese patients with schizophrenia. Exploratory factor analysis (EFA) and multiple regression analysis were conducted to find potential subtests. EFA extracted two dominant factors corresponding to Verbal IQ and Performance IQ measures. Subtests with higher factor loadings on those factors were initially nominated. Regression analysis was carried out to reach the model containing all the nominated subtests. The optimality of the potential subtests included in that model was evaluated from the perspectives of the representativeness of intelligence structure, FIQ predictability, and the relation with demographic and clinical variables. Taken together, the dyad of Vocabulary and Block Design was considered to be the most optimal WAIS-R SF for patients with schizophrenia, reflecting both intelligence structure and FIQ predictability. © 2013 Elsevier Ireland Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Anderson, Nickolas A.; Tobimatsu, Yuki; Ciesielski, Peter N.; Ximenes, Eduardo; Ralph, John; Donohoe, Bryon S.; Ladisch, Michael; Chapple, Clint
2015-08-01
Modifying lignin composition and structure is a key strategy to increase plant cell wall digestibility for biofuel production. Disruption of the genes encoding both cinnamyl alcohol dehydrogenases (CADs), including CADC and CADD, in Arabidopsis thaliana results in the atypical incorporation of hydroxycinnamaldehydes into lignin. Another strategy to change lignin composition is downregulation or overexpression of ferulate 5-hydroxylase (F5H), which results in lignins enriched in guaiacyl or syringyl units, respectively. Here, we combined these approaches to generate plants enriched in coniferaldehyde-derived lignin units or lignins derived primarily from sinapaldehyde. The cadc cadd and ferulic acid hydroxylase1 (fah1) cadc cadd plants are similar in growth to wild-type plants even though their lignin compositions are drastically altered. In contrast, disruption of CAD in the F5H-overexpressing background results in dwarfism. The dwarfed phenotype observed in these plants does not appear to be related to collapsed xylem, a hallmark of many other lignin-deficient dwarf mutants. cadc cadd, fah1 cadc cadd, and cadd F5H-overexpressing plants have increased enzyme-catalyzed cell wall digestibility. Given that these CAD-deficient plants have similar total lignin contents and only differ in the amounts of hydroxycinnamaldehyde monomer incorporation, these results suggest that hydroxycinnamaldehyde content is a more important determinant of digestibility than lignin content.
Anderson, Nickolas A; Tobimatsu, Yuki; Ciesielski, Peter N; Ximenes, Eduardo; Ralph, John; Donohoe, Bryon S; Ladisch, Michael; Chapple, Clint
2015-08-01
Modifying lignin composition and structure is a key strategy to increase plant cell wall digestibility for biofuel production. Disruption of the genes encoding both cinnamyl alcohol dehydrogenases (CADs), including CADC and CADD, in Arabidopsis thaliana results in the atypical incorporation of hydroxycinnamaldehydes into lignin. Another strategy to change lignin composition is downregulation or overexpression of ferulate 5-hydroxylase (F5H), which results in lignins enriched in guaiacyl or syringyl units, respectively. Here, we combined these approaches to generate plants enriched in coniferaldehyde-derived lignin units or lignins derived primarily from sinapaldehyde. The cadc cadd and ferulic acid hydroxylase1 (fah1) cadc cadd plants are similar in growth to wild-type plants even though their lignin compositions are drastically altered. In contrast, disruption of CAD in the F5H-overexpressing background results in dwarfism. The dwarfed phenotype observed in these plants does not appear to be related to collapsed xylem, a hallmark of many other lignin-deficient dwarf mutants. cadc cadd, fah1 cadc cadd, and cadd F5H-overexpressing plants have increased enzyme-catalyzed cell wall digestibility. Given that these CAD-deficient plants have similar total lignin contents and only differ in the amounts of hydroxycinnamaldehyde monomer incorporation, these results suggest that hydroxycinnamaldehyde content is a more important determinant of digestibility than lignin content. © 2015 American Society of Plant Biologists. All rights reserved.
Learning Contracts in Undergraduate Courses: Impacts on Student Behaviors and Academic Performance
2013-04-01
they "felt bound and obligated by the mutual expectations," and the learning contract motivated them to complete readings on time ( Lemieux , 2001...1974; Huff and Johnson, 1998; Williams and Williams, 1999; Chan and Wai-tong, 2000; Lemieux , 2001; Chyung, 2007; Litchfield, et al., 2007; O’Halloran...were required to sign a contract (e.g. Barlow, 1974; Huff and Johnson, 1998; Williams and Williams, 1999; Chan and Wai-tong, 2000; Lemieux 2001
MacLean, Hannah Ng On-Nar
2011-01-01
Background: Support for the four factor construct validity of the third edition of the Wechsler Adult Intelligence Scale (WAIS-III) has been found in clinical and non clinical populations but some studies question whether more complex models consistent with the concepts of fluid and crystallised intelligence provide a better explanation of the data. The WAIS-III is frequently used in the diagnosis of learning disability, however, previous exploratory factor analysis of data from a population ...
DIAGNÓSTICO, CLÍNICA Y TRATAMIENTO DE LA FENILQUETONURIA (PKU)
Cornejo E., Verónica; Raimann B., Erna
2004-01-01
Las hiperfenilalaninemias (HFA) se producen por una deficiencia o ausencia de la enzima fenilalanina hidroxilasa (FAH) la que metaboliza la fenilalanina (FA) en tirosina (TIR), acumulándose la FA en la sangre y el cerebro, causando un daño progresivo en el sistema nervioso central, que posteriormente se traduce en un retardo mental profundo si la enfermedad no se diagnostica y trata oportunamente. Un diagnóstico tardío causa alteraciones conductuales, hipopigmentación de tegumentos, convulsio...
2015-09-30
Interaction of Surface Gravity Waves with Nonlinear Internal Gravity Waves Lian Shen St. Anthony Falls Laboratory and Department of Mechanical...on studying surface gravity wave evolution and spectrum in the presence of surface currents caused by strongly nonlinear internal solitary waves...interaction of surface and internal gravity waves in the South China Sea. We will seek answers to the following questions: 1) How does the wind-wave
African Journals Online (AJOL)
pc
2017-11-10
Nov 10, 2017 ... ts of alkyl chain length on particles morphology were primarily studied ..... [3] Li Z, Yu L, Zheng L, Li N, Han S, Li G. Characterization studies on the ionic ... [4] Chiang YD, Lian HY, Leo SY, Wang SG, Yamauchi Y, Wu KC. ... [20] Yu YJ, Xing JL, Pang JL, Jiang SH, Lam KF, Yang TQ, Xue QS, Zhang K, Wu P.
Potential of the solid-Earth response for limiting long-term West Antarctic Ice Sheet retreat
Konrad, Hannes; Sasgen, Ingo; Pollard, David; Klemann, Volker
2016-04-01
The West Antarctic Ice Sheet (WAIS) is assumed to be inherently unstable because it is grounded below sea level in a large part, where the bedrock deepens from today's grounding line towards the interior of the ice sheet. Idealized simulations have shown that bedrock uplift due to isostatic adjustment of the solid Earth and the associated sea-level fall may stop the retreat of such a marine-based ice sheet (Gomez et al., 2012). Here, we employ a coupled model for ice-sheet dynamics and solid-Earth dynamics, including a gravitationally consistent description of sea level, to investigate the influence of the viscoelastic Earth structure on the WAIS' future stability (Konrad et al. 2015). For this, we start from a steady-state condition for the Antarctic Ice Sheet close to present-day observations and apply atmospheric and oceanic forcing of different strength to initiate the retreat of the WAIS and investigate the effect of the viscoelastic deformation on the ice evolution for a range of solid-Earth rheologies. We find that the climate forcing is the primary control on the occurrence of the WAIS collapse. However, for moderate climate forcing and a weak solid-Earth rheology associated with the West Antarctic rift system (asthenosphere viscosities of 3x10^19 Pa s or less), we find that the combined effect of bedrock uplift and gravitational sea-level fall limits the retreat to the Amundsen Sea embayment on millennial time scales. In contrast, a stiffer Earth rheology yields a collapse under these conditions. Under a stronger climate forcing, weak Earth structures do not prevent the WAIS collapse; however, they produce a delay of up to 5000 years in comparison to a stiffer solid-Earth rheology. In an additional experiment, we test the impact of sea-level rise from an assumed fast deglaciation of the Greenland Ice Sheet. In cases when the climatic forcing is too weak to force WAIS collapse by itself, the additional rise in sea-level leads to disintegration of the WAIS
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
Donders, Jacobus; Strong, Carrie-Ann H
2015-02-01
The performance of 100 patients with traumatic brain injury (TBI) on the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) was compared with that of 100 demographically matched neurologically healthy controls. Processing Speed was the only WAIS-IV factor index that was able to discriminate between persons with moderate-severe TBI on the one hand and persons with either less severe TBI or neurologically healthy controls on the other hand. The Processing Speed index also had acceptable sensitivity and specificity when differentiating between patients with TBI who either did or did not have scores in the clinically significant range on the Trail Making Test. It is concluded that WAIS-IV Processing Speed has acceptable clinical utility in the evaluation of patients with moderate-severe TBI but that it should be supplemented with other measures to assure sufficient accuracy in the diagnostic process. © The Author(s) 2014.
Nelson, Jason M; Canivez, Gary L; Watkins, Marley W
2013-06-01
Structural and incremental validity of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV; Wechsler, 2008a) was examined with a sample of 300 individuals referred for evaluation at a university-based clinic. Confirmatory factor analysis indicated that the WAIS-IV structure was best represented by 4 first-order factors as well as a general intelligence factor in a direct hierarchical model. The general intelligence factor accounted for the most common and total variance among the subtests. Incremental validity analyses indicated that the Full Scale IQ (FSIQ) generally accounted for medium to large portions of academic achievement variance. For all measures of academic achievement, the first-order factors combined accounted for significant achievement variance beyond that accounted for by the FSIQ, but individual factor index scores contributed trivial amounts of achievement variance. Implications for interpreting WAIS-IV results are discussed. (PsycINFO Database Record (c) 2013 APA, all rights reserved).
DEFF Research Database (Denmark)
Garde, E; Mortensen, Erik Lykke; Krabbe, K
2000-01-01
, but no participant scored more than 75% of maximum for deep white-matter hyperintensities. Neither type was related to the WAIS IQs of the 80-year assessment, but both were significantly associated with decline in performance IQ from age 50 to age 80 years (bivariate correlation coefficients 0.32, p=0.0087, and 0......, and they agreed to further WAIS testing at age 80, and cerebral MRI at age 80-82 (mean age 82.3 years). We scored separately the numbers of periventricular and deep white-matter hyperintensities. FINDINGS: Scores for periventricular hyperintensities in this sample included all possible degrees of severity.......28, p=0.0227, respectively). An analysis based on two WAIS subtests showed that the association between white-matter hyperintensities and cognitive impairment was significant only for cognitive decline in the decade 70-80 years. INTERPRETATION: Both periventricular and deep white-matter hyperintensities...
Internet-based wide area measurement applications in deregulated power systems
Khatib, Abdel-Rahman Amin
Since the deregulation of power systems was started in 1989 in the UK, many countries have been motivated to undergo deregulation. The United State started deregulation in the energy sector in California back in 1996. Since that time many other states have also started the deregulation procedures in different utilities. Most of the deregulation market in the United States now is in the wholesale market area, however, the retail market is still undergoing changes. Deregulation has many impacts on power system network operation and control. The number of power transactions among the utilities has increased and many Independent Power Producers (IPPs) now have a rich market for competition especially in the green power market. The Federal Energy Regulatory Commission (FERC) called upon utilities to develop the Regional Transmission Organization (RTO). The RTO is a step toward the national transmission grid. RTO is an independent entity that will operate the transmission system in a large region. The main goal of forming RTOs is to increase the operation efficiency of the power network under the impact of the deregulated market. The objective of this work is to study Internet based Wide Area Information Sharing (WAIS) applications in the deregulated power system. The study is the first step toward building a national transmission grid picture using information sharing among utilities. Two main topics are covered as applications for the WAIS in the deregulated power system, state estimation and Total Transfer Capability (TTC) calculations. As a first step for building this national transmission grid picture, WAIS and the level of information sharing of the state estimation calculations have been discussed. WAIS impacts to the TTC calculations are also covered. A new technique to update the TTC using on line measurements based on WAIS created by sharing state estimation is presented.
International Nuclear Information System (INIS)
Rochet, Nathalie; Kahn, Rachel S; Niemierko, Andrzej; Delaney, Thomas F; Russell, Anthony H
2013-01-01
To evaluate feasibility and preliminary outcomes associated with sequential whole abdomen irradiation (WAI) as consolidative treatment following comprehensive surgery and systemic chemotherapy for advanced endometrial cancer. We conducted a retrospective analysis of patients treated at our institution from 2000 to 2011. Inclusion criteria were stage III-IV endometrial cancer patients with histological proof of one or more sites of extra-uterine abdomen-confined disease, treated with WAI as part of multimodal therapy. Endpoints were feasibility, acute toxicity, late effects, recurrence-free survival (RFS) and overall survival (OS). Twenty patients were identified. Chemotherapy consisted of 3 to 6 cycles of a platinum-paclitaxel regimen in 18 patients. WAI was delivered using conventional technique to a median total dose of 27.5 Gy. No grade 4 toxicities occurred during chemotherapy or radiotherapy. No radiation dose reduction was necessary. Three patients developed small bowel obstruction, all in the context of recurrent intraperitoneal disease. Kaplan-Meier estimates and 95% confidence intervals for RFS and OS at one year were 63% (38–80%) and 83% (56-94%) and at 3 years 57% (33-76%) and 62% (34-81%), respectively. On univariate Cox analysis, stage IVB and serous papillary (SP) histology were found to be statistically significantly (at the p = 0.05 level) associated with worse RFS and OS. The peritoneal cavity was the most frequent site of initial failure. Consolidative WAI following chemotherapy is feasible and can be performed without interruption with manageable acute and late toxicity. Patients with endometrioid adenocarcinoma, especially stage FIGO III, had favorable outcomes possibly meriting prospective evaluation of the addition of WAI following chemotherapy in selected patients. Patients with SP do poorly and do not routinely benefit from this approach
Zhang, Lei; Huang, Chunping; Lan, Yajia; Wang, Mianzhen
2015-12-01
To analyze the correlation between population characteristics and work ability of employees with a multilevel model, to investigate the important influencing factors for work ability, and to provide a basis for improvement in work ability. Work ability index (WAI)was applied to measure the work ability of 1686 subjects from different companies (n=6). MLwi N2.0 software was applied for two-level variance component model fitting. The WAI of employees showed differences between various companies (χ2=3.378 6, P=0.0660); working years was negatively correlated with WAI (χ2=38.229 2, P=0.0001), and the WAI of the employees with 20 or more working years was 1.63 lower than that of the employees with less than 20 working years; the work ability of manual workers was lower than that of mental-manual workers (χ2=8.2726, P=0.0040), and the work ability showed no significant difference between mental workers and mental-manual workers (χ2=2.086 0, P=0.148 7). From the perspective of probability, the multilevel model analysis reveals the differences in work ability of employees between different companies, and suggests that company, work type, and working years are the important influencing factors for work ability of employees. These factors should be improved and adjusted to protect or enhance the work ability of employees.
Measuring Work Ability with Its Antecedents: Evaluation of the Work Ability Survey.
Voltmer, Jan-Bennet; Deller, Jürgen
2017-07-24
Purpose The revised version of the Work Ability Survey (WAS-R) assesses work ability on several sub-scales at the intersection of personal and organizational capacity, thus adding to the measurement of work ability by integrating the holistic model. It, therefore, improves on two features of the current standard measurement tool of work ability, the Work Ability Index (WAI): (1) a ceiling effect and (2) limited detail due to a focus on physical health and personal capacity. Method In two samples (n 1 = 1093, n 2 = 359), psychometric properties and the structure of the WAS-R were analyzed. To evaluate construct validity, inter-correlations of the WAS-R and WAI, sickness absence, expected and desired retirement age, and post-retirement work intention were calculated. Results The WAS-R was found to be distributed closer to normality than the WAI. The structural analyses yielded acceptable results for the hypothesized model. The WAS-R was adequately correlated with the WAI, negatively with sickness absence, and positively with desired retirement age. Conclusions The WAS-R extends the measurement of work ability, reflecting organizations' work demands. Its broad sub-scales lead to high acceptance of the results within the participating companies. In particular, the organizational capacity scales can be used to guide interventions aiming at organizational characteristics to improve work ability.
[Job satisfaction and work ability index in nurses].
Viola, Fiorella; Larese Filon, Francesca
2015-01-22
Job satisfaction and work ability are important in the nursing profession to ensure good working conditions and to reduce work-related diseases and illness. Psychosocial factors such as social support and decision latitude (autonomy) could have a role in cardiovascular diseases, low back pain, injuries and sick leave. To evaluate work ability, job satisfaction, psychosocial factors and diseases in 10 departments of the Monfalcone Hospital. The Work Ability Index (WAI) questionnaire and Karasek Job Content Questionnaire with other questions related to working conditions and diseases were administered to 160 nurses working in 10 departments. The response rate was 90%. SPSS Statistic packaging was used for statistical analysis. The study population had a mean age of 41.1 ± 7 years and the majority were female (81.25%). WAI gave a rating of over 37 points (good and excellent) for 86.4%, with an average of 39.9 ± 5.9 in women and 40.6 ± 6.4 in men. The WAI differences between the departments were significant with Medicine and Surgery showing lower values (p=0.012). WAI was significantly lower in subjects with sick leave higher than 10 days per year (p=0.000) and in subjects with cardiovascular diseases (p=0.031). Our study showed very good working conditions for nurses. A follow-up of the analyzed population over time will add further information on this aspect.
The work ability index and functional capacity among older workers
Directory of Open Access Journals (Sweden)
Rosimeire S. Padula
2013-08-01
Full Text Available BACKGROUND: Decreases in functional ability due to aging can impair work capacity and productivity among older workers. OBJECTIVE: This study compares the sociodemographics, health conditions, and physical functioning abilities of young and old workers as well as correlates of physical functioning capacity with the work ability index (WAI. METHOD: This exploratory, cross-sectional study examined employees of a higher education institution (HEI and those of a metallurgical industry. Older workers (50 years old or above were matched for gender and occupation type with younger workers (less than 50 years old. The following evaluations were applied: the multidimensional assessment questionnaire (which included sociodemographic, clinical, health perception, and physical health indices, the WAI, and a battery of physical functional tests. RESULTS: Diseases and regularly used medications were more common among the group of aging workers. The WAI did not differ between groups (p=0.237. Both groups showed similar physical functional capacity performances with regard to walking speed, muscle strength, and lower limb physical functioning. Aging workers showed a poorer performance on a test of right-leg support (p=0.004. The WAI was moderately correlated with the sit-to-stand test among older female workers (r=0.573, p=0.051. CONCLUSIONS: Unfavorable general health conditions did not affect the assessment of work ability or most of the tests of physical functional capacity in the aging group.
Variability in Wechsler Adult Intelligence Scale-IV subtest performance across age.
Wisdom, Nick M; Mignogna, Joseph; Collins, Robert L
2012-06-01
Normal Wechsler Adult Intelligence Scale (WAIS)-IV performance relative to average normative scores alone can be an oversimplification as this fails to recognize disparate subtest heterogeneity that occurs with increasing age. The purpose of the present study is to characterize the patterns of raw score change and associated variability on WAIS-IV subtests across age groupings. Raw WAIS-IV subtest means and standard deviations for each age group were tabulated from the WAIS-IV normative manual along with the coefficient of variation (CV), a measure of score dispersion calculated by dividing the standard deviation by the mean and multiplying by 100. The CV further informs the magnitude of variability represented by each standard deviation. Raw mean scores predictably decreased across age groups. Increased variability was noted in Perceptual Reasoning and Processing Speed Index subtests, as Block Design, Matrix Reasoning, Picture Completion, Symbol Search, and Coding had CV percentage increases ranging from 56% to 98%. In contrast, Working Memory and Verbal Comprehension subtests were more homogeneous with Digit Span, Comprehension, Information, and Similarities percentage of the mean increases ranging from 32% to 43%. Little change in the CV was noted on Cancellation, Arithmetic, Letter/Number Sequencing, Figure Weights, Visual Puzzles, and Vocabulary subtests (test limitations as well as further our understanding of cognitive domains which remain relatively steady versus those which steadily decline.
Rapidly-administered short forms of the Wechsler Adult Intelligence Scale-3rd edition.
Donnell, Alison J; Pliskin, Neil; Holdnack, James; Axelrod, Bradley; Randolph, Christopher
2007-11-01
Although the Wechsler Full Scale IQ (FSIQ) is a common component of most neuropsychological evaluations, there are many clinical situations where the complete administration of this battery is precluded by various constraints, including limitations of time and patient compliance. These constraints are particularly true for dementia evaluations involving elderly patients. The present study reports data on two short forms particularly suited to dementia evaluations, each requiring less than 20min of administration time. One of the short forms was previously validated in dementia for the WAIS-R [Randolph, C., Mohr, E., & Chase, T. N. (1993). Assessment of intellectual function in dementing disorders: Validity of WAIS-R short forms for patients with Alzheimer's, Huntington's, and Parkinson's disease. Journal of Clinical and Experimental Neuropsychology, 15, 743-753]; the second was developed specifically for patients with motor disabilities. These short forms were validated using the WAIS-III normative standardization sample (N=2450), neurologic sample (N=63), and matched controls (N=49), and a separate mixed clinical sample (N=70). The results suggest that each short form provides an accurate and reliable estimate of WAIS-III FSIQ, validating their use in appropriate clinical contexts. The present data support the use of these short forms for dementia evaluations, and suggests that they may be applicable for the evaluation of other neurological and neuropsychiatric disorders that involve acquired neurocognitive impairment.
Hill, B D; Elliott, Emily M; Shelton, Jill T; Pella, Russell D; O'Jile, Judith R; Gouvier, W Drew
2010-03-01
Working memory is the cognitive ability to hold a discrete amount of information in mind in an accessible state for utilization in mental tasks. This cognitive ability is impaired in many clinical populations typically assessed by clinical neuropsychologists. Recently, there have been a number of theoretical shifts in the way that working memory is conceptualized and assessed in the experimental literature. This study sought to determine to what extent the Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) Working Memory Index (WMI) measures the construct studied in the cognitive working memory literature, whether an improved WMI could be derived from the subtests that comprise the WAIS-III, and what percentage of variance in individual WAIS-III subtests is explained by working memory. It was hypothesized that subtests beyond those currently used to form the WAIS-III WMI would be able to account for a greater percentage of variance in a working memory criterion construct than the current WMI. Multiple regression analyses (n = 180) revealed that the best predictor model of subtests for assessing working memory was composed of the Digit Span, Letter-Number Sequencing, Matrix Reasoning, and Vocabulary. The Arithmetic subtest was not a significant contributor to the model. These results are discussed in the context of how they relate to Unsworth and Engle's (2006, 2007) new conceptualization of working memory mechanisms.
Performance on the Wechsler Adult Intelligence Scale-III in Japanese patients with schizophrenia.
Fujino, Haruo; Sumiyoshi, Chika; Sumiyoshi, Tomiki; Yasuda, Yuka; Yamamori, Hidenaga; Ohi, Kazutaka; Fujimoto, Michiko; Umeda-Yano, Satomi; Higuchi, Arisa; Hibi, Yumiko; Matsuura, Yukako; Hashimoto, Ryota; Takeda, Masatoshi; Imura, Osamu
2014-07-01
Patients with schizophrenia have been reported to perform worse than non-schizophrenic populations on neuropsychological tests, which may be affected by cultural factors. The aim of this study was to examine the performance of a sizable number of patients with schizophrenia on the Japanese version of the Wechsler Adult Intelligence Scale-III (WAIS-III) compared with healthy controls. Performance on the WAIS-III was evaluated in 157 Japanese patients with schizophrenia and in 264 healthy control subjects. All IQ scores and four indices from the WAIS-III were impaired for patients with schizophrenia compared with healthy controls. Processing Speed was markedly disturbed, approximately 2 SD below that of the healthy control group. Among the 13 subtests, Comprehension (z = -1.70, d = 1.55), Digit Symbol Coding (z = -1.84, d = 1.88), and Symbol Search (z = -1.85, d = 1.77) were profoundly impaired relative to the healthy controls. These results indicate that the pattern and degree of impairment, as evaluated by the WAIS-III, in Japanese patients are similar to those previously reported in English-speaking patients and that the deficits of some neuropsychological domains relevant to functional outcomes are universally characteristic of schizophrenia. © 2014 The Authors. Psychiatry and Clinical Neurosciences © 2014 Japanese Society of Psychiatry and Neurology.
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
A Multidisciplinary Study of Ciguatoxin and Related Low Molecular Weight Toxins from Marine Source
1986-08-01
iully Treatmet of the tissues with attract~s from tilapiao, kale ,. guines, pig viscera and avocado produced respnes slimilar to those ctain’ved with...authentic kale extract. Pretreatment with authenitic kale crude extract caused Seusitimticn of the tissues to aglxists such as ca Icto (Figure 4...either extracted or, less likely, synthesized a highly toxic lipophilic substance from fish, umnLian and vegetable tissues. 3) Further investigation of the
2016-03-01
processing. Calcium hydroxide (CaOH) is a common emitter seen in propellant and explosive spectra with bands in the green and red. In addition...temperature sensing by the group led by Dr. Jie Lian (Rensselaer Polytechnic Institute). The approach consists in using ultrathin gold island films (~1...measurements using commercial equipment (e.g., Cary UV/vis/NIR spectrophotometer). Initial results on gold films on quartz substrate required temperature
International Conference on Martensitic Transformations (ICOMAT 92)
1993-03-05
shape memory alloys are considered to be useful materials for fission and fusion reactor devices that may utilize shape memory capabilities or...restoration. Ti-Ni specimens were neutron irradiated in the Japan Materials Testing Reactors (JMTR). The irradiation conditions employed were... Triphase Steel Shen Lian and Li Hua A low carbon-low alloy triphase (F-M-A) steel containing 7- 16% retained austenite is ob- tained by composition design
Physical and functional characteristics of extrudates prepared from fenugreek and oats
Directory of Open Access Journals (Sweden)
Sajad Ahmad Wani
2016-12-01
Full Text Available This study was conducted to investigate the effect of fenugreek seed powder (FSP and oat flour (OF on the physical and functional properties of extruded snack product such as bulk density (BD, hardness (HD, lateral expansion (LE, water absorption index (WAI and water solubility index (WSI using response surface methodology. All the properties were found to be significantly (p < 0.05 affected by proportion of FSP and OF. Results indicated that with the increase in the FSP content, an increase in the values of BD, HD, WAI and WSI was noticed, whereas negative effect of FSP on LE was observed. Results showed negative effect of OF on HD and WSI and an increased effect on BD, LE and WAI of the extruded product. Numerical optimization results showed that a mixture of 2% FSP and 6% OF had higher preference levels for parameters of physical and functional characteristics and could be extruded to produce acceptable quality extrudates.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
Directory of Open Access Journals (Sweden)
JÚLIO CÉSAR FEITOSA FERNANDES
2017-01-01
Full Text Available Aggregate formation and stability are related to soil quality, contributing significantly to the carbon storage and nutrient maintenance capacities of the soil. Soil aggregates are formed by two different process: physicogenic, related to moistening and drying cycles and input of organic matter; and biogenic, related to the action of macrofauna organisms and roots. The objective this work was to classify aggregates according to their formation process, quantify and compare organic carbon contents in humic substances and assess the stability of aggregates formed by different processes, in areas with different coverage in the Mid Paraiba Valley, Pinheiral, State of Rio de Janeiro, Brazil. Aggregated soil samples were collected at a depth of 0-10 cm, in a Cambisol (Cambissolo Háplico Tb Distrófico under four plant covers: secondary forest in advanced (SFAS, medium (SFMS and initial (SFIS successional stages and managed mixed pasture (MMP. Aggregates were classified and identified into three morphological classes (physicogenic, biogenic and intermediate. The variables evaluated were mean weight diameter (MWD and geometric mean diameter (GMD of aggregates, chemical fractions of organic matter, total organic carbon (TOC and humic substances: humin (C-HUM humic acid (C-FAH and fulvic acid (C-FAF. Biogenic aggregates were found in smaller quantities and showed higher TOC, C-HUM and C-FAH, compared to intermediate and physicogenic aggregates. Thus, biogenic aggregates have potential to be used as soil quality indicators for structured environments, which are able to maintain its intrinsic formation processes.
Myers, Joshua; Kei, Joseph; Aithal, Sreedevi; Aithal, Venkatesh; Driscoll, Carlie; Khan, Asaduzzaman; Manuel, Alehandrea; Joseph, Anjali; Malicka, Alicja N
2018-03-03
Wideband acoustic immittance (WAI) is an emerging test of middle-ear function with potential applications for neonates in screening and diagnostic settings. Previous large-scale diagnostic accuracy studies have assessed the performance of WAI against evoked otoacoustic emissions, but further research is needed using a more stringent reference standard. Research into suitable quantitative techniques to analyze the large volume of data produced by WAI is still in its infancy. Prediction models are an attractive method for analysis of multivariate data because they provide individualized probabilities that a subject has the condition. A clinically useful prediction model must accurately discriminate between normal and abnormal cases and be well calibrated (i.e., give accurate predictions). The present study aimed to develop a diagnostic prediction model for detecting conductive conditions in neonates using WAI. A stringent reference standard was created by combining results of high-frequency tympanometry and distortion product otoacoustic emissions. High-frequency tympanometry and distortion product otoacoustic emissions were performed on both ears of 629 healthy neonates to assess outer- and middle-ear function. Wideband absorbance and complex admittance (magnitude and phase) were measured at frequencies ranging from 226 to 8000 Hz in each neonate at ambient pressure using a click stimulus. Results from one ear of each neonate were used to develop the prediction model. WAI results were used as logistic regression predictors to model the probability that an ear had outer/middle-ear dysfunction. WAI variables were modeled both linearly and nonlinearly, to test whether allowing nonlinearity improved model fit and thus calibration. The best-fitting model was validated using the opposite ears and with bootstrap resampling. The best-fitting model used absorbance at 1000 and 2000 Hz, admittance magnitude at 1000 and 2000 Hz, and admittance phase at 1000 and 4000 Hz modeled
A sacred dance transmitted in the ritual for paying homage to one's teacher in Thailand
岩澤, 孝子
2001-01-01
This article attemps to describe a dance which is considered as a sacred knowledge among classical dancers in Thailand. This is the reflection of their unique idea, wai khru, which means showing respect to the teacher and the ritual based on this idea. In Thailand wai khru is generally practised wherever they have a person to be recognized as a teacher in their own comunities. In these days, however, under the influence of the modernization, the idea that the teacher has a special power and k...
International Nuclear Information System (INIS)
Qi Falian; Xu Jun; Wang Bin; Chen Yingjian; Yin Qiuxia; Ke Bingshen
2007-01-01
Objective: To study the effects of Huang Qi and Huang Lian on serum P-selectin, tumor necrosis factor-α (TNF-α), glucose and glycosylated hemoglobin (HbAlc) levels in patients with type two diabetes mellitus (DM). Methods: Sixty DM2 patients were divided randomly into 2 equal numbered groups: one group were treated with routine hypoglycemic medicine, in other group, Jinqi hypoglycemic tablets were added besides western medicine. Fasting blood glucose, two hour postprandial glucose, HbAlc, P-SLT and TNF-α levels were measured detected before and after three months' treatment. Results: There were no significant differences between the plasma glucose, HbAlc, P-SLT and TNF-α levels (P>0.05) in the JinQi group and western medicine group before treatment. Fasting plasma glucose and postprandial glucose were decreased after treatment in both groups. HbAlc, P-SLT and TNF-α levels were significantly decreased after treatment (P<0.05, P<0.01, P<0.01) in JinQi group. Conclusion: On the basis of treatment with western medicine, additional Huang Lian and Huang Qi could further decrease HbAlc, P-SLT and TNF-α levels, stabilize blood glucose and provide better therapeutic results in patients with type 2 diabetes mellitus. (authors)
Conway, Paul Maurice; Campanini, Paolo; Punzi, Silvia; Fichera, Giuseppe Paolo; Camerino, Donatella; Francioli, Laura; Neri, Luca; Costa, Giovanni
2013-01-01
To test three hypotheses in an Italian sample of call center workers: higher levels of perceived work stress are associated with more frequent common mental disorders (GHQ-12) and a lower Work Ability Index; combining the Job Strain (JS) and Effort/Reward Imbalance (ERI) models increases explained variance in health over and above either model when applied separately; compared with outbound operators, inbound call handlers are expected to report a lower health status,which is due to a more intense exposure to task-related work stress factors in the latter. A multi-center cross-sectional study, conducted by means of interviews and self-administered questionnaires. Call handlers working in the Italian branch of a telecommunication multinational company. In all, 1,106 permanent workers were examined (35.9%of the total target population, 98.9% response rate). The majority were women (76.5%);mean age was 33.3 (SD: 3.9) and company seniority 8.0 (SD: 2.1). Nearly 60% worked as inbound call handlers, about one third as outbound operators. Work stress was measured with the well-known JS and ERI models. Three exposure levels (based on tertiles) were identified for each scale. Common mental disorders were measured with the GHQ-12 questionnaire. Subjects with a GHQ-12 score 4 were classified as "cases". The Work Ability Index (WAI) was used to evaluate work ability. Being in the "poor" or "moderate" categories of the WAI indicated a low work ability status. Cronbach's alphas were 0.70 for all scales. Multivariate Poisson regressions showed that both models were linked to more frequent common mental disorders and a lower WAI. Moreover, combined models demonstrated an advantage in terms of explained variance in health. Finally, performing inbound call handling was associated with a lower WAI in comparison with engaging in outbound activities. Mediation analyses showed that such association is explained by the higher levels of psychological job demands and Job Strain experienced
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
ARM West Antarctic Radiation Experiment (AWARE) Field Campaign Report
Energy Technology Data Exchange (ETDEWEB)
Lubin, Daniel [Univ. of California, San Diego, CA (United States). Scripps Inst. of Oceanography; Bromwich, David H [Ohio State University; Vogelmann, Andrew M [Brookhaven National Lab. (BNL), Upton, NY (United States); Verlinde, Johannes [Pennsylvania State Univ., University Park, PA (United States); Russell, Lynn M [Univ. of California, San Diego, CA (United States). Scripps Inst. of Oceanography
2017-09-15
The U.S. Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) West Antarctic Radiation Experiment (AWARE) is the most technologically advanced atmospheric and climate science campaign yet fielded in Antarctica. AWARE was motivated be recent concern about the impact of cryospheric mass loss on global sea level rise. Specifically, the West Antarctic Ice Sheet (WAIS) is now the second largest contributor to rising sea level, after the Greenland Ice Sheet. As steadily warming ocean water erodes the grounding lines of WAIS components where they meet the Amundsen and Bellingshausen Seas, the retreating grounding lines moving inland and downslope on the underlying terrain imply mechanical instability of the entire WAIS. There is evidence that this point of instability may have already been reached, perhaps signifying more rapid loss of WAIS ice mass. At the same time, the mechanical support provided by adjacent ice shelves, and also the fundamental stability of exposed ice cliffs at the ice sheet grounding lines, will be adversely impacted by a warming atmosphere that causes more frequent episodes of surface melting. The surface meltwater damages the ice shelves and ice cliffs through hydrofracturing. With the increasing concern regarding these rapid cryospheric changes, AWARE was motivated by the need to (a) diagnose the surface energy balance in West Antarctica as related to both summer season climatology and potential surface melting, and (b) improve global climate model (GCM) performance over Antarctica, such that future cryospheric projections can be more reliable.
Privacy protection for patients with substance use problems
Hu, Lianne Lian; Sparenborg, Steven; Tai, Betty
2011-01-01
Lianne Lian Hu1, Steven Sparenborg2, Betty Tai21Department of Preventive Medicine and Biometrics, Uniformed Services University of the Health Sciences, 2Center for the Clinical Trials Network, National Institute on Drug Abuse, National Institutes of Health, Bethesda, MDAbstract: Many Americans with substance use problems will have opportunities to receive coordinated health care through the integration of primary care and specialty care for substance use disorders under the Patient Protection...
Bethge, Matthias; Spanier, Katja; Neugebauer, Tjark; Mohnberg, Inka; Radoschewski, Friedrich Michael
2015-11-01
The purpose of this study was to assess associations of self-reported work ability as measured by the Work Ability Index (WAI) with modifiable behavioral and occupational health risks, health service utilization, and intended rehabilitation and pension requests. This is a cross-sectional study of a random sample of German employees aged 40-54 yrs on sickness benefits in 2012 (trial registration: DRKS00004824). In total, 1312 male and 1502 female employees were included in the analyses. Low WAI scores (i.e., work strategies, which include the opportunity to access multiprofessional rehabilitation.
Directory of Open Access Journals (Sweden)
Liu X
2012-10-01
Full Text Available Xun Liu,1,2,* Mu-hua Cheng,3,* Cheng-gang Shi,1 Cheng Wang,1 Cai-lian Cheng,1 Jin-xia Chen,1 Hua Tang,1 Zhu-jiang Chen,1 Zeng-chun Ye,1 Tan-qi Lou11Division of Nephrology, Department of Internal Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China; 2College of Biology Engineering, South China University of Technology, Guangzhou, China; 3Department of Nuclear Medicine, The Third Affiliated Hospital of Sun Yet-sun University, Guangzhou, China *These authors contributed equally to this paperBackground: Chronic kidney disease (CKD is recognized worldwide as a public health problem, and its prevalence increases as the population ages. However, the applicability of formulas for estimating the glomerular filtration rate (GFR based on serum creatinine (SC levels in elderly Chinese patients with CKD is limited.Materials and methods: Based on values obtained with the technetium-99m diethylenetriaminepentaacetic acid (99mTc-DTPA renal dynamic imaging method, 319 elderly Chinese patients with CKD were enrolled in this study. Serum creatinine was determined by the enzymatic method. The GFR was estimated using the Cockroft–Gault (CG equation, the Modification of Diet in Renal Disease (MDRD equations, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI equation, the Jelliffe-1973 equation, and the Hull equation.Results: The median of difference ranged from −0.3–4.3 mL/min/1.73 m2. The interquartile range (IQR of differences ranged from 13.9–17.6 mL/min/1.73 m2. Accuracy with a deviation less than 15% ranged from 27.6%–32.9%. Accuracy with a deviation less than 30% ranged from 53.6%–57.7%. Accuracy with a deviation less than 50% ranged from 74.9%–81.5%. None of the equations had accuracy up to the 70% level with a deviation less than 30% from the standard glomerular filtration rate (sGFR. Bland–Altman analysis demonstrated that the mean difference ranged from −3.0–2.4 mL/min/1.73 m2. However, the
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
El Fassi, Mehdi; Bocquet, Valery; Majery, Nicole; Lair, Marie Lise; Couffignal, Sophie; Mairiaux, Philippe
2013-04-08
Public authorities in European countries are paying increasing attention to the promotion of work ability throughout working life and the best method to monitor work ability in populations of workers is becoming a significant question. The present study aims to compare the assessment of work ability based on the use of the Work Ability Index (WAI), a 7-item questionnaire, with another one based on the use of WAI's first item, which consists in the worker's self-assessment of his/her current work ability level as opposed to his/her lifetime best, this single question being termed "Work Ability score" (WAS). Using a database created by an occupational health service, the study intends to answer the following questions: could the assessment of work ability be based on a single-item measure and which are the variables significantly associated with self-reported work ability among those systematically recorded by the occupational physician during health examinations? A logistic regression model was used in order to estimate the probability of observing "poor" or "moderate" WAI levels depending on age, gender, body mass index, smoking status, position held, firm size and diseases reported by the worker in a population of workers aged 40 to 65 and examined between January 2006 and June 2010 (n=12389). The convergent validity between WAS and WAI was statistically significant (rs=0.63). In the multivariable model, age (pwork ability. A work position characterized by the predominance of mental activity (OR=0.71, 95%CI [0.61-0.84]) had a favourable impact on work ability. These relations were observed regardless of the work ability measurement tool used. The convergent validity and the similarity in results between WAI and WAS observed in a large population of employed workers should thus foster the use of WAS for systematic screening of work ability. Ageing, overweight, decline in health status, holding a mostly physical job and working in a large-sized firm increase the
Adjunct effect of music therapy on cognition in Alzheimer’s disease in Taiwan: a pilot study
Directory of Open Access Journals (Sweden)
Li CH
2015-02-01
Full Text Available Chien-Hsun Li,1–3 Ching-Kuan Liu,2,3 Yuan-Han Yang,2–4 Mei-Chuan Chou,2,4 Chun-Hung Chen,2 Chiou-Lian Lai2,3 1Department of Neurology, Kaohsiung Municipal Hsiao-Kang Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan; 2Department of Neurology, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan; 3Department of and Master’s Program in Neurology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; 4Department of Neurology, Kaohsiung Municipal Ta-Tung Hospital, Kaohsiung, Taiwan Purpose: Music therapy (MT reviews have found beneficial effects on behaviors and social interaction in Alzheimer’s disease (AD but inconsistent effects on cognition. The purpose of the study was to evaluate the adjunct effect of long-term and home-based MT in AD patients under pharmacological treatment. Patients and methods: Mild AD cases (clinical dementia rating =0.5~1 were consecutively recruited and voluntarily separated into an MT group or control group (CG for 6 months. Outcome assessments included Cognitive Abilities Screening Instrument (CASI, CASI-estimated mini-mental state examination, clinical dementia rating with sum of box scores, and neuropsychiatric inventory. The MT interventions were Mozart’s Sonata (KV 448 and Pachelbel’s Canon, listening with headphones for 30 minutes daily in the morning and before sleep, respectively. Results: Forty-one cases (MT versus CG number =20 versus 21 were analyzed. Adjusted differences of CASI-estimated mini-mental state examination and CASI after 6 months in the MT group were slightly less decreased than the CG without statistical significance. In further analysis of cognitive domains of CASI, the adjusted difference of abstraction domain in the MT group was significantly better than the CG. Conclusion: Although there were no apparent additional benefits of this MT on the global cognition and daily functioning in mild AD patients, it confirms the adjunct
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
The Alliance Negotiation Scale: A psychometric investigation.
Doran, Jennifer M; Safran, Jeremy D; Muran, J Christopher
2016-08-01
This study investigates the utility and psychometric properties of a new measure of psychotherapy process, the Alliance Negotiation Scale (ANS; Doran, Safran, Waizmann, Bolger, & Muran, 2012). The ANS was designed to operationalize the theoretical construct of negotiation (Safran & Muran, 2000), and to extend our current understanding of the working alliance concept (Bordin, 1979). The ANS was also intended to improve upon existing measures such as the Working Alliance Inventory (WAI; Horvath & Greenberg, 1986, 1989) and its short form (WAI-S; Tracey & Kokotovic, 1989) by expanding the emphasis on negative therapy process. The present study investigates the psychometric validity of the ANS test scores and interpretation-including confirming its original factor structure and evaluating its internal consistency and construct validity. Construct validity was examined through the ANS' convergence and divergence with several existing scales that measure theoretically related constructs. The results bolster and extend previous findings about the psychometric integrity of the ANS, and begin to illuminate the relationship between negotiation and other important variables in psychotherapy research. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Harrison, Allyson G; Armstrong, Irene T; Harrison, Laura E; Lange, Rael T; Iverson, Grant L
2014-12-01
Psychologists practicing in Canada must decide which set of normative data to use for the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). The purpose of this study was to compare the interpretive effects of applying American versus Canadian normative systems in a sample of 432 Canadian postsecondary-level students who were administered the WAIS-IV as part of an evaluation for a learning disability, attention-deficit hyperactivity disorder, or other mental health problems. Employing the Canadian normative system yielded IQ, Index, and subtest scores that were systematically lower than those obtained using the American norms. Furthermore, the percentage agreement in normative classifications, defined as American and Canadian index scores within five points or within the same classification range, was between 49% and 76%. Substantial differences are present between the American and Canadian WAIS-IV norms. Clinicians should consider carefully the implications regarding which normative system is most appropriate for specific types of evaluations. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Dyadic Short Forms of the Wechsler Adult Intelligence Scale-IV.
Denney, David A; Ringe, Wendy K; Lacritz, Laura H
2015-08-01
Full Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) administration can be time-consuming and may not be necessary when intelligence quotient estimates will suffice. Estimated Full Scale Intelligence Quotient (FSIQ) and General Ability Index (GAI) scores were derived from nine dyadic short forms using individual regression equations based on data from a clinical sample (n = 113) that was then cross validated in a separate clinical sample (n = 50). Derived scores accounted for 70%-83% of the variance in FSIQ and 77%-88% of the variance in GAI. Predicted FSIQs were strongly associated with actual FSIQ (rs = .73-.88), as were predicted and actual GAIs (rs = .80-.93). Each of the nine dyadic short forms of the WAIS-IV was a good predictor of FSIQ and GAI in the validation sample. These data support the validity of WAIS-IV short forms when time is limited or lengthier batteries cannot be tolerated by patients. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
BRST cohomology ring in 2D gravity coupled to minimal models
International Nuclear Information System (INIS)
Kanno, H.; Sarmadi, M.H.
1992-08-01
The ring structure of Lian-Zuckerman states for (q,p) minimal models coupled to gravity is shown to be R=R 0 xC[w,w -1 ] where R 0 is the ring of ghost number zero operators generated by two elements and w is an operator of ghost number -1. Some examples are discussed in detail. For these models the currents are also discussed and their algebra is shown to contain the Virasoro algebra. (author). 21 refs
Financial strategies for minimizing corporate income taxes under Brazil's new global tax system
Limberg, Stephen T.; Robison, John R.; Schadewald, Michael S.
1997-01-01
In 1996, Brazil adopted a worldwide income tax system for corporations. This system represents a fundamental change in how the Brazílian government treats multinational transactions and the tax minimizing strategies relevant to businesses. In this article, we describe the conceptual basis for worldwide tax systems and the problem of double taxation that they create. Responses to double taxation by both the governments and the priva te sector are considered. Namely, the imperfect mechanisms de...
Work ability of Chinese migrant workers: the influence of migration characteristics.
Han, Lu; Shi, Leiyu; Lu, Liming; Ling, Li
2014-04-13
Migrant workers have become a vital labor supply to China's economy. Their migration process and work conditions may influence their health and work ability. The work ability of migrant workers in China and the influence of the migration process on work ability have not been explored extensively in previous studies. The objective of this study is to evaluate the association of migration characteristics and work-related factors with work ability among migrant workers in the Pearl River Delta. In this cross-sectional survey, the study population consisted of 907 migrant workers from ten factories in the Pearl River Delta who were exposed to organic solvents during work. The primary dependent variable of the study was work ability, measured by the Work Ability Index (WAI). The independent variables were individual characteristics, migration characteristics, and work-related factors. Logistic regression models were used to determine the influence of different factors on work ability and three dimensions of WAI. The result shows that among migration characteristics, social support was significantly associated with all three dimensions of the work ability index. Permanent migration intention and longer length of migration were negatively associated with the mental resource dimension of WAI. WAI was also influenced by individual and work-related factors. The findings of this study suggest that expanding migrants' social networks and social support systems in their work place or living community, (i.e. expanding the functions of labor unions) would be an effective way to improve migrant workers' work ability. Improving of migrant workers' physical and psychosocial related work environments would also increase their work ability.
International Nuclear Information System (INIS)
Shimizu, Satoru
2008-01-01
The objective of this study was to clarify the utility of VSRAD (Voxel-based Specific Regional analysis system for Alzheimer's Disease) for the diagnosis of Alzheimer's Disease (AD) or AD-related studies, correlations between VSRAD-based parahippocampal atrophy and results of neuropsychological tests were investigated. Subjects comprised 18 and 12 patients with probable AD and those with mild cognitive impairment (MCI) due to a cerebral degeneration near AD, respectively. Neuropsychological tests consisted of Alzheimer's Disease Assessment Scale (ADAS)-J cog., Hasegawa Dementia Scale-Revised (HDS-R), Wechsler Adult Intelligent Scale-Revised or -IIIrd (WAIS-R/-III) and Wechsler Memory Scale-Revised (WMS-R). Subjects received these tests within one month before or after cranial MRI scans, and correlations between Z-scores of VSRAD reflecting the parahippocampal atrophy and results of these neuropsychological tests were statistically examined. The Z-scores had a significant positive correlation with scores of ADAS (p=.0129) and an inverse correlation with scores of ''Information'' as a subtest of WAIS-R/-III (p=.0294). Further, the Z-scores showed a tendency to weak, inverse correlations with the scores of HDS-R, ''Similarity'' as a subtest of WAIS-R/-III and ''Visual Reproduction II'' as a subtest of WMS-R (p=.0532, .0635, and .0609, respectively). Usefulness of VSRAD for the diagnosis of AD was indicated by the significant correlations hoted with ADAS and HDS-R, and it was further suggested that parahippocampal atrophy was related to semantic and visual memory impairments of AD, judging from the correlations with subtests of WAIS-R/-III and WMS-R. (author)
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
Energy Technology Data Exchange (ETDEWEB)
Tanguay, R.M.; St-Louis, M.; Gibson, K. [Universite Laval, Ste-Foy (Canada)] [and others
1994-09-01
Hereditary tyrosinemia type I (HT I; McKusick 276700) is a severe inborn error of tyrosine catabolism pathway caused by a deficiency of fumarylacetoacetate hydrolase (FAH). The highest frequency reported is the one in Saguenay-Lac St-Jean (Quebec, Canada) where 1:1,846 births are affected. The FAH gene has been cloned and several mutations have been described. Allele specific oligonucleotide (ASO) hybridization was used to examine the frequency of a splice (IVS12-5G{r_arrow}A) mutation recently reported and RFLP analysis was done to identify haplotypes related to HT I. The splice mutation was found on 45/50 alleles (90%) in patients from SLSJ and 12/66 (18%) alleles from patients world-wide. All 25 patients from the SLSJ region were positive with 20 being homozygous, indicating that this mutation is the major cause of HT I in French Canada. Of these 25 patients, 96% were positive for one haplotype called no 6 which is these 25 patients, 96% were positive for one haplotype called no 6 which is identified by TaqI, RsaI, BglII, MspI and KpnI digestions. These data show a really strong association between the mutation (IVS12+5G{r_arrow}A) and haplotype 6. Among our patients from around the world, {approximately}52% were positive for haplotype 6 indicating its strong relation with HT I. These results provide the rationale for DNA-based carrier testing for HT I in the F-C population at risk as well as in HT I patients in general.
Cultural model of self-stigma among Chinese with substance use problems.
Mak, Winnie W S; Ho, Connie Y Y; Wong, Venus U T; Law, Rita W; Chan, Randolph C H
2015-10-01
Substance use is regarded as one of the most stigmatizing conditions worldwide. To achieve recovery, individuals with substance use problems must learn to cope with stigma. Despite the potential importance of cultural factors in the internalization process of stigma, few studies have incorporated culturally salient factors in understanding self-stigma. We responded to this gap in the literature by investigating a mechanism of self-stigma that focused on a cultural value salient to the Chinese-face concern. Specifically, we hypothesized that two types of face concern (mianzi concern and lian concern) would affect self-stigma and mental health through self-conscious moral emotions and rumination. A total of 199 Hong Kong Chinese adults with substance use problems completed standardized questionnaires. Test of the proposed model using structural equation modeling showed excellent fit to the data. The findings support the role of face concern in affecting self-stigma and mental health among Chinese with substance use problems. In particular, the findings showed significant indirect effects of lian concern on rumination, self-stigma, and mental health via moral emotions. The present study provides preliminary empirical support for the importance of cultural factors in the internalization process of stigma and the maintenance of mental health among individuals with substance use problems. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
SISTEM EKONOMI ISLAM: SUATU PENDEKATAN FILSAFAT, NILAI-NILAI DASAR, DAN INSTRUMENTAL
Directory of Open Access Journals (Sweden)
Anwar Abbas
2016-02-01
Full Text Available Islamic economical system has its’ own system. It is not a combination between capitalism and sosialism. Islamic economicalsystem did not put human as a central (anthroposentrism but as a God servant (âbid that should serve and carry out the tasks entrusted to the servant (khalîfah. Therefore, the economic practice must uphold the values of ownership, the values of justice, freedom, balance, and in accordance with the fraternity and togetherness guided by religious teachings in order to create good personal living arrangements, social and nationalDOI: 10.15408/aiq.v4i1.2542
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
Work-related stress and work ability among Croatian university hospital midwives.
Knezevic, Bojana; Milosevic, Milan; Golubic, Rajna; Belosevic, Ljiljana; Russo, Andrea; Mustajbegovic, Jadranka
2011-04-01
to explore the sources and levels of stress at work and work ability among Croatian midwives. midwives are subjected to multiple stressors. Among health-care professionals, psychological distress for a prolonged period of time has negative effects on the worker's health, work ability and quality of patient care. 'Work ability' is a term describing a worker's resources related to physical, mental and social demands at work. As a measure of work ability in midwifery, the Work Ability Index (WAI) is considered to be a very predictive instrument; midwives with a poor WAI score usually leave their current job within five years. university hospitals in Zagreb, Croatia. cross-sectional design survey. 300 health-care workers (105 qualified midwives and 195 paediatric nurses) were invited to complete the questionnaire. The total response rate was 53% (158/300). The sample included 14.7% of all hospital-based midwives in Zagreb hospitals. the Occupational Stress Assessment Questionnaire (OSAQ) for health-care workers and the WAI questionnaire. over three-quarters of the midwives (46/60, 76.7%) believed that their job was stressful, and considered that insufficient work resources caused the most stress. More than half of the midwives associated an insufficient number of coworkers, unexpected situations, inadequate income, night work, incurable patients and poor organisation at work with a high level of stress. The perceived specific stressors differed between midwives and paediatric nurses in the same hospital. Insufficient work resources and poor organisation at work were more common stressors among midwives than paediatric nurses (pworkplace compared with paediatric nurses (pability. After adjusting for age, the difference in WAI score between the groups of workers was not significant. Croatian midwives experienced work-related stress due to: insufficient work resources, insufficient number of coworkers, poor organisation at work, communication with superiors and emotional
ARM West Antarctic Radiation Experiment (AWARE) Science Plan
Energy Technology Data Exchange (ETDEWEB)
Lubin, D [National Science Foundation; Bromwich, DH [Ohio State University; Russell, LM [Scripps Institution of Oceanography; Verlinde, J [The Pennsylvania State University; Vogelmann, AM [Brookhaven National Laboratory
2015-10-01
West Antarctica is one of the most rapidly warming regions on Earth, and this warming is closely connected with global sea level rise. The discovery of rapid climate change on the West Antarctic Ice Sheet (WAIS) has challenged previous explanations of Antarctic climate change that focused on strengthening of circumpolar westerlies in response to the positive polarity trend in the Southern Annular Mode. West Antarctic warming does not yet have a comprehensive explanation: dynamical mechanisms may vary from one season to the next, and these mechanisms very likely involve complex teleconnections with subtropical and tropical latitudes. The prime motivation for this proposal is that there has been no substantial atmospheric science or climatological field work on West Antarctica since the 1957 International Geophysical Year and that research continued for only a few years. Direct meteorological information on the WAIS has been limited to a few automatic weather stations for several decades, yet satellite imagery and meteorological reanalyses indicate that West Antarctica is highly susceptible to advection of warm and moist maritime air with related cloud cover, depending on the location and strength of low pressure cells in the Amundsen, Ross, and Bellingshausen Seas. There is a need to quantify the role of these changing air masses on the surface energy balance, including all surface energy components and cloud-radiative forcing. More generally, global climate model simulations are known to perform poorly over the Antarctic and Southern Oceans, and the marked scarcity of cloud information at southern high latitudes has so far inhibited significant progress. Fortunately, McMurdo Station, where the Atmospheric Radiation Measurement Facility’s (ARM’s) most advanced cloud and aerosol instrumentation is situated, has a meteorological relationship with the WAIS via circulation patterns in the Ross and Amundsen Seas. We can therefore gather sophisticated data with cloud
Positive Selection on Loci Associated with Drug and Alcohol Dependence.
Directory of Open Access Journals (Sweden)
Brooke Sadler
Full Text Available Much of the evolution of human behavior remains a mystery, including how certain disadvantageous behaviors are so prevalent. Nicotine addiction is one such phenotype. Several loci have been implicated in nicotine related phenotypes including the nicotinic receptor gene clusters (CHRNs on chromosomes 8 and 15. Here we use 1000 Genomes sequence data from 3 populations (Africans, Asians and Europeans to examine whether natural selection has occurred at these loci. We used Tajima's D and the integrated haplotype score (iHS to test for evidence of natural selection. Our results provide evidence for strong selection in the nicotinic receptor gene cluster on chromosome 8, previously found to be significantly associated with both nicotine and cocaine dependence, as well as evidence selection acting on the region containing the CHRNA5 nicotinic receptor gene on chromosome 15, that is genome wide significant for risk for nicotine dependence. To examine the possibility that this selection is related to memory and learning, we utilized genetic data from the Collaborative Studies on the Genetics of Alcoholism (COGA to test variants within these regions with three tests of memory and learning, the Wechsler Adult Intelligence Scale (WAIS Block Design, WAIS Digit Symbol and WAIS Information tests. Of the 17 SNPs genotyped in COGA in this region, we find one significantly associated with WAIS digit symbol test results. This test captures aspects of reaction time and memory, suggesting that a phenotype relating to memory and learning may have been the driving force behind selection at these loci. This study could begin to explain why these seemingly deleterious SNPs are present at their current frequencies.
Ohta, Masanori; Higuchi, Yoshiyuki; Kumashiro, Masaharu; Yamato, Hiroshi; Sugimura, Hisamichi
2017-11-01
Using a 2-year follow-up design, we examined whether changes in work ability during 1 year predicted sickness absence in the following year. Workers (N = 1408) from the Japanese information technology sector each completed the Work Ability Index (WAI), the Brief Job Stress Questionnaire (BJSQ), and the General Health Questionnaire (GHQ) in 2011 and 2012. Absence data during 2013 was obtained from employees' computerized attendance records. We used psychological distress as evaluated by the GHQ; job stress and job support calculated using the BJSQ; and job title, sex, and age as potential confounding variables. Thirty-five employees had at least one sickness absence lasting more than seven consecutive days in 2013. Forty-nine percent of sickness absences were due to mental illness, and the others were due to orthopedic disease (20%), cancer (9%), and other illnesses (23%). Decrease in WAI scores from 2011 to 2012 predicted sickness absence in 2013 (Odds ratio (OR) 1.19, 95% confidence interval (CI) 1.12-1.27). This association remained unaltered after adjusting for sex, age, job title, WAI score from the year before, job stress, job support, and GHQ score (OR 1.15, 95% CI 1.06-1.25). We analyzed this association separately by reason for absence: mental or other illness. WAI score decreases predicted sickness absence for both reasons (OR for mental illness 1.24, 95% CI 1.14-1.36; OR for other illnesses 1.14, 95% CI 1.04-1.24). Decrease in work ability during the year predicts sickness absence in the following year while predictive power was weak.
Sprague, Briana N; Hyun, Jinshil; Molenaar, Peter C M
2017-01-01
Invariance of intelligence across age is often assumed but infrequently explicitly tested. Horn and McArdle (1992) tested measurement invariance of intelligence, providing adequate model fit but might not consider all relevant aspects such as sub-test differences. The goal of the current paper is to explore age-related invariance of the WAIS-R using an alternative model that allows direct tests of age on WAIS-R subtests. Cross-sectional data on 940 participants aged 16-75 from the WAIS-R normative values were used. Subtests examined were information, comprehension, similarities, vocabulary, picture completion, block design, picture arrangement, and object assembly. The two intelligence factors considered were fluid and crystallized intelligence. Self-reported ages were divided into young (16-22, n = 300), adult (29-39, n = 275), middle (40-60, n = 205), and older (61-75, n = 160) adult groups. Results suggested partial metric invariance holds. Although most of the subtests reflected fluid and crystalized intelligence similarly across different ages, invariance did not hold for block design on fluid intelligence and picture arrangement on crystallized intelligence for older adults. Additionally, there was evidence of a correlated residual between information and vocabulary for the young adults only. This partial metric invariance model yielded acceptable model fit compared to previously-proposed invariance models of Horn and McArdle (1992). Almost complete metric invariance holds for a two-factor model of intelligence. Most of the subtests were invariant across age groups, suggesting little evidence for age-related bias in the WAIS-R. However, we did find unique relationships between two subtests and intelligence. Future studies should examine age-related differences in subtests when testing measurement invariance in intelligence.
Cognitive Profile of Intellectually Gifted Adults: Analyzing the Wechsler Adult Intelligence Scale.
Lang, Margherita; Matta, Michael; Parolin, Laura; Morrone, Cristina; Pezzuti, Lina
2017-09-01
The Wechsler Adult Intelligence Scale (WAIS) has been used extensively to study intellectual abilities of special groups. Here, we report the results of an intellectually gifted group on the WAIS-IV. Gifted individuals are people who obtained scores equal to or greater than 2 standard deviations above the mean on an intelligence test. Hence, the current study aims first, to examine mean group performance data of gifted individuals on the WAIS-IV; second, to revalidate the pattern of performance identified in this special group in previous studies (i.e., verbal skills higher than all other abilities); third, to compare scatter measures across intellectual domains with a matched comparison group. A total of 130 gifted individuals (79 males) were administered the full battery and their performance was compared with a matched comparison group. Analyses revealed that gifted group displayed higher scores in all intellectual domains. Contrary to expectations, they showed the highest scores in perceptual reasoning tasks. A multivariate approach revealed that this ability was statistically different from all other domains within the gifted group. Moreover, gifted individuals showed higher discrepancies across intellectual domains than average-intelligence people. Findings have important practical implications to detect intellectual giftedness in adulthood.
Bowden, Stephen C; Saklofske, Donald H; Weiss, Lawrence G
2011-06-01
Examination of measurement invariance provides a powerful method to evaluate the hypothesis that the same set of psychological constructs underlies a set of test scores in different populations. If measurement invariance is observed, then the same psychological meaning can be ascribed to scores in both populations. In this study, the measurement model including core and supplementary subtests of the Wechsler Adult Intelligence Scale-Fourth edition (WAIS-IV) were compared across the U.S. and Canadian standardization samples. Populations were compared on the 15 subtest version of the test in people aged 70 and younger and on the 12 subtest version in people aged 70 or older. Results indicated that a slightly modified version of the four-factor model reported in the WAIS-IV technical manual provided the best fit in both populations and in both age groups. The null hypothesis of measurement invariance across populations was not rejected, and the results provide direct evidence for the generalizability of convergent and discriminant validity studies with the WAIS-IV across populations. Small to medium differences in latent means favoring Canadians highlight the value of local norms.
Serova, Tatiana A; Tsyganova, Anna V; Tsyganov, Viktor E
2018-04-03
Plant symbiotic mutants are useful tool to uncover the molecular-genetic mechanisms of nodule senescence. The pea (Pisum sativum L.) mutants SGEFix - -1 (sym40), SGEFix - -3 (sym26), and SGEFix - -7 (sym27) display an early nodule senescence phenotype, whereas the mutant SGEFix - -2 (sym33) does not show premature degradation of symbiotic structures, but its nodules show an enhanced immune response. The nodules of these mutants were compared with each other and with those of the wild-type SGE line using seven marker genes that are known to be activated during nodule senescence. In wild-type SGE nodules, transcript levels of all of the senescence-associated genes were highest at 6 weeks after inoculation (WAI). The senescence-associated genes showed higher transcript abundance in mutant nodules than in wild-type nodules at 2 WAI and attained maximum levels in the mutant nodules at 4 WAI. Immunolocalization analyses showed that the ethylene precursor 1-aminocyclopropane-1-carboxylate accumulated earlier in the mutant nodules than in wild-type nodules. Together, these results showed that nodule senescence was activated in ineffective nodules blocked at different developmental stages in pea lines that harbor mutations in four symbiotic genes.
Multilinguismo em Bonfim/RR : o ensino de língua portuguesa no contexto da diversidade linguística
Santos, Alessandra de Souza
2013-01-01
Esta tese tem por objetivo analisar o ensino da Língua Portuguesa no contexto de multilinguismo. O lócus da pesquisa são as escolas urbanas da rede pública de ensino do município de Bonfim, situado na região leste do estado de Roraima, a 125 km da capital Boa Vista. A diversidade linguística e cultural são marcas facilmente perceptíveis a todos que chegam em Bonfim, lá encontram-se diferentes grupos indígenas (Macuxi, Ingarikó e Wai-wai línguas Karib e Wapichana língua Aruak), guianenses, ...
Christensen, Bruce K; Girard, Todd A; Bagby, R Michael
2007-06-01
An eight-subtest short form (SF8) of the Wechsler Adult Intelligence Scale, Third Edition (WAIS-III), maintaining equal representation of each index factor, was developed for use with psychiatric populations. Data were collected from a mixed inpatient/outpatient sample (99 men and 101 women) referred for neuropsychological assessment. Psychometric analyses revealed an optimal SF8 comprising Vocabulary, Similarities, Arithmetic, Digit Span, Picture Completion, Matrix Reasoning, Digit Symbol Coding, and Symbol Search, scored by linear scaling. Expanding on previous short forms, the current SF8 maximizes the breadth of information and reduces administration time while maintaining the original WAIS-III factor structure. (c) 2007 APA, all rights reserved
Jasinski, Lindsey J; Berry, David T R; Shandera, Anni L; Clark, Jessica A
2011-03-01
Twenty-four studies utilizing the Wechsler Adult Intelligence Scale (WAIS) Digit Span subtest--either the Reliable Digit Span (RDS) or Age-Corrected Scaled Score (DS-ACSS) variant--for malingering detection were meta-analytically reviewed to evaluate their effectiveness in detecting malingered neurocognitive dysfunction. RDS and DS-ACSS effectively discriminated between honest responders and dissimulators, with average weighted effect sizes of 1.34 and 1.08, respectively. No significant differences were found between RDS and DS-ACSS. Similarly, no differences were found between the Digit Span subtest from the WAIS or Wechsler Memory Scale (WMS). Strong specificity and moderate sensitivity were observed, and optimal cutting scores are recommended.
Hieracium sinoaestivum (Asteraceae, a new species from North China
Directory of Open Access Journals (Sweden)
Alexander Sennikov
2014-06-01
Full Text Available Hieracium sinoaestivum Sennikov sp. nov. is described as new to science and illustrated. This presumably apomictic species is solely known from two old collections made in a single locality in the Shanxi Province of China. It belongs to the hybridogenous group H. sect. Aestiva (H. sect. Prenanthoidea × H. sect. Umbellata and is most similar to H. veresczaginii from southern Siberia. The new species occurs at low altitudes in the forest belt of Lülian Mts. and belongs to taiga forest elements.
Regulation of TRAIL-Medicated Apoptosis in Prostate Cancer by Overexpression of XIAP
2005-01-01
to a composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. Mol Cell Biol 1996, 16:5933-5945 41. Guo J, Casolaro V, Seto E...Lian JB, Bushmeyer S, Seto E, Atchison ML, Penman S, van Wijnen AJ, Stein GS: Targeting of the YY1 transcription factor to the nucleolus and the...Multiple Cell Types and Tissues. The Journal of Biological Chemistry . 277: 9637-9640. 12. Lorch AS, Foust III R, Gow A, Arkoviz A, Salzman AL, Szabo
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
Directory of Open Access Journals (Sweden)
Marcia Cristina da Silva
2009-09-01
Full Text Available Rice flour was processed by extrusion cooking in the presence of variable contents of water and sucrose. The process was carried out in a twin-screw extruder under the conditions given by a centre rotational experimental design of second order. The effects of the independent variables, water content (27.9 to 42.1%, and sucrose content (0.1 to 19.9% on the physicochemical properties of the extrudates were investigated. The water absorption index (WAI, water solubility index (WSI, volumetric expansion index (VEI, and bulk density (BD were determined as dependent variables. BD was determined for samples before and after frying. An increase in water contents resulted in higher WAI and VEI, and lower WSI and BD for extrudates before and after frying. Higher sucrose levels led to increased values of WAI and VEI and to reduced values of WSI and BD. Both independent variables had significant influence on the physicochemical properties of rice flour extrudates. However, the sucrose content was the most significant. The interaction between these two independent variables and their quadratic effect were also important for the responses studied.A farinha de arroz foi extrusada em presença de diferentes teores de água e sacarose. O processamento foi realizado em extrusora dupla-rosca, sob condições fornecidas por um delineamento experimental rotacional de segunda ordem. Os efeitos das variáveis independentes, teor de água (27,9 a 42,1% e teor de sacarose (0,1 a 19,9%, sobre as propriedades físico-químicas dos extrusados, foram estudados. As variáveis dependentes avaliadas foram o índice de absorção de água (WAI, o índice de solubilidade em água (WSI, o índice de expansão volumétrica (VEI e a densidade aparente (BD. A densidade aparente (BD foi determinada para os extrusados antes e depois do processo de fritura. O aumento no teor de água resultou em maiores valores de WAI e VEI e menores valores de WSI e de BD (para as amostras fritas e n
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
Effects of work-related stress on work ability index among refinery workers.
Habibi, Ehsanollah; Dehghan, Habibollah; Safari, Shahram; Mahaki, Behzad; Hassanzadeh, Akbar
2014-01-01
Work-related stress is one of the basic problems in industrial also top 10 work-related health problems and it is increasingly implicated in the development a number of problems such as cardiovascular disease, musculoskeletal diseases, early retirement to employees. On the other hand, early retirement to employees from the workplace has increased on the problems of today's industries. Hereof, improving work ability is one of the most effective ways to enhance the ability and preventing disability and early retirement. The aim of This study is determine the relationship between job stress score and work ability index (WAI) at the refinery workers. This is a cross-sectional study in which 171 workers from a refinery in isfahan in 2012 who were working in different occupational groups participated. Based on appropriate assignment sampling, 33 office workers, 69 operational workers, and 69 maintenance workers, respectively, were invited to participate in this study. Two questionnaires including work related-stress and WAI were filled in. Finally, the information was analyzed using the SPSS-20 and statistic tests namely, analysis of covariance Kruskal-Wallis test. Pearson correlation coefficient, ANOVA and t-test. Data analysis revealed that 86% and 14% of participants had moderate and severe stress respectively. Average score of stress and standard deviation was 158.7 ± 17.3 that was in extreme stress range. Average score and standard deviation of WAI questionnaire were 37.18 and 3.86 respectively. That placed in a good range. Pearson correlation coefficient showed that WAI score had significant reversed relationship with a score of stress. According to the results, mean stress score among refinery worker was high and one fator that affect work abiity was high stress, hence training on communication skills and safe working environment in order to decreses stress, enhance the work ability of workers.
Quality of life, work ability and other important indicators of women’s occupational health
Directory of Open Access Journals (Sweden)
Negah Tavakoli-Fard
2016-02-01
Full Text Available Objectives: Work ability may be considered as an important aspect of well-being and health status. One of the most important factors in association with work ability is health-related quality of life (HRQoL. The aim of this study has been to determine the association between work ability, individual characteristics and HRQoL of female workers. Material and Methods: The design of this study has been cross-sectional. The work ability index (WAI and Short-Form General Health Survey (SF-12 questionnaires were used to collect data. Three hundred and twenty female workers were selected from food supplier factories in Karaj. One-way analysis of variance, Pearson’s correlation analysis, independent sample t-test and multiple linear regression methods were used to analyze data. Results: Mean (M and standard deviation (SD of the WAI stood at 35.02 and 5.57, respectively. The categories of the WAI for women being as follows: 8.8% poor, 62% moderate, 25.4% good and 3.7% excellent. Mean±SD for the physical component summary (PCS and mental component summary (MCS of quality of life was 58.84±11.12 and 57.45±9.94, respectively. There was a positive significant association between the PCS and MCS with the WAI (p = 0.0001. Workers with higher education had a better work ability (p = 0.002 and shift-work workers had a worse work ability (p = 0.03. Conclusions: Work ability of majority of women was moderate. Considering mean age of studied women (27.6 years old, this work ability is not satisfactory. Physical and mental components of the HRQoL were the important factors associated with work ability.
Oceanic an climatic consequences of a sudden large-scale West Antarctic Ice Sheet collapse
Scarff, Katie; Green, Mattias; Schmittner, Andreas
2015-04-01
Atmospheric warming is progressing to the point where the West Antarctic Ice Sheet (WAIS) will experience an elevated rate of discharge. The current discharge rate of WAIS is around 0.005Sv, but this rate will most likely accelerate over this century. The input of freshwater, in the form of ice, may have a profound effect on oceanic circulation systems, including potentially reducing the formation of deep water in the Southern Ocean and thus triggering or enhancing the bipolar seesaw. Using UVic - an intermediate complexity ocean-climate model - we investigate how various hosing rates from the WAIS will impact of the present and future ocean circulation and climate. These scenarios range from observed hosing rates (~0.005Sv) being applied for 100 years, to a total collapse of the WAIS over the next 100 years (the equivalent to a0.7Sv hosing). We show that even the present day observed rates can have a significant impact on the ocean and atmospheric temperatures, and that the bipolar seesaw may indeed be enhanced by the Southern Ocean hosing. Consequently, there is a speed-up of the Meridional Overturning Circulation (MOC) early on during the hosing, which leads to a warming over the North Atlantic, and a subsequent reduction in the MOC on centennial scales. The larger hosing cases show more dramatic effects with near-complete shutdowns of the MOC during the hosing. Furthermore, global warming scenarios based on the IPCC "business as usual" scenario show that the atmospheric warming will change the response of the ocean to Southern Ocean hosing and that the warming will dominate the perturbation. The potential feedback between changes in the ocean stratification in the scenarios and tidally driven abyssal mixing via tidal conversion is also explored.
Merchant, Gabrielle R; Merchant, Saumil N; Rosowski, John J; Nakajima, Hideko Heidi
2016-11-01
Current clinical practice cannot distinguish, with any degree of certainty, the multiple pathologies that produce conductive hearing loss in patients with an intact tympanic membrane and a well-aerated middle ear without exploratory surgery. The lack of an effective non-surgical diagnostic procedure leads to unnecessary surgery and limits the accuracy of information available during pre-surgical consultations with the patient. A non-invasive measurement to determine the pathology responsible for a conductive hearing loss prior to surgery would be of great value. This work investigates the utility of wideband acoustic immittance (WAI), a non-invasive measure of middle-ear mobility, in the differential diagnosis of pathologies responsible for conductive hearing loss. We focus on determining whether power reflectance (PR), a derivative of WAI, is a possible solution to this problem. PR is a measure of the fraction of sound power reflected from the middle ear when a sound stimulus is presented to the ear canal. PR and other metrics of middle-ear performance (such as ossicular motion via laser Doppler vibrometry) were measured in well-controlled human temporal bone preparations with simulated pathologies. We report measurements before and after simulation of stapes fixation (n = 8), malleus fixation (n = 10), ossicular disarticulation (n = 10), and superior canal dehiscence (n = 8). Our results are consistent with the small set of previously published reflectance measurements made in temporal bones and patients. In this present study, these temporal bone experiments with different middle- and inner-ear pathologies were compared to the initial normal state by analyzing both WAI and ossicular motion, demonstrating that WAI can be a valuable tool in the diagnosis of conductive hearing loss. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Rochet, Nathalie; Lindel, Katja; Katayama, Sonja; Schubert, Kai; Herfarth, Klaus; Harms, Wolfgang; Debus, Juergen; Schneeweiss, Andreas; Sohn, Christoph
2015-01-01
A prospective study to assess toxicity and survival outcomes after intensity-modulated whole-abdominal irradiation (IM-WAI) following surgery and adjuvant intravenous carboplatin/taxane chemotherapy in advanced FIGO stage III ovarian cancer. Between 2006 and 2009, 16 patients with optimally resected FIGO stage III ovarian cancer, who had received six cycles of adjuvant carboplatin/taxane chemotherapy were treated with consolidation IM-WAI. Radiotherapy was delivered to a total dose of 30 Gy in 1.5-Gy fractions, using step-and-shoot (n = 3) or helical tomotherapy (n = 13). The first 10 patients were treated within a phase I trial; the following patients received the same treatment modality. The target volume included the entire peritoneal cavity, the diaphragm, the liver capsule, and the pelvic and para-aortic node regions. Organs at risk were kidneys, liver, heart, and bone marrow. Median follow-up was 44 months (range 19.2-67.2 months). No grade 4 toxicities occurred during IM-WAI. Common Toxicity Criteria for Adverse Events (CTCAE) grade 3 toxicities were: diarrhea (25 %), leucopenia (19 %), nausea/vomiting (6 %), and thrombocytopenia (6 %). No toxicity-related treatment break was necessary. Small bowel obstruction occurred in a total of 6 patients: in 3 cases (19 %) due to postsurgical adhesions and in 3 cases due to local tumor recurrence (19 %). Median recurrence-free survival (RFS) was 27.6 months (95 % confidence interval, CI = 24-44 months) and median overall survival (OS) was 42.1 months (95 %CI = 17-68 months). The peritoneal cavity was the most frequent site of initial failure. Consolidation IM-WAI following surgery and adjuvant chemotherapy is feasible and can be performed with manageable acute and late toxicity. The favorable RFS outcome is promising and justifies further clinical trials. (orig.) [de
Quality of life, work ability and other important indicators of women's occupational health.
Tavakoli-Fard, Negah; Mortazavi, Seyed-Alireza; Kuhpayehzadeh, Jalil; Nojomi, Marzieh
2016-01-01
Work ability may be considered as an important aspect of well-being and health status. One of the most important factors in association with work ability is health-related quality of life (HRQoL). The aim of this study has been to determine the association between work ability, individual characteristics and HRQoL of female workers. The design of this study has been cross-sectional. The work ability index (WAI) and Short-Form General Health Survey (SF-12) questionnaires were used to collect data. Three hundred and twenty female workers were selected from food supplier factories in Karaj. One-way analysis of variance, Pearson's correlation analysis, independent sample t-test and multiple linear regression methods were used to analyze data. Mean (M) and standard deviation (SD) of the WAI stood at 35.02 and 5.57, respectively. The categories of the WAI for women being as follows: 8.8% poor, 62% moderate, 25.4% good and 3.7% excellent. Mean±SD for the physical component summary (PCS) and mental component summary (MCS) of quality of life was 58.84±11.12 and 57.45±9.94, respectively. There was a positive significant association between the PCS and MCS with the WAI (p = 0.0001). Workers with higher education had a better work ability (p = 0.002) and shift-work workers had a worse work ability (p = 0.03). Work ability of majority of women was moderate. Considering mean age of studied women (27.6 years old), this work ability is not satisfactory. Physical and mental components of the HRQoL were the important factors associated with work ability. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Calibrated and Interactive Modelling of Form-Active Hybrid Structures
DEFF Research Database (Denmark)
Quinn, Gregory; Holden Deleuran, Anders; Piker, Daniel
2016-01-01
Form-active hybrid structures (FAHS) couple two or more different structural elements of low self weight and low or negligible bending flexural stiffness (such as slender beams, cables and membranes) into one structural assembly of high global stiffness. They offer high load-bearing capacity...... software packages which introduce interruptions and data exchange issues in the modelling pipeline. The mechanical precision, stability and open software architecture of Kangaroo has facilitated the development of proof-of-concept modelling pipelines which tackle this challenge and enable powerful...... materially-informed sketching. Making use of a projection-based dynamic relaxation solver for structural analysis, explorative design has proven to be highly effective....
Energy Technology Data Exchange (ETDEWEB)
Rochet, Nathalie; Lindel, Katja; Katayama, Sonja; Schubert, Kai; Herfarth, Klaus; Harms, Wolfgang; Debus, Juergen [Heidelberg Institute of Radiation Oncology (HIRO), Heidelberg (Germany); University of Heidelberg, Department of Radiation Oncology, Heidelberg (Germany); Schneeweiss, Andreas [University of Heidelberg, Nationales Centrum fuer Tumorerkrankungen (NCT), Heidelberg (Germany); Sohn, Christoph [University of Heidelberg, Department of Gynecology, Heidelberg (Germany)
2015-07-15
A prospective study to assess toxicity and survival outcomes after intensity-modulated whole-abdominal irradiation (IM-WAI) following surgery and adjuvant intravenous carboplatin/taxane chemotherapy in advanced FIGO stage III ovarian cancer. Between 2006 and 2009, 16 patients with optimally resected FIGO stage III ovarian cancer, who had received six cycles of adjuvant carboplatin/taxane chemotherapy were treated with consolidation IM-WAI. Radiotherapy was delivered to a total dose of 30 Gy in 1.5-Gy fractions, using step-and-shoot (n = 3) or helical tomotherapy (n = 13). The first 10 patients were treated within a phase I trial; the following patients received the same treatment modality. The target volume included the entire peritoneal cavity, the diaphragm, the liver capsule, and the pelvic and para-aortic node regions. Organs at risk were kidneys, liver, heart, and bone marrow. Median follow-up was 44 months (range 19.2-67.2 months). No grade 4 toxicities occurred during IM-WAI. Common Toxicity Criteria for Adverse Events (CTCAE) grade 3 toxicities were: diarrhea (25 %), leucopenia (19 %), nausea/vomiting (6 %), and thrombocytopenia (6 %). No toxicity-related treatment break was necessary. Small bowel obstruction occurred in a total of 6 patients: in 3 cases (19 %) due to postsurgical adhesions and in 3 cases due to local tumor recurrence (19 %). Median recurrence-free survival (RFS) was 27.6 months (95 % confidence interval, CI = 24-44 months) and median overall survival (OS) was 42.1 months (95 %CI = 17-68 months). The peritoneal cavity was the most frequent site of initial failure. Consolidation IM-WAI following surgery and adjuvant chemotherapy is feasible and can be performed with manageable acute and late toxicity. The favorable RFS outcome is promising and justifies further clinical trials. (orig.) [German] Es wurden Akut- und Langzeittoxizitaet sowie Ueberlebensdaten der konsolidierenden intensitaetsmodulierten Ganzabdomenbestrahlung (&apos
International Nuclear Information System (INIS)
Casey, W.; Chen, Y.; DuBeshter, B.; Angel, C.; Dawson, A.; Smudzin, T.; Rubin, P.
1996-01-01
Objective: The optimum adjuvant therapy for uterine papillary serous carcinoma (UPSC), a rare but clinically aggressive histologic variant of endometrial carcinoma, is a controversial issue. UPSC behaves in a pattern that resembles the papillary serous carcinoma of the ovary with a tendency to spread to the peritoneal surfaces. Whole abdominopelvic irradiation (WAI) has been advocated but it remains unclear if adjuvant pelvic irradiation alone is sufficient for early stage UPSC. We reviewed our experience in the adjuvant radiation treatment for UPSC treated at our institution. Materials and Methods: Between 1985 and 1995, a series of 351 cases of endometrial carcinoma were referred to the department of Radiation Oncology. There were a total of 26 UPSC cases with 25 medical records available for review. Except for one case which received irradiation alone, the remaining 24 cases were all surgically staged with TAH/BSO. These patients were treated with WAI or pelvic irradiation with or without a vaginal cuff boost using brachytherapy. The irradiation treatment fields, dose, the local/regional and distant disease status at last follow-up were recorded. The medium follow-up interval was four years with a range of one to eight years. Kaplan-Meier plots for disease specific survival and local/regional disease free survival were obtained. Results: Of the 25 surgically staged UPSC patients, the stage distribution was as follows: 9 stage I, 4 stage II, 10 stage III, and 2 stage IVB. Twelve patients received WAI (4 stage I disease, and 8 stage III disease), while the remaining patients were treated with pelvic irradiation (XRT). 1.) 13 patients were alive without disease and 3 were alive with disease. Seven patients died of either distant metastasis or abdominal recurrence and two died of intercurrent disease (5 year disease specific survival for the whole group was 43%). Two of 17 patients with stages IIIA and below vs. five of 8 patients with stages IIIB and above died of
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Internet and Its Contributions to Library Services Internet: Kütüphane Hizmetlerine Katkıları
Directory of Open Access Journals (Sweden)
Yaşar Çelik
1995-06-01
Full Text Available This paper examines the major Internet services such as email, telnet and ftp and describes various information discovery and retrieval tools such as gopher, WAIS, and WWW. It also discusses the contributions of the Internet to library and information services. Bu makalede elektronik posta, telnet ve ftp gibi belli başlı Internet hizmetleri tanıtılmış, çeşitli bilgi keşfetme ve erişim araçları (gopher, WAIS, WWW açıklanmıştır. İnternet'in kütüphane hizmetlerine katkıları kısaca tartışılmıştır.
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
Land subsidence of coastal areas of Jiangsu Province, China: historical review and present situation
Directory of Open Access Journals (Sweden)
J. Q. Zhu
2015-11-01
Full Text Available Surface faults related to land subsidence have been observed in coastal cities, such as Nantong, Yancheng, and Lian Yungang, in Jiangsu Province (CAJS since the early 1970s. Nowadays, increases flooding and rising sea levels are attributed to subsidence caused by groundwater pumping. In this work we present a brief description of land subsidence in CAJS, we examine the mechanisms of land subsidence induced mainly by groundwater pumping and its evolution and economic implications as well as the implemented measures by the local government to prevent new damage.
Land subsidence of coastal areas of Jiangsu Province, China: historical review and present situation
Zhu, J. Q.; Yang, Y.; Yu, J.; Gong, X. L.
2015-11-01
Surface faults related to land subsidence have been observed in coastal cities, such as Nantong, Yancheng, and Lian Yungang, in Jiangsu Province (CAJS) since the early 1970s. Nowadays, increases flooding and rising sea levels are attributed to subsidence caused by groundwater pumping. In this work we present a brief description of land subsidence in CAJS, we examine the mechanisms of land subsidence induced mainly by groundwater pumping and its evolution and economic implications as well as the implemented measures by the local government to prevent new damage.
Acupuncture Treatment of Abducent Paralysis
Institute of Scientific and Technical Information of China (English)
任辉; 王涵; 武连仲; 杜元灏
2006-01-01
@@ Abducent paralysis is a kind of the pathological change of the cranial nerve, manifested mainly by the clinical symptoms of inward strabismus, limited abduction of the eyeball and double vision. It is believed in modern medicine that this disease can be caused by pathological change of the pons, basicranial metastatic carcinoma, elevated intracranial pressure, and also by inflammation in the head and face, rupture of local small blood vessels or traumatic injury. Now, Prof. WU Lian-zhong's experience in the treatment of abducent paralysis is reported in the following.
Alexander, Lisa; Liljequist, Laura
2016-04-01
The present research examined the validity of self-report versus informant-report in relation to a performance-based indicator of adult ADHD. Archival data from 118 participants (52 males, 66 females) were used to compare Conners' Adult ADHD Rating Scale-Self-Report: Long Format (CAARS-S:L) and Conners' Adult ADHD Rating Scale-Observer Report: Long Format (CAARS-O:L) with discrepancy scores calculated between the Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) Verbal Comprehension Index - Working Memory Index (VCI - WMI) and Perceptual-Organizational Index - Processing Speed Index (POI - PSI) scaled scores. Neither the self- nor informant-report formats of the CAARS were better predictors of discrepancies between WAIS-III Index scores. Intercorrelations between the CAARS-S:L and CAARS-O:L revealed generally higher correlations between the same scales of different formats and among scales measuring externally visible symptoms. Furthermore, regression analysis indicated that both the CAARS-S:L and CAARS-O:L clinical scales contributed a significant proportion of variance in WAIS-III VCI - WMI discrepancy scores (14.7% and 16.4%, respectively). Results did not establish greater accuracy of self-report versus informant-report of ADHD symptomatology, rather demonstrate the need for multimodal assessment of ADHD in adults. © The Author(s) 2013.
Inferring Ice Thickness from a Glacier Dynamics Model and Multiple Surface Datasets.
Guan, Y.; Haran, M.; Pollard, D.
2017-12-01
The future behavior of the West Antarctic Ice Sheet (WAIS) may have a major impact on future climate. For instance, ice sheet melt may contribute significantly to global sea level rise. Understanding the current state of WAIS is therefore of great interest. WAIS is drained by fast-flowing glaciers which are major contributors to ice loss. Hence, understanding the stability and dynamics of glaciers is critical for predicting the future of the ice sheet. Glacier dynamics are driven by the interplay between the topography, temperature and basal conditions beneath the ice. A glacier dynamics model describes the interactions between these processes. We develop a hierarchical Bayesian model that integrates multiple ice sheet surface data sets with a glacier dynamics model. Our approach allows us to (1) infer important parameters describing the glacier dynamics, (2) learn about ice sheet thickness, and (3) account for errors in the observations and the model. Because we have relatively dense and accurate ice thickness data from the Thwaites Glacier in West Antarctica, we use these data to validate the proposed approach. The long-term goal of this work is to have a general model that may be used to study multiple glaciers in the Antarctic.
The paradox of a long grounding during West Antarctic Ice Sheet retreat in Ross Sea.
Bart, Philip J; Krogmeier, Benjamin J; Bart, Manon P; Tulaczyk, Slawek
2017-04-28
Marine geological data show that the West Antarctic Ice Sheet (WAIS) advanced to the eastern Ross Sea shelf edge during the Last Glacial Maximum (LGM) and eventually retreated ~1000 km to the current grounding-line position on the inner shelf. During the early deglacial, the WAIS deposited a voluminous stack of overlapping grounding zone wedges (GZWs) on the outer shelf of the Whales Deep Basin. The large sediment volume of the GZW cluster suggests that the grounding-line position of the paleo-Bindschadler Ice Stream was relatively stationary for a significant time interval. We used an upper bound estimate of paleo-sediment flux to investigate the lower bound duration over which the ice stream would have deposited sediment to account for the GZW volume. Our calculations show that the cluster represents more than three millennia of ice-stream sedimentation. This long duration grounding was probably facilitated by rapid GZW growth. The subsequent punctuated large-distance (~200 km) grounding-line retreat may have been a highly non-linear ice sheet response to relatively continuous external forcing such as gradual climate warming or sea-level rise. These findings indicate that reliable predictions of future WAIS retreat may require incorporation of realistic calculations of sediment erosion, transport and deposition.
Neri, Luca; Rocca Rey, Luisa A; Gallieni, Maurizio; Brancaccio, Diego; Cozzolino, Mario; Colombi, Antonio; Burroughs, Thomas E
2009-05-01
About 300,000 patients in the United States with Chronic Kidney Failure (CKF) are of working age, but up to 70% lose their job within the first year of renal replacement therapy .No study has examined how work ability and perceived health are influenced by the subjects' adjustment to their job. We assessed the association of occupational stress (Effort-Reward Imbalance, ERI),work ability (WAI) and health-related quality of life (QoL) in hemodialysis. 40 employed hemodialysis patients completed a self-administered questionnaire. Associations between ERI, short Form 12 (sF-12), short Form - 6 Dimensions (sF-6D), Kidney Disease QOL- 36 (KDQOL-36) and WAI were tested with partial Spearman's correlation adjusted for age, income, and comorbidity burden. Study subjects were mainly low-income (82%), african-american (73%), men (75%); 16 were manual laborers and 9 worked in the industrial sector. Study subjects reported low levels of Occupational Stress: ERI scores indicated an imbalance between Job Efforts and Rewards in only 3 subjects. Nevertheless, ERI scores were inversely and strongly associated with WAI (rho=-0.41, pworking. The causal relationship between Occupational stress, perceived health, and work ability should be further investigated. Occupational Health professionals and nephrologists should closely collaborate to meet the needs of occupationally active hemodialysis patients.
Pérez-Revuelta, José; Villagrán-Moreno, José María; Moreno-Sánchez, Luisa; Pascual-Paño, Juan Manuel; González-Saiz, Francisco
2018-03-23
The aim of this paper is to provide evidence of the validity and reliability of the COMRADE scale (Combined Outcome Measure for Risk communication And treatment Decision making Effectiveness) in patients suffering from schizophrenia spectrum disorders. 150 patients recruited at five mental health centers were assessed using a cross-sectional study design. The COMRADE, WAIS-S (therapeutic alliance) and TSQM (satisfaction with medication) scales were used. Exploratory Factor Analysis identified three factors from the COMRADE (F1: "Risk communication"; F2: "Confidence in decision" and F3: "Knowledge of decisional balance") which explain 45.2, 8.5 and 6% of the variance, respectively. Statistically significant correlations were observed between the scores of the COMRADE subscales with the subscales of the WAI-S and the TSQM. The internal consistency observed for each of the factorial scores of the COMRADE were (Cronbach's alpha values) 0.90, 0.89 and 0.74, respectively. The COMRADE scale offers appropriate psychometric properties for its use as a measure of perceived patient involvement in the shared decision making process in antipsychotic treatment. The use of the COMRADE measure in psychiatric clinical practice and in research studies provides an outcome measure of interventions from the shared decision making model. Copyright © 2018 Elsevier B.V. All rights reserved.
Fujimori, Juichi; Nakashima, Ichiro; Baba, Toru; Meguro, Yuko; Ogawa, Ryo; Fujihara, Kazuo
2017-12-01
Approximately 55% of patients with neuromyelitis optica spectrum disorder (NMOSD) show cognitive impairment as evaluated using the Rao Brief Repeatable Neuropsychological Battery (BRBN), but this frequency appears to be higher than the frequency of specific brain lesions in NMOSD. We studied whether cognitive impairment could be observed in NMOSD patients with no or minor non-specific brain lesions. We evaluated cognitive function in 12 NMOSD and 14 MS patients using the Wechsler Adult Intelligence Scale-III (WAIS-III), the Wechsler Memory Scale-Revised (WMS-R), and the BRBN. We judged as cognitively impaired patients whose scores were below the average by 2 standard deviations or greater in 2 or more cognitive domains. Cognitive impairment was observed in 5 MS patients (35.7%) and in the only NMOSD patient (8.3%) with symptomatic brain lesions, but not in the other NMOSD patients who had no or minor non-specific brain lesions. Meanwhile, 5 NMOSD (41.7%) and 4 MS (28.6%) patients who had normal cognition according to the WAIS-III and WMS-R were assessed as cognitively impaired by the BRBN (which is not standardized for age). Cognitive function in NMOSD patients with no or mild non-specific brain lesions was preserved according to the WAIS-III and WMS-R.
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
Esper, O.; Gersonde, R.; Hillenbrand, C.; Kuhn, G.; Smith, J.
2011-12-01
Modern global change affects not only the polar north but also, and to increasing extent, the southern high latitudes, especially the Antarctic regions covered by the West Antarctic Ice Sheet (WAIS). Consequently, knowledge of the mechanisms controlling past WAIS dynamics and WAIS behaviour at the last deglaciation is critical to predict its development in a future warming world. Geological and palaeobiological information from major drainage areas of the WAIS, like the Amundsen Sea Embayment, shed light on the history of the WAIS glaciers. Sediment records obtained from a deep inner shelf basin north of Getz Ice Shelf document a deglacial warming in three phases. Above a glacial diamicton and a sediment package barren of microfossils that document sediment deposition by grounded ice and below an ice shelf or perennial sea ice cover (possibly fast ice), respectively, a sediment section with diatom assemblages dominated by sea ice taxa indicates ice shelf retreat and seasonal ice-free conditions. This conclusion is supported by diatom-based summer temperature reconstructions. The early retreat was followed by a phase, when exceptional diatom ooze was deposited around 12,500 cal. years B.P. [1]. Microscopical inspection of this ooze revealed excellent preservation of diatom frustules of the species Corethron pennatum together with vegetative Chaetoceros, thus an assemblage usually not preserved in the sedimentary record. Sediments succeeding this section contain diatom assemblages indicating rather constant Holocene cold water conditions with seasonal sea ice. The deposition of the diatom ooze can be related to changes in hydrographic conditions including strong advection of nutrients. However, sediment focussing in the partly steep inner shelf basins cannot be excluded as a factor enhancing the thickness of the ooze deposits. It is not only the presence of the diatom ooze but also the exceptional preservation and the species composition of the diatom assemblage
Kuuekümnes Cannes'i filmifestival alustas rullumist / Jaak Lõhmus
Lõhmus, Jaak
2007-01-01
Algas 60. Cannes'i filmifestival. Pikemalt avafilmist - Wong Kar-Wai "My Blueberry Nights", festivali ajaloost ja korraldusest, eestlaste osalemisest (K. Kõusaar filmiga "Magnus", filmiturul "Klass" ja "Sügisball")
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
Physical exercise at the workplace prevents deterioration of work ability among healthcare workers
DEFF Research Database (Denmark)
Jakobsen, Markus D.; Sundstrup, Emil; Brandt, Mikkel
2015-01-01
BACKGROUND: Imbalance between individual resources and work demands can lead to musculoskeletal disorders and reduced work ability. The purpose of this study was to investigate the effect of workplace- versus home-based physical exercise on work ability among healthcare workers. METHODS: Two......) performed during working hours for 5x10 min per week and up to 5 group-based coaching sessions on motivation for regular physical exercise, or 2) home-based physical exercise (HOME) performed during leisure time for 5x10 min per week. Both groups received ergonomic counseling on patient handling and use...... of lifting aides. The main outcome measure was the change from baseline to 10-week follow-up in WAI. RESULTS: Significant group by time interaction was observed for WAI (p
Association between the epidermal growth factor gene and intelligence in major depression patients.
Tian, Wen-min; Zhang, Ke-ran; Zhang, Juan; Shen, Yan; Xu, Qi
2010-06-01
To study the association between the epidermal growth factor (EGF) gene and intelligence in patients with major depression. Intelligence measurement using Wechsler Adult Intelligence Scale (WAIS) was performed on 120 unrelated patients with major depression and 46 control subjects. Blood was collected from all subjects for extraction of genomic DNA. Four single nucleotide polymorphisms (SNPs) in the EGF gene were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI- TOF-MS). Mean scores of both score lang and score task, two subtests in WAIS, differed significantly between major depression patients and controls (Pintelligence in patients with major depression. Genetic variation in the EGF gene may increase the susceptibility of major depression.
Utility of proverb interpretation measures with cardiac transplant candidates.
Dugbartey, A T
1998-12-01
To assess metaphorical understanding and proverb interpretation in cardiac transplant candidates, the neuropsychological assessment records of 22 adults with end-stage cardiac disease under consideration for transplantation were analyzed. Neuropsychological tests consisted of the Controlled Oral Word Association Test, Halstead Category Test, Rey-Osterrieth Complex Figure Test (Copy), Trial Making Test, and summed scores for the proverb items of the WAIS-R Comprehension subtest. Analysis showed that the group tended to interpret proverbs literally. Proverb scores were significantly associated with scores on the Similarities and Picture Arrangement subtests of the WAIS-R. There was a moderate negative association between number of reported heart attacks and Proverb scores. The need for brief yet robust assessments including measures of inferential thinking and conceptualization in transplant candidates are highlighted.
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
Directory of Open Access Journals (Sweden)
Wang LJ
2015-07-01
Full Text Available Liang-Jen Wang,1 Shing-Fang Lu,1 Wen-Jiun Chou,1 Mian-Yoon Chong,2 Yao-Hsing Wang,1 Yu-Lian Hsieh,1 Yi-Hsuan Lee,1 Ching Chen2 1Department of Child and Adolescent Psychiatry, 2Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan Objective: The abuse of ketamine by youths has grown into a serious public health issue. However, a reliable and efficient treatment has still not been found for youths who abuse ketamine. This pilot study investigated the effects of a family-oriented treatment program for ketamine-using youths and their caregivers.Methods: To carry out this study, 42 youths with ketamine use (mean age 16.6±1.1 years who were referred to take part in a 10-week treatment program based on motivational enhancement principles were selected, as were their principal caregivers (mean age 46.4±7.1 years, who were similarly referred to take part in a 10-week training program for parenting skills. The study had the youths complete the Chinese Craving Beliefs Questionnaire, the Adolescents’ Behavior problem Scale, and the Family APGAR both immediately before and after the program. Likewise, the youths’ caregivers completed the Family APGAR, the 12-item version of the Chinese Health Questionnaire, and the Parenting Stress Index.Results: Of the 42 youth–caregiver pairs that took part in this study, 37 (88% completed the 10-week program and both sets of assessments. After the treatment, the participating youths’ substance cravings declined (t=3.88, P<0.001, while family function, as perceived by the participating caregivers, significantly increased (t=2.22, P=0.033. The improvement in caregivers’ perceptions of family function were positively related to the improvement of the caregivers’ health status (r=-0.36, P=0.022.Conclusion: According to its results, this pilot study submits that family-oriented treatment programs may be considered a potentially effective
Directory of Open Access Journals (Sweden)
Yang XY
2018-05-01
Full Text Available Xiangying Yang,1 Xiaolu Chen,1 Yixiao Fu,2 Qinghua Luo,2 Lian Du,2 Haitang Qiu,2 Tian Qiu,2 Li Zhang,1 Huaqing Meng2 1The First Branch, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People’s Republic of China; 2Department of Psychiatry, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People’s Republic of China Purpose: To investigate the efficacy and safety of saffron in the treatment of major depressive disorder (MDD in comparison to placebo and synthetic antidepressants. Patients and methods: We conducted a systematic search in several electronic databases as well as manual search in bibliographies of relevant studies. We included randomized controlled trials that investigated the efficacy and safety of saffron for treating MDD in adults in comparison to either placebo or synthetic antidepressants. Primary outcome was change in scores on depressive symptoms from baseline. Secondary outcomes included remission rate, response rate, and drop-out rate for all reasons. We chose a random-effects model in order to obtain more conservative results. Standardized mean differences (SMDs and odds ratios (ORs with 95% confidence intervals (CIs were estimated as the overall effect index by inverse variance models. Results: Seven studies were included in this meta-analysis. Overall quality of these included studies was moderate. As for the primary outcome, saffron showed more improvements in depression symptoms when compared with placebo, with an SMD of -1.22 (95% CI -1.94, -0.49, P=0.001. Meanwhile, saffron was as effective as synthetic antidepressants, with an SMD of 0.16 (95% CI -0.25, 0.57, P=0.44. Moderate heterogeneity existed in our analysis. Through subgroup analyses, we found that treatment dosage and duration, types of synthetic antidepressants administered in the comparison group, and outcome measures could explain most of the variance. No differences were found in remission rate, response
Directory of Open Access Journals (Sweden)
Jin Y
2013-10-01
Full Text Available Yue-long Jin,* Ling-ling Ding,* Ying-shui Yao, Xiu-li Song, Hui Tang, Lian-ping He, Yan ChenFaculty of Epidemiology and Statistics, School of Public Health, Wannan Medical College, Anhui, People's Republic of China*These authors contributed equally to this workBackground: Obesity has become a major public health problem worldwide. The prevalence of obesity is rising alarmingly among children and adolescents in the People's Republic of China, with an estimated 120 million now in the obese range. It is estimated that 8% of children in the People's Republic of China are obese and 12% are overweight.Methods: Eligible papers on the prevalence of obesity among primary school students in the People's Republic of China and published between 2006 and 2011 were retrieved from PubMed and from online Chinese periodicals, ie, the full-text databases of VIP, the Chinese National Knowledge Infrastructure, and Wan Fang. Meta-Analyst software was used to collate and analyze the detection rates cited in the papers retrieved.Results: After evaluation of the quality of the papers, 25 were finally included, giving a total sample population size for investigation of obesity of 219,763, in which 28,121 cases were detected. Meta-analysis showed that the combined obesity detection rate was 10.4% (95% confidence interval 8.6–12.6 among primary school students in the People's Republic of China, with a higher detection rate in boys (12.6% than in girls (7.2%. The prevalence of obesity was higher in the north (11.8% than in the south (9.5%, east (11.6%, and mid-west (8.0% regions. Obesity defined according to the World Health Organization weight-for-height standard (14.3% was higher than that using age-specific and gender-specific cutoff points for body mass index (9.0%.Conclusion: Our meta-analysis found an obesity prevalence rate of 10.4%, which does not seem as high as previous reports of childhood obesity rates in other countries. However, the prevalence of childhood
Preparing for Combat Readiness for the Fight: Physical Performance Profile of Female US Marines
2016-03-01
22.6 6 1.9 22.6 6 1.9 0.76 0.02 FFM , kg 45.5 6 4.2 44.9 6 4.3 0.05 0.14 3-mile run, min:sec 24:11 6 1:58 24:30 6 2:10 0.07 20.15 Sit-ups, reps 98.5 6...0.01 20.36 MTC, min:sec 3:28 6 0:18 3:31 6 0:22 0.04 20.14 *BMI = body mass index; FFM = fat-free mass; FAH = flexed-arm hang; AL = ammunition can...fat was calculated using the Gallagher equation (5). Fat-free mass ( FFM ) was then calculated for each individual. Owing to the testing environ- ment
Directory of Open Access Journals (Sweden)
Xuan Yao
2017-06-01
Full Text Available Precisely targeted genome editing is highly desired for clinical applications. However, the widely used homology-directed repair (HDR-based genome editing strategies remain inefficient for certain in vivo applications. We here demonstrate a microhomology-mediated end-joining (MMEJ-based strategy for precisely targeted gene integration in transfected neurons and hepatocytes in vivo with efficiencies up to 20%, much higher (up to 10 fold than HDR-based strategy in adult mouse tissues. As a proof of concept of its therapeutic potential, we demonstrate the efficacy of MMEJ-based strategy in correction of Fah mutation and rescue of Fah−/− liver failure mice, offering an efficient approach for precisely targeted gene therapies.
Coordination compounds of titanium, zirconium, tin, thorium and uranium
International Nuclear Information System (INIS)
Deshpande, S.G.; Jain, S.C.
1990-01-01
Reactions of isatin, furoic acid and picolinic acid have been carried out with titanium tetrachloride, tin tetrachloride, thorium tetrachloride, zirconyl chloride and uranyl nitrate. While 2:3(metal:ligand) type compounds of isatin have been obtained with Ti(IV) and Sn(IV), zirconium(IV), thorium(IV), and uranium(VI) do not react with the ligand under similar experimental conditions. Furoic acid (FAH) and picolinic acid(PicH) form various chloro furoates and picolinates when reacted with TiCl 4 , ZrOCl 2 and ThCl 4 , but do not react with SnCl 4 . The various compounds synthesised have been characterised on the basis of elemental analysis, infrared studies, conductivity and thermogravimetric measurements. (author). 1 tab., 10 refs
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
Yue, John K; Ngwenya, Laura B; Upadhyayula, Pavan S; Deng, Hansen; Winkler, Ethan A; Burke, John F; Lee, Young M; Robinson, Caitlin K; Ferguson, Adam R; Lingsma, Hester F; Cnossen, Maryse C; Pirracchio, Romain; Korley, Frederick K; Vassar, Mary J; Yuh, Esther L; Mukherjee, Pratik; Gordon, Wayne A; Valadka, Alex B; Okonkwo, David O; Manley, Geoffrey T
2017-11-01
The relationship between blood alcohol level (BAL) and mild traumatic brain injury (mTBI) remains in need of improved characterization. Adult patients suffering mTBI without intracranial pathology on computed tomography (CT) from the prospective Transforming Research and Clinical Knowledge in Traumatic Brain Injury Pilot study with emergency department (ED) Glasgow Coma Scale (GCS) 13-15 and recorded blood alcohol level (BAL) were extracted. BAL≥80-mg/dl was set as proxy for excessive use. Multivariable regression was performed for patients with six-month Glasgow Outcome Scale-Extended (GOSE; functional recovery) and Wechsler Adult Intelligence Scale Processing Speed Index Composite Score (WAIS-PSI; nonverbal processing speed), using BAL≥80-mg/dl and GOSE≤7; 38.1% vs. 11.5%; p=0.025) and lower WAIS-PSI (92.4±12.7, 30th-percentile vs. 105.1±11.7, 63rd-percentile; pGOSE≤7 and an adjusted mean decrease of 8.88-points (95% CI [0.67-17.09]; p=0.035) on WAIS-PSI. Day-of-injury BAL>80-mg/dl after uncomplicated mTBI was associated with decreased GCS score and prolongation of reported LOC. BAL may be a biomarker for impaired return to baseline function and decreased nonverbal processing speed at six-months postinjury. Future confirmatory studies are needed. Published by Elsevier Ltd.
Association between work ability and fatigue in Brazilian nursing workers.
da Silva, Fabio José; Felli, Vanda Elisa Andres; Martinez, Maria Carmen; Mininel, Vivian Aline; Ratier, Ana Paula Pelegrini
2015-01-01
Impaired work ability is associated with work-related illnesses, early retirement and rising pension costs. To investigate the association between work ability and fatigue in nursing workers. Cross-sectional study conducted with 100 nursing workers from two inpatient units at a public teaching hospital in Sao Paulo, Brazil. The data were collected by means of a socio-demographic profile questionnaire, Work Ability Index (WAI) and Chalder Fatigue Scale. The data were analyzed by means of descriptive and analytical statistical methods, tests of association and multiple linear regression. The study population was mainly composed of women (88% ), exhibited a high educational level (76% ), average age 39.4 years old (SD = 9.5) and 15 years of professional experience, on average. The average score on WAI was good (39.4 points, SD = 6.0) but surprisingly, 35% of the participants exhibited moderate to poor work ability. Fatigue was found in 52% of the participants. The score on WAI decreased in association with fatigue (p work in the same workplace (p = 0.001), as well as among nursing technicians compared to nurses (p = 0.040). Fatigue, longer length of work in the same workplace and work category nursing technician were associated with decreased work ability, which emphasizes the need for investment in health and quality of work life.
Rice varieties in relation to rice bread quality.
Han, Hye Min; Cho, Jun Hyeon; Kang, Hang Won; Koh, Bong Kyung
2012-05-01
It is difficult to predict rice bread quality only from the amylose content (AC) or dough characteristics of new lines produced by rice breeding programmes. This study investigated the AC relative to bread baking quality of rice varieties developed in Korea, and identified specific characteristics that contribute to rice bread quality. Manmibyeo, Jinsumi, Seolgaeng and Hanareumbyeo were classified as low AC, YR24088 Acp9, Suweon517, Chenmaai and Goamibyeo as intermediate AC and Milyang261 as high AC. Suweon517, Milyang261 and Manmibyeo had a high water absorption index (WAI), while Goamibyeo, YR24088 Acp9, Jinsumi, Seolgaeng, Hanareumbyeo and Chenmaai had a low WAI. The gelatinisation enthalpy of flour varied from 9.2 J g(-1) in Milyang261 to 14.8 J g(-1) in YR24088 Acp9. After 7 days of storage the rate of flour retrogradation and crumb firmness were weakly correlated, with the exception of Jinsumi. Bread volumes of Jinsumi, Chenmaai, YR24088 Acp9 and Goamibyeo were comparable to that of wheat flour, but the rest were unsuited to bread making because of their low volume and hard crumb texture. Based on volume, texture and crumb firmness ratio, Chenmaai and Goamibyeo were the most appropriate varieties for making bread. An intermediate AC and low WAI were the primary indicators of rice bread flour quality. Copyright © 2011 Society of Chemical Industry.
Safari, Shahram; Akbari, Jafar; Kazemi, Meghdad; Mououdi, Mohammad Amin; Mahaki, Behzad
2013-01-01
Two great changes in developed countries are taking place: populations are ageing and becoming increasingly overweight. Combination of these factors with shift work is a risk factor for work ability and mental workload that are dynamic processes which change greatly throughout an individual's work life. The aim of this study was to investigate mental workload and work ability in textile workers and to identify factors which affect work ability and mental workload. This cross-sectional study was carried out among 194 male workers in textile industry. Employees based on their job group and work conditions have been divided into 6 categories. They completed work ability index and mental workload questionnaires during three work shifts. Body mass index (BMI) and demographic details were recorded. All of the participants rated their work ability as moderate with high mental workload. The mean WAI and mental workload in age group were significant. The mean BMI was 25.5 kg/m(2) (standard deviation 4.1) and the mean age was 40.22 years. There was a statistically significant correlation between work ability index and shift work. Unlike the previous study, a decrease point in WAI started in early age that may be due to life-style work and another psychological factor; on the other hand, NASA-TLX revealed high score in six subscales that can be another reason for low WAI.
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
Chinese Medicine Treatment for Afatinib-Induced Paronychia
Directory of Open Access Journals (Sweden)
Pei-Yuu Yang
2017-01-01
Full Text Available Afatinib (Gilotrif™ is widely used to treat patients with mutant activating epidermal growth factor receptor- (EGFR- dependent lung adenocarcinoma; however, it has various adverse side effects. Here, we report a patient with afatinib-induced paronychia. After Chinese medicine treatment with the well-known anticancer Chinese herbs, Jen-Ren-Hwo-Minq-Saan, and decoction of Ban-Zhi-Lian (Scutellaria barbata with Bai-Hua-She-She-Cao (Hedyotis diffusa Willd, patient’s condition was significantly improved. This shows that these Chinese medicines can not only be used in cancer treatment but also be used in the afatinib-induced paronychia.
Operadic formulation of topological vertex algebras and gerstenhaber or Batalin-Vilkovisky algebras
International Nuclear Information System (INIS)
Huang Yizhi
1994-01-01
We give the operadic formulation of (weak, strong) topological vertex algebras, which are variants of topological vertex operator algebras studied recently by Lian and Zuckerman. As an application, we obtain a conceptual and geometric construction of the Batalin-Vilkovisky algebraic structure (or the Gerstenhaber algebra structure) on the cohomology of a topological vertex algebra (or of a weak topological vertex algebra) by combining this operadic formulation with a theorem of Getzler (or of Cohen) which formulates Batalin-Vilkovisky algebras (or Gerstenhaber algebras) in terms of the homology of the framed little disk operad (or of the little disk operad). (orig.)
International Nuclear Information System (INIS)
Tulugan, Keli Mu; Park, Cheol Hong; Park, Won Jo; Qing, Wang
2012-01-01
The article 'Composition design and mechanical properties of BCC Ti solid solution alloys with low Young's modulus' has been retracted upon the request of the third author (Prof. Wang Qing, the first author's former advisor during his internship at DaLian University of Technology). The article was published without the third author's knowledge and consent. The corresponding author (Prof. Wonjo Park) apologizes to the third author, to the readers, and to the editorial staff of the JMST. The JMST editorial board does not tolerate such actions from authors and we will take appropriate action to prevent this from happening in the future
Price elasticity of petroleum products in selected African countries
International Nuclear Information System (INIS)
Kaul, S.
1995-01-01
In this paper, a fundamental understanding of the economic impact which is directly related to the price elasticity of petroleum products in six selected African countries is obtained by using the Jorgorson-Lian model for shares. Each kind of fuel price has a different impact on the share of oil products for the different countries. The price increase of one kind of fuel may increase or decrease the share of another fuel in the total oil products. In the oil importing African countries, the price of one product is relatively inelastic, whereas in the oil producing African countries, the price is elastic. (Author)
Work ability as a major determinant of clinical nurses' quality of life.
Milosevic, Milan; Golubic, Rajna; Knezevic, Bojana; Golubic, Karlo; Bubas, Marija; Mustajbegovic, Jadranka
2011-10-01
To examine quality of life determinants among clinical nurses in Croatia with an emphasis on their work ability. An important personnel management challenge is to explore factors that stimulate or hinder the development of individual work ability and quality of life throughout a career. A cross-sectional study. The study was performed during 2007-2008 in six randomly selected hospitals in Croatia. The self-administered questionnaires included the Work Ability Index (WAI) developed by the Finnish Institute of Occupational Health, the Quality of Life questionnaire (WHOQL-BREF) developed by the World Health Organization and additional socio-demographic questions. A total number of 1212 nurses completed the questionnaires, giving a response rate of 67(.) 3%. Binary logistic regression was performed to assess how socio-demographic characteristics and work ability groups predict each of the WHOQL-BREF domains. Having a satisfactory WAI score (WAI ≥ 37) was significantly the most important predictor for all quality of life domains, with the odds ratios (OR) being as follows: OR = 6(.) 8 (95% CI: 4(.) 8-9(.) 6) for the physical domain, OR = 2(.) 3 (95% CI: 1(.) 7-3(.) 1) for the psychological domain, OR = 1(.) 7 (95% CI: 1(.) 3-2(.) 4) for the social relationship domain and OR = 1(.) 7 (95% CI: 1(.) 3-2(.) 3) for the environmental domain. Satisfactory work ability was a major quality of life determinant in all WHOQL-BREF domains with the highest odds ratio for the physical domain. Maintaining clinical nurses' work ability is an important issue, because it is foundational for the quality of life of the workforce. Our study provides quantified estimates of the extent to which a satisfactory WAI score predicts a better score in physical, psychosocial, social relationships and environmental domain of nurses' quality of life. Therefore, maintaining or improving nurses' work ability remains the essential aim of hospital managers. © 2011 Blackwell Publishing Ltd.
Murayama, Norio; Iseki, Eizo; Tagaya, Hirokuni; Ota, Kazumi; Kasanuki, Koji; Fujishiro, Hiroshige; Arai, Heii; Sato, Kiyoshi
2013-03-01
We compared differences in intelligence and memory function between normal elderly Japanese subjects with more years of education and those with fewer years of education. We also investigated clinical and neuropsychological factors that are strongly correlated with memory function. There were 118 normal elderly subjects who underwent the Mini-Mental State Examination, Wechsler Adult Intelligence Scale, 3rd edition (WAIS-III), and Wechsler Memory Scale Revised. Subjects with at least 13 years of education were categorized as the H group, and those with 12 years of education or less were categorized as the L group. Age and Mini-Mental State Examination scores were not significantly different between the two groups. On the WAIS-III, there were significant differences between the two groups in Verbal IQ and Full Scale IQ. On the Wechsler Memory Scale Revised, there were significant differences between the two groups in Visual Memory, General Memory, and Delayed Recall. Correlation coefficients between memory function and the other factors demonstrated significant but weak correlations between years of education and General Memory (R = 0.22) and between years of education and Delayed Recall (R = 0.20). Strong correlations were found between Verbal IQ and Verbal Memory (R = 0.45), between Verbal IQ and General Memory (R = 0.49), between Full Scale IQ and General Memory (R = 0.50) and between Full Scale IQ and Delayed Recall (R = 0.48). In normal elderly Japanese subjects, years of education weakly correlated with memory function while Verbal IQ, Full Scale IQ and Verbal Comprehension on WAIS-III had stronger correlations with memory function. Verbal IQ and Verbal Comprehension on WAIS-III were found to be insusceptible to the cognitive decline characteristic of Alzheimer's disease or amnestic mild cognitive impairment. Therefore, verbal intelligence, as measured by Verbal IQ and Verbal Comprehension, may be the most useful factor for inferring premorbid memory function
International Nuclear Information System (INIS)
Rochet, Nathalie; Jensen, Alexandra D; Sterzing, Florian; Munter, Marc W; Eichbaum, Michael H; Schneeweiss, Andreas; Sohn, Christof; Debus, Juergen; Harms, Wolfgang
2007-01-01
The prognosis for patients with advanced epithelial ovarian cancer remains poor despite aggressive surgical resection and platinum-based chemotherapy. More than 60% of patients will develop recurrent disease, principally intraperitoneal, and die within 5 years. The use of whole abdominal irradiation (WAI) as consolidation therapy would appear to be a logical strategy given its ability to sterilize small tumour volumes. Despite the clinically proven efficacy of whole abdominal irradiation, the use of radiotherapy in ovarian cancer has profoundly decreased mainly due to high treatment-related toxicity. Modern intensity-modulated radiation therapy (IMRT) could allow to spare kidneys, liver, and bone marrow while still adequately covering the peritoneal cavity with a homogenous dose. The OVAR-IMRT-01 study is a single center pilot trial of a phase I/II study. Patients with advanced ovarian cancer stage FIGO III (R1 or R2< 1 cm) after surgical resection and platinum-based chemotherapy will be treated with whole abdomen irradiation as consolidation therapy using intensity modulated radiation therapy (IMRT) to a total dose of 30 Gy in 1.5 Gy fractions. A total of 8 patients will be included in this trial. For treatment planning bone marrow, kidneys, liver, spinal cord, vertebral bodies and pelvic bones are defined as organs at risk. The planning target volume includes the entire peritoneal cavity plus pelvic and para-aortic node regions. The primary endpoint of the study is the evaluation of the feasibility of intensity-modulated WAI and the evaluation of the study protocol. Secondary endpoint is evaluation of the toxicity of intensity modulated WAI before continuing with the phase I/II study. The aim is to explore the potential of IMRT as a new method for WAI to decrease the dose to kidneys, liver, bone marrow while covering the peritoneal cavity with a homogenous dose, and to implement whole abdominal intensity-modulated radiotherapy into the adjuvant multimodal
Directory of Open Access Journals (Sweden)
Flavio Jozef
2000-09-01
Full Text Available Objetivos: Estudar a correlação entre disfunção cerebral e psicopatia em homicidas. Métodos: Foram separados em dois grupos (psicopatas e não-psicopatas 29 homicidas "normais" (não-psicóticos, detidos em uma delegacia policial e escolhidos aleatoriamente, com base no HARE PCL-R (escala de avaliação de psicopatia. Ambos os grupos foram submetidos a testagem neuropsicológica, sendo empregados testes voltados para atividade em lobo frontal (Trail Making Test A e B, e subtestes do WAIS [Mosaico, Semelhanças e Símbolos Numéricos]. Resultados: Dos homicidas, 15 foram considerados psicopatas e 14, não-psicopatas. O subteste Mosaico, do WAIS, constituiu-se em discriminador entre os dois grupos pela presença significativa de resultados negativos em não-psicopatas (chi²=5,37; G.L.=1; PObjectives: The aim of the study was to investigate the association between psychopathy and cerebral dysfunction in a population of murderers. Methods: A random sample of 29 "normal" (non-psychotic murderers detained in a police station were evaluated and classified into psychopaths (n=15 and non-psychopaths (n=14 according to the HARE PCL-R. All individuals in the sample were submitted to neuropsychological tests (Trail Making Test A and B, and WAIS subtests [Block Design, Similarities and Digit Symbol]. Results: The WAIS subtest Block Design was a discriminator between the sample subgroups, with psychopaths scoring significantly better than non-psychopaths (c²=5.37; G.L.=1; p<0.05. As psychopaths were most commonly diagnosed with alcohol/illicit drugs addiction/abuse than non-psychopaths, this factor does not seem to account for the better neuropsychological performance of non-psychopaths. Conclusions: There is evidence that frontal lobe dysfunction is implied in homicidal behavior among non-psychopaths. A better psychiatric evaluation of murderers and the routine use of HARE PCL-R as a clinical and research tool are recommended.
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Ermel, Aare, 1957-2013
2006-01-01
Kolmest iseseisvast armastusloost koosnev episoodfilm "Eros" : režissöörid Wong Kar-Wai ("Käsi"), Steven Soderbergh ("Tasakaal" / "Equilibrium"), Michelangelo Antonioni ("Asjade ohtlik käik") : Hongkong - Hiina - USA - Prantsuse - Itaalia 2004
Identifying internet marketing principles relevant to generic marketers / Ayesha Lian Bevan-Dye
Bevan-Dye, Ayesha Lian
2005-01-01
To deliver the type of marketing graduate that meets industry demand necessitates that marketing curricula content be continuously updated to keep pace with the dynamic marketing environment. One of the major trends influencing the twenty-first century marketing environment is the advent of the Internet and substantial growth in Internet usage and Internet-based commerce. Not only is the Internet driving major marketing environmental change, it is also emerging as a new marketing tool of sign...
Kaufman, A S; Kaufman-Packer, J L; McLean, J E; Reynolds, C R
1991-11-01
Gender comparisons on the WAIS-R were made for 1,480 adults from the standardization sample, ages 20-74 years, to determine whether men and women differ in their age-related patterns of change on tests of fluid and crystallized abilities. Multivariate analyses of covariance and univariate analyses of covariance were conducted, covarying education, to examine the age + gender interactions. These interactions tended to be nonsignificant and trivial for the WAIS-R Verbal and Performance scales and the 11 subtests, which suggests that both men and women maintain their crystallized abilities through old age, but show early, rapid declines in fluid ability. These results were interpreted in terms of the literature on aging and intelligence, gender differences in cognitive abilities, and gender differences in V-P patterns for patients with unilateral brain damage.
Directory of Open Access Journals (Sweden)
Juan Antonio Ruano Ortiz
2010-03-01
Full Text Available The effects of sucrose and water contents on cassava flour processed by extrusion at varied concentrations of sucrose (0-20% w/w and water (28-42% w/w were studied by applying response surface methodology. The extrusion of the mixtures was performed in a twin screw extruder fitted to a torque rheometer. The specific mechanical energy (SME dissipated inside a conical twin-screw extruder was measured. Water absorption index (WAI, water solubility index (WSI and paste viscosity readings (cold viscosity (CV, peak viscosity (PV, breakdown (BD and set back (SB during a gelatinization-retrogradation cycle measured in a Rapid Visco Analyzer were determined on non-directly extruded products. The results indicated that SME and WSI decreased as a function of water and sucrose contents. WAI and pasting properties were influenced by water content. A non antiplasticizing effect of the sucrose content was observed on pasting properties, suggesting that sucrose did not reduce the availability of water available for gelatinizing cassava flour during the extrusion process. The nature of the optimum point was characterized as a saddle point for WAI, WSI, PV and BD, whereas SME showed a maximum and CV and SB a minimum. The results indicated to be valuable for the production of non-expanded cassava flour extrudates with desirable functional properties for specific end users.Foram estudados os efeitos da sacarose e da água de mistura no processamento de farinha de mandioca por extrusão. As variações de sacarose (0-20% p/p e água (28-42% p/p foram estudadas empregando-se metodologia de superfície de resposta. O processo de extrusão foi conduzido em uma extrusora de dupla rosca acoplado a um reômetro de torque. A energia mecânica específica (SME dissipada no final da extrusora foi calculada. As amostras extrusadas foram analisadas quanto aos índices de absorção de água (WAI e de solubilidade em água (WSI, e quanto às propriedades de pasta durante o
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...