Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

Science.gov (United States)

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Secondary Control for Voltage Quality Enhancement in Microgrids

DEFF Research Database (Denmark)

Savaghebi, Mehdi; Jalilian, Alireza; Vasquez, Juan Carlos

2012-01-01

In this paper, a hierarchical control scheme is proposed for enhancement of sensitive load bus (SLB) voltage quality in microgrids. The control structure consists of primary and secondary levels. The primary control level comprises distributed generators (DGs) local controllers. Each of these con......In this paper, a hierarchical control scheme is proposed for enhancement of sensitive load bus (SLB) voltage quality in microgrids. The control structure consists of primary and secondary levels. The primary control level comprises distributed generators (DGs) local controllers. Each...

The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

Science.gov (United States)

Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

2017-08-01

Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

Low-Voltage Solution-Processed Hybrid Light-Emitting Transistors.

Science.gov (United States)

Chaudhry, Mujeeb Ullah; Tetzner, Kornelius; Lin, Yen-Hung; Nam, Sungho; Pearson, Christopher; Groves, Chris; Petty, Michael C; Anthopoulos, Thomas D; Bradley, Donal D C

2018-05-21

We report the development of low operating voltages in inorganic-organic hybrid light-emitting transistors (HLETs) based on a solution-processed ZrO x gate dielectric and a hybrid multilayer channel consisting of the heterojunction In 2 O 3 /ZnO and the organic polymer "Super Yellow" acting as n- and p-channel/emissive layers, respectively. Resulting HLETs operate at the lowest voltages reported to-date (<10 V) and combine high electron mobility (22 cm 2 /(V s)) with appreciable current on/off ratios (≈10 3 ) and an external quantum efficiency of 2 × 10 -2 % at 700 cd/m 2 . The charge injection, transport, and recombination mechanisms within this HLET architecture are discussed, and prospects for further performance enhancement are considered.

Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

International Nuclear Information System (INIS)

Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

2015-01-01

Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

Energy Technology Data Exchange (ETDEWEB)

Arora, N D

1987-05-01

A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

A transient-enhanced NMOS low dropout voltage regulator with parallel feedback compensation

International Nuclear Information System (INIS)

Wang Han; Tan Lin

2016-01-01

This paper presents a transient-enhanced NMOS low-dropout regulator (LDO) for portable applications with parallel feedback compensation. The parallel feedback structure adds a dynamic zero to get an adequate phase margin with a load current variation from 0 to 1 A. A class-AB error amplifier and a fast charging/discharging unit are adopted to enhance the transient performance. The proposed LDO has been implemented in a 0.35 μm BCD process. From experimental results, the regulator can operate with a minimum dropout voltage of 150 mV at a maximum 1 A load and I Q of 165 μA. Under the full range load current step, the voltage undershoot and overshoot of the proposed LDO are reduced to 38 mV and 27 mV respectively. (paper)

Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

International Nuclear Information System (INIS)

Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

2014-01-01

Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

Science.gov (United States)

Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

2016-11-17

Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

Science.gov (United States)

Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

2012-01-01

The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

Science.gov (United States)

Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

2018-01-01

Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

Science.gov (United States)

Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

2014-03-01

The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

Shaping charge excitations in chiral edge states with a time-dependent gate voltage

Science.gov (United States)

Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

2018-02-01

We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

Science.gov (United States)

Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

2018-03-01

Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

Science.gov (United States)

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

Science.gov (United States)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

Science.gov (United States)

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Monitoring operating temperature and supply voltage in achieving high system dependability

NARCIS (Netherlands)

Khan, M.A.; Kerkhoff, Hans G.

2013-01-01

System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

Science.gov (United States)

White, William E.

2013-01-01

Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

A voltage-controlled ring oscillator using InP full enhancement-mode HEMT logic

Energy Technology Data Exchange (ETDEWEB)

Du Rui; Dai Yang; Chen Yanling; Yang Fuhua, E-mail: ddrr@semi.ac.c [Research Center of Semiconductor Integration, Institute of Semiconductors, Chinese Academy of Sciences, Beijing 100083 (China)

2009-03-15

A voltage-controlled ring oscillator (VCO) based on a full enhancement-mode InAlAs/InGaAs/InP high electron mobility transistor (HEMT) logic is proposed. An enhancement-mode HEMT (E-HEMT) is fabricated, whose threshold is demonstrated to be 10 mV. The model of the E-HEMT is established and used in the SPICE simulation of the VCO. The result proves that the full E-HEMT logic technology can be applied to the VCO. And compared with the HEMT DCFL technology, the complexity of our fabrication process is reduced and the reliability is improved.

Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

Science.gov (United States)

Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

2018-04-01

Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

Energy Technology Data Exchange (ETDEWEB)

Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

2011-07-29

Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

CMOS-compatible high-voltage integrated circuits

Energy Technology Data Exchange (ETDEWEB)

Parpia, Z

1988-01-01

Considerable savings in cost and development time can be achieved if high-voltage ICs (HVICs) are fabricated in an existing low-voltage process. In this thesis, the feasibility of fabricating HVICs in a standard CMOS process is investigated. The high-voltage capabilities of an existing 5-{mu}m CMOS process are first studied. High-voltage n- and p-channel transistors with breakdown voltages of 50 and 190 V, respectively, were fabricated without any modifications to the process under consideration. SPICE models for these transistors are developed, and their accuracy verified by comparison with experimental results. In addition, the effect of the interconnect metallization on the high-voltage performance of these devices is also examined. Polysilicon field plates are found to be effective in preventing premature interconnect induced breakdown in these devices. A novel high-voltage transistor structure, the insulated base transistor (IBT), based on a merged MOS-bipolar concept, is proposed and implemented. In order to enhance the high-voltage device capabilities, an improved CMOS-compatible HVIC process using junction isolation is developed.

Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

Science.gov (United States)

Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

2012-01-01

The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

Science.gov (United States)

Cantrell, A R; Scheuer, T; Catterall, W A

1999-07-01

Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

Voltage-controlled colour-tunable microcavity OLEDs with enhanced colour purity

International Nuclear Information System (INIS)

Choy, Wallace C H; Niu, J H; Li, W L; Chui, P C

2008-01-01

The emission spectrum of single-unit voltage-controlled colour-tunable organic light emitting devices (OLEDs) has been theoretically and experimentally studied. Our results show that by introducing the microcavity structure, the colour purity of not only the destination colour but also the colour-tunable route can be enhanced, while colour purity is still an issue in typical single-unit voltage-controlled colour-tunable OLEDs. With the consideration of the periodical cycling of resonant wavelength and absorption loss of the metal electrodes, the appropriate change in the thickness of the microcavity structure has been utilized to achieve voltage-controlled red-to-green and red-to-blue colour-tunable OLEDs without adding dyes or other organic materials to the OLEDs

Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

OpenAIRE

Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

2000-01-01

We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

Science.gov (United States)

Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

2011-05-06

Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

International Nuclear Information System (INIS)

Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

2006-01-01

An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

Science.gov (United States)

Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

2003-03-01

The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

Power Quality Improvement Using an Enhanced Network-Side-Shunt-Connected Dynamic Voltage Restorer

Science.gov (United States)

Fereidouni, Alireza; Masoum, Mohammad A. S.; Moghbel, Moayed

2015-10-01

Among the four basic dynamic voltage restorer (DVR) topologies, the network-side shunt-connected DVR (NSSC-DVR) has a relatively poor performance and is investigated in this paper. A new configuration is proposed and implemented for NSSC-DVR to enhance its performance in compensating (un)symmetrical deep and long voltage sags and mitigate voltage harmonics. The enhanced NSSC-DVR model includes a three-phase half-bridge semi-controlled network-side-shunt-connected rectifier and a three-phase full-bridge series-connected inverter implemented with a back-to-back configuration through a bidirectional buck-boost converter. The network-side-shunt-connected rectifier is employed to inject/draw the required energy by NSSC-DVR to restore the load voltage to its pre-fault value under sag/swell conditions. The buck-boost converter is responsible for maintaining the DC-link voltage of the series-connected inverter at its designated value in order to improve the NSSC-DVR capability in compensating deep and long voltage sags/swells. The full-bridge series-connected inverter permits to compensate unbalance voltage sags containing zero-sequence component. The harmonic compensation of the load voltage is achieved by extracting harmonics from the distorted network voltage using an artificial neural network (ANN) method called adaptive linear neuron (Adaline) strategy. Detailed simulations are performed by SIMULINK/MATLAB software for six case studies to verify the highly robustness of the proposed NSSC-DVR model under various conditions.

Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

International Nuclear Information System (INIS)

Yamacli, Serhan; Avci, Mutlu

2009-01-01

In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

Science.gov (United States)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

Directory of Open Access Journals (Sweden)

Seok-Yong Lee

2009-03-01

Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

Directory of Open Access Journals (Sweden)

Salmela Iikka

2012-08-01

Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

International Nuclear Information System (INIS)

Barchi, R.L.; Tanaka, J.C.

1984-01-01

In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

High voltage-derived enhancement of electric conduction in nanogap devices for detection of prostate-specific antigen

Science.gov (United States)

Park, Hyung Ju; Chi, Young Shik; Choi, Insung S.; Yun, Wan Soo

2010-07-01

We report a simple method of enhancing electric conductance in nanogap devices without any additional treatments, such as silver-enhancing process. The low electric conductance after selective immobilization of biofunctionalized gold nanoparticles in the gap region was greatly enhanced by repeated I-V scans at relatively high voltage ranges of -5 to 5 V, which was attributed to the formation of a new conduction pathway across the gap. The higher conduction state of the nanogap device showed a very stable I-V curve, which was used as an excellent measure of the existence of prostate-specific antigen.

Voltage splay modes and enhanced phase locking in a modified linear Josephson array

Science.gov (United States)

Harris, E. B.; Garland, J. C.

1997-02-01

We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=, where f is the magnetic frustration, while for 0tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N2 dependence, N being the number of series-connected junctions.

Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

OpenAIRE

Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

2009-01-01

Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

International Nuclear Information System (INIS)

Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

2012-01-01

Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

NARCIS (Netherlands)

Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

2002-01-01

Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

Induced over voltage test on transformers using enhanced Z-source inverter based circuit

Science.gov (United States)

Peter, Geno; Sherine, Anli

2017-09-01

The normal life of a transformer is well above 25 years. The economical operation of the distribution system has its roots in the equipments being used. The economy being such, that it is financially advantageous to replace transformers with more than 15 years of service in the second perennial market. Testing of transformer is required, as its an indication of the extent to which a transformer can comply with the customers specified requirements and the respective standards (IEC 60076-3). In this paper, induced over voltage testing on transformers using enhanced Z source inverter is discussed. Power electronic circuits are now essential for a whole array of industrial electronic products. The bulky motor generator set, which is used to generate the required frequency to conduct the induced over voltage testing of transformers is nowadays replaced by static frequency converter. First conventional Z-source inverter, and second an enhanced Z source inverter is being used to generate the required voltage and frequency to test the transformer for induced over voltage test, and its characteristics is analysed.

Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

Energy Technology Data Exchange (ETDEWEB)

Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

2014-03-31

This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

High Input Voltage, Silicon Carbide Power Processing Unit Performance Demonstration

Science.gov (United States)

Bozak, Karin E.; Pinero, Luis R.; Scheidegger, Robert J.; Aulisio, Michael V.; Gonzalez, Marcelo C.; Birchenough, Arthur G.

2015-01-01

A silicon carbide brassboard power processing unit has been developed by the NASA Glenn Research Center in Cleveland, Ohio. The power processing unit operates from two sources: a nominal 300 Volt high voltage input bus and a nominal 28 Volt low voltage input bus. The design of the power processing unit includes four low voltage, low power auxiliary supplies, and two parallel 7.5 kilowatt (kW) discharge power supplies that are capable of providing up to 15 kilowatts of total power at 300 to 500 Volts (V) to the thruster. Additionally, the unit contains a housekeeping supply, high voltage input filter, low voltage input filter, and master control board, such that the complete brassboard unit is capable of operating a 12.5 kilowatt Hall effect thruster. The performance of the unit was characterized under both ambient and thermal vacuum test conditions, and the results demonstrate exceptional performance with full power efficiencies exceeding 97%. The unit was also tested with a 12.5kW Hall effect thruster to verify compatibility and output filter specifications. With space-qualified silicon carbide or similar high voltage, high efficiency power devices, this would provide a design solution to address the need for high power electric propulsion systems.

Novel Interleaved Converter with Extra-High Voltage Gain to Process Low-Voltage Renewable-Energy Generation

Directory of Open Access Journals (Sweden)

Chih-Lung Shen

2016-10-01

Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.

Enhanced Voltage Control of VSC-HVDC Connected Offshore Wind Farms Based on Model Predictive Control

DEFF Research Database (Denmark)

Guo, Yifei; Gao, Houlei; Wu, Qiuwei

2018-01-01

This paper proposes an enhanced voltage control strategy (EVCS) based on model predictive control (MPC) for voltage source converter based high voltage direct current (VSCHVDC) connected offshore wind farms (OWFs). In the proposed MPC based EVCS, all wind turbine generators (WTGs) as well...... as the wind farm side VSC are optimally coordinated to keep voltages within the feasible range and reduce system power losses. Considering the high ratio of the OWF collector system, the effects of active power outputs of WTGs on voltage control are also taken into consideration. The predictive model of VSC...

Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

Science.gov (United States)

Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

2014-01-01

Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

Josephson tunneling current in the presence of a time-dependent voltage

International Nuclear Information System (INIS)

Harris, R.E.

1975-01-01

The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

International Nuclear Information System (INIS)

Hahlbohm, H.D.; Luebbig, H.; Luther, H.

1975-01-01

Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

Science.gov (United States)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Regulation of KV channel voltage-dependent activation by transmembrane β subunits

Directory of Open Access Journals (Sweden)

Xiaohui eSun

2012-04-01

Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Directory of Open Access Journals (Sweden)

Sameera Dharia

2011-02-01

Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Science.gov (United States)

Dharia, Sameera; Rabbitt, Richard D

2011-02-28

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

A novel control strategy for enhancing the LVRT and voltage support capabilities of DFIG

Science.gov (United States)

Shen, Yangwu; Zhang, Bin; Liang, Liqing; Cui, Ting

2018-02-01

A novel integrated control strategy is proposed in this paper to enhance the low voltage ride through capacity for the double-fed induction generator by equipping an energy storage system. The energy storage system is installed into the DC-link capacitor of the DFIG and used to control the DC-link voltage during normal or transient operations. The energy storage device will absorb or compensate the power difference between the captured wind power and the power injected to the grid during the normal and transient period, and the grid side converter can be free from maintaining the voltage stability of the DC-link capacitor. Thus, the grid-side converter is changed to reactive power support while the rotor-side converter is used to control the maximum power production during normal operation. The grid-side converter and rotor-side converter will act as reactive power sources to further enhance the voltage support capability of double-fed induction generator during the transient period. Numerical Simulation are performed to validate the effectiveness of the proposed control designs.

Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

Science.gov (United States)

Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

2010-01-01

In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

DEFF Research Database (Denmark)

Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

2002-01-01

The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

Directory of Open Access Journals (Sweden)

Mohamad Khairul Anuar

2017-01-01

Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

Optimal battery sizing in photovoltaic based distributed generation using enhanced opposition-based firefly algorithm for voltage rise mitigation.

Science.gov (United States)

Wong, Ling Ai; Shareef, Hussain; Mohamed, Azah; Ibrahim, Ahmad Asrul

2014-01-01

This paper presents the application of enhanced opposition-based firefly algorithm in obtaining the optimal battery energy storage systems (BESS) sizing in photovoltaic generation integrated radial distribution network in order to mitigate the voltage rise problem. Initially, the performance of the original firefly algorithm is enhanced by utilizing the opposition-based learning and introducing inertia weight. After evaluating the performance of the enhanced opposition-based firefly algorithm (EOFA) with fifteen benchmark functions, it is then adopted to determine the optimal size for BESS. Two optimization processes are conducted where the first optimization aims to obtain the optimal battery output power on hourly basis and the second optimization aims to obtain the optimal BESS capacity by considering the state of charge constraint of BESS. The effectiveness of the proposed method is validated by applying the algorithm to the 69-bus distribution system and by comparing the performance of EOFA with conventional firefly algorithm and gravitational search algorithm. Results show that EOFA has the best performance comparatively in terms of mitigating the voltage rise problem.

Optimal Battery Sizing in Photovoltaic Based Distributed Generation Using Enhanced Opposition-Based Firefly Algorithm for Voltage Rise Mitigation

Directory of Open Access Journals (Sweden)

Ling Ai Wong

2014-01-01

Full Text Available This paper presents the application of enhanced opposition-based firefly algorithm in obtaining the optimal battery energy storage systems (BESS sizing in photovoltaic generation integrated radial distribution network in order to mitigate the voltage rise problem. Initially, the performance of the original firefly algorithm is enhanced by utilizing the opposition-based learning and introducing inertia weight. After evaluating the performance of the enhanced opposition-based firefly algorithm (EOFA with fifteen benchmark functions, it is then adopted to determine the optimal size for BESS. Two optimization processes are conducted where the first optimization aims to obtain the optimal battery output power on hourly basis and the second optimization aims to obtain the optimal BESS capacity by considering the state of charge constraint of BESS. The effectiveness of the proposed method is validated by applying the algorithm to the 69-bus distribution system and by comparing the performance of EOFA with conventional firefly algorithm and gravitational search algorithm. Results show that EOFA has the best performance comparatively in terms of mitigating the voltage rise problem.

ELECTROMECHANICAL TRANSIENT PROCESSES DURING SUPPLY VOLTAGE CHANGING IN THE SYSTEM OF POLYMER INSULATION COVERING OF THE CURRENT-CARRYING CORE OF ULTRA HIGH VOLTAGE CABLES

Directory of Open Access Journals (Sweden)

V. M. Zolotaryov

2018-04-01

Full Text Available Aim. The article is devoted to the analysis of the electromechanical transient processes in a system of three frequency-controlled electric drives based on asynchronous motors that control current-carrying core motion, as well as to the study of the effect of such processes on the modes applying three-layer polymer insulation to the current-carrying core. Technique. The study was conducted based on the concepts of electromechanics, electromagnetic field theory, mathematical physics, mathematical modeling. Results. A mathematical model has been developed to analyze transients in an electromechanical system consisting of three frequency-controlled electric drives providing current-carrying core motion of ultra-high voltage cables in an inclined extrusion line. The coordination of the electromechanical parameters of the system drives has been carried out and the permissible changes in the supply voltage at the limiting mass while moving current-carrying core of ultra-high voltage cables with applied polymer insulation have been estimated. Scientific novelty. For the first time it is determined that with the limiting mass of the current-carrying core, the electromechanical system allows to stabilize the current-carrying core speed with the required accuracy at short-term decreases in the supply voltage by no more than 27 % of its amplitude value. It is also shown that this system is resistant to short-term increases in voltage by 32 % for 0.2 s. Practical significance. Using the developed model, it is possible to calculate the change in the configuration and speed of the slack current-carrying core when applying polymer insulation, depending on the specific mass of the current-carrying core per unit length, its tension at the bottom, the torque of the traction motor and the supply voltage to achieve stable operation of the system and accurate working of the set parameters.

Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

Directory of Open Access Journals (Sweden)

Dong-Hai Liu

Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

Science.gov (United States)

Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

2017-03-01

Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

Cloning and functional expression of a plant voltage-dependent chloride channel.

Science.gov (United States)

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

Interface charge trapping induced flatband voltage shift during plasma-enhanced atomic layer deposition in through silicon via

Science.gov (United States)

Li, Yunlong; Suhard, Samuel; Van Huylenbroeck, Stefaan; Meersschaut, Johan; Van Besien, Els; Stucchi, Michele; Croes, Kristof; Beyer, Gerald; Beyne, Eric

2017-12-01

A Through Silicon Via (TSV) is a key component for 3D integrated circuit stacking technology, and the diameter of a TSV keeps scaling down to reduce the footprint in silicon. The TSV aspect ratio, defined as the TSV depth/diameter, tends to increase consequently. Starting from the aspect ratio of 10, to improve the TSV sidewall coverage and reduce the process thermal budget, the TSV dielectric liner deposition process has evolved from sub-atmospheric chemical vapour deposition to plasma-enhanced atomic layer deposition (PE-ALD). However, with this change, a strong negative shift in the flatband voltage is observed in the capacitance-voltage characteristic of the vertical metal-oxide-semiconductor (MOS) parasitic capacitor formed between the TSV copper metal and the p-Si substrate. And, no shift is present in planar MOS capacitors manufactured with the same PE-ALD oxide. By comparing the integration process of these two MOS capacitor structures, and by using Elastic Recoil Detection to study the elemental composition of our films, it is found that the origin of the negative flatband voltage shift is the positive charge trapping at the Si/SiO2 interface, due to the positive PE-ALD reactants confined to the narrow cavity of high aspect ratio TSVs. This interface charge trapping effect can be effectively mitigated by high temperature annealing. However, this is limited in the real process due to the high thermal budget. Further investigation on liner oxide process optimization is needed.

Enhancement of VUV emission from a coaxial xenon excimer ultraviolet lamp driven by distorted bipolar square voltages

Energy Technology Data Exchange (ETDEWEB)

Jou, S.Y.; Hung, C.T.; Chiu, Y.M.; Wu, J.S. [Department of Mechanical Engineering, National Chiao Tung University, Hsinchu (China); Wei, B.Y. [High-Efficiency Gas Discharge Lamps Group, Material and Chemical Research Laboratories, Hsinchu (China)

2011-12-15

Enhancement of vacuum UV emission (172 nm VUV) from a coaxial xenon excimer UV lamp (EUV) driven by distorted 50 kHz bipolar square voltages, as compared to that by sinusoidal voltages, is investigated numerically in this paper. A self-consistent radial one-dimensional fluid model, taking into consideration non-local electron energy balance, is employed to simulate the discharge physics and chemistry. The discharge is divided into two three-period portions; these include: the pre-discharge, the discharge (most intense at 172 nm VUV emission) and the post-discharge periods. The results show that the efficiency of VUV emission using the distorted bipolar square voltages is much greater than when using sinusoidal voltages; this is attributed to two major mechanisms. The first is the much larger rate of change of the voltage in bipolar square voltages, in which only the electrons can efficiently absorb the power in a very short period of time. Energetic electrons then generate a higher concentration of metastable (and also excited dimer) xenon that is distributed more uniformly across the gap, for a longer period of time during the discharge process. The second is the comparably smaller amount of ''wasted'' power deposition by Xe{sup +}{sub 2} in the post-discharge period, as driven by distorted bipolar square voltages, because of the nearly vanishing gap voltage caused by the shielding effect resulting from accumulated charges on both dielectric surfaces (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

DEFF Research Database (Denmark)

Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

2001-01-01

The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

Large time-dependent coercivity and resistivity modification under sustained voltage application in a Pt/Co/AlOx/Pt junction.

NARCIS (Netherlands)

Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.

2015-01-01

The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic

A new reconfiguration scheme for voltage stability enhancement of radial distribution systems

International Nuclear Information System (INIS)

Arun, M.; Aravindhababu, P.

2009-01-01

Network reconfiguration is an operation problem, which entails altering the topological structure of the distribution feeders by rearranging the status of switches in order to obtain an optimal configuration in order to minimise the system losses. This paper presents a new reconfiguration algorithm that enhances voltage stability and improves the voltage profile besides minimising losses without incurring any additional cost for installation of capacitors, tap changing transformers and related switching equipment in the distribution system. Test results on a 69 node distribution system reveal the superiority of this algorithm.

Voltage splay modes and enhanced phase locking in a modified linear Josephson array

International Nuclear Information System (INIS)

Harris, E.B.; Garland, J.C.

1997-01-01

We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=(1)/(2), where f is the magnetic frustration, while for 0 p (f)=2aV dc /Φ 0 (1-2f). The locked splay modes are found to be tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N 2 dependence, N being the number of series-connected junctions. copyright 1996 The American Physical Society

Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

Directory of Open Access Journals (Sweden)

Seong-Ho Ok

2013-01-01

Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

A 32 kb 9T near-threshold SRAM with enhanced read ability at ultra-low voltage operation

Science.gov (United States)

Kim, Tony Tae-Hyoung; Lee, Zhao Chuan; Do, Anh Tuan

2018-01-01

Ultra-low voltage SRAMs are highly sought-after in energy-limited systems such as battery-powered and self-harvested SoCs. However, ultra-low voltage operation diminishes SRAM read bitline (RBL) sensing margin significantly. This paper tackles this issue by presenting a novel 9T cell with data-independent RBL leakage in combination with an RBL boosting technique for enhancing the sensing margin. The proposed technique automatically tracks process, temperature and voltage (PVT) variations for robust sensing margin enhancement. A test chip fabricated in 65 nm CMOS technology shows that the proposed scheme significantly enlarges the sensing margin compared to the conventional bitline sensing scheme. It also achieves the minimum operating voltage of 0.18 V and the minimum energy consumption of 0.92 J/access at 0.4 V. He received 2016 International Low Power Design Contest Award from ISLPED, a best paper award at 2014 and 2011 ISOCC, 2008 AMD/CICC Student Scholarship Award, 2008 Departmental Research Fellowship from Univ. of Minnesota, 2008 DAC/ISSCC Student Design Contest Award, 2008, 2001, and 1999 Samsung Humantec Thesis Award and, 2005 ETRI Journal Paper of the Year Award. He is an author/co-author of +100 journal and conference papers and has 17 US and Korean patents registered. His current research interests include low power and high performance digital, mixed- mode, and memory circuit design, ultra-low voltage circuits and systems design, variation and aging tolerant circuits and systems, and circuit techniques for 3D ICs. He serves as an associate editor of IEEE Transactions on VLSI Systems. He is an IEEE senior member and the Chair of IEEE Solid-State Circuits Society Singapore Chapter. He has served numerous conferences as a committee member.

Additional ion bombardment in PVD processes generated by a superimposed pulse bias voltage

International Nuclear Information System (INIS)

Olbrich, W.; Kampschulte, G.

1993-01-01

The superimposed pulse bias voltage is a tool to apply an additional ion bombardment during deposition in physical vapour deposition (PVD) processes. It is generated by the combination of a d.c. ground voltage and a higher d.c. pulse voltage. Using a superimposed pulse bias voltage in ion-assisted PVD processes effects an additional all-around ion bombardment on the surface with ions of higher energy. Both metal and reactive or inert-gas ions are accelerated to the surface. The basic principles and important characteristics of this newly developed process such as ion fluxes or deposition rates are shown. Because of pulsing the high voltage, the deposition temperature does not increase much. The adhesion, structure, morphology and internal stresses are influenced by these additional ion impacts. The columnar growth of the deposited films could be suppressed by using the superimposed pulse bias voltage without increasing the deposition temperature. Different metallizations (Cr and Cu) produced by arc and sputter ion plating are investigated. Carbon-fibre-reinforced epoxy are coated with PVD copper films for further treatment in electrochemical processes. (orig.)

Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

OpenAIRE

Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

2013-01-01

In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

Science.gov (United States)

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

Science.gov (United States)

Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

2018-02-21

Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

DEFF Research Database (Denmark)

Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

2001-01-01

The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

High voltage processing of the SLC polarized electron gun

International Nuclear Information System (INIS)

Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

1993-04-01

The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

Directory of Open Access Journals (Sweden)

Mesbahus Saleheen

2016-05-01

Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

Guanidinium: A Route to Enhanced Carrier Lifetime and Open-Circuit Voltage in Hybrid Perovskite Solar Cells.

Science.gov (United States)

De Marco, Nicholas; Zhou, Huanping; Chen, Qi; Sun, Pengyu; Liu, Zonghao; Meng, Lei; Yao, En-Ping; Liu, Yongsheng; Schiffer, Andy; Yang, Yang

2016-02-10

Hybrid perovskites have shown astonishing power conversion efficiencies owed to their remarkable absorber characteristics including long carrier lifetimes, and a relatively substantial defect tolerance for solution-processed polycrystalline films. However, nonradiative charge carrier recombination at grain boundaries limits open circuit voltages and consequent performance improvements of perovskite solar cells. Here we address such recombination pathways and demonstrate a passivation effect through guanidinium-based additives to achieve extraordinarily enhanced carrier lifetimes and higher obtainable open circuit voltages. Time-resolved photoluminescence measurements yield carrier lifetimes in guanidinium-based films an order of magnitude greater than pure-methylammonium counterparts, giving rise to higher device open circuit voltages and power conversion efficiencies exceeding 17%. A reduction in defect activation energy of over 30% calculated via admittance spectroscopy and confocal fluorescence intensity mapping indicates successful passivation of recombination/trap centers at grain boundaries. We speculate that guanidinium ions serve to suppress formation of iodide vacancies and passivate under-coordinated iodine species at grain boundaries and within the bulk through their hydrogen bonding capability. These results present a simple method for suppressing nonradiative carrier loss in hybrid perovskites to further improve performances toward highly efficient solar cells.

Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

Directory of Open Access Journals (Sweden)

Aldo A Rodríguez Menchaca

2012-09-01

Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

Low-tube-voltage selection for non-contrast-enhanced CT: Comparison of the radiation dose in pediatric and adult phantoms.

Science.gov (United States)

Shimonobo, Toshiaki; Funama, Yoshinori; Utsunomiya, Daisuke; Nakaura, Takeshi; Oda, Seitaro; Kiguchi, Masao; Masuda, Takanori; Sakabe, Daisuke; Yamashita, Yasuyuki; Awai, Kazuo

2016-01-01

We used pediatric and adult anthropomorphic phantoms to compare the radiation dose of low- and standard tube voltage chest and abdominal non-contrast-enhanced computed tomography (CT) scans. We also discuss the optimal low tube voltage for non-contrast-enhanced CT. Using a female adult- and three differently-sized pediatric anthropomorphic phantoms we acquired chest and abdominal non-contrast-enhanced scans on a 320-multidetector CT volume scanner. The tube voltage was set at 80-, 100-, and 120 kVp. The tube current was automatically assigned on the CT scanner in response to the set image noise level. On each phantom and at each tube voltage we measured the surface and center dose using high-sensitivity metal-oxide-semiconductor field-effect transistor detectors. The mean surface dose of chest and abdominal CT scans in 5-year olds was 4.4 and 5.3 mGy at 80 kVp, 4.5 and 5.4 mGy at 100 kV, and 4.0 and 5.0 mGy at 120 kVp, respectively. These values were similar in our 3-pediatric phantoms (p > 0.05). The mean surface dose in the adult phantom increased from 14.7 to 19.4 mGy for chest- and from 18.7 to 24.8 mGy for abdominal CT as the tube voltage decreased from 120 to 80 kVp (p voltage and the low tube voltage technique can be used for non-contrast-enhanced chest- and abdominal scanning. Copyright © 2015 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

An Enhanced Power Sharing Scheme for Voltage unbalance and harmonics compensation in an islanded AC microgrid

DEFF Research Database (Denmark)

Han, Yang; Shen, Pan; Zhao, Xin

2016-01-01

In this paper, an enhanced hierarchical control structure with multiple current loop damping schemes for voltage unbalance and harmonics compensation in ac islanded microgrid is proposed to address unequal power sharing problems. The distributed generation (DG) is properly controlled to autonomou......In this paper, an enhanced hierarchical control structure with multiple current loop damping schemes for voltage unbalance and harmonics compensation in ac islanded microgrid is proposed to address unequal power sharing problems. The distributed generation (DG) is properly controlled...... to autonomously compensate voltage unbalance and harmonics while sharing the compensation effort for the real power, reactive power, unbalance and harmonic powers. The proposed control system of the microgrid mainly consists of the positive sequence real and reactive power droop controllers, voltage and current......) technique is adopted to send the compensation command of the secondary control and auxiliary control from the microgrid control center (MGCC) to the local controllers of DG unit. Finally, the hardware-in-the-loop (HIL) results using dSPACE 1006 platform are presented to demonstrate the effectiveness...

Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

Directory of Open Access Journals (Sweden)

Wei Xia

2015-01-01

Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

Cellular hyper-excitability caused by mutations that alter the activation process of voltage-gated sodium channels

Directory of Open Access Journals (Sweden)

Mohamed-Yassine eAMAROUCH

2015-02-01

Full Text Available Voltage-gated sodium channels (Nav are widely expressed as macro-molecular complexes in both excitable and non-excitable tissues. In excitable tissues, the upstroke of the action potential is the result of the passage of a large and rapid influx of sodium ions through these channels. NaV dysfunction has been associated with an increasingly wide range of neurological, muscular and cardiac disorders. The purpose of this review is to summarize the recently identified sodium channel mutations that are linked to hyper-excitability phenotypes and associated with the alteration of the activation process of voltage gated sodium channels. Indeed, several clinical manifestations that demonstrate an alteration of tissue excitability were recently shown to be strongly associated with the presence of mutations that affect the activation process of the voltage-gated sodium channels. These emerging genotype-phenotype correlations have expanded the clinical spectrum of sodium channelopathies to include disorders which feature a hyper-excitability phenotype that may or may not be associated with a cardiomyopathy. The p.I141V mutation in SCN4A and SCN5A, as well as its homologous p.I136V mutation in SCN9A, are interesting examples of mutations that have been linked to inherited hyperexcitability myotonia, exercise-induced polymorphic ventricular arrhythmias and erythromelalgia, respectively. Regardless of which sodium channel isoform is investigated, the substitution of the isoleucine to valine in the locus 141 induces similar modifications in the biophysical properties of the voltage-gated sodium channels by shifting the voltage-dependence of steady state activation towards more negative potentials.

Listening to membrane potential: photoacoustic voltage-sensitive dye recording

Science.gov (United States)

Zhang, Haichong K.; Yan, Ping; Kang, Jeeun; Abou, Diane S.; Le, Hanh N. D.; Jha, Abhinav K.; Thorek, Daniel L. J.; Kang, Jin U.; Rahmim, Arman; Wong, Dean F.; Boctor, Emad M.; Loew, Leslie M.

2017-04-01

Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.

Enhanced Electron Affinity and Exciton Confinement in Exciplex-Type Host: Power Efficient Solution-Processed Blue Phosphorescent OLEDs with Low Turn-on Voltage.

Science.gov (United States)

Ban, Xinxin; Sun, Kaiyong; Sun, Yueming; Huang, Bin; Jiang, Wei

2016-01-27

A benzimidazole/phosphine oxide hybrid 1,3,5-tris(1-(4-(diphenylphosphoryl)phenyl)-1H-benzo[d]imidazol-2-yl)benzene (TPOB) was newly designed and synthesized as the electron-transporting component to form an exciplex-type host with the conventional hole-transporting material tris(4-carbazoyl-9-ylphenyl)amine (TCTA). Because of the enhanced triplet energy and electron affinity of TPOB, the energy leakage from exciplex-state to the constituting molecule was eliminated. Using energy transfer from exciplex-state, solution-processed blue phosphorescent organic light-emitting diodes (PHOLEDs) achieved an extremely low turn-on voltage of 2.8 V and impressively high power efficiency of 22 lm W(-1). In addition, the efficiency roll-off was very small even at luminance up to 10 000 cd m(-2), which suggested the balanced charge transfer in the emission layer. This study demonstrated that molecular modulation was an effective way to develop efficient exciplex-type host for high performanced PHOLEDs.

Jump locations of jump-diffusion processes with state-dependent rates

International Nuclear Information System (INIS)

Miles, Christopher E; Keener, James P

2017-01-01

We propose a general framework for studying statistics of jump-diffusion systems driven by both Brownian noise (diffusion) and a jump process with state-dependent intensity. Of particular natural interest in many physical systems are the jump locations: the system evaluated at the jump times. As an example, this could be the voltage at which a neuron fires, or the so-called ‘threshold voltage’. However, the state-dependence of the jump rate provides direct coupling between the diffusion and jump components, making it difficult to disentangle the two to study individually. In this work, we provide an iterative map formulation of the sequence of distributions of jump locations. The distributions computed by this map can be used to elucidate other interesting quantities about the process, including statistics of the interjump times. Ultimately, the limit of the map reveals that knowledge of the stationary distribution of the full process is sufficient to recover (but not necessarily equal to) the distribution of jump locations. We propose two biophysical examples to illustrate the use of this framework to provide insight about a system. We find that a sharp threshold voltage emerges robustly in a simple stochastic integrate-and-fire neuronal model. The interplay between the two sources of noise is also investigated in a stepping model of molecular motor in intracellular transport pulling a diffusive cargo. (paper)

An Enhanced Three-Level Voltage Switching State Scheme for Direct Torque Controlled Open End Winding Induction Motor

Science.gov (United States)

Kunisetti, V. Praveen Kumar; Thippiripati, Vinay Kumar

2018-01-01

Open End Winding Induction Motors (OEWIM) are popular for electric vehicles, ship propulsion applications due to less DC link voltage. Electric vehicles, ship propulsions require ripple free torque. In this article, an enhanced three-level voltage switching state scheme for direct torque controlled OEWIM drive is implemented to reduce torque and flux ripples. The limitations of conventional Direct Torque Control (DTC) are: possible problems during low speeds and starting, it operates with variable switching frequency due to hysteresis controllers and produces higher torque and flux ripple. The proposed DTC scheme can abate the problems of conventional DTC with an enhanced voltage switching state scheme. The three-level inversion was obtained by operating inverters with equal DC-link voltages and it produces 18 voltage space vectors. These 18 vectors are divided into low and high frequencies of operation based on rotor speed. The hardware results prove the validity of proposed DTC scheme during steady-state and transients. From simulation and experimental results, proposed DTC scheme gives less torque and flux ripples on comparison to two-level DTC. The proposed DTC is implemented using dSPACE DS-1104 control board interface with MATLAB/SIMULINK-RTI model.

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide.

Science.gov (United States)

Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício

2015-02-01

This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

Science.gov (United States)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Grid-interfacing converter systems with enhanced voltage quality for microgrid application : concept and implementation

NARCIS (Netherlands)

Wang, F.; Duarte, J.L.; Hendrix, M.A.M.

2011-01-01

Grid-interfacing converter systems with enhanced voltage quality are proposed for microgrid application in this paper. By adapting the conventional series-parallel structure, a group of grid-interfacing system topologies are proposed for the purpose of interfacing local generation/microgrid to the

Spin-Dependent Processes Measured without a Permanent Magnet.

Science.gov (United States)

Fontanesi, Claudio; Capua, Eyal; Paltiel, Yossi; Waldeck, David H; Naaman, Ron

2018-05-07

A novel Hall circuit design that can be incorporated into a working electrode, which is used to probe spin-selective charge transfer and charge displacement processes, is reviewed herein. The general design of a Hall circuit based on a semiconductor heterostructure, which forms a shallow 2D electron gas and is used as an electrode, is described. Three different types of spin-selective processes have been studied with this device in the past: i) photoinduced charge exchange between quantum dots and the working electrode through chiral molecules is associated with spin polarization that creates a local magnetization and generates a Hall voltage; ii) charge polarization of chiral molecules by an applied voltage is accompanied by a spin polarization that generates a Hall voltage; and iii) cyclic voltammetry (current-voltage) measurements of electrochemical redox reactions that can be spin-analyzed by the Hall circuit to provide a third dimension (spin) in addition to the well-known current and voltage dimensions. The three studies reviewed open new doors into understanding both the spin current and the charge current in electronic materials and electrochemical processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

Science.gov (United States)

Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

2014-01-01

The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

Directory of Open Access Journals (Sweden)

Ting-Feng Lin

Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

DEFF Research Database (Denmark)

Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

2016-01-01

This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

Solution-processed p-type copper(I) thiocyanate (CuSCN) for low-voltage flexible thin-film transistors and integrated inverter circuits

KAUST Repository

Petti, Luisa

2017-03-17

We report on low operating voltage thin-film transistors (TFTs) and integrated inverters based on copper(I) thiocyanate (CuSCN) layers processed from solution at low temperature on free-standing plastic foils. As-fabricated coplanar bottom-gate and staggered top-gate TFTs exhibit hole-transporting characteristics with average mobility values of 0.0016 cm2 V−1 s−1 and 0.013 cm2 V−1 s−1, respectively, current on/off ratio in the range 102–104, and maximum operating voltages between −3.5 and −10 V, depending on the gate dielectric employed. The promising TFT characteristics enable fabrication of unipolar NOT gates on flexible free-standing plastic substrates with voltage gain of 3.4 at voltages as low as −3.5 V. Importantly, discrete CuSCN transistors and integrated logic inverters remain fully functional even when mechanically bent to a tensile radius of 4 mm, demonstrating the potential of the technology for flexible electronics.

Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

Energy Technology Data Exchange (ETDEWEB)

Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

2016-01-01

Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

International Nuclear Information System (INIS)

Li, Weiping; Li, Wen; Zhu, Liqun; Liu, Huicong; Wang, Xiaofang

2013-01-01

Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg 2 SiO 4 with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na 2 SiO 3 ·9H 2 O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg 2 SiO 4 with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction

Characterization of chaotic electroconvection near flat electrodes under oscillatory voltages

Science.gov (United States)

Kim, Jeonglae; Davidson, Scott; Mani, Ali

2017-11-01

Onset of hydrodynamic instability and chaotic electroconvection in aqueous systems are studied by directly solving the two-dimensional coupled Poisson-Nernst-Planck and Navier-Stokes equations. An aqueous binary electrolyte is bounded by two planar electrodes where time-harmonic voltage is applied at a constant oscillation frequency. The governing equations are solved using a fully-conservative second-order-accurate finite volume discretization and a second-order implicit Euler time advancement. At a sufficiently high amplitude of applied voltage, the system exhibits chaotic behaviors involving strong hydrodynamic mixing and enhanced electroconvection. The system responses are characterized as a function of oscillation frequency, voltage magnitude, and the ratio of diffusivities of two ion species. Our results indicate that electroconvection is most enhanced for frequencies on the order of inverse system RC time scale. We will discuss the dependence of this optimal frequency on the asymmetry of the diffusion coefficients of ionic species. Supported by the Stanford's Precourt Institute.

Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

International Nuclear Information System (INIS)

Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

2008-01-01

Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

International Nuclear Information System (INIS)

Miah, M. Idrish

2008-01-01

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

Fault Ride-through Capability Enhancement of Voltage Source Converter-High Voltage Direct Current Systems with Bridge Type Fault Current Limiters

Directory of Open Access Journals (Sweden)

Md Shafiul Alam

2017-11-01

Full Text Available This paper proposes the use of bridge type fault current limiters (BFCLs as a potential solution to reduce the impact of fault disturbance on voltage source converter-based high voltage DC (VSC-HVDC systems. Since VSC-HVDC systems are vulnerable to faults, it is essential to enhance the fault ride-through (FRT capability with auxiliary control devices like BFCLs. BFCL controllers have been developed to limit the fault current during the inception of system disturbances. Real and reactive power controllers for the VSC-HVDC have been developed based on current control mode. DC link voltage control has been achieved by a feedback mechanism such that net power exchange with DC link capacitor is zero. A grid-connected VSC-HVDC system and a wind farm integrated VSC-HVDC system along with the proposed BFCL and associated controllers have been implemented in a real time digital simulator (RTDS. Symmetrical three phase as well as different types of unsymmetrical faults have been applied in the systems in order to show the effectiveness of the proposed BFCL solution. DC link voltage fluctuation, machine speed and active power oscillation have been greatly suppressed with the proposed BFCL. Another significant feature of this work is that the performance of the proposed BFCL in VSC-HVDC systems is compared to that of series dynamic braking resistor (SDBR. Comparative results show that the proposed BFCL is superior over SDBR in limiting fault current as well as improving system fault ride through (FRT capability.

Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

DEFF Research Database (Denmark)

Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

2006-01-01

Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

OpenAIRE

Dharia, Sameera; Rabbitt, Richard D.

2011-01-01

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

Process engineering of high voltage alginate encapsulation of mesenchymal stem cells

International Nuclear Information System (INIS)

Gryshkov, Oleksandr; Pogozhykh, Denys; Zernetsch, Holger; Hofmann, Nicola; Mueller, Thomas; Glasmacher, Birgit

2014-01-01

Encapsulation of stem cells in alginate beads is promising as a sophisticated drug delivery system in treatment of a wide range of acute and chronic diseases. However, common use of air flow encapsulation of cells in alginate beads fails to produce beads with narrow size distribution, intact spherical structure and controllable sizes that can be scaled up. Here we show that high voltage encapsulation (≥ 15 kV) can be used to reproducibly generate spherical alginate beads (200–400 μm) with narrow size distribution (± 5–7%) in a controlled manner under optimized process parameters. Flow rate of alginate solution ranged from 0.5 to 10 ml/h allowed producing alginate beads with a size of 320 and 350 μm respectively, suggesting that this approach can be scaled up. Moreover, we found that applied voltages (15–25 kV) did not alter the viability and proliferation of encapsulated mesenchymal stem cells post-encapsulation and cryopreservation as compared to air flow. We are the first who employed a comparative analysis of electro-spraying and air flow encapsulation to study the effect of high voltage on alginate encapsulated cells. This report provides background in application of high voltage to encapsulate living cells for further medical purposes. Long-term comparison and work on alginate–cell interaction within these structures will be forthcoming. - Highlights: • High voltage alginate encapsulation of mesenchymal stem cells (MSCs) was designed. • Reproducible and spherical alginate beads were generated via high voltage. • Air flow encapsulation was utilized as a comparative approach to high voltage. • High voltage did not alter the viability and proliferation of encapsulated MSCs. • High voltage encapsulation can be scaled up and applied in cell-based therapy

Molecular mechanism of voltage sensing in voltage-gated proton channels

Science.gov (United States)

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

Energy Technology Data Exchange (ETDEWEB)

Li, Weiping, E-mail: liweiping@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Wen [AVIC Beijing Aeronautical Manufacturing Technology Research Institue, Beijing 100024 (China); Zhu, Liqun; Liu, Huicong; Wang, Xiaofang [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)

2013-04-20

Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg{sub 2}SiO{sub 4} with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na{sub 2}SiO{sub 3}·9H{sub 2}O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg{sub 2}SiO{sub 4} with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction.

Enhancement of Performance and Mechanism Studies of All-Solution Processed Small-Molecule based Solar Cells with an Inverted Structure.

Science.gov (United States)

Long, Guankui; Wu, Bo; Yang, Xuan; Kan, Bin; Zhou, Ye-Cheng; Chen, Li-Chuan; Wan, Xiangjian; Zhang, Hao-Li; Sum, Tze Chien; Chen, Yongsheng

2015-09-30

Both solution-processed polymers and small molecule based solar cells have achieved PCEs over 9% with the conventional device structure. However, for the practical applications of photovoltaic technology, further enhancement of both device performance and stability are urgently required, particularly for the inverted structure devices, since this architecture will probably be most promising for the possible coming commercialization. In this work, we have fabricated both conventional and inverted structure devices using the same small molecular donor/acceptor materials and compared the performance of both device structures, and found that the inverted structure based device gave significantly improved performance, the highest PCE so far for inverted structure based device using small molecules as the donor. Furthermore, the inverted device shows a remarkable stability with almost no obvious degradation after three months. Systematic device physics and charge generation dynamics studies, including optical simulation, light-intensity-dependent current-voltage experiments, photocurrent density-effective voltage analyses, transient absorption measurements, and electrical simulations, indicate that the significantly enhanced performance using inverted device is ascribed to the increasing of Jsc compared to the conventional device, which in turn is mainly attributed to the increased absorption of photons in the active layers, rather than the reduced nongeminate recombination.

Enhanced piezoelectric output voltage and Ohmic behavior in Cr-doped ZnO nanorods

International Nuclear Information System (INIS)

Sinha, Nidhi; Ray, Geeta; Godara, Sanjay; Gupta, Manoj K.; Kumar, Binay

2014-01-01

Highlights: • Low cost highly crystalline Cr-doped ZnO nanorods were synthesized. • Enhancement in dielectric, piezoelectric and ferroelectric properties were observed. • A high output voltage was obtained in AFM. • Cr-doping resulted in enhanced conductivity and better Ohmic behavior in ZnO/Ag contact. - Abstract: Highly crystalline Cr-doped ZnO nanorods (NRs) were synthesized by solution technique. The size distribution was analyzed by high resolution tunneling electron microscope (HRTEM) and particle size analyzer. In atomic force microscope (AFM) studies, peak to peak 8 mV output voltage was obtained on the application of constant normal force of 25 nN. It showed high dielectric constant (980) with phase transition at 69 °C. Polarization vs. electric field (P–E) loops with remnant polarization (6.18 μC/cm 2 ) and coercive field (0.96 kV/cm) were obtained. In I–V studies, Cr-doping was found to reduce the rectifying behavior in the Ag/ZnO Schottky contact which is useful for field effect transistor (FET) and solar cell applications. With these excellent properties, Cr-doped ZnO NRs can be used in nanopiezoelectronics, charge storage and ferroelectric applications

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Effect of actuating voltage and discharge gap on plasma assisted detonation initiation process

Science.gov (United States)

Siyin, ZHOU; Xueke, CHE; Wansheng, NIE; Di, WANG

2018-06-01

The influence of actuating voltage and discharge gap on plasma assisted detonation initiation by alternating current dielectric barrier discharge was studied in detail. A loose coupling method was used to simulate the detonation initiation process of a hydrogen–oxygen mixture in a detonation tube under different actuating voltage amplitudes and discharge gap sizes. Both the discharge products and the detonation forming process assisted by the plasma were analyzed. It was found that the patterns of the temporal and spatial distributions of discharge products in one cycle keep unchanged as changing the two discharge operating parameters. However, the adoption of a higher actuating voltage leads to a higher active species concentration within the discharge zone, and atom H is the most sensitive to the variations of the actuating voltage amplitude among the given species. Adopting a larger discharge gap results in a lower concentration of the active species, and all species have the same sensitivity to the variations of the gap. With respect to the reaction flow of the detonation tube, the corresponding deflagration to detonation transition (DDT) time and distance become slightly longer when a higher actuating voltage is chosen. The acceleration effect of plasma is more prominent with a smaller discharge gap, and the benefit builds gradually throughout the DDT process. Generally, these two control parameters have little effect on the amplitude of the flow field parameters, and they do not alter the combustion degree within the reaction zone.

Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

: off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

Energy Technology Data Exchange (ETDEWEB)

Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

2008-10-15

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

Science.gov (United States)

Shirokov, Roman E.

2018-01-01

Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

Directory of Open Access Journals (Sweden)

Kota Kasahara

Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

Phase-wise enhanced voltage support from electric vehicles in a Danish low-voltage distribution grid

DEFF Research Database (Denmark)

Knezovic, Katarina; Marinelli, Mattia

2016-01-01

High deployment of electric vehicles (EVs) imposes great challenges for the distribution grids, especially in unbalanced systems with notable voltage variations which detrimentally affect security of supply. On the other hand, with development of Vehicle-to-Grid technology, EVs may be able...... to provide numerous services for grid support, e.g., voltage control. Implemented electronic equipment will allow them to exchange reactive power for autonomous voltage support without communicating with the distribution system operator or influencing the available active power for primary transportation...

Influence of process parameters on threshold voltage and leakage current in 18nm NMOS device

Science.gov (United States)

Atan, Norani Binti; Ahmad, Ibrahim Bin; Majlis, Burhanuddin Bin Yeop; Fauzi, Izzati Binti Ahmad

2015-04-01

The process parameters are very crucial factor in the development of transistors. There are many process parameters that influenced in the development of the transistors. In this research, we investigate the effects of the process parameters variation on response characteristics such as threshold voltage (VTH) and sub-threshold leakage current (IOFF) in 18nm NMOS device. The technique to identify semiconductor process parameters whose variability would impact most on the device characteristic is realized through the process by using Taguchi robust design method. This paper presents the process parameters that influenced in threshold voltage (VTH) and sub-threshold leakage current (IOFF) which includes the Halo Implantation, Compensation Implantation, Adjustment Threshold voltage Implantation and Source/Drain Implantation. The design, fabrication and characterization of 18nm HfO2/TiSi2 NMOS device is simulated and performed via a tool called Virtual Wafer Fabrication (VWF) Silvaco TCAD Tool known as ATHENA and ATLAS simulators. These two simulators were combined with Taguchi L9 Orthogonal method to aid in the design and the optimization of the process parameters to achieve the optimum average of threshold voltage (VTH) and sub-threshold leakage current, (IOFF) in 18nm device. Results from this research were obtained; where Halo Implantation dose was identified as one of the process parameter that has the strongest effect on the response characteristics. Whereby the Compensation Implantation dose was identified as an adjustment factor to get the nominal values of threshold voltage VTH, and sub-threshold leakage current, IOFF for 18nm NMOS devices equal to 0.302849 volts and 1.9123×10-16 A/μm respectively. The design values are referred to ITRS 2011 prediction.

C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

Science.gov (United States)

Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

2013-09-01

Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

DEFF Research Database (Denmark)

Bennekou, P.; Barksmann, T. L.; Christophersen, P.

2006-01-01

The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

International Nuclear Information System (INIS)

Povzner, A.A.; Volkov, A.G.

2017-01-01

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

Energy Technology Data Exchange (ETDEWEB)

Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru

2017-06-15

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Science.gov (United States)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

IMPROVING BANDWIDTH OF FLIPPED VOLTAGE FOLLOWER USING GATE-BODY DRIVEN TECHNIQUE

Directory of Open Access Journals (Sweden)

VANDANA NIRANJAN

2017-01-01

Full Text Available In this paper, a new approach to enhance the bandwidth of flipped voltage follower is explored. The proposed approach is based on gate-body driven technique. This technique boosts the transconductance in a MOS transistor as both gate and body/bulk terminals are tied together and used as signal input. This novel technique appears as a good solution to merge the advantages of gate-driven and bulk-driven techniques and suppress their disadvantages. The gate-body driven technique utilizes body effect to enable low voltage low power operation and improves the overall performance of flipped voltage follower, providing it with low output impedance, high input impedance and bandwidth extension ratio of 2.614. The most attractive feature is that bandwidth enhancement has been achieved without use of any passive component or extra circuitry. Simulations in PSpice environment for 180 nm CMOS technology verified the predicted theoretical results. The improved flipped voltage follower is particularly interesting for high frequency low noise signal processing applications.

Monitoring of the submerged arc welding process using current and voltage transducers

International Nuclear Information System (INIS)

Barrera, G.; Velez, M.; Espinosa, M.A.; Santos, O.; Barrera, E.; Gomez, G.

1996-01-01

Welding by fusion is one of the most used techniques to join materials in the manufacture industry. given the increase in applications of this welding process and the demand of more quality in the welding deposits, these welding processes are good candidates for the improvement of their instrumentation and control. Any improvement in the control technique will have a positive effect in the quality and productivity of the welding process. Some of the most significant variables in the submerged arc welding process are: current, voltage and torch speed. For the instrumentation of this research work, two transducers were designed, one for CD current monitoring and one for CD voltage monitoring of the welding machine. The design of both transducers includes an isolation amplifier. Graphical programming and the concept of virtual instrumentation were the main tools used for the design of the data acquisition system and the signal processing task. (Author) 9 refs

ENHANCED ELECTROCHEMICAL PROCESSES IN SUBCRITICAL WATER

Energy Technology Data Exchange (ETDEWEB)

Steven B. Hawthorne

2000-07-01

This project involved designing and performing preliminary electrochemical experiments in subcritical water. An electrochemical cell with substantially better performance characteristics than presently available was designed, built, and tested successfully. The electrochemical conductivity of subcritical water increased substantially with temperature, e.g., conductivities increased by a factor of 120 when the temperature was increased from 25 to 250 C. Cyclic voltammograms obtained with platinum and nickel demonstrated that the voltage required to produce hydrogen and oxygen from water can be dropped by a factor of three in subcritical water compared to the voltages required at ambient temperatures. However, no enhancement in the degradation of 1,2-dichlorobenzene and the polychlorinated biphenyl 3,3',4,4'-tetrachlorobiphenyl was observed with applied potential in subcritical water.

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Directory of Open Access Journals (Sweden)

Alicia Lundby

2008-06-01

Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Voltage breakdown on niobium and copper surfaces

International Nuclear Information System (INIS)

Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.

2003-01-01

Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)

Photovoltaic-STATCOM with Low Voltage Ride through Strategy and Power Quality Enhancement in a Grid Integrated Wind-PV System

Directory of Open Access Journals (Sweden)

Lakshman Naik Popavath

2018-04-01

Full Text Available The traditional configurations of power systems are changing due to the greater penetration of renewable energy sources (solar and wind, resulting in reliability issues. At present, the most severe power quality problems in distribution systems are current harmonics, reactive power demands, and the islanding of renewables caused by severe voltage variations (voltage sag and swell. Current harmonics and voltage sag strongly affect the performance of renewable-based power systems. Various conventional methods (passive filters, capacitor bank, and UPS are not able to mitigate harmonics and voltage sag completely. Based on several studies, custom power devices can mitigate harmonics completely and slightly mitigate voltage sags with reactive power supplies. To ensure the generating units remain grid-connected during voltage sags and to improve system operation during abnormal conditions, efficient and reliable utilization of PV solar farm inverter as STATCOMs is needed. This paper elaborates the dynamic performance of a VSC-based PV-STATCOM for power quality enhancement in a grid integrated system and low voltage ride through (LVRT capability. LVRT requirements suggest that the injection of real and reactive power supports grid voltage during abnormal grid conditions. The proposed strategy was demonstrated with MATLAB simulations.

Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

International Nuclear Information System (INIS)

Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

2015-01-01

The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

Low voltage electron beam accelerators

International Nuclear Information System (INIS)

Ochi, Masafumi

2003-01-01

Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

Low voltage electron beam accelerators

Energy Technology Data Exchange (ETDEWEB)

Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

2003-02-01

Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

Voltage Controlled Dynamic Demand Response

DEFF Research Database (Denmark)

Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

Directory of Open Access Journals (Sweden)

Padalko D.A.

2017-12-01

Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

Science.gov (United States)

Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

2013-09-01

We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

Science.gov (United States)

Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

2016-02-01

Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

Voltage-gated lipid ion channels

DEFF Research Database (Denmark)

Blicher, Andreas; Heimburg, Thomas Rainer

2013-01-01

Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

A fuzzy genetic approach for network reconfiguration to enhance voltage stability in radial distribution systems

International Nuclear Information System (INIS)

Sahoo, N.C.; Prasad, K.

2006-01-01

This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration

Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

Science.gov (United States)

Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

2017-09-20

Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

International Nuclear Information System (INIS)

Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

2015-01-01

Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

Enhanced current and voltage regulators for stand-alone applications

DEFF Research Database (Denmark)

Federico, de Bosio; Pastorelli, Michele; Antonio DeSouza Ribeiro, Luiz

2016-01-01

State feedback decoupling permits to achieve a better dynamic response for Voltage Source in stand-alone applications. The design of current and voltage regulators is performed in the discrete-time domain since it provides better accuracy and allows direct pole placement. As the attainable...... bandwidth of the current loop is mainly limited by computational and PWM delays, a lead compensator structure is proposed to overcome this limitation. The design of the voltage regulator is based on the Nyquist criterion, verifying to guarantee a high sensitivity peak. Discrete-time domain implementation...

Optimal condition of memristance enhancement circuit using external voltage source

Directory of Open Access Journals (Sweden)

Hiroya Tanaka

2014-05-01

Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

International Nuclear Information System (INIS)

Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

2013-01-01

Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

Recording membrane potential changes through photoacoustic voltage sensitive dye

Science.gov (United States)

Zhang, Haichong K.; Kang, Jeeun; Yan, Ping; Abou, Diane S.; Le, Hanh N. D.; Thorek, Daniel L. J.; Kang, Jin U.; Gjedde, Albert; Rahmim, Arman; Wong, Dean F.; Loew, Leslie M.; Boctor, Emad M.

2017-03-01

Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. Based on this concept, we synthesized a novel near infrared photoacoustic VSD (PA-VSD) whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. With a 3-9 μM VSD concentration, we measured a PA signal increase in the range of 5.3 % to 18.1 %, and observed a corresponding signal reduction in fluorescence emission of 30.0 % to 48.7 %. A theoretical model successfully accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize the characteristics of improved photoacoustic probes. Together, our results demonstrate photoacoustic sensing as a potential new modality for sub-second recording and external imaging of electrophysiological and neurochemical events in the brain.

Transformer-based asymmetrical embedded Z-source neutral point clamped inverters with continuous input current and enhanced voltage boost capability

DEFF Research Database (Denmark)

Mo, W.; Loh, Poh Chiang; Blaabjerg, Frede

2013-01-01

Z-source Neutral Point Clamped (NPC) inverters were introduced to integrate both the advantages of Z-source inverters and NPC inverters. However, traditional Z-source inverters suffer from high voltage stress and chopping input current. This paper proposes six types transformer-based impedance-so......-source NPC inverters which have enhanced voltage boost capability and continuous input current by utilizing of transformer and embedded dc source configuration. Experimental results are presented to verify the theory validation....

Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

International Nuclear Information System (INIS)

Diserbo, M.; Barbier, M.; Quignard, J.F.

1998-01-01

Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

Pulse-voltage fast generator

International Nuclear Information System (INIS)

Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

1988-01-01

The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

Directory of Open Access Journals (Sweden)

S. Demirezen

Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

Does a voltage-sensitive outer envelope transport mechanism contributes to the chloroplast iron uptake?

Science.gov (United States)

Solti, Ádám; Kovács, Krisztina; Müller, Brigitta; Vázquez, Saúl; Hamar, Éva; Pham, Hong Diep; Tóth, Brigitta; Abadía, Javier; Fodor, Ferenc

2016-12-01

Based on the effects of inorganic salts on chloroplast Fe uptake, the presence of a voltage-dependent step is proposed to play a role in Fe uptake through the outer envelope. Although iron (Fe) plays a crucial role in chloroplast physiology, only few pieces of information are available on the mechanisms of chloroplast Fe acquisition. Here, the effect of inorganic salts on the Fe uptake of intact chloroplasts was tested, assessing Fe and transition metal uptake using bathophenantroline-based spectrophotometric detection and plasma emission-coupled mass spectrometry, respectively. The microenvironment of Fe was studied by Mössbauer spectroscopy. Transition metal cations (Cd 2+ , Zn 2+ , and Mn 2+ ) enhanced, whereas oxoanions (NO 3 - , SO 4 2- , and BO 3 3- ) reduced the chloroplast Fe uptake. The effect was insensitive to diuron (DCMU), an inhibitor of chloroplast inner envelope-associated Fe uptake. The inorganic salts affected neither Fe forms in the uptake assay buffer nor those incorporated into the chloroplasts. The significantly lower Zn and Mn uptake compared to that of Fe indicates that different mechanisms/transporters are involved in their acquisition. The enhancing effect of transition metals on chloroplast Fe uptake is likely related to outer envelope-associated processes, since divalent metal cations are known to inhibit Fe 2+ transport across the inner envelope. Thus, a voltage-dependent step is proposed to play a role in Fe uptake through the chloroplast outer envelope on the basis of the contrasting effects of transition metal cations and oxoaninons.

Enhanced charge efficiency and reduced energy use in capacitive deionization by increasing the discharge voltage.

Science.gov (United States)

Kim, T; Dykstra, J E; Porada, S; van der Wal, A; Yoon, J; Biesheuvel, P M

2015-05-15

Capacitive deionization (CDI) is an electrochemical method for water desalination using porous carbon electrodes. A key parameter in CDI is the charge efficiency, Λ, which is the ratio of salt adsorption over charge in a CDI-cycle. Values for Λ in CDI are typically around 0.5-0.8, significantly less than the theoretical maximum of unity, due to the fact that not only counterions are adsorbed into the pores of the carbon electrodes, but at the same time coions are released. To enhance Λ, ion-exchange membranes (IEMs) can be implemented. With membranes, Λ can be close to unity because the membranes only allow passage for the counterions. Enhancing the value of Λ is advantageous as this implies a lower electrical current and (at a fixed charging voltage) a reduced energy use. We demonstrate how, without the need to include IEMs, the charge efficiency can be increased to values close to the theoretical maximum of unity, by increasing the cell voltage during discharge, with only a small loss of salt adsorption capacity per cycle. In separate constant-current CDI experiments, where after some time the effluent salt concentration reaches a stable value, this value is reached earlier with increased discharge voltage. We compare the experimental results with predictions of porous electrode theory which includes an equilibrium Donnan electrical double layer model for salt adsorption in carbon micropores. Our results highlight the potential of modified operational schemes in CDI to increase charge efficiency and reduce energy use of water desalination. Copyright © 2014 Elsevier Inc. All rights reserved.

A fuzzy genetic approach for network reconfiguration to enhance voltage stability in radial distribution systems

Energy Technology Data Exchange (ETDEWEB)

Sahoo, N.C. [Faculty of Engineering and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia); Prasad, K. [Faculty of Information Science and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia)

2006-11-15

This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration. (author)

Driving Pressure Influence in Voltage Maps Measurement Process Using Advanced Pneumatic Mapping Probe

Directory of Open Access Journals (Sweden)

Marek Kukucka

2016-01-01

Full Text Available Our paper deals with the method of the voltage-impedance map measurement process as a method useful for the electric mapping of human skin. The area of research extends from the basic research to its practical application in acupuncture skin mapping and acupuncture point localization and visualization. The problem of sufficient skin coverage and electrical contact with measuring electrodes is solved by the conventional mechanical telescopic electrodes and by the pneumatic matrix electrode probe. A 2D or 3D voltage-impedance map of skin is an output of the measuring, interpretation and evaluation process. New pneumatic construction of measuring probe was implemented to achieve a better coverage of specified skin area and get a reduced force range of the touching electrodes allowing the steady contact of the skin-electrode. A skin contact is related to the driving pressure of touching electrodes. Our paper offers experimentally measured results, voltage maps of skin on specific areas, selected measured and described acupuncture points and their applications in electro-acupuncture.

Polymer solar cells with enhanced open-circuit voltage and efficiency

Science.gov (United States)

Chen, Hsiang-Yu; Hou, Jianhui; Zhang, Shaoqing; Liang, Yongye; Yang, Guanwen; Yang, Yang; Yu, Luping; Wu, Yue; Li, Gang

2009-11-01

Following the development of the bulk heterojunction structure, recent years have seen a dramatic improvement in the efficiency of polymer solar cells. Maximizing the open-circuit voltage in a low-bandgap polymer is one of the critical factors towards enabling high-efficiency solar cells. Study of the relation between open-circuit voltage and the energy levels of the donor/acceptor in bulk heterojunction polymer solar cells has stimulated interest in modifying the open-circuit voltage by tuning the energy levels of polymers. Here, we show that the open-circuit voltage of polymer solar cells constructed based on the structure of a low-bandgap polymer, PBDTTT, can be tuned, step by step, using different functional groups, to achieve values as high as 0.76 V. This increased open-circuit voltage combined with a high short-circuit current density results in a polymer solar cell with a power conversion efficiency as high as 6.77%, as certified by the National Renewable Energy Laboratory.

Effect of supply voltage and body-biasing on single-event transient pulse quenching in bulk fin field-effect-transistor process

International Nuclear Information System (INIS)

Yu Jun-Ting; Chen Shu-Ming; Chen Jian-Jun; Huang Peng-Cheng; Song Rui-Qiang

2016-01-01

Charge sharing is becoming an important topic as the feature size scales down in fin field-effect-transistor (FinFET) technology. However, the studies of charge sharing induced single-event transient (SET) pulse quenching with bulk FinFET are reported seldomly. Using three-dimensional technology computer aided design (3DTCAD) mixed-mode simulations, the effects of supply voltage and body-biasing on SET pulse quenching are investigated for the first time in bulk FinFET process. Research results indicate that due to an enhanced charge sharing effect, the propagating SET pulse width decreases with reducing supply voltage. Moreover, compared with reverse body-biasing (RBB), the circuit with forward body-biasing (FBB) is vulnerable to charge sharing and can effectively mitigate the propagating SET pulse width up to 53% at least. This can provide guidance for radiation-hardened bulk FinFET technology especially in low power and high performance applications. (paper)

The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

Science.gov (United States)

Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

2010-03-01

Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

Interface Modification of Dye-sensitized Solar Cells with Pivalic Acid to Enhance the Open-circuit Voltage

KAUST Repository

Li, Xin

2009-01-01

Pivalic acid (PVA) was used as a new coadsorbent to dye-sensitized solar cells (DSCs) to modify the interface between the TiO2 films and electrolyte. The addition of PVA improved the light-to-electricity conversion efficiency of devices by 8% by enhancing the open-circuit voltage. Copyright © 2009 The Chemical Society of Japan.

Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

Science.gov (United States)

Petit, C.; Zander, D.

2007-10-01

It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

Comprehensive Reactive Power Support of DFIG Adapted to Different Depth of Voltage Sags

Directory of Open Access Journals (Sweden)

Yangwu Shen

2017-06-01

Full Text Available The low voltage ride-through (LVRT capability of the doubly-fed induction generator (DFIG significantly impacts upon the integration of wind power into the power grid. This paper develops a novel comprehensive control strategy to enhance the LVRT and reactive power support capacities of the DFIG by installing the energy storage system (ESS. The ESS is connected to the DC-link capacitor of the DFIG and used to regulate the DC-link voltage during normal or fault operations. The unbalanced power between the captured wind power and the power injected to the grid during the transient process is absorbed or compensated by the ESS. The rotor-side converter (RSC is used to control the maximum power production and the grid-side converter (GSC is used to control the reactive power before participating in the voltage support. When the supply voltage continues to drop, the rotor speed is increased by controlling the RSC to realize the LVRT capability and help the GSC further enhance the reactive power support capability. The capacity of the GSC is dedicated to injecting the reactive power to the grid. An auxiliary transient pitch angle controller is proposed to protect the generator’s over speed. Both RSC and GSC act as reactive power sources to further enhance the voltage support capability with serious voltage sags. Simulations based on a single-machine infinite-bus power system verify the effectiveness of the developed comprehensive control strategy.

Proportional-Resonant Control of Doubly-Fed Induction Generator Wind Turbines for Low-Voltage Ride-Through Enhancement

Directory of Open Access Journals (Sweden)

Zhan-Feng Song

2012-11-01

Full Text Available A novel control strategy is proposed in this paper for the rotor side converter (RSC of doubly-fed induction generator (DFIG-based wind power generation systems. It is supposed to enhance the low-voltage ride-through (LVRT capability of DFIGs during great-level grid voltage dips. The strategy consists of a proportional-resonant (PR controller and auxiliary PR controllers. The auxiliary controllers compensate the output voltage of the RSC in case of grid faults, thus limiting the rotor inrush current of DFIG and meeting the requirements of LVRT. Sequential-component decompositions of current are not required in the control system to improve the response of system. Since the resonant compensator is a double-side integrator, the auxiliary controllers can be simplified through coordinate transformation. The feasibility of the control strategy is validated by simulation on a 1.5 MW wind-turbine driven DFIG system. The impact of the RSC converter voltage rating on the LVRT capability of DFIG is investigated. Meanwhile, the influence of angular frequency detection and control parameters are also discussed. Compared with traditional vector control schemes based on PI current controllers, the presented control strategy effectively suppress rotor current and reduce oscillations of DFIG power and torque under grid faults.

Algorithm оf Computer Model Realization оf High-Frequency Processes in Switchgears Containing Non-Linear Over-Voltage Limiters

Directory of Open Access Journals (Sweden)

Ye. V. Dmitriev

2007-01-01

Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.

Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

Science.gov (United States)

Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

2012-01-01

The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

Science.gov (United States)

Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

2013-01-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

Directory of Open Access Journals (Sweden)

RAMÓN LATORRE

2006-01-01

Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

Solution-processed p-type copper(I) thiocyanate (CuSCN) for low-voltage flexible thin-film transistors and integrated inverter circuits

KAUST Repository

Petti, Luisa; Pattanasattayavong, Pichaya; Lin, Yen-Hung; Mü nzenrieder, Niko; Cantarella, Giuseppe; Yaacobi-Gross, Nir; Yan, Feng; Trö ster, Gerhard; Anthopoulos, Thomas D.

2017-01-01

, depending on the gate dielectric employed. The promising TFT characteristics enable fabrication of unipolar NOT gates on flexible free-standing plastic substrates with voltage gain of 3.4 at voltages as low as −3.5 V. Importantly, discrete CuSCN transistors

Mechanism of voltage-gated channel formation in lipid membranes.

Science.gov (United States)

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

Enhanced voltage-controlled magnetic anisotropy in magnetic tunnel junctions with an MgO/PZT/MgO tunnel barrier

Science.gov (United States)

Chien, Diana; Li, Xiang; Wong, Kin; Zurbuchen, Mark A.; Robbennolt, Shauna; Yu, Guoqiang; Tolbert, Sarah; Kioussis, Nicholas; Khalili Amiri, Pedram; Wang, Kang L.; Chang, Jane P.

2016-03-01

Compared with current-controlled magnetization switching in a perpendicular magnetic tunnel junction (MTJ), electric field- or voltage-induced magnetization switching reduces the writing energy of the memory cell, which also results in increased memory density. In this work, an ultra-thin PZT film with high dielectric constant was integrated into the tunneling oxide layer to enhance the voltage-controlled magnetic anisotropy (VCMA) effect. The growth of MTJ stacks with an MgO/PZT/MgO tunnel barrier was performed using a combination of sputtering and atomic layer deposition techniques. The fabricated MTJs with the MgO/PZT/MgO barrier demonstrate a VCMA coefficient, which is ˜40% higher (19.8 ± 1.3 fJ/V m) than the control sample MTJs with an MgO barrier (14.3 ± 2.7 fJ/V m). The MTJs with the MgO/PZT/MgO barrier also possess a sizeable tunneling magnetoresistance (TMR) of more than 50% at room temperature, comparable to the control MTJs with an MgO barrier. The TMR and enhanced VCMA effect demonstrated simultaneously in this work make the MgO/PZT/MgO barrier-based MTJs potential candidates for future voltage-controlled, ultralow-power, and high-density magnetic random access memory devices.

Genetic algorithm based reactive power dispatch for voltage stability improvement

Energy Technology Data Exchange (ETDEWEB)

Devaraj, D. [Department of Electrical and Electronics, Kalasalingam University, Krishnankoil 626 190 (India); Roselyn, J. Preetha [Department of Electrical and Electronics, SRM University, Kattankulathur 603 203, Chennai (India)

2010-12-15

Voltage stability assessment and control form the core function in a modern energy control centre. This paper presents an improved Genetic algorithm (GA) approach for voltage stability enhancement. The proposed technique is based on the minimization of the maximum of L-indices of load buses. Generator voltages, switchable VAR sources and transformer tap changers are used as optimization variables of this problem. The proposed approach permits the optimization variables to be represented in their natural form in the genetic population. For effective genetic processing, the crossover and mutation operators which can directly deal with the floating point numbers and integers are used. The proposed algorithm has been tested on IEEE 30-bus and IEEE 57-bus test systems and successful results have been obtained. (author)

Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

DEFF Research Database (Denmark)

Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

2003-01-01

The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

Enhanced Local Grid Voltage Support Method for High Penetration of Distributed Generators

DEFF Research Database (Denmark)

Demirok, Erhan; Sera, Dezso; Rodriguez, Pedro

2011-01-01

Grid voltage rise and thermal loading of network components are the most remarkable barriers to allow high number of distributed generator (DG) connections on the medium voltage (MV) and low voltage (LV) electricity networks. The other barriers such as grid power quality (harmonics, voltage...

Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

Science.gov (United States)

Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

2017-11-01

Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

Pharmacology of the Nav1.1 domain IV voltage sensor reveals coupling between inactivation gating processes.

Science.gov (United States)

Osteen, Jeremiah D; Sampson, Kevin; Iyer, Vivek; Julius, David; Bosmans, Frank

2017-06-27

The Na v 1.1 voltage-gated sodium channel is a critical contributor to excitability in the brain, where pathological loss of function leads to such disorders as epilepsy, Alzheimer's disease, and autism. This voltage-gated sodium (Na v ) channel subtype also plays an important role in mechanical pain signaling by primary afferent somatosensory neurons. Therefore, pharmacologic modulation of Na v 1.1 represents a potential strategy for treating excitability disorders of the brain and periphery. Inactivation is a complex aspect of Na v channel gating and consists of fast and slow components, each of which may involve a contribution from one or more voltage-sensing domains. Here, we exploit the Hm1a spider toxin, a Na v 1.1-selective modulator, to better understand the relationship between these temporally distinct modes of inactivation and ask whether they can be distinguished pharmacologically. We show that Hm1a inhibits the gating movement of the domain IV voltage sensor (VSDIV), hindering both fast and slow inactivation and leading to an increase in Na v 1.1 availability during high-frequency stimulation. In contrast, ICA-121431, a small-molecule Na v 1.1 inhibitor, accelerates a subsequent VSDIV gating transition to accelerate entry into the slow inactivated state, resulting in use-dependent block. Further evidence for functional coupling between fast and slow inactivation is provided by a Na v 1.1 mutant in which fast inactivation removal has complex effects on slow inactivation. Taken together, our data substantiate the key role of VSDIV in Na v channel fast and slow inactivation and demonstrate that these gating processes are sequential and coupled through VSDIV. These findings provide insight into a pharmacophore on VSDIV through which modulation of inactivation gating can inhibit or facilitate Na v 1.1 function.

Survey of high-voltage pulse technology suitable for large-scale plasma source ion implantation processes

International Nuclear Information System (INIS)

Reass, W.A.

1994-01-01

Many new plasma processes ideas are finding their way from the research lab to the manufacturing plant floor. These require high voltage (HV) pulse power equipment, which must be optimized for application, system efficiency, and reliability. Although no single HV pulse technology is suitable for all plasma processes, various classes of high voltage pulsers may offer a greater versatility and economy to the manufacturer. Technology developed for existing radar and particle accelerator modulator power systems can be utilized to develop a modern large scale plasma source ion implantation (PSII) system. The HV pulse networks can be broadly defined by two classes of systems, those that generate the voltage directly, and those that use some type of pulse forming network and step-up transformer. This article will examine these HV pulse technologies and discuss their applicability to the specific PSII process. Typical systems that will be reviewed will include high power solid state, hard tube systems such as crossed-field ''hollow beam'' switch tubes and planar tetrodes, and ''soft'' tube systems with crossatrons and thyratrons. Results will be tabulated and suggestions provided for a particular PSII process

Simulations of momentum transfer process between solar wind plasma and bias voltage tethers of electric sail thruster

Science.gov (United States)

Xia, Guangqing; Han, Yajie; Chen, Liuwei; Wei, Yanming; Yu, Yang; Chen, Maolin

2018-06-01

The interaction between the solar wind plasma and the bias voltage of long tethers is the basic mechanism of the electric sail thruster. The momentum transfer process between the solar wind plasma and electric tethers was investigated using a 2D full particle PIC method. The coupled electric field distribution and deflected ion trajectory under different bias voltages were compared, and the influence of bias voltage on momentum transfer process was analyzed. The results show that the high potential of the bias voltage of long tethers will slow down, stagnate, reflect and deflect a large number of ions, so that ion cavities are formed in the vicinity of the tether, and the ions will transmit the axial momentum to the sail tethers to produce the thrust. Compared to the singe tether, double tethers show a better thrust performance.

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

Science.gov (United States)

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.

Science.gov (United States)

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo

2012-10-16

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.

Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP

Science.gov (United States)

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo

2013-01-01

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304

Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

International Nuclear Information System (INIS)

Frick, G.; Osswald, F.; Heusch, B.

1996-01-01

Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

Voltage-assisted polymer wafer bonding

International Nuclear Information System (INIS)

Varsanik, J S; Bernstein, J J

2012-01-01

Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

Building mechanism for a high open-circuit voltage in an all-solution-processed tandem polymer solar cell.

Science.gov (United States)

Kong, Jaemin; Lee, Jongjin; Kim, Geunjin; Kang, Hongkyu; Choi, Youna; Lee, Kwanghee

2012-08-14

Additional post-processing techniques, such as post-thermal annealing and UV illumination, were found to be required to obtain desirable values of the cell parameters in a tandem polymer solar cell incorporated with solution-processed basic n-type titanium sub-oxide (TiO(x))/acidic p-type poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) interlayers. Subsequent to the fabrication of the tandem polymer solar cells, the open-circuit voltage (V(OC)) of the cells exhibited half of the expected value. Only after the application of the post-treatments, the V(OC) of a tandem cell increased from the initial half-cell value (∼0.6 V) to its full-cell value (∼1.2 V). The selective light-biased incident photon-to-current efficiency (IPCE) measurements indicated that the initial V(OC) originated from the back subcell and that the application of the post-processing treatments revived the front subcell, such that the net photocurrent of the tandem cell was finally governed by a recombination process of holes from the back subcell and electrons from the front subcell. Based on our experimental results, we suggest that a V(OC) enhancement could be ascribed to two types of subsequent junction formations at the interface between the TiO(x) and PEDOT:PSS interlayers: an 'ion-mediated dipole junction', resulting from the electro-kinetic migration of cationic ions in the interlayers during post-thermal annealing in the presence of a low-work-function metal cathode, and a 'photoinduced Schottky junction', formed by increasing the charge carrier density in the n-type TiO(x) interlayer during UV illumination process. The two junctions separately contributed to the formation of a recombination junction through which the electrons in TiO(x) and the holes in PEDOT:PSS were able to recombine without substantial voltage drops.

Charge-pump voltage converter

Science.gov (United States)

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

Irreversible electroporation ablation area enhanced by synergistic high- and low-voltage pulses.

Directory of Open Access Journals (Sweden)

Chenguo Yao

Full Text Available Irreversible electroporation (IRE produced by a pulsed electric field can ablate tissue. In this study, we achieved an enhancement in ablation area by using a combination of short high-voltage pulses (HVPs to create a large electroporated area and long low-voltage pulses (LVPs to ablate the electroporated area. The experiments were conducted in potato tuber slices. Slices were ablated with an array of four pairs of parallel steel electrodes using one of the following four electric pulse protocols: HVP, LVP, synergistic HVP+LVP (SHLVP or LVP+HVP. Our results showed that the SHLVPs more effectively necrotized tissue than either the HVPs or LVPs, even when the SHLVP dose was the same as or lower than the HVP or LVP doses. The HVP and LVP order mattered and only HVPs+LVPs (SHLVPs treatments increased the size of the ablation zone because the HVPs created a large electroporated area that was more susceptible to the subsequent LVPs. Real-time temperature change monitoring confirmed that the tissue was non-thermally ablated by the electric pulses. Theoretical calculations of the synergistic effects of the SHLVPs on tissue ablation were performed. Our proposed SHLVP protocol provides options for tissue ablation and may be applied to optimize the current clinical IRE protocols.

Irreversible electroporation ablation area enhanced by synergistic high- and low-voltage pulses.

Science.gov (United States)

Yao, Chenguo; Lv, Yanpeng; Dong, Shoulong; Zhao, Yajun; Liu, Hongmei

2017-01-01

Irreversible electroporation (IRE) produced by a pulsed electric field can ablate tissue. In this study, we achieved an enhancement in ablation area by using a combination of short high-voltage pulses (HVPs) to create a large electroporated area and long low-voltage pulses (LVPs) to ablate the electroporated area. The experiments were conducted in potato tuber slices. Slices were ablated with an array of four pairs of parallel steel electrodes using one of the following four electric pulse protocols: HVP, LVP, synergistic HVP+LVP (SHLVP) or LVP+HVP. Our results showed that the SHLVPs more effectively necrotized tissue than either the HVPs or LVPs, even when the SHLVP dose was the same as or lower than the HVP or LVP doses. The HVP and LVP order mattered and only HVPs+LVPs (SHLVPs) treatments increased the size of the ablation zone because the HVPs created a large electroporated area that was more susceptible to the subsequent LVPs. Real-time temperature change monitoring confirmed that the tissue was non-thermally ablated by the electric pulses. Theoretical calculations of the synergistic effects of the SHLVPs on tissue ablation were performed. Our proposed SHLVP protocol provides options for tissue ablation and may be applied to optimize the current clinical IRE protocols.

Voltage stability in low voltage microgrids in aspects of active and reactive power demand

Directory of Open Access Journals (Sweden)

Parol Mirosław

2016-03-01

Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

International Nuclear Information System (INIS)

Pe, T.; McDonald, J.; Clem, J.R.

1995-01-01

The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

Directory of Open Access Journals (Sweden)

Samuel eGoodchild

2012-06-01

Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

2006-01-01

Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

Axonal voltage-gated ion channels as pharmacological targets for pain

DEFF Research Database (Denmark)

Moldovan, Mihai; Alvarez, Susana; Romer Rosberg, Mette

2013-01-01

Upon peripheral nerve injury (caused by trauma or disease process) axons of the dorsal root ganglion (DRG) somatosensory neurons have the ability to sprout and regrow/remyelinate to reinnervate distant target tissue or form a tangled scar mass called a neuroma. This regenerative response can become...... maladaptive leading to a persistent and debilitating pain state referred to as chronic pain corresponding to the clinical description of neuropathic/chronic inflammatory pain. There is little agreement to what causes peripheral chronic pain other than hyperactivity of the nociceptive DRG neurons which...... ultimately depends on the function of voltage-gated ion channels. This review focuses on the pharmacological modulators of voltage-gated ion channels known to be present on axonal membrane which represents by far the largest surface of DRG neurons. Blockers of voltage-gated Na(+) channels, openers of voltage...

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

Science.gov (United States)

Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

2016-03-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

International Nuclear Information System (INIS)

Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

2016-01-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

Influence of voltage input to heavy metal removal from electroplating wastewater using electrocoagulation process

Science.gov (United States)

Wulan, D. R.; Cahyaningsih, S.; Djaenudin

2017-03-01

In medium capacity, electroplating industry usually treats wastewater until 5 m3 per day. Heavy metal content becomes concern that should be reduced. Previous studies performed electrocoagulation method on laboratory scale, either batch or continuous. This study was aimed to compare the influence of voltage input variation into heavy metal removal in electroplating wastewater treatment using electrocoagulation process on laboratory-scale in order to determine the optimum condition for scaling up the reactor into pilot-scale. The laboratory study was performed in 1.5 L glass reactor in batch system using wastewater from electroplating industry, the voltage input varied at 20, 30 and 40 volt. The electrode consisted of aluminium 32 cm2 as sacrifice anode and copper 32 cm2 as cathode. During 120 min electrocoagulation process, the pH value was measured using pH meter, whereas the heavy metal of chromium, copper, iron, and zinc concentration were analysed using Atomic Absorption Spectrophotometer (AAS). Result showed that removal of heavy metals from wastewater increased due to the increasing of voltage input. Different initial concentration of heavy metals on wastewater, resulted the different detention time. At pilot-scale reactor with 30 V voltage input, chromium, iron, and zinc reached removal efficiency until 89-98%, when copper reached 79% efficiency. At 40V, removal efficiencies increased on same detention time, i.e. chromium, iron, and zinc reached 89-99%, whereas copper reached 85%. These removal efficiencies have complied the government standard except for copper that had higher initial concentration in wastewater. Kinetic rate also calculated in this study as the basic factor for scaling up the process.

Bias voltage effect on electron tunneling across a junction with a ferroelectric–ferromagnetic two-phase composite barrier

International Nuclear Information System (INIS)

Wang Jian; Ju Sheng; Li, Z.Y.

2012-01-01

The effect of bias voltage on electron tunneling across a junction with a ferroelectric–ferromagnetic composite barrier is investigated theoretically. Because of the inversion symmetry breaking of the spontaneous ferroelectric polarization, bias voltage dependence of the electron tunneling shows significant differences between the positive bias and the negative one. The differences of spin filtering or tunnel magnetoresistance increase with the increasing absolute value of bias voltage. Such direction preferred electron tunneling is found intimately related with the unusual asymmetry of the electrical potential profile in two-phase composite barrier and provides a unique change to realize rectifying functions in spintronics. - Highlights: ► Electron tunneling across a ferroelectric–ferromagnetic composite barrier junction. ► TMR effect is different under the same value but opposite direction bias voltage. ► This directionality of the electron tunneling enhances with increasing bias voltage.

Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

Directory of Open Access Journals (Sweden)

Galyna Maleeva

2017-05-01

Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

International Nuclear Information System (INIS)

Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

1993-01-01

The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

2017-01-01

Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

International Nuclear Information System (INIS)

Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

2010-01-01

Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

Science.gov (United States)

Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

2006-03-01

We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

Grafting voltage and pharmacological sensitivity in potassium channels.

Science.gov (United States)

Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

2016-08-01

A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

Identification of an HV 1 voltage-gated proton channel in insects.

Science.gov (United States)

Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

2016-04-01

The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

Science.gov (United States)

Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

2014-04-01

Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

"Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

Directory of Open Access Journals (Sweden)

Lei Zhu

Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

Science.gov (United States)

Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

2017-05-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

Current-voltage characteristics of porous-silicon structures

International Nuclear Information System (INIS)

Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

1996-01-01

I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca²⁺ channels

DEFF Research Database (Denmark)

Garau, Gianpiero; Magotti, Paola; Heine, Martin

2015-01-01

Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

Pheromones enhance somatosensory processing in newt brains through a vasotocin-dependent mechanism.

Science.gov (United States)

Thompson, R R; Dickinson, P S; Rose, J D; Dakin, K A; Civiello, G M; Segerdahl, A; Bartlett, R

2008-07-22

We tested whether the sex pheromones that stimulate courtship clasping in male roughskin newts do so, at least in part, by amplifying the somatosensory signals that directly trigger the motor pattern associated with clasping and, if so, whether that amplification is dependent on endogenous vasotocin (VT). Female olfactory stimuli increased the number of action potentials recorded in the medulla of males in response to tactile stimulation of the cloaca, which triggers the clasp motor reflex, as well as to tactile stimulation of the snout and hindlimb. That enhancement was blocked by exposing the medulla to a V1a receptor antagonist before pheromone exposure. However, the antagonist did not affect medullary responses to tactile stimuli in the absence of pheromone exposure, suggesting that pheromones amplify somatosensory signals by inducing endogenous VT release. The ability of VT to couple sensory systems together in response to social stimulation could allow this peptide to induce variable behavioural outcomes, depending on the immediate context of the social interaction and thus on the nature of the associated stimuli that are amplified. If widespread in vertebrates, this mechanism could account for some of the behavioural variability associated with this and related peptides both within and across species.

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

Science.gov (United States)

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

Science.gov (United States)

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

Science.gov (United States)

Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

2018-05-07

Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

Temperature and Voltage Coupling to Channel Opening in Transient Receptor Potential Melastatin 8 (TRPM8)*♦

Science.gov (United States)

Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon

2014-01-01

Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597

Voltage Effect in Holograms of Polyvinyl Alcohol with FeCl3

Directory of Open Access Journals (Sweden)

Arturo Olivares-Pérez

2014-03-01

Full Text Available We show experimentally that the metallic salt, FeCl3, at different concentrations, provides photosensitivity and conductivity characteristics with poly(vinyl alcohol material. The holographic recording in this photosensitive material was made in real time. The effect of applied voltage on holographic diffraction gratings in the recording process and the changes in their diffraction efficiency, depending on their composition, are shown. In addition, we describe the photo-mechanism, physicochemical processes, and water condensations involved in changes of the formation of images due to applied voltage. The results suggest that polymers doped with metallic salts may have potential as inexpensive photosensitive materials that are easy to work under normal laboratory condition.

Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

Energy Technology Data Exchange (ETDEWEB)

Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

2015-01-15

In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

Voltage Optimisation Technology for an Australian Abattoir—A Techno-Economic Evaluation

Directory of Open Access Journals (Sweden)

GM Shafiullah

2017-11-01

Full Text Available Optimising voltage levels to a controlled stable level at a facility can not only reduce the cost of energy but also enhance equipment performance, prolong equipment life, reduce maintenance costs and reduce greenhouse gas emissions. Voltage optimisation (VO technology has been widely used in a number of different industries locally and internationally, but not to a large extent within the red meat processing sector in Australia. To determine whether VO technology can be implemented, and whether it is technically and economically viable for red meat processing sites, this study investigated, through case study analyses, the potential effectiveness of VO technology in Australian abattoirs. Through an extensive literature survey, the study initially explored the need and considerations of deploying VO technologies at a typical red meat processing plant. To determine the advantages of using VO technology the study then performed site analyses to investigate power quality (PQ issues, such as voltage regulation, harmonics and power factor, at two typical medium-sized abattoirs, one in Western Australia and another in Queensland. Finally, an economic assessment of the use of VO in the red meat processing industry was undertaken to identify the potential electricity savings and payback periods. From the case study analyses, it is evident that power quality issues, such as under voltage, overvoltage, and harmonic distortion, can be reduced and significant energy savings can be achieved with the optimum selection of VO technology and voltage level. The outcomes of this study will enable engineering and operations staff to be better informed about the economic and technical benefits of (and possible issues with using VO technologies in an abattoir.

Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

Science.gov (United States)

Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

2011-11-30

We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

Enhanced intrinsic voltage gain in artificially stacked bilayer CVD graphene field effect transistors

Energy Technology Data Exchange (ETDEWEB)

Pandey, Himadri; Kataria, Satender [RWTH Aachen University, Chair for Electronic Devices, Aachen (Germany); University of Siegen, School of Science and Technology, Siegen (Germany); Aguirre-Morales, Jorge-Daniel; Fregonese, Sebastien; Zimmer, Thomas [IMS Laboratory, Centre National de la Recherche Scientifique, University of Bordeaux, Talence (France); Passi, Vikram [University of Siegen, School of Science and Technology, Siegen (Germany); AMO GmbH, Advanced Microelectronics Center Aachen (Germany); Iannazzo, Mario; Alarcon, Eduard [Technical University of Catalonia, Department of Electronics Engineering, UPC, Barcelona (Spain); Lemme, Max C. [RWTH Aachen University, Chair for Electronic Devices, Aachen (Germany); University of Siegen, School of Science and Technology, Siegen (Germany); AMO GmbH, Advanced Microelectronics Center Aachen (Germany)

2017-11-15

We report on electronic transport in dual-gate, artificially stacked bilayer graphene field effect transistors (BiGFETs) fabricated from large-area chemical vapor deposited (CVD) graphene. The devices show enhanced tendency to current saturation, which leads to reduced minimum output conductance values. This results in improved intrinsic voltage gain of the devices when compared to monolayer graphene FETs. We employ a physics based compact model originally developed for Bernal stacked bilayer graphene FETs (BSBGFETs) to explore the observed phenomenon. The improvement in current saturation may be attributed to increased charge carrier density in the channel and thus reduced saturation velocity due to carrier-carrier scattering. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

Science.gov (United States)

Experton, Juliette; Martin, Charles R

2018-05-01

Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High voltage generator circuit with low power and high efficiency applied in EEPROM

International Nuclear Information System (INIS)

Liu Yan; Zhang Shilin; Zhao Yiqiang

2012-01-01

This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

DESIGN OF DYNAMIC VOLTAGE RESTORER TO ENHANCE POWER QUALITY RELYING ON RENEWABLE SOURCE

Directory of Open Access Journals (Sweden)

Haider M. Umran

2018-05-01

Full Text Available Power quality improvement of low voltage grid is a great challenge that confronts the sophisticated power applications, because their performance is highly sensitive to the quality of power supply. Dynamic Voltage Restorer (DVR used widely as an efficient and skillful device to adjust electrical disturbances of the distribution grids. This paper introduces an overview of the components of the 3-phase dynamic voltage restorer and design its own control circuit. The performance of DVR was developed on the basis of the appropriate selection of Photovoltaic (PV module instead of the present conventional designs. Through this design, the need of series converter (DVR for the current from an electrical grid will end and the problems of power losses will curb. The PV-module is selected to meet the requirements of the DVR during voltage sag/swell on voltage line. The proposed system is mimicked in MATLAB software/Simulink and the findings are presented to prove the success of the design in terms of: Full congruence of the load voltage waveform with source voltage waveform, attaining 0.77% of THD analysis for the load voltage and the waveforms of PV system.

The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

OpenAIRE

ПАНЧЕНКО, В В

2015-01-01

The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

Science.gov (United States)

Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

2013-11-01

As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

International Nuclear Information System (INIS)

Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

2010-01-01

The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

Science.gov (United States)

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-11-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

Directory of Open Access Journals (Sweden)

Jader Santos Cruz

2012-10-01

Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

Conversion Coatings Produced on AZ61 Magnesium Alloy by Low-Voltage Process

Directory of Open Access Journals (Sweden)

Nowak M.

2016-03-01

Full Text Available The resultes of anodic oxide conversion coatings on wrought AZ61 magnesium alloy production are describe. The studies were conducted in a solution containing: KOH (80 g/l and KF (300 g/l using anodic current densities of 3, 5 and 10 A/dm2 and different process durations. The obtained coatings were examined under a microscope and corrosion tests were performed by electrochemical method. Based on these results, it was found that the low-voltage process produces coatings conferring improved corrosion resistance to the tested magnesium alloy.

Voltage Unbalance Compensation with Smart Three-phase Loads

DEFF Research Database (Denmark)

Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

2016-01-01

unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

Science.gov (United States)

Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

2018-05-01

Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

Directory of Open Access Journals (Sweden)

M. R. Aghamohammadi

2011-06-01

Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

International Nuclear Information System (INIS)

Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

1986-01-01

Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

International Nuclear Information System (INIS)

Sen, A.K.; Bhattacharya, S.

2006-12-01

In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

Silicone elastomers with covalently incorporated aromatic voltage stabilisers

DEFF Research Database (Denmark)

A Razak, Aliff Hisyam; Skov, Anne Ladegaard

2017-01-01

to the incorporationof an aromatic voltage stabiliser, were prepared by cross-linking synthesised polydimethylsiloxane–polyphenylmethylsiloxane (PDMS–PPMS) copolymers. PPMS possesses voltage stabilisation capabilitiesbut is immiscible in PDMS, and thus the copolymerisation of the two components was necessary...... forhomogeneity. Concentrations of the voltage stabiliser were varied by changing the molecular weights ofthe PPMS in the copolymer. The developed elastomers were inherently soft with enhanced electricalbreakdown strengths, due to delocalisedp-electrons of the aromatic constituent. An optimumconcentration...

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

Directory of Open Access Journals (Sweden)

Yukiko eMishina

2014-09-01

Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

Science.gov (United States)

Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

2014-01-01

Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Radiation effects on the current-voltage and capacitance-voltage characteristics of advanced p-n junction diodes surrounded by shallow trench isolation

International Nuclear Information System (INIS)

Poyai, A.; Simoen, E.; Claeys, C.; Hayama, K.; Kobayashi, K.; Ohyama, H.

2002-01-01

This paper investigates the impact of 20 MeV proton irradiation on the current-voltage (I-V) and capacitance-voltage (C-V) characteristics of different geometry n + -p-well junction diodes surrounded by shallow trench isolation and processed in a 0.18 μm CMOS technology. From I-V characteristics, a higher current damage coefficient was found for the bulk than for the peripheral component. The radiation-induced boron de-activation resulted in a lowering of the p-well doping, which has been derived from high-frequency C-V measurements. This was confirmed by deep level transient spectroscopy (DLTS) analysis, revealing the presence of interstitial boron related radiation defects. As will be demonstrated for the bulk leakage-current damage coefficient, the electric field enhanced generation rate of charge carriers and the radiation-induced boron de-activation should be accounted for properly

ERG voltage-gated K+ channels regulate excitability and discharge dynamics of the medial vestibular nucleus neurones.

Science.gov (United States)

Pessia, Mauro; Servettini, Ilenio; Panichi, Roberto; Guasti, Leonardo; Grassi, Silvarosa; Arcangeli, Annarosa; Wanke, Enzo; Pettorossi, Vito Enrico

2008-10-15

The discharge properties of the medial vestibular nucleus neurones (MVNn) critically depend on the activity of several ion channel types. In this study we show, immunohistochemically, that the voltage-gated K(+) channels ERG1A, ERG1B, ERG2 and ERG3 are highly expressed within the vestibular nuclei of P10 and P60 mice. The role played by these channels in the spike-generating mechanisms of the MVNn and in temporal information processing was investigated electrophysiologically from mouse brain slices, in vitro, by analysing the spontaneous discharge and the response to square-, ramp- and sinusoid-like intracellular DC current injections in extracellular and whole-cell patch-clamp studies. We show that more than half of the recorded MVNn were responsive to ERG channel block (WAY-123,398, E4031), displaying an increase in spontaneous activity and discharge irregularity. The response to step and ramp current injection was also modified by ERG block showing a reduction of first spike latency, enhancement of discharge rate and reduction of the slow spike-frequency adaptation process. ERG channels influence the interspike slope without affecting the spike shape. Moreover, in response to sinusoid-like current, ERG channel block caused frequency-dependent gain enhancement and phase-lead shift. Taken together, the data demonstrate that ERG channels control the excitability of MVNn, their discharge regularity and probably their resonance properties.

Guanfacine enhances inhibitory control and attentional shifting in early abstinent cocaine-dependent individuals.

Science.gov (United States)

Fox, Helen; Sofuoglu, Mehmet; Sinha, Rajita

2015-03-01

Attenuation of adrenergic drive and cognitive enhancement, via stimulation of alpha2 pre- and post-synaptic receptors, may selectively enhance executive performance in early abstinent cocaine-dependent individuals. As these cognitive processes underpin important treatment-related behaviors, the alpha2 agonist, guanfacine HCl, may represent an effective pharmaco-therapeutic intervention. Twenty-five early abstinent cocaine-dependent individuals were administered a battery of neurocognitive tasks on entry into treatment (baseline) and again following 3 weeks of either placebo or guanfacine treatment (up to 3 mg). Tasks included: Stop Signal, Stroop, 3-Dimentional Intra-dimensional/Extra-dimensional (IDED) task, Spatial Working Memory (SWM), Paired Associates Learning (PAL), Verbal Fluency and the Rey Auditory Verbal Learning Test (RAVLT). Compared with placebo, the guanfacine group demonstrated attenuated anxiety and negative affect as well as improved performance on selective executive tests. This included fewer directional errors on the stop signal task, fewer errors on the extra-dimensional shift component of the IDED task and better attentional switching during verbal fluency. Guanfacine did not improve strategic working memory or peripheral memory. Guanfacine improves selective cognitive processes which may underlie salient treatment-related regulatory behaviors. Alpha2 agonists may therefore represent important agents for cocaine dependence. © The Author(s) 2015.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

Science.gov (United States)

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

A new SOI high-voltage device with a step-thickness drift region and its analytical model for the electric field and breakdown voltage

International Nuclear Information System (INIS)

Luo Xiaorong; Zhang Wei; Zhang Bo; Li Zhaoji; Yang Shouguo; Zhan Zhan; Fu Daping

2008-01-01

A new SOI high-voltage device with a step-thickness drift region (ST SOI) and its analytical model for the two-dimension electric field distribution and the breakdown voltage are proposed. The electric field in the drift region is modulated and that of the buried layer is enhanced by the variable thickness SOI layer, thereby resulting in the enhancement of the breakdown voltage. Based on the Poisson equation, the expression for the two-dimension electric field distribution is presented taking the modulation effect into account, from which the RESURF (REduced SURface Field) condition and the approximate but explicit expression for the maximal breakdown voltage are derived. The analytical model can explain the effects of the device parameters, such as the step height and the step length of the SOI layer, the doping concentration and the buried oxide thickness, on the electric field distribution and the breakdown voltage. The validity of this model is demonstrated by a comparison with numerical simulations. Improvement on both the breakdown voltage and the on-resistance (R on ) for the ST SOI is obtained due to the variable thickness SOI layer

CMOS image sensor with contour enhancement

Science.gov (United States)

Meng, Liya; Lai, Xiaofeng; Chen, Kun; Yuan, Xianghui

2010-10-01

Imitating the signal acquisition and processing of vertebrate retina, a CMOS image sensor with bionic pre-processing circuit is designed. Integration of signal-process circuit on-chip can reduce the requirement of bandwidth and precision of the subsequent interface circuit, and simplify the design of the computer-vision system. This signal pre-processing circuit consists of adaptive photoreceptor, spatial filtering resistive network and Op-Amp calculation circuit. The adaptive photoreceptor unit with a dynamic range of approximately 100 dB has a good self-adaptability for the transient changes in light intensity instead of intensity level itself. Spatial low-pass filtering resistive network used to mimic the function of horizontal cell, is composed of the horizontal resistor (HRES) circuit and OTA (Operational Transconductance Amplifier) circuit. HRES circuit, imitating dendrite of the neuron cell, comprises of two series MOS transistors operated in weak inversion region. Appending two diode-connected n-channel transistors to a simple transconductance amplifier forms the OTA Op-Amp circuit, which provides stable bias voltage for the gate of MOS transistors in HRES circuit, while serves as an OTA voltage follower to provide input voltage for the network nodes. The Op-Amp calculation circuit with a simple two-stage Op-Amp achieves the image contour enhancing. By adjusting the bias voltage of the resistive network, the smoothing effect can be tuned to change the effect of image's contour enhancement. Simulations of cell circuit and 16×16 2D circuit array are implemented using CSMC 0.5μm DPTM CMOS process.

Sensing voltage across lipid membranes

Science.gov (United States)

Swartz, Kenton J.

2009-01-01

The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL

International Nuclear Information System (INIS)

Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang

2007-01-01

The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)

Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

DEFF Research Database (Denmark)

Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

1999-01-01

bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

2016-03-07

We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

Science.gov (United States)

Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

2018-04-01

Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

DEFF Research Database (Denmark)

Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

2010-01-01

introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

Origin of the transition voltage in gold–vacuum–gold atomic junctions

International Nuclear Information System (INIS)

Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

2013-01-01

The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

Temperature dependence of frequency dispersion in III–V metal-oxide-semiconductor C-V and the capture/emission process of border traps

Energy Technology Data Exchange (ETDEWEB)

Vais, Abhitosh, E-mail: Abhitosh.Vais@imec.be; Martens, Koen; DeMeyer, Kristin [Department of Electrical Engineering, KU Leuven, B-3000 Leuven (Belgium); IMEC, Kapeldreef 75, B-3001 Leuven (Belgium); Lin, Han-Chung; Ivanov, Tsvetan; Collaert, Nadine; Thean, Aaron [IMEC, Kapeldreef 75, B-3001 Leuven (Belgium); Dou, Chunmeng [Frontier Research Center, Tokyo Institute of Technology, Yokohama 226-8502 (Japan); Xie, Qi; Maes, Jan [ASM International, B-3001 Leuven (Belgium); Tang, Fu; Givens, Michael [ASM International, Phoenix, Arizona 85034-7200 (United States); Raskin, Jean-Pierre [Institute of Information and Communication Technologies, Electronics and Applied Mathematics, Universiteé Catholique de Louvain, B-1348 Louvain-la-Neuve (Belgium)

2015-08-03

This paper presents a detailed investigation of the temperature dependence of frequency dispersion observed in capacitance-voltage (C-V) measurements of III-V metal-oxide-semiconductor (MOS) devices. The dispersion in the accumulation region of the capacitance data is found to change from 4%–9% (per decade frequency) to ∼0% when the temperature is reduced from 300 K to 4 K in a wide range of MOS capacitors with different gate dielectrics and III-V substrates. We show that such significant temperature dependence of C-V frequency dispersion cannot be due to the temperature dependence of channel electrostatics, i.e., carrier density and surface potential. We also show that the temperature dependence of frequency dispersion, and hence, the capture/emission process of border traps can be modeled by a combination of tunneling and a “temperature-activated” process described by a non-radiative multi-phonon model, instead of a widely believed single-step elastic tunneling process.

Gabapentin Modulates HCN4 Channel Voltage-Dependence

Directory of Open Access Journals (Sweden)

Han-Shen Tae

2017-08-01

Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

Current–voltage characteristics of manganite–titanite perovskite junctions

Directory of Open Access Journals (Sweden)

Benedikt Ifland

2015-07-01

Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

Macroeconomic Assessment of Voltage Sags

Directory of Open Access Journals (Sweden)

Sinan Küfeoğlu

2016-12-01

Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

Directory of Open Access Journals (Sweden)

J. Koton

2011-04-01

Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

Rapidity dependence of strangeness enhancement factor at FAIR energies

International Nuclear Information System (INIS)

Dey, Kalyan; Bhattacharjee, B.

2014-01-01

Strange particles are produced only at the time of collisions and thus expected to carry important information of collision dynamics. Strangeness enhancement is considered to be one of the traditional signatures of formation of Quark Gluon Plasma (QGP). Due to the limitation of the detector acceptance, the past and ongoing heavy ion experiments could measure the strangeness enhancement at midrapidity only. But the future heavy ion experiment CBM at FAIR will have the access to the entire forward rapidity hemisphere and thus the experimental determination of rapidity dependent strangeness enhancement is a possibility. In this work, an attempt has therefore been made to study the rapidity dependent strangeness enhancement at FAIR energies with the help of a string based hadronic model (UrQMD). A sum of 93 million minimum biased UrQMD events have been used for the present analysis

A facile approach for reducing the working voltage of Au/TiO2/Au nanostructured memristors by enhancing the local electric field

Science.gov (United States)

Arab Bafrani, Hamidreza; Ebrahimi, Mahdi; Bagheri Shouraki, Saeed; Moshfegh, Alireza Z.

2018-01-01

Memristor devices have attracted tremendous interest due to different applications ranging from nonvolatile data storage to neuromorphic computing units. Exploring the role of surface roughness of the bottom electrode (BE)/active layer interface provides useful guidelines for the optimization of the memristor switching performance. This study focuses on the effect of surface roughness of the BE electrode on the switching characteristics of Au/TiO2/Au three-layer memristor devices. An optimized wet-etching treatment condition was found to modify the surface roughness of the Au BE where the measurement results indicate that the roughness of the Au BE is affected by both duration time and solution concentrations of the wet-etching process. Then we fabricated arrays of TiO2-based nanostructured memristors sandwiched between two sets of cross-bar Au electrode lines (junction area 900 μm2). The results revealed a reduction in the working voltages in current-voltage characteristic of the device performance when increasing the surface roughness at the Au(BE)/TiO2 active layer interface. The set voltage of the device (Vset) significantly decreased from 2.26-1.93 V when we increased the interface roughness from 4.2-13.1 nm. The present work provides information for better understanding the switching mechanism of titanium-dioxide-based devices, and it can be inferred that enhancing the roughness of the Au BE/TiO2 active layer interface leads to a localized non-uniform electric field distribution that plays a vital role in reducing the energy consumption of the device.

High breakdown voltage in AlGaN/GaN HEMTs using AlGaN/GaN/AlGaN quantum-well electron-blocking layers.

Science.gov (United States)

Lee, Ya-Ju; Yao, Yung-Chi; Huang, Chun-Ying; Lin, Tai-Yuan; Cheng, Li-Lien; Liu, Ching-Yun; Wang, Mei-Tan; Hwang, Jung-Min

2014-01-01

In this paper, we numerically study an enhancement of breakdown voltage in AlGaN/GaN high-electron-mobility transistors (HEMTs) by using the AlGaN/GaN/AlGaN quantum-well (QW) electron-blocking layer (EBL) structure. This concept is based on the superior confinement of two-dimensional electron gases (2-DEGs) provided by the QW EBL, resulting in a significant improvement of breakdown voltage and a remarkable suppression of spilling electrons. The electron mobility of 2-DEG is hence enhanced as well. The dependence of thickness and composition of QW EBL on the device breakdown is also evaluated and discussed.

Classification of methods for measuring current-voltage characteristics of semiconductor devices

Directory of Open Access Journals (Sweden)

Iermolenko Ia. O.

2014-06-01

Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.

Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity

KAUST Repository

Savagatrup, Suchol

2017-09-27

Carbon monoxide (CO) outcompetes oxygen when binding to the iron center of hemeproteins, leading to a reduction in blood oxygen level and acute poisoning. Harvesting the strong specific interaction between CO and the iron porphyrin provides a highly selective and customizable sensor. We report the development of chemiresistive sensors with voltage-activated sensitivity for the detection of CO comprising iron porphyrin and functionalized single-walled carbon nanotubes (F-SWCNTs). Modulation of the gate voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV/Vis spectroscopy, differential pulse voltammetry, and density functional theory reveal that the in situ reduction of FeIII to FeII enhances the interaction between the F-SWCNTs and CO. Our results illustrate a new mode of sensors wherein redox active recognition units are voltage-activated to give enhanced and highly specific responses.

A novel on-chip high to low voltage power conversion circuit

International Nuclear Information System (INIS)

Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong; Lai Xinquan; Ye Qiang; Li Xianrui

2009-01-01

A novel power supply transform technique for high voltage IC based on the TSMC 0.6 μm BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm 2 area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.

A novel on-chip high to low voltage power conversion circuit

Energy Technology Data Exchange (ETDEWEB)

Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong [Institute of Mechano-electronic Engineering, Xidian University, Xi' an 71007 (China); Lai Xinquan; Ye Qiang; Li Xianrui, E-mail: whui94@126.co [Institute of Electronic CAD, Xidian University, Xi' an 710071 (China)

2009-03-15

A novel power supply transform technique for high voltage IC based on the TSMC 0.6 mum BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm{sup 2} area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.

A novel partial SOI LDMOSFET with periodic buried oxide for breakdown voltage and self heating effect enhancement

Science.gov (United States)

Jamali Mahabadi, S. E.; Rajabi, Saba; Loiacono, Julian

2015-09-01

In this paper a partial silicon on insulator (PSOI) lateral double diffused metal oxide semiconductor field effect transistor (LDMOSFET) with periodic buried oxide layer (PBO) for enhancing breakdown voltage (BV) and self-heating effects (SHEs) is proposed for the first time. This new structure is called periodic buried oxide partial silicon on insulator (PBO-PSOI). In this structure, periodic small pieces of SiO2 were used as the buried oxide (BOX) layer in PSOI to modulate the electric field in the structure. It was demonstrated that the electric field is distributed more evenly by producing additional electric field peaks, which decrease the common peaks near the drain and gate junctions in the PBO-PSOI structure. Hence, the area underneath the electric field curve increases which leads to higher breakdown voltage. Also a p-type Si window was introduced in the source side to force the substrate to share the vertical voltage drop, leading to a higher vertical BV. Furthermore, the Si window under the source and those between periodic pieces of SiO2 create parallel conduction paths between the active layer and substrate thereby alleviating the SHEs. Simulations with the two dimensional ATLAS device simulator from the Silvaco suite of simulation tools show that the BV of PBO-PSOI is 100% higher than that of the conventional partial SOI (C-PSOI) structure. Furthermore the PBO-PSOI structure alleviates SHEs to a greater extent than its C-PSOI counterpart. The achieved drain current for the PBO-PSOI structure (100 μA), at drain-source voltage of VDS = 100 V and gate-source voltage of VGS = 25 V, is shown to be significantly larger than that in C-PSOI and fully depleted SOI (FD-SOI) structures (87 μA and 51 μA respectively). Drain current can be further improved at the expense of BV by increasing the doping of the drift region.

Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

Science.gov (United States)

Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

2012-07-01

Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

Origin of the transition voltage in gold–vacuum–gold atomic junctions

KAUST Repository

Wu, Kunlin

2012-12-13

The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

International Nuclear Information System (INIS)

Hebboul, S.E.; Garland, J.C.

1993-01-01

We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

2007-01-01

Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

SU-E-T-44: Angular Dependence of Surface Dose Enhancement Measured On Several Inhomogeneities Using Radiochromic EBT3 Films

International Nuclear Information System (INIS)

Jansen, A; Schoenfeld, A; Poppinga, D; Chofor, N; Poppe, B

2014-01-01

Purpose: The quantification of the relative surface dose enhancement in dependence on the angle of incidence and the atomic number Z of the surface material. Methods: Experiments were performed with slabs made of aluminum, titanium, copper, silver, dental gold and lead. The metal slabs with equal sizes of 1.0×8.0×8.8mm 3 were embedded in an Octavius 4D phantom (PTW Freiburg, Germany). Radiochromic EBT3 films were used to measure the surface dose for angles of incidence ranging from 0° to 90°. The setup with the metals slabs at the isocenter was irradiated with acceleration voltages of 6MV and 10MV. Water reference measurements were taken under equal conditions. Results: The surface dose enhancement is highest for angles of incidence below 30° and drops significantly for higher. The surface dose enhancement produced by lead and dental gold at 6MV showed a peak of 65%. At 90°, the surface dose enhancement dropped to 15% for both materials. The surface dose enhancements for silver, copper, titanium and aluminum were 45%, 32%, 22% and 12% at 0°, respectively. At an angle of incidence of 80°, the values dropped to 22%, 18%, 12% und 6%. The values for 10MV were very similar. Lead and dental gold showed peaks of 65% und 60%. Their values dropped to 18% at an angle of 90°. The surface dose enhancements for silver, copper, titanium and aluminum were 45%, 30%, 20% and 8% at 0°. At 80° the values dropped to 30%, 20%, 12% and 5%. A dependence of the magnitude of the surface dose enhancement on the atomic number of the surface material can be seen, which is in consistence with literature. Conclusion: The results show that the surface dose enhancements near implant materials with high Z-values should be taken into consideration in radio therapy, even when the angle of incidence is flat

Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

Directory of Open Access Journals (Sweden)

Paula L Diaz-Sylvester

Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

Simulation of forward dark current voltage characteristics of tandem solar cells

International Nuclear Information System (INIS)

Rubinelli, F.A.

2012-01-01

The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

Energy Technology Data Exchange (ETDEWEB)

Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

2007-04-30

The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

Computational optogenetics: empirically-derived voltage- and light-sensitive channelrhodopsin-2 model.

Directory of Open Access Journals (Sweden)

John C Williams

Full Text Available Channelrhodospin-2 (ChR2, a light-sensitive ion channel, and its variants have emerged as new excitatory optogenetic tools not only in neuroscience, but also in other areas, including cardiac electrophysiology. An accurate quantitative model of ChR2 is necessary for in silico prediction of the response to optical stimulation in realistic tissue/organ settings. Such a model can guide the rational design of new ion channel functionality tailored to different cell types/tissues. Focusing on one of the most widely used ChR2 mutants (H134R with enhanced current, we collected a comprehensive experimental data set of the response of this ion channel to different irradiances and voltages, and used these data to develop a model of ChR2 with empirically-derived voltage- and irradiance- dependence, where parameters were fine-tuned via simulated annealing optimization. This ChR2 model offers: 1 accurate inward rectification in the current-voltage response across irradiances; 2 empirically-derived voltage- and light-dependent kinetics (activation, deactivation and recovery from inactivation; and 3 accurate amplitude and morphology of the response across voltage and irradiance settings. Temperature-scaling factors (Q10 were derived and model kinetics was adjusted to physiological temperatures. Using optical action potential clamp, we experimentally validated model-predicted ChR2 behavior in guinea pig ventricular myocytes. The model was then incorporated in a variety of cardiac myocytes, including human ventricular, atrial and Purkinje cell models. We demonstrate the ability of ChR2 to trigger action potentials in human cardiomyocytes at relatively low light levels, as well as the differential response of these cells to light, with the Purkinje cells being most easily excitable and ventricular cells requiring the highest irradiance at all pulse durations. This new experimentally-validated ChR2 model will facilitate virtual experimentation in neural and

Intermediate state trapping of a voltage sensor

DEFF Research Database (Denmark)

Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

2012-01-01

Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels.

Science.gov (United States)

Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D

2017-05-01

Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

Nonlinear electrokinetics at large voltages

Energy Technology Data Exchange (ETDEWEB)

Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

2009-07-15

The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

Science.gov (United States)

Cai, Yuanji; Guan, Yonggang; Liu, Weidong

2017-06-01

Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

Solution-processed PCDTBT capped low-voltage InGaZnO{sub x} thin film phototransistors for visible-light detection

Energy Technology Data Exchange (ETDEWEB)

Wang, Han; Xiao, Yubin; Chen, Zefeng; Xu, Wangying; Long, Mingzhu; Xu, Jian-Bin, E-mail: jbxu@ee.cuhk.edu.hk [Department of Electronic Engineering and Materials Science and Technology Research Center, The Chinese University of Hong Kong, Shatin, N.T., Hong Kong (China)

2015-06-15

The effects of visible-light detection based on solution processed poly[N-9′′-hepta-decanyl-2,7-carbazole-alt-5,5-(4′,7′-di-2-thienyl-2′,1′, 3′benzothiadiazole) (PCDTBT) capped InGaZnOx (IGZO) phototransistors with Al{sub 2}O{sub x} serving as gate dielectric are investigated in this paper. The high-k dielectric is used to lower the device operating voltage down to 2 V. Photons emitted from laser sources with the wavelengths (λ) of 532 nm and 635 nm are absorbed through the layer of PCDTBT to generate electron-hole-pairs (EHPs). After the separation of EHPs, electrons are injected into IGZO layer through the p-n junction formed between the IGZO (n-type semiconductor) and the PCDTBT (p-type semiconductor). The photo-generated carriers boost the drain current of the transistors as well as bring about the negative threshold voltage shift. Significant enhanced detection performance is achieved under the laser wavelength of 532 nm. The highest photoresponsivity reaches up to 20 A/W, while the photoresponse rise time comes to 10 ms and the fall time comes to approximate 76 ms, which is much faster than trap assisted IGZO visible light detection. The fabricated phototransistors favor the application of visible-light detectors and/or optical switches.

Self-aligned photolithography for the fabrication of fully transparent high-voltage devices

Science.gov (United States)

Zhang, Yonghui; Mei, Zengxia; Huo, Wenxing; Wang, Tao; Liang, Huili; Du, Xiaolong

2018-05-01

High-voltage devices, working in the range of hundreds of volts, are indispensable elements in the driving or readout circuits for various kinds of displays, integrated microelectromechanical systems and x-ray imaging sensors. However, the device performances are found hardly uniform or repeatable due to the misalignment issue, which are extremely common for offset drain high-voltage devices. To resolve this issue, this article reports a set of self-aligned photolithography technology for the fabrication of high-voltage devices. High-performance fully-transparent high-voltage thin film transistors, diodes and logic inverters are successfully fabricated with this technology. Unlike other self-aligned routes, opaque masks are introduced on the backside of the transparent substrate to facilitate proximity exposure method. The photolithography process is simulated and analyzed with technology computer aided design simulation to explain the working principle of the proximity exposure method. The substrate thickness is found to be vital for the implementation of this technology based on both simulation and experimental results. The electrical performance of high-voltage devices is dependent on the offset length, which can be delicately modulated by changing the exposure dose. The presented self-aligned photolithography technology is proved to be feasible in high-voltage circuits, demonstrating its huge potential in practical industrial applications.

Wind Power Plant Voltage Stability Evaluation: Preprint

Energy Technology Data Exchange (ETDEWEB)

Muljadi, E.; Zhang, Y. C.

2014-09-01

Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

Output Force Enhancement of Scratch Drive Actuator in Low-Voltage Region by Using Flexible Joint

Directory of Open Access Journals (Sweden)

Shawn CHEN

2010-04-01

Full Text Available Here a low-voltage scratch drive actuator (LVSDA is proposed by incorporating flexible joint into the conventional SDA to improve performance in low-voltage region. Experimental results show that, at the same total plate length of 80 mm and width of 65 mm, the proposed LVSDA can be actuated as low as 40 V, much lower than 80 V, the minimum required input voltage of the conventional SDA. From finite element analysis by CosmosWorks, yielding effect is found to be a critical factor. Before yielding, LVSDA can provide better performance than SDA at the same input voltage. However, the yielding stress in flexible joint would limit the achievable maximum output force in high-voltage region. By varying joint length, width, or location, LVSDA is shown to be operated in low-voltage region where the conventional SDA can not be operated, and can still provide comparable performance as SDA in high-voltage region.

Effects of Arousal on Mouse Sensory Cortex Depend on Modality

Directory of Open Access Journals (Sweden)

Daisuke Shimaoka

2018-03-01

Full Text Available Summary: Changes in arousal modulate the activity of mouse sensory cortex, but studies in different mice and different sensory areas disagree on whether this modulation enhances or suppresses activity. We measured this modulation simultaneously in multiple cortical areas by imaging mice expressing voltage-sensitive fluorescent proteins (VSFP. VSFP imaging estimates local membrane potential across large portions of cortex. We used temporal filters to predict local potential from running speed or from pupil dilation, two measures of arousal. The filters provided good fits and revealed that the effects of arousal depend on modality. In the primary visual cortex (V1 and auditory cortex (Au, arousal caused depolarization followed by hyperpolarization. In the barrel cortex (S1b and a secondary visual area (LM, it caused only hyperpolarization. In all areas, nonetheless, arousal reduced the phasic responses to trains of sensory stimuli. These results demonstrate diverse effects of arousal across sensory cortex but similar effects on sensory responses. : Shimaoka et al. use voltage-sensitive imaging to show that the effects of arousal on the mouse cortex are markedly different across areas and over time. In all the sensory areas studied, nonetheless, arousal reduced the phasic voltage responses to trains of sensory stimuli. Keywords: cerebral cortex, cortical state, locomotion, sensory processing, widefield imaging

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

Degraded voltage protection at nuclear plant safety buses

International Nuclear Information System (INIS)

Haddad, S.Z.; Berger, W.E.

1989-01-01

This paper reviews the events that led to the NRC's degraded voltage protection requirement and outlines the related NRC positions. It describes problems that have occurred with the protection scheme and identifies the measures required to minimize the occurrence of these problems. The paper recommends new guidelines for degraded voltage protection and proposes a protection scheme logic that aims at enhancing the reliability of the safety systems

Opposition-Based Improved PSO for Optimal Reactive Power Dispatch and Voltage Control

Directory of Open Access Journals (Sweden)

Shengrang Cao

2015-01-01

Full Text Available An opposition-based improved particle swarm optimization algorithm (OIPSO is presented for solving multiobjective reactive power optimization problem. OIPSO uses the opposition learning to improve search efficiency, adopts inertia weight factors to balance global and local exploration, and takes crossover and mutation and neighborhood model strategy to enhance population diversity. Then, a new multiobjective model is built, which includes system network loss, voltage dissatisfaction, and switching operation. Based on the market cost prices, objective functions are converted to least-cost model. In modeling process, switching operation cost is described according to the life cycle cost of transformer, and voltage dissatisfaction penalty is developed considering different voltage quality requirements of customers. The experiment is done on the new mathematical model. Through the simulation of IEEE 30-, 118-bus power systems, the results prove that OIPSO is more efficient to solve reactive power optimization problems and the model is more accurate to reflect the real power system operation.

A temperature monitor circuit with small voltage sensitivity using a topology-reconfigurable ring oscillator

Science.gov (United States)

Kishimoto, Tadashi; Ishihara, Tohru; Onodera, Hidetoshi

2018-04-01

In this paper, we propose a temperature monitor circuit that exhibits a small supply voltage sensitivity adopting a circuit topology of a reconfigurable ring oscillator. The circuit topology of the monitor is crafted such that the oscillation frequency is determined by the amount of subthreshold leakage current, which has an exponential dependence on temperature. Another important characteristic of the monitor is its small supply voltage sensitivity. The measured oscillation frequency of a test chip fabricated in a 65 nm CMOS process varies only 2.6% under a wide range of supply voltages from 0.4 to 1.0 V at room temperature. The temperature estimation error ranges from -0.3 to 0.4 °C over a temperature range of 10 to 100 °C.

Neuromodulation of activity-dependent synaptic enhancement at crayfish neuromuscular junction.

Science.gov (United States)

Qian, S M; Delaney, K R

1997-10-17

Action potential-evoked transmitter release is enhanced for many seconds after moderate-frequency stimulation (e.g. 15 Hz for 30 s) at the excitor motorneuron synapse of the crayfish dactyl opener muscle. Beginning about 1.5 s after a train, activity-dependent synaptic enhancement (ADSE) is dominated by a process termed augmentation (G.D. Bittner, D.A. Baxter, Synaptic plasticity at crayfish neuromuscular junctions: facilitation and augmentation, Synapse 7 (1991) 235-243'[4]; K.L. Magleby, Short-term changes in synaptic efficacy, in: G.M. Edelman, L.E. Gall, C.W. Maxwell (Eds.), Synaptic Function, John Wiley and Sons, New York, 1987, pp. 21-56; K.L. Magleby; J.E. Zengel, Augmentation: a process that acts to increase transmitter release at the frog neuromuscular junction, J. Physiol. (Lond.) 257 (1976) 449-470) which decays approximately exponentially with a time constant of about 10 s at 16 degrees C, reflecting the removal of Ca2+ which accumulates during the train in presynaptic terminals (K.R. Delaney, D.W. Tank, R.S. Zucker, Serotonin-mediated enhancement of transmission at crayfish neuromuscular junction is independent of changes in calcium, J. Neurosci. 11 (1991) 2631-2643). Serotonin (5-HT, 1 microM) increases evoked and spontaneous transmitter release several-fold (D. Dixon, H.L. Atwood, Crayfish motor nerve terminal's response to serotonin examined by intracellular microelectrode, J. Neurobiol. 16 (1985) 409-424; J. Dudel, Modulation of quantal synaptic release by serotonin and forskolin in crayfish motor nerve terminals, in: Modulation of Synaptic Transmission and Plasticity in Nervous Systems, G. Hertting, H.-C. Spatz (Eds.), Springer-Verlag, Berlin, 1988; S. Glusman, E.A. Kravitz. The action of serotonin on excitatory nerve terminals in lobster nerve-muscle preparations, J. Physiol. (Lond.) 325 (1982) 223-241). We found that ADSE persists about 2-3 times longer after moderate-frequency presynaptic stimulation in the presence of 5-HT. This slowing of the

Dreaming of a Learning Task is Associated with Enhanced Sleep-Dependent Memory Consolidation

Science.gov (United States)

Wamsley, Erin J.; Tucker, Matthew; Payne, Jessica D.; Benavides, Joseph; Stickgold, Robert

2010-01-01

Summary It is now well established that post-learning sleep is beneficial for human memory performance [1–5]. Meanwhile, human and animal studies demonstrate that learning-related neural activity is re-expressed during post-training non-rapid eye movement sleep (NREM) [6–9]. NREM sleep processes appear to be particularly beneficial for hippocampus-dependent forms of memory [1–3, 10]. These observations suggest that learning triggers the reactivation and reorganization of memory traces during sleep, a systems-level process that in turn enhances behavioral performance. Here, we hypothesized that dreaming about a learning experience during NREM sleep would be associated with improved performance on a hippocampus-dependent spatial memory task. Subjects (n=99) were trained on a virtual navigation task, and then retested on the same task 5 hours after initial training. Improved performance at retest was strongly associated with task-related dream imagery during an intervening afternoon nap. Task-related thoughts during wakefulness, in contrast, did not predict improved performance. These observations suggest that sleep-dependent memory consolidation in humans is facilitated by the offline reactivation of recently formed memories, and furthermore, that dream experiences reflect this memory processing. That similar effects were not seen during wakefulness suggests that these mnemonic processes are specific to the sleep state. PMID:20417102

Surface effects of electrode-dependent switching behavior of resistive random-access memory

KAUST Repository

Ke, Jr Jian; Wei, Tzu Chiao; Tsai, Dung Sheng; Lin, Chun-Ho; He, Jr-Hau

2016-01-01

of the oxygen chemisorption process was proposed to explain this electrode-dependent switching behavior. The temperature-dependent switching voltage demonstrates that the ReRAM devices fabricated with Pt electrodes have a lower activation energy

Studies on transient characteristics of unipolar resistive switching processes in TiO2 thin film grown by atomic layer deposition

Science.gov (United States)

Sahu, Vikas Kumar; Das, Amit K.; Ajimsha, R. S.; Misra, P.

2018-05-01

The transient characteristics of resistive switching processes have been investigated in TiO2 thin films grown by atomic layer deposition (ALD) to study the temporal evolution of the switching processes and measure the switching times. The reset and set switching times of unipolar Au/TiO2/Pt devices were found to be ~250 µs and 180 ns, respectively in the voltage windows of 0.5–0.9 V for reset and 1.9–4.8 V for set switching processes, obtained from quasi-static measurements. The reset switching time decreased exponentially with increasing amplitude of applied reset voltage pulse, while the set switching time remained insensitive to the amplitude of the set voltage pulse. A fast reset process with a switching time of ~400 ns was achieved by applying a reset voltage of ~1.8 V, higher than that of the quasi-static reset voltage window but below the set voltage window. The sluggish reset process in TiO2 thin film and the dependence of the reset switching time on the amplitude of the applied voltage pulse was understood on the basis of a self-accelerated thermal dissolution model of conducting filaments (CFs), where a higher temperature of the CFs owing to enhanced Joule heating at a higher applied voltage imposes faster diffusion of oxygen vacancies, resulting in a shorter reset switching time. Our results clearly indicate that fast resistive switching with switching times in hundreds of nanoseconds can be achieved in ALD-grown TiO2 thin films. This may find applications in fast non-volatile unipolar resistive switching memories.

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

Science.gov (United States)

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

Electric-field-control of magnetic anisotropy of Co0.6Fe0.2B0.2/oxide stacks using reduced voltage

Science.gov (United States)

Kita, Koji; Abraham, David W.; Gajek, Martin J.; Worledge, D. C.

2012-08-01

We have demonstrated purely electrical manipulation of the magnetic anisotropy of a Co0.6Fe0.2B0.2 film by applying only 8 V across the CoFeB/oxide stack. A clear transition from in-plane to perpendicular anisotropy was observed. The quantitative relationship between interface anisotropy energy and the applied electric-field was determined from the linear voltage dependence of the saturation field. By comparing the dielectric stacks of MgO/Al2O3 and MgO/HfO2/Al2O3, enhanced voltage control was also demonstrated, due to the higher dielectric constant of the HfO2. These results suggest the feasibility of purely electrical control of magnetization with small voltage bias for spintronics applications.

A common pathway for charge transport through voltage-sensing domains.

Science.gov (United States)

Chanda, Baron; Bezanilla, Francisco

2008-02-07

Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

Improvement in interfacial characteristics of low-voltage carbon nanotube thin-film transistors with solution-processed boron nitride thin films

Energy Technology Data Exchange (ETDEWEB)

Jeon, Jun-Young; Ha, Tae-Jun, E-mail: taejunha0604@gmail.com

2017-08-15

Highlights: • We demonstrate the potential of solution-processed boron nitride (BN) thin films for nanoelectronics. • Improved interfacial characteristics reduced the leakage current by three orders of magnitude. • The BN encapsulation improves all the device key metrics of low-voltage SWCNT-TFTs. • Such improvements were achieved by reduced interaction of interfacial localized states. - Abstract: In this article, we demonstrate the potential of solution-processed boron nitride (BN) thin films for high performance single-walled carbon nanotube thin-film transistors (SWCNT-TFTs) with low-voltage operation. The use of BN thin films between solution-processed high-k dielectric layers improved the interfacial characteristics of metal-insulator-metal devices, thereby reducing the current density by three orders of magnitude. We also investigated the origin of improved device performance in SWCNT-TFTs by employing solution-processed BN thin films as an encapsulation layer. The BN encapsulation layer improves the electrical characteristics of SWCNT-TFTs, which includes the device key metrics of linear field-effect mobility, sub-threshold swing, and threshold voltage as well as the long-term stability against the aging effect in air. Such improvements can be achieved by reduced interaction of interfacial localized states with charge carriers. We believe that this work can open up a promising route to demonstrate the potential of solution-processed BN thin films on nanoelectronics.

Thermal voltage noise in layered superconductors

International Nuclear Information System (INIS)

Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

1995-01-01

Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

Science.gov (United States)

Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

2010-10-01

The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

Effect of voltage on the characteristics of magnesium-lanthanum deposits synthesized by an electrodeposition process

Energy Technology Data Exchange (ETDEWEB)

Sahli, M. [Laboratoire de Physique Energétique, Université de Constantine 1 (Algeria); Chetehouna, K.; Gascoin, N. [INSA-CVL, Univ. Orléans, PRISME, EA 4229, F-18020, Bourges (France); Bellel, N. [Laboratoire de Physique Energétique, Université de Constantine 1 (Algeria); Tadini, P., E-mail: tadini.pietro@gmail.com [INSA-CVL, Univ. Orléans, PRISME, EA 4229, F-18020, Bourges (France)

2017-04-15

This work deals with the characterization of magnesium-lanthanum powders deposits produced with an electrodeposition technique using an aqueous solution based on magnesium chloride and lanthanum(III) nitrate. In recent years, the interest for magnesium-based alloys is growing due to their potential use as solid state systems for hydrogen storage. This work is a preliminary study on the synthesis of magnesium-lanthanum powders oriented to their later evaluation in systems for hydrogen storage. Magnesium and Lanthanum are deposited on a copper plate used as a cathode. Chemical composition, structure and morphology are investigated by EDS, XRD, FTIR and SEM. The effect of voltage on powders characteristics is studied considering three values (3, 3.5 and 4 V). EDS analysis shows the presence of three major elements (Mg, La and O) with a little amount of Cl. The weight percentages of Mg and O increase whereas the one of La decreases with the growth of voltage. Morphological characterization reveals that heterogeneous chemical structures are formed on the surface of the electrode and the size of aggregates decreases with the increase of voltage. From the results of X-ray analysis the deposits reveal the significant presence of two phases: Mg(OH){sub 2} and La(OH){sub 3}. The peaks originating from the Mg(OH){sub 2} phase has a non-monotonic behavior and those of La(OH){sub 3} phase increase with the increase of voltage. FTIR analysis confirms the presence of the two phases identified in XRD diffractograms and exhibits that their corresponding transmittance values increase for higher voltage values. - Highlights: • Synthesis of magnesium-lanthanum deposits by an electrodeposition process. • Voltage effect is investigated using different physicochemical analysis techniques (EDS, XRD, FTIR and SEM). • The EDS analysis shows the presence of three major elements (Mg, La and O) and a little amount of Cl. • Two phases, namely Mg(OH){sub 2} and La(OH){sub 3} are

Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

Science.gov (United States)

Findeisen, Felix; Minor, Daniel L

2009-03-01

Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

High frequency breakdown voltage

International Nuclear Information System (INIS)

Chu, Thanh Duy.

1992-03-01

This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

Improved model predictive control for high voltage quality in microgrid applications

DEFF Research Database (Denmark)

Dragicevic, T.; Al hasheem, Mohamed; Lu, M.

2017-01-01

This paper proposes an improvement of the finite control set model predictive control (FCS-MPC) strategy for enhancing the voltage regulation performance of a voltage source converter (VSC) used for standalone microgrid and uninterrupted power supply (UPS) applications. The modification is based...

Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

International Nuclear Information System (INIS)

Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

2014-01-01

Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

Electric-regulated enhanced in-plane uniaxial anisotropy in FeGa/PMN-PT composite using oblique pulsed laser deposition

Science.gov (United States)

Zhang, Yi; Huang, Chaojuan; Turghun, Mutellip; Duan, Zhihua; Wang, Feifei; Shi, Wangzhou

2018-04-01

The FeGa film with in-plane uniaxial magnetic anisotropy was fabricated onto different oriented single-crystal lead magnesium niobate-lead titanate using oblique pulsed laser deposition. An enhanced in-plane uniaxial magnetic anisotropy field of FeGa film can be adjusted from 18 Oe to 275 Oe by tuning the oblique angle and polarizing voltage. The competitive relationship of shape anisotropy and strain anisotropy has been discussed, which was induced by oblique angle and polarizing voltage, respectively. The (100)-oriented and (110)-oriented PMN-PT show completely different characters on voltage-dependent magnetic properties, which could be attributed to various anisotropy directions depended on different strain directions.

Process optimization of a deep trench isolation structure for high voltage SOI devices

International Nuclear Information System (INIS)

Zhu Kuiying; Qian Qinsong; Zhu Jing; Sun Weifeng

2010-01-01

The process reasons for weak point formation of the deep trench on SOI wafers have been analyzed in detail. An optimized trench process is also proposed. It is found that there are two main reasons: one is over-etching laterally of the silicon on the surface of the buried oxide caused by a fringe effect; and the other is the slow growth rate of the isolation oxide in the concave silicon corner of the trench bottom. In order to improve the isolation performance of the deep trench, two feasible ways for optimizing the trench process are proposed. The improved process thickens the isolation oxide and rounds sharp silicon corners at their weak points, increasing the applied voltage by 15-20 V at the same leakage current. The proposed new trench isolation process has been verified in the foundry's 0.5-μm HV SOI technology. (semiconductor devices)

Free-energy relationships in ion channels activated by voltage and ligand

Science.gov (United States)

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Fiber-optic voltage measuring system

Science.gov (United States)

Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

1993-09-01

A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

NARCIS (Netherlands)

Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

1993-01-01

A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

Multi-objective optimization of distributed generation with voltage ...

African Journals Online (AJOL)

DR OKE

1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

Cotunneling enhancement of magnetoresistance in double magnetic tunnel junctions with embedded superparamagnetic NiFe nanoparticles

International Nuclear Information System (INIS)

Dempsey, K.J.; Arena, D.; Hindmarch, A.T.; Wei, H.X.; Qin, Q.H.; Wen, Z.C.; Wang, W.X.; Vallejo-Fernandez, G.; Han, X.F.; Marrows, C.H.

2010-01-01

Temperature and bias voltage-dependent transport characteristics are presented for double magnetic tunnel junctions (DMTJs) with self-assembled NiFe nanoparticles embedded between insulating alumina barriers. The junctions with embedded nanoparticles are compared to junctions with a single barrier of comparable size and growth conditions. The embedded particles are characterized using x-ray absorption spectroscopy, transmission electron microscopy, and magnetometry techniques, showing that they are unoxidized and remain superparamagnetic to liquid helium temperatures. The tunneling magnetoresistance (TMR) for the DMTJs is lower than the control samples, however, for the DMTJs an enhancement in TMR is seen in the Coulomb blockade region. Fitting the transport data in this region supports the theory that cotunneling is the dominant electron transport process within the Coulomb blockade region, sequential tunneling being suppressed. We therefore see an enhanced TMR attributed to the change in the tunneling process due to the interplay of the Coulomb blockade and spin-dependent tunneling through superparamagnetic nanoparticles, and develop a simple model to quantify the effect, based on the fact that our nanoparticles will appear blocked when measured on femtosecond tunneling time scales.

Recording membrane potential changes through photoacoustic voltage sensitive dye

DEFF Research Database (Denmark)

Zhang, Haichong K.; Kang, Jeeun; Yan, Ping

2017-01-01

Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...

Low start-up voltage dc–dc converter with negative voltage control for thermoelectric energy harvesting

Directory of Open Access Journals (Sweden)

Pui-Sun Lei

2015-01-01

Full Text Available This Letter presents a low start-up voltage dc–dc converter for low-power thermoelectric systems which uses a native n-type MOS transistor as the start-up switch. The start-up voltage of the proposed converter is 300 mV and the converter does not need batteries to start up. The negative voltage control is proposed to reduce the leakage current caused by native n-type transistor and increase the efficiency. The proposed converter was designed using standard 0.18 µm CMOS process with chip size of 0.388 mm^2. The peak efficiency is 63% at load current of 1.5 mA. The proposed converter provides output voltage >1 V at maximum load current of 3.2 mA.

Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

International Nuclear Information System (INIS)

Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

2002-01-01

The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

New method for determining avalanche breakdown voltage of silicon photomultipliers

International Nuclear Information System (INIS)

Chirikov-Zorin, I.

2017-01-01

The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

Solution-processable electrochemiluminescent ion gels for flexible, low-voltage, emissive displays on plastic.

Science.gov (United States)

Moon, Hong Chul; Lodge, Timothy P; Frisbie, C Daniel

2014-03-05

Ion gels comprising ABA triblock copolymers and ionic liquids have received much attention as functional materials in numerous applications, especially as gate dielectrics in organic transistors. Here we have expanded the functionality of ion gels by demonstrating low-voltage, flexible electrochemiluminescent (ECL) devices using patterned ion gels containing redox-active luminophores. The ECL devices consisted only of a 30 μm thick emissive gel and two electrodes and were fabricated on indium tin oxide-coated substrates (e.g., polyester) simply by solution-casting the ECL gel and brush-painting a top Ag electrode. The triblock copolymer employed in the gel was polystyrene-block-poly(methyl methacrylate)-block-polystyrene, where the solvophobic polystyrene end blocks associate into micellar cross-links in the versatile ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([EMI][TFSI]). An ECL gel containing ~6.25 wt % Ru(bpy)3Cl2 (relative to [EMI][TFSI]) as the luminophore turned on at an AC peak-to-peak voltage as low as 2.6 V (i.e., -1.3 to +1.3 V) and showed a relatively rapid response (sub-ms). The wavelength of maximum emission was 610 nm (red-orange). With the use of an iridium(III) complex, Ir(diFppy)2(bpy)PF6 [diFppy = 2-(2',4'-difluorophenyl)pyridine; bpy = 2,2'-bipyridyl], the emitting color was tuned to a maximum wavelength of 540 nm (green). Moreover, when a blended luminophore system containing a 60:40 mixture of Ru(bpy)3(2+) and Ir(diFppy)2(bpy)(+) was used in the emissive layer, the luminance of red-orange-colored light was enhanced by a factor of 2, which is explained by the generation of the additional excited state Ru(bpy)3(2+)* by a coreactant pathway with Ir(diFppy)2(bpy)(+)* in addition to the usual annihilation pathway. This is the first time that enhanced ECL has been achieved in ion gels (or ionic liquids) using a coreactant. Overall, the results indicate that ECL ion gels are attractive multifunctional materials for

Analysis the Transient Process of Wind Power Resources when there are Voltage Sags in Distribution Grid

Science.gov (United States)

Nhu Y, Do

2018-03-01

Vietnam has many advantages of wind power resources. Time by time there are more and more capacity as well as number of wind power project in Vietnam. Corresponding to the increase of wind power emitted into national grid, It is necessary to research and analyze in order to ensure the safety and reliability of win power connection. In national distribution grid, voltage sag occurs regularly, it can strongly influence on the operation of wind power. The most serious consequence is the disconnection. The paper presents the analysis of distribution grid's transient process when voltage is sagged. Base on the analysis, the solutions will be recommended to improve the reliability and effective operation of wind power resources.

Capacitance and conductance versus voltage characterization of Al2O3 layers prepared by plasma enhanced atomic layer deposition at 25 °C≤ T ≤ 200 °C

International Nuclear Information System (INIS)

Henkel, Karsten; Tallarida, Massimo; Schmeißer, Dieter; Gargouri, Hassan; Gruska, Bernd; Arens, Michael

2014-01-01

In this work, plasma enhanced atomic layer deposited (PE-ALD) samples were prepared at substrate temperatures in the range between room temperature (RT) and 200 °C and investigated by capacitance–voltage and conductance–voltage recordings. The measurements are compared to standard thermal atomic layer deposition (T-ALD) at 200 °C. Very low interface state density (D it ) ∼10 11  eV −1  cm −2 could be achieved for the PE-ALD process at 200 °C substrate temperature after postdeposition anneal (PDA) in forming gas at 450 °C. The PDA works very effectively for both the PE-ALD and T-ALD at 200 °C substrate temperature delivering also similar values of negative fixed charge density (N fix ) around −2.5 × 10 12  cm −2 . At the substrate temperature of 150 °C, highest N fix (−2.9 × 10 12  cm −2 ) and moderate D it (2.7 × 10 11  eV −1  cm −2 ) values were observed. The as deposited PE-ALD layer at RT shows both low D it in the range of (1 to 3) × 10 11  eV −1 cm −2 and low N fix (−4.4 × 10 11  cm −2 ) at the same time. The dependencies of N fix , D it , and relative permittivity on the substrate temperatures and its adjustability are discussed

Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

DEFF Research Database (Denmark)

Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

2012-01-01

The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

Learning-dependent and -independent enhancement of mitral/tufted cell glomerular odor responses following olfactory fear conditioning in awake mice.

Science.gov (United States)

Ross, Jordan M; Fletcher, Max L

2018-04-18

Associative fear learning produces fear toward the conditioned stimulus (CS) and often generalization, the expansion of fear from the CS to similar, unlearned stimuli. However, how fear learning affects early sensory processing of learned and unlearned stimuli in relation to behavioral fear responses to these stimuli remains unclear. We subjected male and female mice expressing the fluorescent calcium indicator GCaMP3 in olfactory bulb mitral and tufted cells to a classical olfactory fear conditioning paradigm. We then used awake, in vivo calcium imaging to quantify learning-induced changes in glomerular odor responses, which constitute the first site of olfactory processing in the brain. The results demonstrate that odor-shock pairing non-specifically enhances glomerular odor representations in a learning-dependent manner and increases representational similarity between the CS and non-conditioned odors, potentially priming the system towards generalization of learned fear. Additionally, CS-specific glomerular enhancements remain even when associative learning is blocked, suggesting two separate mechanisms lead to enhanced glomerular responses following odor-shock pairings. SIGNIFICANCE STATEMENT In the olfactory bulb (OB), odors are uniquely coded in a spatial map that represents odor identity, making the OB a unique model system for investigating how learned fear alters sensory processing. Classical fear conditioning causes fear of the conditioned stimulus (CS) and of neutral stimuli, known as generalization. Combining fear conditioning with fluorescent calcium imaging of OB glomeruli, we found enhanced glomerular responses of the CS as well as neutral stimuli in awake mice, which mirrors fear generalization. We report that CS and neutral stimuli enhancements are, respectively, learning- independent and learning-dependent. Together, these results reveal distinct mechanisms leading to enhanced OB processing of fear-inducing stimuli and provide important

Technical and economic considerations of extra high voltage power transmission

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1966-09-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

Ambiance-dependent agglomeration and surface-enhanced Raman spectroscopy response of self-assembled silver nanoparticles for plasmonic photovoltaic devices

Science.gov (United States)

Gwamuri, Jephias; Venkatesan, Ragavendran; Sadatgol, Mehdi; Mayandi, Jeyanthinath; Guney, Durdu O.; Pearce, Joshua M.

2017-07-01

The agglomeration/dewetting process of thin silver films provides a scalable method of obtaining self-assembled nanoparticles (SANPs) for plasmonics-based thin-film solar photovoltaic (PV) devices. We show the effect of annealing ambiance on silver SANP average size, particle/cluster finite shape, substrate area coverage/particle distribution, and how these physical parameters influence optical properties and surface-enhanced Raman scattering (SERS) responses of SANPs. Statistical analysis performed indicates that generally Ag SANPs processed in the presence of a gas (argon and nitrogen) ambiance tend to have smaller average size particles compared to those processed under vacuum. Optical properties are observed to be highly dependent on particle size, separation distance, and finite shape. The greatest SERS enhancement was observed for the argon-processed samples. There is a correlation between simulation and experimental data that indicate argon-processed AgNPs have a great potential to enhance light coupling when integrated to thin-film PV.

Facile solution-processed aqueous MoOx for feasible application in organic light-emitting diode

Science.gov (United States)

Zheng, Qinghong; Qu, Disui; Zhang, Yan; Li, Wanshu; Xiong, Jian; Cai, Ping; Xue, Xiaogang; Liu, Liming; Wang, Honghang; Zhang, Xiaowen

2018-05-01

Solution-processed techniques attract increasing attentions in organic electronics for their low-cost and scalable manufacturing. We demonstrate the favorite hole injection material of solution-processed aqueous MoOx (s-MoOx) with facile fabrication process and cast successful application to constructing efficient organic light-emitting diodes (OLEDs). Atomic force microscopy and X-ray photoelectron spectroscopy analysis show that s-MoOx behaves superior film morphology and non-stoichiometry with slight oxygen deficiency. With tris(8-hydroxy-quinolinato)aluminium as emitting layer, s-MoOx based OLED shows maximum luminous efficiency of 7.9 cd/A and power efficiency of 5.9 lm/W, which have been enhanced by 43.6% and 73.5%, respectively, in comparison with the counterpart using conventional vacuum thermal evaporation MoOx. Current-voltage, impedance-voltage, phase-voltage and capacitance-voltage characteristics of hole-only devices indicate that s-MoOx with two processes of "spin-coating/annealing" shows mostly enhanced hole injection capacity and thus promoting device performance. Our experiments provide an alternative approach for constructing efficient OLED with solution process.

Piezo Voltage Controlled Planar Hall Effect Devices.

Science.gov (United States)

Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

2016-06-22

The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

Demonstration of InAlN/AlGaN high electron mobility transistors with an enhanced breakdown voltage by pulsed metal organic chemical vapor deposition

Energy Technology Data Exchange (ETDEWEB)

Xue, JunShuai, E-mail: junshuaixue@hotmail.com; Zhang, JinCheng; Hao, Yue [Key Laboratory of Wide Band Gap Semiconductor Materials and Devices, School of Microelectronics, Xidian University, Xi' an 710071 (China)

2016-01-04

In this work, InAlN/AlGaN heterostructures employing wider bandgap AlGaN instead of conventional GaN channel were grown on sapphire substrate by pulsed metal organic chemical vapor deposition, where the nominal Al composition in InAlN barrier and AlGaN channel were chosen to be 83% and 5%, respectively, to achieve close lattice-matched condition. An electron mobility of 511 cm{sup 2}/V s along with a sheet carrier density of 1.88 × 10{sup 13 }cm{sup −2} were revealed in the prepared heterostructures, both of which were lower compared with lattice-matched InAlN/GaN due to increased intrinsic alloy disorder scattering resulting from AlGaN channel and compressively piezoelectric polarization in barrier, respectively. While the high electron mobility transistor (HEMT) processed on these structures not only exhibited a sufficiently high drain output current density of 854 mA/mm but also demonstrated a significantly enhanced breakdown voltage of 87 V, which is twice higher than that of reported InAlN/GaN HEMT with the same device dimension, potential characteristics for high-voltage operation of GaN-based electronic devices.

Subnanosecond breakdown development in high-voltage pulse discharge: Effect of secondary electron emission

Science.gov (United States)

Alexandrov, A. L.; Schweigert, I. V.; Zakrevskiy, Dm. E.; Bokhan, P. A.; Gugin, P.; Lavrukhin, M.

2017-10-01

A subnanosecond breakdown in high-voltage pulse discharge may be a key tool for superfast commutation of high power devices. The breakdown in high-voltage open discharge at mid-high pressure in helium was studied in experiment and in kinetic simulations. The kinetic model of electron avalanche development was constructed, based on PIC-MCC simulations, including dynamics of electrons, ions and fast helium atoms, produced by ions scattering. Special attention was paid to electron emission processes from cathode, such as: photoemission by Doppler-shifted resonant photons, produced in excitation processes involving fast atoms; electron emission by ions and fast atoms bombardment of cathode; the secondary electron emission (SEE) by hot electrons from bulk plasma. The simulations show that the fast atoms accumulation is the main reason of emission growth at the early stage of breakdown, but at the final stage, when the voltage on plasma gap diminishes, namely the SEE is responsible for subnanosecond rate of current growth. It was shown that the characteristic time of the current growth can be controlled by the SEE yield. The influence of SEE yield for three types of cathode material (titanium, SiC, and CuAlMg-alloy) was tested. By changing the pulse voltage amplitude and gas pressure, the area of existence of subnanosecond breakdown is identified. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time value as small as τs = 0.4 ns, for the pulse voltage amplitude of 5÷12 kV. An increase of gas pressure from 15 Torr to 30 Torr essentially decreases the time of of current front growth, whereas the pulse voltage variation weakly affects the results.

High voltage engineering fundamentals

CERN Document Server

Kuffel, E; Hammond, P

1984-01-01

Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

CMOS voltage references an analytical and practical perspective

CERN Document Server

Kok, Chi-Wah

2013-01-01

A practical overview of CMOS circuit design, this book covers the technology, analysis, and design techniques of voltage reference circuits.  The design requirements covered follow modern CMOS processes, with an emphasis on low power, low voltage, and low temperature coefficient voltage reference design. Dedicating a chapter to each stage of the design process, the authors have organized the content to give readers the tools they need to implement the technologies themselves. Readers will gain an understanding of device characteristics, the practical considerations behind circuit topology,

The effect of substrate bias voltages on impact resistance of CrAlN coatings deposited by modified ion beam enhanced magnetron sputtering

Science.gov (United States)

Chunyan, Yu; Linhai, Tian; Yinghui, Wei; Shebin, Wang; Tianbao, Li; Bingshe, Xu

2009-01-01

CrAlN coatings were deposited on silicon and AISI H13 steel substrates using a modified ion beam enhanced magnetron sputtering system. The effect of substrate negative bias voltages on the impact property of the CrAlN coatings was studied. The X-ray diffraction (XRD) data show that all CrAlN coatings were crystallized in the cubic NaCl B1 structure, with the (1 1 1), (2 0 0) (2 2 0) and (2 2 2) diffraction peaks observed. Two-dimensional surface morphologies of CrAlN coatings were investigated by atomic force microscope (AFM). The results show that with increasing substrate bias voltage the coatings became more compact and denser, and the microhardness and fracture toughness of the coatings increased correspondingly. In the dynamic impact resistance tests, the CrAlN coatings displayed better impact resistance with the increase of bias voltage, due to the reduced emergence and propagation of the cracks in coatings with a very dense structure and the increase of hardness and fracture toughness in coatings.

MOTOR ACCELERATION TIME OPTIMIZATION BY THE CHANGE OF THE SUPPLY VOLTAGE VALUE

Directory of Open Access Journals (Sweden)

G. K. Aslanov

2016-01-01

Full Text Available Abstract. It is proved that the deviation of the voltage from the nominal values, often leads to overheating of the motor windings, which reduces the insulation life to a great extent.The task of determining the change in the acceleration time of the motor depending on the switching time of its supply voltage is set. The modeling of DC motor 2ПН132М operation in the short- run changes in starting voltage from 380 V to 220 V - which is its nominal value-is carried out. By sweep method is determined the optimum time for switching the supply voltage of the motor. Mathematical dependencies and simulation results are presented. 

Secondary control for voltage unbalance compensation in an islanded microgrid

DEFF Research Database (Denmark)

Savaghebi, Mehdi; Guerrero, Josep M.; Jalilian, Alireza

2011-01-01

In this paper, the concept of secondary control is applied for voltage unbalance compensation in an islanded microgrid. The aim of the proposed control approach is to enhance the voltage quality at the point of common coupling (PCC). Unbalance compensation is achieved by proper control...... of distributed generators (DGs). The DGs control structure mainly consists of active and reactive power controllers, virtual impedance loop and voltage and current proportional-resonant controllers. Simulation results are presented for different cases. The results show the effectiveness of the proposed approach...

Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

Science.gov (United States)

Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

2018-01-01

Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

Enhancement in the interfacial perpendicular magnetic anisotropy and the voltage-controlled magnetic anisotropy by heavy metal doping at the Fe/MgO interface

Directory of Open Access Journals (Sweden)

Takayuki Nozaki

2018-02-01

Full Text Available We investigated the influence of heavy metal doping at the Fe/MgO interface on the interfacial perpendicular magnetic anisotropy (PMA and the voltage-controlled magnetic anisotropy (VCMA in magnetic tunnel junctions prepared by sputtering-based deposition. The interfacial PMA was increased by tungsten doping and a maximum intrinsic interfacial PMA energy, Ki,0 of 2.0 mJ/m2 was obtained. Ir doping led to a large increase in the VCMA coefficient by a factor of 4.7 compared with that for the standard Fe/MgO interface. The developed technique provides an effective approach to enhancing the interfacial PMA and VCMA properties in the development of voltage-controlled spintronic devices.

Improvement of stability of sinusoidally driven atmospheric pressure plasma jet using auxiliary bias voltage

Directory of Open Access Journals (Sweden)

Hyun-Jin Kim

2015-12-01

Full Text Available In this study, we have proposed the auxiliary bias pulse scheme to improve the stability of atmospheric pressure plasma jets driven by an AC sinusoidal waveform excitation source. The stability of discharges can be significantly improved by the compensation of irregular variation in memory voltage due to the effect of auxiliary bias pulse. From the parametric study, such as the width, voltage, and onset time of auxiliary bias pulse, it has been demonstrated that the auxiliary bias pulse plays a significant role in suppressing the irregular discharges caused by the irregular variation in memory voltage and stable discharge can be initiated with the termination of the auxiliary bias pulse. As a result of further investigating the effects of the auxiliary pulse scheme on the jet stability under various process conditions such as the distance between the jet head and the counter electrode, and carrier gas flow, the jet stability can be improved by adjusting the amplitude and number of the bias pulse depending on the variations in the process conditions.

E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

Science.gov (United States)

Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

2018-04-17

E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

Science.gov (United States)

Teverovsky, Alexander

2016-01-01

Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.

Technical and economic considerations of extra high voltage power transmission

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1966-09-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

Energy Technology Data Exchange (ETDEWEB)

Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

2015-07-07

Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

The Voltage-Sensing Domain of Kv7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants

Science.gov (United States)

Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

2010-01-01

Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499

The voltage-sensing domain of kv7.2 channels as a molecular target for epilepsy-causing mutations and anticonvulsants

Directory of Open Access Journals (Sweden)

Francesco eMiceli

2011-02-01

Full Text Available Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically-determined channelopathies affecting heart rhythm (arrhythmias, neuronal excitability (epilepsy, pain or skeletal muscle contraction (periodic paralysis. Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function.In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2-5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically-determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

Electrokinetic-enhanced phytoremediation of soils: status and opportunities.

Science.gov (United States)

Cameselle, Claudio; Chirakkara, Reshma A; Reddy, Krishna R

2013-10-01

Phytoremediation is a sustainable process in which green plants are used for the removal or elimination of contaminants in soils. Both organic and inorganic contaminants can be removed or degraded by growing plants by several mechanisms, namely phytoaccumulation, phytostabilization, phytodegradation, rhizofiltration and rhizodegradation. Phytoremediation has several advantages: it can be applied in situ over large areas, the cost is low, and the soil does not undergo significant damages. However, the restoration of a contaminated site by phytoremediation requires a long treatment time since the remediation depends on the growth and the biological cycles of the plant. It is only applicable for shallow depths within the reach of the roots, and the remediation efficiency largely depends on the physico-chemical properties of the soil and the bioavailability of the contaminants. The combination of phytoremediation and electrokinetics has been proposed in an attempt to avoid, in part, the limitations of phytoremediation. Basically, the coupled phytoremediation-electrokinetic technology consists of the application of a low intensity electric field to the contaminated soil in the vicinity of growing plants. The electric field may enhance the removal of the contaminants by increasing the bioavailability of the contaminants. Variables that affect the coupled technology are: the use of AC or DC current, voltage level and mode of voltage application (continuous or periodic), soil pH evolution, and the addition of facilitating agents to enhance the mobility and bioavailability of the contaminants. Several technical and practical challenges still remain that must be overcome through future research for successful application of this coupled technology at actual field sites. Copyright © 2013 Elsevier Ltd. All rights reserved.

The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

Energy Technology Data Exchange (ETDEWEB)

Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

2016-07-11

Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

Potentiation of glycine-gated NR1/NR3A NMDA receptors relieves Ca2+-dependent outward rectification

Directory of Open Access Journals (Sweden)

Christian Madry

2010-03-01

Full Text Available Glycine has diverse functions within the mammalian central nervous system. It inhibits postsynaptic neurons via strychnine-sensitive glycine receptors (GlyRs and enhances neuronal excitation through co-activation of N-methyl-D-aspartate (NMDA receptors. Classical Ca2+-permeable NMDA receptors are composed of glycine-binding NR1 and glutamate-binding NR2 subunits, and hence require both glutamate and glycine for efficient activation. In contrast, recombinant receptors composed of NR1 and the glycine binding NR3A and/or NR3B subunits lack glutamate binding sites and can be activated by glycine alone. Therefore these receptors are also named excitatory glycine receptors. Co-application of antagonists of the NR1 glycine-binding site or of the divalent cation Zn2+ markedly enhances the glycine responses of these receptors. To gain further insight into the properties of these glycine-gated NMDA receptors, we investigated their current-voltage (I-V dependence. Whole-cell current-voltage relations of glycine currents recorded from NR1/NR3B and NR1/NR3A/NR3B expressing oocytes were found to be linear under our recording conditions. In contrast, NR1/NR3A receptors displayed a strong outwardly rectifying I-V relation. Interestingly, the voltage-dependent inward current block was abolished in the presence of NR1 antagonists, Zn2+ or a combination of both. Further analysis revealed that Ca2+ (1.8 mM present in our recording solutions was responsible for the voltage-dependent inhibition of ion flux through NR1/NR3A receptors. Since physiological concentrations of the divalent cation Mg2+ did not affect the I-V dependence, our data suggest that relief of the voltage-dependent Ca2+ block of NR1/NR3A receptors by Zn2+ may be important for the regulation of excitatory glycinergic transmission, according to the Mg2+-block of conventional NR1/NR2 NMDA receptors.

Trap Healing for High-Performance Low-Voltage Polymer Transistors and Solution-Based Analog Amplifiers on Foil.

Science.gov (United States)

Pecunia, Vincenzo; Nikolka, Mark; Sou, Antony; Nasrallah, Iyad; Amin, Atefeh Y; McCulloch, Iain; Sirringhaus, Henning

2017-06-01

Solution-processed semiconductors such as conjugated polymers have great potential in large-area electronics. While extremely appealing due to their low-temperature and high-throughput deposition methods, their integration in high-performance circuits has been difficult. An important remaining challenge is the achievement of low-voltage circuit operation. The present study focuses on state-of-the-art polymer thin-film transistors based on poly(indacenodithiophene-benzothiadiazole) and shows that the general paradigm for low-voltage operation via an enhanced gate-to-channel capacitive coupling is unable to deliver high-performance device behavior. The order-of-magnitude longitudinal-field reduction demanded by low-voltage operation plays a fundamental role, enabling bulk trapping and leading to compromised contact properties. A trap-reduction technique based on small molecule additives, however, is capable of overcoming this effect, allowing low-voltage high-mobility operation. This approach is readily applicable to low-voltage circuit integration, as this work exemplifies by demonstrating high-performance analog differential amplifiers operating at a battery-compatible power supply voltage of 5 V with power dissipation of 11 µW, and attaining a voltage gain above 60 dB at a power supply voltage below 8 V. These findings constitute an important milestone in realizing low-voltage polymer transistors for solution-based analog electronics that meets performance and power-dissipation requirements for a range of battery-powered smart-sensing applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

DEFF Research Database (Denmark)

Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

2017-01-01

This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

Enhanced high voltage cyclability of LiCoO{sub 2} cathode by adopting poly[bis-(ethoxyethoxyethoxy)phosphazene] with flame-retardant property as an electrolyte additive for lithium-ion batteries

Energy Technology Data Exchange (ETDEWEB)

Zhou, Mingjiong; Qin, Chenyang; Liu, Zhen; Feng, Li; Su, Xiaoru; Chen, Yifeng [School of Materials Science and Chemical Engineering, Ningbo University, Fenghua Road 818, Ningbo, 315211 (China); Xia, Lan, E-mail: Lan.Xia@nottingham.edu.cn [Department of Chemical and Environmental Engineering, Faculty of Science and Engineering, Centre for Sustainable Energy Technologies (CSET), University of Nottingham Ningbo China, Taikang East Road 199, Ningbo, 315100 (China); Ningbo Institute of Materials Technology & Engineering (NIMTE), Chinese Academy of Science (CAS), Zhongguan West Road 1219, Ningbo, 315201 (China); Xia, Yonggao, E-mail: xiayg@nimte.ac.cn [Ningbo Institute of Materials Technology & Engineering (NIMTE), Chinese Academy of Science (CAS), Zhongguan West Road 1219, Ningbo, 315201 (China); Liu, Zhaoping [Ningbo Institute of Materials Technology & Engineering (NIMTE), Chinese Academy of Science (CAS), Zhongguan West Road 1219, Ningbo, 315201 (China)

2017-05-01

Highlights: • EEEP with electro-oxidable of the P-O bond can serves as a high-voltage additive. • EEEP tend to be electro-oxidized on LiCoO{sub 2} cathode prior to the solvents. • The high-voltage cyclability of LiCoO{sub 2} cathode is obviously improved using EEEP. - Abstract: Poly[bis-(ethoxyethoxyethoxy)phosphazene] (EEEP) with electro-oxidable of the P-O bond is prepared by a facile method and utilized as an electrolyte additive to enhance the cycling performance of LiCoO{sub 2} cathodes under high-voltage operations. We found that 5 wt.% EEEP made the blank electrolyte obviously reduce the flammability, as well as the capacity retention of Li/LiCoO{sub 2} half-cell assembling with the EEEP-containing electrolyte is elevated to 89.9% from 51.2% after 100 cycles at a high cutoff voltage of 4.4 V. The enhanced cycling performance of LiCoO{sub 2} cathode in the EEEP-containing electrolyte at a high potential should be ascribed to the formation of stable film on the cathode surface, resulting in suppression of the subsequent decomposition of electrolyte under high voltage working. The characterization from scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS) indicates that EEEP can be electrochemically oxidized to form a robust and protective film on LiCoO{sub 2}, and improve the interfacial stability of LiCoO{sub 2} cathode/electrolyte at high potentials.

Origin of Reduced Open-Circuit Voltage in Highly Efficient Small-Molecule-Based Solar Cells upon Solvent Vapor Annealing.

Science.gov (United States)

Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong

2018-03-07

In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.

Design and Tuning of Wind Power Plant Voltage Controller with Embedded Application of Wind Turbines and STATCOMs

DEFF Research Database (Denmark)

Petersen, Lennart; Kryezi, Fitim; Iov, Florin

2017-01-01

This study addresses a detailed design and tuning of a wind power plant voltage control with reactive power contribution of wind turbines and static synchronous compensators (STATCOMs). First, small-signal models of a single wind turbine and STATCOM are derived by using the state-space approach....... A complete phasor model of the entire wind power plant is constructed, being appropriate for voltage control assessment. An exemplary wind power plant located in the United Kingdom and the corresponding grid code requirements are used as a base case. The final design and tuning process of the voltage...... controller results in a guidance, proposed for this particular control architecture. It provides qualitative outcomes regarding the parametrisation of each individual control loop and how to adjust the voltage controller depending on different grid stiffnesses of the wind power plant connection...

Effects of doping and bias voltage on the screening in AAA-stacked trilayer graphene

Science.gov (United States)

Mohammadi, Yawar; Moradian, Rostam; Shirzadi Tabar, Farzad

2014-09-01

We calculate the static polarization of AAA-stacked trilayer graphene (TLG) and study its screening properties within the random phase approximation (RPA) in all undoped, doped and biased regimes. We find that the static polarization of undoped AAA-stacked TLG is a combination of the doped and undoped single-layer graphene static polarization. This leads to an enhancement of the dielectric background constant along a Thomas-Fermi screening with the Thomas-Fermi wave vector which is independent of carrier concentrations and a 1/r3 power law decay for the long-distance behavior of the screened Coulomb potential. We show that effects of a bias voltage can be taken into account by a renormalization of the interlayer hopping energy to a new bias-voltage-dependent value, indicating screening properties of AAA-stacked TLG can be tuned electrically. We also find that screening properties of doped AAA-stacked TLG, when μ exceeds √{2}γ, are similar to that of doped SLG only depending on doping. While for μ<√{2}γ, its screening properties are combination of SLG and AA-stacked bilayer graphene screening properties and they are determined by doping and the interlayer hopping energy.

Suppression of the high-frequency disturbances in low-voltage circuits caused by disconnector operation in high-voltage open-air substations

Energy Technology Data Exchange (ETDEWEB)

Savic, M.S.

1986-07-01

The switching off and on of small capacitive currents charging busbar capacitances, connection conductors and open circuit breakers with disconnectors causes high-frequency transients in high-voltage networks. In low voltage circuits, these transient processes induce dangerous overvoltages for the electronic equipment in the substation. A modified construction of the disconnector with a damping resistor was investigated. Digital simulation of the transient process in a high-voltage network during the arcing period between the disconnector contacts with and without damping resistor were performed. A significant decrease of the arcing duration and the decrease of the electromagnetic field magnitude in the vicinity of the operating disconnector were noticed. In the low voltage circuit protected with the surge arrester, the overvoltage magnitude was not affected by the damping resistor due to the arrester protection effect.

The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels

Science.gov (United States)

Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.

2005-01-01

All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

Science.gov (United States)

Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

2018-03-01

Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

Voltage-sensing phosphatase modulation by a C2 domain.

Science.gov (United States)

Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

2015-01-01

The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

High-voltage picoamperemeter

Energy Technology Data Exchange (ETDEWEB)

Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

2014-07-01

Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

Morphology-dependent enhancement of the pseudocapacitance of template-guided tunable polyaniline nanostructures

KAUST Repository

Chen, Wei

2013-07-25

Polyaniline is one of the most investigated conducting polymers as supercapacitor material for energy storage applications. The preparation of nanostructured polyaniline with well-controlled morphology is crucial to obtaining good supercapacitor performance. We present here a facile chemical process to produce polyaniline nanostructures with three different morphologies (i.e., nanofibers, nanospheres, and nanotubes) by utilizing the corresponding tunable morphology of MnO2 reactive templates. A growth mechanism is proposed to explain the evolution of polyaniline morphology based on the reactive templates. The morphology-induced improvement in the electrochemical performance of polyaniline pseudocapacitors is as large as 51% due to the much enhanced surface area and the porous nature of the template-guided polyaniline nanostructures. In addition, and for the first time, a redox-active electrolyte is applied to the polyaniline pseudocapacitors to achieve significant enhancement of pseudocapacitance. Compared to the conventional electrolyte, the enhancement of pseudocapacitance in the redox-active electrolyte is 49%-78%, depending on the specific polyaniline morphology, reaching the highest reported capacitance of 896 F/g for polyaniline full cells so far. © 2013 American Chemical Society.

Morphology-dependent enhancement of the pseudocapacitance of template-guided tunable polyaniline nanostructures

KAUST Repository

Chen, Wei; Baby, Rakhi Raghavan; Alshareef, Husam N.

2013-01-01

Polyaniline is one of the most investigated conducting polymers as supercapacitor material for energy storage applications. The preparation of nanostructured polyaniline with well-controlled morphology is crucial to obtaining good supercapacitor performance. We present here a facile chemical process to produce polyaniline nanostructures with three different morphologies (i.e., nanofibers, nanospheres, and nanotubes) by utilizing the corresponding tunable morphology of MnO2 reactive templates. A growth mechanism is proposed to explain the evolution of polyaniline morphology based on the reactive templates. The morphology-induced improvement in the electrochemical performance of polyaniline pseudocapacitors is as large as 51% due to the much enhanced surface area and the porous nature of the template-guided polyaniline nanostructures. In addition, and for the first time, a redox-active electrolyte is applied to the polyaniline pseudocapacitors to achieve significant enhancement of pseudocapacitance. Compared to the conventional electrolyte, the enhancement of pseudocapacitance in the redox-active electrolyte is 49%-78%, depending on the specific polyaniline morphology, reaching the highest reported capacitance of 896 F/g for polyaniline full cells so far. © 2013 American Chemical Society.

Systems and methods for process and user driven dynamic voltage and frequency scaling

Science.gov (United States)

Mallik, Arindam [Evanston, IL; Lin, Bin [Hillsboro, OR; Memik, Gokhan [Evanston, IL; Dinda, Peter [Evanston, IL; Dick, Robert [Evanston, IL

2011-03-22

Certain embodiments of the present invention provide a method for power management including determining at least one of an operating frequency and an operating voltage for a processor and configuring the processor based on the determined at least one of the operating frequency and the operating voltage. The operating frequency is determined based at least in part on direct user input. The operating voltage is determined based at least in part on an individual profile for processor.

Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter

Science.gov (United States)

Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.;

Secondary Droop for Frequency and Voltage Restoration in Microgrids

DEFF Research Database (Denmark)

Nutkani, Inam Ullah; Peng, Wang; Blaabjerg, Frede

2015-01-01

Droop based autonomous control offers several advantages such as communication independence, plug-n-play capability and enhanced reliability of the system. Despite these advantages, frequency and voltage of droop controlled microgrid varies with the load change which is one of the major drawback...... of the droop control. Presently, the frequency and voltage restoration in microgrid is achieved through secondary control using low bandwidth communication links. This paper presents secondary-droop based frequency and voltage restoration method which is fully autonomous and independent of communication links....... With the proposed method, the microgrid frequency and voltage can be restored back to nominal value without affecting the power sharing performance of the generation sources. The proposed scheme performance has been validated in simulation for several cases of active and reactive power load conditions....

Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement

International Nuclear Information System (INIS)

Boudjella, Aissa

2011-01-01

The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.

A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme

Science.gov (United States)

Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol

2018-02-01

We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.

Using arc voltage to locate the anode attachment in plasma arc cutting

International Nuclear Information System (INIS)

Osterhouse, D J; Heberlein, J V R; Lindsay, J W

2013-01-01

Plasma arc cutting is a widely used industrial process in which an electric arc in the form of a high velocity plasma jet is used to melt and blow away metal. The arc attaches inside the resulting cut slot, or kerf, where it both provides a large heat flux and determines the flow dynamics of the plasma. Knowledge of the position of the arc attachment is essential for understanding the phenomena present at the work piece. This work presents a new method of measuring the location of the arc attachment in which the arc voltage is measured during the cutting of a range of work piece thicknesses. The attachment location is then interpreted from the voltages. To support the validity of this method, the kerf shape, dross particle size and dross adhesion to the work piece are also observed. While these do not conclusively give an attachment location, they show patterns which are consistent with the attachment location found from the voltage measurements. The method is demonstrated on the cutting of mild steel, where the arc attachment is found to be stationary in the upper portion of the cut slot and in reasonable agreement with existing published findings. For a process optimized for the cutting of 12.7 mm mild steel, the attachment is found at a depth of 1.5–3.4 mm. For a slower process optimized for the cutting of 25.4 mm mild steel, the attachment is found at a depth of 3.4–4.8 mm, which enhances heat transfer further down in the kerf, allowing cutting of the thicker work piece. The use of arc voltage to locate the position of the arc attachment is unique when compared with existing methods because it is entirely independent of the heat distribution and visualization techniques. (paper)

Radiation effects on residual voltage of polyethylene films

International Nuclear Information System (INIS)

Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

1986-01-01

It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

Advanced DVR with Zero-Sequence Voltage Component and Voltage Harmonic Elimination for Three-Phase Three-Wire Distribution Systems

Directory of Open Access Journals (Sweden)

Margo P

2009-11-01

Full Text Available Dynamic Voltage Restorer (DVR is a power electronics device to protect sensitive load when voltage sag occurs. Commonly, sensitive loads are electronic-based devices which generate harmonics. The magnitude and phase of compensated voltage in DVR depend on grounding system and type of fault. If the system is floating, the zero sequence components do not appear on the load side. Meanwhile, in a neutral grounded system, voltage sag is extremely affected by zero sequence components. A blocking transformer is commonly installed in series with DVR to reduce the effect of zero sequence components. This paper proposes a new DVR control scheme that is capable of eliminating the blocking transformer and reducing harmonic distortion. The system uses fuzzy polar controller to replace the conventional PI or FL controller that is commonly used. By taking into account the zero sequence components in the controller design, the effects of zero sequence components can be compensated. Simulated results show the effectiveness of the proposed DVR controller

Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

Directory of Open Access Journals (Sweden)

E.F. Schwartz

2003-09-01

Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

Enhanced Corrosion Resistance and Interfacial Conductivity of TiC x/a-C Nanolayered Coatings via Synergy of Substrate Bias Voltage for Bipolar Plates Applications in PEMFCs.

Science.gov (United States)

Yi, Peiyun; Zhang, Weixin; Bi, Feifei; Peng, Linfa; Lai, Xinmin

2018-06-06

Proton-exchange membrane fuel cells are one kind of renewable and clean energy conversion device, whose metallic bipolar plates are one of the key components. However, high interfacial contact resistance and poor corrosion resistance are still great challenges for the commercialization of metallic bipolar plates. In this study, we demonstrated a novel strategy for depositing TiC x /amorphous carbon (a-C) nanolayered coatings by synergy of 60 and 300 V bias voltage to enhance corrosion resistance and interfacial conductivity. The synergistic effects of bias voltage on the composition, microstructure, surface roughness, electrochemical corrosion behaviors, and interfacial conductivity of TiC x /a-C coatings were explored. The results revealed that the columnar structures in the inner layer were suppressed and the surface became rougher with the 300 V a-C layer outside. The composition analysis indicated that the sp 2 content increased with an increase of 300 V sputtering time. Due to the synergy strategy of bias voltage, lower corrosion current densities were achieved both in potentiostatic polarization (1.6 V vs standard hydrogen electrode) and potentiodynamic polarization. With the increase of 300 V sputtering time, the interfacial conductivity was improved. The enhanced corrosion resistance and interfacial conductivity of the TiC x /a-C coatings would provide new opportunities for commercial bipolar plates.

CO-PRODUCT ENHANCEMENT AND DEVELOPMENT FOR THE MASADA OXYNOL PROCESS PROCESS

Energy Technology Data Exchange (ETDEWEB)

Donald V. Watkins

2010-06-14

The focus of this project was an overall process improvement through the enhancement of the co-product streams. The enhancement of the process operations and co-products will increase both ethanol production and the value of other process outputs and reduces the amount of waste byproducts. This leads to a more economical and environmentally sound alternative to landfill disposal of municipal solid waste (MSW). These enhancements can greatly increase the commercial potential for the production of ethanol from MSW by the Masada CES OxyNol process. Both technological and economical issues were considered for steps throughout the conversion process. The research efforts of this project are varied but synergistic. The project investigated many of the operations involved in the Masada process with the overall goal of process improvements. The general goal of the testing was to improve co-product quality, improve conversions efficiencies, minimize process losses, increase energy efficiency, and mitigate process and commercialization risks. The project was divided into 16 subtasks as described in general terms below. All these tasks are interrelated but not necessarily interdependent.

Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

Best voltage bias-flipping strategy towards maximum piezoelectric power generation

International Nuclear Information System (INIS)

Liang, Junrui; Chung, Henry Shu-Hung

2013-01-01

In piezoelectric energy harvesting (PEH) systems, energy extracted from piezoelectric structure can be increased by making piezoelectric voltage in phase with vibration velocity and raising the voltage amplitude. Such voltage manipulations can be realized by synchronously flipping the piezoelectric voltage with respect to a bias dc source at every displacement extremum. Given that net harvested energy is obtained by deducting dissipated energy from total extracted energy, a sophisticated voltage bias-flipping scheme, which can maximize extracted energy at low dissipative cost, is required towards harvested energy optimization. This paper extends the state of the art by proposing the best bias-flip strategy, which is delivered on conceptual synchronized multiple bias-flip (SMBF) interface circuits. The proposed strategy coordinates both requirements on larger voltage change in synchronized instant for more extracted energy and smaller voltage change in each bias-flip action for less dissipated energy. It not only leads to further enhancement of harvesting capability beyond existing solutions, but also provides an unprecedented physical insight on maximum achievable harvesting capability of PEH interface circuit

The Voltage-Sensing Domain of K(v)7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants.

Science.gov (United States)

Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

2011-01-01

Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

Current-voltage characteristics of individual conducting polymer nanotubes and nanowires

Institute of Scientific and Technical Information of China (English)

Long Yun-ze; Yin Zhi-Hua; Li Meng-Meng; Gu Chang-Zhi; Duvail Jean-Luc; Jin Ai-zi; Wan Mei-xiang

2009-01-01

We report the current-voltage (Ⅰ-Ⅴ) characteristics of individual polypyrrole nanotubes and poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires in a temperature range from 300 K to 2 K. Considering the complex structures of such quasi-one-dimensional systems with an array of ordered conductive regions separated by disordered barriers, we use the extended fluctuation-induced tunneling (FIT) and thermal excitation model (Kaiser expression) to fit the temperature and electric-field dependent Ⅰ-Ⅴ curves. It is found that the Ⅰ-Ⅴ data measured at higher temperatures or higher voltages can be well fitted by the Kaiser expression. However, the low-temperature data around the zero bias clearly deviate from those obtained from this model. The deviation (or zero-bias conductance suppression)could be possibly ascribed to the occurrence of the Coulomb-gap in the density of states near the Femi level and/or the enhancement of electron-electron interaction resulting from nanosize effects, which have been revealed in the previous studies on low-temperature electronic transport in conducting polymer films, pellets and nanostructures. In addition,similar Ⅰ-Ⅴ characteristics and deviation are also observed in an isolated K0.27MnO2 nanowire.

Glucose enhancement of memory depends on initial thirst.

Science.gov (United States)

Scholey, Andrew B; Sünram-Lea, Sandra I; Greer, Joanna; Elliott, Jade; Kennedy, David O

2009-12-01

This double-blind, placebo-controlled study examined the influence of appetitive state on glucose enhancement of memory. Participants rated their mood, hunger and thirst, then consumed a 25 g glucose drink or a matched placebo 20 min prior to a verbal memory task. There was a double dissociation when the effects of thirst ratings and drink on subsequent memory performance were considered. Those who were initially less thirsty recalled significantly more words following glucose than placebo; those who were more thirsty recalled significantly fewer words after glucose than placebo. Glucose enhancement of memory may therefore critically depend on participants' initial thirst.

ESTIMATION OF DECREASING LOSSES OF ACTIVE POWER IN TRANSFORMERS IN SETTING BATTERY OF LOW-VOLTAGE CAPACITORS

Directory of Open Access Journals (Sweden)

V. N. Radkevich

2014-01-01

Full Text Available This paper describes an estimation method of decreasing losses of active power in power transformers with voltage 10(6/0,4 kV after installation of devices of reactive power compensation on output side depending on voltage level, connected to capacity devices, taking into account dielectric loss in capacitors. Analysis of functional dependences was carried out. Investigation of function with a help of derivations was carried out. Points of function extremum and also its intervals of rise and fall rates were founded. This paper describes graphic investigation of obtained functional dependence, which is introduced by quartic polynominal. It is established that decreasing of losses of active power depends on technical parameters and load factor of transformer, coefficient of loading power of electricity consumers, voltage value connected to capacitor unit.Using obtained functional dependences, calculations for the main size-types of power transformers with voltage 10(6/0,4 kV serie ТМГ 11 and ТМГ12 were done. It is established that depending on technical characteristics of certain transformer, coefficient of its loading and power, there is a definite value of deviation of real voltage value from working voltage of capacitor installation when it will be observed positive technical and economical effect from installed capacitor battery unit. For taken value of loading coefficient and transformer’s power the maximum decrease of losses of active power takes place under voltage directed to capacitor unit, which is lower then nominal value. For all taken size-types of power transformers the argument of investigating function for its maximal value is out of standard permissible of voltage deviations from nominal value.These functional dependents can be used for preliminary calculations, which are needed for making decision on compensation of reactive power in electric power supply systems of industrial objects. Their consideration allows more

Development of a New Cascade Voltage-Doubler for Voltage Multiplication

OpenAIRE

Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

2014-01-01

For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

Notes on the voltage performance of accelerator tube sub-modules for the NSF tandem

International Nuclear Information System (INIS)

Eastham, D.A.; Groome, A.E.; Powell, P.

1978-01-01

Measurements are reported of the d.c. voltage performance of vacuum accelerator tube sub-modules for the Nuclear Structure Facility 30 MV Tandem at Daresbury. Using diagnostic techniques it has been possible to separate out the different processes in the tube which can lead to breakdown. As a result, improved sub-modules have been produced. Tests, have simulated the ion exchange processes which occur in longer tube lengths, and a better understanding has been obtained of the way in which these processes depend on the tube geometry and cleanliness. (U.K.)

Energy Storage Characteristic Analysis of Voltage Sags Compensation for UPQC Based on MMC for Medium Voltage Distribution System

Directory of Open Access Journals (Sweden)

Yongchun Yang

2018-04-01

Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.

Enhancement of striatum-dependent memory by conditioned fear is mediated by beta-adrenergic receptors in the basolateral amygdala

Directory of Open Access Journals (Sweden)

Travis D. Goode

2016-06-01

Full Text Available Emotional arousal can have a profound impact on various learning and memory processes. For example, unconditioned emotional stimuli (e.g., predator odor or anxiogenic drugs enhance dorsolateral striatum (DLS-dependent habit memory. These effects critically depend on a modulatory role of the basolateral complex of the amygdala (BLA. Recent work indicates that, like unconditioned emotional stimuli, exposure to an aversive conditioned stimulus (CS (i.e., a tone previously paired with shock can also enhance consolidation of DLS-dependent habit memory. The present experiments examined whether noradrenergic activity, particularly within the BLA, is required for a fear CS to enhance habit memory consolidation. First, rats underwent a fear conditioning procedure in which a tone CS was paired with an aversive unconditioned stimulus. Over the course of the next five days, rats received training in a DLS-dependent water plus-maze task, in which rats were reinforced to make a consistent body-turn response to reach a hidden escape platform. Immediately after training on days 1–3, rats received post-training systemic (Experiment 1 or intra-BLA (Experiment 2 administration of the β-adrenoreceptor antagonist, propranolol. Immediately after drug administration, half of the rats were re-exposed to the tone CS in the conditioning context (without shock. Post-training CS exposure enhanced consolidation of habit memory in vehicle-treated rats, and this effect was blocked by peripheral (Experiment 1 or intra-BLA (Experiment 2 propranolol administration. The present findings reveal that noradrenergic activity within the BLA is critical for the enhancement of DLS-dependent habit memory as a result of exposure to conditioned emotional stimuli.

Glucocorticoid enhancement of dorsolateral striatum-dependent habit memory requires concurrent noradrenergic activity.

Science.gov (United States)

Goodman, J; Leong, K-C; Packard, M G

2015-12-17

Previous findings indicate that post-training administration of glucocorticoid stress hormones can interact with the noradrenergic system to enhance consolidation of hippocampus- or amygdala-dependent cognitive/emotional memory. The present experiments were designed to extend these findings by examining the potential interaction of glucocorticoid and noradrenergic mechanisms in enhancement of dorsolateral striatum (DLS)-dependent habit memory. In experiment 1, different groups of adult male Long-Evans rats received training in two DLS-dependent memory tasks. In a cued water maze task, rats were released from various start points and were reinforced to approach a visibly cued escape platform. In a response-learning version of the water plus-maze task, animals were released from opposite starting positions and were reinforced to make a consistent egocentric body-turn to reach a hidden escape platform. Immediately post-training, rats received peripheral injections of the glucocorticoid corticosterone (1 or 3 mg/kg) or vehicle solution. In both tasks, corticosterone (3 mg/kg) enhanced DLS-dependent habit memory. In experiment 2, a separate group of animals received training in the response learning version of the water plus-maze task and were given peripheral post-training injections of corticosterone (3 mg/kg), the β-adrenoreceptor antagonist propranolol (3 mg/kg), corticosterone and propranolol concurrently, or control vehicle solution. Corticosterone injections again enhanced DLS-dependent memory, and this effect was blocked by concurrent administration of propranolol. Propranolol administration by itself (3 mg/kg) did not influence DLS-dependent memory. Taken together, the findings indicate an interaction between glucocorticoid and noradrenergic mechanisms in DLS-dependent habit memory. Propranolol administration may be useful in treating stress-related human psychopathologies associated with a dysfunctional DLS-dependent habit memory system. Copyright © 2015

Hysteresis analysis of graphene transistor under repeated test and gate voltage stress

International Nuclear Information System (INIS)

Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang

2014-01-01

The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Development of enhanced sulfur rejection processes

Energy Technology Data Exchange (ETDEWEB)

Yoon, R.H.; Luttrell, G.H.; Adel, G.T.; Richardson, P.E.

1996-03-01

Research at Virginia Tech led to the development of two complementary concepts for improving the removal of inorganic sulfur from many eastern U.S. coals. These concepts are referred to as Electrochemically Enhanced Sulfur Rejection (EESR) and Polymer Enhanced Sulfur Rejection (PESR) processes. The EESR process uses electrochemical techniques to suppress the formation of hydrophobic oxidation products believed to be responsible for the floatability of coal pyrite. The PESR process uses polymeric reagents that react with pyrite and convert floatable middlings, i.e., composite particles composed of pyrite with coal inclusions, into hydrophilic particles. These new pyritic-sulfur rejection processes do not require significant modifications to existing coal preparation facilities, thereby enhancing their adoptability by the coal industry. It is believed that these processes can be used simultaneously to maximize the rejection of both well-liberated pyrite and composite coal-pyrite particles. The project was initiated on October 1, 1992 and all technical work has been completed. This report is based on the research carried out under Tasks 2-7 described in the project proposal. These tasks include Characterization, Electrochemical Studies, In Situ Monitoring of Reagent Adsorption on Pyrite, Bench Scale Testing of the EESR Process, Bench Scale Testing of the PESR Process, and Modeling and Simulation.

Towards low-voltage organic thin film transistors (OTFTs with solution-processed high-k dielectric and interface engineering

Directory of Open Access Journals (Sweden)

Yaorong Su

2015-11-01

Full Text Available Although impressive progress has been made in improving the performance of organic thin film transistors (OTFTs, the high operation voltage resulting from the low gate capacitance density of traditional SiO2 remains a severe limitation that hinders OTFTs'development in practical applications. In this regard, developing new materials with high-k characteristics at low cost is of great scientific and technological importance in the area of both academia and industry. Here, we introduce a simple solution-based technique to fabricate high-k metal oxide dielectric system (ATO at low-temperature, which can be used effectively to realize low-voltage operation of OTFTs. On the other hand, it is well known that the properties of the dielectric/semiconductor and electrode/semiconductor interfaces are crucial in controlling the electrical properties of OTFTs. By optimizing the above two interfaces with octadecylphosphonic acid (ODPA self-assembled monolayer (SAM and properly modified low-cost Cu, obviously improved device performance is attained in our low-voltage OTFTs. Further more, organic electronic devices on flexible substrates have attracted much attention due to their low-cost, rollability, large-area processability, and so on. Basing on the above results, outstanding electrical performance is achieved in flexible devices. Our studies demonstrate an effective way to realize low-voltage, high-performance OTFTs at low-cost.

High performance of PbSe/PbS core/shell quantum dot heterojunction solar cells: short circuit current enhancement without the loss of open circuit voltage by shell thickness control.

Science.gov (United States)

Choi, Hyekyoung; Song, Jung Hoon; Jang, Jihoon; Mai, Xuan Dung; Kim, Sungwoo; Jeong, Sohee

2015-11-07

We fabricated heterojunction solar cells with PbSe/PbS core shell quantum dots and studied the precisely controlled PbS shell thickness dependency in terms of optical properties, electronic structure, and solar cell performances. When the PbS shell thickness increases, the short circuit current density (JSC) increases from 6.4 to 11.8 mA cm(-2) and the fill factor (FF) enhances from 30 to 49% while the open circuit voltage (VOC) remains unchanged at 0.46 V even with the decreased effective band gap. We found that the Fermi level and the valence band maximum level remain unchanged in both the PbSe core and PbSe/PbS core/shell with a less than 1 nm thick PbS shell as probed via ultraviolet photoelectron spectroscopy (UPS). The PbS shell reduces their surface trap density as confirmed by relative quantum yield measurements. Consequently, PbS shell formation on the PbSe core mitigates the trade-off relationship between the open circuit voltage and the short circuit current density. Finally, under the optimized conditions, the PbSe core with a 0.9 nm thick shell yielded a power conversion efficiency of 6.5% under AM 1.5.

A Transformerless Medium Voltage Multiphase Motor Drive System

Directory of Open Access Journals (Sweden)

Dan Wang

2016-04-01

Full Text Available A multiphase motor has several major advantages, such as high reliability, fault tolerance, and high power density. It is a critical issue to develop a reliable and efficient multiphase motor drive system. In this paper, a transformerless voltage source converter-based drive system for a medium-voltage (MV multiphase motor is proposed. This drive converter employs cascaded H-bridge rectifiers loaded by H-bridge inverters as the interface between the grid and multiphase motor. The cascaded H-bridge rectifier technique makes the drive system able to be directly connected to the MV grid without the phase-shifting transformer because it can offset the voltage level gap between the MV grid and the semiconductor devices, provide near-sinusoidal AC terminal voltages without filters, and draw sinusoidal line current from the grid. Based on a digital signal processor (DSP, a complete improved Phase Disposition Pulse Width Modulation (PD-PWM method is developed to ensure the individual DC-link capacitor voltage balancing for enhancing the controllability and limiting the voltage and power stress on the H-bridge cells. A downscaled prototype is designed and developed based on a nine-phase motor. The experimental results verify the excellent performances of the proposed drive system and control strategy in steady-state and variant-frequency startup operations.

Automatic Voltage Control (AVC) System under Uncertainty from Wind Power

DEFF Research Database (Denmark)

Qin, Nan; Abildgaard, Hans; Flynn, Damian

2016-01-01

An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...

Motivation enhances visual working memory capacity through the modulation of central cognitive processes.

Science.gov (United States)

Sanada, Motoyuki; Ikeda, Koki; Kimura, Kenta; Hasegawa, Toshikazu

2013-09-01

Motivation is well known to enhance working memory (WM) capacity, but the mechanism underlying this effect remains unclear. The WM process can be divided into encoding, maintenance, and retrieval, and in a change detection visual WM paradigm, the encoding and retrieval processes can be subdivided into perceptual and central processing. To clarify which of these segments are most influenced by motivation, we measured ERPs in a change detection task with differential monetary rewards. The results showed that the enhancement of WM capacity under high motivation was accompanied by modulations of late central components but not those reflecting attentional control on perceptual inputs across all stages of WM. We conclude that the "state-dependent" shift of motivation impacted the central, rather than the perceptual functions in order to achieve better behavioral performances. Copyright © 2013 Society for Psychophysiological Research.

Effect of secondary electron emission on subnanosecond breakdown in high-voltage pulse discharge

Science.gov (United States)

Schweigert, I. V.; Alexandrov, A. L.; Gugin, P.; Lavrukhin, M.; Bokhan, P. A.; Zakrevsky, Dm E.

2017-11-01

The subnanosecond breakdown in open discharge may be applied for producing superfast high power switches. Such fast breakdown in high-voltage pulse discharge in helium was explored both in experiment and in kinetic simulations. The kinetic model of electron avalanche development was developed using PIC-MCC technique. The model simulates motion of electrons, ions and fast helium atoms, appearing due to ions scattering. It was shown that the mechanism responsible for ultra-fast breakdown development is the electron emission from cathode. The photoemission and emission by ions or fast atoms impact is the main reason of current growth at the early stage of breakdown, but at the final stage, when the voltage on discharge gap drops, the secondary electron emission (SEE) is responsible for subnanosecond time scale of current growth. It was also found that the characteristic time of the current growth τS depends on the SEE yield of the cathode material. Three types of cathode material (titanium, SiC, and CuAlMg-alloy) were tested. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time as small as τS = 0.4 ns, for the pulse voltage amplitude of 5- 12 kV..

Nano silver diffusion behaviour on conductive polymer during doping process for high voltage application

Science.gov (United States)

Mohammad, A.; Mahmood, A.; Chin, K. T.; Danquah, M. K.; van Stratan, S.

2017-06-01

Conductive polymer had opened a new era of engineering for microelectronics and semiconductor applications. However, it is still a challenge for high voltage applications due to lower electrical conductivity compare to metals. This results tremendous energy losses during transmission and restricts its usage. In order to address such problem a novel method was investigated using nano silver particle doped iodothiophene since silver is the highest electrical conductive material. The experiments were carried out to study the organometallic diffusion behaviour of nanosilver doped iodothiophene with different concentration of iodothiophene. Five different mixing ratio between nanosilver and the solution of iodothiophene dissolved in diethyl ether were used which are 1:1.25, 1:1.5, 1:2.5, 1:3 and l:5. It was revealed that there is an effective threshold concentration of which the nano silver evenly distributed and there was no coagulation observed. These parameters laid the foundation of better doping process between the nano silver and the polymer significantly which would contribute developing conductive polymer towards high voltage application for industries that are vulnerable to corrosive environment.

Current-voltage-temperature characteristics of DNA origami

Energy Technology Data Exchange (ETDEWEB)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)

2009-04-29

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Current-voltage-temperature characteristics of DNA origami

International Nuclear Information System (INIS)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander

2009-01-01

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

Science.gov (United States)

Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

2016-04-01

We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

Wideband Electrostatic Vibration Energy Harvester (e-VEH) Having a Low Start-Up Voltage Employing a High-Voltage Integrated Interface

International Nuclear Information System (INIS)

Dudka, A; Galayko, D; Basset, P; Cottone, F; Blokhina, E

2013-01-01

This paper reports on an electrostatic Vibration Energy Harvester (e-VEH) system, for which the energy conversion process is initiated with a low bias voltage and is compatible with wideband stochastic external vibrations. The system employs the auto-synchronous conditioning circuit topology with the use of a novel dedicated integrated low-power high-voltage switch that is needed to connect the charge pump and flyback – two main parts of the used conditioning circuit. The proposed switch is designed and implemented in AMS035HV CMOS technology. Thanks to the proposed switch device, which is driven with a low-voltage ground-referenced logic, the e-VEH system may operate within a large voltage range, from a pre-charge low voltage up to several tens volts. With such a high-voltage e-VEH operation, it is possible to obtain a strong mechanical coupling and a high rate of vibration energy conversion. The used transducer/resonator device is fabricated with a batch-processed MEMS technology. When excited with stochastic vibrations having an acceleration level of 0.8 g rms distributed in the band 110–170 Hz, up to 0.75 μW of net electrical power has been harvested with our system. This work presents an important milestone in the challenge of designing a fully integrated smart conditioning interface for the capacitive e-VEHs

Applicability of anaerobic nitrate-dependent Fe(II) oxidation to microbial enhanced oil recovery (MEOR).

Science.gov (United States)

Zhu, Hongbo; Carlson, Han K; Coates, John D

2013-08-06

Microbial processes that produce solid-phase minerals could be judiciously applied to modify rock porosity with subsequent alteration and improvement of floodwater sweep in petroleum reservoirs. However, there has been little investigation of the application of this to enhanced oil recovery (EOR). Here, we investigate a unique approach of altering reservoir petrology through the biogenesis of authigenic rock minerals. This process is mediated by anaerobic chemolithotrophic nitrate-dependent Fe(II)-oxidizing microorganisms that precipitate iron minerals from the metabolism of soluble ferrous iron (Fe(2+)) coupled to the reduction of nitrate. This mineral biogenesis can result in pore restriction and reduced pore throat diameter. Advantageously and unlike biomass plugs, these biominerals are not susceptible to pressure or thermal degradation. Furthermore, they do not require continual substrate addition for maintenance. Our studies demonstrate that the biogenesis of insoluble iron minerals in packed-bed columns results in effective hydrology alteration and homogenization of heterogeneous flowpaths upon stimulated microbial Fe(2+) biooxidation. We also demonstrate almost 100% improvement in oil recovery from hydrocarbon-saturated packed-bed columns as a result of this metabolism. These studies represent a novel departure from traditional microbial EOR approaches and indicate the potential for nitrate-dependent Fe(2+) biooxidation to improve volumetric sweep efficiency and enhance both the quality and quantity of oil recovered.

Optimization of Passive Voltage Multipliers for Fast Start-up and Multi-voltage Power Supplies in Electromagnetic Energy Harvesting Systems

Science.gov (United States)

Yang, G.; Stark, B. H.; Burrow, S. G.; Hollis, S. J.

2014-11-01

This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up.

Optimization of Passive Voltage Multipliers for Fast Start-up and Multi-voltage Power Supplies in Electromagnetic Energy Harvesting Systems

International Nuclear Information System (INIS)

Yang, G; Stark, B H; Burrow, S G; Hollis, S J

2014-01-01

This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up

Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam

Science.gov (United States)

Andreev, Andrey

2005-10-01

The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.

A novel high voltage start up circuit for an integrated switched mode power supply

Energy Technology Data Exchange (ETDEWEB)

Hu Hao; Chen Xingbi, E-mail: huhao21@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2010-09-15

A novel high voltage start up circuit for providing an initial bias voltage to an integrated switched mode power supply (SMPS) is presented. An enhanced mode VDMOS transistor, the gate of which is biased by a floating p-island, is used to provide start up current and sustain high voltage. An NMOS transistor having a high source to ground breakdown voltage is included to extend the bias voltage range to the SMPS. Simulation results indicate that the high voltage start up circuit can start and restart as designed. The proposed structure is believed to be more energy saving and cost-effective compared with other solutions. (semiconductor devices)

Enhanced Decoupled Double Synchronous Reference Frame Current Controller for Unbalanced Grid-Voltage Conditions

DEFF Research Database (Denmark)

Reyes, M.; Rodriguez, Pedro; Vazquez, S.

2012-01-01

. In these codes, the injection of positive- and negative-sequence current components becomes necessary for fulfilling, among others, the low-voltage ride-through requirements during balanced and unbalanced grid faults. However, the performance of classical dq current controllers, applied to power converters......, under unbalanced grid-voltage conditions is highly deficient, due to the unavoidable appearance of current oscillations. This paper analyzes the performance of the double synchronous reference frame controller and improves its structure by adding a decoupling network for estimating and compensating...

First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment

Energy Technology Data Exchange (ETDEWEB)

König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)

2017-11-15

Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

Transient voltage sharing in series-coupled high voltage switches

Directory of Open Access Journals (Sweden)

Editorial Office

1992-07-01

Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

Depolarization-dependent 45Ca uptake by synaptosomes of rat cerebral cortex is enhanced by L-triiodothyronine

International Nuclear Information System (INIS)

Mason, G.A.; Walker, C.H.; Prange, A.J. Jr.

1990-01-01

Depolarization-induced release of neurotransmitters and other secretions from nerve endings is triggered by the rapid entry of Ca++ through voltage-sensitive channels. Calcium entry is thought to occur in two distinct phases or processes: a fast-phase response to an action potential, which initiates release; and a slow phase associated with extended stimulation of the neuron. Thyroid hormones are sequestered by nerve terminals and can produce changes in behaviour and mood. They may therefore be involved in modulating central synaptic transmission. We studied the effects of L-triiodothyronine (T3), L-thyroxine (T4), reverse T3 (rT3) and D-T3 on depolarization-induced uptake of 45Ca by synaptosomes from euthyroid and hypothyroid rats. T3, but not T4, rT3, or D-T3 significantly enhanced depolarization-induced 45Ca uptake at physiologically relevant (1 to 10 nmol/L) concentrations. The stimulatory effect of 10 nmol/L T3 on depolarization-induced uptake after 2 seconds (21%) was greater than after 5 (10%) or 30 (8%) seconds, indicating that T3 enhanced primarily the fast-phase process. There was no effect of T3 or other hormones tested on nondepolarization-induced 45Ca uptake. Preincubation of synaptosomes with T3 prior to depolarization did not enhance the effect of T3; in fact, preincubations of 30 seconds or more resulted in diminished T3 effects. Preincubation of synaptosomes for 15 seconds with D-T3 or the addition of D-T3 and T3 together reduced the effect of T3. We found no difference in the effect of T3 on 45Ca uptake by synaptosomes from euthyroid and hypothyroid rats. These results suggest a novel mechanism of action of thyroid hormones in the brain

Plasma diagnostics with electrostatic probes in the reactive low voltage ion plating process

International Nuclear Information System (INIS)

Lechleitner, T.; Huber, D.; Pulker, H.K.

2002-01-01

The analysis of cold plasmas, which are used in thin film coating techniques, is mainly important for the understanding of the correlation between the film properties and the plasma (or the process) parameters. With the knowledge of these correlations, one is able to optimise and eventually improve the coating processes for the production of films with certain desirable properties. The plasma for the reactive-low-voltage-ion-plating processes is a cold non-isothermal plasma produced by a low-pressure dc non-self sustained arc discharge, controlled by two main parameters, the arc current and the total gas pressure in the chamber. It was shown that the arc current is in a direct linear relation to the degree of ionization and the increase of the total gas pressure has a contrary effect. Besides, it was also demonstrated, that the usage of electrostatic probes for the plasma analysis od deposition processes is a powerful tool to complete the common plasma monitor measurements (energy analysing quadrupol mass spectrometer) and to improve the understanding of industrially used plasma. (nevyjel)

[Ion-dependency of the GABA-potentiating effects of benzodiazepine tranquilizers and harmane].

Science.gov (United States)

Abramets, I I; Komissarov, I V

1984-06-01

Experiments on an isolated spinal cord of 8-15-day-old rats have shown that one of the possible mechanisms of the GABA-potentiating action of the benzodiazepine tranquilizer, chlorodiazepoxide, may be a decrease in the intraneuronal concentration of Ca2+. This is evidenced by the enhancement of the GABA-potentiating action of chlorodiazepoxide under Ca2+ deficiency in the medium and in the presence of the blockers of the voltage-dependent Ca2+ ionic channels--Mn2+ and Co2+, and by the reduction of the effect in question under Ca2+ excess in the medium and in the presence of the K+ channels blockers--tetraethylammonium and 4-aminopyridine. The GABA-potentiating action of harmane is likely to be related to the blockade of the voltage-dependent K+ channels and elevation of the intracellular concentration of Ca2+.

Voltage-sensing phosphatase modulation by a C2 domain

Directory of Open Access Journals (Sweden)

Paul M. Castle

2015-04-01

Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

Luminescence and scintillation enhancement of Y2O3:Tm transparent ceramic through post-fabrication thermal processing

International Nuclear Information System (INIS)

Chapman, M.G.; Marchewka, M.R.; Roberts, S.A.; Schmitt, J.M.; McMillen, C.; Kucera, C.J.; DeVol, T.A.; Ballato, J.; Jacobsohn, L.G.

2015-01-01

The effects of post-fabrication thermal processing in O 2 flux on the luminescence and scintillation of a Y 2 O 3 :Tm transparent ceramic were investigated. The results showed that the strategy of post-fabrication processing can be beneficial to the performance of the ceramics, depending on the cumulative processing time. After the first hour of processing, about 40% enhancement in the luminescence output together with about 20% enhancement in the scintillation light yield were obtained. The enhancements were tentatively assigned to the incorporation of oxygen into vacancy sites. Longer cumulative processing times lead to the incorporation of oxygen as interstitials that is detrimental to scintillation light yield but not to luminescence output. This work also revealed that thermoluminescence measurements are a useful tool to predict scintillation light yield of Y 2 O 3 :Tm. - Highlights: • Scintillation and PL enhancement of transparent ceramics through thermal processing. • First thermoluminescence measurements of Y 2 O 3 :Tm above room temperature. • Observation of correlation between TL and scintillation light yield results

Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

International Nuclear Information System (INIS)

Kim, N.; Cheong, Y.; Song, W.

2010-01-01

We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

Voltage fluctuations in granular superconductors in the perpendicular configuration

International Nuclear Information System (INIS)

Gerashchenko, O V

2003-01-01

The spectral density of voltage fluctuations in granular YBa 2 Cu 3 O 7-δ superconductors in the perpendicular configuration has been studied in the flux flow mode. It has been found that, in this case, the 1/f-voltage noise observed depends weakly on temperature and is associated with motion of a magnetic flux in the superconductor. A comparison of the data obtained with the results of previous measurements in parallel configuration has shown that voltage noise is produced by a single common source, which is presumably associated with self-organization of the critical state in granular superconductors