Analysis of the current-voltage characteristics lineshapes of resonant tunneling diodes
International Nuclear Information System (INIS)
Rivera, P.H.; Schulz, P.A.
1996-01-01
It is discussed the influence of a two dimensional electron gas at the emitter-barrier interface on the current-voltage characteristics of a Ga As-Al Ga As double-barrier quantum well resonant tunneling diode. This effect is characterized by the modification of the space charge distribution along the structure. Within the framework of a self-consistent calculation we analyse the current-voltage characteristics of the tunneling diodes. This analysis permits us to infer different tunneling ways, related to the formation of confined states in the emitter region, and their signatures in the current-voltage characteristics. We show that varying the spacer layer, together with barrier heights, changes drastically the current density-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics reported in the literature. The general trend of experimental lineshapes can be reproduced and interpreted with our model. The possibility of tunneling paths is predicted for a range that has not yet been explored experimentally. (author). 12 refs., 4 figs
Current-Voltage Characteristics of Quasi-One-Dimensional Superconductors
DEFF Research Database (Denmark)
Vodolazov, D.Y.; Peeters, F.M.; Piraux, L.
2003-01-01
The current-voltage (I-V) characteristics of quasi-one-dimensional superconductors were discussed. The I-V characteristics exhibited an unusual S behavior. The dynamics of superconducting condensate and the existence of two different critical currents resulted in such an unusual behavior....
Voltage current characteristics of type III superconductors
International Nuclear Information System (INIS)
Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.
1980-01-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)
Voltage current characteristics of type III superconductors
Energy Technology Data Exchange (ETDEWEB)
Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii
1980-06-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.
Classification of methods for measuring current-voltage characteristics of semiconductor devices
Directory of Open Access Journals (Sweden)
Iermolenko Ia. O.
2014-06-01
Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.
Voltage-current characteristics of multiterminal HVDC-VSC for offshore wind farms
Energy Technology Data Exchange (ETDEWEB)
Gomis-Bellmunt, Oriol [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Universitat Politecnica de Catalunya UPC, Av. Diagonal, 647, Pl. 2., 08028 Barcelona (Spain); IREC Catalonia Institute for Energy Research, Barcelona (Spain); Liang, Jun; Ekanayake, Janaka; Jenkins, Nicholas [School of Engineering, Cardiff University, Queen' s Buildings, The Parade, Cardiff CF24 3AA, Wales (United Kingdom)
2011-02-15
Voltage-current characteristics and equilibrium points for the DC voltages of multiterminal HVDC systems using voltage source converters are discussed. The wind farm rectifiers and grid connected inverters are analyzed through their operating modes, governing equations and graphical characteristics. Using the converter equations and the HVDC grid conductance matrix the equilibrium voltages and currents are found. Case studies are presented considering wind power generation, loss of a converter and voltage sags in the AC grid. (author)
Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation
Directory of Open Access Journals (Sweden)
N Hatefi Kargan
2013-09-01
Full Text Available In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.
Dynamic voltage-current characteristics for a water jet plasma arc
International Nuclear Information System (INIS)
Yang Jiaxiang; Lan Sheng; Xu Zuoming
2008-01-01
A virtual instrument technology is used to measure arc current, arc voltage, dynamic V-I characteristics, and nonlinear conductance for a cone-shaped water jet plasma arc under ac voltage. Experimental results show that ac arc discharge mainly happens in water vapor evaporated from water when heated. However, due to water's cooling effect and its conductance, arc conductance, reignition voltage, extinguish voltage, and current zero time are very different from those for ac arc discharge in gas work fluid. These can be valuable to further studies on mechanism and characteristics of plasma ac discharge in water, and even in gas work fluid
Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam
Andreev, Andrey
2005-10-01
The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.
Branching in current-voltage characteristics of intrinsic Josephson junctions
International Nuclear Information System (INIS)
Shukrinov, Yu M; Mahfouzi, F
2007-01-01
We study branching in the current-voltage characteristics of the intrinsic Josephson junctions of high-temperature superconductors in the framework of the capacitively coupled Josephson junction model with diffusion current. A system of dynamical equations for the gauge-invariant phase differences between superconducting layers for a stack of ten intrinsic junctions has been numerically solved. We have obtained a total branch structure in the current-voltage characteristics. We demonstrate the existence of a 'breakpoint region' on the current-voltage characteristics and explain it as a result of resonance between Josephson and plasma oscillations. The effect of the boundary conditions is investigated. The existence of two outermost branches and correspondingly two breakpoint regions for the periodic boundary conditions is shown. One branch, which is observed only at periodic boundary conditions, corresponds to the propagating of the plasma mode. The second one corresponds to the situation when the charge oscillations on the superconducting layers are absent, excluding the breakpoint. A time dependence of the charge oscillations at breakpoints is presented
Current-voltage-temperature characteristics of DNA origami
Energy Technology Data Exchange (ETDEWEB)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)
2009-04-29
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Current-voltage-temperature characteristics of DNA origami
International Nuclear Information System (INIS)
Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander
2009-01-01
The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.
Current-voltage characteristics of C70 solid near Meyer-Neldel temperature
Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru
2017-06-01
The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.
Sturiale, A.; Li, H. B. T.; Rath, J.K.; Schropp, R.E.I.; Rubinelli, F.A.
2009-01-01
The transport mechanisms controlling the forward dark current-voltage characteristic of the silicon micromorph tandem solar cell were investigated with numerical modeling techniques. The dark current-voltage characteristics of the micromorph tandem structure at forward voltages show three regions:
Voltage current characteristics of type III superconductors
Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.
1980-06-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.
Features of current-voltage characteristic of nonequilibrium trench MOS barrier Schottky diode
Mamedov, R. K.; Aslanova, A. R.
2018-06-01
The trench MOS barrier Schottky diodes (TMBS diode) under the influence of the voltage drop of the additional electric field (AEF) appearing in the near-contact region of the semiconductor are in a nonequilibrium state and their closed external circuit flows currents in the absence of an external voltage. When an external voltage is applied to the TMBS diode, the current transmission is described by the thermionic emission theory with a specific feature. Both forward and reverse I-V characteristics of the TMBS diode consist of two parts. In the initial first part of the forward I-V characteristic there are no forward currents, but reverse saturation currents flow, in its subsequent second part the currents increase exponentially with the voltage. In the initial first part of the reverse I-V characteristic, the currents increase in an abrupt way and in the subsequent second part the saturation currents flow under the action of the image force. The mathematical expressions for forward and reverse I-V characteristic of the TMBS diode and also narrow or nanostructure Schottky diode are proposed, which are in good agreement with the results of experimental and calculated I-V characteristics.
Simulation of forward dark current voltage characteristics of tandem solar cells
International Nuclear Information System (INIS)
Rubinelli, F.A.
2012-01-01
The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
Current-voltage characteristics of carbon nanotubes with substitutional nitrogen
DEFF Research Database (Denmark)
Kaun, C.C.; Larade, B.; Mehrez, H.
2002-01-01
unit cell generates a metallic transport behavior. Nonlinear I-V characteristics set in at high bias and a negative differential resistance region is observed for the doped tubes. These behaviors can be well understood from the alignment/mis-alignment of the current carrying bands in the nanotube leads......We report ab initio analysis of current-voltage (I-V) characteristics of carbon nanotubes with nitrogen substitution doping. For zigzag semiconducting tubes, doping with a single N impurity increases current flow and, for small radii tubes, narrows the current gap. Doping a N impurity per nanotube...
Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films
International Nuclear Information System (INIS)
Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David
2007-01-01
We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching
International Nuclear Information System (INIS)
Shukrinov, Yu.M.; Mahfouzi, F.
2006-01-01
We study the current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors by numerical calculations and in framework of capacitively coupled Josephson junctions model we obtain the total number of branches. The influence of the coupling parameter α on the current-voltage characteristics at fixed parameter β (β 2 1/β c , where β c is McCumber parameter) and the influence of α on β-dependence of the current-voltage characteristics are investigated. We obtain the α-dependence of the branch's slopes and branch's endpoints. The presented results show new features of the coupling effect on the scheme of hysteresis jumps in current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors
Current-voltage characteristics of porous-silicon structures
International Nuclear Information System (INIS)
Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.
1996-01-01
I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described
Chattopadhyay, P.
1994-10-01
The role of discrete localized states on the current-voltage characteristics of metal-semiconductor contact is examined. It is seen that, because of these localized states, the logarithmic current vs voltage characteristics become nonlinear. Such nonlinearity is found sensitive to the temperature, and the energy and density of the localized states. The predicted temperature dependence of barrier height and the current-voltage characteristics are in agreement with the experimental results of Aboelfotoh [ Phys. Rev. B39, 5070 (1989)].
Energy Technology Data Exchange (ETDEWEB)
Jiang, C.; Samnakay, R.; Balandin, A. A., E-mail: balandin@ee.ucr.edu [Nano-Device Laboratory (NDL), Department of Electrical Engineering, Bourns College of Engineering, University of California—Riverside, Riverside, California 92521 (United States); Phonon Optimized Engineered Materials (POEM) Center, Materials Science and Engineering Program, University of California—Riverside, Riverside, California 92521 (United States); Rumyantsev, S. L. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Ioffe Physical-Technical Institute, St. Petersburg 194021 (Russian Federation); Shur, M. S. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)
2015-02-14
We report on fabrication of MoS{sub 2} thin-film transistors (TFTs) and experimental investigations of their high-temperature current-voltage characteristics. The measurements show that MoS{sub 2} devices remain functional to temperatures of at least as high as 500 K. The temperature increase results in decreased threshold voltage and mobility. The comparison of the direct current (DC) and pulse measurements shows that the direct current sub-linear and super-linear output characteristics of MoS{sub 2} thin-films devices result from the Joule heating and the interplay of the threshold voltage and mobility temperature dependences. At temperatures above 450 K, a kink in the drain current occurs at zero gate voltage irrespective of the threshold voltage value. This intriguing phenomenon, referred to as a “memory step,” was attributed to the slow relaxation processes in thin films similar to those in graphene and electron glasses. The fabricated MoS{sub 2} thin-film transistors demonstrated stable operation after two months of aging. The obtained results suggest new applications for MoS{sub 2} thin-film transistors in extreme-temperature electronics and sensors.
International Nuclear Information System (INIS)
Kim, H. C.; Kim, H. T.; Cho, S. D.; Song, S. J.; Kim, Y. C.; Kim, S. K.; Chi, S. S.; Kim, D. J.; Kim, D. M.
2002-01-01
Based on the photonic high-frequency capacitance-voltage (HF-CV) response of MOS capacitors, a new characterization method is reported for the analysis of interface states in MOS systems. An optical source with a photonic energy less than the silicon band-gap energy (hv g ) is employed for the photonic HF-CV characterization of interface states distributed in the photoresponsive energy band (E C - hv t C ). If a uniform distribution of trap levels is assumed, the density of interface states (D it ) in the photoresponsive energy band of MOS capacitors, characterized by the new photonic HF-CV method, was observed to be D it = 1 ∼ 5 x 10 11 eV -1 cm -2 . Photonic current-voltage characteristics (I D - V GS , V DS ) of MOSFETs, which are under control of the photoconductive and the photovoltaic effects, are also investigated under optical illumination
Current-voltage characteristic of a Josephson junction with randomly distributed Abrikosov vortices
International Nuclear Information System (INIS)
Fistul, M.V.; Giuliani, G.F.
1997-01-01
We have developed a theory of the current-voltage characteristic of a Josephson junction in the presence of randomly distributed, pinned misaligned Abrikosov vortices oriented perpendicularly to the junction plane. Under these conditions the Josephson phase difference var-phi acquires an interesting stochastic dependence on the position in the plane of the junction. In this situation it is possible to define an average critical current which is determined by the spatial correlations of this function. Due to the inhomogeneity, we find that for finite voltage bias the electromagnetic waves propagating in the junction display a broad spectrum of wavelengths. This is at variance with the situation encountered in homogeneous junctions. The amplitude of these modes is found to decrease as the bias is increased. We predict that the presence of these excitations is directly related to a remarkable feature in the current-voltage characteristic. The dependence of the position and the magnitude of this feature on the vortex concentration has been determined. copyright 1997 The American Physical Society
Current-voltage characteristics of dendrimer light-emitting diodes
International Nuclear Information System (INIS)
Stevenson, S G; Samuel, I D W; Staton, S V; Knights, K A; Burn, P L; Williams, J H T; Walker, Alison B
2010-01-01
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Current-voltage characteristics of dendrimer light-emitting diodes
Stevenson, S. G.; Samuel, I. D. W.; Staton, S. V.; Knights, K. A.; Burn, P. L.; Williams, J. H. T.; Walker, Alison B.
2010-09-01
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Current-voltage characteristics of dendrimer light-emitting diodes
Energy Technology Data Exchange (ETDEWEB)
Stevenson, S G; Samuel, I D W [Organic Semiconductor Centre, SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, Fife, KY16 9SS (United Kingdom); Staton, S V; Knights, K A; Burn, P L [Department of Chemistry, Chemistry Research Laboratory, 12 Mansfield Road, Oxford, OX1 3TA (United Kingdom); Williams, J H T; Walker, Alison B, E-mail: a.b.walker@bath.ac.u [Department of Physics, University of Bath, Bath, BA2 7AY (United Kingdom)
2010-09-29
We have investigated current-voltage (I-V) characteristics of unipolar and bipolar organic diodes that use phosphorescent dendrimers as the emissive organic layer. Through simulation of the measured I-V characteristics we were able to determine the device parameters for each device structure studied, leading to a better understanding of injection and transport behaviour in these devices. It was found that the common practice of assuming injection barriers are equal to the difference between bare electrode work functions and molecular orbital levels is unsuitable for the devices considered here, particularly for gold contacts. The studies confirm that different aromatic units in the dendrons can give significant differences in the charge transporting properties of the dendrimers.
Current voltage characteristics of composite superconductors with high contact resistance
International Nuclear Information System (INIS)
Akhmetov, A.A.; Baev, V.P.
1984-01-01
An experimental study has been made of current-voltage characteristics of composite superconductors with contact resistance between superconducting filaments and normal metal with high electrical conductivity. It is shown that stable resistive states exist in such conductors over a wide range of currents. The presence of resistive states is interpreted in terms of the resistive domain concept. The minimum and maximum currents of resistive states are found to be dependent on the electrical resistance of normal metal and magnetic field. (author)
Current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization
International Nuclear Information System (INIS)
Stoyanov, D G
2007-01-01
The balances of particles and charges in the volume of parallel-plane ionization chamber are considered. Differential equations describing the distribution of current densities in the chamber volume are obtained. As a result of the differential equations solution an analytical form of the current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization in the volume is obtained
Current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization
Energy Technology Data Exchange (ETDEWEB)
Stoyanov, D G [Faculty of Engineering and Pedagogy in Sliven, Technical University of Sofia, 59, Bourgasko Shaussee Blvd, 8800 Sliven (Bulgaria)
2007-08-15
The balances of particles and charges in the volume of parallel-plane ionization chamber are considered. Differential equations describing the distribution of current densities in the chamber volume are obtained. As a result of the differential equations solution an analytical form of the current-voltage characteristic of parallel-plane ionization chamber with inhomogeneous ionization in the volume is obtained.
Energy Technology Data Exchange (ETDEWEB)
Venkattraman, Ayyaswamy [Department of Applied Mechanics, Indian Institute of Technology Madras, Chennai 600036 (India)
2013-11-15
The post-breakdown characteristics of field emission driven microplasma are studied theoretically and numerically. A cathode fall model assuming a linearly varying electric field is used to obtain equations governing the operation of steady state field emission driven microplasmas. The results obtained from the model by solving these equations are compared with particle-in-cell with Monte Carlo collisions simulation results for parameters including the plasma potential, cathode fall thickness, ion number density in the cathode fall, and current density vs voltage curves. The model shows good overall agreement with the simulations but results in slightly overpredicted values for the plasma potential and the cathode fall thickness attributed to the assumed electric field profile. The current density vs voltage curves obtained show an arc region characterized by negative slope as well as an abnormal glow discharge characterized by a positive slope in gaps as small as 10 μm operating at atmospheric pressure. The model also retrieves the traditional macroscale current vs voltage theory in the absence of field emission.
International Nuclear Information System (INIS)
Venkattraman, Ayyaswamy
2013-01-01
The post-breakdown characteristics of field emission driven microplasma are studied theoretically and numerically. A cathode fall model assuming a linearly varying electric field is used to obtain equations governing the operation of steady state field emission driven microplasmas. The results obtained from the model by solving these equations are compared with particle-in-cell with Monte Carlo collisions simulation results for parameters including the plasma potential, cathode fall thickness, ion number density in the cathode fall, and current density vs voltage curves. The model shows good overall agreement with the simulations but results in slightly overpredicted values for the plasma potential and the cathode fall thickness attributed to the assumed electric field profile. The current density vs voltage curves obtained show an arc region characterized by negative slope as well as an abnormal glow discharge characterized by a positive slope in gaps as small as 10 μm operating at atmospheric pressure. The model also retrieves the traditional macroscale current vs voltage theory in the absence of field emission
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
Study of current-voltage characteristics in PbTe(Ga) alloys at low temperatures
International Nuclear Information System (INIS)
Akimov, B.A.; Albul, A.V.; Bogdanov, E.V.
1992-01-01
Results of determining current-voltage characteristics in PbTe(Ga) monocrystals of n- and p-types of conductivity in strong electric fields E ≤ 2 x 10 3 V/Cm at 4.2-77 K are presented. It was established that at helium and nitrogen temperatures, the current-voltage characteristics of PbTe(Ga) alloys, high-ohmic state of which was realized in helium, differed qualitatively from ones, typical for unalloyed PbTe. The superlinear dependence, observed in the fields, beginning from E ≥ 1 V/cm, is explained in the framework of concepts of strong electric field effect on conductivity of impurity states
Special features of the current-voltage characteristics of short superconducting bridges
International Nuclear Information System (INIS)
Zhilinskii, S.; Latyshev, Y.; Nad', F.
1981-01-01
A study was made of variable-thickness superconducting bridges made of tin and indium. The current-voltage characteristics were determined for these bridges as a function of their length and width. The characteristics exhibited a linear region as well as an inflection. The temperature of the appearance of such an inflection depended on the length of the bridge but was independent of the bridge material
The dynamic current-voltage characteristic as a powerful tool to analyze fast phenomena in plasma
International Nuclear Information System (INIS)
Ivan, L. M.; Mihai-Plugaru, M.; Amarandei, G.; Aflori, M.; Dimitriu, D. G.
2006-01-01
The static current-voltage characteristic of an electrode immersed in plasma is obtained by slowly increasing and subsequently decreasing the potential on the electrode with respect to the plasma potential or the ground. This characteristic can give us important information about the phenomena that take place in front of the electrode. Current jumps can be evidenced which were often associated with an hysteresis effect, regions with S-type or N-type negative differential resistance, etc. The method is always used when we investigate the appearance of complex space charge configurations (CSCC) in front of an electrode immersed in plasma. However, to investigate the dynamics of such structures or other fast phenomena (like instabilities) which take place in plasma devices with frequencies of tenth, hundred kHz or more, complex investigation techniques must be used. One of the most efficient methods to investigate fast phenomena in plasma devices is the dynamic current-voltage characteristic. This is obtained by recording the time series of the current collected by the electrode when the voltage applied on it is very fast modified (most likely increased) by using a signal generator. In this way, very fast oscillations of the current can be recorded and new phenomena can be evidenced. We used this technique to study the phenomena which take place at the onset of electrostatic instabilities in Q-machine plasma, namely the potential relaxation instability (PRI) and the electrostatic ion-cyclotron instability (EICI). The obtained experimental results prove that the negative differential resistance region in the static current-voltage characteristic is the result of a nonlinear dynamics of a CSCC in form of a double layer (DL) which takes place just before the onset of the instabilities. In the case of the PRI we emphasized current jumps related with the DL appearance, which are not present in the static current-voltage characteristic at high plasma density. (authors)
Energy Technology Data Exchange (ETDEWEB)
Boix, Pablo P.; Guerrero, Antonio; Garcia-Belmonte, Germa; Bisquert, Juan [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain); Marchesi, Luis F. [Laboratorio Interdisciplinar de, Eletroquimica e Ceramica (LIEC), Universidade Federal de Sao Carlos (Brazil); Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain)
2011-11-15
A connection is established between recombination and series resistances extracted from impedance spectroscopy and current-voltage curves of polythiophene:fullerene organic solar cells. Recombination is shown to depend exclusively on the (Fermi level) voltage, which allows construction of the current-voltage characteristics in any required conditions based on a restricted set of measurements. The analysis highlights carrier recombination current as the determining mechanism of organic solar cell performance. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Calculation of DC Arc Plasma Torch Voltage- Current Characteristics Based on Steebeck Model
International Nuclear Information System (INIS)
Gnedenko, V.G.; Ivanov, A.A.; Pereslavtsev, A.V.; Tresviatsky, S.S.
2006-01-01
The work is devoted to the problem of the determination of plasma torches parameters and power sources parameters (working voltage and current of plasma torch) at the predesigning stage. The sequence of calculation of voltage-current characteristics of DC arc plasma torch is proposed. It is shown that the simple Steenbeck model of arc discharge in cylindrical channel makes it possible to carry out this calculation. The results of the calculation are confirmed by the experiments
Comment on: "Current-voltage characteristics and zero-resistance state in 2DEG"
Cheremisin, M. V.
2003-01-01
We demonstrate that N(S)-shape current-voltage characteristics proposed to explain zero-resistance state in Corbino(Hall bar) geometry 2DEG (cond-mat/0302063, cond-mat/0303530) cannot account essential features of radiation-induced magnetoresistance oscillations experiments.
International Nuclear Information System (INIS)
Minasyants, M.Kh.; Badalyan, G. G.; Shahinian, A. A.
1997-01-01
The effect of electric and magnetic fields on current-voltage characteristics is studied for the lamellar phase in the lyotropic liquid-crystal sodium pentadecylsulfonate (SPDS)-water and lecithin-water systems. It has been found that the current-voltage characteristics of both systems have hysteresis. In the case of ionogenic SPDS, the hysteresis is formed due to ion current caused by the spatial reorientation of domains consisting of parallel lamellar fragments; in the case of lecithin, whose molecules contain dipoles, the hysteresis is formed due to the spatial reorientation of domains caused by the interaction of the resultant dipole moment of the domains with the electric field. It is shown that the introduction into lamellae of cetylpyridine bromide, which has an intrinsic magnetic moment, changes the resultant magnetic moment of domains and, thus, also the hysteresis loop of the current-voltage characteristic. The systems studied show the 'memory' effect with respect to both the electric and magnetic fields. Field-induced processes of domain reorientation were recorded by the method of small-angle x-ray scattering
Popov, E. O.; Kolosko, A. G.; Filippov, S. V.; Romanov, P. A.; Terukov, E. I.; Shchegolkov, A. V.; Tkachev, A. G.
2017-12-01
We received and compared the current-voltage characteristics of large-area field emitters based on nanocomposites with graphene and nanotubes. The characteristics were measured in two high voltage scanning modes: the "slow" and the "fast". Correlation between two types of hysteresis observed in these regimes was determined. Conditions for transition from "reverse" hysteresis to the "direct" one were experimentally defined. Analysis of the eight-shaped hysteresis was provided with calculation of the effective emission parameters. The phenomenological model of adsorption-desorption processes in the field emission system was proposed.
Calculation of current-voltage characteristics of electron-capture detectors
International Nuclear Information System (INIS)
Hinneburg, D.; Grosse, H.J.; Leonhardt, J.; Popp, P.
1983-01-01
Starting from the law of conservation of charge a stationary one-dimensional non-linear differential equation system is derived, which is applied to the direct-current mode of an electron-capture detector with parallel electrode plates. The theory takes into account space-charge, recombination, and inhomogeneous ionization and it deals with three kinds of charge carriers with different mobilities (positive and negative ions, electrons). Terms due to diffusion and gas-flow losses are excluded. The equations so constructed were programmed to get a means of calculating the charge and field distributions and the current-voltage characteristics as functions of various parameters of the detectors, the attaching gas and the ionization. For two cases the results are given. (author)
Singularities of current-voltage characteristics of GaAs films fabricated by pulsed ions ablation
International Nuclear Information System (INIS)
Kabyshev, A.V.; Konusov, F.V.; Lozhnikov, S.N.; Remnev, G.E.; Saltymakov, M.S.
2009-01-01
A singularities and advantages of the optical, photoelectric and electrical properties of GaAs in comparison with other available materials for electronics, for example, silicon allow to manufacture on it base the devices having an advanced characteristics. The GaAs for electronics, obtained from the dense ablation plasma, possess some preferences as compared to material manufactured by traditional methods of vacuum deposition. The electrical characteristics of GaAs produced by chemical deposition were extensively studied. Purpose of this work is investigation the current-voltage characteristics of thin films of GaAs, deposited on polycrystalline corundum (polycor) from plasma forming the power ions bunch and determination of the thermal vacuum annealing effect on photoelectric and electrical properties of films. Peculiarities of optical, photoelectric and current-voltage characteristics of films obtained by ions ablation are determined by deposition conditions and resistance of initial target GaAs. The transitions between the states with low- and high conduction were revealed directly after deposition in films having the optical properties similar to amorphous materials and/or after annealing in films with properties similar to initial target GaAs. Behavior of current-voltage characteristics at vacuum annealing correlates with Schottky barrier height and photosensitivity and is accompanies of the transport mechanism change. The stable properties of films are formed at its dark conduction 10 -10 -10 -8 s and after annealing at T an =600-700 K. (authors)
Voltage-current characteristics of a pin-plate system with different plate configurations
International Nuclear Information System (INIS)
Feng, Zhuangbo; Long, Zhengwei
2013-01-01
In this paper, the voltage-current (V-I) characteristics of a pin-plate system with four types of collection plate configurations are studied experimentally. The collection plates consider a single metal plate, a metal plate with a fly ash cake layer, a metal plate with a clean filter media and a metal plate with a dirty filter media. The results show that the clean filter media has no obvious effect on the V-I characteristics. But the dirty filter media reduces the current density because of its high resistance. The thick fly ash cake layer increase current density because of the anti-corona effect but the increment is not very obvious.
Nonlinear current-voltage characteristics of WO3-x nano-/micro-rods
Shen, Zhenguang; Peng, Zhijian; Zhao, Zengying; Fu, Xiuli
2018-04-01
A series of crystalline tungsten oxide nano-/micro-rods with different compositions of WO3, WO2.90, W19O55 (WO2.89) and W18O49 (WO2.72) but identical morphology feature were first prepared. Then, various nanoscaled electrical devices were fabricated from them by micro-fabrication through a focused ion beam technique. Interestingly, the devices from the oxygen-deficient WO3-x display significantly nonlinear current-voltage characteristics. The calculated nonlinear coefficients of the WO2.90, WO2.83, and WO2.72 varistors are 2.52, 3.32 and 4.91, respectively. The breakdown voltage of the WO2.90, WO2.83, and WO2.72 varistors are 1.93, 1.28 and 0.93 V, respectively. Such WO3-x nano-varistors might be promising for low-voltage electrical/electronic devices.
Current-voltage characteristics of individual conducting polymer nanotubes and nanowires
Institute of Scientific and Technical Information of China (English)
Long Yun-ze; Yin Zhi-Hua; Li Meng-Meng; Gu Chang-Zhi; Duvail Jean-Luc; Jin Ai-zi; Wan Mei-xiang
2009-01-01
We report the current-voltage (Ⅰ-Ⅴ) characteristics of individual polypyrrole nanotubes and poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires in a temperature range from 300 K to 2 K. Considering the complex structures of such quasi-one-dimensional systems with an array of ordered conductive regions separated by disordered barriers, we use the extended fluctuation-induced tunneling (FIT) and thermal excitation model (Kaiser expression) to fit the temperature and electric-field dependent Ⅰ-Ⅴ curves. It is found that the Ⅰ-Ⅴ data measured at higher temperatures or higher voltages can be well fitted by the Kaiser expression. However, the low-temperature data around the zero bias clearly deviate from those obtained from this model. The deviation (or zero-bias conductance suppression)could be possibly ascribed to the occurrence of the Coulomb-gap in the density of states near the Femi level and/or the enhancement of electron-electron interaction resulting from nanosize effects, which have been revealed in the previous studies on low-temperature electronic transport in conducting polymer films, pellets and nanostructures. In addition,similar Ⅰ-Ⅴ characteristics and deviation are also observed in an isolated K0.27MnO2 nanowire.
Pitel, J; Lehtonen, J; Kovács, P
2002-01-01
We have developed a mathematical model, which enables us to predict the voltage-current V(I) characteristics of a solenoidal high-temperature superconductor (HTS) magnet subjected to an external magnetic field parallel to the magnet axis. The model takes into account the anisotropy in the critical current-magnetic field (I sub c (B)) characteristic and the n-value of Bi(2223)Ag multifilamentary tape at 20 K. From the power law between the electric field and the ratio of the operating and critical currents, the voltage on the magnet terminals is calculated by integrating the contributions of individual turns. The critical current of each turn, at given values of operating current and external magnetic field, is obtained by simple linear interpolation between the two suitable points of the I sub c (B) characteristic, which corresponds to the angle alpha between the vector of the resulting magnetic flux density and the broad tape face. In fact, the model is valid for any value and orientation of external magneti...
International Nuclear Information System (INIS)
Poyai, A.; Simoen, E.; Claeys, C.; Hayama, K.; Kobayashi, K.; Ohyama, H.
2002-01-01
This paper investigates the impact of 20 MeV proton irradiation on the current-voltage (I-V) and capacitance-voltage (C-V) characteristics of different geometry n + -p-well junction diodes surrounded by shallow trench isolation and processed in a 0.18 μm CMOS technology. From I-V characteristics, a higher current damage coefficient was found for the bulk than for the peripheral component. The radiation-induced boron de-activation resulted in a lowering of the p-well doping, which has been derived from high-frequency C-V measurements. This was confirmed by deep level transient spectroscopy (DLTS) analysis, revealing the presence of interstitial boron related radiation defects. As will be demonstrated for the bulk leakage-current damage coefficient, the electric field enhanced generation rate of charge carriers and the radiation-induced boron de-activation should be accounted for properly
DEFF Research Database (Denmark)
Gloos, K.; Utko, P.; Aagesen, M.
2006-01-01
We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...
Directory of Open Access Journals (Sweden)
Šarūnas MEŠKINIS
2013-03-01
Full Text Available In present study five synthesized organic semiconductor compounds have been used for fabrication of the planar metal / organic semiconductor / metal structures. Both top electrode and bottom electrode configurations were used. Current-voltage (I-V characteristics of the samples were investigated. Effect of the hysteresis of the I-V characteristics was observed for all the investigated samples. However, strength of the hysteresis was dependent on the organic semiconductor used. Study of I-V characteristics of the top contact Al/AT-RB-1/Al structures revealed, that in (0 – 500 V voltages range average current of the samples measured in air is only slightly higher than current measured in nitrogen ambient. Deposition of the ultra-thin diamond like carbon interlayer resulted in both decrease of the hysteresis of I-V characteristics of top contact Al/AT-RB-1/Al samples. However, decreased current and decreased slope of the I-V characteristics of the samples with diamond like carbon interlayer was observed as well. I-V characteristic hysteresis effect was less pronounced in the case of the bottom contact metal/organic semiconductor/metal samples. I-V characteristics of the bottom contact samples were dependent on electrode metal used.DOI: http://dx.doi.org/10.5755/j01.ms.19.1.3816
Current-Voltage Characteristics of DC Discharge in Micro Gas Jet Injected into Vacuum Environment
International Nuclear Information System (INIS)
Matra, K; Furuta, H; Hatta, A
2013-01-01
A current-voltage characteristic of direct current (DC) gas discharge operated in a micro gas jet injected into a secondary electron microscope (SEM) chamber is presented. Ar gas was injected through a 30 μm orifice gas nozzle (OGN) and was evacuated by an additional pump to keep the high vacuum environment. Gas discharges were ignited between the OGN as anode and a counter electrode of Si wafer. The discharge was self-pulsating in most of the cases while it was stable at lower pressure, larger gap length, and larger time averaged current. The self-pulsating discharge was oscillated by the RC circuit consisting of a stray capacitor and a large ballast resistor. The real time plots of voltage and current during the pulsating was investigated using a discharge model.
Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement
International Nuclear Information System (INIS)
Boudjella, Aissa
2011-01-01
The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.
Directory of Open Access Journals (Sweden)
Jennifer H Hou
2014-09-01
Full Text Available The cardiac action potential (AP and the consequent cytosolic Ca2+ transient are key indicators of cardiac function. Natural developmental processes, as well as many drugs and pathologies change the waveform, propagation, or variability (between cells or over time of these parameters. Here we apply a genetically encoded dual-function calcium and voltage reporter (CaViar to study the development of the zebrafish heart in vivo between 1.5 and 4 days post fertilization (dpf. We developed a high-sensitivity spinning disk confocal microscope and associated software for simultaneous three-dimensional optical mapping of voltage and calcium. We produced a transgenic zebrafish line expressing CaViar under control of the heart-specific cmlc2 promoter, and applied ion channel blockers at a series of developmental stages to map the maturation of the action potential in vivo. Early in development, the AP initiated via a calcium current through L-type calcium channels. Between 90 – 102 hours post fertilization (hpf, the ventricular AP switched to a sodium-driven upswing, while the atrial AP remained calcium driven. In the adult zebrafish heart, a sodium current drives the AP in both the atrium and ventricle. Simultaneous voltage and calcium imaging with genetically encoded reporters provides a new approach for monitoring cardiac development, and the effects of drugs on cardiac function.
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav
2014-01-01
The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.
A simple approximation for the current-voltage characteristics of high-power, relativistic diodes
Energy Technology Data Exchange (ETDEWEB)
Ekdahl, Carl, E-mail: cekdahl@lanl.gov [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)
2016-06-15
A simple approximation for the current-voltage characteristics of a relativistic electron diode is presented. The approximation is accurate from non-relativistic through relativistic electron energies. Although it is empirically developed, it has many of the fundamental properties of the exact diode solutions. The approximation is simple enough to be remembered and worked on almost any pocket calculator, so it has proven to be quite useful on the laboratory floor.
Nasr, Mahmoud; El Radaf, I. M.; Mansour, A. M.
2018-04-01
In this study, a crystalline n-PbTe/p-GaP heterojunction was fabricated using the electron beam deposition technique. The structural properties of the prepared heterojunction were examined by X-ray diffraction and scanning electron microscopy. The dark current-voltage characteristics of the heterojunction were investigated at different temperatures ranging from 298 to 398 K. The rectification factor, series resistance, shunt resistance, diode ideality factor, and effective barrier height (ϕb) were determined. The photovoltaic parameters were identified based on the current density-voltage characteristics under illumination. The capacitance-voltage characteristics showed that the junction was abrupt in nature.
Harmonic current interaction at a low voltage customer's installations
Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.
2009-01-01
The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low
Wolf, M.; Noel, G. T.; Stirn, R. J.
1976-01-01
A theoretical analysis is presented of certain peculiarities of the current-voltage characteristics of silicon solar cells, involving high values of the empirical constant A in the diode equation for a p-n junction. An attempt was made in a lab experiment to demonstrate that the saturation current which is associated with the exponential term qV/A2kT of the I-V characteristic, with A2 roughly equal to 2, originates in the space charge region and that it can be increased, as observed on ATS-1 cells, by the introduction of additional defects through low energy proton irradiation. It was shown that the proton irradiation introduces defects into the space charge region which give rise to a recombination current from this region, although the I-V characteristic is, in this case, dominated by an exponential term which has A = 1.
Current-Voltage Characteristics of Nb2O5 nanoporous via light illumination
Samihah Khairir, Nur; Rani, Rozina Abdul; Fazlida Hanim Abdullah, Wan; Hafiz Mamat, Mohamad; Kadir, Rosmalini Abdul; Rusop, M.; Sabirin Zoolfakar, Ahmad
2018-03-01
This work discussed the effect of light on I-V characteristics of anodized niobium pentoxide (Nb2O5) which formed nanoporous structure film. The structure was synthesized by anodizing niobium foils in glycerol based solution with 10 wt% supplied by two different voltages, 5V and 10V. The anodized foils that contained Nb2O5 film were then annealed to obtain an orthorhombic phase for 30 minutes at 450°C. The metal contact used for I-V testing was platinum (Pt) and it was deposited using thermal evaporator at 30nm thickness. I-V tests were conducted under different condition; dark and illumination to study the effect of light on I-V characteristics of anodized nanoporous Nb2O5. Higher anodization voltage and longer anodization time resulted in higher pore dispersion and larger pore size causing the current to increase. The increase of conductivity in I-V behaviour of Nb2O5 device is also affected by the illumination test as higher light intensity caused space charge region width to increase, thus making it easier for electron transfer between energy band gap.
Ejrnaes, M.; Parlato, L.; Arpaia, R.; Bauch, T.; Lombardi, F.; Cristiano, R.; Tafuri, F.; Pepe, G. P.
2017-12-01
We have fabricated several 10 nm thick and 65 nm wide YBa2Cu3O7-δ (YBCO) nanostrips. The nanostrips with the highest critical current densities are characterized by hysteretic current voltage characteristics (IVCs) with a direct bistable switch from the zero-voltage to the finite voltage state. The presence of hysteretic IVCs allowed the observation of dark pulses due to fluctuations phenomena. The key role of the bistable behavior is its ability to transform a small disturbance (e.g. an intrinsic fluctuation) into a measurable transient signal, i.e. a dark pulse. On the contrary, in devices characterized by lower critical current density values, the IVCs are non-hysteretic and dark pulses have not been observed. To investigate the physical origin of the dark pulses, we have measured the bias current dependence of the dark pulse rate: the observed exponential increase with the bias current is compatible with mechanisms based on thermal activation of magnetic vortices in the nanostrip. We believe that the successful amplification of small fluctuation events into measurable signals in nanostrips of ultrathin YBCO is a milestone for further investigation of YBCO nanostrips for superconducting nanostrip single photon detectors and other quantum detectors for operation at higher temperatures.
International Nuclear Information System (INIS)
Chen Zuhui; Jie Binbin; Sah Chihtang
2010-01-01
Impurity deionization on the direct-current current-voltage characteristics from electron-hole recombination (R-DCIV) at SiO 2 /Si interface traps in MOS transistors is analyzed using the steady-state Shockley-Read-Hall recombination kinetics and the Fermi distributions for electrons and holes. Insignificant distortion is observed over 90% of the bell-shaped R-DCIV curves centered at their peaks when impurity deionization is excluded in the theory. This is due to negligible impurity deionization because of the much lower electron and hole concentrations at the interface than the impurity concentration in the 90% range. (invited papers)
Wen, Jing; Zhang, Xitian; Gao, Hong; Wang, Mingjiao
2013-12-01
We present a method to calculate the I-V characteristics of semiconductor nanowires under the metal-semiconductor-metal (MSM) structure. The carrier concentration as an important parameter is introduced into the expression of the current. The subband structure of the nanowire has been considered for associating it with the position of the Fermi level and circumventing the uncertainties of the contact areas in the contacts. The tunneling and thermionic emission currents in the two Schottky barriers at the two metal-semiconductor contacts are discussed. We find that the two barriers have different influences on the I-V characteristics of the MSM structure, one of which under the forward bias plays the role of threshold voltage if its barrier height is large and the applied voltage is small, and the other under the reverse bias controls the shapes of I-V curves. Our calculations show that the shapes of the I-V curves for the MSM structure are mainly determined by the barrier heights of the contacts and the carrier concentration. The nearly identical I-V characteristics can be obtained by using different values of the barrier heights and carrier concentration, which means that the contact type conversion can be ascribed not only to the changes of the barrier heights but also that of the carrier concentration. We also discuss the mechanisms of the ohmic-Schottky conversions and clarify the ambiguity in the literature. The possibility about the variation of the carrier concentration under the applied fields has been confirmed by experimental results.
Characteristics of output voltage and current of integrated nanogenerators
Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin
2009-01-01
three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity
Wolf, M.; Noel, G. T.; Stirn, R. J.
1977-01-01
Difficulties in relating observed current-voltage characteristics of individual silicon solar cells to their physical and material parameters were underscored by the unexpected large changes in the current-voltage characteristics telemetered back from solar cells on the ATS-1 spacecraft during their first year in synchronous orbit. Depletion region recombination was studied in cells exhibiting a clear double-exponential dark characteristic by subjecting the cells to proton irradiation. A significant change in the saturation current, an effect included in the Sah, Noyce, Shockley formulation of diode current resulting from recombination in the depletion region, was caused by the introduction of shallow levels in the depletion region by the proton irradiation. This saturation current is not attributable only to diffusion current from outside the depletion region and only its temperature dependence can clarify its origin. The current associated with the introduction of deep-lying levels did not change significantly in these experiments.
Tunneling effects in the current-voltage characteristics of high-efficiency GaAs solar cells
Kachare, R.; Anspaugh, B. E.; Garlick, G. F. J.
1988-01-01
Evidence is that tunneling via states in the forbidden gap is the dominant source of excess current in the dark current-voltage (I-V) characteristics of high-efficiency DMCVD grown Al(x)Ga(1-x)As/GaAs(x is equal to or greater than 0.85) solar cells. The dark forward and reverse I-V measurements were made on several solar cells, for the first time, at temperatures between 193 and 301 K. Low-voltage reverse-bias I-V data of a number of cells give a thermal activation energy for excess current of 0.026 + or - 0.005 eV, which corresponds to the carbon impurity in GaAs. However, other energy levels between 0.02 eV and 0.04 eV were observed in some cells which may correspond to impurity levels introduced by Cu, Si, Ge, or Cd. The forward-bias excess current is mainly due to carrier tunneling between localized levels created in the space-charge layer by impurities such as carbon, which are incorporated during the solar cell growth process. A model is suggested to explain the results.
International Nuclear Information System (INIS)
Peon A, R.
1978-01-01
A regulated direct current feeding source was designed for the Nuclear Energy National Institute Electronics Labortory, with the following characteristics: a) voltage input 105-130V a.c. 50-60 Hz; b) voltage output 0.40 V d.c.; c) output current 0-2 Amp d.c.; d) load regulation 0.001%; e) line regulation 0.001%; f) ripple and noise 200 μ Vpp; g) temperature interval 3-60 0 C; h) stability 0.5%; i) output impedance as voltage source 0.01 ohms; j) transient response 50 μ seg. Besides of operating normally, that is as voltage source or current-source through the front controls, the source can be used and interconnected with one or other compatible sources (autoseries, autoparallel and programmed reference). The source will cost 70,000 pesos approximately. (author)
Leakage current characteristics of the multiple metal alloy nanodot memory
International Nuclear Information System (INIS)
Lee, Gae Hun; Lee, Jung Min; Yang, Hyung Jun; Song, Yun Heub; Bea, Ji Chel; Tanaka, Tetsu
2010-01-01
The leakage current characteristics of a multiple metal alloy nanodot device for a nonvolatile random access memory using FePt materials are investigated. Several annealing conditions are evaluated and optimized to suppress the leakage current and to better the memory characterisctics. This work confirmed that the annealing condition of 700 .deg. C in a high vacuum ambience (under 1 x 10 -5 Pa) simultaneously provided good cell characteristics from a high dot density of over 1 x 10 13 /cm 2 and a low leakage current. In addition, a smaller nanodot diameter was found to give a lower leakage current for the multiple nanodot memory. Finally, for the proposed annealing condition, the quadruple FePt multiple nanodot memory with a 2-nm dot diameter provided good leakage current characteristics, showing a threshold voltage shift of under 5% at an initial retention stage of 1000 sec.
Determination of the internal parameters of tc from the current-voltage characteristics
International Nuclear Information System (INIS)
Kaibyshev, V.Z.
1986-01-01
This paper proposes a method for determining the effective work function of a collector, the electron temperature, and the voltage drop in the interelectrode gap from the experimental vurrent-voltage characteristics (IVC). Analysis of the boundary conditions at the collector shows that as the emission from the collector increases the height of the potential jump retarding plasma electrons decrease
Oshurko, V. B.; Fedorov, A. N.; Ropyanoi, A. A.; Fedosov, M. V.
2014-06-01
It is found experimentally that the properties of nanoporous ion-exchange membranes (hysteresis of the current-voltage characteristic in the solution and negative differential resistance), which have been discussed in recent years, are not associated with the properties of the membrane. It is shown that these effects are also observed in a floating water bridge and in water-filled tubes and are apparently determined by the geometrical shape of the liquid conductor. The observed effects are explained qualitatively.
DEFF Research Database (Denmark)
Xin, Zhen; Mattavelli, Paolo; Yao, WenLi
2017-01-01
Due to the low inductance of an LCL-filter, the grid current generated by an LCL-filtered Voltage Source Inverter (VSI) is sensitive to low-order grid-voltage harmonics. This issue is especially tough for the control system with Inverter Current Feedback (ICF), because the grid-current harmonics...... can freely flow into the filter capacitor without control. To cope with this issue, this paper develops an approach for the ICF control system to suppress the grid-current harmonics without adding extra sensors. The proposed method applies harmonic controllers and feedforward scheme simultaneously...
A Hybrid, Current-Source/Voltage-Source Power Inverter Circuit
DEFF Research Database (Denmark)
Trzynadlowski, Andrzej M.; Patriciu, Niculina; Blaabjerg, Frede
2001-01-01
A combination of a large current-source inverter and a small voltage-source inverter circuits is analyzed. The resultant hybrid inverter inherits certain operating advantages from both the constituent converters. In comparison with the popular voltage-source inverter, these advantages include...... reduced switching losses, improved quality of output current waveforms, and faster dynamic response to current control commands. Description of operating principles and characteristics of the hybrid inverter is illustrated with results of experimental investigation of a laboratory model....
DEFF Research Database (Denmark)
Nielsen, Otto M.
1983-01-01
of multistep tunneling recombination current and injected minority carrier diffusion current. This can explain the observed values of the diode quality factor n. The results also show that the voltage drop across the oxide Vox is increased with increased NA, with the result that the lowering of the minority...... carrier diode current Jmin is greater than in the usual theory. The conclusion drawn is that the increase in Vox and lowering of Jmin is due to multistep tunneling of majority carriers through the semiconductor barrier. Journal of Applied Physics is copyrighted by The American Institute of Physics.......Current–voltage characteristics have been examined for Al–SiO2–pSi diodes with an interfacial oxide thickness of delta[approximately-equal-to]20 Å. The diodes were fabricated on and oriented substrates with an impurity concentration in the range of NA=1014–1016 cm−3. The results show that for low...
Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell
Directory of Open Access Journals (Sweden)
Walker Don
2017-01-01
Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.
Current–voltage characteristics of manganite–titanite perovskite junctions
Directory of Open Access Journals (Sweden)
Benedikt Ifland
2015-07-01
Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.
DEFF Research Database (Denmark)
Spataru, Sergiu; Sera, Dezso; Hacke, Peter
2016-01-01
This article proposes a fault identification method, based on the complementary analysis of the light and dark current-voltage (I-V) characteristics of the photovoltaic (PV) module, to distinguish between four important degradation modes that lead to power loss in PV modules: (a) degradation of t...
Omura, Yasuhisa; Mori, Yoshiaki; Sato, Shingo; Mallik, Abhijit
2018-04-01
This paper discusses the role of trap-assisted-tunneling process in controlling the ON- and OFF-state current levels and its impacts on the current-voltage characteristics of a tunnel field-effect transistor. Significant impacts of high-density traps in the source region are observed that are discussed in detail. With regard to recent studies on isoelectronic traps, it has been discovered that deep level density must be minimized to suppress the OFF-state leakage current, as is well known, whereas shallow levels can be utilized to control the ON-state current level. A possible mechanism is discussed based on simulation results.
International Nuclear Information System (INIS)
Matsushita, Teruo; Yamafuji, Kaoru; Sakamoto, Nobuyoshi.
1977-01-01
In case of applying superconductors to electric machinery or high intensity field magnets for fusion reactors, the superconductors are generally expected to be sensible to small field fluctuation besides DC magnetic field. The behavior of superconductors in DC magnetic field superimposed with small AC magnetic field has been investigated often experimentally, and the result has been obtained that the critical current at which DC flow voltage begins to appear extremely decreased or disappeared. Some theoretical investigations have been carried out on this phenomenon so far, however, their application has been limited to the region where frequency is sufficiently low or which is close to the critical magnetic field. Purpose of this report is to deal with the phenomenon in more unified way by analyzing the behavior of magnetic flux lines in a superconductor under a superimposed small AC field using the criticalstate model including viscous force. In order to solve the fundamental equation in this report, first the solution has been obtained in the quasi-static state neglecting viscous force, then about the cases that current density J is not more than Jc and J is larger than Jc, concerning the deviation from the quasi-static limit by employing successive approximation. Current-voltage characteristics have been determined by utilizing the above results. This method seems to be most promising at present except the case of extremely high frequency. (Wakatsuki, Y.)
Energy Technology Data Exchange (ETDEWEB)
Stoyanov, D G [Faculty of Engineering and Pedagogy in Sliven, Technical University of Sofia, 59, Bourgasko Shaussee Blvd, 8800 Sliven (Bulgaria)
2007-11-15
The elementary processes taking place in the formation of charged particles and their flow in parallel-plane, cylindrical and spherical geometry cases of ionization chamber are considered. On the basis of particles and charges balance a differential equation describing the distribution of current densities in the ionization chamber volume is obtained. As a result of the differential equation solution an analytical form of the current-voltage characteristic of an ionization chamber with homogeneous ionization is obtained. For the parallel-plane case comparision with experimental data is performed.
International Nuclear Information System (INIS)
Stoyanov, D G
2007-01-01
The elementary processes taking place in the formation of charged particles and their flow in parallel-plane, cylindrical and spherical geometry cases of ionization chamber are considered. On the basis of particles and charges balance a differential equation describing the distribution of current densities in the ionization chamber volume is obtained. As a result of the differential equation solution an analytical form of the current-voltage characteristic of an ionization chamber with homogeneous ionization is obtained. For the parallel-plane case comparision with experimental data is performed
International Nuclear Information System (INIS)
Abdallah, Salah
2004-01-01
An experimental study was performed to investigate the effect of using different types of sun tracking systems on the voltage-current characteristics and electrical power generation at the output of flat plate photovoltaics (FPPV). Four electromechanical sun tracking systems, two axes, one axis vertical, one axis east-west and one axis north-south, were designed and constructed for the purpose of investigating the effect of tracking on the electrical values, current, voltage and power, according to the different loads (variable resistance). The above mentioned variables were measured at the output of the FPPV and compared with those on a fixed surface. The results indicated that the volt-ampere characteristics on the tracking surfaces were significantly greater than that on a fixed surface. There were increases of electrical power gain up to 43.87%, 37.53%, 34.43% and 15.69% for the two axes, east-west, vertical and north-south tracking, respectively, as compared with the fixed surface inclined 32 deg. to the south in Amman, Jordan
Ab initio and empirical studies on the asymmetry of molecular current-voltage characteristics
International Nuclear Information System (INIS)
Hoft, R C; Armstrong, N; Ford, M J; Cortie, M B
2007-01-01
We perform theoretical calculations of the tunnelling current through various small organic molecules sandwiched between gold electrodes by using both a tunnel barrier model and an ab initio transport code. The height of the tunnelling barrier is taken to be the work function of gold as modified by the adsorbed molecule and calculated from an ab initio electronic structure code. The current-voltage characteristics of these molecules are compared. Asymmetry is introduced into the system in two ways: an asymmetric molecule and a gap between the molecule and the right electrode. The latter is a realistic situation in scanning probe experiments. The asymmetry is also realized in the tunnel barrier model by two distinct work functions on the left and right electrodes. Significant asymmetry is observed in the ab initio i(V) curves. The tunnel barrier i(V) curves show much less pronounced asymmetry. The relative sizes of the currents through the molecules are compared. In addition, the performance of the WKB approximation is compared to the results obtained from the exact Schroedinger solution to the tunnelling barrier problem
International Nuclear Information System (INIS)
Carpenter, R.T.; Torven, S.
1986-07-01
The properties of a strong double layer in a current circuit with a capacitance and an inductance are investigated in a triple plasma device. The double layer gives rise to a region of negative differential resistance in the current-voltage characteristic of the device, and this gives non-linear oscillations in the current and the potential drop over the double layer (PhiDL). For a sufficiently large circuit inductance PhiDL reaches an amplitude given by the induced voltage (-LdI/dt) which is much larger than the circuit EMF due to the rapid current decrease when PhiDL increases. A variable potential minimum exists in the plasma on the low potential side of the double layer, and the depth of the minimum increases when PhiDL increases. An increasing fraction of the electrons incident at the double layer are then reflected, and this is found to be the main process giving rise to the negative differential resistance. A qualitative model for the variation of the minimum potential with PhiDL is also proposed. It is based on the condition that the minimum potential must adjust itself self-consistentely so that quasi-neutrality is maintained in the plasma region where the minimum is assumed. (authors)
International Nuclear Information System (INIS)
Gopal, Vishnu; Qiu, WeiCheng; Hu, Weida
2014-01-01
The current–voltage characteristics of long wavelength mercury cadmium telluride infrared detectors have been studied using a recently suggested method for modelling of illuminated photovoltaic detectors. Diodes fabricated on in-house grown arsenic and vacancy doped epitaxial layers were evaluated for their leakage currents. The thermal diffusion, generation–recombination (g-r), and ohmic currents were found as principal components of diode current besides a component of photocurrent due to illumination. In addition, both types of diodes exhibited an excess current component whose growth with the applied bias voltage did not match the expected growth of trap-assisted-tunnelling current. Instead, it was found to be the best described by an exponential function of the type, I excess = I r0 + K 1 exp (K 2 V), where I r0 , K 1 , and K 2 are fitting parameters and V is the applied bias voltage. A study of the temperature dependence of the diode current components and the excess current provided the useful clues about the source of origin of excess current. It was found that the excess current in diodes fabricated on arsenic doped epitaxial layers has its origin in the source of ohmic shunt currents. Whereas, the source of excess current in diodes fabricated on vacancy doped epitaxial layers appeared to be the avalanche multiplication of photocurrent. The difference in the behaviour of two types of diodes has been attributed to the difference in the quality of epitaxial layers
A fast high-voltage current-peak detection system for the ALICE transition radiation detector
Energy Technology Data Exchange (ETDEWEB)
Verclas, Robert [Physikalisches Institut, Ruprecht-Karls-Universitaet Heidelberg (Germany); Collaboration: ALICE-Collaboration
2016-07-01
During LHC operation in run 1, the gaseous detectors of ALICE occasionally experienced simultaneous trips in their high voltage which affected the majority of the high voltage channels. These trips are caused by large anode currents in the detector and are potentially related to LHC machine operations. We developed and installed a fast current-peak detection system for the ALICE Transition Radiation Detector. This system is based on FPGA technology and monitors 144 out 522 high voltage channels minimally invasively at a maximum readout rate of 2 MHz. It is an integral part of the LHC beam monitoring system. We report on the latest status.
Gas stream analysis using voltage-current time differential operation of electrochemical sensors
Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay; Wang, Gangqiang; Henderson, Brett Tamatea; Lourdhusamy, Anthoniraj; Steppan, James John; Allmendinger, Klaus Karl
2018-01-02
A method for analysis of a gas stream. The method includes identifying an affected region of an affected waveform signal corresponding to at least one characteristic of the gas stream. The method also includes calculating a voltage-current time differential between the affected region of the affected waveform signal and a corresponding region of an original waveform signal. The affected region and the corresponding region of the waveform signals have a sensitivity specific to the at least one characteristic of the gas stream. The method also includes generating a value for the at least one characteristic of the gas stream based on the calculated voltage-current time differential.
Non-contact current and voltage sensor
Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A
2014-03-25
A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.
Influence of current limitation on voltage stability with voltage sourced converter HVDC
DEFF Research Database (Denmark)
Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela
2013-01-01
A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...
Directory of Open Access Journals (Sweden)
Vishnu Gopal
2015-09-01
Full Text Available It is shown that current-voltage characteristics of infrared photo-detectors based on type-II InAs/GaSb super-lattices with uni-polar blocking layers can be modelled similar to a junction diode with a finite series resistance on account of blocking barriers. As an example this paper presents the results of a study of current-voltage characteristics of a type II InAs/GaSb super-lattice diode with PbIbN architecture using a recently proposed [J. Appl. Phys. 116, 084502 (2014] method for modelling of illuminated photovoltaic detectors. The thermal diffusion, generation – recombination (g-r, and ohmic currents are found as principal components besides a component of photocurrent due to background illumination. The experimentally observed reverse bias diode current in excess of thermal current (diffusion + g-r, photo-current and ohmic shunt current is reported to be best described by an exponential function of the type, Iexcess = Ir0 + K1exp(K2 V, where Ir0, K1 and K2 are fitting parameters and V is the applied bias voltage. The present investigations suggest that the exponential growth of excess current with the applied bias voltage may be taking place along the localized regions in the diode. These localized regions are the shunt resistance paths on account of the surface leakage currents and/or defects and dislocations in the base of the diode.
Variable speed wind turbine generator system with current controlled voltage source inverter
International Nuclear Information System (INIS)
Muyeen, S.M.; Al-Durra, Ahmed; Tamura, J.
2011-01-01
highlights: → Current controlled voltage source inverter scheme for wind power application. → Low voltage ride through of wind farm. → Variable speed wind turbine driven permanent magnet synchronous generator-operation and control. -- Abstract: The present popular trend of wind power generation is to use variable speed wind turbine (VSWT) driving a doubly fed induction generator (DFIG), wound field synchronous generator (WFSG) or permanent magnet synchronous generator (PMSG). Among them, stability analyses of DFIG type of VSWT have already been reported in many literatures. However, transient stability and low voltage ride through (LVRT) characteristics analyses for synchronous generator type of VSWT is not sufficient enough. This paper focuses on detailed LVRT characteristic analysis of variable speed wind turbine driving a PMSG (VSWT-PMSG) with current controlled voltage source inverter (CC-VSI). Modeling and suitable control strategies for overall system are developed to augment the low voltage ride through capability of variable speed wind generator, considering recent wind farm grid code. Both symmetrical and unsymmetrical faults are analyzed as network disturbances in this paper. The permanent fault due to unsuccessful reclosing of circuit breakers is taken into consideration, which is a salient feature of this study. Moreover, the dynamic characteristic is analyzed using real wind speed data measured in Hokkaido Island, Japan. The proposed control scheme is simulated by using the standard power system simulation package PSCAD/EMTDC and results are verified by comparing that of voltage controlled voltage source inverter scheme available in power system literature.
Variable speed wind turbine generator system with current controlled voltage source inverter
Energy Technology Data Exchange (ETDEWEB)
Muyeen, S.M., E-mail: muyeen0809@yahoo.co [Dept. of Electrical Engineering, Petroleum Institute, P.O. Box 2533, Abu Dhabi (United Arab Emirates); Al-Durra, Ahmed [Dept. of Electrical Engineering, The Petroleum Institute, P.O. Box 2533, Abu Dhabi (United Arab Emirates); Tamura, J. [Dept. of EEE, Kitami Institute of Technology, 165 Koen-cho, Kitami 090-8507 (Japan)
2011-07-15
highlights: {yields} Current controlled voltage source inverter scheme for wind power application. {yields} Low voltage ride through of wind farm. {yields} Variable speed wind turbine driven permanent magnet synchronous generator-operation and control. -- Abstract: The present popular trend of wind power generation is to use variable speed wind turbine (VSWT) driving a doubly fed induction generator (DFIG), wound field synchronous generator (WFSG) or permanent magnet synchronous generator (PMSG). Among them, stability analyses of DFIG type of VSWT have already been reported in many literatures. However, transient stability and low voltage ride through (LVRT) characteristics analyses for synchronous generator type of VSWT is not sufficient enough. This paper focuses on detailed LVRT characteristic analysis of variable speed wind turbine driving a PMSG (VSWT-PMSG) with current controlled voltage source inverter (CC-VSI). Modeling and suitable control strategies for overall system are developed to augment the low voltage ride through capability of variable speed wind generator, considering recent wind farm grid code. Both symmetrical and unsymmetrical faults are analyzed as network disturbances in this paper. The permanent fault due to unsuccessful reclosing of circuit breakers is taken into consideration, which is a salient feature of this study. Moreover, the dynamic characteristic is analyzed using real wind speed data measured in Hokkaido Island, Japan. The proposed control scheme is simulated by using the standard power system simulation package PSCAD/EMTDC and results are verified by comparing that of voltage controlled voltage source inverter scheme available in power system literature.
DEFF Research Database (Denmark)
Han, Renke; Tucci, Michele; Martinelli, Andrea
2018-01-01
In this paper, we propose a new decentralized control scheme for Microgrid (MG) clusters, given by the interconnection of atomic dc MGs, each composed by grid-forming and grid-feeding converters. In particular, we develop a new Plug-and-Play (PnP) voltage/current controller for each MG in order...... to achieve simultaneous voltage support and current feeding function with local references. The coefficients of each stabilizing controller are characterized by explicit inequalities, which are related only to local electrical parameters of the MG. With the proposed controller, each MG can plug...
Autowaves in an active two-wire line with exponential current-voltage characteristics
International Nuclear Information System (INIS)
Zhuravlev, V. M.
2006-01-01
Nonlinear wave processes in two-wire lines containing an active element with an exponential current-voltage characteristic (CVC) similar to that of a p-n junction are investigated. These lines are models of systems that are encountered in various physical and biological applications, such as biological membranes and semiconductor devices. It is shown that such systems may operate in different modes each of which has different dispersion and dissipation properties and, as a consequence, is described by autowave processes of different types. The behavior of a system in all basic modes is analyzed. For each mode, exact solutions to relevant equations are found and their differential conservation laws and intrinsic symmetries are investigated. One of common properties of such equations is the presence of a special superposition principle that describes the discrete structure of excitations in a line that consist of individual elementary excitations. It is shown that autopulses may be generated in such systems
Erwin, Patrick
2011-01-01
A short series of alkyl substituted perylenediimides (PDIs) with varying steric bulk are used to demonstrate the relationship between molecular structure, materials properties, and performance characteristics in organic photovoltaics. Devices were made with the structure indium tin oxide/copper phthalocyanine (200 Å)/PDI (200 Å)/bathocuproine (100 Å)/aluminum (1000 Å). We found that PDIs with larger substituents produced higher open circuit voltages (VOC\\'s) despite the donor acceptor interface gap (Δ EDA) remaining unchanged. Additionally, series resistance was increased simultaneously with VOC the effect of reducing short circuit current, making the addition of steric bulk a tradeoff that needs to be balanced to optimize power conversion efficiency. © 2011 American Institute of Physics.
Energy Technology Data Exchange (ETDEWEB)
Sirikulrat, N., E-mail: scphi003@chiangmai.ac.th
2012-02-29
The current-voltage (I-V) relationship of aluminum doped zinc oxide thin film-antimony doped barium strontium titanate single heterojunction diodes was investigated. The linear I-V characteristics are similar to those of the PN junction diodes. The linear conduction at a low forward bias voltage as predicted by the space charge limited current theory and the trap free square law at a higher forward voltage are observed. The overall current density-voltage (J-V) characteristics of the diodes are found to be well described by the Power Series Equation J= N-Ary-Summation {sub m}C{sub m}V{sup m} where C{sub m} is the leakage constant at particular power m with the best fit for the power m found to be at the fourth and fifth orders for the forward and reverse bias respectively. - Highlights: Black-Right-Pointing-Pointer The n-n isotype heterojunction diodes of ceramic oxide semiconductors were prepared. Black-Right-Pointing-Pointer The current density-voltage (J-V) curves were analyzed using the Power Series (PS). Black-Right-Pointing-Pointer The J-V characteristics were found to be well described with PS at low order. Black-Right-Pointing-Pointer The thermionic emission and diode leakage currents were comparatively discussed.
Partial discharge characteristics and mechanism in voids at impulse voltages
International Nuclear Information System (INIS)
Zhao, X F; Guo, Z F; Wang, Y Y; Li, J H; Li, Y M; Yao, X
2011-01-01
Partial discharge (PD) characteristics and mechanism in artificial cavities in an epoxy plate have been investigated for different void dimensions and impulse voltage waveforms. A differential measurement system was developed in order to detect PD current pulses effectively. Experimental results showed that the 50% probability PD inception voltage (PDIV 50 ) increases initially as the cavity diameter decreases at constant depth for double exponential impulses as well as oscillating impulses, but after aging, it becomes independent of the cavity diameter. Moreover, some distinctive characteristics of PD (e.g. main discharge and reverse discharge during the rise and fall phases of the applied voltage) were also investigated. The differences of the PD propagation and the mechanism between double exponential impulses and oscillating impulse were discussed
A model for voltage collapse study considering load characteristics
Energy Technology Data Exchange (ETDEWEB)
Aguiar, L B [Companhia de Energia Eletrica da Bahia (COELBA), Salvador, BA (Brazil)
1994-12-31
This paper presents a model for analysis of voltage collapse and instability problem considering the load characteristics. The model considers fundamentally the transmission lines represented by exact from through the generalized constants A, B, C, D and the loads as function of the voltage, emphasizing the cases of constant power, constant current and constant impedance. the study treats of the system behavior on steady state and presents illustrative graphics about the problem. (author) 12 refs., 4 figs.
Characteristics of output voltage and current of integrated nanogenerators
Yang, Rusen
2009-01-01
Owing to the anisotropic property and small output signals of the piezoelectric nanogenerators (NGs) and the influence of the measurement system and environment, identification of the true signal generated by the NG is critical. We have developed three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity, and random signals, which might change signs but cannot consistently add up or cancel out under designed connection configurations. This study establishes the standards for designing and scale up of integrated nanogenerators. © 2009 American Institute of Physics.
Nonlinear current-voltage behavior in PZT thin films
Energy Technology Data Exchange (ETDEWEB)
Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)
2017-05-15
In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)
International Nuclear Information System (INIS)
Shamirzaev, S. H.; Gulyamov, G.; Dadamirzaev, M. G.; Gulyamov, A. G.
2009-01-01
The effect of heating of electrons and holes on the nonideality coefficient of the current-voltage characteristic for a p-n junction in a high microwave field is studied. It is established that the nonideality coefficient for a diode depends on the type of charge carriers that make the major contribution to the current in the p-n junction. It is shown that, in some cases in silicon samples, the nonideality coefficient for the diode is governed by the temperature for holes in spite of the fact that the temperature for electrons is higher than the temperature for holes.
MAGY: An innovative high voltage-low current power supply for gyrotron
International Nuclear Information System (INIS)
Siravo, Ugo; Alex, Juergen; Bader, Michael; Carpita, Mauro; Fasel, Damien; Gavin, Serge; Perez, Albert
2011-01-01
From the electrical point of view, the body and the anode of high power gyrotrons behave as capacitive loads. A highly dynamic power supply is, therefore, hard to achieve. The MAGY concept (Modulator for the Anode of a triode type GYrotron) embodies an innovative solution to manage the capacitive current ensuring a very low ripple on the output voltage. It consists of a series of independent, bi-directional and regulated DC sources. Compared to existing topologies, this solution requires a smaller number of power modules. It avoids internal high frequency modulation and simultaneously offers high resolution of the output voltage and a wide range of operating scenarios.
Current-voltage temperature characteristics of Au/n-Ge (1 0 0) Schottky diodes
Energy Technology Data Exchange (ETDEWEB)
Chawanda, Albert, E-mail: albert.chawanda@up.ac.za [Midlands State University, Bag 9055 Gweru (Zimbabwe); University of Pretoria, 0002 Pretoria (South Africa); Mtangi, Wilbert; Auret, Francois D; Nel, Jacqueline [University of Pretoria, 0002 Pretoria (South Africa); Nyamhere, Cloud [Nelson Mandela Metropolitan University, Port Elizabeth (South Africa); Diale, Mmantsae [University of Pretoria, 0002 Pretoria (South Africa)
2012-05-15
The variation in electrical characteristics of Au/n-Ge (1 0 0) Schottky contacts have been systematically investigated as a function of temperature using current-voltage (I-V) measurements in the temperature range 140-300 K. The I-V characteristics of the diodes indicate very strong temperature dependence. While the ideality factor n decreases, the zero-bias Schottky barrier height (SBH) ({Phi}{sub B}) increases with the increasing temperature. The I-V characteristics are analyzed using the thermionic emission (TE) model and the assumption of a Gaussian distribution of the barrier heights due to barrier inhomogeneities at the metal-semiconductor interface. The zero-bias barrier height {Phi}{sub B} vs. 1/2 kT plot has been used to show the evidence of a Gaussian distribution of barrier heights and values of {Phi}{sub B}=0.615 eV and standard deviation {sigma}{sub s0}=0.0858 eV for the mean barrier height and zero-bias standard deviation have been obtained from this plot, respectively. The Richardson constant and the mean barrier height from the modified Richardson plot were obtained as 1.37 A cm{sup -2} K{sup -2} and 0.639 eV, respectively. This Richardson constant is much smaller than the reported of 50 A cm{sup -2} K{sup -2}. This may be due to greater inhomogeneities at the interface.
Energy Technology Data Exchange (ETDEWEB)
Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt
2008-02-27
Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)
International Nuclear Information System (INIS)
Vysotsky, V S; Fetisov, S S; Sytnikov, V E
2008-01-01
Electro - technical devices are considered as the most prospective use for high temperature superconductors. For such devices the overload currents due to faults in grids are the operational reality. In these cases the fault currents may forcibly go to superconductors being sometimes dozens times more than the critical currents of HTS. Overloads are the working modes for fault current limiters also. To understand the behavior of HTS devices at overloads it is important to study voltage-current characteristics (VCC) of basic HTS tapes in real cooling conditions. The knowledge of VCC permits to model and to simulate properly HTS devices behavior at overloads. We performed the study of VCC of several HTS tapes at currents several times more than their critical ones. Both, 1-G and 2-G tapes were tested. There were found peculiarities or 'spikes' on VCC at rising currents that vanished at decaying currents. It was shown that such peculiarities are determined by the change of cooling conditions from the convective heat exchange to the nucleate boiling. Nucleate boiling activation and development times were determined. Their dependencies on heat release were measured. The data obtained can be used in simulation of heating of real superconducting devices at overload conditions
Transient voltage response of a superconducting strip to a supercritical current pulse
International Nuclear Information System (INIS)
Attekum, P.M.Th.M. van; Wouters, M.C.H.M.; Wolter, J.; Horstman, R.E.
1981-01-01
A superconductor subject to a supercritical current pulse displays a delay time between the onset of the current pulse and the onset of the corresponding voltage response. From the onset of the voltage response it takes a second (transient) time to reach the stationary state. It is shown that the transient time can be explained with inhomogeneities in the strip which give rise to a distribution of delay times. The transient time is thus not related to a characteristic time in the superconductor. For small supercritical currents also heating effects show up. (author)
Saive, Rebecca; Mueller, Christian; Schinke, Janusz; Lovrincic, Robert; Kowalsky, Wolfgang
2013-12-01
We present a comparison of the potential distribution along the cross section of bilayer poly(3-hexylthiophene)/1-(3-methoxycarbonyl)propyl-1-phenyl[6,6]C61 (P3HT/PCBM) solar cells, which show normal and anomalous, S-shaped current-voltage (IV) characteristics. We expose the cross sections of the devices with a focussed ion beam and measure them with scanning Kelvin probe microscopy. We find that in the case of S-shaped IV-characteristics, there is a huge potential drop at the PCBM/Al top contact, which does not occur in solar cells with normal IV-characteristics. This behavior confirms the assumption that S-shaped curves are caused by hindered charge transport at interfaces.
International Nuclear Information System (INIS)
Saive, Rebecca; Kowalsky, Wolfgang; Mueller, Christian; Schinke, Janusz; Lovrincic, Robert
2013-01-01
We present a comparison of the potential distribution along the cross section of bilayer poly(3-hexylthiophene)/1-(3-methoxycarbonyl)propyl-1-phenyl[6,6]C61 (P3HT/PCBM) solar cells, which show normal and anomalous, S-shaped current-voltage (IV) characteristics. We expose the cross sections of the devices with a focussed ion beam and measure them with scanning Kelvin probe microscopy. We find that in the case of S-shaped IV-characteristics, there is a huge potential drop at the PCBM/Al top contact, which does not occur in solar cells with normal IV-characteristics. This behavior confirms the assumption that S-shaped curves are caused by hindered charge transport at interfaces
Simulation and investigation of SiPM’s leakage currents at low voltages
International Nuclear Information System (INIS)
Parygin, P P; Popova, E V; Grachev, V M
2017-01-01
Technology Computer-Aided Design (TCAD) allows us to use computers in order to develop semiconductor processing technologies and devices and optimize them. Within a framework of a study of silicon photomultipliers (SiPM) a simulation of these devices has been made. The simulation was performed for the irradiated SiPMs and current-voltage characteristics were obtained for the modeled devices. Investigation of current-voltage curve below breakdown with regard to the simulated structure was performed. Obtained curves are presented. (paper)
LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control
Directory of Open Access Journals (Sweden)
Hung-I Hsieh
2017-02-01
Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.
Current-Voltage Characteristics of the Composites Based on Epoxy Resin and Carbon Nanotubes
Directory of Open Access Journals (Sweden)
Iwona Pełech
2015-01-01
Full Text Available Polymer composites based on epoxy resin were prepared. Multiwalled carbon nanotubes synthesized on iron-cobalt catalyst were applied as a filler in a polymer matrix. Chlorine or hydroxyl groups were incorporated on the carbon nanotubes surface via chlorination or chlorination followed by hydroxylation. The effect of functionalized carbon nanotubes on the epoxy resin matrix is discussed in terms of the state of CNTs dispersion in composites as well as electrical properties. For the obtained materials current-voltage characteristics were determined. They had a nonlinear character and were well described by an exponential-type equation. For all the obtained materials the percolation threshold occurred at a concentration of about 1 wt%. At a higher filler concentration >2 wt%, better conductivity was demonstrated by polymer composites with raw carbon nanotubes. At a lower filler concentration <2 wt%, higher values of electrical conductivity were obtained for polymer composites with modified carbon nanotubes.
Loss characteristics of FLTD magnetic cores under fast pulsed voltage
International Nuclear Information System (INIS)
Wang Zhiguo; Sun Fengju; Qiu Aici; Jiang Xiaofeng; Liang Tianxue; Yin Jiahui; Liu Peng; Wei Hao; Zhang Pengfei; Zhang Zhong
2012-01-01
The test platform has been developed to generate exciting pulsed voltages with the rise time less than 30 ns. The loss characteristics of cores of 25 μm 2605TCA Metglas and 50 μm DG6 electrical steel were then studied. A characteristic parameter, the gradient of the voltage pulse applied per unit core area, is proposed to describe the exciting condition applied on magnetic cores. The loss of the DG6 core is about 4 times that of the 2605TCA core. Most loss of the DG6 core, about 75%, is due to eddy current. For the 2605TCA core, the percentage is about 28%. (authors)
Current-voltage characteristics of a tunnel junction with resonant centers
International Nuclear Information System (INIS)
Ivanov, T.; Valtchinov, V.
1994-05-01
We calculated the I-V characteristics of a tunnel junction containing impurities in the barrier. We consider the indirect resonant tunneling involving the impurities. The Coulomb repulsion energy E c between two electrons with opposite spins simultaneously residing on the impurity is introduced by an Anderson Hamiltonian. At low temperatures T is much less than E c the I-V characteristics is linear in V both for V c and for V>E c and changes slope at V=E c . This behaviour reflects the energy spectrum of the impurity electrons - the finite value of the charging energy E c . At T ∼ E c the junction reveals an ohmic-like behaviour as a result of the smearing out of the charging effects by the thermal fluctuations. (author). 10 refs, 2 figs
A Novel Programmable CMOS Fuzzifiers Using Voltage-to-Current Converter Circuit
Directory of Open Access Journals (Sweden)
K. P. Abdulla
2012-01-01
Full Text Available This paper presents a new voltage-input, current-output programmable membership function generator circuit (MFC using CMOS technology. It employs a voltage-to-current converter to provide the required current bias for the membership function circuit. The proposed MFC has several advantageous features. This MFC can be reconfigured to perform triangular, trapezoidal, S-shape, Z-Shape, and Gaussian membership forms. This membership function can be programmed in terms of its width, slope, and its center locations in its universe of discourses. The easily adjustable characteristics of the proposed circuit and its accuracy make it suitable for embedded system and industrial control applications. The proposed MFC is designed using the spice software, and simulation results are obtained.
Low Voltage Current Mode Switched-Current-Mirror Mixer
Directory of Open Access Journals (Sweden)
Chunhua Wang
2009-09-01
Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.
International Nuclear Information System (INIS)
Cui Yimin; Wang Rongming
2010-01-01
Effects of moisture absorption on capacitance-loss and current-voltage characteristics of LaMnO 3+δ /SrTiO 3 :Nb heterojunction had been investigated after the heterojunctions were exposed to ambient air. The moisture-absorption-induced increases in loss tangent and breakdown voltage were observed, whereas no changes were found on capacitance and diffusion voltage. These results were discussed by the decrease of oxygen ions in LaMnO 3+δ and the generation of hydroxide ions at grain boundaries. This work will favor both electronic transport analysis and future device applications.
Dynamic range of low-voltage cascode current mirrors
DEFF Research Database (Denmark)
Bruun, Erik; Shah, Peter Jivan
1995-01-01
Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...
International Nuclear Information System (INIS)
Rivera, V.A.G.; Stari, C.; Sergeenkov, S.; Marega, E.; Araujo-Moreira, F.M.
2008-01-01
We present our recent results on the temperature dependence of current-voltage characteristics for polycrystalline Y 1-x Pr x Ba 2 Cu 3 O 7-δ superconductors with x=0.0, 0.1 and 0.3. The experimental results are found to be reasonably well fitted for all samples by a power like law of the form V=R(I-I c ) a(T) . Here, we assume that a(T)=1+Φ 0 I C (T)/2πk B T and I C (T)=I C (0)(1-T/T C ) 3/2 for the temperature dependences of the power exponent and critical current, respectively. According to the theoretical interpretation of the obtained results, nonlinear deviation of our current-voltage characteristics curves from Ohmic behavior (with a(T C )=1) below T C is attributed to the manifestation of dissipation processes. They have a characteristic temperature T p defined via the power exponent as a(T p )=2 and are related to the current induced depinning of Abrikosov vortices. Both T C (x) and T p (x) are found to decrease with an increase of Pr concentration x reflecting deterioration of the superconducting properties of the doped samples
Associating ground magnetometer observations with current or voltage generators
DEFF Research Database (Denmark)
Hartinger, M. D.; Xu, Z.; Clauer, C. R.
2017-01-01
A circuit analogy for magnetosphere-ionosphere current systems has two extremes for driversof ionospheric currents: ionospheric elec tric fields/voltages constant while current/conductivity vary—the“voltage generator”—and current constant while electric field/conductivity vary—the “current generator.......”Statistical studies of ground magnetometer observations associated with dayside Transient High LatitudeCurrent Systems (THLCS) driven by similar mechanisms find contradictory results using this paradigm:some studies associate THLCS with voltage generators, others with current generators. We argue that mostof...... these two assumptions substantially alter expectations for magnetic perturbations associatedwith either a current or a voltage generator. Our results demonstrate that before interpreting groundmagnetometer observations of THLCS in the context of current/voltage generators, the location...
The Effect of Image Potential on the Current-Voltage Characteristics of a Ferritin-layer
Directory of Open Access Journals (Sweden)
Eunjung Bang
2010-11-01
Full Text Available Considering for the concept of power storage systems, such as those used to supply power to microelectronic devices, ferritins have aroused a lot of interests for applications in bioelectrochemical devices. And electron transfer rates from the proteins to electrode surface are key determinants of overall performance and efficiency of the ferritin-based devices. Here we have investigated the electron transport mechanism of ferritin layer which was immobilized on an Au electrode. The current-voltage (I-V curves are obtained by a conductive atomic force microscope (c-AFM as a function of contact area between AFM tip and the ferritin layer. In the low voltage region, I-V curves are affected by both Fowler-Nordheim tunneling and image force. On the other hand, the experimental results are consistent with a Simmons model in a high voltage region, indicating that, as the voltage increases, the image potential has a dominant effect on the electron transport mechanism. These results are attributed to the film-like character of the ferritin layer, which generates an image potential to lower the barrier height in proportion to the voltage increment.
High-voltage, high-current, solid-state closing switch
Focia, Ronald Jeffrey
2017-08-22
A high-voltage, high-current, solid-state closing switch uses a field-effect transistor (e.g., a MOSFET) to trigger a high-voltage stack of thyristors. The switch can have a high hold-off voltage, high current carrying capacity, and high time-rate-of-change of current, di/dt. The fast closing switch can be used in pulsed power applications.
Qin, Yunpeng; Chen, Yu; Cui, Yong; Zhang, Shaoqing; Yao, Huifeng; Huang, Jiang; Li, Wanning; Zheng, Zhong; Hou, Jianhui
2017-06-01
Tandem organic solar cells (TOSCs), which integrate multiple organic photovoltaic layers with complementary absorption in series, have been proved to be a strong contender in organic photovoltaic depending on their advantages in harvesting a greater part of the solar spectrum and more efficient photon utilization than traditional single-junction organic solar cells. However, simultaneously improving open circuit voltage (V oc ) and short current density (J sc ) is a still particularly tricky issue for highly efficient TOSCs. In this work, by employing the low-bandgap nonfullerene acceptor, IEICO, into the rear cell to extend absorption, and meanwhile introducing PBDD4T-2F into the front cell for improving V oc , an impressive efficiency of 12.8% has been achieved in well-designed TOSC. This result is also one of the highest efficiencies reported in state-of-the-art organic solar cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Chundeva-Blajer, Marija M.
2004-01-01
The principle aim and task of the thesis is the analysis and development of 20 kV combined current-voltage instrument transformer (CCVIT) by using modern CAD techniques. CCVIT is a complex electromagnetic system comprising of four windings and two magnetic cores in one insulation housing for simultaneous transformation of high voltages and currents to measurable signal values by standard instruments. The analytical design methods can be applied on simple electromagnetic configurations, which is not the case with the CCVIT. There is mutual electromagnetic influence between the voltage measurement core (VMC) and the current measurement core (CMC). After the analytical CCVIT design had been done, exact determination of its metrological characteristics has been accomplished by using the numerical finite element method implemented in the FEM-3D program package. The FEM-3D calculation is made in 19 cross-sectional layers of the z-axis of the CCVIT three-dimensional domain. By FEM-3D application the three-dimensional CCVIT magnetic field distribution is derived. This is the basis for calculation of the initial metrological characteristics of the CCVIT (VMC is accuracy class 3 and CMC is accuracy class 1). By using the stochastic optimization technique based on genetic algorithm the CCVIT optimal design is achieved. The objective function is the minimum of the metrological parameters (VIM voltage error and CMC current error). There are I I independent input variables during the optimization process by which the optimal project is derived. The optimal project is adapted for realization of a prototype and the optimized project is derived. Full comparative analysis of the metrological and the electromagnetic characteristics of the three projects is accomplished. By application of the program package MATLAB/SIMULINK the CCVIT transient phenomena is analyzed for different regimes in the three design projects. In the Instrument Transformer Factory of EMO A. D.-Ohrid a CCVIT
Directory of Open Access Journals (Sweden)
Ricardo Vera
2010-04-01
Full Text Available Polymer-based organic light-emitting diodes (OLEDs with the structure ITO / PEDOT:PSS / MDMO-PPV / Metal were prepared by spincoating. It is known that electroluminescence of these devices is strongly dependent on the material used as cathode and on the depositionparameters of the polymer electroluminescent layer MDMO-PPV. Objective. In this work the effect of i the frequency of the spin coater(1000-8000 rpm, ii the concentration of the MDMO-PPV: Toluene solution, and iii the material used as cathode (Aluminium or Silveron the electrical response of the devices, was evaluated through current-voltage (I-V measurements. Materials and methods. PEDOT:PPSand MDMO-PPV organic layers were deposited by spin coating on ITO substrates, and the OLED structure was completed with cathodesof aluminium and silver. The electric response of the devices was evaluated based on the I-V characteristics. Results. Diodes prepared withthinner organic films allow higher currents at lower voltages; this can be achieved either by increasing the frequency of the spin coater orby using concentrations of MDMO-PPV: Toluene lower than 2% weight. A fit of the experimental data showed that the diodes have twocontributions to the current. The first one is attributed to parasitic currents between anode and cathode, and the other one is a parallel currentthrough the organic layer, in which the carrier injection mechanism is mediated by thermionic emission. Conclusions. The results of thefitting and the energy level alignment through the whole structure show that PPV-based OLEDs are unipolar devices, with current mainlyattributed to hole transport.
Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers
Directory of Open Access Journals (Sweden)
J. Koton
2011-04-01
Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.
Influence of process parameters on threshold voltage and leakage current in 18nm NMOS device
Atan, Norani Binti; Ahmad, Ibrahim Bin; Majlis, Burhanuddin Bin Yeop; Fauzi, Izzati Binti Ahmad
2015-04-01
The process parameters are very crucial factor in the development of transistors. There are many process parameters that influenced in the development of the transistors. In this research, we investigate the effects of the process parameters variation on response characteristics such as threshold voltage (VTH) and sub-threshold leakage current (IOFF) in 18nm NMOS device. The technique to identify semiconductor process parameters whose variability would impact most on the device characteristic is realized through the process by using Taguchi robust design method. This paper presents the process parameters that influenced in threshold voltage (VTH) and sub-threshold leakage current (IOFF) which includes the Halo Implantation, Compensation Implantation, Adjustment Threshold voltage Implantation and Source/Drain Implantation. The design, fabrication and characterization of 18nm HfO2/TiSi2 NMOS device is simulated and performed via a tool called Virtual Wafer Fabrication (VWF) Silvaco TCAD Tool known as ATHENA and ATLAS simulators. These two simulators were combined with Taguchi L9 Orthogonal method to aid in the design and the optimization of the process parameters to achieve the optimum average of threshold voltage (VTH) and sub-threshold leakage current, (IOFF) in 18nm device. Results from this research were obtained; where Halo Implantation dose was identified as one of the process parameter that has the strongest effect on the response characteristics. Whereby the Compensation Implantation dose was identified as an adjustment factor to get the nominal values of threshold voltage VTH, and sub-threshold leakage current, IOFF for 18nm NMOS devices equal to 0.302849 volts and 1.9123×10-16 A/μm respectively. The design values are referred to ITRS 2011 prediction.
Energy Technology Data Exchange (ETDEWEB)
Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)
2016-07-11
Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.
International Nuclear Information System (INIS)
Swain, R.; Jena, K.; Lenka, T. R.
2016-01-01
In this paper, an AlN/GaN-based MOSHEMT is proposed, in accordance to this, a charge control model has been developed analytically and simulated with MATLAB to predict the characteristics of threshold voltage, drain currents and transconductance. The physics based models for 2DEG density, threshold voltage and quantum capacitance in the channel has been put forward. By using these developed models, the drain current for both linear and saturation models is derived. The predicted threshold voltage with the variation of barrier thickness has been plotted. A positive threshold voltage can be obtained by decreasing the barrier thickness which builds up the foundation for enhancement mode MOSHEMT devices. The predicted I_d–V_g_s, I_d–V_d_s and transconductance characteristics show an excellent agreement with the experimental results and hence validate the model.
Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film
Das, Amit Kumar; Meikap, Ajit Kumar
2017-12-01
In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.
Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film
Das, Amit Kumar; Meikap, Ajit Kumar
2018-06-01
In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.
An, Qiaoshi; Zhang, Fujun; Li, Lingliang; Wang, Jian; Sun, Qianqian; Zhang, Jian; Tang, Weihua; Deng, Zhenbo
2015-02-18
We present a smart strategy to simultaneously increase the short circuit current (Jsc), the open circuit voltage (Voc), and the fill factor (FF) of polymer solar cells (PSCs). A two-dimensional conjugated small molecule photovoltaic material (SMPV1), as the second electron donor, was doped into the blend system of poly(3-hexylthiophene) (P3HT) and [6,6]-phenyl-C71-butyric acid methyl (PC71BM) to form ternary PSCs. The ternary PSCs with 5 wt % SMPV1 doping ratio in donors achieve 4.06% champion power conversion efficiency (PCE), corresponding to about 21.2% enhancement compared with the 3.35% PCE of P3HT:PC71BM-based PSCs. The underlying mechanism on performance improvement of ternary PSCs can be summarized as (i) harvesting more photons in the longer wavelength region to increase Jsc; (ii) obtaining the lower mixed highest occupied molecular orbital (HOMO) energy level by incorporating SMPV1 to increase Voc; (iii) forming the better charge carrier transport channels through the cascade energy level structure and optimizing phase separation of donor/acceptor materials to increase Jsc and FF.
Stability of high current diode under 100-nanosecond-pulse voltage
International Nuclear Information System (INIS)
Lai Dingguo; Qiu Aici; Zhang Yongmin; Huang Jianjun; Ren Shuqing; Yang Li
2012-01-01
Stability of high current diode under pulse voltage with 80 ns and 34 ns rise time was studied on the flash Ⅱ accelerator. Influence of rise time of diode voltage on startup time and cathode emission uniformity and repeatability of diode impedance was analyzed by comparing the experimental results with numerically simulated results, and the influence mechanism was discussed. The startup time of diode increases with the increasing of rise time of voltage, and the repeatability of diode impedance decreases. Discal plane cathode is prone to emit rays intensely in the center area, the time that plasma covers the surface of the cathode increases and the shielding effect has more impact on cathode emission according to the increase of rise time. Local intense emission on the cathode increases expansion speed of plasma and reduces the effective emission area. The stability of characteristic impedance of diode under a pulse voltage with slow rise time is decreased by the combined action of expansion speed of plasma and the effective emission area. (authors)
Szmyd, Janusz S.; Komatsu, Yosuke; Brus, Grzegorz; Ghigliazza, Francesco; Kimijima, Shinji; Ściążko, Anna
2014-09-01
This paper discusses the transient characteristics of the planar type SOFC cell stack, of which the standard output is 300 W. The transient response of the voltage to the manipulation of an electric current was investigated. The effects of the response and of the operating condition determined by the operating temperature of the stack were studied by mapping a current-voltage (I-V) correlation. The current-based fuel control (CBFC) was adopted for keeping the fuel utilization factor at constant while the value of the electric current was ramped at the constant rate. The present experimental study shows that the transient characteristics of the cell voltage are determined by primarily the operating temperature caused by the manipulation of the current. Particularly, the slope of the I-V curve and the overshoot found on the voltage was remarkably influenced by the operating temperature. The different values of the fuel utilization factor influence the height of the settled voltages. The CBFC has significance in determining the slope of the I-V characteristic, but the different values ofthe fuel utilization factor does not affect the slope as the operating temperature does. The CBFC essentially does not alter the amplitude of the overshoot on the voltage response, since this is dominated by the operating temperature and its change is caused by manipulating the current.
Directory of Open Access Journals (Sweden)
Szmyd Janusz S.
2014-09-01
Full Text Available This paper discusses the transient characteristics of the planar type SOFC cell stack, of which the standard output is 300 W. The transient response of the voltage to the manipulation of an electric current was investigated. The effects of the response and of the operating condition determined by the operating temperature of the stack were studied by mapping a current-voltage (I-V correlation. The current-based fuel control (CBFC was adopted for keeping the fuel utilization factor at constant while the value of the electric current was ramped at the constant rate. The present experimental study shows that the transient characteristics of the cell voltage are determined by primarily the operating temperature caused by the manipulation of the current. Particularly, the slope of the I-V curve and the overshoot found on the voltage was remarkably influenced by the operating temperature. The different values of the fuel utilization factor influence the height of the settled voltages. The CBFC has significance in determining the slope of the I-V characteristic, but the different values ofthe fuel utilization factor does not affect the slope as the operating temperature does. The CBFC essentially does not alter the amplitude of the overshoot on the voltage response, since this is dominated by the operating temperature and its change is caused by manipulating the current.
Directory of Open Access Journals (Sweden)
Hyewon Lee
2015-04-01
Full Text Available This paper describes the design, evaluation, and implementation of a compensation scheme for a measurement voltage transformer (VT using the hysteresis characteristics of the core. The error of a VT is caused by the primary winding voltage and secondary winding voltage. The latter depends on the secondary current, whereas the former depends on the primary current, which is an aggregate of the exciting and secondary currents. The secondary current is obtained directly from the secondary voltage and is used to obtain the voltage across the secondary winding. For the primary current, the exciting current is decomposed into two components: core-loss and magnetizing currents. The magnetizing current is obtained by the flux-magnetizing current curve instead of the hysteresis loop to minimize the required loops for compensation. The core-loss current is obtained by dividing the primary induced voltage by the core-loss resistance. Finally, the estimated voltages across the primary and secondary windings are added to the measured secondary voltage for compensation. The scheme can significantly improve the accuracy of a VT. The results of the performance of compensator are shown in the experimental test. The accuracy of the measurement VT improves from 1.0C class to 0.1C class. The scheme can help to significantly reduce the required core cross section of a measurement VT in an electrical energy system.
Thermal instability and current-voltage scaling in superconducting fault current limiters
Energy Technology Data Exchange (ETDEWEB)
Zeimetz, B [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Tadinada, K [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Eves, D E [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Coombs, T A [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Evetts, J E [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Campbell, A M [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom)
2004-04-01
We have developed a computer model for the simulation of resistive superconducting fault current limiters in three dimensions. The program calculates the electromagnetic and thermal response of a superconductor to a time-dependent overload voltage, with different possible cooling conditions for the surfaces, and locally variable superconducting and thermal properties. We find that the cryogen boil-off parameters critically influence the stability of a limiter. The recovery time after a fault increases strongly with thickness. Above a critical thickness, the temperature is unstable even for a small applied AC voltage. The maximum voltage and maximum current during a short fault are correlated by a simple exponential law.
Yan Hong; Yong Wang; Wang Ling Goh; Yuan Gao; Lei Yao
2015-08-01
This paper presents a mathematic method and a cost-efficient circuit to measure the value of each component of the bio-impedance model at electrode-electrolyte interface. The proposed current excited triple-time-voltage oversampling (TTVO) method deduces the component values by solving triple simultaneous electric equation (TSEE) at different time nodes during a current excitation, which are the voltage functions of time. The proposed triple simultaneous electric equations (TSEEs) allows random selections of the time nodes, hence numerous solutions can be obtained during a single current excitation. Following that, the oversampling approach is engaged by averaging all solutions of multiple TSEEs acquired after a single current excitation, which increases the practical measurement accuracy through the improvement of the signal-to-noise ratio (SNR). In addition, a print circuit board (PCB) that consists a switched current exciter and an analog-to-digital converter (ADC) is designed for signal acquisition. This presents a great cost reduction when compared against other instrument-based measurement data reported [1]. Through testing, the measured values of this work is proven to be in superb agreements on the true component values of the electrode-electrolyte interface model. This work is most suited and also useful for biological and biomedical applications, to perform tasks such as stimulations, recordings, impedance characterizations, etc.
Mitigation of Voltage and Current Harmonics in Grid-Connected Microgrids
DEFF Research Database (Denmark)
Savaghebi, Mehdi; Guerrero, Josep M.; Jalilian, Alireza
2012-01-01
In this paper, a control approach is proposed for selective compensation of main voltage and current harmonics in grid-connected microgrids. Two modes of compensation are considered, i.e. voltage and current compensation modes. In the case that sensitive loads are connected to the point of common...... coupling (PCC), voltage compensation mode is activated in order to provide a high voltage quality at PCC. Otherwise, grid current harmonics are mitigated (current compensation mode) in order to avoid excessive harmonic supply by the grid. In both modes, harmonic compensation is achieved through proper...... control of distributed generators (DGs) interface converters. The compensation effort of each harmonic is shared considering the corresponding current harmonic supplied by the DGs. The control system of each DG comprises harmonic compensator, power controllers, voltage and current controllers and virtual...
Method of controlling illumination device based on current-voltage model
DEFF Research Database (Denmark)
2013-01-01
The present invention relates to an illumination device comprising a number of LEDs, means for receiving an input signal, means for generating an activation signal for at least one of the LEDs based on the input signal. The illumination device comprises further means for obtaining the voltage...... and the colorimetric properties of said light emitted by LED. The present invention relates also to a method of controlling and a meted of calibrating such illumination device....... across and current through the LED and the means for generating the activation signal is adapted to generate the activating signal based on the voltage, the current and a current- voltage model related to LED. The current-voltage model defines a relationship between the current, the voltage...
Zorba, S; Le, Q T; Watkins, N J; Yan, L; Gao, Y
2001-09-01
Atomic force microscopy was used to study the growth modes (on SiO2, MoS2, and Au substrates) and the current-voltage (I-V) characteristics of organic semiconductor pentacene. Pentacene films grow on SiO2 substrate in a layer-by-layer manner with full coverage at an average thickness of 20 A and have the highest degree of molecular ordering with large dendritic grains among the pentacene films deposited on the three different substrates. Films grown on MoS2 substrate reveal two different growth modes, snowflake-like growth and granular growth, both of which seem to compete with each other. On the other hand, films deposited on Au substrate show granular structure for thinner coverages (no crystal structure) and dendritic growth for higher coverages (crystal structure). I-V measurements were performed with a platinum tip on a pentacene film deposited on a Au substrate. The I-V curves on pentacene film reveal symmetric tunneling type character. The field dependence of the current indicates that the main transport mechanism at high field intensities is hopping (Poole-Frenkel effect). From these measurements, we have estimated a field lowering coefficient of 9.77 x 10(-6) V-1/2 m1/2 and an ideality factor of 18 for pentacene.
Shimer, Daniel W.; Lange, Arnold C.
1995-01-01
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.
Shimer, D.W.; Lange, A.C.
1995-05-23
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.
International Nuclear Information System (INIS)
Saad, M.; Kassis, A.
2005-03-01
Current voltage characteristics of Zn O/CdS/CuGaSe 2 single crystal solar cells, which have gone through repetitive annealing treatment and have been measured at different values of temperature and illumination intensity, were analyzed using the two-diode equation. The analysis revealed that current transport in these cells is governed by two competing transport mechanisms relating strongly to interface states and that both mechanisms are thermally and light activated. These two mechanisms are interface recombination and tunneling enhanced interface recombination. The activation energy values of the saturation current density in both mechanisms were calculated from the temperature dependence of the parameters describing each of them. It was found that these values depend on temperature and illumination intensity. Furthermore, the behavior of the photovoltaic parameters could be explained relying on the results of the analysis. (Authors)
International Nuclear Information System (INIS)
Rezapour, Arash; Rezapour, Pegah
2015-01-01
We investigate the effect of dopant random fluctuation on threshold voltage and drain current variation in a two-gate nanoscale transistor. We used a quantum-corrected technology computer aided design simulation to run the simulation (10000 randomizations). With this simulation, we could study the effects of varying the dimensions (length and width), and thicknesses of oxide and dopant factors of a transistor on the threshold voltage and drain current in subthreshold region (off) and overthreshold (on). It was found that in the subthreshold region the variability of the drain current and threshold voltage is relatively fixed while in the overthreshold region the variability of the threshold voltage and drain current decreases remarkably, despite the slight reduction of gate voltage diffusion (compared with that of the subthreshold). These results have been interpreted by using previously reported models for threshold current variability, load displacement, and simple analytical calculations. Scaling analysis shows that the variability of the characteristics of this semiconductor increases as the effects of the short channel increases. Therefore, with a slight increase of length and a reduction of width, oxide thickness, and dopant factor, we could correct the effect of the short channel. (paper)
Directory of Open Access Journals (Sweden)
M. R. Aghamohammadi
2011-06-01
Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.
DEFF Research Database (Denmark)
Liu, Changjin; Xu, Dehong; Zhu, Nan
2013-01-01
Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...
Optical sensors for the measurement of electric current and voltage
Energy Technology Data Exchange (ETDEWEB)
Rutgers, W R; Hulshof, H J.M.; Laurensse, I J; van der Wey, A H
1987-01-01
Optical sensors for the measurement of electrical current and voltage were developed for application in electric power systems. The current sensor, based on the Faraday effect in a monomode glass fiber, and the voltage sensor, based on the transverse Pockels effect in a crystal, are demonstrated in wide-band (10 MHz) interference-free measurements of pulsed currents and impulse voltages.
Study on the streamer inception characteristics under positive lightning impulse voltage
Directory of Open Access Journals (Sweden)
Zezhong Wang
2017-11-01
Full Text Available The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.
Study on the streamer inception characteristics under positive lightning impulse voltage
Wang, Zezhong; Geng, Yinan
2017-11-01
The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.
Ultra-Low Voltage Class AB Switched Current Memory Cell
DEFF Research Database (Denmark)
Igor, Mucha
1996-01-01
This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...
DEFF Research Database (Denmark)
Pankratov, A.L.; Sobolev, A.S.; Koshelets, V.P.
2007-01-01
We have numerically investigated the dynamics of a long linear Josephson tunnel junction with overlap geometry. Biased by a direct current (dc) and an applied dc magnetic field, the junction has important applications as tunable high frequency oscillator [flux-flow oscillator (FFO......) placed at both ends of the FFO. In our model, the damping parameter depends both on the spatial coordinate and on the amplitude of the ac voltage. In order to find the dc current-voltage curves, the damping parameter has to be calculated self-consistently by successive approximations and time integration...
International Nuclear Information System (INIS)
Saad, M.; Kasis, A.
2011-01-01
Current-voltage (j-V) characteristics of the record-efficiency CuGaSe 2 solar cell measured under several illumination levels are analyzed using a two-diode equation for a more accurate description of cell behavior. The contribution of each diode to the total cell j-V characteristic under illumination was estimated using the current separation method presented recently. This is performed in an effort to identify the distinctive features of this record-efficiency cell which have led to the up-to-date highest open circuit voltage of V o c = 946 mV and fill factor of FF = 66.5% for CuGaSe 2 solar cells. Furthermore, the interface recombination component of the cell current under illumination is quantitatively discussed applying the interface recombination model presented earlier. (author)
Energy Technology Data Exchange (ETDEWEB)
Grishakov, K. S., E-mail: ksgrishakov@yahoo.com; Elesin, V. F. [National Research Nuclear University “MEPhI” (Russian Federation)
2016-08-15
A numerical solution to the problem of transient processes in a resonant tunneling diode featuring a current–voltage characteristic with hysteresis is found for the first time in the context of a coherent model (based on the coupled Schrödinger and Poisson equations) taking into account the Fermi distribution of electrons. The transitions from the high-current to the low-current state and vice versa, which result from the existence of hysteresis and are of great practical importance for ultrafast switches based on resonant tunneling diodes, are studied in detail. It is shown that the transition times for such processes initiated by the application of a small voltage can significantly exceed the characteristic time ℏ/Γ (where G is the width of the resonance level). It is established for the first time that the transition time can be reduced and made as short as the characteristic time ℏ/Γ by applying a sufficiently high voltage. For the parameters of the resonant-tunnelingdiode structure considered in this study, the required voltage is about 0.01 V.
Symmetric voltage-controlled variable resistance
Vanelli, J. C.
1978-01-01
Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.
Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke
2012-01-01
We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.
International Nuclear Information System (INIS)
Mendes, Luciano A.; Rodrigues, Jhonatam C.; Mafra, Marcio
2012-01-01
The glow-to-arc transition phenomena (arcing) observed in plasma reactors used in materials processing was studied through the arcs characteristic current and voltage waveforms. In order to capture these arcs signals, a LABVIEW based automated instrumentation system (ARCVIEW) was developed, including the integration of an oscilloscope equipped with proper current and voltage probes. The system also allows capturing the process parameters at the arc occurrence moments, which were used to map the arcs events conditions. Experiments in H 2 -Ar DC pulsed plasma returned signals data from 215 arcs events, which were analyzed through software routines. According to the results, an anti-arcing system should react in the time order of few microseconds to prevent most of the damage caused by the undesired arcing phenomena.
Bidirectional current-voltage converters based on magnetostrictive/piezoelectric composites
Jia, Y.; Or, S.W.; Chan, H.L.W.; Jiao, J.; Luo, H.; Van der Zwaag, S.
2009-01-01
We report a power supply-free, bidirectional electric current-voltage converter based on a coil-wound laminated composite of magnetostrictive alloy and piezoelectric crystal. An electric current applied to the coil induces a magnetic field, resulting in an electric voltage from the composite due to
Cai, Yuanji; Guan, Yonggang; Liu, Weidong
2017-06-01
Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.
Current-voltage model of LED light sources
DEFF Research Database (Denmark)
Beczkowski, Szymon; Munk-Nielsen, Stig
2012-01-01
Amplitude modulation is rarely used for dimming light-emitting diodes in polychromatic luminaires due to big color shifts caused by varying magnitude of LED driving current and nonlinear relationship between intensity of a diode and driving current. Current-voltage empirical model of light...
International Nuclear Information System (INIS)
Murray, C.S.; El-Genk, M.S.
1994-02-01
A low voltage/high current switch refer-red as ''Cs-Ba tacitron'' is studied for use as a dc to ac inverter in high temperature and/or ionizing radiation environments. The operational characteristics of the Cs-Ba tacitron as a switch were investigated experimentally in three modes: (a) breakdown mode, (b) I-V mode, and (c) current modulation mode. Operation parameters measured include switching frequencies up to 20 kHz, hold-off voltages up to 200 V, current densities in excess of 15 A/CM 2 , switch power density of 1 kW/cm 2 , and a switching efficiency in excess of 90 % at collector voltages greater than 30 V. Also, if the discharge current is circuit limited to a value below the maximum thermal emission current density, the voltage drop is constant and below 3 V
Voltage-regulating constant-current sources in a linear induction accelerator
International Nuclear Information System (INIS)
Zhao Juan; Cao Kefeng; Deng Jianjun; Zhu Lijun; Yang Jia; Ye Chao; Huang Bin; Cao Ningxiang; Dong Jinxuan; Zhang Jichang; Yu Zhiguo; Chen Min
2002-01-01
Constant-current Sources are one of key units in a linear induction accelerator. The requirements for the sources are to supply stable direct current of high power for the induction coil, be easy to computer-control and highly stable and reliable. Applying the technique of linear current source regulating in series, the primary voltage of the power transformer is regulated through an MJYS-JL-350A type three-phase alterative voltage-regulating module. The output current variation is 300-500 A when the load variation is 0.06-0.1 Ω and the voltage drop of the regulator tube is controlled within 8 V±2V when the variation of mains voltage is in ±10%. Both the current ripple and stability meet the technical requirements. The constant-current sources are controlled through an industrial controller. For each of the constant-current sources has a smallest system comprised of 8051 which is communication-controlled through a RS-485 interface, the sources can be controlled remotely
International Nuclear Information System (INIS)
Bezuglyj, A.I.; Shklovskij, V.A.
1984-01-01
The static and dynamic behavior of thermal domains in inhomogeneous superconducting films, where the inhomogeneity behaves like a portion of the film with a reduced critical current, have been studied theoretically within the framework of the phenomenological approach, using the heat balance equation and the dependence of the superconductor critical current on temperature. Depending on the size of the inhomogeneity (local or extended) and on the relative values of parameters of the homogeneous and inhomogeneous regions, different types of current-voltage characteristics are obtained. The nonstationary problem of thermal domain formation near the inhomogeneity after a current jump has been solved, and the domain boundary (kink) dynamics at a distance from the inhomogeneity has been analyzed. A combination of the results allows one to describe the whole process of normal phase formation and its spread throughout the superconducting film
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
On characteristic voltage of the high Tc superconductor. [Y-Ba-Cu-O
Energy Technology Data Exchange (ETDEWEB)
Vasiliev, B V; Uchaikin, S V [Joint Inst. for Nuclear Research, Low Temperature Physics Dept., Dubna (USSR)
1991-12-01
The critical currents and normal resistances of the small bridges from yttrium-based high-Tc superconducting ceramics have been measured. The characteristic voltage of these bridges was found to be approximately 20{mu}V. This effect can be explained if between the ceramic grains there are contacts of an order of one crystalline cell in size. (orig.).
International Nuclear Information System (INIS)
Wilken, L.; Hoffmann, V.; Wetzig, K.
2006-01-01
A radio frequency (rf) Grimm-type glow discharge source for the chemical analysis of solid samples, with integrated voltage and current probes, was developed. All elements of a plasma equivalent circuit are determined from the measured current-voltage characteristics. The procedure is based on the independent evaluation of the ion current and electron current region. The physical meaning of the parameters is investigated by comparisons with measurements from dc glow discharges. We found that the reduced rf current of the powered electrode is comparable to the reduced current in dc discharges. A formula is developed that corrects the reduced current due to gas heating. The sheath thickness at the powered rf electrode is evaluated and is between 75 and 1100 μm. The voltage of the bulk plasma is in the range 2-15 V, and the resistance is between 30 and 400 Ω. The bulk plasma consumes about 3% of the total power, and the reduced voltage is comparable to the reduced electrical field in the positive column of direct current discharges. The sheath voltage at the grounded electrode is in the range 25-100 V, the capacities are between 10 and 400 pF, and the resistances are in the range 100 Ω-5000 Ω. We also found invariants for the evaluated sheath parameters
Improving off-state leakage characteristics for high voltage AlGaN/GaN-HFETs on Si substrates
Moon, Sung-Woon; Twynam, John; Lee, Jongsub; Seo, Deokwon; Jung, Sungdal; Choi, Hong Goo; Shim, Heejae; Yim, Jeong Soon; Roh, Sungwon D.
2014-06-01
We present a reliable process and design technique for realizing high voltage AlGaN/GaN hetero-junction field effect transistors (HFETs) on Si substrates with very low and stable off-state leakage current characteristics. In this work, we have investigated the effects of the surface passivation layer, prepared by low pressure chemical vapor deposition (LPCVD) of silicon nitride (SiNx), and gate bus isolation design on the off-state leakage characteristics of metal-oxide-semiconductor (MOS) gate structure-based GaN HFETs. The surface passivated devices with gate bus isolation fully surrounding the source and drain regions showed extremely low off-state leakage currents of less than 20 nA/mm at 600 V, with very small variation. These techniques were successfully applied to high-current devices with 80-mm gate width, yielding excellent off-state leakage characteristics within a drain voltage range 0-700 V.
International Nuclear Information System (INIS)
Liu, Yingyi; Yuan, Haiwen; Yang, Qinghua; Cui, Yong
2011-01-01
The research in the field of corona discharge, which is one of the key technologies, can help us to realize ultra-high-voltage (UHV) power transmission. This paper proposes a new sampling resistance sensor to measure the dc UHV corona current in a wide band. By designing the structural and distributed parameters of the sensor, the UHV dielectric breakdown performance and the wide-band measuring characteristics of the sensor are satisfied. A high-voltage discharge test shows that the designed sensor can work under a 1200 kV dc environment without the occurrence of corona discharge. A frequency characteristic test shows that the measuring bandwidth of the sensor can be improved from the current 4.5 to 20 MHz. The test results in an actual dc UHV transmission line demonstrate that the sensor can accurately measure the corona current under the dc UHV environment
Directory of Open Access Journals (Sweden)
R. N. Bhowmik
2015-06-01
Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Bhowmik, R. N.; Vijayasri, G.
2015-06-01
We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids
Directory of Open Access Journals (Sweden)
Seyyed Yousef Mousazadeh Mousavi
2017-10-01
Full Text Available In recent years, the harmonics and unbalance problems endanger the voltage and current quality of power systems, due to increasing usage of nonlinear and unbalanced loads. Use of Distributed Generation (DG-interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method is proposed to compensate voltage and current unbalance and harmonics using the distributed generation (DG-interfacing inverters. This method is applicable to both grid-connected and islanded Microgrids (MGs. In the proposed method, not only the proper control of active and reactive powers can be achieved, but also there is flexibility in compensating the voltage or current quality problems at DG terminals or Points of Common Coupling (PCCs. This control strategy consists of active and reactive power controllers and a voltage/current quality-improvement block. The controller is designed in a stationary (αβ frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. Depending on the compensation modes, the harmonics and unbalance compensation of DG output current, MG-injected current to the grid, as well as PCC and DG voltages, can be achieved in grid-connected operation of MG while in the islanded operation, and the PCC and DG voltages compensation can be obtained through the proposed control scheme.
Enhanced current and voltage regulators for stand-alone applications
DEFF Research Database (Denmark)
Federico, de Bosio; Pastorelli, Michele; Antonio DeSouza Ribeiro, Luiz
2016-01-01
State feedback decoupling permits to achieve a better dynamic response for Voltage Source in stand-alone applications. The design of current and voltage regulators is performed in the discrete-time domain since it provides better accuracy and allows direct pole placement. As the attainable...... bandwidth of the current loop is mainly limited by computational and PWM delays, a lead compensator structure is proposed to overcome this limitation. The design of the voltage regulator is based on the Nyquist criterion, verifying to guarantee a high sensitivity peak. Discrete-time domain implementation...
A New Asymmetrical Current-fed Converter with Voltage Lifting
Directory of Open Access Journals (Sweden)
DELSHAD, M.
2011-05-01
Full Text Available This paper presents a new zero voltage switching current-fed DC-DC converter with high voltage gain. In this converter all switches (main and auxiliary turn on under zero voltage switching and turn off under almost zero voltage switching due to snubber capacitor. Furthermore, the voltage spike across the main switch due to leakage inductance of forward transformer is absorbed. The flyback transformer which is connected to the output in series causes to high voltage gain and less voltage stress on the power devices. Considering high efficiency and voltage gain of this converter, it is suitable for green generated systems such as fuel cells or photovoltaic systems. The presented experimental results verify the integrity of the proposed converter.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Directory of Open Access Journals (Sweden)
Todorović Andreja
2010-01-01
Full Text Available The paper elaborates determination of characteristic values in the discharging process of non-hermetic nickel-cadmium galvanic battery with nominal voltage Un = 60 V and nominal capacity qn = C5 = 190 Ah and its dependence from current and temperature. Study has been performed with the set of experimental metering of voltages, electromotive force, current from discharge time range and electromotive force in steady state regime before and after battery charging. Electromotive force characteristics are obtained by using the Nernst’s equation, while the least square method was used to determine the average values of internal electrical resistivity, power losses and efficiency level. These results were used in the approximate exponential functions to determine the range dependence of the efficiency level from the internal electrical resistance of discharge current in reliance from the temperature range. Obtained results show that, in accordance to the given voltage variation of 10% Un, this type of battery holds maximal full load current of one hour capacity at the temperature of 25°C and maximal full load current of two hours capacity at the temperature of −30°C. The methodology used in the case study covers determination of the electromotive force in time range based on the metered results of values during complete battery fullness and emptiness with prior determination of equilibrium constants of galvanic battery reaction through method suggested by the author of this paper. Further process, using the electromotive force values obtained through the aforementioned process, the metered current, and approximate polynomial function of the nominal discharge voltage characteristic determines range of battery internal electric resistance from time, followed by the selection of discharge cases with average values for: voltage, electromotive force, internal electrical resistance, available and utilized power, power losses, and battery efficiency
Unusual Voltage-Gated Sodium Currents as Targets for Pain.
Barbosa, C; Cummins, T R
2016-01-01
Pain is a serious health problem that impacts the lives of many individuals. Hyperexcitability of peripheral sensory neurons contributes to both acute and chronic pain syndromes. Because voltage-gated sodium currents are crucial to the transmission of electrical signals in peripheral sensory neurons, the channels that underlie these currents are attractive targets for pain therapeutics. Sodium currents and channels in peripheral sensory neurons are complex. Multiple-channel isoforms contribute to the macroscopic currents in nociceptive sensory neurons. These different isoforms exhibit substantial variations in their kinetics and pharmacology. Furthermore, sodium current complexity is enhanced by an array of interacting proteins that can substantially modify the properties of voltage-gated sodium channels. Resurgent sodium currents, atypical currents that can enhance recovery from inactivation and neuronal firing, are increasingly being recognized as playing potentially important roles in sensory neuron hyperexcitability and pain sensations. Here we discuss unusual sodium channels and currents that have been identified in nociceptive sensory neurons, describe what is known about the molecular determinants of the complex sodium currents in these neurons. Finally, we provide an overview of therapeutic strategies to target voltage-gated sodium currents in nociceptive neurons. Copyright © 2016 Elsevier Inc. All rights reserved.
Influence of Voltage on Main Characteristics of Electric Lighting Lamps
Directory of Open Access Journals (Sweden)
V. B. Kozlovskaya
2009-01-01
Full Text Available An analysis and systemization of data on influence of voltage value on main lighting engineering, electric and economic characteristics of incandescent lamps, gaseous-discharge lamps of low and high pressure have been made in the paper.Analytical and graphical dependences have been obtained that ensure to evaluate quantitative changes of corresponding lamp characteristics at voltage deviation from nominal value.
DEFF Research Database (Denmark)
Xin, Zhen; Mattavelli, Paolo; Yao, WenLi
2018-01-01
LCL filters feature low inductance; thus, the injected grid current from an LCL-filtered Voltage Source Inverter (VSI) can be easily distorted by grid voltage harmonics. This problem is especially tough for the control system with Inverter-side Current Feedback (ICF), since the grid current...... harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...
Analytical drift-current threshold voltage model of long-channel double-gate MOSFETs
International Nuclear Information System (INIS)
Shih, Chun-Hsing; Wang, Jhong-Sheng
2009-01-01
This paper presents a new, physical threshold voltage model to solve the ambiguity in determining the threshold voltage of double-gate (DG) MOSFETs. To avoid the difficulties of the conventional 2ψ B model in nearly undoped DG MOSFETs, this study proposes to define the on–off switching based on the actual roles of the drift and diffusion components in the total drain current. The drift current strongly enhances beyond the threshold voltage, while the diffusion current plays a major role in the subthreshold. The threshold voltage is defined as the drift component that exceeds the diffusion counterpart. From the solutions of Poisson's equation, the drift and diffusion currents of DG MOSFETs are separately formulated to derive the analytical expressions of the threshold voltage and associated threshold current. This model provides a comprehensive description of the switching behavior of DG MOSFET devices, and offers a physical onset threshold current to determine the threshold voltage in practical extraction
Water Electrolysis at Different Current - Voltage Regimes
International Nuclear Information System (INIS)
Kleperis, J.; Blums, J.; Vanags, M.
2007-01-01
Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)
Electronic Current Transducer (ECT) for high voltage dc lines
Houston, J. M.; Peters, P. H., Jr.; Summerayes, H. R., Jr.; Carlson, G. J.; Itani, A. M.
1980-02-01
The development of a bipolar electronic current transducer (ECT) for measuring the current in a high voltage dc (HVDC) power line at line potential is discussed. The design and construction of a free standing ECT for use on a 400 kV line having a nominal line current of 2000 A is described. Line current is measured by a 0.0001 ohm shunt whose voltage output is sampled by a 14 bit digital data link. The high voltage interface between line and ground is traversed by optical fibers which carry digital light signals as far as 300 m to a control room where the digital signal is converted back to an analog representation of the shunt voltage. Two redundant electronic and optical data links are used in the prototype. Power to operate digital and optical electronics and temperature controlling heaters at the line is supplied by a resistively and capacitively graded 10 stage cascade of ferrite core transformers located inside the hollow, SF6 filled, porcelain support insulator. The cascade is driven by a silicon controlled rectifier inverter which supplies about 100 W of power at 30 kHz.
Directory of Open Access Journals (Sweden)
Md Shafiul Alam
2017-11-01
Full Text Available This paper proposes the use of bridge type fault current limiters (BFCLs as a potential solution to reduce the impact of fault disturbance on voltage source converter-based high voltage DC (VSC-HVDC systems. Since VSC-HVDC systems are vulnerable to faults, it is essential to enhance the fault ride-through (FRT capability with auxiliary control devices like BFCLs. BFCL controllers have been developed to limit the fault current during the inception of system disturbances. Real and reactive power controllers for the VSC-HVDC have been developed based on current control mode. DC link voltage control has been achieved by a feedback mechanism such that net power exchange with DC link capacitor is zero. A grid-connected VSC-HVDC system and a wind farm integrated VSC-HVDC system along with the proposed BFCL and associated controllers have been implemented in a real time digital simulator (RTDS. Symmetrical three phase as well as different types of unsymmetrical faults have been applied in the systems in order to show the effectiveness of the proposed BFCL solution. DC link voltage fluctuation, machine speed and active power oscillation have been greatly suppressed with the proposed BFCL. Another significant feature of this work is that the performance of the proposed BFCL in VSC-HVDC systems is compared to that of series dynamic braking resistor (SDBR. Comparative results show that the proposed BFCL is superior over SDBR in limiting fault current as well as improving system fault ride through (FRT capability.
Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor
International Nuclear Information System (INIS)
Kim, N.; Cheong, Y.; Song, W.
2010-01-01
We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.
Directory of Open Access Journals (Sweden)
Yongchun Yang
2018-04-01
Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.
Zeghdar, Kamal; Dehimi, Lakhdar; Saadoune, Achour; Sengouga, Nouredine
2015-12-01
We report the current-voltage (I-V) characteristics of the Schottky diode (Au/n-InP) as a function of temperature. The SILVACO-TCAD numerical simulator is used to calculate the I-V characteristic in the temperature range of 280-400 K. This is to study the effect of temperature on the I-V curves and assess the main parameters that characterize the Schottky diode such as the ideality factor, the height of the barrier and the series resistance. The I-V characteristics are analyzed on the basis of standard thermionic emission (TE) theory and the inhomogeneous barrier heights (BHs) assuming a Gaussian distribution. It is shown that the ideality factor decreases while the barrier height increases with increasing temperature, on the basis of TE theory. Furthermore, the homogeneous BH value of approximately 0.524 eV for the device has been obtained from the linear relationship between the temperature-dependent experimentally effective BHs and ideality factors. The modified Richardson plot, according to the inhomogeneity of the BHs, has a good linearity over the temperature range. The evaluated Richardson constant A* was 10.32 A·cm-2·K-2, which is close to the theoretical value of 9.4 A·cm-2·K-2 for n-InP. The temperature dependence of the I-V characteristics of the Au/n-InP Schottky diode have been successfully explained on the basis of the thermionic emission (TE) mechanism with a Gaussian distribution of the Schottky barrier heights (SBHs). Simulated I-V characteristics are in good agreement with the measurements [Korucu D, Mammadov T S. J Optoelectronics Advanced Materials, 2012, 14: 41]. The barrier height obtained using Gaussian Schottky barrier distribution is 0.52 eV, which is about half the band gap of InP.
Breakdown Characteristic Analysis of Paper- Oil Insulation under AC and DC Voltage
Anuar, N. F.; Jamail, N. A. M.; Rahman, R. A.; Kamarudin, M. S.
2017-08-01
This paper presents the study of breakdown characteristic of Kraft paper insulated with two different types of insulating fluid, which are Palm oil and Coconut oil. Palm oil and Coconut oil are chosen as the alternative fluid to the transformer oil because it has high potential and environmentally-friendly. The Segezha Kraft papers with various thicknesses (65.5 gsm, 75 gsm, 85gsm, 90 gsm) have been used in this research. High Voltage Direct Current (HVDC), High Voltage Alternating Current (HVAC) and carbon track and severity analysis is conducted to observe the sample of aging Kraft paper. These samples have been immersed using Palm oil and Coconut oil up to 90 days to observe the absorption rate. All samples started to reach saturation level at 70 days of immersion. HVDC and HVAC breakdown experiments have been done after the samples had reached the saturation level based on normal condition, immersed in Palm oil and immersed in Coconut oil. All samples immersed in liquid show different breakdown voltage reading compared to normal condition. The analysis of carbon track and severity on surface has been done using Analytical Scanning Electron Microscope (SEM) Analysis. The results of the experiment show that the sample of Kraft paper immersed in Palm oil was better than Coconut oil immersed sample. Therefore the sample condition was the main factor that determines the value of breakdown voltage test. Introduction
Teverovsky, Alexander A.
2011-01-01
The majority of solid tantalum capacitors are produced by high-temperature sintering of a fine tantalum powder around a tantalum wire followed by electrolytic anodization that forms a thin amorphous Ta2O5 dielectric layer and pyrolysis of manganese nitrite on the oxide to create a conductive manganese dioxide electrode. A contact to tantalum wire is used as anode terminal and to the manganese layer as a cathode terminal of the device. This process results in formation of an asymmetric Ta -- Ta2O5 -- MnO2 capacitor that has different characteristics at forward (positive bias applied to tantalum) and reverse (positive bias applied to manganese cathode) voltages. Reverse bias currents might be several orders of magnitude larger than forward leakage currents so I-V characteristics of tantalum capacitors resemble characteristics of semiconductor rectifiers. Asymmetric I-V characteristics of Ta -- anodic Ta2O5 systems have been observed at different top electrode materials including metals, electrolytes, conductive polymers, and manganese oxide thus indicating that this phenomenon is likely related to the specifics of the Ta -- Ta2O5 interface. There have been multiple attempts to explain rectifying characteristics of capacitors employing anodic tantalum pentoxide dielectrics. A brief review of works related to reverse bias (RB) behavior of tantalum capacitors shows that the mechanism of conduction in Ta -- Ta2O5 systems is still not clear and more testing and analysis is necessary to understand the processes involved. If tantalum capacitors behave just as rectifiers, then the assessment of the safe reverse bias operating conditions would be a relatively simple task. Unfortunately, these parts can degrade with time under reverse bias significantly, and this further complicates analysis of the I-V characteristics and establishing safe operating areas of the parts. On other hand, time dependence of reverse currents might provide additional information for investigation of
Dark Current And Voltage Measurements Of Metal-Organic-Semiconductor (M-Or-S) Diode
International Nuclear Information System (INIS)
Adianto
1996-01-01
. Some Metal-Organic-Semiconductor (M-Or-S) thin film diodes, constructed with an organic polymer (polymerized toluene) as an active component has been successfully fabricated. The thin film M-Or-S diodes were fabricated on an n-type silicon with resistivity of 250-500 Ocm and p type silicon with resistivity of 10-20 Ocm as a substrate with polymerized toluene used as insulator. When deposited on silicon wafers with electrode of evaporated Ni on the n-type silicon and evaporated Au as the electrode on the polymerized toluene film, the electronic devices of Metal-Organic- Semiconductor (M-Or-S) type can be produced with one of its characteristics is that their light sensitivity. A plasma ion deposition system was constructed and used to deposit organic monomeric substance (toluene) that functioned as an isolator between semiconductor and the evaporated metal electrodes. The current-voltage measurements for different configurations of M-Or-S devices were carried out to determine the current-voltage (1-V) characteristics for M-Or-S devices with different materials and thicknesses. In addition to the 1-V measurement mentioned before, 1-V measurements of the devices were also carried out by using a curve tracer oscilloscope, and the picture of the effective parameters of each of the device could be taken by using a polaroid camera. Since the devices are very sensitive to light, the devices were all tested in a black-box which was covered by a black cloth to make sure that there was no light coming through. The experimental results for p- and n-type silicon substrates showed that an M-Or-S diode with n-type gave a higher breakdown voltage than that p- type silicon. In addition, the reverse bias breakdown voltage increased as the thickness of the thin film increased in the range of 50 -2500 V/μm
Two coupled Josephson junctions: dc voltage controlled by biharmonic current
International Nuclear Information System (INIS)
Machura, L; Spiechowicz, J; Kostur, M; Łuczka, J
2012-01-01
We study transport properties of two Josephson junctions coupled by an external shunt resistance. One of the junctions (say, the first) is driven by an unbiased ac current consisting of two harmonics. The device can rectify the ac current yielding a dc voltage across the first junction. For some values of coupling strength, controlled by an external shunt resistance, a dc voltage across the second junction can be generated. By variation of system parameters such as the relative phase or frequency of two harmonics, one can conveniently manipulate both voltages with high efficiency, e.g. changing the dc voltages across the first and second junctions from positive to negative values and vice versa. (paper)
Energy Technology Data Exchange (ETDEWEB)
Altin, E. [Inonu University, Scientific and Technological Research Center, Malatya (Turkey); Anadolu University, Department of Physics, Eskisehir (Turkey); Hostut, M. [Akdeniz University, Department of Secondary Education of Science and Maths., Division of Physics Education, Antalya (Turkey); Ergun, Y. [Anadolu University, Department of Physics, Eskisehir (Turkey)
2011-12-15
In this study, we investigate dark current voltage characteristics of GaAs/AlGaAs staircase-like asymmetric multiquantum well structure at various temperatures experimentally. The activation energy is calculated by using Arrhenius plots at different voltages. It is found that the activation energy decreased with increasing electric field. This result is evaluated using a barrier lowering effect which is a combination of geometrical and Poole-Frenkel effects. Measured dark current density-voltage (J-V) characteristics compared with the Levine model, 3D carrier drift model and the emission capture model. The best agreement with the experimental results of dark current densities is obtained by the Levine model. (orig.)
International Nuclear Information System (INIS)
Lasa, J.; Sliwka, I.; Drozdowicz, B.
1989-01-01
The paper contains results of measurements of current characteristics and of the signal for the constant concentration of freon F-11 of the ECD supplied with pulse voltage of changeable time of pulse duration t p , amplitude U 1 and the time of pulse repetition t r . In the course of measurements the detector worked at temperature 573 K with the additional constant polarization voltage. The polarization voltage has been observed to cause the effect of hypercoulometry. The presented mathematical analysis helps to determine the values of the coefficient of efficiency of electron capture p, the coefficient of electron loss k D , the coefficient of collecting of electric charges by the anode k' 3 and the coefficient of collecting of electric charges by the detector cathode k u . The coefficients are determined on the basis of experimental measurements. An attempt of physical interpretation of calculated values of these coefficients and their dependence on the parameters of the pulses supplying the detector has been presented. This interpretation requires the assumption that in some pulse periods t r the concentration of positive ions in the detector considerably exceeds concentration n 0 + = √a xα e /V, where a is an efficiency of the carrier gas ionization, α e is the coefficient of the electron-ion recombination and V is the detector volume. This statement helping to describe the effects observed in the electron capture polarized by voltage U a contradicts the recognized concept that the concentration of positive ions in the detector does not exceed the concentration n 0 + . The paper shows that the detector of the cylindrical construction, supplied with a pulse voltage can be used for coulometric measurements and the voltage polarizing the cathode can cause an effect of hypercoulometry. 33 figs., 9 refs. (author)
Egusa, Shigenori; Iwasawa, Naozumi
1995-11-01
A specially prepared paint made up of lead zirconate titanate (PZT) ceramic powder and epoxy resin was coated on an aluminum plate and was cured at room temperature, thus forming the paint film of 25-300 μm thickness with a PZT volume fraction of 53%. The paint film was then poled at room temperature, and the poling behavior was determined by measuring the piezoelectric activity as a function of poling field. The poling behavior shows that the piezoelectric activity obtained at a given poling field increases with an increase in the film thickness from 25 to 300 μm. The current-voltage characteristic of the paint film, on the other hand, shows that the increase in the film thickness leads not only to an increase in the magnitude of the current density at a given electric field but also to an increase in the critical electric field at which the transition from the ohmic to space-charge-limited conduction takes place. This fact indicates that the amount of the space charge of electrons injected into the paint film decreases as the film thickness increases. Furthermore, comparison of the current-voltage characteristic of the paint film with that of a pure epoxy film reveals that the space charge is accumulated largely at the interface between the PZT and epoxy phases in the paint film. On the basis of this finding, a model is developed for the poling behavior of the paint film by taking into account a possible effect of the space-charge accumulation and a broad distribution of the electric field in the PZT phase. This model is shown to give an excellent fit to the experimental data of the piezoelectric activity obtained here as a function of poling field and film thickness.
International Nuclear Information System (INIS)
Bouzazi, Boussairi; Kojima, Nobuaki; Ohshita, Yoshio; Yamaguchi, Masafumi
2013-01-01
Highlights: ► The cause of high background doping was confirmed and characterized. ► The current–voltage characteristics deviate from the thermionic emission. ► The recombination current is attributed to a hole trap (E V + 0.52 eV). ► The hole trap (E V + 0.52 eV) was confirmed by DLTS measurements. -- Abstract: The temperature dependence of capacitance–voltage (C–V) and current voltage (I–V) characteristics were used to study the cause of high background doping and the underlying current transport mechanisms in GaAsN Schottky diode grown by chemical beam epitaxy (CBE). In one hand, a nitrogen-related sigmoid increase of junction capacitance and ionized acceptor concentration was observed in the temperature range 70–100 K and was attributed to the thermal ionization of a nitrogen–hydrogen-related deep acceptor-state, with thermal activation energy of approximately 0.11 eV above the valence band maximum (VBM) of GaAsN. This acceptor state is mainly responsible for the high background doping in unintentionally doped GaAsN grown by CBE. On the other hand, the I–V characteristics at different temperatures were found to deviate from the well known pure thermionic-emission mechanism. Based on their fitting at each temperature, the recombination current in the space charge region of GaAsN Schottky diode was mainly attributed to a hole trap, localized at 0.51 eV above the VBM. Given the accuracy of measurements, this result was confirmed by deep level transient spectroscopy measurements. Nevertheless, considering the Shockley–Read–Hall model of generation-recombination, the recombination activity of this defect was quantified and qualified to be weak compared with the markedly degradation of minority carrier lifetime in GaAsN material
Low-cost wireless voltage & current grid monitoring
Energy Technology Data Exchange (ETDEWEB)
Hines, Jacqueline [SenSanna Inc., Arnold, MD (United States)
2016-12-31
This report describes the development and demonstration of a novel low-cost wireless power distribution line monitoring system. This system measures voltage, current, and relative phase on power lines of up to 35 kV-class. The line units operate without any batteries, and without harvesting energy from the power line. Thus, data on grid condition is provided even in outage conditions, when line current is zero. This enhances worker safety by detecting the presence of voltage and current that may appear from stray sources on nominally isolated lines. Availability of low-cost power line monitoring systems will enable widespread monitoring of the distribution grid. Real-time data on local grid operating conditions will enable grid operators to optimize grid operation, implement grid automation, and understand the impact of solar and other distributed sources on grid stability. The latter will enable utilities to implement eneygy storage and control systems to enable greater penetration of solar into the grid.
Directory of Open Access Journals (Sweden)
Yeongsu Bak
2016-12-01
Full Text Available This paper proposes a balanced current control strategy for the current source rectifier (CSR stage of an indirect matrix converter (IMC under unbalanced grid voltage conditions. If the three-phase grid connected to the voltage source inverter (VSI of the IMC has unbalanced voltage conditions, it affects the currents of the CSR stage and VSI stage, and the currents are distorted. Above all, the distorted currents of the CSR stage cause instability in the overall system, which can affect the life span of the system. Therefore, in this paper, a control strategy for balanced currents in the CSR stage is proposed. To achieve balanced currents in the CSR stage, the VSI stage should receive DC power without ripple components from the CSR stage. This is implemented by controlling the currents in the VSI stage. Therefore, the proposed control strategy decouples the positive and negative phase-sequence components existing in the unbalanced voltages and currents of the VSI stage. Using the proposed control strategy under unbalanced grid voltage conditions, the stability and life span of the overall system can be improved. The effectiveness of the proposed control strategy is verified by simulation and experimental results.
Energy Technology Data Exchange (ETDEWEB)
Kyyrae, J. [Helsinki University of Technology, Institute of Intelligent Power Electronics, Espoo (Finland)
1997-12-31
Voltage- and current-sourced dc-ac converters operating in quasi-square area are compared. Their characteristics are calculated with switching vector, which is space-vector of switching functions. When the load is an asynchronous motor various analytical equations, including torque, are calculated efficiently. Motor current and torque approximations are compared with the simulated ones. (orig.) 6 refs.
The Design of Operational Amplifier for Low Voltage and Low Current Sound Energy Harvesting System
Fang, Liew Hui; Rahim, Rosemizi Bin Abd; Isa, Muzamir; Idris Syed Hassan, Syed; Ismail, Baharuddin Bin
2018-03-01
The objective of this paper is to design a combination of an operational amplifier (op-amp) with a rectifier used in an alternate current (ac) to direct current (dc) power conversion. The op-amp was designed to specifically work at low voltage and low current for a sound energy harvesting system. The goal of the op-amp design with adjustable gain was to control output voltage based on the objectives of the experiment conducted. The op-amp was designed for minimum power dissipation performance, with the means of increasing the output current when receiving a large amount of load. The harvesting circuits which designed further improved the power output efficiency by shortening the fully charged time needed by a supercapacitor bank. It can fulfil the long-time power demands for low power device. Typically, a small amount of energy sources were converted to electricity and stored in the supercapacitor bank, which was built by 10 pieces of capacitors with 0.22 F each, arranged in parallel connection. The highest capacitance was chosen based on the characteristic that have the longest discharging time to support the applications of a supercapacitor bank. Testing results show that the op-amp can boost the low input ac voltage (∼3.89 V) to high output dc voltage (5.0 V) with output current of 30 mA and stored the electrical energy in a big supercapacitor bank having a total of 2.2 F, effectively. The measured results agree well with the calculated results.
Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks
Teverovsky, Alexander A.
2016-01-01
Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.
Current source converter based D-STATCOM for voltage sag mitigation
Directory of Open Access Journals (Sweden)
Singh Moirangthem Deben
2015-01-01
Full Text Available This paper presents a novel method of realizing one of the custom power controllers, the distribution static synchronous compensator (D-STATCOM using current source converter (CSC topology. Almost all the custom power controllers such as dynamic voltage restorer (DVR, unified power quality conditioner (UPQC including D-STATCOM are generally designed and implemented by using voltage source converters (VSC and not much research publications with CSC based approach has been reported over the last one decade. Since the D-STATCOM is a current injection device, its performance can be improved when realized by a current-source converter which can generate a controllable current directly at its output terminals and offers many advantageous features. In this paper, an attempt has been made to study the performance of a CSC based D-STATCOM suitable for use in the power distribution system in order to mitigate voltage sag and improve power quality. The proposed model uses a three leg CSC whose switching strategy is based on sinusoidal pulse width modulation (SPWM. The model has been simulated in the Matlab/Simulink environment. The results of the simulation runs under steady state and dynamic load perturbation provide excellent voltage and current waveforms that support the justification of the proposed model.
International Nuclear Information System (INIS)
Hanada, R.; Sugawara, H.; Aoki, Y.; Sato, H.; Shigeto, K.; Shinjo, T.; Ono, T.; Miyajima, H.
2002-01-01
We have simultaneously measured the field dependences of voltages at multiple pairs of resistance and transverse voltage probes in ferromagnetic wires (with either magnetic or non-magnetic voltage probes). Both the resistive (through the giant magnetoresistance and anisotropic magnetoresistance) and transverse voltages (through the planar Hall effect) exhibit abrupt jumps, reflecting discrete motion of domain walls or rotations of magnetization. Voltage probes, even if non-magnetic, are found to affect the jump fields depending on the sample conditions. We demonstrate that the specific information on the domain (wall) motion along a thin ferromagnetic wire could be obtained from the jump fields. (author)
High Voltage Coil Current Sensor for DC-DC Converters Employing DDCC
Directory of Open Access Journals (Sweden)
M. Drinovsky
2015-12-01
Full Text Available Current sensor is an integral part of every switching converter. It is used for over-current protection, regulation and in case of multiphase converters for balancing. A new high voltage current sensor for coil-based current sensing in DC-DC converters is presented. The sensor employs DDCC with high voltage input stage and gain trimming. The circuit has been simulated and implemented in 0.35 um BCD technology as part of a multiphase DC-DC converter where its function has been verified. The circuit is able to sustain common mode voltage on the input up to 40 V, it occupies 0.387*0.345 mm2 and consumes 3.2 mW typically.
Pulsed Current-Voltage-Induced Perturbations of a Premixed Propane/Air Flame
Directory of Open Access Journals (Sweden)
Jacob. B. Schmidt
2011-01-01
Full Text Available The effect of millisecond wide sub-breakdown pulsed voltage-current induced flow perturbation has been measured in premixed laminar atmospheric pressure propane/air flame. The flame equivalence ratios were varied from 0.8 to 1.2 with the flow speeds near 1.1 meter/second. Spatio-temporal flame structure changes were observed through collection of CH (A-X and OH (A-X chemiluminescence and simultaneous spontaneous Raman scattering from N2. This optical collection scheme allows us to obtain a strong correlation between the measured gas temperature and the chemiluminescence intensity, verifying that chemiluminescence images provide accurate measurements of flame reaction zone structure modifications. The experimental results suggest that the flame perturbation is caused by ionic wind originating only from the radial positive space-charge distribution in/near the cathode fall. A net momentum transfer acts along the annular space discharge distribution in the reaction zone at or near the cathode fall which modifies the flow field near the cathodic burner head. This radially inward directed body force appears to enhance mixing similar to a swirl induced modification of the flame structure. The flame fluidic response exhibit a strong dependence on the voltage pulse width ≤10 millisecond.
DEFF Research Database (Denmark)
Spataru, Sergiu; Sera, Dezso; Hacke, Peter
2014-01-01
Photovoltaic system (PV) maintenance and diagnostic tools are often based on performance models of the system, complemented with light current-voltage (I-V) measurements, visual inspection and/or thermal imaging. Although these are invaluable tools in diagnosing PV system performance losses and f...
A micro-power LDO with piecewise voltage foldback current limit protection
International Nuclear Information System (INIS)
Wei Hailong; Liu Youbao; Guo Zhongjie; Liao Xue
2012-01-01
To achieve a constant current limit, low power consumption and high driving capability, a micro-power LDO with a piecewise voltage-foldback current-limit circuit is presented. The current-limit threshold is dynamically adjusted to achieve a maximum driving capability and lower quiescent current of only 300 nA. To increase the loop stability of the proposed LDO, a high impedance transconductance buffer under a micro quiescent current is designed for splitting the pole that exists at the gate of the pass transistor to the dominant pole, and a zero is designed for the purpose of the second pole phase compensation. The proposed LDO is fabricated in a BiCMOS process. The measurement results show that the short-circuit current of the LDO is 190 mA, the constant limit current under a high drop-out voltage is 440 mA, and the maximum load current under a low drop-out voltage is up to 800 mA. In addition, the quiescent current of the LDO is only 7 μA, the load regulation is about 0.56% on full scale, the line regulation is about 0.012%/V, the PSRR at 120 Hz is 58 dB and the drop-out voltage is only 70 mV when the load current is 250 mA. (semiconductor integrated circuits)
Surge currents and voltages at the low voltage power mains during lightning strike to a GSM tower
Energy Technology Data Exchange (ETDEWEB)
Markowska, Renata [Bialystok Technical University (Poland)], E-mail: remark@pb.edu.pl
2007-07-01
The paper presents the results of numerical calculations of lightning surge currents and voltages in the low voltage power mains system connected to a free standing GSM base station. Direct lightning strike to GSM tower was studied. The analysis concerned the current that flows to the transformer station through AC power mains, the potential difference between the grounding systems of the GSM and the transformer stations and the voltage differences between phase and PE conductors of the power mains underground cable at both the GSM and the transformer sides. The calculations were performed using a numerical program based on the electromagnetic field theory and the method of moments. (author)
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids
DEFF Research Database (Denmark)
Mousazadeh, Seyyed Yousef; Jalilian, Alireza; Savaghebi, Mehdi
2017-01-01
In recent years, the harmonics and unbalance problem endanger the voltage and current quality of power systems due to increasing usage of nonlinear and unbalance loads. Using DG interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method...... is proposed to compensate voltage and current unbalance and harmonics using the Distributed Generation (DG) interfacing inverters. This method is applicable to both grid-connected and islanded microgrids. In the proposed method, not only the proper control of active and reactive powers can be achieved......) frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. The results show that depending on the compensation mode, the harmonics and unbalance compensation of DGs’ output current, MG’s injected current to the grid as well...
Energy Technology Data Exchange (ETDEWEB)
Ivanov, P. A., E-mail: Pavel.Ivanov@mail.ioffe.ru; Potapov, A. S.; Samsonova, T. P.; Grekhov, I. V. [Ioffe Physical–Technical Institute (Russian Federation)
2017-03-15
p{sup +}–n{sub 0}–n{sup +} 4H-SiC diodes with homogeneous avalanche breakdown at 1860 V are fabricated. The pulse current–voltage characteristics are measured in the avalanche-breakdown mode up to a current density of 4000 A/cm{sup 2}. It is shown that the avalanche-breakdown voltage increases with increasing temperature. The following diode parameters are determined: the avalanche resistance (8.6 × 10{sup –2} Ω cm{sup 2}), the electron drift velocity in the n{sub 0} base at electric fields higher than 10{sup 6} V/cm (7.8 × 10{sup 6} cm/s), and the relative temperature coefficient of the breakdown voltage (2.1 × 10{sup –4} K{sup –1}).
Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics
Directory of Open Access Journals (Sweden)
Yuji Isshiki
2018-02-01
Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.
Jin, N.; Yang, F.; Shang, S. Y.; Tao, T.; Liu, J. S.
2016-08-01
According to the limitations of the LVRT technology of traditional photovoltaic inverter existed, this paper proposes a low voltage ride through (LVRT) control method based on model current predictive control (MCPC). This method can effectively improve the photovoltaic inverter output characteristics and response speed. The MCPC method of photovoltaic grid-connected inverter designed, the sum of the absolute value of the predictive current and the given current error is adopted as the cost function with the model predictive control method. According to the MCPC, the optimal space voltage vector is selected. Photovoltaic inverter has achieved automatically switches of priority active or reactive power control of two control modes according to the different operating states, which effectively improve the inverter capability of LVRT. The simulation and experimental results proves that the proposed method is correct and effective.
Current-voltage curves of gold quantum point contacts revisited
DEFF Research Database (Denmark)
Hansen, K.; Nielsen, S K.; Brandbyge, Mads
2000-01-01
We present measurements of current-voltage (I-V) curves on gold quantum point contacts (QPCs) with a conductance up to 4 G(0) (G(0) = 2e(2)/h is the conductance quantum) and voltages up to 2 V. The QPCs are formed between the gold tip of a scanning tunneling microscope and a Au(110) surface under...
Energy Technology Data Exchange (ETDEWEB)
Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)
2014-07-01
Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.
Energy Technology Data Exchange (ETDEWEB)
Nishi, Shohei; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa, E-mail: iwamoto@pe.titech.ac.jp [Department of Physical Electronics, Tokyo Institute of Technology, 2-12-1 S3-33, O-okayama, Meguro-ku, Tokyo 152-8552 (Japan)
2015-06-28
By using electric-field-induced optical second-harmonic generation measurement coupled with the conventional current-voltage (I-V) measurement, we studied the carrier transport of organic double-layer diodes with a Au/pentacene/fluorine polymer (FP)/indium zinc oxide (IZO) structure. The rectifying I-V characteristics were converted into the I-E characteristics of the FP and pentacene layers. Results suggest a model in which Schottky-type electron injection from the IZO electrode to the FP layer governs the forward electrical conduction (V > 0), where the space charge electric field produced in the FP layer by accumulated holes at the pentacene/FP interface makes a significant contribution. On the other hand, Schottky-type injection by accumulated interface electrons from the pentacene layer to the FP layer governs the backward electrical conduction (V < 0). The electroluminescence generated from the pentacene layer in the region V > 0 verifies the electron transport across the FP layer, and supports the above suggested model.
International Nuclear Information System (INIS)
Nishi, Shohei; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa
2015-01-01
By using electric-field-induced optical second-harmonic generation measurement coupled with the conventional current-voltage (I-V) measurement, we studied the carrier transport of organic double-layer diodes with a Au/pentacene/fluorine polymer (FP)/indium zinc oxide (IZO) structure. The rectifying I-V characteristics were converted into the I-E characteristics of the FP and pentacene layers. Results suggest a model in which Schottky-type electron injection from the IZO electrode to the FP layer governs the forward electrical conduction (V > 0), where the space charge electric field produced in the FP layer by accumulated holes at the pentacene/FP interface makes a significant contribution. On the other hand, Schottky-type injection by accumulated interface electrons from the pentacene layer to the FP layer governs the backward electrical conduction (V < 0). The electroluminescence generated from the pentacene layer in the region V > 0 verifies the electron transport across the FP layer, and supports the above suggested model
International Nuclear Information System (INIS)
Chi, C.C.; Vanneste, C.
1990-01-01
A comprehensive picture of the dc current-voltage (I-V) characteristics of rf-driven Josephson junctions in the low-frequency regime is presented. The boundary of the low-frequency regime is roughly defined by the junction characteristic frequency for overdamped junctions, and by the inverse of the junction damping time for underdamped junctions. An adiabatic model valid for the low-frequency regime is used to describe the overall shapes of the I-V curves, which is in good agreement with both the numerical simulations and the experimental results. For underdamped junctions, the Shapiro steps are the prominent features on the I-V curves if the rf frequency is sufficiently below the boundary. As the rf frequency is increased towards the boundary, large negatively-going tails on top of the Shapiro steps are observed both experimentally and numerically. Numerical simulations using the resistively- and capacitively-shunted-junction model (RCSJ model) reveal that the negatively-going tail is a signature of the low-frequency boundary of the junction chaotic regime. With use of the adiabatic model and the existence of plasma oscillations for underdamped junctions, the onset of chaos and its effect on the Shapiro steps can be fully explained. The high-frequency limit of the adiabatic model and the chaotic behavior of the Josephson junctions beyond the low-frequency regime are also briefly discussed
Current and Voltage Mode Multiphase Sinusoidal Oscillators Using CBTAs
Directory of Open Access Journals (Sweden)
M. Sagbas
2013-04-01
Full Text Available Current-mode (CM and voltage-mode (VM multiphase sinusoidal oscillator (MSO structures using current backward transconductance amplifier (CBTA are proposed. The proposed oscillators can generate n current or voltage signals (n being even or odd equally spaced in phase. n+1 CBTAs, n grounded capacitors and a grounded resistor are used for nth-state oscillator. The oscillation frequency can be independently controlled through transconductance (gm of the CBTAs which are adjustable via their bias currents. The effects caused by the non-ideality of the CBTA on the oscillation frequency and condition have been analyzed. The performance of the proposed circuits is demonstrated on third-stage and fifth-stage MSOs by using PSPICE simulations based on the 0.25 µm TSMC level-7 CMOS technology parameters.
A uniform laminar air plasma plume with large volume excited by an alternating current voltage
Li, Xuechen; Bao, Wenting; Chu, Jingdi; Zhang, Panpan; Jia, Pengying
2015-12-01
Using a plasma jet composed of two needle electrodes, a laminar plasma plume with large volume is generated in air through an alternating current voltage excitation. Based on high-speed photography, a train of filaments is observed to propagate periodically away from their birth place along the gas flow. The laminar plume is in fact a temporal superposition of the arched filament train. The filament consists of a negative glow near the real time cathode, a positive column near the real time anode, and a Faraday dark space between them. It has been found that the propagation velocity of the filament increases with increasing the gas flow rate. Furthermore, the filament lifetime tends to follow a normal distribution (Gaussian distribution). The most probable lifetime decreases with increasing the gas flow rate or decreasing the averaged peak voltage. Results also indicate that the real time peak current decreases and the real time peak voltage increases with the propagation of the filament along the gas flow. The voltage-current curve indicates that, in every discharge cycle, the filament evolves from a Townsend discharge to a glow one and then the discharge quenches. Characteristic regions including a negative glow, a Faraday dark space, and a positive column can be discerned from the discharge filament. Furthermore, the plasma parameters such as the electron density, the vibrational temperature and the gas temperature are investigated based on the optical spectrum emitted from the laminar plume.
Development of an intelligent high-voltage direct-current power supply for nuclear detectors
International Nuclear Information System (INIS)
Zhao Xiuliang
1997-01-01
The operation and performances of a new type direct-current high-voltage power supply are described. The power supply with intelligent feature is controlled by a single-chip microcomputer (8031), and various kinds of output voltage can be preset. The output-voltage is monitored and regulated by the single-chip microcomputer and displayed by LED. The output voltage is stable when the load current is within the allowable limits
Chen, Xin; Sánchez-Arriaga, Gonzalo
2018-02-01
To model the sheath structure around an emissive probe with cylindrical geometry, the Orbital-Motion theory takes advantage of three conserved quantities (distribution function, transverse energy, and angular momentum) to transform the stationary Vlasov-Poisson system into a single integro-differential equation. For a stationary collisionless unmagnetized plasma, this equation describes self-consistently the probe characteristics. By solving such an equation numerically, parametric analyses for the current-voltage (IV) and floating-potential (FP) characteristics can be performed, which show that: (a) for strong emission, the space-charge effects increase with probe radius; (b) the probe can float at a positive potential relative to the plasma; (c) a smaller probe radius is preferred for the FP method to determine the plasma potential; (d) the work function of the emitting material and the plasma-ion properties do not influence the reliability of the floating-potential method. Analytical analysis demonstrates that the inflection point of an IV curve for non-emitting probes occurs at the plasma potential. The flat potential is not a self-consistent solution for emissive probes.
Thyristor current-pulse generator for betatron electromagnet with independent low-voltage supply
International Nuclear Information System (INIS)
Baginskii, B.A.; Makarevich, V.N.; Shtein, M.M.
1989-01-01
A thyristor generator is described that produces unipolar current pulses in the winding of a betatron electromagnet. The voltage on the electro-magnet is increased and the shape of the current pulses is improved by use of an intermediate inductive storage device. The current pulses have a duration of 11 msec, an amplitude of 190 A, and a repetition frequency of 50 Hz. The maximum magnetic-field energy is 450 J, the voltage on the electromagnet winding is 1.5 kV, and the supply voltage is 27 V
Energy Technology Data Exchange (ETDEWEB)
Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)
2015-06-15
We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
A dulal-functional medium voltage level DVR to limit downstream fault currents
DEFF Research Database (Denmark)
Blaabjerg, Frede; Li, Yun Wei; Vilathgamuwa, D. Mahinda
2007-01-01
on the other parallel feeders connected to PCC. Furthermore, if not controlled properly, the DVR might also contribute to this PCC voltage sag in the process of compensating the missing voltage, thus further worsening the fault situation. To limit the flow of large line currents, and therefore restore the PCC...... situations. Controlling the DVR as a virtual inductor would also ensure zero real power absorption during the DVR compensation and thus minimize the stress in the dc link. Finally, the proposed fault current limiting algorithm has been tested in Matlab/Simulink simulation and experimentally on a medium......The dynamic voltage restorer (DVR) is a modern custom power device used in power distribution networks to protect consumers from sudden sags (and swells) in grid voltage. Implemented at medium voltage level, the DVR can be used to protect a group of medium voltage or low voltage consumers. However...
Current integrator using the voltage to frequency converter
International Nuclear Information System (INIS)
Ukai, K.; Gomi, K.
1975-01-01
A current integrator using the Voltage to Frequency Converter has been constructed to measure the beam intensity of the 1.3 GeV Electron Synchrotron at the INS. This integrator ranges the current 10 -7 to 10 -11 amperes and has been calibrated by the extracted electron beam and constant current sources. The accuracy of this integrator agrees with the previous integrator within 1%. (auth.)
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
PV source based high voltage gain current fed converter
Saha, Soumya; Poddar, Sahityika; Chimonyo, Kudzai B.; Arunkumar, G.; Elangovan, D.
2017-11-01
This work involves designing and simulation of a PV source based high voltage gain, current fed converter. It deals with an isolated DC-DC converter which utilizes boost converter topology. The proposed converter is capable of high voltage gain and above all have very high efficiency levels as proved by the simulation results. The project intends to produce an output of 800 V dc from a 48 V dc input. The simulation results obtained from PSIM application interface were used to analyze the performance of the proposed converter. Transformer used in the circuit steps up the voltage as well as to provide electrical isolation between the low voltage and high voltage side. Since the converter involves high switching frequency of 100 kHz, ultrafast recovery diodes are employed in the circuitry. The major application of the project is for future modeling of solar powered electric hybrid cars.
Research on resistance characteristics of YBCO tape under short-time DC large current impact
Zhang, Zhifeng; Yang, Jiabin; Qiu, Qingquan; Zhang, Guomin; Lin, Liangzhen
2017-06-01
Research of the resistance characteristics of YBCO tape under short-time DC large current impact is the foundation of the developing DC superconducting fault current limiter (SFCL) for voltage source converter-based high voltage direct current system (VSC-HVDC), which is one of the valid approaches to solve the problems of renewable energy integration. SFCL can limit DC short-circuit and enhance the interrupting capabilities of DC circuit breakers. In this paper, under short-time DC large current impacts, the resistance features of naked tape of YBCO tape are studied to find the resistance - temperature change rule and the maximum impact current. The influence of insulation for the resistance - temperature characteristics of YBCO tape is studied by comparison tests with naked tape and insulating tape in 77 K. The influence of operating temperature on the tape is also studied under subcooled liquid nitrogen condition. For the current impact security of YBCO tape, the critical current degradation and top temperature are analyzed and worked as judgment standards. The testing results is helpful for in developing SFCL in VSC-HVDC.
A HIGH CURRENT, HIGH VOLTAGE SOLID-STATE PULSE GENERATOR FOR THE NIF PLASMA ELECTRODE POCKELS CELL
International Nuclear Information System (INIS)
Arnold, P A; Barbosa, F; Cook, E G; Hickman, B C; Akana, G L; Brooksby, C A
2007-01-01
A high current, high voltage, all solid-state pulse modulator has been developed for use in the Plasma Electrode Pockels Cell (PEPC) subsystem in the National Ignition Facility. The MOSFET-switched pulse generator, designed to be a more capable plug-in replacement for the thyratron-switched units currently deployed in NIF, offers unprecedented capabilities including burst-mode operation, pulse width agility and a steady-state pulse repetition frequency exceeding 1 Hz. Capable of delivering requisite fast risetime, 17 kV flattop pulses into a 6 (Omega) load, the pulser employs a modular architecture characteristic of the inductive adder technology, pioneered at LLNL for use in acceleration applications, which keeps primary voltages low (and well within the capabilities of existing FET technology), reduces fabrication costs and is amenable to rapid assembly and quick field repairs
International Nuclear Information System (INIS)
Mel'nikov, V.I.; Suetoe, A.
1986-01-01
The minima of the potential energy for the dynamical variable phi of a Josephson junction are separated by barriers of height hI/sub c//e, where I/sub c/ is the critical current. At low temperatures, T hΩ/2π (Ω is the Josephson plasma frequency). We consider this problem for high-quality junctions (RCΩ>>1, R and C are the resistance and the capacitance of the junction), accounting for the effect of a Johnson-Nyquist noise and quantum tunneling at the barrier top. With a simplifying assumption, we derive a pair of integral equations containing an energy variable for the steady-state distribution of phi and phi-dot, and solve it by a modification of the Wiener-Hopf method. The result is a formula for the current dependence of the fluctuational voltage, valid for currents I 2 <<1
Vu, Thi Kim Oanh; Lee, Kyoung Su; Lee, Sang Jun; Kim, Eun Kyu
2018-09-01
We studied defect states in In0.53Ga0.47As/InP heterojunctions with interface control by group V atoms during metalorganic chemical vapor (MOCVD) deposition. From deep level transient spectroscopy (DLTS) measurements, two defects with activation energies of 0.28 eV (E1) and 0.15 eV (E2) below the conduction band edge, were observed. The defect density of E1 for In0.53Ga0.47As/InP heterojunctions with an addition of As and P atoms was about 1.5 times higher than that of the heterojunction added P atom only. From the temperature dependence of current- voltage characteristics, the thermal activation energies of In0.53Ga0.47As/InP of heterojunctions were estimated to be 0.27 and 0.25 eV, respectively. It appeared that the reverse light current for In0.53Ga0.47As/InP heterojunction added P atom increased only by illumination of a 940 nm-LED light source. These results imply that only the P addition at the interface can enhance the quality of InGaAs/InP heterojunction.
Realization of Nth-Order Voltage Transfer Function using Current Conveyors CCII
Directory of Open Access Journals (Sweden)
K. Vrba
1997-06-01
Full Text Available A universal method for the realization of arbitrary voltage transfer function in canonic form is presented. A voltage-controlled current-source using a plus-type second-generation current conveyor is here applied as the basic building element. Filters designed according to this method have a high input impedance and low sensitivity to variations of circuit parameters. All passive elements are grounded.
Directory of Open Access Journals (Sweden)
Yong Chen
2016-01-01
Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.
International Nuclear Information System (INIS)
Lemaire, J.; Scherer, M.
1983-01-01
The field-aligned current density (Jsub(tot)) is a non-linear function of the applied potential difference (phi) between the ionosphere and the magnetosphere. This nonlinear function has been calculated for plasma boundary conditions typical in a dayside cusp magnetic flux tube. The J-characteristic of such a flux tube changes when the temperatures of the warm magnetospheric electrons and of the cold ionospheric electrons are modified; it changes also when the relative density of the warm plasma is modified; the presence of trapped secondary electrons changes also the J-characteristic. The partial currents contributed by the warm and cold electrons, and by warm and cold ions are illustrated. The dynamic characteristic of an electric circuit depends on the static characteristic of each component of the sytem: i.e. the resistive ionosphere, the return current region, and the region of particle precipitation whose field-aligned current/voltage characteristics have been studied in this article
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
High-voltage direct-current circuit breakers
International Nuclear Information System (INIS)
Yoshioka, Y.; Hirasawa, K.
1991-01-01
This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system
Fan, Feng-Ru; Tang, Wei; Yao, Yan; Luo, Jianjun; Zhang, Chi; Wang, Zhong Lin
2014-04-04
Recently, a triboelectric generator (TEG) has been invented to convert mechanical energy into electricity by a conjunction of triboelectrification and electrostatic induction. Compared to the traditional electromagnetic generator (EMG) that produces a high output current but low voltage, the TEG has different output characteristics of low output current but high output voltage. In this paper, we present a comparative study regarding the fundamentals of TEGs and EMGs. The power output performances of the EMG and the TEG have a special complementary relationship, with the EMG being a voltage source and the TEG a current source. Utilizing a power transformed and managed (PTM) system, the current output of a TEG can reach as high as ∼3 mA, which can be coupled with the output signal of an EMG to enhance the output power. We also demonstrate a design to integrate a TEG and an EMG into a single device for simultaneously harvesting mechanical energy. In addition, the integrated NGs can independently output a high voltage and a high current to meet special needs.
H∞ Robust Current Control for DFIG Based Wind Turbine subject to Grid Voltage Distortions
DEFF Research Database (Denmark)
Wang, Yun; Wu, Qiuwei; Gong, Wenming
2016-01-01
This paper proposes an H∞ robust current controller for doubly fed induction generator (DFIG) based wind turbines (WTs) subject to grid voltage distortions. The controller is to mitigate the impact of the grid voltage distortions on rotor currents with DFIG parameter perturbation. The grid voltage...... distortions considered include asymmetric voltage dips and grid background harmonics. An uncertain DFIG model is developed with uncertain factors originating from distorted stator voltage, and changed generator parameters due to the flux saturation effect, the skin effect, etc. Weighting functions...... are designed to efficiently track the unbalanced current components and the 5th and 7th background harmonics. The robust stability (RS) and robust performance (RP) of the proposed controller are verified by the structured singular value µ. The performance of the H∞ robust current controller was demonstrated...
Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael A.
2016-04-26
A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing formed from two portions that mechanically close around the wire and that contain the current and voltage sensors. The current sensor is a ferrite cylinder formed from at least three portions that form the cylinder when the sensor is closed around the wire with a hall effect sensor disposed in a gap between two of the ferrite portions along the circumference to measure current. A capacitive plate or wire is disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.
van den Bos, R A J M; Sobota, A; Manders, F; Kroesen, G M W
2013-04-01
To investigate the cold and hot re-ignition properties of High Intensity Discharge (HID) lamps in more detail an automated setup was designed in such a way that HID lamps of various sizes and under different background pressures can be tested. The HID lamps are ignited with a ramped sinusoidal voltage signal with frequencies between 60 and 220 kHz and with amplitude up to 7.5 kV. Some initial results of voltage and current measurements on a commercially available HID lamp during hot and cold re-ignition are presented.
Modulation of voltage-gated channel currents by harmaline and harmane.
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2005-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.
Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.
Freites, J Alfredo; Tobias, Douglas J
2015-06-01
Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.
International Nuclear Information System (INIS)
Takata, N.
2000-01-01
It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the
Directory of Open Access Journals (Sweden)
Vukić Vladimir Đ.
2012-01-01
Full Text Available A method of on-line monitoring of the low-dropout voltage regulator's operation in a radiation environment is developed in this paper. The method had to enable detection of the circuit's degradation during exploitation, without terminating its operation in an ionizing radiation field. Moreover, it had to enable automatic measurement and data collection, as well as the detection of any considerable degradation, well before the monitored voltage regulator's malfunction. The principal parameters of the voltage regulator's operation that were monitored were the serial pnp transistor's base current and the forward emitter current gain. These parameters were procured indirectly, from the data on the voltage regulator's load and quiescent currents. Since the internal consumption current in moderately and heavily loaded devices was used, the quiescent current of a negligibly loaded voltage regulator of the same type served as a reference. Results acquired by on-line monitoring demonstrated marked agreement with the results acquired from examinations of the voltage regulator's maximum output current and minimum dropout voltage in a radiation environment. The results were particularly consistent in tests with heavily loaded devices. Results obtained for moderately loaded voltage regulators and the risks accompanying the application of the presented method, were also analyzed.
Rahman Khan, Motiur; Anjaneyulu, P.; Koteswara Rao, K. S. R.; Menon, R.
2017-03-01
We report on the analysis of temperature-dependent current-voltage characteristics and impedance measurements of electrochemically doped poly(3-methylthiophene) devices at different doping levels. The extent of doping is carefully tailored such that only the bulk-limited transport mechanism prevails. A transition from exponentially distributed trap-limited transport to trap-free space-charge-limited current is observed in current-voltage conduction upon increasing the doping. The obtained trap densities (3.2 × 1016 cm-3 and 8.6 × 1015 cm-3) and trap energies (31.7 meV and 16.6 meV) for different devices signify the variation in disorder with doping, which is later supported by impedance measurements. Impedance-frequency data for various devices can not be explained using the parallel resistance-capacitance (RC) model in the equivalent circuit. However, this was established by incorporating a constant phase element Q (CPE) instead of the capacitance parameter. It should be emphasized that low doping devices in particular are best simulated with two CPE elements, while the data related to other devices are fitted well with a single CPE element. It is also observed from evaluated circuit parameters that the spatial inhomogeneity and disorder are the cause of variability in different samples, which has an excellent correlation with the temperature-dependent current-voltage characteristics.
Characteristics and Breakdown Behaviors of Polysilicon Resistors for High Voltage Applications
Directory of Open Access Journals (Sweden)
Xiao-Yu Tang
2015-01-01
Full Text Available With the rapid development of the power integrated circuit technology, polysilicon resistors have been widely used not only in traditional CMOS circuits, but also in the high voltage applications. However, there have been few detailed reports about the polysilicon resistors’ characteristics, like voltage and temperature coefficients and breakdown behaviors which are critical parameters of high voltage applications. In this study, we experimentally find that the resistance of the polysilicon resistor with a relatively low doping concentration shows negative voltage and temperature coefficients, while that of the polysilicon resistor with a high doping concentration has positive voltage and temperature coefficients. Moreover, from the experimental results of breakdown voltages of the polysilicon resistors, it could be deduced that the breakdown of polysilicon resistors is thermally rather than electrically induced. We also proposed to add an N-type well underneath the oxide to increase the breakdown voltage in the vertical direction when the substrate is P-type doped.
International Nuclear Information System (INIS)
De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.
2010-01-01
Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Wei, Xixiong; Deng, Wanling; Fang, Jielin; Ma, Xiaoyu; Huang, Junkai
2017-10-01
A physical-based straightforward extraction technique for interface and bulk density of states in metal oxide semiconductor thin film transistors (TFTs) is proposed by using the capacitance-voltage (C-V) characteristics. The interface trap density distribution with energy has been extracted from the analysis of capacitance-voltage characteristics. Using the obtained interface state distribution, the bulk trap density has been determined. With this method, for the interface trap density, it is found that deep state density nearing the mid-gap is approximately constant and tail states density increases exponentially with energy; for the bulk trap density, it is a superposition of exponential deep states and exponential tail states. The validity of the extraction is verified by comparisons with the measured current-voltage (I-V) characteristics and the simulation results by the technology computer-aided design (TCAD) model. This extraction method uses non-numerical iteration which is simple, fast and accurate. Therefore, it is very useful for TFT device characterization.
Rotor current transient analysis of DFIG-based wind turbines during symmetrical voltage faults
International Nuclear Information System (INIS)
Ling, Yu; Cai, Xu; Wang, Ningbo
2013-01-01
Highlights: • We theoretically analyze the rotor fault current of DFIG based on space vector. • The presented analysis is simple, easy to understand. • The analysis highlights the accuracy of the expression of the rotor fault currents. • The expression can be widely used to analyze the different levels of voltage symmetrical fault. • Simulation results show the accuracy of the expression of the rotor currents. - Abstract: The impact of grid voltage fault on doubly fed induction generators (DFIGs), especially rotor currents, has received much attention. So, in this paper, the rotor currents of based-DFIG wind turbines are considered in a generalized way, which can be widely used to analyze the cases under different levels of voltage symmetrical faults. A direct method based on space vector is proposed to obtain an accurate expression of rotor currents as a function of time for symmetrical voltage faults in the power system. The presented theoretical analysis is simple and easy to understand and especially highlights the accuracy of the expression. Finally, the comparable simulations evaluate this analysis and show that the expression of the rotor currents is sufficient to calculate the maximum fault current, DC and AC components, and especially helps to understand the causes of the problem and as a result, contributes to adapt reasonable approaches to enhance the fault ride through (FRT) capability of DFIG wind turbines during a voltage fault
Current and voltage distribution in the diffuse vacuum arc
Schellekens, H.; Schram, D.C.
1985-01-01
On the basis of extensive measurements, a model is developed for the diffuse plasma of the high-current vacuum arc. The model shows that the current constriction and the voltage distribution in the diffuse vacuum arc prior to anode-spot formation are caused by the pressure source to which the
Energy Technology Data Exchange (ETDEWEB)
Vitorio, Patricia Cals de O.; Franca, Ademir Martins de; Soares, Marco Aurelio; Pereira, Luiz Napoleao; Costa, Danielli Guimaraes; Moreira, Giselle Cobica; Nascimento, Paulo Roberto Mesquita [Instituto Nacional de Metrologia, Normalizacao e Qualidade Industrial (DIMCI/INMETRO), Duque de Caxias, RJ (Brazil). Diretoria de Metrologia Cientifica e Industrial], E-mail: latra@inmetro.gov.br
2009-07-01
This work presents the basic characteristics and uncertainties of the calibration equipment in high voltage and high current available at the INMETRO: system of measurement in alternating high voltage up to 200 kV, system of measurement in alternating current up to 2 k A, and system of measurement in continuous high voltage up to 150 kV.
Electronic voltage and current transformers testing device.
Pan, Feng; Chen, Ruimin; Xiao, Yong; Sun, Weiming
2012-01-01
A method for testing electronic instrument transformers is described, including electronic voltage and current transformers (EVTs, ECTs) with both analog and digital outputs. A testing device prototype is developed. It is based on digital signal processing of the signals that are measured at the secondary outputs of the tested transformer and the reference transformer when the same excitation signal is fed to their primaries. The test that estimates the performance of the prototype has been carried out at the National Centre for High Voltage Measurement and the prototype is approved for testing transformers with precision class up to 0.2 at the industrial frequency (50 Hz or 60 Hz). The device is suitable for on-site testing due to its high accuracy, simple structure and low-cost hardware.
Directory of Open Access Journals (Sweden)
Jingyu Shen
2018-01-01
Full Text Available The breakdown characteristics of ultra-thin gate oxide MOS capacitors fabricated in 65 nm CMOS technology under constant voltage stress and substrate hot-carrier injection are investigated. Compared to normal thick gate oxide, the degradation mechanism of time-dependent dielectric breakdown (TDDB of ultra-thin gate oxide is found to be different. It is found that the gate current (Ig of ultra-thin gate oxide MOS capacitor is more likely to be induced not only by Fowler-Nordheim (F-N tunneling electrons, but also by electrons surmounting barrier and penetrating electrons in the condition of constant voltage stress. Moreover it is shown that the time to breakdown (tbd under substrate hot-carrier injection is far less than that under constant voltage stress when the failure criterion is defined as a hard breakdown according to the experimental results. The TDDB mechanism of ultra-thin gate oxide will be detailed. The differences in TDDB characteristics of MOS capacitors induced by constant voltage stress and substrate hot-carrier injection will be also discussed.
Energy Technology Data Exchange (ETDEWEB)
Jeon, Jun-Young; Ha, Tae-Jun, E-mail: taejunha0604@gmail.com
2017-08-15
Highlights: • We demonstrate the potential of solution-processed boron nitride (BN) thin films for nanoelectronics. • Improved interfacial characteristics reduced the leakage current by three orders of magnitude. • The BN encapsulation improves all the device key metrics of low-voltage SWCNT-TFTs. • Such improvements were achieved by reduced interaction of interfacial localized states. - Abstract: In this article, we demonstrate the potential of solution-processed boron nitride (BN) thin films for high performance single-walled carbon nanotube thin-film transistors (SWCNT-TFTs) with low-voltage operation. The use of BN thin films between solution-processed high-k dielectric layers improved the interfacial characteristics of metal-insulator-metal devices, thereby reducing the current density by three orders of magnitude. We also investigated the origin of improved device performance in SWCNT-TFTs by employing solution-processed BN thin films as an encapsulation layer. The BN encapsulation layer improves the electrical characteristics of SWCNT-TFTs, which includes the device key metrics of linear field-effect mobility, sub-threshold swing, and threshold voltage as well as the long-term stability against the aging effect in air. Such improvements can be achieved by reduced interaction of interfacial localized states with charge carriers. We believe that this work can open up a promising route to demonstrate the potential of solution-processed BN thin films on nanoelectronics.
Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang
2018-04-01
This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.
Directory of Open Access Journals (Sweden)
Rui Li
2016-12-01
Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.
The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model
Directory of Open Access Journals (Sweden)
Marius Birlea
2012-08-01
Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.
International Nuclear Information System (INIS)
Wu, You-Lin; Liao, Chun-Wei; Ling, Jing-Jenn
2014-01-01
The electrical characterization of HfO 2 /ITO/Invar resistive switching memory structure was studied using conductive atomic force microscopy (AFM) with a semiconductor parameter analyzer, Agilent 4156C. The metal alloy Invar was used as the metal substrate to ensure good ohmic contact with the substrate holder of the AFM. A conductive Pt/Ir AFM tip was placed in direct contact with the HfO 2 surface, such that it acted as the top electrode. Nanoscale current-voltage (I-V) characteristics of the HfO 2 /ITO/Invar structure were measured by applying a ramp voltage through the conductive AFM tip at various current compliances and ramp voltage sweep rates. It was found that the resistance of the low resistance state (RLRS) decreased with increasing current compliance value, but resistance of high resistance state (RHRS) barely changed. However, both the RHRS and RLRS decreased as the voltage sweep rate increased. The reasons for this dependency on current compliance and voltage sweep rate are discussed.
Non-contact current and voltage sensing method using a clamshell housing and a ferrite cylinder
Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C.; Schappert, Michael
2016-04-26
A method of measurement using a detachable current and voltage sensor provides an isolated and convenient technique for to measuring current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.
Lee, Chi-Yuan; Li, Shih-Chun; Chen, Chia-Hung; Huang, Yen-Ting; Wang, Yu-Syuan
2018-03-15
Looking for alternative energy sources has been an inevitable trend since the oil crisis, and close attentioned has been paid to hydrogen energy. The proton exchange membrane (PEM) water electrolyzer is characterized by high energy efficiency, high yield, simple system and low operating temperature. The electrolyzer generates hydrogen from water free of any carbon sources (provided the electrons come from renewable sources such as solar and wind), so it is very clean and completely satisfies the environmental requirement. However, in long-term operation of the PEM water electrolyzer, the membrane material durability, catalyst corrosion and nonuniformity of local flow, voltage and current in the electrolyzer can influence the overall performance. It is difficult to measure the internal physical parameters of the PEM water electrolyzer, and the physical parameters are interrelated. Therefore, this study uses micro-electro-mechanical systems (MEMS) technology to develop a flexible integrated microsensor; internal multiple physical information is extracted to determine the optimal working parameters for the PEM water electrolyzer. The real operational data of local flow, voltage and current in the PEM water electrolyzer are measured simultaneously by the flexible integrated microsensor, so as to enhance the performance of the PEM water electrolyzer and to prolong the service life.
Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge
Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.
2014-11-01
The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.
Breakdown characteristics of xenon HID Lamps
Babaeva, Natalia; Sato, Ayumu; Brates, Nanu; Noro, Koji; Kushner, Mark
2009-10-01
The breakdown characteristics of mercury free xenon high intensity discharge (HID) lamps exhibit a large statistical time lag often having a large scatter in breakdown voltages. In this paper, we report on results from a computational investigation of the processes which determine the ignition voltages for positive and negative pulses in commercial HID lamps having fill pressures of up to 20 atm. Steep voltage rise results in higher avalanche electron densities and earlier breakdown times. Circuit characteristics also play a role. Large ballast resistors may limit current to the degree that breakdown is quenched. The breakdown voltage critically depends on cathode charge injection by electric field emission (or other mechanisms) which in large part controls the statistical time lag for breakdown. For symmetric lamps, ionization waves (IWs) simultaneously develop from the bottom and top electrodes. Breakdown typically occurs when the top and bottom IWs converge. Condensed salt layers having small conductivities on the inner walls of HID lamps and on the electrodes can influence the ignition behavior. With these layers, IWs tend to propagate along the inner wall and exhibit a different structure depending on the polarity.
Ekino, T; Gabovich, A M; Suan Li, Mai; Szymczak, H; Voitenko, A I
2017-12-20
Quasiparticle tunnel conductance-voltage characteristics (CVCs), [Formula: see text], were calculated for break junctions (BJs) made up of layered d-wave superconductors partially gapped by charge-density waves (CDWs). The current is assumed to flow in the ab-plane of electrodes. The influence of CDWs is analyzed by comparing the resulting CVCs with CVCs calculated for BJs made up of pure d-wave superconductors with relevant parameters. The main CDW-effects were found to be the appearance of new CVC peculiarities and the loss of CVC symmetry with respect to the V-sign. Tunnel directionality was shown to be one of the key factors in the formation of [Formula: see text] dependences. In particular, the orientation of electrodes with respect to the current channel becomes very important. As a result, [Formula: see text] can acquire a large variety of forms similar to those for tunnel junctions between superconductors with s-wave, d-wave, and mixed symmetry of their order parameters. The diversity of peculiarities is especially striking at finite temperatures. In the case of BJs made up of pure d-wave superconductors, the resulting CVC can include a two-peak gap-driven structure. The results were compared with the experimental BJ data for a number of high-T c oxides. It was shown that the large variety of the observed current-voltage characteristics can be interpreted in the framework of our approach. Thus, quasiparticle tunnel currents in the ab-plane can be used as an additional mean to detect CDWs competing with superconductivity in cuprates or other layered superconductors.
Teruya, Daisuke; Masukawa, Shigeo; Iida, Shoji
We propose a novel inverter that can be operated either as a Current Source Inverter (CSI) or as a Voltage Source Inverter (VSI) by changing only the control signals. It is proper to apply it to the interconnecting system with renewal energy, such as photovoltaic cells or wind generation systems, to a grid. This inverter is usually operated as the CSI connected to the grid. Even if the energy source has a lower voltage than the grid, the energy can be supplied to the grid through the proposed inverter. The power factor can be briefly maintained at almost unity. When power supply from the grid is interrupted, the proposed circuit should be operated as the VSI in the stand-alone operation mode. In this way, the circuit can maintain a constant output voltage to the loads. In this paper, the proposed circuit configuration and the control schemes for both the CSI and the VSI are described. Further, the circuit characteristics for both are discussed experimentally.
Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors
DEFF Research Database (Denmark)
Mucha, Igor
1999-01-01
current memory cells were designed using a CMOS process with threshold voltages V-T0n = \\V-T0p\\ = 0.9 V for the n- and p-channel devices. Both hand calculations and PSPICE simulations showed that the designed example switched current memory cell allowed a maximum signal range better than +/-18 mu......A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages....... This paper presents the theoretical basis for the design of "floating-gate'' switched current memory cells by giving a detailed description and analysis of the most important impacts degrading the performance of the cells. To support the theoretical assumptions circuits based on "floating-gate'' switched...
Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks
Pace, D. C.; Austin, M. E.; Bardoczi, L.; Collins, C. S.; Crowley, B.; Davis, E.; Du, X.; Ferron, J.; Grierson, B. A.; Heidbrink, W. W.; Holcomb, C. T.; McKee, G. R.; Pawley, C.; Petty, C. C.; Podestà, M.; Rauch, J.; Scoville, J. T.; Spong, D. A.; Thome, K. E.; Van Zeeland, M. A.; Varela, J.; Victor, B.
2018-05-01
An engineering upgrade to the neutral beam system at the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)] enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic ( E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2 MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities and results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.
International Nuclear Information System (INIS)
Mohamadou, Youssoufa; Oh, Tong In; Wi, Hun; Sohal, Harsh; Farooq, Adnan; Woo, Eung Je; McEwan, Alistair Lee
2012-01-01
Current sources are widely used in bio-impedance spectroscopy (BIS) measurement systems to maximize current injection for increased signal to noise while keeping within medical safety specifications. High-performance current sources based on the Howland current pump with optimized impedance converters are able to minimize stray capacitance of the cables and setup. This approach is limited at high frequencies primarily due to the deteriorated output impedance of the constant current source when situated in a real measurement system. For this reason, voltage sources have been suggested, but they require a current sensing resistor, and the SNR reduces at low impedance loads due to the lower current required to maintain constant voltage. In this paper, we compare the performance of a current source-based BIS and a voltage source-based BIS, which use common components. The current source BIS is based on a Howland current pump and generalized impedance converters to maintain a high output impedance of more than 1 MΩ at 2 MHz. The voltage source BIS is based on voltage division between an internal current sensing resistor (R s ) and an external sample. To maintain high SNR, R s is varied so that the source voltage is divided more or less equally. In order to calibrate the systems, we measured the transfer function of the BIS systems with several known resistor and capacitor loads. From this we may estimate the resistance and capacitance of biological tissues using the least-squares method to minimize error between the measured transimpedance excluding the system transfer function and that from an impedance model. When tested on realistic loads including discrete resistors and capacitors, and saline and agar phantoms, the voltage source-based BIS system had a wider bandwidth of 10 Hz to 2.2 MHz with less than 1% deviation from the expected spectra compared to more than 10% with the current source. The voltage source also showed an SNR of at least 60 dB up to 2.2 MHz
Study on the construction and its operating characteristics of Marx high voltage pulse generator
International Nuclear Information System (INIS)
Chung, W.K.; Yook, C.C.
1984-01-01
This study is to investigate the operating characteristics of a Marx high voltage pulse generator, which is designed and fabricated for the purpose of constructing a linear theta-pinch plasma generating facility. The Marx generator consists of a 2 kJ capacitor bank of maximum output voltage of 200kV, a set of main spark switch, a triggring system, and high voltage charging power supply. The experimental results show that the operating characteristics of the generator can be controlled through varying nitrogen pressure as a filling gas. The output pulse of the generator is achieved close to the estimated voltage with the rise time of 3*m seconds. The stability of the generator is also very satisfactory within operating range of main spark switch. (Author)
Development of high voltage PEEK wire with radiation-resistance and cryogenic characteristics
International Nuclear Information System (INIS)
Fujita, T.; Hirata, T.; Araki, S.; Ohara, H.; Nishimura, H.
1989-01-01
High voltage electric wires insulated with highly-refined polyetheretherketone (PEEK) have been developed for the wiring in fusion reactors, where the wire is required to withstand high voltage under high vacuum up to 10 -5 Torr. The PEEK wires having the advantages of PEEK resin including superior radiation resistance and cryogenic characteristics are usable over a wide range of temperature and in radiation fields. The results of withstand voltage tests proved that the PEEK wires exceeding 0.8 mm in insulation thickness withstand such specified high voltage conditions as 24 kV for 1 minutes by 10 times and 6.6 kV for 110 hours. The results also revealed that the withstand voltage is improved by providing a jacket layer over the insulation and decreased by periodical voltage charge, by bending of the specimen and by water in the conductor. This paper deal with the withstand voltage test results under varied conditions of the PEEK wires. (author)
Dacuña, Javier
2012-09-06
We used a mobility edge transport model and solved the drift-diffusion equation to characterize the space-charge-limited current of a rubrene single-crystal hole-only diode. The current-voltage characteristics suggest that current is injection-limited at high voltage when holes are injected from the bottom contact (reverse bias). In contrast, the low-voltage regime shows that the current is higher when holes are injected from the bottom contact as compared to hole injection from the top contact (forward bias), which does not exhibit injection-limited current in the measured voltage range. This behavior is attributed to an asymmetric distribution of trap states in the semiconductor, specifically, a distribution of traps located near the top contact. Accounting for a localized trap distribution near the contact allows us to reproduce the temperature-dependent current-voltage characteristics in forward and reverse bias simultaneously, i.e., with a single set of model parameters. We estimated that the local trap distribution contains 1.19×1011 cm -2 states and decays as exp(-x/32.3nm) away from the semiconductor-contact interface. The local trap distribution near one contact mainly affects injection from the same contact, hence breaking the symmetry in the charge transport. The model also provides information of the band mobility, energy barrier at the contacts, and bulk trap distribution with their corresponding confidence intervals. © 2012 American Physical Society.
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
DEFF Research Database (Denmark)
Federico, de Bosio; de Sousa Ribeiro, Luiz Antonio; Freijedo Fernandez, Francisco Daniel
2016-01-01
In stand-alone microgrids based on voltage source inverters state feedback coupling between the capacitor voltage and inductor current degrades significantly the dynamics performance of voltage and current regulators. The decoupling of the controlled states is proposed, considering the limitations...
Basic characteristics of simultaneous color contrast revisited.
Ekroll, Vebjørn; Faul, Franz
2012-10-01
In this article, we present evidence supporting the hypothesis that the local mechanism of simultaneous color contrast is the same as the mechanism responsible for the crispening effect and the gamut expansion effect. A theoretically important corollary of this hypothesis is that the basic characteristics of simultaneous contrast are at odds with traditional laws. First, this hypothesis implies that the direction of the simultaneous contrast effect in color space is given by the vector from surround to target and not--as traditionally assumed--by the hue complementary to that of the surround. Second, it implies that the size of the simultaneous contrast effect depends on the difference between the target and surround colors in a way that challenges Kirschmann's fourth law. The widespread belief in the traditional laws, we argue, is due to the confounding influence of temporal adaptation.
Design of current source for multi-frequency simultaneous electrical impedance tomography
Han, Bing; Xu, Yanbin; Dong, Feng
2017-09-01
Multi-frequency electrical impedance tomography has been evolving from the frequency-sweep approach to the multi-frequency simultaneous measurement technique which can reduce measuring time and will be increasingly attractive for time-varying biological applications. The accuracy and stability of the current source are the key factors determining the quality of the image reconstruction. This article presents a field programmable gate array-based current source for a multi-frequency simultaneous electrical impedance tomography system. A novel current source circuit was realized by combining the classic current mirror based on the feedback amplifier AD844 with a differential topology. The optimal phase offsets of harmonic sinusoids were obtained through the crest factor analysis. The output characteristics of this current source were evaluated by simulation and actual measurement. The results include the following: (1) the output impedance was compared with one of the Howland pump circuit in simulation, showing comparable performance at low frequencies. However, the proposed current source makes lower demands for resistor tolerance but performs even better at high frequencies. (2) The output impedance in actual measurement below 200 kHz is above 1.3 MΩ and can reach 250 KΩ up to 1 MHz. (3) An experiment based on a biological RC model has been implemented. The mean error for the demodulated impedance amplitude and phase are 0.192% and 0.139°, respectively. Therefore, the proposed current source is wideband, biocompatible, and high precision, which demonstrates great potential to work as a sub-system in the multi-frequency electrical impedance tomography system.
A 1.8 V LDO voltage regulator with foldback current limit and thermal protection
International Nuclear Information System (INIS)
Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo
2009-01-01
This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 μm CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 μs and the quiescent current is 20 μA. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)
Current voltage perspective of an organic electronic device
Mukherjee, Ayash K.; Kumari, Nikita
2018-05-01
Nonlinearity in current (I) - voltage (V) measurement is a well-known attribute of two-terminal organic device, irrespective of the geometrical or structural arrangement of the device. Most of the existing theories that are developed for interpretation of I-V data, either focus current-voltage relationship of charge injection mechanism across the electrode-organic material interface or charge transport mechanism through the organic active material. On the contrary, both the mechanisms work in tandem charge conduction through the device. The transport mechanism is further complicated by incoherent scattering from scattering centres/charge traps that are located at the electrode-organic material interface and in the bulk of organic material. In the present communication, a collective expression has been formulated that comprises of all the transport mechanisms that are occurring at various locations of a planar organic device. The model has been fitted to experimental I-V data of Au/P3HT/Au device with excellent degree of agreement. Certain physical parameters such as the effective area of cross-section and resistance due to charge traps have been extracted from the fit.
A Study on Energy Saving of Single Phase Induction Motor By Voltage Control
Energy Technology Data Exchange (ETDEWEB)
Bae, Jong Moon [Pusan College of Information Technolgy, Pusan (Korea); Kim, Joon Hong [Dong Myong College, Pusan (Korea)
2001-06-01
This paper describes a simple effective method for energy saving of AC motors having a widely variable load. The proposed method is based on an optimal efficiency control which is operated by voltage-current pattern such as to maintain the maximum efficiency on the efficiency-output characteristics of the motor, TRIAC voltage control characteristics. The parameters of simplified voltage-current pattern can be determined approximately and reliably from the rated voltage and current of the motor. Experiments are focused on a single phase capacitor motor, the optimal energy saving are proved by proposed method. (author). 8 refs., 15 figs.
Energy Technology Data Exchange (ETDEWEB)
Yukimura, K.; Kawakami, H. (Doshisha Univ., Tokyo (Japan)); Hitomi, K. (Kyoto Polytechnic College, Kyoto (Japan))
1991-04-20
On the gap destruction characteristics of UV-preionized discharge-pumped KrF excimer laser (charge transfer type) and the electric characteristics of the excited discharge, studies were made by changing the pressure (1.5-3 atm) and the discharge gap length (14-21 mm) of the discharge medium. (1) Gap breakdown voltage and the maximum current of the excited discharge give a similarity by a product of pressure and the gap length at the charge volatge. (2) Insulation breakdown of the gap occurs at the wave front of the applied voltage and the breakdown time gets delayed by the decreasing voltage applied. By setting the ionization index at constant value 20, the gap breakdown voltage is estimated at the error within 10%. (3) The relation between the maximum current, pressure and the gap length product changes the characteristics by the charge voltage of the primary condenser. With the result combined with the standardization of voltage/current of the excited discharge, the electric characteristics at the specific pressure and gap length can be readily known. 10 refs., 10 figs.
Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei
2017-03-01
The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.
Investigation of Vacuum Arc Voltage Characteristics Under Different Axial Magnetic Field Profiles
International Nuclear Information System (INIS)
Jia Shenli; Song Xiaochuan; Huo Xintao; Shi Zongqian; Wang Lijun
2010-01-01
Characteristics of the arc voltage under different profiles of axial magnetic field were investigated experimentally in a detachable vacuum chamber with five pairs of specially designed electrodes generating both bell-shaped and saddle-shaped magnetic field profile. The arc column and cathode spot images were photographed by a high speed digital camera. The dependence of the arc voltage on arcing evolution is analyzed. It is indicated that the axial magnetic field profile could affect the arc behaviors significantly, and the arc voltage is closely related to the arc light intensity.
Capacitance-voltage characteristics of GaAs ion-implanted structures
Directory of Open Access Journals (Sweden)
Privalov E. N.
2008-08-01
Full Text Available A noniterative numerical method is proposed to calculate the barrier capacitance of GaAs ion-implanted structures as a function of the Schottky barrier bias. The features of the low- and high-frequency capacitance-voltage characteristics of these structures which are due to the presence of deep traps are elucidated.
Performance Characteristics of an Armature Voltage Controlled D.C. ...
African Journals Online (AJOL)
In this paper, the performance study of a separately excited d. c. motor whose speed is controlled by armature voltage variation is presented. Both the open loop and the closed loop steady state and transient characteristics are reported. The speed controllers considered in the closed loop mode are the proportional and the ...
A 1.8 V LDO voltage regulator with foldback current limit and thermal protection
Energy Technology Data Exchange (ETDEWEB)
Liu Zhiming; Fu Zhongqian; Huang Lu; Xi Tianzuo, E-mail: zml1985@mail.ustc.edu.c [Department of Electronic Science and Technology, University of Science and Technology of China, Hefei 230027 (China)
2009-08-15
This paper introduces the design of a l.8 V low dropout voltage regulator (LDO) and a foldback current limit circuit which limits the output current to 3 mA when load over-current occurs. The LDO was implemented in a 0.18 {mu}m CMOS technology. The measured result reveals that the LDO's power supply rejection (PSR) is about -58 dB and -54 dB at 20 Hz and 1 kHz respectively, the response time is 4 {mu}s and the quiescent current is 20 {mu}A. The designed LDO regulator can work with a supply voltage down to 2.0 V with a drop-out voltage of 200 mV at a maximum load current of 240 mA. (semiconductor integrated circuits)
Leakage Currents in Low-Voltage PME and BME Ceramic Capacitors
Teverovsky, Alexander
2015-01-01
Introduction of BME capacitors to high-reliability electronics as a replacement for PME capacitors requires better understanding of changes in performance and reliability of MLCCs to set justified screening and qualification requirements. In this work, absorption and leakage currents in various lots of commercial and military grade X7R MLCCs rated to 100V and less have been measured to reveal difference in behavior of PME and BME capacitors in a wide range of voltages and temperatures. Degradation of leakage currents and failures in virgin capacitors and capacitors with introduced cracks has been studied at different voltages and temperatures during step stress highly accelerated life testing. Mechanisms of charge absorption, conduction and degradation have been discussed and a failure model in capacitors with defects suggested.
The frequency characteristics of medium voltage distribution system impedances
Directory of Open Access Journals (Sweden)
Liviu Emil Petrean
2009-10-01
Full Text Available In this paper we present the frequency characteristics of impedances involved in the electrical equivalent circuit of a large medium voltage distribution system. These impedances influence harmonics distortions propagation occurring due to the nonsinusoidal loads. We analyse the case of a 10 kV large urban distribution system which supplies industrial, commercial and residential customers. The influence of various parameters of the distribution network on the frequency characteristics are presented, in order to assess the interaction of harmonic distortion and distribution system network.
Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier
Directory of Open Access Journals (Sweden)
Josef Burian
2012-12-01
Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.
DEFF Research Database (Denmark)
Reyes, M.; Rodriguez, Pedro; Vazquez, S.
2012-01-01
. In these codes, the injection of positive- and negative-sequence current components becomes necessary for fulfilling, among others, the low-voltage ride-through requirements during balanced and unbalanced grid faults. However, the performance of classical dq current controllers, applied to power converters......, under unbalanced grid-voltage conditions is highly deficient, due to the unavoidable appearance of current oscillations. This paper analyzes the performance of the double synchronous reference frame controller and improves its structure by adding a decoupling network for estimating and compensating...
[High voltage accidents, characteristics and treatment].
Hülsbergen-Krüger, S; Pitzler, D; Partecke, B D
1995-04-01
High-voltage injuries cause localised entrance and exit burns, extensive arc, flame and flash burns and, even more dangerous, necrosis of the underlying muscles on the pathway of the current through the body. Therefore it should be recognized that the ensuing disease is more like a crush injury than a thermal burn. The extent of injury cannot be judged by the percentage and depth of the skin burn. Diagnostic fasciotomies, radical debridement, and in many cases early amputation are necessary to prevent life-threatening complications. Over a period of 10 years, 43 patients with high-voltage injuries have been treated at the Hamburg Burn Center, 36 of them in primary care. Common causes of injury were accidents in railway areas (28%), using portable aluminium ladders near overhead power lines (9.3%), and working on electrical equipment (30.2%). Six of the primary care patients died (16.6%), and 34.9% had an amputation of one or more extremities. Nearly all patients underwent several debridement and split-skin graft procedures. In 30% of cases additional free and pedicled flaps were needed to cover soft tissue defects. Ten patients (23.3%) sustained fractures and other injuries from falls, seven (16.3%) of them severe polytrauma. Initial cardiac arrhythmics were diagnosed in 16.6% of the primarily treated patients. Thirty per cent of our patients had neurological complications such as peripheral paresis, tetraplegia and paraplegia, 20.7% of these caused solely by the electric current.
Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems
Directory of Open Access Journals (Sweden)
Dung Vo Tien
2018-01-01
Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.
Energy Technology Data Exchange (ETDEWEB)
Abdusalam, Mohamed; Karimi, Shahram; Saadate, Shahrokh [Groupe de Recherche en Electrotechnique et Electronique de Nancy (GREEN), CNRS UMR 7037 (France); Poure, Philippe [Laboratoire d' Instrumentation Electronique de Nancy (LIEN), EA 3440, Universite Henri Poincare - Nancy Universite, B.P. 239, 54506 Vandoeuvre les Nancy Cedex (France)
2009-05-15
In this paper, a new reference current computation method suitable for shunt active power filter control under distorted voltage conditions is proposed. The active power filter control is based on the use of self-tuning filters (STF) for the reference current generation and on a modulated hysteresis current controller. This active filter is intended for harmonic compensation of a diode rectifier feeding a RL load under distorted voltage conditions. The study of the active filter control is divided in two parts. The first one deals with the harmonic isolator which generates the harmonic reference currents and is experimentally implemented in a DS1104 card of a DSPACE prototyping system. The second part focuses on the generation of the switching pattern of the inverter by using a modulated hysteresis current controller, implemented in an analogue card. The use of STF instead of classical extraction filters allows extracting directly the voltage and current fundamental components in the {alpha}-{beta} axis without phase locked loop (PLL). The performances are good even under distorted voltage conditions. First, the effectiveness of the new proposed method is mathematically studied and verified by computer simulation. Then, experimental results are presented using a DSPACE system associated with the analogue current controller for a real shunt active power filter. (author)
Energy Technology Data Exchange (ETDEWEB)
Han, Myung-Geun, E-mail: mghan@bnl.gov [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Garlow, Joseph A. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Materials Science and Engineering Department, Stony Brook University, Stony Brook, NY 11794 (United States); Marshall, Matthew S.J.; Tiano, Amanda L. [Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Wong, Stanislaus S. [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11974 (United States); Cheong, Sang-Wook [Department of Physics and Astronomy, Rutgers Center for Emergent Materials, Rutgers University, Piscataway, NJ 08854 (United States); Walker, Frederick J.; Ahn, Charles H. [Department of Applied Physics and Center for Research on Interface Structures and Phenomena, Yale University, New Haven, CT 06520 (United States); Department of Mechanical Engineering and Materials Science, Yale University, New Haven, CT 06520 (United States); Zhu, Yimei [Condensed Matter Physics & Materials Science, Brookhaven National Laboratory, Upton, NY 11973 (United States)
2017-05-15
Highlights: • Electron-beam-induced-current (EBIC) and active secondary-electron voltage-contrast (SE-VC) are demonstrated in STEM mode combined with in situ electrical biasing in a TEM. • Electrostatic potential maps in ferroelectric thin films, multiferroic nanowires, and single crystals obtained by off-axis electron holography were compared with EBIC and SE-VC data. • Simultaneous EBIC and active SE-VC performed with atomic resolution STEM are demonstrated. - Abstract: The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fields and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.
Directory of Open Access Journals (Sweden)
V. M. Zolotaryov
2018-04-01
Full Text Available Aim. The article is devoted to the analysis of the electromechanical transient processes in a system of three frequency-controlled electric drives based on asynchronous motors that control current-carrying core motion, as well as to the study of the effect of such processes on the modes applying three-layer polymer insulation to the current-carrying core. Technique. The study was conducted based on the concepts of electromechanics, electromagnetic field theory, mathematical physics, mathematical modeling. Results. A mathematical model has been developed to analyze transients in an electromechanical system consisting of three frequency-controlled electric drives providing current-carrying core motion of ultra-high voltage cables in an inclined extrusion line. The coordination of the electromechanical parameters of the system drives has been carried out and the permissible changes in the supply voltage at the limiting mass while moving current-carrying core of ultra-high voltage cables with applied polymer insulation have been estimated. Scientific novelty. For the first time it is determined that with the limiting mass of the current-carrying core, the electromechanical system allows to stabilize the current-carrying core speed with the required accuracy at short-term decreases in the supply voltage by no more than 27 % of its amplitude value. It is also shown that this system is resistant to short-term increases in voltage by 32 % for 0.2 s. Practical significance. Using the developed model, it is possible to calculate the change in the configuration and speed of the slack current-carrying core when applying polymer insulation, depending on the specific mass of the current-carrying core per unit length, its tension at the bottom, the torque of the traction motor and the supply voltage to achieve stable operation of the system and accurate working of the set parameters.
International Nuclear Information System (INIS)
Briffod, G.; Hoang, G.T.
1987-06-01
On a tokamak in a current drive operation with a hybrid wave, the R.F. current is estimated from the voltage drop by plasma turn generated by R.F. power application. This estimated current is not proportional to the injected power. There still exists in the plasma an electric field corresponding to the current part produced by induction. The role evaluation of this parameter on the current drive efficiency is important. In this report the relation voltage-R.F. current is studied on Petula and results on the voltage evolution by turn on different machines are compared [fr
Voltage adjusting characteristics in terahertz transmission through Fabry-Pérot-based metamaterials
Directory of Open Access Journals (Sweden)
Jun Luo
2015-10-01
Full Text Available Metallic electric split-ring resonators (SRRs with featured size in micrometer scale, which are connected by thin metal wires, are patterned to form a periodically distributed planar array. The arrayed metallic SRRs are fabricated on an n-doped gallium arsenide (n-GaAs layer grown directly over a semi-insulating gallium arsenide (SI-GaAs wafer. The patterned metal microstructures and n-GaAs layer construct a Schottky diode, which can support an external voltage applied to modify the device properties. The developed architectures present typical functional metamaterial characters, and thus is proposed to reveal voltage adjusting characteristics in the transmission of terahertz waves at normal incidence. We also demonstrate the terahertz transmission characteristics of the voltage controlled Fabry-Pérot-based metamaterial device, which is composed of arrayed metallic SRRs. To date, many metamaterials developed in earlier works have been used to regulate the transmission amplitude or phase at specific frequencies in terahertz wavelength range, which are mainly dominated by the inductance-capacitance (LC resonance mechanism. However, in our work, the external voltage controlled metamaterial device is developed, and the extraordinary transmission regulation characteristics based on both the Fabry-Pérot (FP resonance and relatively weak surface plasmon polariton (SPP resonance in 0.025-1.5 THz range, are presented. Our research therefore shows a potential application of the dual-mode-resonance-based metamaterial for improving terahertz transmission regulation.
Hernández-Ochoa, Erick O.; Schneider, Martin F.
2012-01-01
Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655
Energy Technology Data Exchange (ETDEWEB)
Biber, M
2003-01-01
The current-voltage (I-V) characteristics of metal-insulating layer-semiconductor Cu/n-GaAs and inhomogeneous Cu/n-GaAs Schottky barrier diodes were determined in the temperature range 80-300 K. The evaluation of the experimental I-V data reveals a nonlinear increase of the zero-bias barrier height (qPHI{sub 0}) for the inhomogeneous Cu/n-GaAs Schottky barrier diodes and a linear increase of the zero-bias barrier height (qPHI{sub 0}) for Cu/n-GaAs Schottky barrier diodes with an interfacial layer. The ideality factor n decreases with increasing temperature for all diodes. Furthermore, the changes in PHI{sub 0} and n become quite significant below 150 K and the plot of ln(I{sub 0}/T{sup 2}) versus 1/T exhibits a non-linearity below 180 K for the inhomogeneous barrier diodes. Such behavior is attributed to barrier inhomogeneities by assuming a Gaussian distribution of barrier heights at the interface. The value of the Richardson constant was found to be 5.033 A/cm{sup 2} K{sup 2}, which is close to the theoretical value of 8.16 A/cm{sup 2} K{sup 2} used for the determination of the zero-bias barrier height.
Halpern, Mark
2011-01-01
This paper considers the achievable reduction in peak voltage across two driving terminals of an RC circuit when delivering charge using a stepped current waveform, comprising a chosen number of steps of equal duration, compared with using a constant current over the total duration. This work has application to the design of neurostimulators giving reduced peak electrode voltage when delivering a given electric charge over a given time duration. Exact solutions for the greatest possible peak voltage reduction using two and three steps are given. Furthermore, it is shown that the achievable peak voltage reduction, for any given number of steps is identical for simple series RC circuits and parallel RC circuits, for appropriate different values of RC. It is conjectured that the maximum peak voltage reduction cannot be improved using a more complicated RC circuit.
Self-consistent calculation of tunneling current in w-GaN/AlGaN(0001) two-barrier heterostructures
International Nuclear Information System (INIS)
Grinyaev, S. N.; Razzhuvalov, A. N.
2006-01-01
The specific features of the tunneling current in wurtzite GaN/AlGaN(0001) two-barrier structures are studied by solving the Schroedinger equation and the Poisson equation simultaneously, with regard to spontaneous and piezoelectric polarizations. It is shown that the internal fields manifest themselves in the asymmetry of the tunneling current via the value of the electronic charge in the quantum well. This charge is larger when the internal and external fields in the well compensate each other, resulting in smaller shifts of potential and resonance levels in the active region with voltage, in the higher resistance of the structure, and in the linear current-voltage dependence within a wide range of voltages. When the internal and external fields are the same, the current exhibits a sharp negative-differential-conductivity structure, with the peak-to-valley ratio equal to about four. The structure is similar to one of the branches of the current-voltage characteristic of the GaAs/AlGaAs(001) two-barrier structure, suggesting that nitrides are promising materials for resonance-tunneling devices
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
Energy Technology Data Exchange (ETDEWEB)
Marques, Hugo S.; Anunciada, Victor; Borges, Beatriz V. [Power Electronics Group, Instituto de Telecomunicacoes, Lisbon (Portugal); Instituto Superior Tecnico - Universidade Tecnica de Lisboa, Lisbon (Portugal)
2010-01-15
The great majority of the existing hybrid active power filter solutions is normally focused in 3{phi} systems and, in general, concentrates its domain of application in specific loads with deterministic behavior. Because common use grids do not exhibit these characteristics, it is mandatory to develop solutions for more generic scenarios, encouraging the use of less classical hybrid solutions. In fact, due to the widely use of switch mode converters in a great variety of consumer electronics, the problematic of mains current harmonic mitigation is no longer an exclusive matter of 3{phi} systems. The contribution of this paper is to present a shunt hybrid active power filter topology, initially conceived to work in 1{phi} domestic grids, able to operate the inverter at a voltage rate that can be lower than 10% of the mains voltage magnitude, even under nonspecific working conditions. In addition, the results shown in this paper demonstrate that this topology can, without lack of generality, be suitable to medium voltage (1{phi} or 3{phi}) systems. A new control approach for the proposed topology is discussed in this paper. The control method exhibits an extremely simple architecture requiring single point current sensing only, with no need for any kind of reference. Its practical implementation can be fulfilled by using very few, common use, operational amplifiers. The principle of operation, design criteria, simulation predictions and experimental results are presented and discussed. (author)
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
Ecker, Bernhard; Egelhaaf, Hans-Joachim; Steim, Roland; Parisi, Juergen; von Hauff', Elizabeth
2012-01-01
In this study we propose an equivalent circuit model to describe S-shaped current–voltage (I–V) characteristics in inverted solar cells with a TiOx interlayer between the cathode and the poly(3-hexylthiophene):[6,6]-phenyl C61 butyric acid methyl ester active layer. Initially the solar cells
Directory of Open Access Journals (Sweden)
Guido Ala
2018-03-01
Full Text Available This paper presents the results of a first investigation on the effects of lightning stroke on medium voltage installations’ grounding systems, interconnected with the metal shields of the Medium Voltage (MV distribution grid cables or with bare buried copper ropes. The study enables us to evaluate the distribution of the lightning current among interconnected ground electrodes in order to estimate if the interconnection, usually created to reduce ground potential rise during a single-line-to-ground fault, can give place to dangerous situations far from the installation hit by the lightning stroke. Four different case studies of direct lightning stroke are presented and discussed: (1 two secondary substations interconnected by the cables’ shields; (2 two secondary substations interconnected by a bare buried conductor; (3 a high voltage/medium voltage station connected with a secondary substation by the medium voltage cables’ shields; (4 a high voltage/medium voltage station connected with a secondary substation by a bare buried conductor. The results of the simulations show that a higher peak-lowering action on the lighting-stroke current occurs due to the use of bare conductors as interconnection elements in comparison to the cables’ shields.
Khutoryan, E. M.; Idehara, T.; Kuleshov, A. N.; Tatematsu, Y.; Yamaguchi, Y.; Matsuki, Y.; Fujiwara, T.
2017-07-01
In this paper, we present the results of simultaneous stabilization of both the frequency and the output power by a double PID feedback control on the acceleration and anode voltages in the 460-GHz gyrotron FU CW GVI, also known as "Gyrotron FU CW GO-1" (according to the nomenclature adopted at Osaka University). The approach used in the experiments is based on the modulation of the cyclotron frequency and the pitch factor (velocity ratio) of the electron beam by varying the acceleration and the anode voltages, respectively. In a long-term experiment, the frequency and power stabilities were made to be better than ±10-6 and ±1%, respectively.
Wang, Yaping; Lin, Shunjiang; Yang, Zhibin
2017-05-01
In the traditional three-phase power flow calculation of the low voltage distribution network, the load model is described as constant power. Since this model cannot reflect the characteristics of actual loads, the result of the traditional calculation is always different from the actual situation. In this paper, the load model in which dynamic load represented by air conditioners parallel with static load represented by lighting loads is used to describe characteristics of residents load, and the three-phase power flow calculation model is proposed. The power flow calculation model includes the power balance equations of three-phase (A,B,C), the current balance equations of phase 0, and the torque balancing equations of induction motors in air conditioners. And then an alternating iterative algorithm of induction motor torque balance equations with each node balance equations is proposed to solve the three-phase power flow model. This method is applied to an actual low voltage distribution network of residents load, and by the calculation of three different operating states of air conditioners, the result demonstrates the effectiveness of the proposed model and the algorithm.
Energy Technology Data Exchange (ETDEWEB)
Fujita, S; Sasaki, M; Kaga, T; Koyama, N [Hachinohe Institute of Technology, Aomori (Japan)
1996-10-27
The electric system of a solar vehicle was removed and the fundamental characteristics examined in order to carry out a basic experiment on the electric system. Using a basic circuit with panels, batteries and loads connected, the voltage and current were measured in the presence/absence of the trackers, batteries, etc., and then, their effects were examined. Simultaneously, the quantity of solar radiation was also measured. The lowering of the output voltage was somewhat relaxed with the use of the trackers. Further, with the trackers used, the output voltage of the panel was small in spite of a large quantity of solar radiation compared to the case without the trackers, which was due to the restriction of the output voltage by the trackers. When measured without batteries, the output voltage of the panel was such that the load current was also influenced by the variation of insolation, so that, with a large decrease in insolation, the load current was decreased with the supply of current suspended from the panel. 7 figs., 1 tab.
Kanazawa, Seiji; Enokizono, Masato; Shibakita, Toshihide; Umehara, Eiji; Toshimitsu, Jun; Ninomiya, Shinji; Taniguchi, Hideki; Abe, Yukari
In recent years, inverter drive machines such as a hybrid vehicle and an electric vehicle are operated under high voltage pulse with high repetition rate. In this case, inverter surge is generated and affected the machine operation. Especially, the enameled wire of a motor is deteriorated due to the partial discharge (PD) and finally breakdown of the wire will occur. In order to investigate a PD on a resistant enameled wire, characteristics of PD in the twisted pair sample under bipolar repetitive impulse voltages are investigated experimentally. The relationship between the applied voltage and discharge current was measured at PD inception and extinction, and we estimated the repetitive PD inception and extinction voltages experimentally. The corresponding optical emission of the discharge was also observed by using an ICCD camera. Furthermore, ozone concentration due to the discharge was measured during the life-time test of the resistant enameled wires from a working environmental point of view.
Energy Technology Data Exchange (ETDEWEB)
Prevosto, L.; Mancinelli, B. [Grupo de Descargas Eléctricas, Departamento Ing. Electromecánica, Facultad Regional Venado Tuerto (UTN), Laprida 651, Venado Tuerto (2600) Santa Fe (Argentina); Kelly, H. [Grupo de Descargas Eléctricas, Departamento Ing. Electromecánica, Facultad Regional Venado Tuerto (UTN), Laprida 651, Venado Tuerto (2600) Santa Fe (Argentina); Instituto de Física del Plasma (CONICET), Departamento de Física, Facultad de Ciencias Exactas y Naturales (UBA) Ciudad Universitaria Pab. I, 1428 Buenos Aires (Argentina)
2013-12-15
This work describes the application of Langmuir probe diagnostics to the measurement of the electron temperature in a time-fluctuating-highly ionized, non-equilibrium cutting arc. The electron retarding part of the time-averaged current-voltage characteristic of the probe was analysed, assuming that the standard exponential expression describing the electron current to the probe in collision-free plasmas can be applied under the investigated conditions. A procedure is described which allows the determination of the errors introduced in time-averaged probe data due to small-amplitude plasma fluctuations. It was found that the experimental points can be gathered into two well defined groups allowing defining two quite different averaged electron temperature values. In the low-current region the averaged characteristic was not significantly disturbed by the fluctuations and can reliably be used to obtain the actual value of the averaged electron temperature. In particular, an averaged electron temperature of 0.98 ± 0.07 eV (= 11400 ± 800 K) was found for the central core of the arc (30 A) at 3.5 mm downstream from the nozzle exit. This average included not only a time-average over the time fluctuations but also a spatial-average along the probe collecting length. The fitting of the high-current region of the characteristic using such electron temperature value together with the corrections given by the fluctuation analysis showed a relevant departure of local thermal equilibrium in the arc core.
International Nuclear Information System (INIS)
Prevosto, L.; Mancinelli, B.; Kelly, H.
2013-01-01
This work describes the application of Langmuir probe diagnostics to the measurement of the electron temperature in a time-fluctuating-highly ionized, non-equilibrium cutting arc. The electron retarding part of the time-averaged current-voltage characteristic of the probe was analysed, assuming that the standard exponential expression describing the electron current to the probe in collision-free plasmas can be applied under the investigated conditions. A procedure is described which allows the determination of the errors introduced in time-averaged probe data due to small-amplitude plasma fluctuations. It was found that the experimental points can be gathered into two well defined groups allowing defining two quite different averaged electron temperature values. In the low-current region the averaged characteristic was not significantly disturbed by the fluctuations and can reliably be used to obtain the actual value of the averaged electron temperature. In particular, an averaged electron temperature of 0.98 ± 0.07 eV (= 11400 ± 800 K) was found for the central core of the arc (30 A) at 3.5 mm downstream from the nozzle exit. This average included not only a time-average over the time fluctuations but also a spatial-average along the probe collecting length. The fitting of the high-current region of the characteristic using such electron temperature value together with the corrections given by the fluctuation analysis showed a relevant departure of local thermal equilibrium in the arc core
Prevosto, L; Kelly, H; Mancinelli, B
2013-12-01
This work describes the application of Langmuir probe diagnostics to the measurement of the electron temperature in a time-fluctuating-highly ionized, non-equilibrium cutting arc. The electron retarding part of the time-averaged current-voltage characteristic of the probe was analysed, assuming that the standard exponential expression describing the electron current to the probe in collision-free plasmas can be applied under the investigated conditions. A procedure is described which allows the determination of the errors introduced in time-averaged probe data due to small-amplitude plasma fluctuations. It was found that the experimental points can be gathered into two well defined groups allowing defining two quite different averaged electron temperature values. In the low-current region the averaged characteristic was not significantly disturbed by the fluctuations and can reliably be used to obtain the actual value of the averaged electron temperature. In particular, an averaged electron temperature of 0.98 ± 0.07 eV (= 11400 ± 800 K) was found for the central core of the arc (30 A) at 3.5 mm downstream from the nozzle exit. This average included not only a time-average over the time fluctuations but also a spatial-average along the probe collecting length. The fitting of the high-current region of the characteristic using such electron temperature value together with the corrections given by the fluctuation analysis showed a relevant departure of local thermal equilibrium in the arc core.
Currents and voltages in the MFTF coils during the formation of a normal zone
International Nuclear Information System (INIS)
Owen, E.W.
1980-08-01
Expressions are obtained for the currents and voltages in a pair of inductively coupled superconducting coils under two conditions: formation of a normal zone and during a change in the level of the current in one coil. A dump resistor of low resistance and a detector bridge is connected across each coil. Calculated results are given for the MFTF coils. The circuit equations during formation of a normal zone are nonlinear and time-varying, consequently, only a series solution is possible. The conditions during a change in current are more easily found. After the transient has died away, the voltages in the coil associated with the changing source are all self-inductive, while the voltages in the other coil are all mutually inductive
Load Insensitive, Low Voltage Quadrature Oscillator Using Single Active Element
Directory of Open Access Journals (Sweden)
Jitendra Mohan
2017-01-01
Full Text Available In this paper, a load insensitive quadrature oscillator using single differential voltage dual-X second generation current conveyor operated at low voltage is proposed. The proposed circuit employs single active element, three grounded resistors and two grounded capacitors. The proposed oscillator offers two load insensitive quadrature current outputs and three quadrature voltage outputs simultaneously. Effects of non-idealities along with the effects of parasitic are further studied. The proposed circuit enjoys the feature of low active and passive sensitivities. Additionally, a resistorless realization of the proposed quadrature oscillator is also explored. Simulation results using PSPICE program on cadence tool using 90 nm Complementary Metal Oxide Semiconductor (CMOS process parameters confirm the validity and practical utility of the proposed circuit.
The pulse-driven AC Josephson voltage normal
International Nuclear Information System (INIS)
Kieler, Oliver
2016-01-01
In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.
International Nuclear Information System (INIS)
Munir, T.; Aziz, A. A.; Abdullah, M. J.; Ain, M. F.
2010-01-01
Practical design of GaN Schottky diodes incorporating a field plate necessitates an understanding of how the addition of such plate affects the diode performance. In this paper, we investigated the effects on DC current-voltage (I-V) characteristics of n-GaN schottky diode by incorporating metal overlap edge termination. The thickness of the oxide film varies from 0.001 to 1 micron. Two-dimensional Atlas/Blaze simulations revealed that severe electric field crowding across the metal semiconductor contact will cause reliability concern and limit device breakdown voltage. DC current-voltage (I-V) measurements indicate that the forward currents are higher for thinner oxide film schottky diodes with metal overlap edge termination than those of unterminated schottky diodes. The forward current increased due to formation of an accumulation layer underneath the oxide layer. Extending the field plate to beyond periphery regions of schottky contact does not result in any significant increase in forward current. The new techniques of ramp oxide metal overlap edge termination have been implemented to increase the forward current of n-GaN schottky diode. In reverse bias, breakdown voltage increased with edge termination oxide up to a certain limit of oxide thickness.
Cross Voltage Control with Inner Hysteresis Current Control for Multi-output Boost Converter
DEFF Research Database (Denmark)
Nami, Alireza; Zare, Firuz; Blaabjerg, Frede
2009-01-01
Multi-output boost (MOB) converter is a novel DC-DC converter unlike the regular boost converter, has the ability to share its total output voltage and to have different series output voltage from a given duty cycle for low and high power applications. In this paper, discrete voltage control...... with inner hysteresis current control loop has been proposed to keep the simplicity of the control law for the double-output MOB converter, which can be implemented by a combination of analogue and logical ICs or simple microcontroller to constrain the output voltages of MOB converter at their reference...... voltages against variation in load or input voltage. The salient features of the proposed control strategy are simplicity of implementation and ease to extend to multiple outputs in the MOB converter. Simulation and experimental results are presented to show the validity of control strategy....
She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William
2016-12-13
A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories
Energy Technology Data Exchange (ETDEWEB)
Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)
2016-07-11
High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.
DEFF Research Database (Denmark)
Han, Renke; Meng, Lexuan; Guerrero, Josep M.
2018-01-01
combining the state-dependent tolerance with a nonnegative offset. In order to design the event-triggered principle and guarantee the global stability, a generalized dc microgrid model is proposed and proven to be positive definite, based on which Lyapunov-based approach is applied. Furthermore, considering......A distributed nonlinear controller is presented to achieve both accurate current-sharing and voltage regulation simultaneously in dc microgrids considering different line impedances’ effects among converters. Then, an improved event-triggered principle for the controller is introduced through...... for precise real-time information transmission, without sacrificing system performance. Experimental results obtained from a dc microgrid setup show the robustness of the new proposal under normal, communication failure, communication delay and plug-and-play operation conditions. Finally, communication...
Mnati, Mohannad Jabbar; Van den Bossche, Alex; Chisab, Raad Farhood
2017-04-15
In this paper, a new smart voltage and current monitoring system (SVCMS) technique is proposed. It monitors a three phase electrical system using an Arduino platform as a microcontroller to read the voltage and current from sensors and then wirelessly send the measured data to monitor the results using a new Android application. The integrated SVCMS design uses an Arduino Nano V3.0 as the microcontroller to measure the results from three voltage and three current sensors and then send this data, after calculation, to the Android smartphone device of an end user using Bluetooth HC-05. The Arduino Nano V3.0 controller and Bluetooth HC-05 are a cheap microcontroller and wireless device, respectively. The new Android smartphone application that monitors the voltage and current measurements uses the open source MIT App Inventor 2 software. It allows for monitoring some elementary fundamental voltage power quality properties. An effort has been made to investigate what is possible using available off-the-shelf components and open source software.
Bureau of Naval Personnel, Washington, DC.
This module covers the relationships between current and voltage; resistance in a series circuit; how to determine the values of current, voltage, resistance, and power in resistive series circuits; the effects of source internal resistance; and an introduction to the troubleshooting of series circuits. This module is divided into five lessons:…
Energy Technology Data Exchange (ETDEWEB)
Vaisanen, V.
2012-07-01
Fuel cells are a promising alternative for clean and efficient energy production. A fuel cell is probably the most demanding of all distributed generation power sources. It resembles a solar cell in many ways, but sets strict limits to current ripple, common mode voltages and load variations. The typically low output voltage from the fuel cell stack needs to be boosted to a higher voltage level for grid interfacing. Due to the high electrical efficiency of the fuel cell, there is a need for high efficiency power converters, and in the case of low voltage, high current and galvanic isolation, the implementation of such converters is not a trivial task. This thesis presents galvanically isolated DC-DC converter topologies that have favorable characteristics for fuel cell usage and reviews the topologies from the viewpoint of electrical efficiency and cost efficiency. The focus is on evaluating the design issues when considering a single converter module having large current stresses. The dominating loss mechanism in low voltage, high current applications is conduction losses. In the case of MOSFETs, the conduction losses can be efficiently reduced by paralleling, but in the case of diodes, the effectiveness of paralleling depends strongly on the semiconductor material, diode parameters and output configuration. The transformer winding losses can be a major source of losses if the windings are not optimized according to the topology and the operating conditions. Transformer prototyping can be expensive and time consuming, and thus it is preferable to utilize various calculation methods during the design process in order to evaluate the performance of the transformer. This thesis reviews calculation methods for solid wire, litz wire and copper foil winding losses, and in order to evaluate the applicability of the methods, the calculations are compared against measurements and FEM simulations. By selecting a proper calculation method for each winding type, the winding
DEFF Research Database (Denmark)
Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng
2017-01-01
In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...
Current Transport Mechanisms and Capacitance Characteristic in the InN/InP Schottky Structures
Directory of Open Access Journals (Sweden)
K. AMEUR
2014-05-01
Full Text Available In this work, electrical characterization of the current-voltage and capacitance- voltage curves for the Metal/InN/InP Schottky structures are investigated. We have studied electrically thin InN films realized by the nitridation of InP (100 substrates using a Glow Discharge Source (GDS in ultra high vacuum. The I (V curves have exhibited anomalous two-step (kink forward bias behaviour; a suitable fit was only obtained by using a model of two discrete diodes in parallel. Thus, we have calculated, using I(V and C(V curves of Hg/InN/InP Schottky structures, the ideality factor n, the saturation current Is, the barrier height jB, the series resistance Rs, the doping concentration Nd and the diffusion voltage Vd. We have also presented the band diagram of this heterojunction which indicates the presence of a channel formed by holes at the interface InN/InP which explain by the presence of two-dimensional electron gas (2-DEG and this was noticed in the presentation of characteristics C(V.
DEFF Research Database (Denmark)
Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger
2017-01-01
This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....
Current-voltage relation for thin tunnel barriers: Parabolic barrier model
DEFF Research Database (Denmark)
Hansen, Kim; Brandbyge, Mads
2004-01-01
We derive a simple analytic result for the current-voltage curve for tunneling of electrons through a thin uniform insulating layer modeled by a parabolic barrier. Our model, which goes beyond the Wentzel–Kramers–Brillouin approximation, is applicable also in the limit of highly transparant...
International Nuclear Information System (INIS)
Cuneo, M.E.; Hanson, D.L.; Menge, P.R.; Poukey, J.W.; Savage, M.E.
1994-01-01
SABRE (Sandia Accelerator and Beam Research Experiment) is a ten-cavity linear induction magnetically insulated voltage adder (6 MV, 300 kA) operated in positive polarity to investigate issues relevant to ion beam production and propagation for inertial confinement fusion. The voltage adder section is coupled to an applied-B extraction ion diode via a long coaxial output transmission line. Observations indicate that the power propagates in a vacuum wave prior to electron emission. After the electron emission threshold is reached, power propagates in a magnetically insulated wave. The precursor is observed to have a dominant impact on he turn-on, impedance history, and beam characteristics of applied-B ion diodes since the precursor voltage is large enough to cause electron emission at the diode from both the cathode feed and cathode tips. The amplitude of the precursor at the load (3--4.5 MV) is a significant fraction of the maximum load voltage (5--6 MV) because (1) the transmission line gaps ( ∼ 9 cm at output) and therefore impedances are relatively large, and hence the electric field threshold for electron emission (200 to 300 kV/cm) is not reached until well into the power pulse rise time; and (2) the rapidly falling forward wave and diode impedance reduces the ratio of main pulse voltage to precursor voltage. Experimental voltage and current data from the transmission line and the ion diode will be presented and compared with TWOQUICK (2-D electromagnetic PIC code) simulations and analytic models
Truong, Hoa Thi; Hayashi, Misaki; Uesugi, Yoshihiko; Tanaka, Yasunori; Ishijima, Tatsuo
2017-06-01
This work focuses on design, construction, and optimization of configuration of a novel high voltage pulse power source for large-scale dielectric barrier discharge (DBD) generation. The pulses were generated by using the high-speed switching characteristic of an inexpensive device called silicon diodes for alternating current and the self-terminated characteristic of DBD. The operation started to be powered by a primary DC low voltage power supply flexibly equipped with a commercial DC power supply, or a battery, or DC output of an independent photovoltaic system without transformer employment. This flexible connection to different types of primary power supply could provide a promising solution for the application of DBD, especially in the area without power grid connection. The simple modular structure, non-control requirement, transformer elimination, and a minimum number of levels in voltage conversion could lead to a reduction in size, weight, simple maintenance, low cost of installation, and high scalability of a DBD generator. The performance of this pulse source has been validated by a load of resistor. A good agreement between theoretically estimated and experimentally measured responses has been achieved. The pulse source has also been successfully applied for an efficient DBD plasma generation.
Dextromethorphan inhibition of voltage-gated proton currents in BV2 microglial cells.
Song, Jin-Ho; Yeh, Jay Z
2012-05-10
Dextromethorphan, an antitussive drug, has a neuroprotective property as evidenced by its inhibition of microglial production of pro-inflammatory cytokines and reactive oxygen species. The microglial activation requires NADPH oxidase activity, which is sustained by voltage-gated proton channels in microglia as they dissipate an intracellular acid buildup. In the present study, we examined the effect of dextromethorphan on proton currents in microglial BV2 cells. Dextromethorphan reversibly inhibited proton currents with an IC(50) value of 51.7 μM at an intracellular/extracellular pH gradient of 5.5/7.3. Dextromethorphan did not change the reversal potential or the voltage dependence of the gating. Dextrorphan and 3-hydroxymorphinan, major metabolites of dextromethorphan, and dextromethorphan methiodide were ineffective in inhibiting proton currents. The results indicate that dextromethorphan inhibition of proton currents would suppress NADPH oxidase activity and, eventually, microglial activation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Modelling chloride penetration in concrete using electrical voltage and current approaches
Directory of Open Access Journals (Sweden)
Juan Lizarazo-Marriaga
2011-03-01
Full Text Available This paper reports a research programme aimed at giving a better understanding of the phenomena involved in the chloride penetration in cement-based materials. The general approach used was to solve the Nernst-Planck equation numerically for two physical ideal states that define the possible conditions under which chlorides will move through concrete. These conditions are named in this paper as voltage control and current control. For each condition, experiments and simulations were carried out in order to establish the importance of electrical variables such as voltage and current in modelling chloride transport in concrete. The results of experiments and simulations showed that if those electrical variables are included as key parameters in the modelling of chloride penetration through concrete, a better understanding of this complex phenomenon can be obtained.
Output pressure and harmonic characteristics of a CMUT as function of bias and excitation voltage
DEFF Research Database (Denmark)
Lei, Anders; Diederichsen, Søren Elmin; Hansen, Sebastian Molbech
2015-01-01
of the transmitted signal. The generation of intrinsic harmonics by the CMUT can be minimized by decreasing the excitation signal. This, however, leads to lower fundamental pressure which limits the desired generation of harmonics in the medium. This work examines the output pressure and harmonic characteristics...... of a CMUT as function of bias and excitation voltage. The harmonic to fundamental ratio of the surface pressures declines for decreasing excitation voltage and increasing bias voltage. The ratio, however, becomes unchanged for bias levels close to the pull-in voltage. The harmonic limitations of the CMUT...
Directory of Open Access Journals (Sweden)
Korobeynikov S.M.
2017-08-01
Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.
CURRENT-VOLTAGE CURVES FOR TREATING EFFLUENT CONTAINING HEDP: DETERMINATION OF THE LIMITING CURRENT
Directory of Open Access Journals (Sweden)
T. Scarazzato
2015-12-01
Full Text Available Abstract Membrane separation techniques have been explored for treating industrial effluents to allow water reuse and component recovery. In an electrodialysis system, concentration polarization causes undesirable alterations in the ionic transportation mechanism. The graphic construction of the current voltage curve is proposed for establishing the value of the limiting current density applied to the cell. The aim of this work was to determine the limiting current density in an electrodialysis bench stack, the function of which was the treatment of an electroplating effluent containing HEDP. For this, a system with five compartments was used with a working solution simulating the rinse waters of HEDP-based baths. The results demonstrated correlation between the regions defined by theory and the experimental data.
Two ways to model voltage-current curves of adiabatic MgB2 wires
International Nuclear Information System (INIS)
Stenvall, A; Korpela, A; Lehtonen, J; Mikkonen, R
2007-01-01
Usually overheating of the sample destroys attempts to measure voltage-current curves of conduction cooled high critical current MgB 2 wires at low temperatures. Typically, when a quench occurs a wire burns out due to massive heat generation and negligible cooling. It has also been suggested that high n values measured with MgB 2 wires and coils are not an intrinsic property of the material but arise due to heating during the voltage-current measurement. In addition, quite recently low n values for MgB 2 wires have been reported. In order to find out the real properties of MgB 2 an efficient computational model is required to simulate the voltage-current measurement. In this paper we go back to basics and consider two models to couple electromagnetic and thermal phenomena. In the first model the magnetization losses are computed according to the critical state model and the flux creep losses are considered separately. In the second model the superconductor resistivity is described by the widely used power law. Then the coupled current diffusion and heat conduction equations are solved with the finite element method. In order to compare the models, example runs are carried out with an adiabatic slab. Both models produce a similar significant temperature rise near the critical current which leads to fictitiously high n values
Directory of Open Access Journals (Sweden)
Martín-Antonio Rodríguez-Licea
2018-05-01
Full Text Available A Direct Current (DC microgrid is a concept derived from a smart grid integrating DC renewable sources. The DC microgrids have three particularities: (1 integration of different power sources and local loads through a DC link; (2 on-site power source generation; and (3 alternating loads (on-off state. This kind of arrangement achieves high efficiency, reliability and versatility characteristics. The key device in the development of the DC microgrid is the power electronic converter (PEC, since it allows an efficient energy conversion between power sources and loads. However, alternating loads with strictly-controlled PECs can provide negative impedance behavior to the microgrid, acting as constant power loads (CPLs, such that the overall closed-loop system becomes unstable. Traditional CPL compensation techniques rely on a damping increment by the adaptation of the source or load voltage level, adding external circuitry or by using some advanced control technique. However, none of them provide a simple and general solution for the CPL problem when abrupt changes in parameters and/or in alternating loads/sources occur. This paper proposes a mathematical modeling and a robust control for the basic PECs dealing with CPLs in continuous conduction mode. In particular, the case of the low voltage residential DC microgrid with CPLs is taken as a benchmark. The proposed controller can be easily tuned for the desired response even by the non-expert. Basic converters with voltage mode control are taken as a basis to show the feasibility of this analysis, and experimental tests on a 100-W testbed include abrupt parameter changes such as input voltage.
Jump in current at the gap voltage in a superconducting junction
International Nuclear Information System (INIS)
Coombes, J.M.; Carbotte, J.P.
1986-01-01
For many materials not previously considered, we have calculated the jump, at the gap voltage, in the quasiparticle current of a tunnel junction. An empirical relationship between the jump and the effective electron-phonon coupling λ-μ/sup */ previously established is confirmed. Further, a new and equally as accurate correlation is found with the strong coupling index T/sub c//ω/sub ln/, where T/sub c/ is the critical temperature and ω/sub ln/ a specific characteristic phonon energy. A simple formula for the jump which includes a strong-coupling correction is derived and found to fit the observed correlation well. Finally, we study the effect on the jump of unusual values of Coulomb pseudopotential μ/sup */. Also a δ-function electron-phonon spectral density α 2 F(ω) is used to help in the understanding of the range of values that is possible for the jump when α 2 F(ω) is not restricted to realistic shapes
A Study on Gas Insulation Characteristics for Design Optimization of High Voltage Power Apparatus
Energy Technology Data Exchange (ETDEWEB)
Kim, I S; Kim, M K; Seo, K S; Moon, I W; Choi, C K [Korea Electrotechnology Research Institute (Korea, Republic of)
1996-12-01
This study aim of obtaining the basic data for gas insulation in the high voltage apparatus and for investigating the breakdown characteristics in uniform field and non-uniform which the geometric construction in the practical power apparatus. In this study, the research results on the insulation technology published earlier are reviewed and the basic data for an optimum design of a high voltage apparatus are obtained thorough the experiment and computer simulation by using a uniform field. The main result are summarized as follows: (A) Investigation on the insulation technology in a large-capacity power apparatus. (B) Investigation on the breakdown characteristics in particle contaminated condition. (C) Investigation on the design in computer simulation. (D) Investigation on the simulation technology of breakdown characteristics. (E) Investigation on breakdown characteristics in the nonuniform field and experiment. (author). refs., figs., tabs.
Current transport mechanisms in mercury cadmium telluride diode
Energy Technology Data Exchange (ETDEWEB)
Gopal, Vishnu, E-mail: vishnu-46@yahoo.com, E-mail: wdhu@mail.sitp.ac.cn [Institute of Defence Scientists and Technologists, CFEES Complex, Brig. S. K. Majumdar Marg, Delhi 110054 (India); Li, Qing; He, Jiale; Hu, Weida, E-mail: vishnu-46@yahoo.com, E-mail: wdhu@mail.sitp.ac.cn [National Lab for Infrared Physics, Shanghai Institute of Technical Physics, Chinese Academy of Sciences, Shanghai 200083 (China); He, Kai; Lin, Chun [Key Laboratory of Infrared Imaging Materials and Detectors, Shanghai Institute of Technical Physics, Chinese Academy of Sciences, Shanghai 200083 (China)
2016-08-28
This paper reports the results of modelling of the current-voltage characteristics (I-V) of a planar mid-wave Mercury Cadmium Telluride photodiode in a gate controlled diode experiment. It is reported that the diode exhibits nearly ideal I-V characteristics under the optimum surface potential leading to the minimal surface leakage current. Deviations from the optimum surface potential lead to non ideal I–V characteristics, indicating a strong relationship between the ideality factor of the diode with its surface leakage current. Diode's I–V characteristics have been modelled over a range of gate voltages from −9 V to −2 V. This range of gate voltages includes accumulation, flat band, and depletion and inversion conditions below the gate structure of the diode. It is shown that the I–V characteristics of the diode can be very well described by (i) thermal diffusion current, (ii) ohmic shunt current, (iii) photo-current due to background illumination, and (iv) excess current that grows by the process of avalanche multiplication in the gate voltage range from −3 V to −5 V that corresponds to the optimum surface potential. Outside the optimum gate voltage range, the origin of the excess current of the diode is associated with its high surface leakage currents. It is reported that the ohmic shunt current model applies to small surface leakage currents. The higher surface leakage currents exhibit a nonlinear shunt behaviour. It is also shown that the observed zero-bias dynamic resistance of the diode over the entire gate voltage range is the sum of ohmic shunt resistance and estimated zero-bias dynamic resistance of the diode from its thermal saturation current.
International Nuclear Information System (INIS)
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-01-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-07-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
Reverse Current Characteristics of InP Gunn Diodes for W-Band Waveguide Applications.
Kim, Hyun-Seok; Heo, Jun-Woo; Chol, Seok-Gyu; Ko, Dong-Sik; Rhee, Jin-Koo
2015-07-01
InP is considered as the most promising material for millimeter-wave laser-diode applications owing to its superior noise performance and wide operating frequency range of 75-110 GHz. In this study, we demonstrate the fabrication of InP Gunn diodes with a current-limiting structure using rapid thermal annealing to modulate the potential height formed between an n-type InP active layer and a cathode contact. We also explore the reverse current characteristics of the InP Gunn diodes. Experimental results indicate a maximum anode current and an oscillation frequency of 200 mA and 93.53 GHz, respectively. The current-voltage characteristics are modeled by considering the Schottky and ohmic contacts, work function variations, negative differential resistance (NDR), and tunneling effect. Although no direct indication of the NDR is observed, the simulation results match the measured data well. The modeling results show that the NDR effect is always present but is masked because of electron emission across the shallow Schottky barrier.
Cathode voltage and discharge current oscillations in HiPIMS
Czech Academy of Sciences Publication Activity Database
Klein, P.; Hnilica, J.; Hubička, Zdeněk; Čada, Martin; Šlapanská, M.; Zemánek, M.; Vašina, P.
2017-01-01
Roč. 26, č. 5 (2017), s. 1-12, č. článku 055015. ISSN 0963-0252 R&D Projects: GA ČR(CZ) GA15-00863S Institutional support: RVO:68378271 Keywords : HiPIMS * voltage and current oscillations * spokes Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 3.302, year: 2016
Wide Operating Voltage Range Fuel Cell Battery Charger
DEFF Research Database (Denmark)
Hernandez Botella, Juan Carlos; Mira Albert, Maria del Carmen; Sen, Gokhan
2014-01-01
DC-DC converters for fuel cell applications require wide voltage range operation due to the unique fuel cell characteristic curve. Primary parallel isolated boost converter (PPIBC) is a boost derived topology for low voltage high current applications reaching an efficiency figure up to 98...... by two the converter input-to-output voltage gain. This allows covering the conditions when the fuel cell stack operates in the activation region (maximum output voltage) and increases the degrees of freedom for converter optimization. The transition between operating modes is studied because represents...
Energy Technology Data Exchange (ETDEWEB)
Litzenberger, Wayne; Lava, Val
1994-08-01
References are contained for HVDC systems, converter stations and components, overhead transmission lines, cable transmission, system design and operations, simulation of high voltage direct current systems, high-voltage direct current installations, and flexible AC transmission system (FACTS).
Mahato, Somnath; Puigdollers, Joaquim
2018-02-01
Temperature dependent current-voltage (I‒V) characteristics of Au/n-type silicon (n-Si) Schottky barrier diodes have been investigated. Three transition metal oxides (TMO) are used as an interface layer between gold and silicon. The basic Schottky diode parameters such as ideality factor (n), barrier height (ϕb 0) and series resistance (Rs) are calculated and successfully explained by the thermionic emission (TE) theory. It has been found that ideality factor decreased and barrier height increased with increased of temperature. The conventional Richardson plot of ln(I0/T2) vs. 1000/T is determined the activation energy (Ea) and Richardson constant (A*). Whereas value of 'A*' is much smaller than the known theoretical value of n-type Si. The temperature dependent I-V characteristics obtained the mean value of barrier height (ϕb 0 bar) and standard deviation (σs) from the linear plot of ϕap vs. 1000/T. From the modified Richardson plot of ln(I0/T2) ˗ (qσ)2/2(kT)2 vs. 1000/T gives Richardson constant and homogeneous barrier height of Schottky diodes. Main observation in this present work is the barrier height and ideality factor shows a considerable change but the series resistance value exhibits negligible change due to TMO as an interface layer.
E-beam high voltage switching power supply
Shimer, Daniel W.; Lange, Arnold C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.
E-beam high voltage switching power supply
International Nuclear Information System (INIS)
Shimer, D.W.; Lange, A.C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs
DEFF Research Database (Denmark)
Xin, Zhen; Mattavelli, Paolo; Yao, WenLi
2018-01-01
harmonics can freely flow into the filter capacitor. In this case, because of the loss of harmonic information, traditional harmonic controllers fail to mitigate the grid current distortion. Although this problem may be avoided using the grid voltage feedforward scheme, the required differentiators may...
International Nuclear Information System (INIS)
Volkov, M. S.; Gusev, Yu. P.; Monakov, Yu. V.; Cho, Gvan Chun
2016-01-01
The insertion of current-limiting reactors into electrical equipment operating at a voltage of 110 and 220 kV produces a change in the parameters of the transient recovery voltages at the contacts of the circuit breakers for disconnecting short circuits, which could be the reason for the increase in the duration of the short circuit, damage to the electrical equipment and losses in the power system. The results of mathematical modeling of the transients, caused by tripping of the short circuit in a reactive electric power transmission line are presented, and data are given on the negative effect of a current-limiting resistor on the rate of increase and peak value of the transient recovery voltages. Methods of ensuring the standard requirements imposed on the parameters of the transient recovery voltages when using current-limiting reactors in the high-voltage electrical equipment of power plants and substations are proposed and analyzed
DEFF Research Database (Denmark)
Fuchs, W; Larsen, Erik Hviid; Lindemann, B
1977-01-01
1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...
Milood Almelian, Mohamad; Mohd, Izzeldin I.; Asghaiyer Omran, Mohamed; Ullah Sheikh, Usman
2018-04-01
Power quality-related issues such as current and voltage distortions can adversely affect home and industrial appliances. Although several conventional techniques such as the use of passive and active filters have been developed to increase power quality standards, these methods have challenges and are inadequate due to the increasing number of applications. The Unified Power Quality Conditioner (UPQC) is a modern strategy towards correcting the imperfections of voltage and load current supply. A UPQC is a combination of both series and shunt active power filters in a back-to-back manner with a common DC link capacitor. The control of the voltage of the DC link capacitor is important in achieving a desired UPQC performance. In this paper, the UPQC with a Fuzzy logic controller (FLC) was used to precisely eliminate the imperfections of voltage and current harmonics. The results of the simulation studies using MATLAB/Simulink and Simpower system programming for R-L load associated through an uncontrolled bridge rectifier was used to assess the execution process. The UPQC with FLC was simulated for a system with distorted load current and a system with distorted source voltage and load current. The outcome of the comparison of %THD in the load current and source voltage before and after using UPQC for the two cases was presented.
Zhou, Shengjun; Lv, Jiajiang; Wu, Yini; Zhang, Yuan; Zheng, Chenju; Liu, Sheng
2018-05-01
We investigated the reverse leakage current characteristics of InGaN/GaN multiple quantum well (MQW) near-ultraviolet (NUV)/blue/green light-emitting diodes (LEDs). Experimental results showed that the NUV LED has the smallest reverse leakage current whereas the green LED has the largest. The reason is that the number of defects increases with increasing nominal indium content in InGaN/GaN MQWs. The mechanism of the reverse leakage current was analyzed by temperature-dependent current–voltage measurement and capacitance–voltage measurement. The reverse leakage currents of NUV/blue/green LEDs show similar conduction mechanisms: at low temperatures, the reverse leakage current of these LEDs is attributed to variable-range hopping (VRH) conduction; at high temperatures, the reverse leakage current of these LEDs is attributed to nearest-neighbor hopping (NNH) conduction, which is enhanced by the Poole–Frenkel effect.
International Nuclear Information System (INIS)
Karimov, A.V.; Yodgorova, D.M.; Kamanov, B.M.; Giyasova, F.A.; Yakudov, A.A.
2012-01-01
The silicon field-effect transistors were investigated to use in circuits for stabilization of current and voltage. As in gallium arsenide field-effect transistors, in silicon field-effect transistors with p-n-junction a new mechanism of saturation of the drain current is experimentally found out due to both transverse and longitudinal compression of channel by additional resistance between the source and the gate of the transistor. The criteria for evaluating the coefficients of stabilization of transient current suppressors and voltage stabilizator based on the field-effect transistor are considered. (authors)
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
New circuits high-voltage pulse generators with inductive-capacitive energy storage
International Nuclear Information System (INIS)
Gordeev, V.S.; Myskov, G.A.
2001-01-01
The paper describes new electric circuits of multi-cascade generators based on stepped lines. The distinction of the presented circuits consists in initial storage of energy in electric and magnetic fields simultaneously. The circuit of each generator,relations of impedances,values of initial current and charge voltages are selected in such a manner that the whole of initially stored energy is concentrated at the generator output as a result of transient wave processes. In ideal case the energy is transferred with 100% efficiency to the resistive load where a rectangular voltage pulse is formed, whose duration is equals to the double electrical length of the individual cascade. At the same time there is realized a several time increase of output voltage as compared to the charge voltage of the generator. The use of the circuits proposed makes it possible to ensure a several time increase (as compared to the selection of the number of cascades) of the generator energy storage, pulse current and output electric power
Directory of Open Access Journals (Sweden)
Lei Lan
2017-07-01
Full Text Available It is important to reveal the relations of physical factors to deposition of contaminants on insulator. In this paper, the simulation model of high voltage end of insulator was established to study the force and motion characteristics of particles affected by electric force and airflow drag force near the ultra-high voltage direct current (UHVDC insulator. By finite element method, the electric field was set specially to be similar to the one near practical insulator, the steady fluid field was simulated. The electric force and air drag force were loaded on the uniformly charged particles. The characteristics of the two forces on particles, the relationship between quantity of electric charge on particles and probability of particles contacting the insulator were analyzed. It was found that, near the sheds, airflow drag force on particles is significantly greater than electric force with less electric charge. As the charge multiplies, electric force increases linearly, airflow drag force grows more slowly. There is a trend that the magnitude of electric force and drag force is going to similar. Meanwhile, the probability of particles contacting the insulator is increased too. However, at a certain level of charge which has different value with different airflow velocity, the contact probability has extremum here. After exceeding the value, as the charge increasing, the contact probability decreases gradually.
Microscopic origin of gating current fluctuations in a potassium channel voltage sensor.
Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J
2012-06-06
Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
High voltage power supplies for ITER RF heating and current drive systems
International Nuclear Information System (INIS)
Gassmann, T.; Arambhadiya, B.; Beaumont, B.; Baruah, U.K.; Bonicelli, T.; Darbos, C.; Purohit, D.; Decamps, H.; Albajar, F.; Gandini, F.; Henderson, M.; Kazarian, F.; Lamalle, P.U.; Omori, T.; Parmar, D.; Patel, A.; Rathi, D.; Singh, N.P.
2011-01-01
The RF heating and current drive (H and CD) systems to be installed for the ITER fusion machine are the electron cyclotron (EC), ion cyclotron (IC) and, although not in the first phase of the project, lower hybrid (LH). These systems require high voltage, high current power supplies (HVPS) in CW operation. These HVPS should deliver around 50 MW electrical power to each of the RF H and CD systems with stringent requirements in terms of accuracy, voltage ripple, response time, turn off time and fault energy. The PSM (Pulse Step Modulation) technology has demonstrated over the past 20 years its ability to fulfill these requirements in many industrial facilities and other fusion reactors and has therefore been chosen as reference design for the IC and EC HVPS systems. This paper describes the technical specifications, including interfaces, the resulting constraints on the design, the conceptual design proposed for ITER EC and IC HVPS systems and the current status.
Ahmed, M.; Putrus, G. A.; Ran, L.; Penlington, R.
2006-01-01
This paper describes the development of a solid-state Fault Current Limiting and Interrupting Device (FCLID) suitable for low voltage distribution networks. The main components of the FCLID are a bidirectional semiconductor switch that can disrupt the short-circuit current, and a voltage clamping element that helps in controlling the current and absorbing the inductive energy stored in the network during current interruption. Using a hysteresis type control algorithm, the short-circuit curren...
Energy Technology Data Exchange (ETDEWEB)
Costa, Marcos Rodrigues
1996-07-01
The technical feasibility of the development of a novel system measuring of high voltage and current in 15 kV distribution lines was presented. The system is basically the combination of two other systems, one conventional and other electro-optical. The conventional subsystem is based on voltage dividers and magnetic rings while the electro-optical subsystem uses LEDs, resistors, optical-fibers and photodetectors. The system was completely tested in laboratory and its main characteristics are low price, easy of installation and flexibility. Two software for data acquisition by GPIB and A/D boards were also developed. The can provide reports on voltages, currents, power and phase-power. (author)
International Nuclear Information System (INIS)
Najafi, E.; Yatim, A.H.M.
2011-01-01
Research highlights: → We proposed a new current control method for STATCOM. → The current control method maintains a fixed switching frequency. → It also produces fewer harmonics compared to conventional hysteresis method. → A new voltage dip (sag) detection method was used in STATCOM. → The control method can mitigate voltage sag in each phase separately. -- Abstract: Static compensator (STATCOM) has been widely proposed for power quality and network stability improvement. It is easily connected in parallel to the electric network and has many advantages for electrical grids. It can improve network stability; power factor, power transfer rating and can avoid some disturbances such as sags and swells. Most of STATCOM controllers are based on voltage controllers that are based on balanced d-q transform. However, they are not thorough solutions for network disturbances since in most cases single-phase disturbances occur in electrical networks that cannot be avoided by the conventional controllers. Voltage mode controllers are also not capable of responding fast enough to the changes expected of a network system. This paper proposes a new current mode controller to overcome the mentioned problem. The approach uses a fixed frequency current controller to maintain voltage levels in voltage sags (dips). This approach is also simple and can be easily implemented by digitally. It has superior performance over conventional methods in terms of harmonic reduction in STATCOM output current. Another important factor for STATCOM effectiveness in sag mitigation is its sag detection method. This paper also introduces a new sag detection method based on Goertzel algorithm which is both effective and simple for practical applications. The simulation results presented illustrate the superiority of the proposed controller and sag detection algorithm to be utilized in the STATCOM.
Multi-Port High Voltage Gain Modular Power Converter for Offshore Wind Farms
Directory of Open Access Journals (Sweden)
Sen Song
2018-06-01
Full Text Available In high voltage direct current (HVDC power transmission of offshore wind power systems, DC/DC converters are applied to transfer power from wind generators to HVDC terminals, and they play a crucial role in providing a high voltage gain, high efficiency, and high fault tolerance. This paper introduces an innovative multi-port DC/DC converter with multiple modules connected in a scalable matrix configuration, presenting an ultra-high voltage step-up ratio and low voltage/current rating of components simultaneously. Additionally, thanks to the adoption of active clamping current-fed push–pull (CFPP converters as sub-modules (SMs, soft-switching is obtained for all power switches, and the currents of series-connected CFPP converters are auto-balanced, which significantly reduce switching losses and control complexity. Furthermore, owing to the expandable matrix structure, the output voltage and power of a modular converter can be controlled by those of a single SM, or by adjusting the column and row numbers of the matrix. High control flexibility improves fault tolerance. Moreover, due to the flexible control, the proposed converter can transfer power directly from multiple ports to HVDC terminals without bus cable. In this paper, the design of the proposed converter is introduced, and its functions are illustrated by simulation results.
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1993-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1991-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs
Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.
Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.
Input-current-shaper based on a modified SEPIC converter with low voltage stress
DEFF Research Database (Denmark)
Petersen, Lars
2001-01-01
The boost topology is often the designer's first choice when dealing with PFC front-ends. This topology is well documented in the literature and has obvious advantages like continuous input current and low voltage- and current-stress compared to other PFC topologies. The PFC SEPIC converter also...
International Nuclear Information System (INIS)
Jiang Xue-Dong; Xu He; Wang Xin
2014-01-01
The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)
International Nuclear Information System (INIS)
Madjid, Syahrun Nur; Idris, Nasrullah; Kurniawan, Koo Hendrik; Kagawa, Kiichiro
2011-01-01
In laser processing, suitable conditions for laser and gas play important role in ensuring a high quality of processing. To determine suitable conditions, we employed the electromagnetic phenomena associated with laser plasma generation. An electrode circuit was utilised to detect induced current due to the fast electrons propelled from the material during laser material processing. The characteristics of induced current were examined by changing parameters such as supplied voltage, laser pulse energy, number of laser shots, and type of ambient gas. These characteristics were compared with the optical emission characteristics. It was shown that the induced current technique proposed in this study is much more sensitive than the optical method in monitoring laser processing, that is to determine the precise focusing condition, and to accurately determine the moment of completion of laser beam penetration. In this study it was also shown that the induced current technique induced by CW CO 2 laser can be applied in industrial material processing for monitoring the penetration completion in a stainless steel plate drilling process.
Usak, P
2003-01-01
The measurement of the current-voltage (I-V) characteristics of BSCCO-2223/Ag multifilamentary tapes in a silver matrix has been performed on short samples (of several centimetres) as well as on long tape (1 m), wound in the form of a helical one-layer coil. Measurements at 77 K and in zero external magnetic field have revealed good reproducibility of the I-V hysteresis in most runs. Nevertheless, strange irregularities have sometimes been observed in the I-V curve behaviour during current ramping up and down. Quasi-reproducible drops from the ascending hysteretic branch in the direction of the descending one have been measured at higher voltage levels (approx 1 mV cm sup - sup 1) on the curve measured on the helical coil. These have recently been explained by a sudden change in the heat transfer coefficient [1]. Rarely and non-reproducibly we have also observed these drops on short samples at E approx 1 x 10 sup - sup 2 V m sup - sup 1 , (and even under 1 x 10 sup - sup 3 V m sup - sup 1). The accidental dro...
MOS Capacitance—Voltage Characteristics III. Trapping Capacitance from 2-Charge-State Impurities
International Nuclear Information System (INIS)
Jie Binbin; Sah Chihtang
2011-01-01
Low-frequency and high-frequency capacitance—voltage curves of Metal—Oxide—Semiconductor Capacitors are presented to illustrate giant electron and hole trapping capacitances at many simultaneously present two-charge-state and one-trapped-carrier, or one-energy-level impurity species. Models described include a donor electron trap and an acceptor hole trap, both donors, both acceptors, both shallow energy levels, both deep, one shallow and one deep, and the identical donor and acceptor. Device and material parameters are selected to simulate chemically and physically realizable capacitors for fundamental trapping parameter characterizations and for electrical and optical signal processing applications. (invited papers)
Sani, A.; Siahaan, S.; Mubarakah, N.; Suherman
2018-02-01
Supercapacitor is a new device of energy storage, which has much difference between ordinary capacitors and batteries. Supercapacitor have higher capacitance and energy density than regular capacitors. The supercapacitor also has a fast charging time, as well as a long life. To be used as a battery replacement please note the internal parameters of the battery to be replaced. In this paper conducted a simulation study to utilize supercapacitor as a replacement battery. The internal parameters of the battery and the supercapacitor are obtained based on the characteristics of charging and discharging current using a predefined equivalent circuit model. The battery to be replaced is a 12-volt lead-acid type, 6.5 Ah which is used on motorcycles with 6A charging and discharging currents. Super capacitor replacement capacitor is a capacity of 1600F, 2.7V which is connected in series as many as 6 pieces with 16.2 volt terminal voltage and charging current 12A. To obtain the same supercapacitor characteristic as the battery characteristic to be replaced, modification of its internal parameters is made. The results show that the super-capacitor can replace the battery function for 1000 seconds.
Device for monitoring cell voltage
Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE
2012-08-21
A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.
Degtiarenko, Pavel V [Williamsburg, VA; Popov, Vladimir E [Newport News, VA
2011-03-22
A first stage electronic system for receiving charge or current from voltage-controlled sensors or detectors that includes a low input impedance current receiver/converter device (for example, a transimpedance amplifier), which is directly coupled to the sensor output, a source of bias voltage, and the device's power supply (or supplies), which use the biased voltage point as a baseline.
Energy Technology Data Exchange (ETDEWEB)
Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.
2016-01-01
Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
J. W. Horng
2010-12-01
Full Text Available A voltage-mode high input impedance first-order highpass, lowpass and allpass filters using two differential voltage current conveyors (DVCCs, one grounded capacitor and one grounded resistor is presented. The highpass, lowpass and allpass signals can be obtained simultaneously from the circuit configuration. The suggested filter uses a canonical number of passive components without requiring any component matching condition. The simulation results confirm the theoretical analysis.
DEFF Research Database (Denmark)
Liu, Hui; Ma, Ke; Loh, Poh Chiang
2015-01-01
There are several problems in the Modular Multilevel Converter (MMC), such as the appearance of circulating current, capacitor voltage unbalance and the requirement for a high number of sensors. All these problems will decrease the reliability and raise the cost/uncertainty of using MMC solutions....... As a result, a sensorless control method is proposed in this paper, which targets to improve the performances of MMC in respect to the above mentioned disadvantages: To decrease the cost and simplify the physical implementation, a state observer is proposed and designed to estimate both the capacitor voltages...... and the circulating currents in order to replace the high numbers of sensors. Furthermore, a control method combining the circulating current suppression and the capacitor voltage balancing is conducted based on the proposed state observer. It is concluded that the proposed state observer and control method can...
International Nuclear Information System (INIS)
Povzner, A.A.; Volkov, A.G.
2017-01-01
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Energy Technology Data Exchange (ETDEWEB)
Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru
2017-06-15
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Optimal condition of memristance enhancement circuit using external voltage source
Directory of Open Access Journals (Sweden)
Hiroya Tanaka
2014-05-01
Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.
DEFF Research Database (Denmark)
Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez
2016-01-01
This paper describes a theoretical with experiment study on a control strategy for the parallel operation of threephase voltage source inverters (VSI), to be applied to uninterruptible power systems (UPS). A circulating current suppression strategy for parallel VSIs is proposed in this paper based...... on circulating current control loops used to modify the reference currents by compensating the error currents among parallel inverters. Both of the cross and zero-sequence circulating currents are considered. The proposed method is coordinated together with droop and virtual impedance control. In this paper......, droop control is used to generate the reference voltage of each inverter, and the virtual impedance is used to fix the output impedance of the inverters. In addition, a secondary control is used in order to recover the voltage deviation caused by the virtual impedance. And the auxiliary current control...
Schneider, A. V.; Popov, S. A.; Batrakov, A. V.; Dubrovskaya, E. L.; Lavrinovich, V. A.
2017-12-01
Vacuum-gap breakdown has been studied after high-current arc interruption with a subsequent increase in the transient recovery voltage across a gap. The effects of factors, such as the rate of the rise in the transient voltage, the potential of the shield that surrounds a discharge gap, and the arc burning time, have been determined. It has been revealed that opening the contacts earlier leads to the formation of an anode spot, which is the source of electrode material vapors into the discharge gap after current zero moment. Under the conditions of increasing voltage, this fact results in the breakdown. Too late opening leads to the breakdown of a short gap due to the high electric fields.
Low Noise Bias Current/Voltage References Based on Floating-Gate MOS Transistors
DEFF Research Database (Denmark)
Igor, Mucha
1997-01-01
The exploitation of floating-gate MOS transistors as reference current and voltage sources is investigated. Test structures of common source and common drain floating-gate devices have been implemented in a commercially available 0.8 micron double-poly CMOS process. The measurements performed...
Lüpke, Felix; Cuma, David; Korte, Stefan; Cherepanov, Vasily; Voigtländer, Bert
2018-02-01
We present a four-point probe resistance measurement technique which uses four equivalent current measuring units, resulting in minimal hardware requirements and corresponding sources of noise. Local sample potentials are measured by a software feedback loop which adjusts the corresponding tip voltage such that no current flows to the sample. The resulting tip voltage is then equivalent to the sample potential at the tip position. We implement this measurement method into a multi-tip scanning tunneling microscope setup such that potentials can also be measured in tunneling contact, allowing in principle truly non-invasive four-probe measurements. The resulting measurement capabilities are demonstrated for \
Kühnel, R-S; Reber, D; Remhof, A; Figi, R; Bleiner, D; Battaglia, C
2016-08-16
The extended electrochemical stability window offered by highly concentrated electrolytes allows the operation of aqueous batteries at voltages significantly above the thermodynamic stability limit of water, at which the stability of the current collector potentially limits the cell voltage. Here we report the observation of suppressed anodic dissolution of aluminum in "water-in-salt" electrolytes enabling roll-to-roll electrode fabrication for high-voltage aqueous lithium-ion batteries on cost-effective light-weight aluminum current collectors using established lithium-ion battery technology.
Energy Technology Data Exchange (ETDEWEB)
Liu Zhongqi [Department of Electronic Engineering, Tsinghua University, Beijing 100084 (China); Zhang Chun; Li Yongming; Wang Zhihua, E-mail: liu-zq04@mails.tsinghua.edu.c [Institute of Microelectronics, Tsinghua University, Beijing 100084 (China)
2010-06-15
This paper presents a current-mode voltage regulator for a passive UHF RFID transponder. The passive tag power is extracted from RF energy through the RF-to-DC rectifier. Due to huge variations of the incoming RF power, the rectifier output voltage should be regulated to achieve a stable power supply. By accurately controlling the current flowing into the load with an embedded sub-threshold reference, the regulated voltage varies in a range of 1-1.3 V from -20 to 80 {sup 0}C, and a bandwidth of about 100 kHz is achieved for a fast power recovery. The circuit is fabricated in UMC 0.18 {mu}m mixed-mode CMOS technology, and the current consumption is only 1 {mu}A. (semiconductor integrated circuits)
International Nuclear Information System (INIS)
Liu Zhongqi; Zhang Chun; Li Yongming; Wang Zhihua
2010-01-01
This paper presents a current-mode voltage regulator for a passive UHF RFID transponder. The passive tag power is extracted from RF energy through the RF-to-DC rectifier. Due to huge variations of the incoming RF power, the rectifier output voltage should be regulated to achieve a stable power supply. By accurately controlling the current flowing into the load with an embedded sub-threshold reference, the regulated voltage varies in a range of 1-1.3 V from -20 to 80 0 C, and a bandwidth of about 100 kHz is achieved for a fast power recovery. The circuit is fabricated in UMC 0.18 μm mixed-mode CMOS technology, and the current consumption is only 1 μA. (semiconductor integrated circuits)
Accurate characterization of organic thin film transistors in the presence of gate leakage current
Directory of Open Access Journals (Sweden)
Vinay K. Singh
2011-12-01
Full Text Available The presence of gate leakage through polymer dielectric in organic thin film transistors (OTFT prevents accurate estimation of transistor characteristics especially in subthreshold regime. To mitigate the impact of gate leakage on transfer characteristics and allow accurate estimation of mobility, subthreshold slope and on/off current ratio, a measurement technique involving simultaneous sweep of both gate and drain voltages is proposed. Two dimensional numerical device simulation is used to illustrate the validity of the proposed technique. Experimental results obtained with Pentacene/PMMA OTFT with significant gate leakage show a low on/off current ratio of ∼ 102 and subthreshold is 10 V/decade obtained using conventional measurement technique. The proposed technique reveals that channel on/off current ratio is more than two orders of magnitude higher at ∼104 and subthreshold slope is 4.5 V/decade.
Mechanism of Estradiol-Induced Block of Voltage-Gated K+ Currents in Rat Medial Preoptic Neurons
Druzin, Michael; Malinina, Evgenya; Grimsholm, Ola; Johansson, Staffan
2011-01-01
The present study was conducted to characterize possible rapid effects of 17-β-estradiol on voltage-gated K+ channels in preoptic neurons and, in particular, to identify the mechanisms by which 17-β-estradiol affects the K+ channels. Whole-cell currents from dissociated rat preoptic neurons were studied by perforated-patch recording. 17-β-estradiol rapidly (within seconds) and reversibly reduced the K+ currents, showing an EC50 value of 9.7 µM. The effect was slightly voltage dependent, but independent of external Ca2+, and not sensitive to an estrogen-receptor blocker. Although 17-α-estradiol also significantly reduced the K+ currents, membrane-impermeant forms of estradiol did not reduce the K+ currents and other estrogens, testosterone and cholesterol were considerably less effective. The reduction induced by estradiol was overlapping with that of the KV-2-channel blocker r-stromatoxin-1. The time course of K+ current in 17-β-estradiol, with a time-dependent inhibition and a slight dependence on external K+, suggested an open-channel block mechanism. The properties of block were predicted from a computational model where 17-β-estradiol binds to open K+ channels. It was concluded that 17-β-estradiol rapidly reduces voltage-gated K+ currents in a way consistent with an open-channel block mechanism. This suggests a new mechanism for steroid action on ion channels. PMID:21625454
Effect of high-voltage impulse current on the structure and function of rabbit heart
Directory of Open Access Journals (Sweden)
Xin-ping XU
2011-06-01
Full Text Available Objective To explore the effect of high-voltage impulse current(HVIC on the structure and function of rabbit heart.Methods Sixty healthy male rabbits were involved in present study and divided into 6 groups randomly(n=10.The rabbits were then shocked using a high-voltage pulse generator with current intensity of 0,50,100,150,250 and 500mA(pulse width 100μs,duration 5s respectively.The heart rate and electrocardiogram(ECG of rabbits were detected before and 0,1,3,7,14 and 28 days after the electric shock.Moreover,the myocardial tissue of rabbits was obtained immediately and 28 days after shock to observe the pathological changes.Results Immediately after electric shock of 50 to 500mA,the heart rate of rabbit increased by different degree,and the ECG showed arrhythmia,myocardial ischemia,atrial fibrillation and atrioventricular block,and the changes recovered gradually one day later.The pathological observation showed cell swelling,separation of myofibril and sarcoplasmic condensation of Purkinje fibers immediately after electric shock of 50 to 500mA,and the changes recovered 28 days after shock.The cardiac injuries aggravated with the increasing of current intensity,especially when it exceeded 150mA,and the recovery time prolonged.Conclusion High-voltage impulse current may induce recoverable injuries on heart structure and function,and the damage effect shows a correlation with the current intensity.
DEFF Research Database (Denmark)
Wei, Baoze; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez
2017-01-01
This paper presents a theoretical study with experimental validation of a circulating-current suppression method for parallel operation of three-phase voltage source inverters (VSI), which may be suitable for modular parallel uninterruptible power supply systems or hybrid AC/DC microgrid applicat......This paper presents a theoretical study with experimental validation of a circulating-current suppression method for parallel operation of three-phase voltage source inverters (VSI), which may be suitable for modular parallel uninterruptible power supply systems or hybrid AC/DC microgrid......, and added into the conventional droop plus virtual impedance control. In the control architecture, the reference voltages of the inverters are generated by the primary control loop which consists of a droop control and a virtual impedance. The secondary control is used to compensate the voltage drop...
Energy Technology Data Exchange (ETDEWEB)
Yang, De-Zheng; Wang, Wen-Chun; Zhang, Shuai; Tang, Kai; Liu, Zhi-jie; Wang, Sen [Key Lab of Materials Modification, Dalian University of Technology, Ministry of Education, Dalian 116024 (China)
2013-05-13
Room temperature homogenous dielectric barrier discharge plasma with high instantaneous energy efficiency is acquired by using nanosecond pulse voltage with 20-200 ns tunable pulse width. Increasing the voltage pulse width can lead to the generation of regular and stable multiple current peaks in each discharge sequence. When the voltage pulse width is 200 ns, more than 5 organized current peaks can be observed under 26 kV peak voltage. Investigation also shows that the organized multiple current peaks only appear in homogenous discharge mode. When the discharge is filament mode, organized multiple current peaks are replaced by chaotic filament current peaks.
Simultaneous fabrication of nanogap electrodes using field-emission-induced electromigration
International Nuclear Information System (INIS)
Ito, Mitsuki; Yagi, Mamiko; Morihara, Kohei; Shirakashi, Jun-ichi
2015-01-01
We present a simple technique for simultaneous control of the electrical properties of multiple Ni nanogaps. This technique is based on electromigration induced by a field emission current and is called “activation.” Simultaneous tuning of the tunnel resistance of multiple nanogaps was achieved by passing a Fowler–Nordheim (F-N) field emission current through an initial group of three Ni nanogaps connected in series. The Ni nanogaps, which had asymmetrical shapes with initial gap separations in the 80–110-nm range, were fabricated by electron-beam lithography and a lift-off process. By performing the activation procedure, the current–voltage properties of the series-connected nanogaps were varied simultaneously from “insulating” to “metallic” via “tunneling” properties by increasing the preset current of the activation procedure. We can also simultaneously control the tunnel resistances of the series-connected nanogaps, which range from a resistance of the order of 100 TΩ–100 kΩ, by increasing the preset current from 1 nA to 30 μA. This tendency is quite similar to that of individually activated nanogaps, and the tunnel resistance values of the simultaneously activated nanogaps were almost the same at each preset current. These results clearly imply that the electrical properties of the series-connected nanogaps can be controlled simultaneously via the activation procedure
A dynamic Monte Carlo study of anomalous current voltage behaviour in organic solar cells
International Nuclear Information System (INIS)
Feron, K.; Fell, C. J.; Zhou, X.; Belcher, W. J.; Dastoor, P. C.
2014-01-01
We present a dynamic Monte Carlo (DMC) study of s-shaped current-voltage (I-V) behaviour in organic solar cells. This anomalous behaviour causes a substantial decrease in fill factor and thus power conversion efficiency. We show that this s-shaped behaviour is induced by charge traps that are located at the electrode interface rather than in the bulk of the active layer, and that the anomaly becomes more pronounced with increasing trap depth or density. Furthermore, the s-shape anomaly is correlated with interface recombination, but not bulk recombination, thus highlighting the importance of controlling the electrode interface. While thermal annealing is known to remove the s-shape anomaly, the reason has been not clear, since these treatments induce multiple simultaneous changes to the organic solar cell structure. The DMC modelling indicates that it is the removal of aluminium clusters at the electrode, which act as charge traps, that removes the anomalous I-V behaviour. Finally, this work shows that the s-shape becomes less pronounced with increasing electron-hole recombination rate; suggesting that efficient organic photovoltaic material systems are more susceptible to these electrode interface effects
Energy Technology Data Exchange (ETDEWEB)
Pettersson, S.
2009-07-01
During the past two decades, active power filters have increasingly grown their popularity as a viable method for improving electric power quality. The main reasons for this have been the advent of fast self-commutating solid-state devices, the progression of digital technology and the improved sensor technology. Four-wire active power filters provide an efficient solution for improving the quality of supply in grounded three-phase systems or three-phase systems with neutral conductors, which are commonly used for powering residential, office and public buildings. Four-wire active power filters are applicable in compensating current harmonics, reactive power, neutral current and load phase imbalance.This thesis presents a comparative study of microcontroller controlled four-wire voltage and current source shunt active power filters. The study includes two voltage source topologies and a current source topology with two different dc-link energy storage structures, which are compared on the basis of their filtering properties, filtering performance and efficiency. The obtained results are used for determining the suitability of current source technology for four-wire active power filtering and finding the most viable four-wire shunt active power filter topology. One commonly recognized disadvantage of the current source active power filter has always been the bulky dc-link inductor. To reduce the size of the dc-link inductor, an alternative dc-link structure for current source active power filters was introduced in the late 80's. The hybrid energy storage consists of both inductive and capacitive energy storage elements, two diodes and two controllable semiconductor switching devices. Since the capacitive element is used as a main storage unit, the inductance of the dc-link inductor can be considerably reduced. However, the original dc current control method proposed is not able to utilize the full potential of the hybrid energy storage and the inductance
Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.
Dharia, Sameera; Rabbitt, Richard D
2010-01-01
Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.
Monitoring of the submerged arc welding process using current and voltage transducers
International Nuclear Information System (INIS)
Barrera, G.; Velez, M.; Espinosa, M.A.; Santos, O.; Barrera, E.; Gomez, G.
1996-01-01
Welding by fusion is one of the most used techniques to join materials in the manufacture industry. given the increase in applications of this welding process and the demand of more quality in the welding deposits, these welding processes are good candidates for the improvement of their instrumentation and control. Any improvement in the control technique will have a positive effect in the quality and productivity of the welding process. Some of the most significant variables in the submerged arc welding process are: current, voltage and torch speed. For the instrumentation of this research work, two transducers were designed, one for CD current monitoring and one for CD voltage monitoring of the welding machine. The design of both transducers includes an isolation amplifier. Graphical programming and the concept of virtual instrumentation were the main tools used for the design of the data acquisition system and the signal processing task. (Author) 9 refs
Shah, M. A. H.; Khan, M. K. R.; Tanveer Karim, A. M. M.; Rahman, M. M.; Kamruzzaman, M.
2018-01-01
Heterojunction diodes of n-ZnO/ p-Si (100) and n-ZnO:Al/ p-Si (100) were fabricated by spray pyrolysis technique. X-ray diffraction (XRD), energy dispersive x-ray spectroscopy (EDX), and field emission scanning electron microscopy (FESEM) were used to characterize the as-prepared samples. The XRD pattern indicates the hexagonal wurzite structure of zinc oxide (ZnO) and Al-doped ZnO (AZO) thin films grown on Si (100) substrate. The compositional analysis by EDX indicates the presence of Al in the AZO structure. The FESEM image indicates the smooth and compact surface of the heterostructures. The current-voltage characteristics of the heterojunction confirm the rectifying diode behavior at different temperatures and illumination intensities. For low forward bias voltage, the ideality factors were determined to be 1.24 and 1.38 for un-doped and Al-doped heterostructures at room temperature (RT), respectively, which indicates the good diode characteristics. The capacitance-voltage response of the heterojunctions was studied for different oscillation frequencies. From the 1/ C 2- V plot, the junction built-in potentials were found 0.30 V and 0.40 V for un-doped and Al-doped junctions at RT, respectively. The differences in built-in potential for different heterojunctions indicate the different interface state densities of the junctions. From the RT photoluminescence (PL) spectrum of the n-ZnO/ p-Si (100) heterostructure, an intense main peak at near band edge (NBE) 378 nm (3.28 eV) and weak deep-level emissions (DLE) centered at 436 nm (2.84 eV) and 412 nm (3.00 eV) were observed. The NBE emission is attributed to the radiative recombination of the free and bound excitons and the DLE results from the radiative recombination through deep level defects.
Kikta, Thomas J.; Mitchell, Ronald D.
1992-01-01
A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.
Yuan, Jiaxin; Zhou, Hang; Gan, Pengcheng; Zhong, Yongheng; Gao, Yanhui; Muramatsu, Kazuhiro; Du, Zhiye; Chen, Baichao
2018-05-01
To develop mechanical circuit breaker in high voltage direct current (HVDC) system, a fault current limiter is required. Traditional method to limit DC fault current is to use superconducting technology or power electronic devices, which is quite difficult to be brought to practical use under high voltage circumstances. In this paper, a novel concept of high voltage DC transmission system fault current limiter (DCSFCL) based on saturable core was proposed. In the DCSFCL, the permanent magnets (PM) are added on both up and down side of the core to generate reverse magnetic flux that offset the magnetic flux generated by DC current and make the DC winding present a variable inductance to the DC system. In normal state, DCSFCL works as a smoothing reactor and its inductance is within the scope of the design requirements. When a fault occurs, the inductance of DCSFCL rises immediately and limits the steepness of the fault current. Magnetic field simulations were carried out, showing that compared with conventional smoothing reactor, DCSFCL can decrease the high steepness of DC fault current by 17% in less than 10ms, which verifies the feasibility and effectiveness of this method.
Supplementary High-Input Impedance Voltage-Mode Universal Biquadratic Filter Using DVCCs
Directory of Open Access Journals (Sweden)
Jitendra Mohan
2012-01-01
Full Text Available To further extend the existing knowledge on voltage-mode universal biquadratic filter, in this paper, a new biquadratic filter circuit with single input and multiple outputs is proposed, employing three differential voltage current conveyors (DVCCs, three resistors, and two grounded capacitors. The proposed circuit realizes all the standard filter functions, that is, high-pass, band-pass, low-pass, notch, and all-pass filters simultaneously. The circuit enjoys the feature of high-input impedance, orthogonal control of resonance angular frequency (o, and quality factor (Q via grounded resistor and the use of grounded capacitors which is ideal for IC implementation.
Electrooptic Methods for Measurement of Small DC Currents at High Voltage Level
DEFF Research Database (Denmark)
Tønnesen, Ole; Beatty, Neville; Skilbreid, Asbjørn Ottar
1989-01-01
collectors are connected via resistors RA and RB to the protective side of the voltage to be measured and the emitters to the negative side. The currents flowing in to the bases of the transistors are independently controlled by the light levels following on the two photodiodes PDA, PDB....
Transient analysis for alternating over-current characteristics of HTSC power transmission cable
Lim, S. H.; Hwang, S. D.
2006-10-01
In this paper, the transient analysis for the alternating over-current distribution in case that the over-current was applied for a high-TC superconducting (HTSC) power transmission cable was performed. The transient analysis for the alternating over-current characteristics of HTSC power transmission cable with multi-layer is required to estimate the redistribution of the over-current between its conducting layers and to protect the cable system from the over-current in case that the quench in one or two layers of the HTSC power cable happens. For its transient analysis, the resistance generation of the conducting layers for the alternating over-current was reflected on its equivalent circuit, based on the resistance equation obtained by applying discrete Fourier transform (DFT) for the voltage and the current waveforms of the HTSC tape, which comprises each layer of the HTSC power transmission cable. It was confirmed through the numerical analysis on its equivalent circuit that after the current redistribution from the outermost layer into the inner layers first happened, the fast current redistribution between the inner layers developed as the amplitude of the alternating over-current increased.
A novel voltage clamp circuit for the measurement of transistor dynamic on-resistance
Gelagaev, R.; Jacqmaer, P.; Everts, J.; Driesen, Johan
2012-01-01
For determining the dynamic on-resistance Rdyn,on of a power transistor, the voltage and current waveforms have to be measured during the switching operation. In measurements of voltage waveforms, using an oscilloscope, the characteristics of an amplifier inside the oscilloscope are distorted when
2010-01-01
... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Suggested Instrumentation for Current Monitoring Device and High Voltage Facility 1 Figures 1 and 2 to Part 1204 Commercial Practices CONSUMER... Instrumentation for Current Monitoring Device and High Voltage Facility EC03OC91.008 ...
DEFF Research Database (Denmark)
Wickramasinghe, Harith R.; Konstantinou, Georgios; Pou, Josep
2018-01-01
Estimation-based indirect dc-voltage control in MMCs interacts with circulating current control methods. This paper proposes an estimation-based indirect dc-voltage control method for MMC-HVDC systems and analyzes its performance compared to alternative estimations. The interactions between......-state and transient performance is demonstrated using a benchmark MMC-HVDC transmission system, implemented in a real-time digital simulator. The results verify the theoretical evaluations and illustrate the operation and performance of the proposed indirect dc-voltage control method....
The performance of Dutch photovoltaic inverters in areas with low grid voltage. A preliminary study
International Nuclear Information System (INIS)
Van Twisk, J.; Van der Borg, N.J.C.M.; Groeman, J.F.
2000-08-01
An important component of grid-connected photovoltaic (PV) systems is the inverter. The inverter must be suitable for the expected characteristics of the input of the photovoltaic panels and for the expected characteristics of the output of the electricity network. The characteristics of the electric grid in potential markets for Dutch inverter manufacturers can differ from the characteristics of Dutch electric grids. A preliminary study has been carried out to determine the characteristics of relevant power distribution systems and the expected effects of those networks on PV-inverters. It is concluded that the following characteristics need further study: voltage level (nominal voltage and long-lasting deviations of that level); transient overvoltages, harmonic components in the voltage, and direct current component. 5 refs
Low-Cost Open-Source Voltage and Current Monitor for Gas Metal Arc Weld 3D Printing
Directory of Open Access Journals (Sweden)
A. Pinar
2015-01-01
Full Text Available Arduino open-source microcontrollers are well known in sensor applications for scientific equipment and for controlling RepRap 3D printers. Recently low-cost open-source gas metal arc weld (GMAW RepRap 3D printers have been developed. The entry-level welders used have minimal controls and therefore lack any real-time measurement of welder voltage or current. The preliminary work on process optimization of GMAW 3D printers requires a low-cost sensor and data logger system to measure welder current and voltage. This paper reports on the development of a low-cost open-source power measurement sensor system based on Arduino architecture. The sensor system was designed, built, and tested with two entry-level MIG welders. The full bill of materials and open source designs are provided. Voltage and current were measured while making stepwise adjustments to the manual voltage setting on the welder. Three conditions were tested while welding with steel and aluminum wire on steel substrates to assess the role of electrode material, shield gas, and welding velocity. The results showed that the open source sensor circuit performed as designed and could be constructed for <$100 in components representing a significant potential value through lateral scaling and replication in the 3D printing community.
Tampubolon, Marojahan; Pamungkas, Laskar; Hsieh, Yao Ching; Chiu, Huang Jen
2018-04-01
This paper presents the implementation of Constant Voltage (CV) and Constant Current (CC) control for a wireless charger system. A battery charging system needs these control modes to ensure the safety of the battery and the effectiveness of the charging system. Here, the wireless charger system does not employ any post-regulator stage to control the output voltage and output current of the charger. But, it uses a variable frequency control incorporated with a conventional PI control. As a result, the size and the weight of the system are reduced. This paper discusses the brief review of the SS-WPT, control strategy and implementation of the CV and CC control. Experimental hardware with 2kW output power has been performed and tested. The results show that the proposed CV and CC control method works well with the system.
International Nuclear Information System (INIS)
Li Bin; Wei Lan; Wen Cai
2014-01-01
This paper aims to simulate the I–V static characteristic of the enhancement-mode (E-mode) N-polar GaN metal—insulator—semiconductor field effect transistor (MISFET) with self-aligned source/drain regions. Firstly, with SILVACO TCAD device simulation, the drain—source current as a function of the gate—source voltage is calculated and the dependence of the drain—source current on the drain—source voltage in the case of different gate—source voltages for the device with a 0.62 μm gate length is investigated. Secondly, a comparison is made with the experimental report. Lastly, the transfer characteristic with different gate lengths and different buffer layers has been performed. The results show that the simulation is in accord with the experiment at the gate length of 0.62 μm and the short channel effect becomes pronounced as gate length decreases. The E-mode will not be held below a 100 nm gate length unless both transversal scaling and vertical scaling are being carried out simultaneously. (semiconductor devices)
Gu, Lei; Fu, Hua-Hua
2015-12-01
Current-induced forces can excite molecules, polymers and other low-dimensional materials, which in turn leads to an effective gate voltage through Holstein interaction. Here, by taking a short asymmetric DNA junction as an example, and using the Langevin approach, we find that when suppression of charge transport by the effective gate voltage surpasses the current increase from an elevated voltage bias, the current-voltage (I-V) curves display strong negative differential resistance (NDR) and perfect current-switching characteristics. The asymmetric DNA chain differs in mechanical stability under inverse voltages and the I-V curve is asymmetric about inverse biases, which can be used to understand recent transport experiments on DNA chains, and meanwhile provides a new strategy to realize NDR in molecular junctions and other low-dimensional quantum systems.
International Nuclear Information System (INIS)
Gu, Lei; Fu, Hua-Hua
2015-01-01
Current-induced forces can excite molecules, polymers and other low-dimensional materials, which in turn leads to an effective gate voltage through Holstein interaction. Here, by taking a short asymmetric DNA junction as an example, and using the Langevin approach, we find that when suppression of charge transport by the effective gate voltage surpasses the current increase from an elevated voltage bias, the current-voltage (I–V) curves display strong negative differential resistance (NDR) and perfect current-switching characteristics. The asymmetric DNA chain differs in mechanical stability under inverse voltages and the I–V curve is asymmetric about inverse biases, which can be used to understand recent transport experiments on DNA chains, and meanwhile provides a new strategy to realize NDR in molecular junctions and other low-dimensional quantum systems. (paper)
Modeling of Pulsed Direct-Current Glow Discharge
International Nuclear Information System (INIS)
Du Mu; Zheng Yaru; Fan Yujia; Zhang Nan; Liu Chengsen; Wang Dezhen
2010-01-01
A self-consistent model was adopted to study the time evolution of low-voltage pulsed DC glow discharge. The distributions of electric field, ion density and electron density in nitrogen were investigated in our simulation, and the temporal shape of the discharge current was also obtained. Our results show that the dynamic behaviors of the discharge depends strongly on the applied pulse voltage, and the use of higher pulse voltages results in a significantly increase of discharge current and a decrease of discharge delay time. The current-voltage characteristic calculated by adjusting secondary electron emission coefficient for different applied pulse voltage under the gas pressure of 1 Torr is found in a reasonable agreement with the experimental results.
International Nuclear Information System (INIS)
Vexler, M I
2006-01-01
The effect of a tunnel charge transport in the near-surface region of silicon on the electrical characteristics of MOS structures with a 2-3 nm insulator layer is studied theoretically. An equilibrium condition for the substrate is assumed. The cases of an Al and polySi gate are considered. The possibility of a 'double' (in Si and through SiO 2 ) tunnelling expands the energy range of transported particles, which increases one of the components of the total tunnel current. The proposed model allows for the improved simulation of gate current in MOSFETs, which is especially important for highly-doped substrates
International Nuclear Information System (INIS)
Romanovskii, V R; Watanabe, K
2006-01-01
The operating thermal and electric modes of a high-T c superconducting composite in partially and fully penetrated states induced by the charging current are investigated. They were studied under conditions in which the current charging rate, the volume fraction of the superconductor in a composite or the temperature of the cooling bath were changed. The transient behaviour of the voltage-current dependence, which is characteristic during stable and unstable increases in electric field inside the composite under a continuous current charging, is discussed. Simulations were done using zero- and one-dimensional steady and unsteady thermoelectric models with a power equation describing the virgin voltage-current characteristic of a superconductor. It is found that some thermoelectric trends underlie the shape of the voltage-current characteristic of the high-T c superconducting composite. These have to be considered during experiments in which the critical or quench currents are defined. First, in the initial stage of the fully penetrated regime (in the low voltage range), the electric field distribution does not have a uniform character. These states depend on the volume fraction of the superconductor and the current charging rate: the higher these quantities, the higher the heterogeneity of the electric field. Second, during the stable over-critical regime (in the high voltage range) occurring in complete penetration modes, the evolution of the electric field may depend on the relevant temperature increase of a composite according to the corresponding increase in its temperature-dependent heat capacity. Consequently, the shape of the voltage-current characteristic of a composite high-T c superconductor during continuous current charging, both before and after thermal runaway, has only a positive slope. Moreover, it is proved that the growth of the fully penetrated part of the voltage-current characteristic becomes less intensive when the current charging rate or the
Hirata, M.; Miyake, Y.; Cho, T.; Kohagura, J.; Numakura, T.; Shimizu, K.; Ito, M.; Kiminami, S.; Morimoto, N.; Hirai, K.; Yamagishi, T.; Miyata, Y.; Nakashima, Y.; Miyoshi, S.; Ogura, K.; Kondoh, T.; Kariya, T.
2006-10-01
For the purpose of end-loss-ion and -electron analyses in open-field plasmas, a compact-sized electrostatic end-loss-current detector is proposed on the basis of a self-collection principle for suppressing the effects of secondary-electron emission from a metal collector. For employing this specific method, it is worth noting that no further additional magnetic systems except the ambient open-ended magnetic fields are required in the detector operation. This characteristic property provides a compactness of the total detection system and availability for its use in plasma confinement devices without disturbing plasma-confining magnetic fields. The detector consists of a set of parallel metal plates with respect to lines of ambient magnetic forces of a plasma device for analyzing incident ion currents along with a grid for shielding the collector against strays due to the metal-plate biasing. The characterization experiments are carried out by the use of a test-ion-beam line along with an additional use of a Helmholtz coil system for the formation of open magnetic fields similar to those in the GAMMA 10 end region. The applications of the developed end-loss-current detector in the GAMMA 10 plasma experiments are demonstrated under the conditions with simultaneous incidence of energetic electrons produced by electron-cyclotron heatings for end-loss-plugging potential formation.
DEFF Research Database (Denmark)
Zhu, Rongwu; Liserre, Marco; Chen, Zhe
2017-01-01
A zero-sequence circulating current (ZSCC) is typically generated among the multiparallel converters that share the common dc link and ac side without isolated transformers under the space vector modulation (SVM), due to the injected third-order zero-sequence voltage (ZSV). This paper analyzes SVM...... references and filter inductances. The simulation and experimental results based on the parallel converters clearly verify the effectiveness of the proposed control....
Directory of Open Access Journals (Sweden)
Majid Mehrasa
2016-10-01
Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.
Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band
International Nuclear Information System (INIS)
Fang Chao; Zhou Dongxiang; Gong Shuping
2010-01-01
A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.
Guest Editorial: Flexible Operation and Control for Medium Voltage Direct-Current (MVDC) Grid
DEFF Research Database (Denmark)
Li, Yong; Guerrero, Josep M.; Siano, Pierluigi
2017-01-01
We appreciate very much the support from the IET Power Electronics editorial board for this Special Issue on ‘Flexible Operation and Control for Medium Voltage Direct-Current (MVDC) Grid’. In this final version for publication, 15 papers have been selected for this Special Issue. Three papers...... relate to the topology of MVDC converter, four papers relate to the control of MVDC converter, four papers relate to the introduction of application fields of MVDC grid, and four papers relate to the semiconductor power device and drives towards the application in the medium- and high-voltage DC grid....
Simulation and analysis of transient over voltages due to capacitor banks switching
International Nuclear Information System (INIS)
Jadid, Sh.; Yazdanpanah, D.
2002-01-01
The switching of any capacitor bank produces over voltages. Transient overvoltage will always occur in the switching device, the switching of shunt capacitor bank has become the most common source of transient voltage on power systems. Transient over voltages due to switching the capacitor bands hurt not only to the capacitor banks, but also to other equipment, such as circuit breakers and transformers. Several methods are available for reducing energising transients. These devices include pre-insertion resistors, pre-insertion inductors,synchronous closing, and MOV arresters. However, not all are practical or economical. The other important problem is existence of capacitor banks in presence of harmonics.Capacitors do not produce harmonics;however,the addition of capacitors to the electrical system will change the frequency response characteristics of the system will change the frequency response characteristics of the system, and in some cases can result in magnification of the voltage and current distortion in the system. In other word in presence of harmonic-producing loads,the capacitors used for power factor correction,may cause parallel resonance with the system inductance, so they increase the total harmonic distortion of voltage and current waveforms
Effect of selected factors on the current flow and voltage loss at ...
African Journals Online (AJOL)
In this paper, laboratory scale study was conducted to investigate the current flow and voltage loss at the electrodes in the electrochemical treatment of a tropical laterite. Three different tests using calcium chloride (CC) as anolyte and sodium chloride (SC) as catholyte (NC); SC as anolyte and Phosphoric acid (PA) as ...
Y Tao, S.; Zhang, X. Z.; Cai, H. W.; Li, P.; Feng, Y.; Zhang, T. C.; Li, J.; Wang, W. S.; Zhang, X. K.
2017-12-01
The pulse current method for partial discharge detection is generally applied in type testing and other off-line tests of electrical equipment at delivery. After intensive analysis of the present situation and existing problems of partial discharge detection in switch cabinets, this paper designed the circuit principle and signal extraction method for partial discharge on-line detection based on a high-voltage presence indicating systems (VPIS), established a high voltage switch cabinet partial discharge on-line detection circuit based on the pulse current method, developed background software integrated with real-time monitoring, judging and analyzing functions, carried out a real discharge simulation test on a real-type partial discharge defect simulation platform of a 10KV switch cabinet, and verified the sensitivity and validity of the high-voltage switch cabinet partial discharge on-line monitoring device based on the pulse current method. The study presented in this paper is of great significance for switch cabinet maintenance and theoretical study on pulse current method on-line detection, and has provided a good implementation method for partial discharge on-line monitoring devices for 10KV distribution network equipment.
International Nuclear Information System (INIS)
Eslami, E.; Barjasteh, A.; Morshedian, N.
2015-01-01
In this work, we numerically compare the effect of a sinusoidal, triangular, and rectangular pulsed voltage profile on the calculated particle production, electric current, and gas voltage in a dielectric barrier discharge. The total argon gas pressure of 400 Pa, the distance between dielectrics of 5 mm, the dielectric thickness of 0.7 mm, and the temperature of T = 300 K were considered as input parameters. The different driving voltage pulse shapes (triangular, rectangular, and sinusoidal) are considered as applied voltage with a frequency of 7 kHz and an amplitude of 700 V peak to peak. It is shown that applying a rectangular voltage, as compared with a sinusoidal or triangle voltage, increases the current peak, while the peak width is decreased. Higher current density is related to high production of charged particles, which leads to the generation of some highly active species, such as Ar* (4s level), and Ar** (4p level) in the gap
Capacitance-voltage characteristics of quantum well structures
Moon, C R; Choe, B D
1999-01-01
The characteristics of the apparent carrier distribution (ACD) of quantum well (QW) structures are investigated using the self-consistent simulation and the capacitance-voltage (C-V) profiling techniques. The simulation results on the differential carrier distribution show that the change of position expectation value of two-dimensional electrons determines the full width at half maximum of 100 K ACD peaks when conduction band offset is DELTA E sub c = 160 meV and the QW width t sub w is greater than 120 A. The contribution of Debye averaging effects to the ACD peaks becomes important as t sub w and DELTA E sub c values decrease and the temperature is increased. The influence of Debye averaging effects on ACD peaks appears differently according to the location of each well in multiple QWs. These results indicate that the extraction of QW parameters from the C-V profile should be done with caution.
Research on lightning stroke model and characteristics of electronic transformer
Directory of Open Access Journals (Sweden)
Li Mu
2018-01-01
Full Text Available In order to improve the reliability of power supply, a large number of electronic voltage and current transformers are used in digital substations. In this paper, the mathematical model of the electronic transformer is analyzed firstly, and its circuit model is given. According to the difference of working characteristics between voltage transformer and current transformer, the circuit model of voltage type electronic transformer and current type electronic transformer is given respectively. By analyzing their broadband transmission characteristics, the accuracy of the model is verified, and their lightning analysis models are obtained.
The pulse-driven AC Josephson voltage normal; Das pulsgetriebene AC-Josephson-Spannungsnormal
Energy Technology Data Exchange (ETDEWEB)
Kieler, Oliver [Physikalisch-Technische Bundesanstalt (PTB), Braunschweig (Germany). Arbeitsgruppe 2.43 ' ' Josephson-Schaltungen' '
2016-09-15
In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.
International Nuclear Information System (INIS)
Ahmadeev, V.V.; Kost'yuchenko, S.V.; Kudryavtsev, N.N.; Kurkin, G.A.; Vasilyak, L.M.
1998-01-01
Electrical and optical characteristics of the dielectric-barrier discharge in the pressure range of 10-400 Torr were investigated experimentally, particular attention being paid to the discharge homogeneity and to the energy dissipation in the discharge volume. The discharge was driven by a high-voltage pulse generator producing nanosecond high-voltage pulses with an amplitude of 20-30 kV. Air, nitrogen, and helium were used as working gases. The discharge was found to be homogeneous within a wide range of gas pressure. A power density of up to 250 mW/cm 3 has been achieved. (J.U.)
Dual patch voltage clamp study of low membrane resistance astrocytes in situ.
Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min
2014-03-17
Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.
Luo, Li-Chuan; Bao, De-Chun; Yu, Wu-Qi; Zhang, Zhao-Hua; Ren, Tian-Ling
2016-01-01
It is meaningful to research the Triboelectric Nanogenerators (TENG), which can create electricity anywhere and anytime. There are many researches on the structures and materials of TENG to explain the phenomenon that the maximum voltage is stable and the current is increasing. The output voltage of the TENG is high about 180-400 V, and the output current is small about 39 μA, which the electronic devices directly integration of TENG with Li-ion batteries will result in huge energy loss due to the ultrahigh TENG impedance. A novel interface circuit with the high-voltage buck regulator for TENG is introduced firstly in this paper. The interface circuit can transfer the output signal of the TENG into the signal fit to a lithium ion battery. Through the circuit of the buck regulator, the average output voltage is about 4.0 V and the average output current is about 1.12 mA. Further, the reliability and availability for the lithium ion battery and the circuit are discussed. The interface circuit is simulated using the Cadence software and verified through PCB experiment. The buck regulator can achieve 75% efficiency for the High-Voltage TENG. This will lead to a research hot and industrialization applications.
Intrinsic current oscillations in an asymmetric triple-barrier resonant tunnelling diode
International Nuclear Information System (INIS)
Wójcik, P; Spisak, B J; Wołoszyn, M; Adamowski, J
2010-01-01
The electronic transport characteristics of an asymmetric triple-barrier resonant tunnelling diode are calculated by the time-dependent Wigner–Poisson method. The intrinsic current oscillations are found in two separate bias voltage ranges. The first one is located below the resonant current peak, and the second lies in the negative differential resistance region. We provide the explanation of the current density oscillations in these two separate bias voltage ranges based on the analysis of the self-consistent potential profiles and changes of electron density. We have shown that two different formation mechanisms are responsible for the current density oscillations in these two bias voltage ranges. In the bias voltage range below the resonant current peak in the current–voltage characteristics, the current density oscillations are caused by the coupling between quasi-bound states in the left and right quantum wells. On the other hand, the current density oscillations in the negative differential resistance region result from the coupling between quasi-bound states in the left quantum well and the quantum well formed in the region of the left contact
Hysteresis analysis of graphene transistor under repeated test and gate voltage stress
International Nuclear Information System (INIS)
Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang
2014-01-01
The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)
Discharge current characteristics as an 'electrical method' for glow discharge plasma diagnosis
International Nuclear Information System (INIS)
Toma, M.; Paraschivescu, Alina; Morminches, Anisoara
2001-01-01
In its simplest form, the glow discharge can be established by passing an electric current through gas between two electrodes. The gas and the electrodes are contained in an insulating envelope. In many technological applications, and not only, the plasma devices are often treated like a black box. There is a series of external parameters or control variables which can be adjusted to obtain a desired effect, namely, the operating voltage, gas pressure, gas nature, gas flow rate, magnetic field strength and magnetic field configuration, electric field geometry, interelectrode distance, and cathode characteristics. The discharge current can be controlled by each of the above control variables. The core idea of this work is the following: a lot of information about the phenomena from the discharge volume, at electrodes or at the discharge bounding wall surface, can be obtained knowing how the change of one of the control parameters influences the discharge current. The following regimes were analyzed: dark discharges (background ionization, saturation regime, Townsend regime, corona regime), glow discharge (the normal and abnormal discharge) and arc discharge (glow to arc transition, non-thermal arcs, thermal arcs). It was concluded that the nonlinearity in the shape of the discharge current characteristics as a function of an external control parameter, can be correlated with the elementary processes and the dynamics of different space charge structures generated in plasma devices. (authors)
Fast Coordinated Control of DFIG Wind Turbine Generators for Low and High Voltage Ride-Through
Directory of Open Access Journals (Sweden)
Yun Wang
2014-06-01
Full Text Available This paper presents a fast coordinated control scheme of the rotor side converter (RSC, the Direct Current (DC chopper and the grid side converter (GSC of doubly fed induction generator (DFIG wind turbine generators (WTGs to improve the low voltage ride through (LVRT and high voltage ride through (HVRT capability of the DFIG WTGs. The characteristics of DFIG WTGs under voltage sags and swells were studied focusing on the DFIG WTG stator flux and rotor voltages during the transient periods of grid voltage changes. The protection schemes of the rotor crowbar circuit and the DC chopper circuit were proposed considering the characteristics of the DFIG WTGs during voltage changes. The fast coordinated control of RSC and GSC were developed based on the characteristic analysis in order to realize efficient LVRT and HVRT of the DFIG WTGs. The proposed fast coordinated control schemes were verified by time domain simulations using Matlab-Simulink.
A maximum power point tracking for photovoltaic-SPE system using a maximum current controller
Energy Technology Data Exchange (ETDEWEB)
Muhida, Riza [Osaka Univ., Dept. of Physical Science, Toyonaka, Osaka (Japan); Osaka Univ., Dept. of Electrical Engineering, Suita, Osaka (Japan); Park, Minwon; Dakkak, Mohammed; Matsuura, Kenji [Osaka Univ., Dept. of Electrical Engineering, Suita, Osaka (Japan); Tsuyoshi, Akira; Michira, Masakazu [Kobe City College of Technology, Nishi-ku, Kobe (Japan)
2003-02-01
Processes to produce hydrogen from solar photovoltaic (PV)-powered water electrolysis using solid polymer electrolysis (SPE) are reported. An alternative control of maximum power point tracking (MPPT) in the PV-SPE system based on the maximum current searching methods has been designed and implemented. Based on the characteristics of voltage-current and theoretical analysis of SPE, it can be shown that the tracking of the maximum current output of DC-DC converter in SPE side will track the MPPT of photovoltaic panel simultaneously. This method uses a proportional integrator controller to control the duty factor of DC-DC converter with pulse-width modulator (PWM). The MPPT performance and hydrogen production performance of this method have been evaluated and discussed based on the results of the experiment. (Author)
Current-voltage relationship in the auroral particle acceleration region
Directory of Open Access Journals (Sweden)
M. Morooka
2004-11-01
Full Text Available The current-voltage relationship in the auroral particle acceleration region has been studied statistically by the Akebono (EXOS-D satellite in terms of the charge carriers of the upward field-aligned current. The Akebono satellite often observed field-aligned currents which were significantly larger than the model value predicted by Knight (1973. We compared the upward field-aligned current estimated by three different methods, and found that low-energy electrons often play an important role as additional current carriers, together with the high-energy primary electrons which are expected from Knight's relation. Such additional currents have been observed especially at high and middle altitudes of the particle acceleration region. Some particular features of electron distribution functions, such as "cylindrical distribution functions" and "electron conics", have often been observed coinciding with the additional currents. They indicated time variability of the particle acceleration region. Therefore, we have concluded that the low-energy electrons within the "forbidden" region of electron phase space in the stationary model often contribute to charge carriers of the current because of the rapid time variability of the particle acceleration region. "Cylindrical distribution functions" are expected to be found below the time-varying potential difference. We statistically examined the locations of "cylindrical distribution function", and found that their altitudes are related to the location where the additional currents have been observed. This result is consistent with the idea that the low-energy electrons can also carry significant current when the acceleration region changes in time.
International Nuclear Information System (INIS)
Lin, Yow-Jon; Jheng, Mei-Jyuan; Zeng, Jian-Jhou
2010-01-01
This study investigates the current density-voltage (J-V) characteristics of Au/n-type ZnO and Au/polyaniline (PANI)/n-type ZnO devices. ZnO films were prepared by the sol-gel method. For Au/n-type ZnO devices, native defects and impurities resident within the ZnO depletion region contribute to barrier thinning of, carrier hopping across, and tunneling through the Schottky barrier. This leads to the formation of nonalloyed ohmic contacts. However, rectifying junctions were formed on n-type ZnO by employing the simple technique of spin-coating PANI to act as the electron-blocking layer. Our present results suggest that the ZnO depletion region at the PANI/n-type ZnO interface is not the origin of the rectifying behavior of Au/PANI/n-type ZnO contact. In addition, the presence of the built-in potential of Au/PANI/n-type ZnO devices could result in the shift of the J-V curve toward negative voltage. Excellent agreement between simulated and measured data was obtained when the built-in potential was taken into account in the J-V relationship.
High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter
International Nuclear Information System (INIS)
Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.
1987-01-01
The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V
Dynamic response of HTS composite tapes to pulsed currents
International Nuclear Information System (INIS)
Meerovich, V; Sokolovsky, V; Prigozhin, L; Rozman, D
2006-01-01
Dynamic voltage-current characteristics of an HTS Ag/BiSCCO composite tape are studied both experimentally and theoretically. The tape is subjected to pulsed currents with different shapes and magnitudes and voltage traces are measured using the four-point method with different locations of potential taps on the sample surface. Clockwise and anticlockwise hysteresis loops are obtained for the same sample depending on the location of the potential taps. The dynamic characteristics deviate substantially from the DC characteristic, especially in the range of low voltages where a criterion for the critical current value is usually chosen (1-10 μV cm -1 ). The critical current determined from dynamic characteristics and its change with the pulse magnitude depend on the location of the potential taps and on the curve branch chosen for the critical current determination (ascending or descending). The theoretical analysis is based on a model of the magnetic flux diffusion into a composite tape for a superconductor described by the flux creep characteristic. Numerical simulation based on this model gives results in good agreement with the experimental ones and explains the observed peculiarities of the dynamic characteristics of HTS composite tapes. The difference between the magnetic diffusion into a tape and a slab is discussed
Energy Technology Data Exchange (ETDEWEB)
Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies
2008-04-09
This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.
A critique of current developments in simultaneous localization and mapping
Directory of Open Access Journals (Sweden)
Shoudong Huang
2016-10-01
Full Text Available The number of research publications dealing with the simultaneous localization and mapping problem has grown significantly over the past 15 years. Many fundamental and practical aspects of simultaneous localization and mapping have been addressed, and some efficient algorithms and practical solutions have been demonstrated. The aim of this paper is to provide a critical review of current theoretical understanding of the fundamental properties of the SLAM problem, such as observability, convergence, achievable accuracy and consistency. Recent research outcomes associated with these topics are briefly discussed together with potential future research directions.
Fabrication and current–voltage characteristics of NiOx/ZnO based MIIM tunnel diode
Energy Technology Data Exchange (ETDEWEB)
Singh, Aparajita, E-mail: asing044@fiu.edu [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174, United States of America (United States); Ratnadurai, Rudraskandan [Global Foundaries, Malta, New York 12020 (United States); Kumar, Rajesh [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Department of Physics, Panjab University, Chandigarh 160014 (India); Krishnan, Subramanian [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Emirov, Yusuf [Advanced Materials Engineering Research Institute, Florida International University, Miami, Florida 33174 (United States); Bhansali, Shekhar [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States)
2015-04-15
Highlights: • Fabrication of single and bilayer tunnel diodes by sputter deposition. • Current–voltage characteristics study. • Enhanced asymmetry and non-linearity. • Study of tunneling mechanism. - Abstract: Enhanced asymmetric and non-linear characteristics of Ni–NiOx based MIM diode has been reported by the addition of a second insulator layer ZnO to form MIIM configuration. These properties are required for applications like energy-harvesting devices, terahertz electronics, macro electronics, etc. In this work, single insulator layer Ni–NiOx–Cr and double insulator Ni–NiOx–ZnO–Cr tunnel diodes were fabricated and their I–V characteristics were studied. A significant increase by one order of magnitude in asymmetry has been observed in case of bilayer NiOx/ZnO dielectric configuration at low voltages. The sensitivity of the NiOx and NiOx/ZnO dielectric configuration in MIM stack was 11 V{sup −1} and 16 V{sup −1}. The improved performance of the bilayer insulator diode is due to the second insulator which enables resonant tunneling or step-tunneling. Resonant tunneling was found to be dominant through trap assisted tunneling in the NiOx/ZnO diode.
Investigation of leakage current and breakdown voltage in irradiated double-sided 3D silicon sensors
International Nuclear Information System (INIS)
Betta, G.-F. Dalla; Mendicino, R.; Povoli, M.; Sultan, D.M.S.; Ayllon, N.; Hoeferkamp, M.; McDuff, H.; Seidel, S.; Boscardin, M.; Zorzi, N.; Mattiazzo, S.
2016-01-01
We report on an experimental study aimed at gaining deeper insight into the leakage current and breakdown voltage of irradiated double-sided 3D silicon sensors from FBK, so as to improve both the design and the fabrication technology for use at future hadron colliders such as the High Luminosity LHC. Several 3D diode samples of different technologies and layout are considered, as well as several irradiations with different particle types. While the leakage current follows the expected linear trend with radiation fluence, the breakdown voltage is found to depend on both the bulk damage and the surface damage, and its values can vary significantly with sensor geometry and process details.
International Nuclear Information System (INIS)
Martin, M.
1991-01-01
Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance
Vessel eddy current characteristics in SST-1 tokamak
Energy Technology Data Exchange (ETDEWEB)
Jana, Subrata; Pradhan, Subrata, E-mail: pradhan@ipr.res.in; Dhongde, Jasraj; Masand, Harish
2016-11-15
Highlights: • Eddy current distribution in the SST-1 vacuum vessel. • Circuit model analysis of eddy current. • A comparison of the field lines with and without the plasma column in identical conditions. • The influence of eddy current in magnetic NULL dynamics. - Abstract: Eddy current distribution in the vacuum vessel of the Steady state superconducting (SST-1) tokamak has been determined from the experimental data obtained using an array of internal voltage loops (flux loop) installed inside the vacuum vessel. A simple circuit model has been employed. The model takes into account the geometric and constructional features of SST-1 vacuum vessel. SST-1 vacuum vessel is a modified ‘D’ shaped vessel having major axis of 1.285 m and minor axis of 0.81 m and has been manufactured from non-magnetic stainless steel. The Plasma facing components installed inside the vacuum vessel are graphite blocks mounted on Copper Chromium Zirconium (CuCrZr) heat sink plates on inconel supports. During discharge of the central solenoid, eddy currents get generated in the vacuum vessel and passive supports on it. These eddy currents influence the early magnetic NULL dynamics and plasma break-down and start-up characteristics. The computed results obtained from the model have been benchmarked against experimental data obtained in large number of SST-1 plasma shots. The results are in good agreement. Once bench marked, the calculated eddy current based on flux loop signal and circuit equation model has been extended to the reconstruction of the overall B- field contours of SST-1 tokamak in the vessel region. A comparison of the field lines with and without the plasma column in identical conditions of the central solenoid and equilibrium field profiles has also been done with an aim to quantify the diagnostics responses in vacuum shots.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Wondmagegn, Wudyalew T.
2011-04-01
The capacitance-voltage (C-V) characteristics of metal-insulator- semiconductor (MIS) capacitors consisting of pentacene as an organic semiconductor and parylene as the dielectric have been investigated by experimental, analytical, and numerical analysis. The device simulation was performed using two-dimensional drift-diffusion methods taking into account the Poole-Frenkel field-dependent mobility. Pentacene bulk defect states and fixed charge density at the semiconductor/insulator interface were incorporated into the simulation. The analysis examined pentacene/parylene interface characteristics for various parylene thicknesses. For each thickness, the corresponding flat band voltage extracted from the C-V plot of the MIS structure was more negative than - 2.4 V. From the flat band voltage the existence of a significant mismatch between the work functions of the gate electrode and pentacene active material has been identified. Experimental and simulation results suggest the existence of interface charge density on the order of 3 × 1011 q/cm2 at the insulator/semiconductor interface. The frequency dispersion characteristics of the device are also presented and discussed. © 2011 Elsevier B.V.
Directory of Open Access Journals (Sweden)
N.A. Kostin
2015-03-01
Full Text Available The paper proposes the non-canonical spectral decomposition of random functions of the traction voltages and currents. This decomposition is adapted for the electric transportation systems. The numerical representation is carried out for the random function of voltage on the pantograph of electric locomotives VL8 and DE1.
Voltage-Controlled Square/Triangular Wave Generator with Current Conveyors and Switching Diodes
Directory of Open Access Journals (Sweden)
Martin Janecek
2012-12-01
Full Text Available A novel relaxation oscillator based on integrating the diode-switched currents and Schmitt trigger is presented. It is derived from a known circuit with operational amplifiers where these active elements were replaced by current conveyors. The circuit employs only grounded resistances and capacitance and is suitable for high frequency square and triangular signal generation. Its frequency can be linearly and accurately controlled by voltage that is applied to a high-impedance input. Computer simulation with a model of a manufactured conveyor prototype verifies theoretic assumptions.
Energy Technology Data Exchange (ETDEWEB)
Su, Guo-Qiang; Wang, Yi-Bo; Song, Bai-Peng; Mu, Hai-Bao, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn; Zhang, Guan-Jun, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, School of Electrical Engineering, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Li, Feng; Wang, Meng [Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China)
2016-06-15
The luminescence evolution phenomena from alumina ceramic surface in vacuum under high voltage of direct and alternating current are reported, with the voltage covering a large range from far below to close to the flashover voltage. Its time resolved and spatial distributed behaviors are examined by a photon counting system and an electron-multiplying charge-coupled device (EMCCD) together with a digital camera, respectively. The luminescence before flashover exhibits two stages as voltage increasing, i.e., under a relative low voltage (Stage A), the luminescence is ascribed to radiative recombination of hetero-charges injected into the sample surface layer by Schottky effect; under a higher voltage (Stage B), a stable secondary electron emission process, resulting from the Fowler-Nordheim emission at the cathode triple junction (CTJ), is responsible for the luminescence. Spectrum analysis implies that inner secondary electrons within the surface layer of alumina generated during the SSEE process also participate in the luminescence of Stage B. A comprehensive interpretation of the flashover process is formulated, which might promote a better understanding of flashover issue in vacuum.
Directory of Open Access Journals (Sweden)
J. D. Nichols
2005-03-01
Full Text Available We consider the effect of field-aligned voltages on the magnetosphere-ionosphere coupling current system associated with the breakdown of rigid corotation of equatorial plasma in Jupiter's middle magnetosphere. Previous analyses have assumed perfect mapping of the electric field and flow along equipotential field lines between the equatorial plane and the ionosphere, whereas it has been shown that substantial field-aligned voltages must exist to drive the field-aligned currents associated with the main auroral oval. The effect of these field-aligned voltages is to decouple the flow of the equatorial and ionospheric plasma, such that their angular velocities are in general different from each other. In this paper we self-consistently include the field-aligned voltages in computing the plasma flows and currents in the system. A third order differential equation is derived for the ionospheric plasma angular velocity, and a power series solution obtained which reduces to previous solutions in the limit that the field-aligned voltage is small. Results are obtained to second order in the power series, and are compared to the original zeroth order results with no parallel voltage. We find that for system parameters appropriate to Jupiter the effect of the field-aligned voltages on the solutions is small, thus validating the results of previously-published analyses.
Verification of the short-circuit current making capability of high-voltage switching devices
Smeets, R.P.P.; Linden, van der W.A.
2001-01-01
Switching-in of short-circuit current leads to pre-arcing in the switching device. Pre-arcing affects the ability of switchgear to close and latch. In three-phase systems, making is associated with transient voltage phenomena that may have a significant impact on the duration of the pre-arcing
The humidity effect on the breakdown voltage characteristics and the transport parameters of air
International Nuclear Information System (INIS)
Radmilović-Radjenović, M.; Radjenović, B.; Nikitović, Ž.; Matejčik, Š.; Klas, M.
2012-01-01
This paper contains experimental results for the direct current (DC) breakdown voltages and calculated transport parameters for dry, synthetic and ambient air. The breakdown voltage curves for dry, ambient and synthetic air at the gap size of 100μm are very similar. The differences between them are much more pronounced at the interelectrode separation of 20μm, especially at the right hand branch of the breakdown voltage curves. On the other hand, the effective yields γ for dry and synthetic air are in disagreement at lower values of the E/p. Results of calculations based on the Two Term Approximation indicate that the humidity has no a great influence on the transport parameters at all range of the reduce field E/N.
Testing and analysis of tube voltage and tube current in the radiation generator for mammography
International Nuclear Information System (INIS)
Jung, Hong Ryang; Hong, Dong Hee; Han, Beom Hui
2014-01-01
Breast shooting performance management and quality control of the generator is applied to the amount of current IEC(International Electrotechnical Commission) 60601-2-45 tube voltage and tube current are based on standards that were proposed in the analysis of the test results were as follows. Tube voltage according to the value of the standard deviation by year of manufacture from 2001 to 2010 as a 42-3.15 showed the most significant, according to the year of manufacture by tube amperage value of the standard deviation to 6.38 in the pre-2000 showed the most significant , manufactured after 2011 the standard deviation of the devices, the PAE(Percent Average Error) was relatively low. This latest generation device was manufactured in the breast of the tube voltage and tube diagnosed shooting the correct amount of current to maintain the performance that can be seen. The results of this study as the basis for radiography diagnosed breast caused by using the device's performance and maintain quality control, so the current Food and Drug Administration 'about the safety of diagnostic radiation generator rule' specified in the test cycle during three years of self-inspection radiation on a radiation generating device ensure safety and performance of the device using a coherent X-ray(constancy) by two ultimately able to keep the radiation dose to the public to reduce the expected effect is expected
Functional model of a high-current high-voltage superconducting switches
International Nuclear Information System (INIS)
Menke, Kh.; Shishov, Yu.A.
1977-01-01
Considered are problems of superconducting switches (SS) for energy extraction from magnets at a current of several kiloamperes and a voltage of several kilovolts with a time for transition to the normal state of <0.5 ms. SS is made of a wire of 0.5 mm diameter containing 19 strands of Nb-Ti alloy of 65 μm diameter. The wire matrix was etched out, 19 wires of 4.5 m length were braided together. On each of three groups of wires a heater wire of constantan of 0.12 mm diameter and 6 m length was wound. A second heater intended for slow heating during current feeding into the magnet, is wound over the braid. The wires and heaters are parallel connected and impregnated by an epoxy compound. The following main parameters were obtained in SS testing: critical current of 920 A, resistance in the normal state of 2.5 Ohm, and minimum delay time of 0.2 ms at a nominal current of 0.8 of the critical one
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
International Nuclear Information System (INIS)
Fathizadeh, M.; Despe, O.D.; McGhee, D.G.; Mills, F.E.; Turner, L.R.
1991-01-01
This paper describes a high-voltage, high-current power supply for the injector synchrotron dipole magnets at APS. In order to reset the dipole magnets in each cycle two different current waveforms are suggested. The first current waveform consists of three sections, namely: dc-reset, linear ramp, and recovery sections where injection is done ''on the fly''. The second current waveform consists of six different sections, dc-reset, transition to injection level, injection flat level, parabolic, linear ramp and recovery sections. The effect of such waveforms on the beam is discussed and the power supply limitations to follow such waveforms are given. The power supply limitations are due to the power components and control loops. The reference for the current loop is generated by a DAC which is discussed
Research of Measurement Circuits for High Voltage Current Transformer Based on Rogowski Coils
Directory of Open Access Journals (Sweden)
Yan Bing
2014-02-01
Full Text Available The electronic current transformer plays an irreplaceable position in the field of relay protection and current measurement of the power system. Rogowski coils are used as sensor parts, and in order to improve the measurement accuracy and reliability, the circuits at the high voltage system are introduced and improved in this paper, including the analog integral element, the filtering circuit and the phase shift circuit. Simulations results proved the reliability and accuracy of the improved circuits.
High Order Voltage and Current Harmonic Mitigation Using the Modular Multilevel Converter STATCOM
Kontos, E.; Tsolaridis, Georgios; Teodorescu, Remus; Bauer, P.
2017-01-01
Due to the increase of power electronic-based loads, the maintenance of high power quality poses a challenge in modern power systems. To limit the total harmonic distortion in the line voltage and currents at the point of the common coupling (PCC), active power filters are commonly employed. This
DEFF Research Database (Denmark)
Zhu, Jiebei; Guerrero, Josep M.; Hung, William
2014-01-01
A generic Inertia Emulation Controller (INEC) scheme for Multi-Terminal Voltage-Source-Converter based HVDC (VSC-MTDC) systems is proposed and presented in this paper. The proposed INEC can be incorporated in any Grid-side Voltage-Source-Converter (GVSC) station, allowing the MTDC terminal...
Gandhi, Keyur K.; Nejim, Ahmed; Beliatis, Michail J.; Mills, Christopher A.; Henley, Simon J.; Silva, S. Ravi P.
2015-01-01
Rapid prototyping of photovoltaic (PV) cells requires a method for the simultaneous simulation of the optical and electrical characteristics of the device. The development of nanomaterial-enabled PV cells only increases the complexity of such simulations. Here, we use a commercial technology computer aided design (TCAD) software, Silvaco Atlas, to design and model plasmonic gold nanoparticles integrated in optoelectronic device models of thin-film amorphous silicon (a-Si:H) PV cells. Upon illumination with incident light, we simulate the optical and electrical properties of the cell simultaneously and use the simulation to produce current-voltage (J-V) and external quantum efficiency plots. Light trapping due to light scattering and localized surface plasmon resonance interactions by the nanoparticles has resulted in the enhancement of both the optical and electrical properties due to the reduction in the recombination rates in the photoactive layer. We show that the device performance of the modeled plasmonic a-Si:H PV cells depends significantly on the position and size of the gold nanoparticles, which leads to improvements either in optical properties only, or in both optical and electrical properties. The model provides a route to optimize the device architecture by simultaneously optimizing the optical and electrical characteristics, which leads to a detailed understanding of plasmonic PV cells from a design perspective and offers an advanced tool for rapid device prototyping.
A differential low-voltage high gain current-mode integrated RF receiver front-end
Energy Technology Data Exchange (ETDEWEB)
Wang Chunhua; Ma Minglin; Sun Jingru; Du Sichun; Guo Xiaorong; He Haizhen, E-mail: wch1227164@sina.com [School of Information Science and Technology, Hunan University, Changsha 410082 (China)
2011-02-15
A differential low-voltage high gain current-mode integrated RF front end for an 802.11b WLAN is proposed. It contains a differential transconductance low noise amplifier (G{sub m}-LNA) and a differential current-mode down converted mixer. The single terminal of the G{sub m}-LNA contains just one MOS transistor, two capacitors and two inductors. The gate-source shunt capacitors, C{sub x1} and C{sub x2}, can not only reduce the effects of gate-source C{sub gs} on resonance frequency and input-matching impedance, but they also enable the gate inductance L{sub g1,2} to be selected at a very small value. The current-mode mixer is composed of four switched current mirrors. Adjusting the ratio of the drain channel sizes of the switched current mirrors can increase the gain of the mixer and accordingly increase the gain of RF receiver front-end. The RF front-end operates under 1 V supply voltage. The receiver RFIC was fabricated using a chartered 0.18 {mu}m CMOS process. The integrated RF receiver front-end has a measured power conversion gain of 17.48 dB and an input referred third-order intercept point (IIP3) of -7.02 dBm. The total noise figure is 4.5 dB and the power is only 14 mW by post-simulations. (semiconductor integrated circuits)
High Current, Low Voltage Power Converter [20kA, 6V] LHC Converter Prototype
Jørgensen, H E; Dupaquier, A; Fernqvist, G
1998-01-01
The superconducting LHC accelerator requires high currents (~12.5kA) and relatively low voltages (~10 V) for its magnets. The need to install the power converters underground is the driving force for reduced volume and high efficiency. Moreover, the LHC machine will require a very high level of performance from the power converters, particularly in terms of DC stability, dynamic response and also in matters of EMC. To meet these requirements soft-switching techniques will be used. This paper describes the development of a [20kA,6V] power converter intended as a stable high-current source for D CCT calibration and an evaluation prototype for the future LHC converters. The converter is made with a modular concept with five current sources [4kA,6V] in parallel. The 4kA sources are built as plu g-in modules: a diode rectifier on the AC mains with a damped L-C passive filter, a Zero Voltage Switching inverter working at 20 kHz and an output stage (high frequency transformers, Schottky rectifi ers and output filter...
Voltage balancing strategies for serial connection of microbial fuel cells
Khaled, Firas; Ondel, Olivier; Allard, Bruno; Buret, François
2015-07-01
The microbial fuel cell (MFC) converts electrochemically organic matter into electricity by means of metabolisms of bacteria. The MFC power output is limited by low voltage and low current characteristics in the range of microwatts or milliwatts per litre. In order to produce a sufficient voltage level (>1.5 V) and sufficient power to supply real applications such as autonomous sensors, it is necessary to either scale-up one single unit or to connect multiple units together. Many topologies of connection are possible as the serial association to improve the output voltage, or the parallel connection to improve the output current or the series/parallel connection to step-up both voltage and current. The association of MFCs in series is a solution to increase the voltage to an acceptable value and to mutualize the unit's output power. The serial association of a large number of MFCs presents several issues. The first one is the hydraulic coupling among MFCs when they share the same substrate. The second one is the dispersion between generators that lead to a non-optimal stack efficiency because the maximum power point (MPP) operation of all MFCs is not permitted. Voltage balancing is a solution to compensate non-uniformities towards MPP. This paper presents solutions to improve the efficiency of a stack of serially connected MFCs through a voltage-balancing circuit. Contribution to the topical issue "Electrical Engineering Symposium (SGE 2014)", edited by Adel Razek
International Nuclear Information System (INIS)
Hilscher, A.
2002-01-01
A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)
Energy Technology Data Exchange (ETDEWEB)
Özerli, Halil; Karteri, İbrahim [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Karataş, Şükrü, E-mail: skaratas@ksu.edu.tr [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Department of Physics, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Altindal, Şemsettin [Department of Physics, Gazi University, 06100 Ankara (Turkey)
2014-05-01
Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I{sub 0}/T{sup 2}) versus (kT){sup −1} and ln(I{sub 0}/T{sup 2}) versus (nkT){sup −1} plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ{sub b0} versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ{sup ¯}{sub b0} = 1.071 eV and σ{sub 0} = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot.
International Nuclear Information System (INIS)
Özerli, Halil; Karteri, İbrahim; Karataş, Şükrü; Altindal, Şemsettin
2014-01-01
Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I 0 /T 2 ) versus (kT) −1 and ln(I 0 /T 2 ) versus (nkT) −1 plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ b0 versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ ¯ b0 = 1.071 eV and σ 0 = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot
Energy Technology Data Exchange (ETDEWEB)
Venter, A., E-mail: andre.venter@nmmu.ac.za [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Murape, D.M.; Botha, J.R. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Auret, F.D. [Department of Physics, University of the Pretoria, Lynnwood Road, Pretoria 0002 (South Africa)
2015-01-01
The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ{sub b} vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ{sub b,mean} assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact.
International Nuclear Information System (INIS)
Venter, A.; Murape, D.M.; Botha, J.R.; Auret, F.D.
2015-01-01
The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ b vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ b,mean assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact
Chen, Y.; Wang, J.; Wang, H. H.; Yang, L.; Chen, W.; Xu, Y. T.
2016-08-01
Double-fed induction generator (DFIG) is sensitive to the disturbances of grid, so the security and stability of the grid and the DFIG itself are under threat with the rapid increase of DFIG. Therefore, it is important to study dynamic response of the DFIG when voltage drop failure is happened in power system. In this paper, firstly, mathematical models and the control strategy about mechanical and electrical response processes is respectively introduced. Then through the analysis of response process, it is concluded that the dynamic response characteristics are related to voltage drop level, operating status of DFIG and control strategy adapted to rotor side. Last, the correctness of conclusion is validated by the simulation about mechanical and electrical response processes in different voltage levels drop and different DFIG output levels under DIgSILENT/PowerFactory software platform.
Design of shielded voltage divider for impulse voltage measurement
International Nuclear Information System (INIS)
Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.
1976-01-01
The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)
Quasiparticle current in superconductor-semiconductor-superconductor junctions
International Nuclear Information System (INIS)
Tartakovskij, A.V.; Fistul', M.V.
1988-01-01
It is shown that the quasiparticle current in a superconductor-semiconductor-superconductor junction may significantly increase as a result of resonant passage of the quasiparticle along particular trajectories from periodically situated localized centers. A prediction of the theory is that with increasing junction resistance there should be a change from an excessive current to a insufficient current on the current-voltage characteristics (at high voltages). The effect of transparency of the boundaries on resonance tunneling in such junctions is also investigated
[Development of residual voltage testing equipment].
Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng
2014-07-01
For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.
DEFF Research Database (Denmark)
Li, Zhongyu; Zhao, Rende; Xin, Zhen
2016-01-01
The Inrush Transient Current (ITC) in the output of the photovoltaic grid-connected inverters is usually generated when grid voltage sag occurs, which can trigger the protection of the grid-connected inverters, and even destroy the semiconductor switches. Then, the grid-connected inverters...
Directory of Open Access Journals (Sweden)
M. Č. Bošković
2016-06-01
Full Text Available This paper presents a comparison of voltage mode control (VMC and two current mode control (CMC methods of noninverting buck-boost converter. The converter control-to-output transfer function, line-to-output transfer function and the output impedance are obtained for all methods by averaging converter equations over one switching period and applying small-signal linearization. The obtained results are required for the design procedure of feedback compensator to keep a system stable and robust. A comparative study of VMC, peak current mode control (PCMC and dual-current mode control (DCMC is performed. Performance evaluation of the closed-loop system with obtained compensator between these methods is performed via numerical simulations.
Simulation of a perfect CVD diamond Schottky diode steep forward current–voltage characteristic
Energy Technology Data Exchange (ETDEWEB)
Kukushkin, V.A., E-mail: vakuk@appl.sci-nnov.ru [Institute of Applied Physics of the Russian Academy of Science, 46 Ulyanov St., 603950 Nizhny Novgorod (Russian Federation); Nizhny Novgorod State University named after N.I. Lobachevsky, 23 Gagarin pr., 603950 Nizhny Novgorod (Russian Federation)
2016-10-01
The kinetic equation approach to the simulation of the perfect CVD diamond Schottky diode current–voltage characteristic is considered. In result it is shown that the latter has a significantly steeper forward branch than that of perfect devices of such a type on usual semiconductors. It means that CVD diamond-based Schottky diodes have an important potential advantage over analogous devices on conventional materials.
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Murali, Swetha S; Napier, Ian A; Mohammadi, Sarasa A; Alewood, Paul F; Lewis, Richard J; Christie, MacDonald J
2015-03-01
Changes in ion channel function and expression are characteristic of neuropathic pain. Voltage-gated calcium channels (VGCCs) are integral for neurotransmission and membrane excitability, but relatively little is known about changes in their expression after nerve injury. In this study, we investigate whether peripheral nerve ligation is followed by changes in the density and proportion of high-voltage-activated (HVA) VGCC current subtypes in dorsal root ganglion (DRG) neurons, the contribution of presynaptic N-type calcium channels in evoked excitatory postsynaptic currents (EPSCs) recorded from dorsal horn neurons in the spinal cord, and the changes in expression of mRNA encoding VGCC subunits in DRG neurons. Using C57BL/6 mice [8- to 11-wk-old males (n = 91)] for partial sciatic nerve ligation or sham surgery, we performed whole cell patch-clamp recordings on isolated DRG neurons and dorsal horn neurons and measured the expression of all VGCC subunits with RT-PCR in DRG neurons. After nerve injury, the density of P/Q-type current was reduced overall in DRG neurons. There was an increase in the percentage of N-type and a decrease in that of P/Q-type current in medium- to large-diameter neurons. No changes were found in the contribution of presynaptic N-type calcium channels in evoked EPSCs recorded from dorsal horn neurons. The α2δ-1 subunit was upregulated by 1.7-fold and γ-3, γ-2, and β-4 subunits were all downregulated 1.7-fold in injured neurons compared with sham-operated neurons. This comprehensive characterization of HVA VGCC subtypes in mouse DRG neurons after nerve injury revealed changes in N- and P/Q-type current proportions only in medium- to large-diameter neurons. Copyright © 2015 the American Physiological Society.
Gayen, P K; Chatterjee, D; Goswami, S K
2016-05-01
In this paper, an enhanced low-voltage ride-through (LVRT) performance of a grid connected doubly fed induction generator (DFIG) has been presented with the usage of stator dynamic composite fault current limiter (SDCFCL). This protection circuit comprises of a suitable series resistor-inductor combination and parallel bidirectional semiconductor switch. The SDCFCL facilitates double benefits such as reduction of rotor induced open circuit voltage due to increased value of stator total inductance and concurrent increase of rotor impedance. Both effects will limit rotor circuit over current and over voltage situation more secured way in comparison to the conventional scheme like the dynamic rotor current limiter (RCL) during any type of fault situation. The proposed concept is validated through the simulation study of the grid integrated 2.0MW DFIG. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wang Qimin; Kim, Kwang Ho
2008-01-01
Chromium nitride (CrN) films were deposited on Si wafers by arc ion plating (AIP) at various negative bias voltages and several groups of N 2 /Ar gas flux ratios and chamber gas pressures. The authors systematically investigated the influence of negative bias voltage on the synthesis, composition, microstructure, and properties of the AIP CrN films. In this part (Part I), the investigations were mainly focused on the macroparticle distributions and film-growth characteristics. The results showed that macroparticle densities on the film surfaces decreased greatly by applying negative bias voltage, which can be affected by partial pressure of N 2 and Ar gases. From the statistical analysis of the experimental results, they proposed a new hybrid mechanism of ion bombardment and electrical repulsion. Also, the growth of the AIP CrN films was greatly altered by applying negative bias voltage. By increasing the bias voltage, the film surfaces became much smoother and the films evolved from apparent columnar microstructures to an equiaxed microstructure. The impinging high-energy Cr ions accelerated by negative bias voltages were deemed the inherent reason for the evolution of growth characteristics
Seidi, Shahram; Yamini, Yadollah; Rezazadeh, Maryam; Esrafili, Ali
2012-06-22
In the present work, for the first time a new set-up was presented for simultaneous extraction of acidic and basic drugs using a recent novel electrically-enhanced microextraction technique, termed electromembrane extraction at low voltages followed by high performance liquid chromatography with ultraviolet detection. Nalmefene (NAL) as a basic drug and diclofenac (DIC) as an acidic drug were extracted from 24 mL aqueous sample solutions at neutral pH into 10 μL of each acidified (HCl 50 mM) and basic (NaOH 50 mM) acceptor solution, respectively. Supported liquid membranes including 2-nitrophenyl octyl ether containing 5% di-(2-ethylhexyl) phosphate and 1-octanol were used to ensure efficient extraction of NAL and DIC, respectively. Low voltage of 40 V was applied over the SLMs during 14 min extraction time. The influences of fundamental parameters affecting the transport of target drugs were optimized using experimental design. Under optimal conditions, NAL and DIC were extracted with extraction recoveries of 12.5 and 14.6, respectively, which corresponded to preconcentration factors of 300 and 350, respectively. The proposed technique provided good linearity with correlation coefficient values higher than 0.9956 over a concentration range of 8-500 μg L⁻¹ and 12-500 μg L⁻¹ for NAL and DIC, respectively. Limits of detection and quantifications, and intra-day precisions (n=3) were less than 4 μg L⁻¹, 12 μg L⁻¹, and 10.1%, respectively. Extraction and determination of NAL and DIC in human urine samples were successfully performed. In light of the data obtained in the present work, this new set-up for EME with low voltages has a future potential as a simple, selective, and fast sample preparation technique for simultaneous extraction and determination of acidic and basic drugs in different complicated matrices. Copyright © 2012 Elsevier B.V. All rights reserved.
Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles
Directory of Open Access Journals (Sweden)
Yan Jiang
2013-06-01
Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.
DEFF Research Database (Denmark)
Mo, W.; Loh, Poh Chiang; Blaabjerg, Frede
2013-01-01
Z-source Neutral Point Clamped (NPC) inverters were introduced to integrate both the advantages of Z-source inverters and NPC inverters. However, traditional Z-source inverters suffer from high voltage stress and chopping input current. This paper proposes six types transformer-based impedance-so......-source NPC inverters which have enhanced voltage boost capability and continuous input current by utilizing of transformer and embedded dc source configuration. Experimental results are presented to verify the theory validation....
Power-MOSFET Voltage Regulator
Miller, W. N.; Gray, O. E.
1982-01-01
Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.
DEFF Research Database (Denmark)
Göksu, Ömer; Teodorescu, Remus; Bak, Claus Leth
2014-01-01
In recent grid codes for wind power integration, wind turbines are required to stay connected during grid faults even when the grid voltage drops down to zero; and also to inject reactive current in proportion to the voltage drop. However, a physical fact, instability of grid-connected converters...... during current injection to very low (close to zero) voltage faults, has been omitted, i.e., failed to be noticed in the previous wind power studies and grid code revisions. In this paper, the instability of grid side converters of wind turbines defined as loss of synchronism (LOS), where the wind...... turbines lose synchronism with the grid fundamental frequency (e.g., 50 Hz) during very deep voltage sags, is explored with its theory, analyzed and a novel stability solution based on PLL frequency is proposed; and both are verified with power system simulations and by experiments on a grid...
Khound, Sagarika; Sarma, Ranjit
2018-01-01
We have reported here on the design, processing and dielectric properties of pentacene-based organic thin film transitors (OTFTs) with a bilayer gate dilectrics of crosslinked PVA/Nd2O3 which enables low-voltage organic thin film operations. The dielectric characteristics of PVA/Nd2O3 bilayer films are studied by capacitance-voltage ( C- V) and current-voltage ( I- V) curves in the metal-insulator-metal (MIM) structure. We have analysed the output electrical responses and transfer characteristics of the OTFT devices to determine their performance of OTFT parameters. The mobility of 0.94 cm2/Vs, the threshold voltage of - 2.8 V, the current on-off ratio of 6.2 × 105, the subthreshold slope of 0.61 V/decade are evaluated. Low leakage current of the device is observed from current density-electric field ( J- E) curve. The structure and the morphology of the device are studied using X-ray diffraction (XRD) and atomic force microscope (AFM), respectively. The study demonstrates an effective way to realize low-voltage, high-performance OTFTs at low cost.
LED-Based High-Voltage Lines Warning System
Directory of Open Access Journals (Sweden)
Eldar MUSA
2013-04-01
Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area
Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin
2018-04-01
This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.
Improving the voltage quality of an inverter via by-passing the harmonic current components
DEFF Research Database (Denmark)
Zhong, Qing-Chang; Blaabjerg, Frede; Guerrero, Josep M.
2012-01-01
In this paper, a control strategy is proposed to improve the total harmonic distortion (THD) of the output voltage of an inverter. The physical interpretation of the control strategy is to connect shunt resonant filters at harmonic frequencies to the output so that the harmonic current components...
A triple hybrid micropower generator with simultaneous multi-mode energy harvesting
Uluşan, H.; Chamanian, S.; Pathirana, W. P. M. R.; Zorlu, Ö.; Muhtaroğlu, A.; Külah, H.
2018-01-01
This study presents a triple hybrid energy harvesting system that combines harvested power from thermoelectric (TE), vibration-based electromagnetic (EM) and piezoelectric (PZT) harvesters into a single DC supply. A power management circuit is designed and implemented in 180 nm standard CMOS technology based on the distinct requirements of each harvester, and is terminated with a Schottky diode to avoid reverse current flow. The system topology hence supports simultaneous power generation and delivery from low and high frequency vibrations as well as temperature differences in the environment. The ultra-low DC voltage harvested from TE generator is boosted with a cross-coupled charge-pump driven by an LC oscillator with fully-integrated center-tapped differential inductors. The EM harvester output was rectified with a self-powered and low drop-out AC/DC doubler circuit. The PZT interface electronics benefits from peak-to-peak cycle of the harvested voltage through a negative voltage converter followed by synchronous power extraction and DC-to-DC conversion through internal switches, and an external inductor. The hybrid system was tested with a wearable in-house EM energy harvester placed wrist of a jogger, a commercial low volume PZT harvester, and DC supply as the TE generator output. The system generates more than 1.2 V output for load resistances higher than 50 kΩ, which corresponds to 24 μW to power wearable sensors. Simultaneous multi-mode operation achieves higher voltage and power compared to stand-alone harvesting circuits, and generates up to 110 μW of output power. This is the first hybrid harvester circuit that simultaneously extracts energy from three independent sources, and delivers a single DC output.
Alexandrov, A. L.; Schweigert, I. V.; Zakrevskiy, Dm. E.; Bokhan, P. A.; Gugin, P.; Lavrukhin, M.
2017-10-01
A subnanosecond breakdown in high-voltage pulse discharge may be a key tool for superfast commutation of high power devices. The breakdown in high-voltage open discharge at mid-high pressure in helium was studied in experiment and in kinetic simulations. The kinetic model of electron avalanche development was constructed, based on PIC-MCC simulations, including dynamics of electrons, ions and fast helium atoms, produced by ions scattering. Special attention was paid to electron emission processes from cathode, such as: photoemission by Doppler-shifted resonant photons, produced in excitation processes involving fast atoms; electron emission by ions and fast atoms bombardment of cathode; the secondary electron emission (SEE) by hot electrons from bulk plasma. The simulations show that the fast atoms accumulation is the main reason of emission growth at the early stage of breakdown, but at the final stage, when the voltage on plasma gap diminishes, namely the SEE is responsible for subnanosecond rate of current growth. It was shown that the characteristic time of the current growth can be controlled by the SEE yield. The influence of SEE yield for three types of cathode material (titanium, SiC, and CuAlMg-alloy) was tested. By changing the pulse voltage amplitude and gas pressure, the area of existence of subnanosecond breakdown is identified. It is shown that in discharge with SiC and CuAlMg-alloy cathodes (which have enhanced SEE) the current can increase with a subnanosecond characteristic time value as small as τs = 0.4 ns, for the pulse voltage amplitude of 5÷12 kV. An increase of gas pressure from 15 Torr to 30 Torr essentially decreases the time of of current front growth, whereas the pulse voltage variation weakly affects the results.
Microwave integrated circuit for Josephson voltage standards
Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)
1980-01-01
A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells
International Nuclear Information System (INIS)
Diserbo, M.; Barbier, M.; Quignard, J.F.
1998-01-01
Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)
International Nuclear Information System (INIS)
Islam, S. M. Z.; Gayen, Taposh; Tint, Naing; Alfano, Robert; Shi, Lingyan; Seredych, Mykola; Bandosz, Teresa J.
2014-01-01
The effects of fabrication temperature are investigated on the performance of CdSe quantum dot (QD)-sensitized hybrid solar cells of the composite material of zinc (hydr)oxide (ZnOH-GO)with 2 wt. % graphite oxide. The current-voltage (I-V) and photo-current measurements show that higher fabrication temperatures yield greater photovoltaic power conversion efficiencies that essentially indicate more efficient solar cells. Two Photon Fluorescence images show the effects of temperature on the internal morphologies of the solar devices based on such materials. The CdSe-QD sensitized ZnOH-GO hybrid solar cells fabricated at 450 °C showing conversion of ∼10.60% under a tungsten lamp (12.1 mW/cm 2 ) are reported here, while using potassium iodide as an electrolyte. The output photocurrent, I (μA) with input power, P (mW/cm 2 ) is found to be superlinear, showing a relation of I = P n , where n = 1.4.
She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di
2017-08-29
A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
Transformer inrush current reduction through sequential energization for wind farm applications
Energy Technology Data Exchange (ETDEWEB)
Abdulsalam, S.; Xu, W. [Alberta Univ., Edmonton, AB (Canada)
2008-07-01
Wind power is considered as one of the fastest growing technologies in the power industry. The electrical configuration of a wind farm consists of long spans of medium voltage collector feeders. Each wind generator is connected to the collector circuit/feeder through either a pad mount oil filled, or a nacelle-mounted dry type transformer. All collector feeders connect to a single collector substation where the connection to the high-voltage transmission is established through a step up transformer. With a large number of wind generators per feeder, large inrush current will flow due to simultaneous transformer energization which can cause high voltage sag at the point of common coupling. Wind farms are generally located in unpopulated remote areas where no access to strong network connection is feasible. It is common to have the PCC on a relatively weak location on the sub-transmission/distribution network. In order to meet interconnection standards requirements, the amount of voltage sag due to the energization of a number of transformers needs to be evaluated. This paper presented an effective solution to the mitigation of inrush currents and associated voltage sag for wind farm applications. The paper presented a diagram of a typical configuration of a wind farm electrical distribution system and also described the analytical methodologies for the evaluation of inrush current level together with simulation results. A simplified analysis and sizing criteria for the associated neutral resistor size was presented. It was concluded that the scheme could significantly reduce inrush current level when a large number of transformers are simultaneously energized. The presented application eliminates the need to sectionalize feeders, thereby simplifying them for the energization process. 6 refs., 5 figs.
Sheath and arc-column voltages in high-pressure arc discharges
International Nuclear Information System (INIS)
Benilov, M S; Benilova, L G; Li Heping; Wu Guiqing
2012-01-01
Electrical characteristics of a 1 cm-long free-burning atmospheric-pressure argon arc are calculated by means of a model taking into account the existence of a near-cathode space-charge sheath and the discrepancy between the electron and heavy-particle temperatures in the arc column. The computed arc voltage exhibits a variation with the arc current I similar to the one revealed by the experiment and exceeds experimental values by no more than approximately 2 V in the current range 20-175 A. The sheath contributes about two-thirds or more of the arc voltage. The LTE model predicts a different variation of the arc voltage with I and underestimates the experimental values appreciably for low currents but by no more than approximately 2 V for I ≳ 120 A. However, the latter can hardly be considered as a proof of unimportance of the space-charge sheath at high currents: the LTE model overestimates both the resistance of the bulk of the arc column and the resistance of the part of the column that is adjacent to the cathode, and this overestimation to a certain extent compensates for the neglect of the voltage drop in the sheath. Furthermore, if the latter resistance were evaluated in the framework of the LTE model in an accurate way, then the overestimation would be still much stronger and the obtained voltage would significantly exceed those observed in the experiment.
Shin, Hyewon; Song, Jin-Ho
2014-09-05
Microglial dysfunction and neuroinflammation are thought to contribute to the pathogenesis of schizophrenia. Some antipsychotic drugs have anti-inflammatory activity and can reduce the secretion of pro-inflammatory cytokines and reactive oxygen species from activated microglial cells. Voltage-gated proton channels on the microglial cells participate in the generation of reactive oxygen species and neuronal toxicity by supporting NADPH oxidase activity. In the present study, we examined the effects of two typical antipsychotics, chlorpromazine and haloperidol, on proton currents in microglial BV2 cells using the whole-cell patch clamp method. Chlorpromazine and haloperidol potently inhibited proton currents with IC50 values of 2.2 μM and 8.4 μM, respectively. Chlorpromazine and haloperidol are weak bases that can increase the intracellular pH, whereby they reduce the proton gradient and affect channel gating. Although the drugs caused a marginal positive shift of the activation voltage, they did not change the reversal potential. This suggested that proton current inhibition was not due to an alteration of the intracellular pH. Chlorpromazine and haloperidol are strong blockers of dopamine receptors. While dopamine itself did not affect proton currents, it also did not alter proton current inhibition by the two antipsychotics, indicating dopamine receptors are not likely to mediate the proton current inhibition. Given that proton channels are important for the production of reactive oxygen species and possibly pro-inflammatory cytokines, the anti-inflammatory and antipsychotic activities of chlorpromazine and haloperidol may be partly derived from their ability to inhibit microglial proton currents. Copyright © 2014 Elsevier B.V. All rights reserved.