WorldWideScience

Sample records for voltage threshold lowering

  1. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers

    Directory of Open Access Journals (Sweden)

    Francesco Dell’ Anna

    2018-04-01

    Full Text Available This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  2. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers.

    Science.gov (United States)

    Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar

    2018-04-17

    This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  3. Quantum Mechanical Enhancement of the Random Dopant Induced Threshold Voltage Fluctuations and Lowering in Sub 0.1 Micron MOSFETs

    Science.gov (United States)

    Asenov, Asen; Slavcheva, G.; Brown, A. R.; Davies, J. H.; Saini, Subhash

    1999-01-01

    A detailed study of the influence of quantum effects in the inversion layer on the random dopant induced threshold voltage fluctuations and lowering in sub 0.1 micron MOSFETs has been performed. This has been achieved using a full 3D implementation of the density gradient (DG) formalism incorporated in our previously published 3D 'atomistic' simulation approach. This results in a consistent, fully 3D, quantum mechanical picture which implies not only the vertical inversion layer quantisation but also the lateral confinement effects manifested by current filamentation in the 'valleys' of the random potential fluctuations. We have shown that the net result of including quantum mechanical effects, while considering statistical fluctuations, is an increase in both threshold voltage fluctuations and lowering.

  4. Circuit and method for controlling the threshold voltage of transistors.

    NARCIS (Netherlands)

    2008-01-01

    A control unit, for controlling a threshold voltage of a circuit unit having transistor devices, includes a reference circuit and a measuring unit. The measuring unit is configured to measure a threshold voltage of at least one sensing transistor of the circuit unit, and to measure a threshold

  5. Implementation of floating gate MOSFET in inverter for threshold voltage tunability

    Directory of Open Access Journals (Sweden)

    Musa F.A.S.

    2017-01-01

    Full Text Available This paper presents the ability of floating gate MOSFET (FGMOS threshold voltage to be programmed or tuned which is exploited to improve the performance of electronic circuit design. This special characteristic owns by FGMOS is definitely contributes towards low voltage and low power circuit design. The comparison of threshold voltage between FGMOS and conventional NMOS is done in order to prove that FGMOS is able to produce a lower threshold voltage compared to conventional NMOS. In addition, in this paper, an implementation of FGMOS into inverter circuit is also done to show the programmability of FGMOS threshold voltage. The operations of the inverter circuits are verified using Sypnopsys simulation in 0.1μm CMOS technology with supply voltage of 1.8V.

  6. Determining lower threshold concentrations for synergistic effects

    DEFF Research Database (Denmark)

    Bjergager, Maj-Britt Andersen; Dalhoff, Kristoffer; Kretschmann, Andreas

    2017-01-01

    which proven synergists cease to act as synergists towards the aquatic crustacean Daphnia magna. To do this, we compared several approaches and test-setups to evaluate which approach gives the most conservative estimate for the lower threshold for synergy for three known azole synergists. We focus...... on synergistic interactions between the pyrethroid insecticide, alpha-cypermethrin, and one of the three azole fungicides prochloraz, propiconazole or epoxiconazole measured on Daphnia magna immobilization. Three different experimental setups were applied: A standard 48h acute toxicity test, an adapted 48h test...... of immobile organisms increased more than two-fold above what was predicted by independent action (vertical assessment). All three tests confirmed the hypothesis of the existence of a lower azole threshold concentration below which no synergistic interaction was observed. The lower threshold concentration...

  7. Continuous adjustment of threshold voltage in carbon nanotube field-effect transistors through gate engineering

    Science.gov (United States)

    Zhong, Donglai; Zhao, Chenyi; Liu, Lijun; Zhang, Zhiyong; Peng, Lian-Mao

    2018-04-01

    In this letter, we report a gate engineering method to adjust threshold voltage of carbon nanotube (CNT) based field-effect transistors (FETs) continuously in a wide range, which makes the application of CNT FETs especially in digital integrated circuits (ICs) easier. Top-gated FETs are fabricated using solution-processed CNT network films with stacking Pd and Sc films as gate electrodes. By decreasing the thickness of the lower layer metal (Pd) from 20 nm to zero, the effective work function of the gate decreases, thus tuning the threshold voltage (Vt) of CNT FETs from -1.0 V to 0.2 V. The continuous adjustment of threshold voltage through gate engineering lays a solid foundation for multi-threshold technology in CNT based ICs, which then can simultaneously provide high performance and low power circuit modules on one chip.

  8. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  9. Analytical drift-current threshold voltage model of long-channel double-gate MOSFETs

    International Nuclear Information System (INIS)

    Shih, Chun-Hsing; Wang, Jhong-Sheng

    2009-01-01

    This paper presents a new, physical threshold voltage model to solve the ambiguity in determining the threshold voltage of double-gate (DG) MOSFETs. To avoid the difficulties of the conventional 2ψ B model in nearly undoped DG MOSFETs, this study proposes to define the on–off switching based on the actual roles of the drift and diffusion components in the total drain current. The drift current strongly enhances beyond the threshold voltage, while the diffusion current plays a major role in the subthreshold. The threshold voltage is defined as the drift component that exceeds the diffusion counterpart. From the solutions of Poisson's equation, the drift and diffusion currents of DG MOSFETs are separately formulated to derive the analytical expressions of the threshold voltage and associated threshold current. This model provides a comprehensive description of the switching behavior of DG MOSFET devices, and offers a physical onset threshold current to determine the threshold voltage in practical extraction

  10. Lower versus higher hemoglobin threshold for transfusion in septic shock.

    Science.gov (United States)

    Holst, Lars B; Haase, Nicolai; Wetterslev, Jørn; Wernerman, Jan; Guttormsen, Anne B; Karlsson, Sari; Johansson, Pär I; Aneman, Anders; Vang, Marianne L; Winding, Robert; Nebrich, Lars; Nibro, Helle L; Rasmussen, Bodil S; Lauridsen, Johnny R M; Nielsen, Jane S; Oldner, Anders; Pettilä, Ville; Cronhjort, Maria B; Andersen, Lasse H; Pedersen, Ulf G; Reiter, Nanna; Wiis, Jørgen; White, Jonathan O; Russell, Lene; Thornberg, Klaus J; Hjortrup, Peter B; Müller, Rasmus G; Møller, Morten H; Steensen, Morten; Tjäder, Inga; Kilsand, Kristina; Odeberg-Wernerman, Suzanne; Sjøbø, Brit; Bundgaard, Helle; Thyø, Maria A; Lodahl, David; Mærkedahl, Rikke; Albeck, Carsten; Illum, Dorte; Kruse, Mary; Winkel, Per; Perner, Anders

    2014-10-09

    Blood transfusions are frequently given to patients with septic shock. However, the benefits and harms of different hemoglobin thresholds for transfusion have not been established. In this multicenter, parallel-group trial, we randomly assigned patients in the intensive care unit (ICU) who had septic shock and a hemoglobin concentration of 9 g per deciliter or less to receive 1 unit of leukoreduced red cells when the hemoglobin level was 7 g per deciliter or less (lower threshold) or when the level was 9 g per deciliter or less (higher threshold) during the ICU stay. The primary outcome measure was death by 90 days after randomization. We analyzed data from 998 of 1005 patients (99.3%) who underwent randomization. The two intervention groups had similar baseline characteristics. In the ICU, the lower-threshold group received a median of 1 unit of blood (interquartile range, 0 to 3) and the higher-threshold group received a median of 4 units (interquartile range, 2 to 7). At 90 days after randomization, 216 of 502 patients (43.0%) assigned to the lower-threshold group, as compared with 223 of 496 (45.0%) assigned to the higher-threshold group, had died (relative risk, 0.94; 95% confidence interval, 0.78 to 1.09; P=0.44). The results were similar in analyses adjusted for risk factors at baseline and in analyses of the per-protocol populations. The numbers of patients who had ischemic events, who had severe adverse reactions, and who required life support were similar in the two intervention groups. Among patients with septic shock, mortality at 90 days and rates of ischemic events and use of life support were similar among those assigned to blood transfusion at a higher hemoglobin threshold and those assigned to blood transfusion at a lower threshold; the latter group received fewer transfusions. (Funded by the Danish Strategic Research Council and others; TRISS ClinicalTrials.gov number, NCT01485315.).

  11. Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

    International Nuclear Information System (INIS)

    Baruah, Ratul Kumar; Mahapatra, Santanu

    2009-01-01

    Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

  12. High performance Si nanowire field-effect-transistors based on a CMOS inverter with tunable threshold voltage.

    Science.gov (United States)

    Van, Ngoc Huynh; Lee, Jae-Hyun; Sohn, Jung Inn; Cha, Seung Nam; Whang, Dongmok; Kim, Jong Min; Kang, Dae Joon

    2014-05-21

    We successfully fabricated nanowire-based complementary metal-oxide semiconductor (NWCMOS) inverter devices by utilizing n- and p-type Si nanowire field-effect-transistors (NWFETs) via a low-temperature fabrication processing technique. We demonstrate that NWCMOS inverter devices can be operated at less than 1 V, a significantly lower voltage than that of typical thin-film based complementary metal-oxide semiconductor (CMOS) inverter devices. This low-voltage operation was accomplished by controlling the threshold voltage of the n-type Si NWFETs through effective management of the nanowire (NW) doping concentration, while realizing high voltage gain (>10) and ultra-low static power dissipation (≤3 pW) for high-performance digital inverter devices. This result offers a viable means of fabricating high-performance, low-operation voltage, and high-density digital logic circuits using a low-temperature fabrication processing technique suitable for next-generation flexible electronics.

  13. Lower versus Higher Hemoglobin Threshold for Transfusion in Septic Shock

    DEFF Research Database (Denmark)

    Holst, Lars B; Haase, Nicolai; Wetterslev, Jørn

    2014-01-01

    BACKGROUND: Blood transfusions are frequently given to patients with septic shock. However, the benefits and harms of different hemoglobin thresholds for transfusion have not been established. METHODS: In this multicenter, parallel-group trial, we randomly assigned patients in the intensive care...... unit (ICU) who had septic shock and a hemoglobin concentration of 9 g per deciliter or less to receive 1 unit of leukoreduced red cells when the hemoglobin level was 7 g per deciliter or less (lower threshold) or when the level was 9 g per deciliter or less (higher threshold) during the ICU stay...... were similar in the two intervention groups. CONCLUSIONS: Among patients with septic shock, mortality at 90 days and rates of ischemic events and use of life support were similar among those assigned to blood transfusion at a higher hemoglobin threshold and those assigned to blood transfusion...

  14. Two-dimensional threshold voltage analytical model of DMG strained-silicon-on-insulator MOSFETs

    International Nuclear Information System (INIS)

    Li Jin; Liu Hongxia; Li Bin; Cao Lei; Yuan Bo

    2010-01-01

    For the first time, a simple and accurate two-dimensional analytical model for the surface potential variation along the channel in fully depleted dual-material gate strained-Si-on-insulator (DMG SSOI) MOSFETs is developed. We investigate the improved short channel effect (SCE), hot carrier effect (HCE), drain-induced barrier-lowering (DIBL) and carrier transport efficiency for the novel structure MOSFET. The analytical model takes into account the effects of different metal gate lengths, work functions, the drain bias and Ge mole fraction in the relaxed SiGe buffer. The surface potential in the channel region exhibits a step potential, which can suppress SCE, HCE and DIBL. Also, strained-Si and SOI structure can improve the carrier transport efficiency, with strained-Si being particularly effective. Further, the threshold voltage model correctly predicts a 'rollup' in threshold voltage with decreasing channel length ratios or Ge mole fraction in the relaxed SiGe buffer. The validity of the two-dimensional analytical model is verified using numerical simulations. (semiconductor devices)

  15. An AMOLED AC-Biased Pixel Design Compensating the Threshold Voltage and I-R Drop

    Directory of Open Access Journals (Sweden)

    Ching-Lin Fan

    2011-01-01

    Full Text Available We propose a novel pixel design and an AC bias driving method for active-matrix organic light-emitting diode (AM-OLED displays using low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs. The proposed threshold voltage and I-R drop compensation circuit, which comprised three transistors and one capacitor, have been verified to supply uniform output current by simulation work using the Automatic Integrated Circuit Modeling Simulation Program with Integrated Circuit Emphasis (AIM-SPICE simulator. The simulated results demonstrate excellent properties such as low error rate of OLED anode voltage variation (<0.7% and low voltage drop of VDD power line. The proposed pixel circuit effectively enables threshold-voltage-deviation correction of driving TFT and compensates for the voltage drop of VDD power line using AC bias on OLED cathode.

  16. Influence of process parameters on threshold voltage and leakage current in 18nm NMOS device

    Science.gov (United States)

    Atan, Norani Binti; Ahmad, Ibrahim Bin; Majlis, Burhanuddin Bin Yeop; Fauzi, Izzati Binti Ahmad

    2015-04-01

    The process parameters are very crucial factor in the development of transistors. There are many process parameters that influenced in the development of the transistors. In this research, we investigate the effects of the process parameters variation on response characteristics such as threshold voltage (VTH) and sub-threshold leakage current (IOFF) in 18nm NMOS device. The technique to identify semiconductor process parameters whose variability would impact most on the device characteristic is realized through the process by using Taguchi robust design method. This paper presents the process parameters that influenced in threshold voltage (VTH) and sub-threshold leakage current (IOFF) which includes the Halo Implantation, Compensation Implantation, Adjustment Threshold voltage Implantation and Source/Drain Implantation. The design, fabrication and characterization of 18nm HfO2/TiSi2 NMOS device is simulated and performed via a tool called Virtual Wafer Fabrication (VWF) Silvaco TCAD Tool known as ATHENA and ATLAS simulators. These two simulators were combined with Taguchi L9 Orthogonal method to aid in the design and the optimization of the process parameters to achieve the optimum average of threshold voltage (VTH) and sub-threshold leakage current, (IOFF) in 18nm device. Results from this research were obtained; where Halo Implantation dose was identified as one of the process parameter that has the strongest effect on the response characteristics. Whereby the Compensation Implantation dose was identified as an adjustment factor to get the nominal values of threshold voltage VTH, and sub-threshold leakage current, IOFF for 18nm NMOS devices equal to 0.302849 volts and 1.9123×10-16 A/μm respectively. The design values are referred to ITRS 2011 prediction.

  17. The effect of random dopant fluctuation on threshold voltage and drain current variation in junctionless nanotransistors

    International Nuclear Information System (INIS)

    Rezapour, Arash; Rezapour, Pegah

    2015-01-01

    We investigate the effect of dopant random fluctuation on threshold voltage and drain current variation in a two-gate nanoscale transistor. We used a quantum-corrected technology computer aided design simulation to run the simulation (10000 randomizations). With this simulation, we could study the effects of varying the dimensions (length and width), and thicknesses of oxide and dopant factors of a transistor on the threshold voltage and drain current in subthreshold region (off) and overthreshold (on). It was found that in the subthreshold region the variability of the drain current and threshold voltage is relatively fixed while in the overthreshold region the variability of the threshold voltage and drain current decreases remarkably, despite the slight reduction of gate voltage diffusion (compared with that of the subthreshold). These results have been interpreted by using previously reported models for threshold current variability, load displacement, and simple analytical calculations. Scaling analysis shows that the variability of the characteristics of this semiconductor increases as the effects of the short channel increases. Therefore, with a slight increase of length and a reduction of width, oxide thickness, and dopant factor, we could correct the effect of the short channel. (paper)

  18. Threshold voltage roll-off modelling of bilayer graphene field-effect transistors

    International Nuclear Information System (INIS)

    Saeidmanesh, M; Ismail, Razali; Khaledian, M; Karimi, H; Akbari, E

    2013-01-01

    An analytical model is presented for threshold voltage roll-off of double gate bilayer graphene field-effect transistors. To this end, threshold voltage models of short- and long-channel states have been developed. In the short-channel case, front and back gate potential distributions have been modelled and used. In addition, the tunnelling probability is modelled and its effect is taken into consideration in the potential distribution model. To evaluate the accuracy of the potential model, FlexPDE software is employed with proper boundary conditions and a good agreement is observed. Using the proposed models, the effect of several structural parameters on the threshold voltage and its roll-off are studied at room temperature. (paper)

  19. Modeling, Simulation, and Analysis of Novel Threshold Voltage Definition for Nano-MOSFET

    Directory of Open Access Journals (Sweden)

    Yashu Swami

    2017-01-01

    Full Text Available Threshold voltage (VTH is the indispensable vital parameter in MOSFET designing, modeling, and operation. Diverse expounds and extraction methods exist to model the on-off transition characteristics of the device. The governing gauge for efficient threshold voltage definition and extraction method can be itemized as clarity, simplicity, precision, and stability throughout the operating conditions and technology node. The outcomes of extraction methods diverge from the exact values due to various short-channel effects (SCEs and nonidealities present in the device. A new approach to define and extract the real value of VTH of MOSFET is proposed in the manuscript. The subsequent novel enhanced SCE-independent VTH extraction method named “hybrid extrapolation VTH extraction method” (HEEM is elaborated, modeled, and compared with few prevalent MOSFET threshold voltage extraction methods for validation of the results. All the results are verified by extensive 2D TCAD simulation and confirmed analytically at various technology nodes.

  20. Analytical modeling of threshold voltage for Cylindrical Gate All Around (CGAA MOSFET using center potential

    Directory of Open Access Journals (Sweden)

    K.P. Pradhan

    2015-12-01

    Full Text Available In this paper, an analytical threshold voltage model is proposed for a cylindrical gate-all-around (CGAA MOSFET by solving the 2-D Poisson’s equation in the cylindrical coordinate system. A comparison is made for both the center and the surface potential model of CGAA MOSFET. This paper claims that the calculation of threshold voltage using center potential is more accurate rather than the calculation from surface potential. The effects of the device parameters like the drain bias (VDS, oxide thickness (tox, channel thickness (r, etc., on the threshold voltage are also studied in this paper. The model is verified with 3D numerical device simulator Sentaurus from Synopsys Inc.

  1. Modern Adaptive Analytics Approach to Lowering Seismic Network Detection Thresholds

    Science.gov (United States)

    Johnson, C. E.

    2017-12-01

    Modern seismic networks present a number of challenges, but perhaps most notably are those related to 1) extreme variation in station density, 2) temporal variation in station availability, and 3) the need to achieve detectability for much smaller events of strategic importance. The first of these has been reasonably addressed in the development of modern seismic associators, such as GLASS 3.0 by the USGS/NEIC, though some work still remains to be done in this area. However, the latter two challenges demand special attention. Station availability is impacted by weather, equipment failure or the adding or removing of stations, and while thresholds have been pushed to increasingly smaller magnitudes, new algorithms are needed to achieve even lower thresholds. Station availability can be addressed by a modern, adaptive architecture that maintains specified performance envelopes using adaptive analytics coupled with complexity theory. Finally, detection thresholds can be lowered using a novel approach that tightly couples waveform analytics with the event detection and association processes based on a principled repicking algorithm that uses particle realignment for enhanced phase discrimination.

  2. Higher vs. lower haemoglobin threshold for transfusion in septic shock

    DEFF Research Database (Denmark)

    Rygård, S L; Holst, L B; Wetterslev, J

    2017-01-01

    . a lower haemoglobin threshold. METHODS: In post-hoc analyses of the full trial population of 998 patients from the Transfusion Requirements in Septic Shock (TRISS) trial, we investigated the intervention effect on 90-day mortality in patients with severe comorbidity (chronic lung disease, haematological......BACKGROUND: Using a restrictive transfusion strategy appears to be safe in sepsis, but there may be subgroups of patients who benefit from transfusion at a higher haemoglobin level. We explored if subgroups of patients with septic shock and anaemia had better outcome when transfused at a higher vs.......51), in those who had undergone surgery (P = 0.99) or in patients with septic shock by the new definition (P = 0.20). CONCLUSION: In exploratory analyses of a randomized trial in patients with septic shock and anaemia, we observed no survival benefit in any subgroups of transfusion at a haemoglobin threshold...

  3. Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

    Science.gov (United States)

    Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

    2018-03-01

    Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

  4. Thresholds of parametric instabilities near the lower hybrid frequency

    International Nuclear Information System (INIS)

    Berger, R.L.; Perkins, F.W.

    1975-06-01

    Resonant decay instabilities of a pump wave with frequency ω 0 near the lower-hybrid frequency ω/sub LH/ are analyzed with respect to the wavenumber k of the decay waves and the ratio ω 0 /ω/sub LH/ to determine the decay process with the minimum threshold. It was found that the lowest thresholds are for decay into an electron plasma (lower hybrid) wave plus either a backward ion-cyclotron wave, an ion Bernstein wave, or a low frequency sound wave. For ω 0 less than (2ω/sub LH/)/sup 1 / 2 /, it was found that these decay processes can occur and have faster growth than ion quasimodes provided the drift velocity (cE 0 /B 0 ) is much less than the sound speed. In many cases of interest, electromagnetic corrections to the lower-hybrid wave rule out decay into all but short wavelength (k rho/sub i/ greater than 1) waves. The experimental results are consistent with the linear theory of parametric instabilities in a homogeneous plasma. (U.S.)

  5. Adaptive Tuning of Frequency Thresholds Using Voltage Drop Data in Decentralized Load Shedding

    DEFF Research Database (Denmark)

    Hoseinzadeh, Bakhtyar; Faria Da Silva, Filipe Miguel; Bak, Claus Leth

    2015-01-01

    Load shedding (LS) is the last firewall and the most expensive control action against power system blackout. In the conventional under frequency LS (UFLS) schemes, the load drop locations are already determined independently of the event location. Furthermore, the frequency thresholds of LS relays...... are prespecified and constant values which may not be a comprehensive solution for widespread range of possible events. This paper addresses the decentralized LS in which the instantaneous voltage deviation of load buses is used to determine the frequency thresholds of LS relays. The higher frequency thresholds...

  6. A patch in the pectoral position lowers defibrillation threshold.

    Science.gov (United States)

    Karasik, P; Solomon, A; Verdino, R; Moore, H; Rodak, D; Hannan, R; Fletcher, R

    1997-06-01

    Implantable pacemaker cardioverter defibrillators are now available with biphasic waveforms, which have been shown to markedly improve defibrillation thresholds (DFTs). However, in a number of patients the DFT remains high. Also, DFT may increase after implantation, especially if antiarrhythmic drugs are added. We report on the use of a subcutaneous patch in the pectoral position in 15 patients receiving a transvenous defibrillator as a method of easily reducing the DFT. A 660-mm2 patch electrode was placed beneath the generator in a pocket created on the pectoral fascia. The energy required for defibrillation was lowered by 56% on average, and the system impedance was lowered by a mean of 25%. This maneuver allowed all patients to undergo a successful implant with adequate safety margin.

  7. Threshold voltage and power-supply tolerance of CMOS logic design families

    NARCIS (Netherlands)

    Kishor, M.; Pineda de Gyvez, J.

    2000-01-01

    The advent of deep submicron technologies brings new challenges to digital circuit design. A reduced threshold voltage (VT) and power supply (Vdd) in addition to process variabilities have a direct impact on circuit design. In a semiconductor environment it is conventionally thought that parametric

  8. Interface Engineering for Precise Threshold Voltage Control in Multilayer-Channel Thin Film Transistors

    KAUST Repository

    Park, Jihoon

    2016-11-29

    Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.

  9. Interface Engineering for Precise Threshold Voltage Control in Multilayer-Channel Thin Film Transistors

    KAUST Repository

    Park, Jihoon; Alshammari, Fwzah Hamud; Wang, Zhenwei; Alshareef, Husam N.

    2016-01-01

    Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.

  10. Near-Threshold Computing and Minimum Supply Voltage of Single-Rail MCML Circuits

    Directory of Open Access Journals (Sweden)

    Ruiping Cao

    2014-01-01

    Full Text Available In high-speed applications, MOS current mode logic (MCML is a good alternative. Scaling down supply voltage of the MCML circuits can achieve low power-delay product (PDP. However, the current almost all MCML circuits are realized with dual-rail scheme, where the NMOS configuration in series limits the minimum supply voltage. In this paper, single-rail MCML (SRMCML circuits are described, which can avoid the devices configuration in series, since their logic evaluation block can be realized by only using MOS devices in parallel. The relationship between the minimum supply voltage of the SRMCML circuits and the model parameters of MOS transistors is derived, so that the minimum supply voltage can be estimated before circuit designs. An MCML dynamic flop-flop based on SRMCML is also proposed. The optimization algorithm for near-threshold sequential circuits is presented. A near-threshold SRMCML mode-10 counter based on the optimization algorithm is verified. Scaling down the supply voltage of the SRMCML circuits is also investigated. The power dissipation, delay, and power-delay products of these circuits are carried out. The results show that the near-threshold SRMCML circuits can obtain low delay and small power-delay product.

  11. Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

    Energy Technology Data Exchange (ETDEWEB)

    Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)

    2017-02-15

    High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

  12. Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

    International Nuclear Information System (INIS)

    Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.

    2017-01-01

    High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

  13. Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing

    KAUST Repository

    Zhang, Yu

    2017-10-17

    Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

  14. Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.

    Science.gov (United States)

    Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni

    2017-11-08

    Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

  15. Simulating threshold voltage shift of MOS devices due to radiation in the low-dose range

    CERN Document Server

    Wan Xin Heng; Gao Wen Yu; Huang Ru; Wang Yang Yuan

    2002-01-01

    An analytical MOSFET threshold voltage shift model due to radiation in the low-dose range has been developed for circuit simulations. Experimental data in the literature shows that the model predictions are in good agreement. It is simple in functional form and hence computationally efficient. It can be used as a basic circuit simulation tool for analysing MOSFET exposed to a nuclear environment up to about 1 Mrad(Si). In accordance with common believe, radiation induced absolute change of threshold voltage was found to be larger in irradiated PMOS devices. However, if the radiation sensitivity is defined in the way authors did it, the results indicated NMOS rather than PMOS devices are more sensitive, specially at low doses. This is important from the standpoint of their possible application in dosimetry

  16. Threshold-voltage modulated phase change heterojunction for application of high density memory

    International Nuclear Information System (INIS)

    Yan, Baihan; Tong, Hao; Qian, Hang; Miao, Xiangshui

    2015-01-01

    Phase change random access memory is one of the most important candidates for the next generation non-volatile memory technology. However, the ability to reduce its memory size is compromised by the fundamental limitations inherent in the CMOS technology. While 0T1R configuration without any additional access transistor shows great advantages in improving the storage density, the leakage current and small operation window limit its application in large-scale arrays. In this work, phase change heterojunction based on GeTe and n-Si is fabricated to address those problems. The relationship between threshold voltage and doping concentration is investigated, and energy band diagrams and X-ray photoelectron spectroscopy measurements are provided to explain the results. The threshold voltage is modulated to provide a large operational window based on this relationship. The switching performance of the heterojunction is also tested, showing a good reverse characteristic, which could effectively decrease the leakage current. Furthermore, a reliable read-write-erase function is achieved during the tests. Phase change heterojunction is proposed for high-density memory, showing some notable advantages, such as modulated threshold voltage, large operational window, and low leakage current

  17. Threshold-voltage modulated phase change heterojunction for application of high density memory

    Science.gov (United States)

    Yan, Baihan; Tong, Hao; Qian, Hang; Miao, Xiangshui

    2015-09-01

    Phase change random access memory is one of the most important candidates for the next generation non-volatile memory technology. However, the ability to reduce its memory size is compromised by the fundamental limitations inherent in the CMOS technology. While 0T1R configuration without any additional access transistor shows great advantages in improving the storage density, the leakage current and small operation window limit its application in large-scale arrays. In this work, phase change heterojunction based on GeTe and n-Si is fabricated to address those problems. The relationship between threshold voltage and doping concentration is investigated, and energy band diagrams and X-ray photoelectron spectroscopy measurements are provided to explain the results. The threshold voltage is modulated to provide a large operational window based on this relationship. The switching performance of the heterojunction is also tested, showing a good reverse characteristic, which could effectively decrease the leakage current. Furthermore, a reliable read-write-erase function is achieved during the tests. Phase change heterojunction is proposed for high-density memory, showing some notable advantages, such as modulated threshold voltage, large operational window, and low leakage current.

  18. Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

    Science.gov (United States)

    Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2004-03-22

    DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

  19. An Analytical Threshold Voltage Model of Fully Depleted (FD) Recessed-Source/Drain (Re-S/D) SOI MOSFETs with Back-Gate Control

    Science.gov (United States)

    Saramekala, Gopi Krishna; Tiwari, Pramod Kumar

    2016-10-01

    This paper presents an analytical threshold voltage model for back-gated fully depleted (FD), recessed-source drain silicon-on-insulator metal-oxide-semiconductor field-effect transistors (MOSFETs). Analytical surface potential models have been developed at front and back surfaces of the channel by solving the two-dimensional (2-D) Poisson's equation in the channel region with appropriate boundary conditions assuming a parabolic potential profile in the transverse direction of the channel. The strong inversion criterion is applied to the front surface potential as well as on the back one in order to find two separate threshold voltages for front and back channels of the device, respectively. The device threshold voltage has been assumed to be associated with the surface that offers a lower threshold voltage. The developed model was analyzed extensively for a variety of device geometry parameters like the oxide and silicon channel thicknesses, the thickness of the source/drain extension in the buried oxide, and the applied bias voltages with back-gate control. The proposed model has been validated by comparing the analytical results with numerical simulation data obtained from ATLAS™, a 2-D device simulator from SILVACO.

  20. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D

    1987-05-01

    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  1. IGZO TFT-based circuit with tunable threshold voltage by laser annealing

    Science.gov (United States)

    Huang, Xiaoming; Yu, Guang; Wu, Chenfei

    2017-11-01

    In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.

  2. New pixel circuit compensating poly-si TFT threshold-voltage shift for a driving AMOLED

    International Nuclear Information System (INIS)

    Fan, C. L.; Lin, Y. Y.; Lin, B. S.; Chang, J. Y.; Fan, C. L.; Chang, H. C.

    2010-01-01

    This study presents a novel pixel circuit that uses only n-type low-temperature polycrystalline silicon (poly-Si) thin-film transistors (LTPS-TFTs) to simplify the fabrication process of active matrix organic light-emitting diode (AMOLED) displays. The proposed pixel circuit consists of five switching TFTs, one driving TFT (DTFT), and two capacitors. The output current and the OLED anode voltage error rates are about 3% and 0.7%, respectively. Thus, the pixel circuit can realize uniform output current with high immunity to the poly-Si TFT threshold voltage deviation. The proposed novel pixel design has great potential for use in large-size, high-resolution AMOLED displays.

  3. Suppression of threshold voltage variability in MOSFETs by adjustment of ion implantation parameters

    Science.gov (United States)

    Park, Jae Hyun; Chang, Tae-sig; Kim, Minsuk; Woo, Sola; Kim, Sangsig

    2018-01-01

    In this study, we investigate threshold voltage (VTH) variability of metal-oxide-semiconductor field-effect transistors induced by random dopant fluctuation (RDF). Our simulation work demonstrates not only the influence of the implantation parameters such as its dose, tilt angle, energy, and rotation angle on the RDF-induced VTH variability, but also the solution to reduce the effect of this variability. By adjusting the ion implantation parameters, the 3σ (VTH) is reduced from 43.8 mV to 28.9 mV. This 34% reduction is significant, considering that our technique is very cost effective and facilitates easy fabrication, increasing availability.

  4. SEMICONDUCTOR DEVICES: Two-dimensional threshold voltage analytical model of DMG strained-silicon-on-insulator MOSFETs

    Science.gov (United States)

    Jin, Li; Hongxia, Liu; Bin, Li; Lei, Cao; Bo, Yuan

    2010-08-01

    For the first time, a simple and accurate two-dimensional analytical model for the surface potential variation along the channel in fully depleted dual-material gate strained-Si-on-insulator (DMG SSOI) MOSFETs is developed. We investigate the improved short channel effect (SCE), hot carrier effect (HCE), drain-induced barrier-lowering (DIBL) and carrier transport efficiency for the novel structure MOSFET. The analytical model takes into account the effects of different metal gate lengths, work functions, the drain bias and Ge mole fraction in the relaxed SiGe buffer. The surface potential in the channel region exhibits a step potential, which can suppress SCE, HCE and DIBL. Also, strained-Si and SOI structure can improve the carrier transport efficiency, with strained-Si being particularly effective. Further, the threshold voltage model correctly predicts a “rollup" in threshold voltage with decreasing channel length ratios or Ge mole fraction in the relaxed SiGe buffer. The validity of the two-dimensional analytical model is verified using numerical simulations.

  5. A two-dimensional analytical model for channel potential and threshold voltage of short channel dual material gate lightly doped drain MOSFET

    International Nuclear Information System (INIS)

    Tripathi Shweta

    2014-01-01

    An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator. (interdisciplinary physics and related areas of science and technology)

  6. A two-dimensional analytical model for channel potential and threshold voltage of short channel dual material gate lightly doped drain MOSFET

    Science.gov (United States)

    Shweta, Tripathi

    2014-11-01

    An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator.

  7. Noradrenaline decreases spike voltage threshold and induces electrographic sharp waves in turtle medial cortex in vitro.

    Science.gov (United States)

    Lorenzo, Daniel; Velluti, Julio C

    2004-01-01

    The noradrenergic modulation of neuronal properties has been described at different levels of the mammalian brain. Although the anatomical characteristics of the noradrenergic system are well known in reptiles, functional data are scarce. In our study the noradrenergic modulation of cortical electrogenesis in the turtle medial cortex was studied in vitro using a combination of field and intracellular recordings. Turtle EEG consists of a low voltage background interspersed by spontaneous large sharp waves (LSWs). Noradrenaline (NA, 5-40 microM) induced (or enhanced) the generation of LSWs in a dose-dependent manner. Pharmacological experiments suggest the participation of alpha and beta receptors in this effect. In medial cortex neurons NA induced a hyperpolarization of the resting potential and a decrease of input resistance. Both effects were observed also after TTX treatment. Noradrenaline increased the response of the cells to depolarizing pulses, resulting in an upward shift of the frequency/current relation. In most cells the excitability change was mediated by a decrease of the spike voltage threshold resulting in the reduction of the amount of depolarization needed to fire the cell (voltage threshold minus resting potential). As opposed to the mechanisms reported in mammalian neurons, no changes in the frequency adaptation or the post-train afterhyperpolarization were observed. The NA effects at the cellular level were not reproduced by noradrenergic agonists. Age- and species-dependent properties in the pharmacology of adrenergic receptors could be involved in this result. Cellular effects of NA in turtle cortex are similar to those described in mammals, although the increase in cellular excitability seems to be mediated by a different mechanism. Copyright 2004 S. Karger AG, Basel

  8. Adjustable threshold-voltage in all-inkjet-printed organic thin film transistor using double-layer dielectric structures

    International Nuclear Information System (INIS)

    Wu, Wen-Jong; Lee, Chang-Hung; Hsu, Chun-Hao; Yang, Shih-Hsien; Lin, Chih-Ting

    2013-01-01

    An all-inkjet-printed organic thin film transistor (OTFT) with a double-layer dielectric structure is proposed and implemented in this study. By using the double-layer structure with different dielectric materials (i.e., polyvinylphenol with poly(vinylidene fluoride-co-hexafluoropropylene)), the threshold-voltage of OTFT can be adjusted. The threshold-voltage shift can be controlled by changing the composition of dielectric layers. That is, an enhancement-mode OTFT can be converted to a depletion-mode OTFT by selectively printing additional dielectric layers to form a high-k/low-k double-layer structure. The printed OTFT has a carrier mobility of 5.0 × 10 −3 cm 2 /V-s. The threshold-voltages of the OTFTs ranged between − 13 V and 10 V. This study demonstrates an additional design parameter for organic electronics manufactured using inkjet printing technology. - Highlights: • A double-layer dielectric organic thin film transistor, OTFT, is implemented. • The threshold voltage of OTFT can be configured by the double dielectric structure. • The composition of the dielectric determines the threshold voltage shift. • The characteristics of OTFTs can be adjusted by double dielectric structures

  9. Threshold voltage control in TmSiO/HfO2 high-k/metal gate MOSFETs

    Science.gov (United States)

    Dentoni Litta, E.; Hellström, P.-E.; Östling, M.

    2015-06-01

    High-k interfacial layers have been proposed as a way to extend the scalability of Hf-based high-k/metal gate CMOS technology, which is currently limited by strong degradations in threshold voltage control, channel mobility and device reliability when the chemical oxide (SiOx) interfacial layer is scaled below 0.4 nm. We have previously demonstrated that thulium silicate (TmSiO) is a promising candidate as a high-k interfacial layer, providing competitive advantages in terms of EOT scalability and channel mobility. In this work, the effect of the TmSiO interfacial layer on threshold voltage control is evaluated, showing that the TmSiO/HfO2 dielectric stack is compatible with threshold voltage control techniques commonly used with SiOx/HfO2 stacks. Specifically, we show that the flatband voltage can be set in the range -1 V to +0.5 V by the choice of gate metal and that the effective workfunction of the stack is properly controlled by the metal workfunction in a gate-last process flow. Compatibility with a gate-first approach is also demonstrated, showing that integration of La2O3 and Al2O3 capping layers can induce a flatband voltage shift of at least 150 mV. Finally, the effect of the annealing conditions on flatband voltage is investigated, finding that the duration of the final forming gas anneal can be used as a further process knob to tune the threshold voltage. The evaluation performed on MOS capacitors is confirmed by the fabrication of TmSiO/HfO2/TiN MOSFETs achieving near-symmetric threshold voltages at sub-nm EOT.

  10. Through thick and thin: tuning the threshold voltage in organic field-effect transistors.

    Science.gov (United States)

    Martínez Hardigree, Josué F; Katz, Howard E

    2014-04-15

    Organic semiconductors (OSCs) constitute a class of organic materials containing densely packed, overlapping conjugated molecular moieties that enable charge carrier transport. Their unique optical, electrical, and magnetic properties have been investigated for use in next-generation electronic devices, from roll-up displays and radiofrequency identification (RFID) to biological sensors. The organic field-effect transistor (OFET) is the key active element for many of these applications, but the high values, poor definition, and long-term instability of the threshold voltage (V(T)) in OFETs remain barriers to realization of their full potential because the power and control circuitry necessary to compensate for overvoltages and drifting set points decrease OFET practicality. The drifting phenomenon has been widely observed and generally termed "bias stress." Research on the mechanisms responsible for this poor V(T) control has revealed a strong dependence on the physical order and chemical makeup of the interfaces between OSCs and adjacent materials in the OFET architecture. In this Account, we review the state of the art for tuning OFET performance via chemical designs and physical processes that manipulate V(T). This parameter gets to the heart of OFET operation, as it determines the voltage regimes where OFETs are either ON or OFF, the basis for the logical function of the devices. One obvious way to decrease the magnitude and variability of V(T) is to work with thinner and higher permittivity gate dielectrics. From the perspective of interfacial engineering, we evaluate various methods that we and others have developed, from electrostatic poling of gate dielectrics to molecular design of substituted alkyl chains. Corona charging of dielectric surfaces, a method for charging the surface of an insulating material using a constant high-voltage field, is a brute force means of shifting the effective gate voltage applied to a gate dielectric. A gentler and more

  11. Effect of single walled carbon nanotubes on the threshold voltage of dye based photovoltaic devices

    International Nuclear Information System (INIS)

    Chakraborty, S.; Manik, N.B.

    2016-01-01

    Carbon nanotubes are being widely used in organic photovoltaic (OPV) devices as their usage has been reported to enhance the device efficiency along with other related parameters. In this work we have studied the energy (E_c) effect of single walled carbon nanotubes (SWCNT) on the threshold voltage (V_t_h) and also on the trap states of dye based photovoltaic devices. SWCNT is added in a series of dyes such as Rose Bengal (RB), Methyl Red (MR), Malachite Green (MG) and Crystal Violet (CV). By analysing the steady state dark current–voltage (I–V) characteristics V_t_h and E_c is estimated for the different devices with and without addition of SWCNT. It is observed that on an average for all the dyes V_t_h is reduced by about 30% in presence of SWCNT. The trap energy E_c also reduces in case of all the dyes. The relation between V_t_h, E_c and total trap density is discussed. From the photovoltaic measurements it is seen that the different photovoltaic parameters change with addition of SWCNT to the dye based devices. Both the short circuit current density and fill factor are found to increase for all the dye based devices in presence of SWCNT.

  12. Prediction Model and Principle of End-of-Life Threshold for Lithium Ion Batteries Based on Open Circuit Voltage Drifts

    International Nuclear Information System (INIS)

    Cui, Yingzhi; Yang, Jie; Du, Chunyu; Zuo, Pengjian; Gao, Yunzhi; Cheng, Xinqun; Ma, Yulin; Yin, Geping

    2017-01-01

    Highlights: •Open circuit voltage evolution over ageing of lithium ion batteries is deciphered. •The mechanism responsible for the end-of-life (EOL) threshold is elaborated. •A new prediction model of EOL threshold with improved accuracy is developed. •This EOL prediction model is promising for the applications in electric vehicles. -- Abstract: The end-of-life (EOL) of a lithium ion battery (LIB) is defined as the time point when the LIB can no longer provide sufficient power or energy to accomplish its intended function. Generally, the EOL occurs abruptly when the degradation of a LIB reaches the threshold. Therefore, current prediction methods of EOL by extrapolating the early degradation behavior often result in significant errors. To address this problem, this paper analyzes the reason for the EOL threshold of a LIB with shallow depth of discharge. It is found that the sudden appearance of EOL threshold results from the drift of open circuit voltage (OCV) at the end of both shallow depth and full discharges. Further, a new EOL threshold prediction model with highly improved accuracy is developed based on the OCV drifts and their evolution mechanism, which can effectively avoid the misjudgment of EOL threshold. The accuracy of this EOL threshold prediction model is verified by comparing with experimental results. The EOL threshold prediction model can be applied to other battery chemistry systems and its possible application in electric vehicles is finally discussed.

  13. Remarkable reduction in the threshold voltage of pentacene-based thin film transistors with pentacene/CuPc sandwich configuration

    Directory of Open Access Journals (Sweden)

    Yi Li

    2014-06-01

    Full Text Available This study investigates the remarkable reduction in the threshold voltage (VT of pentacene-based thin film transistors with pentacene/copper phthalocyanine (CuPc sandwich configuration. This reduction is accompanied by increased mobility and lowered sub-threshold slope (S. Sandwich devices coated with a 5 nm layer of CuPc layer are compared with conventional top-contact devices, and results indicate that VT decreased significantly from −20.4 V to −0.2 V, that mobility increased from 0.18 cm2/Vs to 0.51 cm2/Vs, and that S was reduced from 4.1 V/dec to 2.9 V/dec. However, the on/off current ratio remains at 105. This enhanced performance could be attributed to the reduction in charge trap density by the incorporated CuPc layer. Results suggest that this method is simple and effectively generates pentacene-based organic thin film transistors with high mobility and low VT.

  14. Tuning the threshold voltage of carbon nanotube transistors by n-type molecular doping for robust and flexible complementary circuits

    Science.gov (United States)

    Wang, Huiliang; Wei, Peng; Li, Yaoxuan; Han, Jeff; Lee, Hye Ryoung; Naab, Benjamin D.; Liu, Nan; Wang, Chenggong; Adijanto, Eric; Tee, Benjamin C.-K.; Morishita, Satoshi; Li, Qiaochu; Gao, Yongli; Cui, Yi; Bao, Zhenan

    2014-01-01

    Tuning the threshold voltage of a transistor is crucial for realizing robust digital circuits. For silicon transistors, the threshold voltage can be accurately controlled by doping. However, it remains challenging to tune the threshold voltage of single-wall nanotube (SWNT) thin-film transistors. Here, we report a facile method to controllably n-dope SWNTs using 1H-benzoimidazole derivatives processed via either solution coating or vacuum deposition. The threshold voltages of our polythiophene-sorted SWNT thin-film transistors can be tuned accurately and continuously over a wide range. Photoelectron spectroscopy measurements confirmed that the SWNT Fermi level shifted to the conduction band edge with increasing doping concentration. Using this doping approach, we proceeded to fabricate SWNT complementary inverters by inkjet printing of the dopants. We observed an unprecedented noise margin of 28 V at VDD = 80 V (70% of 1/2VDD) and a gain of 85. Additionally, robust SWNT complementary metal−oxide−semiconductor inverter (noise margin 72% of 1/2VDD) and logic gates with rail-to-rail output voltage swing and subnanowatt power consumption were fabricated onto a highly flexible substrate. PMID:24639537

  15. Unified analytical threshold voltage model for non-uniformly doped dual metal gate fully depleted silicon-on-insulator MOSFETs

    Science.gov (United States)

    Rao, Rathnamala; Katti, Guruprasad; Havaldar, Dnyanesh S.; DasGupta, Nandita; DasGupta, Amitava

    2009-03-01

    The paper describes the unified analytical threshold voltage model for non-uniformly doped, dual metal gate (DMG) fully depleted silicon-on-insulator (FDSOI) MOSFETs based on the solution of 2D Poisson's equation. 2D Poisson's equation is solved analytically for appropriate boundary conditions using separation of variables technique. The solution is then extended to obtain the threshold voltage of the FDSOI MOSFET. The model is able to handle any kind of non-uniform doping, viz. vertical, lateral as well as laterally asymetric channel (LAC) profile in the SOI film in addition to the DMG structure. The analytical results are validated with the numerical simulations using the device simulator MEDICI.

  16. Cocaine Promotes Coincidence Detection and Lowers Induction Threshold during Hebbian Associative Synaptic Potentiation in Prefrontal Cortex.

    Science.gov (United States)

    Ruan, Hongyu; Yao, Wei-Dong

    2017-01-25

    Addictive drugs usurp neural plasticity mechanisms that normally serve reward-related learning and memory, primarily by evoking changes in glutamatergic synaptic strength in the mesocorticolimbic dopamine circuitry. Here, we show that repeated cocaine exposure in vivo does not alter synaptic strength in the mouse prefrontal cortex during an early period of withdrawal, but instead modifies a Hebbian quantitative synaptic learning rule by broadening the temporal window and lowers the induction threshold for spike-timing-dependent LTP (t-LTP). After repeated, but not single, daily cocaine injections, t-LTP in layer V pyramidal neurons is induced at +30 ms, a normally ineffective timing interval for t-LTP induction in saline-exposed mice. This cocaine-induced, extended-timing t-LTP lasts for ∼1 week after terminating cocaine and is accompanied by an increased susceptibility to potentiation by fewer pre-post spike pairs, indicating a reduced t-LTP induction threshold. Basal synaptic strength and the maximal attainable t-LTP magnitude remain unchanged after cocaine exposure. We further show that the cocaine facilitation of t-LTP induction is caused by sensitized D1-cAMP/protein kinase A dopamine signaling in pyramidal neurons, which then pathologically recruits voltage-gated l-type Ca 2+ channels that synergize with GluN2A-containing NMDA receptors to drive t-LTP at extended timing. Our results illustrate a mechanism by which cocaine, acting on a key neuromodulation pathway, modifies the coincidence detection window during Hebbian plasticity to facilitate associative synaptic potentiation in prefrontal excitatory circuits. By modifying rules that govern activity-dependent synaptic plasticity, addictive drugs can derail the experience-driven neural circuit remodeling process important for executive control of reward and addiction. It is believed that addictive drugs often render an addict's brain reward system hypersensitive, leaving the individual more susceptible to

  17. On-chip active gate bias circuit for MMIC amplifier applications with 100% threshold voltage variation compensation

    NARCIS (Netherlands)

    Hek, A.P. de; Busking, E.B.

    2006-01-01

    In this paper the design and performance of an on-chip active gate bias circuit for application in MMIC amplifiers, which gives 100% compensation for threshold variation and at the same time is insensitive to supply voltage variations, is discussed. Design equations have been given. In addition, the

  18. Two-dimensional threshold voltage model and design considerations for gate electrode work function engineered recessed channel nanoscale MOSFET: I

    International Nuclear Information System (INIS)

    Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj

    2009-01-01

    This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology

  19. Anomalous Threshold Voltage Variability of Nitride Based Charge Storage Nonvolatile Memory Devices

    Directory of Open Access Journals (Sweden)

    Meng Chuan Lee

    2013-01-01

    Full Text Available Conventional technology scaling is implemented to meet the insatiable demand of high memory density and low cost per bit of charge storage nonvolatile memory (NVM devices. In this study, effect of technology scaling to anomalous threshold voltage ( variability is investigated thoroughly on postcycled and baked nitride based charge storage NVM devices. After long annealing bake of high temperature, cell’s variability of each subsequent bake increases within stable distribution and found exacerbate by technology scaling. Apparent activation energy of this anomalous variability was derived through Arrhenius plots. Apparent activation energy (Eaa of this anomalous variability is 0.67 eV at sub-40 nm devices which is a reduction of approximately 2 times from 110 nm devices. Technology scaling clearly aggravates this anomalous variability, and this poses reliability challenges to applications that demand strict control, for example, reference cells that govern fundamental program, erase, and verify operations of NVM devices. Based on critical evidence, this anomalous variability is attributed to lateral displacement of trapped charges in nitride storage layer. Reliability implications of this study are elucidated. Moreover, potential mitigation methods are proposed to complement technology scaling to prolong the front-runner role of nitride based charge storage NVM in semiconductor flash memory market.

  20. Sensitivity of the threshold voltage of organic thin-film transistors to light and water

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Cong; Marinov, Ognian; Deen, M. Jamal; Selvaganapathy, Ponnambalam Ravi [McMaster University, 1280 Main Street West, Hamilton, Ontario L8S 4K1 (Canada); Wu, Yiliang [Xerox Research Centre, 2660 Speakman Dr., Mississauga, Ontario L5K 2L1 (Canada)

    2015-05-14

    Analyses of extensive experiments with organic thin-film transistors (OTFTs) indicate that the threshold voltage V{sub T} of an OTFT has a temporal differential sensitivity. In particular, V{sub T} changes initially by changing the light illumination intensity or making/removing a contact of water with the organic semiconductor. Keeping the conditions stationary, then the initial shift of V{sub T} diminishes, since the time dependence of V{sub T} gradually recovers the OTFT to the state before applying the change in the environmental conditions. While still causing a differential and time-variant shift of V{sub T}, the deionized water does not have a dramatic impact on OTFTs that use the polymer DKPP-βT (diketopyrrolopyrrole β-unsubstituted quaterthiophene) as the active semiconductor material. Observations for the impact of water are made from experiments with an OTFT that has a microfluidic channel on the top the electrical channel, with the water in the microfluidic channel in direct contact with the electrical channel of the OTFT. This arrangement of electrical and microfluidic channels is a novel structure of the microfluidic OTFT, suitable for sensing applications of liquid analytes by means of organic electronics.

  1. [Investigation of radiation dose for lower tube voltage CT using automatic exposure control].

    Science.gov (United States)

    Takata, Mitsuo; Matsubara, Kousuke; Koshida, Kichirou; Tarohda, Tohru

    2015-04-01

    The purpose of our study was to investigate radiation dose for lower tube voltage CT using automatic exposure control (AEC). An acrylic body phantom was used, and volume CT dose indices (CTDIvol) for tube voltages of 80, 100, 120, and 135 kV were investigated with combination of AEC. Average absorbed dose in the abdomen for 100 and 120 kV were also measured using thermoluminescence dosimeters. In addition, we examined noise characteristics under the same absorbed doses. As a result, the exposure dose was not decreased even when the tube voltage was lowered, and the organ absorbed dose value became approximately 30% high. And the noise was increased under the radiographic condition to be an equal absorbed dose. Therefore, radiation dose increases when AEC is used for lower tube voltage CT under the same standard deviation (SD) setting with 120 kV, and the optimization of SD setting is crucial.

  2. Analytical threshold voltage modeling of ion-implanted strained-Si double-material double-gate (DMDG) MOSFETs

    Science.gov (United States)

    Goel, Ekta; Singh, Balraj; Kumar, Sanjay; Singh, Kunal; Jit, Satyabrata

    2017-04-01

    Two dimensional threshold voltage model of ion-implanted strained-Si double-material double-gate MOSFETs has been done based on the solution of two dimensional Poisson's equation in the channel region using the parabolic approximation method. Novelty of the proposed device structure lies in the amalgamation of the advantages of both the strained-Si channel and double-material double-gate structure with a vertical Gaussian-like doping profile. The effects of different device parameters (such as device channel length, gate length ratios, germanium mole fraction) and doping parameters (such as projected range, straggle parameter) on threshold voltage of the proposed structure have been investigated. It is observed that the subthreshold performance of the device can be improved by simply controlling the doping parameters while maintaining other device parameters constant. The modeling results show a good agreement with the numerical simulation data obtained by using ATLAS™, a 2D device simulator from SILVACO.

  3. A current-mode voltage regulator with an embedded sub-threshold reference for a passive UHF RFID transponder

    International Nuclear Information System (INIS)

    Liu Zhongqi; Zhang Chun; Li Yongming; Wang Zhihua

    2010-01-01

    This paper presents a current-mode voltage regulator for a passive UHF RFID transponder. The passive tag power is extracted from RF energy through the RF-to-DC rectifier. Due to huge variations of the incoming RF power, the rectifier output voltage should be regulated to achieve a stable power supply. By accurately controlling the current flowing into the load with an embedded sub-threshold reference, the regulated voltage varies in a range of 1-1.3 V from -20 to 80 0 C, and a bandwidth of about 100 kHz is achieved for a fast power recovery. The circuit is fabricated in UMC 0.18 μm mixed-mode CMOS technology, and the current consumption is only 1 μA. (semiconductor integrated circuits)

  4. A current-mode voltage regulator with an embedded sub-threshold reference for a passive UHF RFID transponder

    Energy Technology Data Exchange (ETDEWEB)

    Liu Zhongqi [Department of Electronic Engineering, Tsinghua University, Beijing 100084 (China); Zhang Chun; Li Yongming; Wang Zhihua, E-mail: liu-zq04@mails.tsinghua.edu.c [Institute of Microelectronics, Tsinghua University, Beijing 100084 (China)

    2010-06-15

    This paper presents a current-mode voltage regulator for a passive UHF RFID transponder. The passive tag power is extracted from RF energy through the RF-to-DC rectifier. Due to huge variations of the incoming RF power, the rectifier output voltage should be regulated to achieve a stable power supply. By accurately controlling the current flowing into the load with an embedded sub-threshold reference, the regulated voltage varies in a range of 1-1.3 V from -20 to 80 {sup 0}C, and a bandwidth of about 100 kHz is achieved for a fast power recovery. The circuit is fabricated in UMC 0.18 {mu}m mixed-mode CMOS technology, and the current consumption is only 1 {mu}A. (semiconductor integrated circuits)

  5. A threshold-voltage model for small-scaled GaAs nMOSFET with stacked high-k gate dielectric

    Science.gov (United States)

    Chaowen, Liu; Jingping, Xu; Lu, Liu; Hanhan, Lu; Yuan, Huang

    2016-02-01

    A threshold-voltage model for a stacked high-k gate dielectric GaAs MOSFET is established by solving a two-dimensional Poisson's equation in channel and considering the short-channel, DIBL and quantum effects. The simulated results are in good agreement with the Silvaco TCAD data, confirming the correctness and validity of the model. Using the model, impacts of structural and physical parameters of the stack high-k gate dielectric on the threshold-voltage shift and the temperature characteristics of the threshold voltage are investigated. The results show that the stacked gate dielectric structure can effectively suppress the fringing-field and DIBL effects and improve the threshold and temperature characteristics, and on the other hand, the influence of temperature on the threshold voltage is overestimated if the quantum effect is ignored. Project supported by the National Natural Science Foundation of China (No. 61176100).

  6. A threshold-voltage model for small-scaled GaAs nMOSFET with stacked high-k gate dielectric

    International Nuclear Information System (INIS)

    Liu Chaowen; Xu Jingping; Liu Lu; Lu Hanhan; Huang Yuan

    2016-01-01

    A threshold-voltage model for a stacked high-k gate dielectric GaAs MOSFET is established by solving a two-dimensional Poisson's equation in channel and considering the short-channel, DIBL and quantum effects. The simulated results are in good agreement with the Silvaco TCAD data, confirming the correctness and validity of the model. Using the model, impacts of structural and physical parameters of the stack high-k gate dielectric on the threshold-voltage shift and the temperature characteristics of the threshold voltage are investigated. The results show that the stacked gate dielectric structure can effectively suppress the fringing-field and DIBL effects and improve the threshold and temperature characteristics, and on the other hand, the influence of temperature on the threshold voltage is overestimated if the quantum effect is ignored. (paper)

  7. Lowering the Permanent Establishment Threshold via the Anti-BEPS Convention: Much Ado about Nothing?

    NARCIS (Netherlands)

    M.F. de Wilde (Maarten)

    2017-01-01

    textabstractThe author examines the lowering of the threshold at which commissionaire, auxiliary, and building site and construction activities qualify as a permanent establishment under the Multilateral anti-BEPS Convention (MLI). With a view to countries planning to implement the provisions in

  8. Stress lowers the detection threshold for foul-smelling 2-mercaptoethanol.

    Science.gov (United States)

    Pacharra, Marlene; Schäper, Michael; Kleinbeck, Stefan; Blaszkewicz, Meinolf; Wolf, Oliver T; van Thriel, Christoph

    2016-01-01

    Previous studies have reported enhanced vigilance for threat-related information in response to acute stress. While it is known that acute stress modulates sensory systems in humans, its impact on olfaction and the olfactory detection of potential threats is less clear. Two psychophysical experiments examined, if acute stress lowers the detection threshold for foul-smelling 2-mercaptoethanol. Participants in Experiment 1 (N = 30) and Experiment 2 (N = 32) were randomly allocated to a control group or a stress group. Participants in the stress group underwent a purely psychosocial stressor (public mental arithmetic) in Experiment 1 and a stressor that combined a physically demanding task with social-evaluative threat in Experiment 2 (socially evaluated cold-pressor test). In both experiments, olfactory detection thresholds were repeatedly assessed by means of dynamic dilution olfactometry. Each threshold measurement consisted of three trials conducted using an ascending method of limits. Participants in the stress groups showed the expected changes in heart rate, salivary cortisol, and mood measures in response to stress. About 20 min after the stressor, participants in the stress groups could detect 2-mercaptoethanol at a lower concentration than participants in the corresponding control groups. Our results show that acute stress lowers the detection threshold for a malodor.

  9. Phased arrays: A strategy to lower the energy threshold for neutrinos

    Directory of Open Access Journals (Sweden)

    Wissel Stephanie

    2017-01-01

    Full Text Available In-ice radio arrays are optimized for detecting the highest energy, cosmogenic neutrinos expected to be produced though cosmic ray interactions with background photons. However, there are two expected populations of high energy neutrinos: the astrophysical flux observed by IceCube (~1 PeV and the cosmogenic flux (~ 1017 eV or 100 PeV. Typical radio arrays employ a noise-riding trigger, which limits their minimum energy threshold based on the background noise temperature of the ice. Phased radio arrays could lower the energy threshold by combining the signals from several channels before triggering, thereby improving the signal-to-noise at the trigger level. Reducing the energy threshold would allow radio experiments to more efficiently overlap with optical Cherenkov neutrino telescopes as well as for more efficient searches for cosmogenic neutrinos. We discuss the proposed technique and prototypical phased arrays deployed in an anechoic chamber and at Greenland’s Summit Station.

  10. A thermalization energy analysis of the threshold voltage shift in amorphous indium gallium zinc oxide thin film transistors under simultaneous negative gate bias and illumination

    Energy Technology Data Exchange (ETDEWEB)

    Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk [Electrical Engineering Division, Cambridge University, J J Thomson Avenue, Cambridge CB3 0FA (United Kingdom); Powell, M. J. [252, Valley Drive, Kendal LA9 7SL (United Kingdom)

    2014-04-07

    It has been previously observed that thin film transistors (TFTs) utilizing an amorphous indium gallium zinc oxide (a-IGZO) semiconducting channel suffer from a threshold voltage shift when subjected to a negative gate bias and light illumination simultaneously. In this work, a thermalization energy analysis has been applied to previously published data on negative bias under illumination stress (NBIS) in a-IGZO TFTs. A barrier to defect conversion of 0.65–0.75 eV is extracted, which is consistent with reported energies of oxygen vacancy migration. The attempt-to-escape frequency is extracted to be 10{sup 6}−10{sup 7} s{sup −1}, which suggests a weak localization of carriers in band tail states over a 20–40 nm distance. Models for the NBIS mechanism based on charge trapping are reviewed and a defect pool model is proposed in which two distinct distributions of defect states exist in the a-IGZO band gap: these are associated with states that are formed as neutrally charged and 2+ charged oxygen vacancies at the time of film formation. In this model, threshold voltage shift is not due to a defect creation process, but to a change in the energy distribution of states in the band gap upon defect migration as this allows a state formed as a neutrally charged vacancy to be converted into one formed as a 2+ charged vacancy and vice versa. Carrier localization close to the defect migration site is necessary for the conversion process to take place, and such defect migration sites are associated with conduction and valence band tail states. Under negative gate bias stressing, the conduction band tail is depleted of carriers, but the bias is insufficient to accumulate holes in the valence band tail states, and so no threshold voltage shift results. It is only under illumination that the quasi Fermi level for holes is sufficiently lowered to allow occupation of valence band tail states. The resulting charge localization then allows a negative threshold voltage

  11. Flexible, ferroelectric nanoparticle doped polymer dispersed liquid crystal devices for lower switching voltage and nanoenergy generation

    Science.gov (United States)

    Nimmy John, V.; Varanakkottu, Subramanyan Namboodiri; Varghese, Soney

    2018-06-01

    Flexible polymer dispersed liquid crystal (F-PDLC) devices were fabricated using transparent conducting ITO/PET film. Polymerization induced phase separation (PIPS) method was used for pure and ferroelectric BaTiO3 (BTO) and ZnO doped PDLC devices. The distribution of nanoparticles in the PDLC and the formation of micro cavities were studied using field emission scanning electron microscopy (FESEM). It was observed that the addition of ferroelectric BTO nanoparticles has reduced the threshold voltage (Vth) and saturation voltage (Vsat) of FNP-PDLC by 85% and 41% respectively due to the spontaneous polarization of ferroelectric nanoparticles. The ferroelectric properties of BTO and ZnO in the fabricated devices were investigated using dynamic contact electrostatic force microscopy (DC EFM). Flexing the device can generate a potential due to the piezo-tribo electric effect of the ferroelectric nanomaterial doped in the PDLC matrix, which could be utilized as an energy generating system. The switching voltage after multiple flexing was also studied and found to be in par with non-flexing situations.

  12. Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

    Science.gov (United States)

    Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

    2016-04-01

    We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

  13. 65NM sub-threshold 11T-SRAM for ultra low voltage applications

    DEFF Research Database (Denmark)

    Moradi, Farshad; Wisland, Dag T.; Aunet, Snorre

    In this paper a new ultra low power SRAM cell is proposed. In the proposed SRAM topology, additional circuitry has been added to a standard 6T-SRAM cell to improve the static noise margin (SNM) and the performance. Foundry models for a 65 nm standard CMOS process were used for obtaining reliable...... simulated results. The circuit was simulated for supply voltages from 0.2 V to 0.35 V verifying the robustness of the proposed circuit for different supply voltages. The simulations show a significant improvement in SNM and a 4X improvement in read speed still maintaining a satisfactory write noise margin...

  14. Lowering effect of radioactive irradiation on breakdown voltage and electron avalanche pulse characteristics

    International Nuclear Information System (INIS)

    Kawahashi, Akira; Nakano, Toru; Hosokawa, Tatsuzo; Miyoshi, Yosinori.

    1976-01-01

    In the time resolving measurement of the growing process and breakdown of electron avalanche in a gap of uniform electric field, the phenomenon that DC breakdown voltage slightly lowered was observed when β ray was irradiated as the initial electron source, as compared with unirradiated condition. Beta source used is 90 Sr- 90 Y of 2 mCi in radiative equilibrium. The experimental results and the examination are described in detail. In brief, the remarkable superposition of succeeding avalanche pulse over the preceeding avalanche pulse waveform was observed under the gap condition in which the breakdown voltage decreased in β-ray irradiation. Thus this superposition of avalanche pulses is considered as one of the causes of the breakdown voltage reduction. When β source is used as the initial electron source, the number of supplied initial electrons is very large as compared with unity, and at the same time, a great number of initial electrons can be supplied within the diffusion radius r of avalanche. Then the effect of initial electron number n 0 was considered by employing a diagram for breakdown scheme. The transition from Townsend type breakdown to streamer type breakdown occurs owing to increasing n 0 , and in that condition, the breakdown voltage lowers slightly. (Wakatsuki, Y)

  15. Threshold-Voltage Shifts in Organic Transistors Due to Self-Assembled Monolayers at the Dielectric: Evidence for Electronic Coupling and Dipolar Effects.

    Science.gov (United States)

    Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen

    2015-10-21

    The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.

  16. Lowering the Permanent Establishment Threshold via the Anti-BEPS Convention: Much Ado about Nothing?

    OpenAIRE

    Wilde, Maarten

    2017-01-01

    textabstractThe author examines the lowering of the threshold at which commissionaire, auxiliary, and building site and construction activities qualify as a permanent establishment under the Multilateral anti-BEPS Convention (MLI). With a view to countries planning to implement the provisions in this convention on permanent establishments within their tax treaty networks, the author argues for exercising a degree of caution. Some caution may be worthwhile to be exercised specifically with reg...

  17. Role of AlGaN/GaN interface traps on negative threshold voltage shift in AlGaN/GaN HEMT

    Science.gov (United States)

    Malik, Amit; Sharma, Chandan; Laishram, Robert; Bag, Rajesh Kumar; Rawal, Dipendra Singh; Vinayak, Seema; Sharma, Rajesh Kumar

    2018-04-01

    This article reports negative shift in the threshold-voltage in AlGaN/GaN high electron mobility transistor (HEMT) with application of reverse gate bias stress. The device is biased in strong pinch-off and low drain to source voltage condition for a fixed time duration (reverse gate bias stress), followed by measurement of transfer characteristics. Negative threshold voltage shift after application of reverse gate bias stress indicates the presence of more carriers in channel as compared to the unstressed condition. We propose the presence of AlGaN/GaN interface states to be the reason of negative threshold voltage shift, and developed a process to electrically characterize AlGaN/GaN interface states. We verified the results with Technology Computer Aided Design (TCAD) ATLAS simulation and got a good match with experimental measurements.

  18. Low tube voltage CT for improved detection of pancreatic cancer: detection threshold for small, simulated lesions

    International Nuclear Information System (INIS)

    Holm, Jon; Loizou, Louiza; Albiin, Nils; Kartalis, Nikolaos; Leidner, Bertil; Sundin, Anders

    2012-01-01

    Pancreatic ductal adenocarcinoma is associated with dismal prognosis. The detection of small pancreatic tumors which are still resectable is still a challenging problem. The aim of this study was to investigate the effect of decreasing the tube voltage from 120 to 80 kV on the detection of pancreatic tumors. Three scanning protocols was used; one using the standard tube voltage (120 kV) and current (160 mA) and two using 80 kV but with different tube currents (500 and 675 mA) to achieve equivalent dose (15 mGy) and noise (15 HU) as that of the standard protocol. Tumors were simulated into collected CT phantom images. The attenuation in normal parenchyma at 120 kV was set at 130 HU, as measured previously in clinical examinations, and the tumor attenuation was assumed to differ 20 HU and was set at 110HU. By scanning and measuring of iodine solution with different concentrations the corresponding tumor and parenchyma attenuation at 80 kV was found to be 185 and 219 HU, respectively. To objectively evaluate the differences between the three protocols, a multi-reader multi-case receiver operating characteristic study was conducted, using three readers and 100 cases, each containing 0–3 lesions. The highest reader averaged figure-of-merit (FOM) was achieved for 80 kV and 675 mA (FOM = 0,850), and the lowest for 120 kV (FOM = 0,709). There was a significant difference between the three protocols (p < 0,0001), when making an analysis of variance (ANOVA). Post-hoc analysis (students t-test) shows that there was a significant difference between 120 and 80 kV, but not between the two levels of tube currents at 80 kV. We conclude that when decreasing the tube voltage there is a significant improvement in tumor conspicuity

  19. Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

    Science.gov (United States)

    Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

    2018-04-01

    The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

  20. Analysis of the effect of interface state charges on threshold voltage and transconductance of 6H-SiC N-channel MOSFET

    International Nuclear Information System (INIS)

    Tang Xiaoyan; Zhang Yimen; Zhang Yuming

    2002-01-01

    The effect of interface state charges on the threshold voltage and transconductance of 6H-SiC N-channel metal-oxide semiconductor field-effect transistor (MOSFET) is analyzed based on the non-uniformly distributed interface state density in the band gap and incomplete impurity ionization in silicon carbide. The results show that the nonuniform distribution of interface state density cause not only the increment of the threshold voltage but also the degradation of the transconductance of MOSFET so that it is one of the important factors to influence the characteristics of SiC MOSFET

  1. Repeated restraint stress lowers the threshold for response to third ventricle CRF administration.

    Science.gov (United States)

    Harris, Ruth B S

    2017-03-01

    Rats and mice exposed to repeated stress or a single severe stress exhibit a sustained increase in energetic, endocrine, and behavioral response to subsequent novel mild stress. This study tested whether the hyper-responsiveness was due to a lowered threshold of response to corticotropin releasing factor (CRF) or an exaggerated response to a standard dose of CRF. Male Sprague-Dawley rats were subjected to 3h of restraint on each of 3 consecutive days (RRS) or were non-restrained controls. RRS caused a temporary hypophagia but a sustained reduction in body weight. Eight days after the end of restraint, rats received increasing third ventricle doses of CRF (0-3.0μg). The lowest dose of CRF (0.25μg) increased corticosterone release in RRS, but not control rats. Higher doses caused the same stimulation of corticosterone in the two groups of rats. Fifteen days after the end of restraint, rats were food deprived during the light period and received increasing third ventricle doses of CRF at the start of the dark period. The lowest dose of CRF inhibited food intake during the first hour following infusion in RRS, but not control rats. All other doses of CRF inhibited food intake to the same degree in both RRS and control rats. The lowered threshold of response to central CRF is consistent with the chronic hyper-responsiveness to CRF and mild stress in RRS rats during the post-restraint period. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The effect of lowering the threshold for diagnosis of impaired fasting glucose.

    Science.gov (United States)

    Kim, So Hun; Shim, Wan Sub; Kim, Eun A; Kim, Eun Joo; Lee, Seung Hee; Hong, Seong Bin; Kim, Yong Seong; Park, Shin Goo; Leem, Jong Han; Lim, Jong Whan; Lee, Hun-Jae; Nam, Moonsuk

    2008-04-30

    The aim of this study was to evaluate the effect of lowering the fasting plasma glucose (FPG) criteria for impaired fasting glucose (IFG) on the prevalence of IFG and the risk for the development of diabetes associated with IFG in Koreans. A total of 7,211 subjects who had normal glucose tolerance (NGT) or IFG were recruited. Subjects were evaluated at baseline and after two years follow up. Clinical data including total cholesterol, FPG and blood pressure were examined. Lowering the criteria for IFG from 6.1 mmol/L (110 mg/dL) to 5.6 mmol/L (100 mg/dL) increased the prevalence of IFG from 6.6% (494 subjects) to 24.4% (1829 subjects). After the 2 years follow up period, 91 subjects (1.3%) developed diabetes. Twenty one (0.3%) subjects developed diabetes among 5,382 NGT subjects and 70 (3.8%) subjects developed diabetes among 1,829 IFG (5.6-7.0 mmol/L) subjects. Lowering the IFG threshold from 6.1 mmol/L to 5.6 mmol/L resulted in a 18.4% decrease in specificity and 23.9% increase in sensitivity for predicting diabetes. The baseline FPG for predicting the development of diabetes after 2 years at a point on the receiver operating characteristic curve that was closest to the ideal 100% sensitivity and 100% specificity was 5.7 mmol/L (103 mg/dL). Lowering the FPG criterion of IFG should have benefits in predicting new onset type 2 diabetes mellitus in Koreans. The economic and health benefits of applying the new IFG criteria should be evaluated in future studies.

  3. Limitations of threshold voltage engineering of AlGaN/GaN heterostructures by dielectric interface charge density and manipulation by oxygen plasma surface treatments

    Science.gov (United States)

    Lükens, G.; Yacoub, H.; Kalisch, H.; Vescan, A.

    2016-05-01

    The interface charge density between the gate dielectric and an AlGaN/GaN heterostructure has a significant impact on the absolute value and stability of the threshold voltage Vth of metal-insulator-semiconductor (MIS) heterostructure field effect transistor. It is shown that a dry-etching step (as typically necessary for normally off devices engineered by gate-recessing) before the Al2O3 gate dielectric deposition introduces a high positive interface charge density. Its origin is most likely donor-type trap states shifting Vth to large negative values, which is detrimental for normally off devices. We investigate the influence of oxygen plasma annealing techniques of the dry-etched AlGaN/GaN surface by capacitance-voltage measurements and demonstrate that the positive interface charge density can be effectively compensated. Furthermore, only a low Vth hysteresis is observable making this approach suitable for threshold voltage engineering. Analysis of the electrostatics in the investigated MIS structures reveals that the maximum Vth shift to positive voltages achievable is fundamentally limited by the onset of accumulation of holes at the dielectric/barrier interface. In the case of the Al2O3/Al0.26Ga0.74N/GaN material system, this maximum threshold voltage shift is limited to 2.3 V.

  4. Competitive behavior of photons contributing to junction voltage jump in narrow band-gap semiconductor multi-quantum-well laser diodes at lasing threshold

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Liefeng, E-mail: fengliefeng@tju.edu.cn, E-mail: lihongru@nankai.edu.cn; Yang, Xiufang; Wang, Cunda; Yao, Dongsheng [Tianjin Key Laboratory of Low Dimensional Materials Physics and Preparing Technology, Faculty of Science, Tianjin University, Tianjin 300072 (China); Li, Yang [Business and Vocational College of Hainan, Haikou 570203 (China); Li, Ding; Hu, Xiaodong [Research Center for Wide Band Gap Semiconductors, State Key Laboratory for Artificial Microstructure and Mesoscopic Physics, School of Physics, Peking University, Beijing 100871 (China); Li, Hongru, E-mail: fengliefeng@tju.edu.cn, E-mail: lihongru@nankai.edu.cn [State Key Laboratory for Medicinal Chemistry and Biology, College of Pharmacy, Nankai University, Tianjin 300071 (China)

    2015-04-15

    The junction behavior of different narrow band-gap multi-quantum-well (MQW) laser diodes (LDs) confirmed that the jump in the junction voltage in the threshold region is a general characteristic of narrow band-gap LDs. The relative change in the 1310 nm LD is the most obvious. To analyze this sudden voltage change, the threshold region is divided into three stages by I{sub th}{sup l} and I{sub th}{sup u}, as shown in Fig. 2; I{sub th}{sup l} is the conventional threshold, and as long as the current is higher than this threshold, lasing exists and the IdV/dI-I plot drops suddenly; I{sub th}{sup u} is the steady lasing point, at which the separation of the quasi-Fermi levels of electron and holes across the active region (V{sub j}) is suddenly pinned. Based on the evolutionary model of dissipative structure theory, the rate equations of the photons in a single-mode LD were deduced in detail at I{sub th}{sup l} and I{sub th}{sup u}. The results proved that the observed behavior of stimulated emission suddenly substituting for spontaneous emission, in a manner similar to biological evolution, must lead to a sudden increase in the injection carriers in the threshold region, which then causes the sudden increase in the junction voltage in this region.

  5. Competitive behavior of photons contributing to junction voltage jump in narrow band-gap semiconductor multi-quantum-well laser diodes at lasing threshold

    International Nuclear Information System (INIS)

    Feng, Liefeng; Yang, Xiufang; Wang, Cunda; Yao, Dongsheng; Li, Yang; Li, Ding; Hu, Xiaodong; Li, Hongru

    2015-01-01

    The junction behavior of different narrow band-gap multi-quantum-well (MQW) laser diodes (LDs) confirmed that the jump in the junction voltage in the threshold region is a general characteristic of narrow band-gap LDs. The relative change in the 1310 nm LD is the most obvious. To analyze this sudden voltage change, the threshold region is divided into three stages by I th l and I th u , as shown in Fig. 2; I th l is the conventional threshold, and as long as the current is higher than this threshold, lasing exists and the IdV/dI-I plot drops suddenly; I th u is the steady lasing point, at which the separation of the quasi-Fermi levels of electron and holes across the active region (V j ) is suddenly pinned. Based on the evolutionary model of dissipative structure theory, the rate equations of the photons in a single-mode LD were deduced in detail at I th l and I th u . The results proved that the observed behavior of stimulated emission suddenly substituting for spontaneous emission, in a manner similar to biological evolution, must lead to a sudden increase in the injection carriers in the threshold region, which then causes the sudden increase in the junction voltage in this region

  6. Correlation of proton irradiation induced threshold voltage shifts to deep level traps in AlGaN/GaN heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.; Cardwell, D.; Sasikumar, A.; Arehart, A. R.; Ringel, S. A., E-mail: ringel.5@osu.edu [Department of Electrical and Computer Engineering, The Ohio State University, Columbus, Ohio 43210 (United States); Kyle, E. C. H.; Speck, J. S. [Department of Materials, University of California, Santa Barbara, California 93106-5050 (United States); Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D. [Department of Electrical Engineering and Computer Science, Vanderbilt University, Nashville, Tennessee 37235 (United States)

    2016-04-28

    The impact of proton irradiation on the threshold voltage (V{sub T}) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of V{sub T} was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 10{sup 14} cm{sup −2}. Silvaco Atlas simulations of V{sub T} shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different V{sub T} dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed V{sub T} shifts. The proton irradiation induced V{sub T} shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.

  7. Correlation of proton irradiation induced threshold voltage shifts to deep level traps in AlGaN/GaN heterostructures

    Science.gov (United States)

    Zhang, Z.; Cardwell, D.; Sasikumar, A.; Kyle, E. C. H.; Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D.; Speck, J. S.; Arehart, A. R.; Ringel, S. A.

    2016-04-01

    The impact of proton irradiation on the threshold voltage (VT) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of VT was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 1014 cm-2. Silvaco Atlas simulations of VT shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different VT dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed VT shifts. The proton irradiation induced VT shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.

  8. Correlation of proton irradiation induced threshold voltage shifts to deep level traps in AlGaN/GaN heterostructures

    International Nuclear Information System (INIS)

    Zhang, Z.; Cardwell, D.; Sasikumar, A.; Arehart, A. R.; Ringel, S. A.; Kyle, E. C. H.; Speck, J. S.; Chen, J.; Zhang, E. X.; Fleetwood, D. M.; Schrimpf, R. D.

    2016-01-01

    The impact of proton irradiation on the threshold voltage (V T ) of AlGaN/GaN heterostructures is systematically investigated to enhance the understanding of a primary component of the degradation of irradiated high electron mobility transistors. The value of V T was found to increase monotonically as a function of 1.8 MeV proton fluence in a sub-linear manner reaching 0.63 V at a fluence of 1 × 10 14  cm −2 . Silvaco Atlas simulations of V T shifts caused by GaN buffer traps using experimentally measured introduction rates, and energy levels closely match the experimental results. Different buffer designs lead to different V T dependences on proton irradiation, confirming that deep, acceptor-like defects in the GaN buffer are primarily responsible for the observed V T shifts. The proton irradiation induced V T shifts are found to depend on the barrier thickness in a linear fashion; thus, scaling the barrier thickness could be an effective way to reduce such degradation.

  9. "The Lower Threshold" phenomenon in tumor cells toward endogenous digitalis-like compounds: Responsible for tumorigenesis?

    Directory of Open Access Journals (Sweden)

    Heidrun Weidemann

    2012-01-01

    Full Text Available Since their first discovery as potential anti-cancer drugs decades ago, there is increasing evidence that digitalis-like compounds (DLC have anti-tumor effects. Less is known about endogenous DLC (EDLC metabolism and regulation. As stress hormones synthesized in and secreted from the adrenal gland, they likely take part in the hypothalamo-pituitary-adrenal (HPA axis. In a previous study, we revealed reduced EDLC concentrations in plasma and organs from immune-compromised animals and proposed that a similar situation of a deregulated HPA axis with "adrenal EDLF exhaustion" may contribute to tumorigenesis in chronic stress situations. Here, we put forward the hypothesis that a lowered EDLC response threshold of tumor cells as compared with normal cells increases the risk of tumorigenesis, especially in those individuals with reduced EDLC plasma concentrations after chronic stress exposure. We will evaluate this hypothesis by (a summarizing the effects of different DLC concentrations on tumor as compared with normal cells and (b reviewing some essential differences in the Na/K-ATPase of tumor as compared with normal cells (isoform pattern, pump activity, mutations of other signalosome receptors. We will conclude that (1 tumor cells, indeed, seem to have their individual "physiologic" EDLC response range that already starts at pmolar levels and (2 that individuals with markedly reduced (pmolar EDLC plasma levels are predisposed to cancer because these EDLC concentrations will predominantly stimulate the proliferation of tumor cells. Finally, we will summarize preliminary results from our department supporting this hypothesis.

  10. Quantitative Sensory Testing and Current Perception Threshold Testing in Patients With Chronic Pain Following Lower Extremity Fracture.

    Science.gov (United States)

    Griffioen, Mari A; Greenspan, Joel D; Johantgen, Meg; Von Rueden, Kathryn; O'Toole, Robert V; Dorsey, Susan G; Renn, Cynthia L

    2018-01-01

    Chronic pain is a significant problem for patients with lower extremity injuries. While pain hypersensitivity has been identified in many chronic pain conditions, it is not known whether patients with chronic pain following lower extremity fracture report pain hypersensitivity in the injured leg. To quantify and compare peripheral somatosensory function and sensory nerve activation thresholds in persons with chronic pain following lower extremity fractures with a cohort of persons with no history of lower extremity fractures. This was a cross-sectional study where quantitative sensory testing and current perception threshold testing were conducted on the injured and noninjured legs of cases and both legs of controls. A total of 14 cases and 28 controls participated in the study. Mean time since injury at the time of testing for cases was 22.3 (standard deviation = 12.1) months. The warmth detection threshold ( p = .024) and nerve activation thresholds at 2,000 Hz ( p sensory nerve function at the site of injury in patients with chronic pain following lower extremity fractures using quantitative sensory testing and current perception threshold testing.

  11. Development of CDMS-II Surface Event Rejection Techniques and Their Extensions to Lower Energy Thresholds

    Energy Technology Data Exchange (ETDEWEB)

    Hofer, Thomas James [Univ. of Minnesota, Minneapolis, MN (United States)

    2014-12-01

    The CDMS-II phase of the Cryogenic Dark Matter Search, a dark matter direct-detection experiment, was operated at the Soudan Underground Laboratory from 2003 to 2008. The full payload consisted of 30 ZIP detectors, totaling approximately 1.1 kg of Si and 4.8 kg of Ge, operated at temperatures of 50 mK. The ZIP detectors read out both ionization and phonon pulses from scatters within the crystals; channel segmentation and analysis of pulse timing parameters allowed e ective ducialization of the crystal volumes and background rejection su cient to set world-leading limits at the times of their publications. A full re-analysis of the CDMS-II data was motivated by an improvement in the event reconstruction algorithms which improved the resolution of ionization energy and timing information. The Ge data were re-analyzed using three distinct background-rejection techniques; the Si data from runs 125 - 128 were analyzed for the rst time using the most successful of the techniques from the Ge re-analysis. The results of these analyses prompted a novel \\mid-threshold" analysis, wherein energy thresholds were lowered but background rejection using phonon timing information was still maintained. This technique proved to have signi cant discrimination power, maintaining adequate signal acceptance and minimizing background leakage. The primary background for CDMS-II analyses comes from surface events, whose poor ionization collection make them di cult to distinguish from true nuclear recoil events. The novel detector technology of SuperCDMS, the successor to CDMS-II, uses interleaved electrodes to achieve full ionization collection for events occurring at the top and bottom detector surfaces. This, along with dual-sided ionization and phonon instrumentation, allows for excellent ducialization and relegates the surface-event rejection techniques of CDMS-II to a secondary level of background discrimination. Current and future SuperCDMS results hold great promise for mid- to low

  12. Proposed high voltage power supply for the ITER relevant lower hybrid current drive system

    International Nuclear Information System (INIS)

    Sharma, P.K.; Kazarian, F.; Garibaldi, P.; Gassman, T.; Artaud, J.F.; Bae, Y.S.; Belo, J.; Berger-By, G.; Bernard, J.M.; Cara, Ph.; Cardinali, A.; Castaldo, C.; Ceccuzzi, S.; Cesario, R.; Decker, J.; Delpech, L.; Ekedahl, A.; Garcia, J.; Goniche, M.; Guilhem, D.

    2011-01-01

    In the framework of the EFDA task HCD-08-03-01, the ITER lower hybrid current drive (LHCD) system design has been reviewed. The system aims to generate 24 MW of RF power at 5 GHz, of which 20 MW would be coupled to the plasmas. The present state of the art does not allow envisaging a unitary output of the klystrons exceeding 500 kW, so the project is based on 48 klystron units, leaving some margin when the transmission lines losses are taken into account. A high voltage power supply (HVPS), required to operate the klystrons, is proposed. A single HVPS would be used to feed and operate four klystrons in parallel configuration. Based on the above considerations, it is proposed to design and develop twelve HVPS, based on pulse step modulator (PSM) technology, each rated for 90 kV/90 A. This paper describes in details, the typical electrical requirements and the conceptual design of the proposed HVPS for the ITER LHCD system.

  13. Lower power by voltage stacking : a fine-grained system design approach

    NARCIS (Netherlands)

    Blutman, K.; Kapoor, A.; Martinez, J.G.; Fatemi, S.H.; Pineda de Gyvez, J.

    2016-01-01

    Stacking voltage domains on top of each other is a design approach that is getting the attention of engineering communities due to the implicit high efficiency of the power delivery. Previous works have shown voltage stacking at the core level only. In this paper we present a more involved approach

  14. Ascending-ramp biphasic waveform has a lower defibrillation threshold and releases less troponin I than a truncated exponential biphasic waveform.

    Science.gov (United States)

    Huang, Jian; Walcott, Gregory P; Ruse, Richard B; Bohanan, Scott J; Killingsworth, Cheryl R; Ideker, Raymond E

    2012-09-11

    We tested the hypothesis that the shape of the shock waveform affects not only the defibrillation threshold but also the amount of cardiac damage. Defibrillation thresholds were determined for 11 waveforms-3 ascending-ramp waveforms, 3 descending-ramp waveforms, 3 rectilinear first-phase biphasic waveforms, a Gurvich waveform, and a truncated exponential biphasic waveform-in 6 pigs with electrodes in the right ventricular apex and superior vena cava. The ascending, descending, and rectilinear waveforms had 4-, 8-, and 16-millisecond first phases and a 3.5-millisecond rectilinear second phase that was half the voltage of the first phase. The exponential biphasic waveform had a 60% first-phase and a 50% second-phase tilt. In a second study, we attempted to defibrillate after 10 seconds of ventricular fibrillation with a single ≈30-J shock (6 pigs successfully defibrillated with 8-millisecond ascending, 8-millisecond rectilinear, and truncated exponential biphasic waveforms). Troponin I blood levels were determined before and 2 to 10 hours after the shock. The lowest-energy defibrillation threshold was for the 8-milliseconds ascending ramp (14.6±7.3 J [mean±SD]), which was significantly less than for the truncated exponential (19.6±6.3 J). Six hours after shock, troponin I was significantly less for the ascending-ramp waveform (0.80±0.54 ng/mL) than for the truncated exponential (1.92±0.47 ng/mL) or the rectilinear waveform (1.17±0.45 ng/mL). The ascending ramp has a significantly lower defibrillation threshold and at ≈30 J causes 58% less troponin I release than the truncated exponential biphasic shock. Therefore, the shock waveform affects both the defibrillation threshold and the amount of cardiac damage.

  15. Rethinking avian response to Tamarix on the lower Colorado River: A threshold hypothesis

    Science.gov (United States)

    van Riper, Charles; Paxton, K.L.; O'brien, C.; Shafroth, P.B.; McGrath, L.J.

    2008-01-01

    Many of the world's large river systems have been greatly altered in the past century due to river regulation, agriculture, and invasion of introduced Tamarix spp. (saltcedar, tamarisk). These riverine ecosystems are known to provide important habitat for avian communities, but information on responses of birds to differing levels of Tamarix is not known. Past research on birds along the Colorado River has shown that avian abundance in general is greater in native than in non-native habitat. In this article, we address habitat restoration on the lower Colorado River by comparing abundance and diversity of avian communities at a matrix of different amounts of native and non-native habitats at National Wildlife Refuges in Arizona. Two major patterns emerged from this study: (1) Not all bird species responded to Tamarix in a similar fashion, and for many bird species, abundance was highest at intermediate Tamarix levels (40-60%), suggesting a response threshold. (2) In Tamarix-dominated habitats, the greatest increase in bird abundance occurred when small amounts of native vegetation were present as a component of that habitat. In fact, Tamarix was the best vegetation predictor of avian abundance when compared to vegetation density and canopy cover. Our results suggest that to positively benefit avian abundance and diversity, one cost-effective way to rehabilitate larger monoculture Tamarix stands would be to add relatively low levels of native vegetation (???20-40%) within homogenous Tamarix habitat. In addition, this could be much more cost effective and feasible than attempting to replace all Tamarix with native vegetation. ?? 2008 Society for Ecological Restoration International.

  16. Thermal injury lowers the threshold for radiation-induced neuroinflammation and cognitive dysfunction.

    Science.gov (United States)

    Cherry, Jonathan D; Williams, Jacqueline P; O'Banion, M Kerry; Olschowka, John A

    2013-10-01

    The consequences of radiation exposure alone are relatively well understood, but in the wake of events such as the World War II nuclear detonations and accidents such as Chernobyl, other critical factors have emerged that can substantially affect patient outcome. For example, ~70% of radiation victims from Hiroshima and Nagasaki received some sort of additional traumatic injury, the most common being thermal burn. Animal data has shown that the addition of thermal insult to radiation results in increased morbidity and mortality. To explore possible synergism between thermal injury and radiation on brain, C57BL/6J female mice were exposed to either 0 or 5 Gy whole-body gamma irradiation. Irradiation was immediately followed by a 10% total-body surface area full thickness thermal burn. Mice were sacrificed 6 h, 1 week or 6 month post-injury and brains and plasma were harvested for histology, mRNA analysis and cytokine ELISA. Plasma analysis revealed that combined injury synergistically upregulates IL-6 at acute time points. Additionally, at 6 h, combined injury resulted in a greater upregulation of the vascular marker, ICAM-1 and TNF-α mRNA. Enhanced activation of glial cells was also observed by CD68 and Iba1 immunohistochemistry at all time points. Additionally, doublecortin staining at 6 months showed reduced neurogenesis in all injury conditions. Finally, using a novel object recognition test, we observed that only mice with combined injury had significant learning and memory deficits. These results demonstrate that thermal injury lowers the threshold for radiation-induced neuroinflammation and long-term cognitive dysfunction.

  17. Sensory function assessment of the human male lower urinary tract using current perception thresholds.

    Science.gov (United States)

    Knüpfer, Stephanie C; Liechti, Martina D; Gregorini, Flavia; De Wachter, Stefan; Kessler, Thomas M; Mehnert, Ulrich

    2017-02-01

    To evaluate the feasibility and reliability of current perception threshold (CPT) measurement for sensory assessment of distinct locations in the male lower urinary tract (LUT). Twelve male subjects (>18 years) without LUT symptoms or medical comorbidities were eligible. CPTs were determined twice (interval: 7-20 days) at the bladder dome, trigone and the proximal, membranous, and distal urethra. Square wave electrical stimulation of 3 Hz/0.2 ms and 0.5 Hz/1 ms was applied using a transurethral 8F catheter placed under fluoroscopic control. Bladder volume was kept constant (60 mL) using a second 10F catheter. Repetitive measurements and reliability were assessed by analysis of variance (ANOVA) and intraclass correlation coefficient (ICC). The ANOVA revealed significant main effects for stimulation site (P = 0.008) and type of stimulation (P < 0.001) with lower CPTs for 0.5 Hz/1 ms compared to 3 Hz/0.2 ms. There was no significant effect for visit number (P = 0.061). CPTs were higher for bladder dome than for proximal (0.5 Hz/1 ms: P = 0.022; 3 Hz/0.2 ms: P = 0.022) and distal urethra (0.5 Hz/1 ms: P = 0.026; 3 Hz/0.2 ms: P = 0.030). Reliability of CPT measurements was excellent to good (ICC = 0.67-0.96) except for the bladder dome (5 Hz/1 ms: ICC = 0.45; 3 Hz/0.2 ms: ICC = 0.20) and distal urethra (3 Hz/0.2 ms: ICC = 0.57). CPTs can be reliably detected at different LUT locations. However, alert and compliant subjects are essential. CPTs of LUT may become a complementary assessment method providing information on responsiveness and sensitivity of afferent LUT nerves. This is especially relevant for urethral afferents, which are not covered by standard urodynamic investigations. Neurourol. Urodynam. 36:469-473, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Tactile, thermal, and electrical thresholds in patients with and without phantom limb pain after traumatic lower limb amputation

    Directory of Open Access Journals (Sweden)

    Li S

    2015-04-01

    Full Text Available Shengai Li,1,2 Danielle H Melton,1,2 Sheng Li1,2 1Department of Physical Medicine and Rehabilitation, University of Texas Health Science Center at Houston, Houston, TX, USA; 2Neurorehabilitation Research Laboratory, TIRR Memorial Hermann Research Center, Houston, TX, USA Purpose: To examine whether there is central sensitization in patients with phantom limb pain (PLP after traumatic limb amputation. Methods: Seventeen patients after unilateral lower limb amputation secondary to trauma were enrolled. Ten patients had chronic PLP, while the other seven patients had no PLP. Tactile-sensation threshold, cold- and warm-sensation thresholds, cold- and heat-pain thresholds, electrical-sensation threshold (EST, and electrical-pain threshold on the distal residual limb and the symmetrical site on the sound limb were measured in all tested patients. Their thresholds were compared within the PLP and non-PLP group, and between the groups. Results: The novel findings included: 1 electrical-pain threshold was only decreased in the sound limb in the PLP group and there was no difference between two limbs in the non-PLP group, suggesting central sensitization in patients with PLP; and 2 EST was increased on the affected limb as compared to the sound limb within the PLP group, but there were no significant differences in EST between the PLP and non-PLP group. There were in general no significant differences in other tested thresholds within the groups and between groups. Conclusion: Our results demonstrate central sensitization in the patients with PLP after traumatic limb amputation. Keywords: central sensitization, pain threshold, human

  19. Pyogenic Arthritis of the Ankle Joint Following a High-Voltage Electrical Burn in the Lower Extremity: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kuk Seon; Lee, Gyung Kyu; Kang, Ik Won; Hwang, Dae Hyun; Lee, Eil Seong; Min, Seon Jung; Han, You Mie [Dept. of Radiology, Hangang Scared Heart Hospital, Hallym University College of Medicine, Seoul (Korea, Republic of); Lee, Eil Seong [Dept.of Radiology, Gyeongju Hospital, Dongguk University College of Medicine, Gyeongju (Korea, Republic of)

    2011-04-15

    A high-voltage electrical burn caused extensive deep muscle injuries beneath a relatively small skin wound at the contact point. Hidden, undetected deep muscle injuries have a tendency for progressive tissue necrosis, which can lead to major amputations or sepsis. The radiologic features of this rare, sometimes life-threatening injury have occasionally been described in the literature. However, to the best of our knowledge, there have been no reports on a case of pyogenic arthritis of the ankle joint following a high-voltage electrical burn involving the lower extremity. We report a case of the pyogenic arthritis of the ankle joint following a high-voltage electrical burn involving the lower extremity.

  20. LTPS-TFT Pixel Circuit Compensating for TFT Threshold Voltage Shift and IR-Drop on the Power Line for AMOLED Displays

    Directory of Open Access Journals (Sweden)

    Ching-Lin Fan

    2012-01-01

    Full Text Available We propose a new pixel design for the active matrix organic light-emitting diode (AMOLED using low-temperature polycrystalline silicon thin-film transistors (LTPS-TFTs. The proposed pixel is composed of four switching TFTs, one driving TFT (DTFT, and one capacitor. The simulation results are performed by AIM-SPICE software. The error rate of OLED output current with (threshold voltage variation (0.3 V and power line drop by 1 V are improved to about 1.67% and 15%, respectively. Thus, the proposed pixel circuit can successfully overcome drawbacks suffered from DTFT threshold voltage deviation and IR-drop on power line.

  1. A thermalization energy analysis of the threshold voltage shift in amorphous indium gallium zinc oxide thin film transistors under positive gate bias stress

    Energy Technology Data Exchange (ETDEWEB)

    Niang, K. M.; Flewitt, A. J., E-mail: ajf@eng.cam.ac.uk [Electrical Engineering Division, Cambridge University, J J Thomson Avenue, Cambridge CB3 0FA (United Kingdom); Barquinha, P. M. C.; Martins, R. F. P. [i3N/CENIMAT, Department of Materials Science, Faculty of Science and Technology, Universidade NOVA de Lisboa and CEMOP/UNINOVA, Campus de Caparica, 2829-516 Caparica (Portugal); Cobb, B. [Holst Centre/TNO, High Tech Campus 31, 5656AE Eindhoven (Netherlands); Powell, M. J. [252, Valley Drive, Kendal LA9 7SL (United Kingdom)

    2016-02-29

    Thin film transistors (TFTs) employing an amorphous indium gallium zinc oxide (a-IGZO) channel layer exhibit a positive shift in the threshold voltage under the application of positive gate bias stress (PBS). The time and temperature dependence of the threshold voltage shift was measured and analysed using the thermalization energy concept. The peak energy barrier to defect conversion is extracted to be 0.75 eV and the attempt-to-escape frequency is extracted to be 10{sup 7} s{sup −1}. These values are in remarkable agreement with measurements in a-IGZO TFTs under negative gate bias illumination stress (NBIS) reported recently (Flewitt and Powell, J. Appl. Phys. 115, 134501 (2014)). This suggests that the same physical process is responsible for both PBS and NBIS, and supports the oxygen vacancy defect migration model that the authors have previously proposed.

  2. Threshold intensity factors as lower boundaries for crack propagation in ceramics

    Directory of Open Access Journals (Sweden)

    Walter Per-Ole

    2004-11-01

    Full Text Available Abstract Background Slow crack growth can be described in a v (crack velocity versus KI (stress intensity factor diagram. Slow crack growth in ceramics is attributed to corrosion assisted stress at the crack tip or at any pre-existing defect in the ceramic. The combined effect of high stresses at the crack tip and the presence of water or body fluid molecules (reducing surface energy at the crack tip induces crack propagation, which eventually may result in fatigue. The presence of a threshold in the stress intensity factor, below which no crack propagation occurs, has been the subject of important research in the last years. The higher this threshold, the higher the reliability of the ceramic, and consequently the longer its lifetime. Methods We utilize the Irwin K-field displacement relation to deduce crack tip stress intensity factors from the near crack tip profile. Cracks are initiated by indentation impressions. The threshold stress intensity factor is determined as the time limit of the tip stress intensity when the residual stresses have (nearly disappeared. Results We determined the threshold stress intensity factors for most of the all ceramic materials presently important for dental restorations in Europe. Of special significance is the finding that alumina ceramic has a threshold limit nearly identical with that of zirconia. Conclusion The intention of the present paper is to stress the point that the threshold stress intensity factor represents a more intrinsic property for a given ceramic material than the widely used toughness (bend strength or fracture toughness, which refers only to fast crack growth. Considering two ceramics with identical threshold limits, although with different critical stress intensity limits, means that both ceramics have identical starting points for slow crack growth. Fast catastrophic crack growth leading to spontaneous fatigue, however, is different. This growth starts later in those ceramic materials

  3. Effects of controlling the interface trap densities in InGaZnO thin-film transistors on their threshold voltage shifts

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, S-W.; Lee, J-T.; Roh, Y. [Sungkyunkwan University, Suwon (Korea, Republic of)

    2014-12-15

    In this paper, the threshold voltage stability characteristics of indium-gallium-zinc-oxide (IGZO) thin-film transistors (TFT) are discussed. The IGZO TFTs were found to induce a parallel threshold voltage (V{sub th}) shift with changing field effect mobility (μ{sub FE}) or a sub-threshold gate voltage swing (SS) due to various thermal annealing conditions. The IGZO TFT that was post-annealed in an O{sub 2} ambient was found to be more stable for use in oxide-based TFT devices and to have better performance characteristics, such as the on/off current ratio (I{sub on/off} ), SS, and V{sub th}, than other TFTs did. The mechanism for improving the V{sub th} stability in the post-annealed IGZO TFT is a decrease in the number of trap sites for the electrons and the weak oxygen bonding in the IGZO thin films. The device's performance could be significantly affected by adjusting the annealing conditions. This mechanism is closely related to that of modulation annealing, where the number of localized trapped carriers and defect centers at the interface or in the channel layer are reduced.

  4. Genetic absence rats have a lower threshold for limbic type of afterdischarges: a cortical stimulation study

    NARCIS (Netherlands)

    Tolmacheva, E.A.; Luijtelaar, E.L.J.M. van; Chepurnov, S.A.; Mares, P.; Luijtelaar, E.L.J.M. van; Kuznetsova, G.D.; Coenen, A.M.L.; Chepurnov, S.A.

    2004-01-01

    Classical theories on absence epilepsy suggest that a hyperexcitable cortex is a precondition for the occurrence of absence seizures. In the present experiment seizure thresholds and cortical epileptic afterdischarges (AD) were determined in a comparative study of genetically epileptic WAG/Rij,

  5. Ozone synthesis improves by increasing number density of plasma channels and lower voltage in a nonthermal plasma

    Science.gov (United States)

    Arif Malik, Muhammad; Hughes, David

    2016-04-01

    Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.

  6. Correlation of interface states/border traps and threshold voltage shift on AlGaN/GaN metal-insulator-semiconductor high-electron-mobility transistors

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tian-Li, E-mail: Tian-Li.Wu@imec.be; Groeseneken, Guido [imec, Kapeldreef 75, 3001 Leuven (Belgium); Department of Electrical Engineering, KU Leuven, Leuven (Belgium); Marcon, Denis; De Jaeger, Brice; Lin, H. C.; Franco, Jacopo; Stoffels, Steve; Van Hove, Marleen; Decoutere, Stefaan [imec, Kapeldreef 75, 3001 Leuven (Belgium); Bakeroot, Benoit [imec, Kapeldreef 75, 3001 Leuven (Belgium); Centre for Microsystems Technology, Ghent University, 9052 Gent (Belgium); Roelofs, Robin [ASM, Kapeldreef 75, 3001 Leuven (Belgium)

    2015-08-31

    In this paper, three electrical techniques (frequency dependent conductance analysis, AC transconductance (AC-g{sub m}), and positive gate bias stress) were used to evaluate three different gate dielectrics (Plasma-Enhanced Atomic Layer Deposition Si{sub 3}N{sub 4}, Rapid Thermal Chemical Vapor Deposition Si{sub 3}N{sub 4}, and Atomic Layer Deposition (ALD) Al{sub 2}O{sub 3}) for AlGaN/GaN Metal-Insulator-Semiconductor High-Electron-Mobility Transistors. From these measurements, the interface state density (D{sub it}), the amount of border traps, and the threshold voltage (V{sub TH}) shift during a positive gate bias stress can be obtained. The results show that the V{sub TH} shift during a positive gate bias stress is highly correlated to not only interface states but also border traps in the dielectric. A physical model is proposed describing that electrons can be trapped by both interface states and border traps. Therefore, in order to minimize the V{sub TH} shift during a positive gate bias stress, the gate dielectric needs to have a lower interface state density and less border traps. However, the results also show that the commonly used frequency dependent conductance analysis technique to extract D{sub it} needs to be cautiously used since the resulting value might be influenced by the border traps and, vice versa, i.e., the g{sub m} dispersion commonly attributed to border traps might be influenced by interface states.

  7. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  8. Room temperature resistive state switching with hysteresis in GdMnO3 thin film with low threshold voltage

    International Nuclear Information System (INIS)

    Nath, Rajib; Raychaudhuri, A. K.; Mukovskii, Ya. M.; Andreev, N.; Chichkov, Vladimir

    2014-01-01

    In this paper, we report a room temperature resistive state switching with hysteresis, in a thin film of GdMnO 3 grown on NdGaO 3 substrate. The switched states have a resistance ratio ≈10 3 . The switching is unipolar in nature, with a low set voltage <3 V, while the reset voltage <0.3 V. The switching occurs between a high resistance polaronic insulating state and a low resistance metallic state. The resistance state transition has been ascribed to an electronic mechanism that originates from co-existing phases (created by charge disproportionation) that can undergo a percolative transition enabled by the applied bias

  9. Total dose behavior of partially depleted SOI dynamic threshold voltage MOS (DTMOS) for very low supply voltage applications (0.6 - 1 V)

    International Nuclear Information System (INIS)

    Ferlet-Cavrois, V.; Musseau, O.; Leray, J.L.; Faynot, O.; Raynaud, C.; Pelloie, J.L.

    1999-01-01

    In this paper, we presented two DTMOS architectures processed with a partially depleted SOI technology. The first architecture, DTMOS without limiting transistor, is dedicated to ultra-low voltage applications, at 0.6 V. For 1V applications, the second architecture, DTMOS with limiting transistor, needs an additional transistor to limit the body-source diode current. The total dose irradiation of both DTMOS architectures induces no change of the drain current, but an increase of the body-source diode current. Total dose induced trapped charge in the buried oxide increases the body potential of the DTMOS transistor. It induces an increase of the current flow at the back interface of the silicon film. Irradiation of complex circuits using DTMOS transistors would lead to a degradation of the stand-by consumption. (authors)

  10. Lowering of the cavitation threshold in aqueous suspensions of porous silicon nanoparticles for sonodynamic therapy applications

    Energy Technology Data Exchange (ETDEWEB)

    Sviridov, A. P., E-mail: asagittarius89@gmail.com; Osminkina, L. A. [Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Nikolaev, A. L. [Faculty of Chemistry, Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Kudryavtsev, A. A. [Institute of Theoretical and Experimental Biophysics, Russian Academy of Science, 142290 Pushino, Moscow Region (Russian Federation); Vasiliev, A. N. [Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Theoretical Physics and Applied Mathematics Department, Ural Federal University, 620002 Ekaterinburg (Russian Federation); Timoshenko, V. Yu. [Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Tomsk State University, 634050 Tomsk (Russian Federation)

    2015-09-21

    A significant decrease of the cavitation threshold in aqueous suspensions of porous silicon nanoparticles (PSi NPs) with sizes about 100 nm as compared with pure water was observed for ultrasound irradiation (USI) with therapeutic frequency (0.88 MHz) and intensities (about 1 W/cm{sup 2}). This effect is explained by porous morphology of PSi NPs, which promotes the nucleation of cavitation bubbles. In vitro experiments revealed a suppression of the proliferation of cancer cells with the introduced PSi NPs after exposure to USI related to the enhanced cavitation processes, which led to the cell destruction. The obtained results demonstrate that PSi NPs are prospective for applications as sonosensitizers in mild cancer therapy.

  11. A 32 kb 9T near-threshold SRAM with enhanced read ability at ultra-low voltage operation

    Science.gov (United States)

    Kim, Tony Tae-Hyoung; Lee, Zhao Chuan; Do, Anh Tuan

    2018-01-01

    Ultra-low voltage SRAMs are highly sought-after in energy-limited systems such as battery-powered and self-harvested SoCs. However, ultra-low voltage operation diminishes SRAM read bitline (RBL) sensing margin significantly. This paper tackles this issue by presenting a novel 9T cell with data-independent RBL leakage in combination with an RBL boosting technique for enhancing the sensing margin. The proposed technique automatically tracks process, temperature and voltage (PVT) variations for robust sensing margin enhancement. A test chip fabricated in 65 nm CMOS technology shows that the proposed scheme significantly enlarges the sensing margin compared to the conventional bitline sensing scheme. It also achieves the minimum operating voltage of 0.18 V and the minimum energy consumption of 0.92 J/access at 0.4 V. He received 2016 International Low Power Design Contest Award from ISLPED, a best paper award at 2014 and 2011 ISOCC, 2008 AMD/CICC Student Scholarship Award, 2008 Departmental Research Fellowship from Univ. of Minnesota, 2008 DAC/ISSCC Student Design Contest Award, 2008, 2001, and 1999 Samsung Humantec Thesis Award and, 2005 ETRI Journal Paper of the Year Award. He is an author/co-author of +100 journal and conference papers and has 17 US and Korean patents registered. His current research interests include low power and high performance digital, mixed- mode, and memory circuit design, ultra-low voltage circuits and systems design, variation and aging tolerant circuits and systems, and circuit techniques for 3D ICs. He serves as an associate editor of IEEE Transactions on VLSI Systems. He is an IEEE senior member and the Chair of IEEE Solid-State Circuits Society Singapore Chapter. He has served numerous conferences as a committee member.

  12. LOWERING ICECUBE'S ENERGY THRESHOLD FOR POINT SOURCE SEARCHES IN THE SOUTHERN SKY

    Energy Technology Data Exchange (ETDEWEB)

    Aartsen, M. G. [Department of Physics, University of Adelaide, Adelaide, 5005 (Australia); Abraham, K. [Physik-department, Technische Universität München, D-85748 Garching (Germany); Ackermann, M. [DESY, D-15735 Zeuthen (Germany); Adams, J. [Department of Physics and Astronomy, University of Canterbury, Private Bag 4800, Christchurch (New Zealand); Aguilar, J. A.; Ansseau, I. [Université Libre de Bruxelles, Science Faculty CP230, B-1050 Brussels (Belgium); Ahlers, M. [Department of Physics and Wisconsin IceCube Particle Astrophysics Center, University of Wisconsin, Madison, WI 53706 (United States); Ahrens, M. [Oskar Klein Centre and Department of Physics, Stockholm University, SE-10691 Stockholm (Sweden); Altmann, D.; Anton, G. [Erlangen Centre for Astroparticle Physics, Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91058 Erlangen (Germany); Andeen, K. [Department of Physics, Marquette University, Milwaukee, WI, 53201 (United States); Anderson, T.; Arlen, T. C. [Department of Physics, Pennsylvania State University, University Park, PA 16802 (United States); Archinger, M.; Baum, V. [Institute of Physics, University of Mainz, Staudinger Weg 7, D-55099 Mainz (Germany); Arguelles, C. [Department of Physics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Auffenberg, J. [III. Physikalisches Institut, RWTH Aachen University, D-52056 Aachen (Germany); Bai, X. [Physics Department, South Dakota School of Mines and Technology, Rapid City, SD 57701 (United States); Barwick, S. W. [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Bay, R., E-mail: jacob.feintzeig@gmail.com, E-mail: naoko@icecube.wisc.edu [Department of Physics, University of California, Berkeley, CA 94720 (United States); Collaboration: IceCube Collaboration; and others

    2016-06-20

    Observation of a point source of astrophysical neutrinos would be a “smoking gun” signature of a cosmic-ray accelerator. While IceCube has recently discovered a diffuse flux of astrophysical neutrinos, no localized point source has been observed. Previous IceCube searches for point sources in the southern sky were restricted by either an energy threshold above a few hundred TeV or poor neutrino angular resolution. Here we present a search for southern sky point sources with greatly improved sensitivities to neutrinos with energies below 100 TeV. By selecting charged-current ν{sub μ} interacting inside the detector, we reduce the atmospheric background while retaining efficiency for astrophysical neutrino-induced events reconstructed with sub-degree angular resolution. The new event sample covers three years of detector data and leads to a factor of 10 improvement in sensitivity to point sources emitting below 100 TeV in the southern sky. No statistically significant evidence of point sources was found, and upper limits are set on neutrino emission from individual sources. A posteriori analysis of the highest-energy (∼100 TeV) starting event in the sample found that this event alone represents a 2.8 σ deviation from the hypothesis that the data consists only of atmospheric background.

  13. Influence of Optimization of Process Parameters on Threshold Voltage for Development of HfO2/TiSi2 18 nm PMOS

    Directory of Open Access Journals (Sweden)

    Atan N.

    2016-01-01

    Full Text Available Manufacturing a 18-nm transistor requires a variety of parameters, materials, temperatures, and methods. In this research, HfO2 was used as the gate dielectric ad TiO2 was used as the gate material. The transistor HfO2/TiSi2 18-nm PMOS was invented using SILVACO TCAD. Ion implantation was adopted in the fabrication process for the method’s practicality and ability to be used to suppress short channel effects. The study involved ion implantation methods: compensation implantation, halo implantation energy, halo tilt, and source–drain implantation. Taguchi method is the best optimization process for a threshold voltage of HfO2/TiSi2 18-nm PMOS. In this case, the method adopted was Taguchi orthogonal array L9. The process parameters (ion implantations and noise factors were evaluated by examining the Taguchi’s signal-to-noise ratio (SNR and nominal-the-best for the threshold voltage (VTH. After optimization, the result showed that the VTH value of the 18-nm PMOS device was -0.291339.

  14. An analytical threshold voltage model for a short-channel dual-metal-gate (DMG) recessed-source/drain (Re-S/D) SOI MOSFET

    Science.gov (United States)

    Saramekala, G. K.; Santra, Abirmoya; Dubey, Sarvesh; Jit, Satyabrata; Tiwari, Pramod Kumar

    2013-08-01

    In this paper, an analytical short-channel threshold voltage model is presented for a dual-metal-gate (DMG) fully depleted recessed source/drain (Re-S/D) SOI MOSFET. For the first time, the advantages of recessed source/drain (Re-S/D) and of dual-metal-gate structure are incorporated simultaneously in a fully depleted SOI MOSFET. The analytical surface potential model at Si-channel/SiO2 interface and Si-channel/buried-oxide (BOX) interface have been developed by solving the 2-D Poisson’s equation in the channel region with appropriate boundary conditions assuming parabolic potential profile in the transverse direction of the channel. Thereupon, a threshold voltage model is derived from the minimum surface potential in the channel. The developed model is analyzed extensively for a variety of device parameters like the oxide and silicon channel thicknesses, thickness of source/drain extension in the BOX, control and screen gate length ratio. The validity of the present 2D analytical model is verified with ATLAS™, a 2D device simulator from SILVACO Inc.

  15. 22q11.2 deletion syndrome lowers seizure threshold in adult patients without epilepsy.

    Science.gov (United States)

    Wither, Robert G; Borlot, Felippe; MacDonald, Alex; Butcher, Nancy J; Chow, Eva W C; Bassett, Anne S; Andrade, Danielle M

    2017-06-01

    Previous studies examining seizures in patients with 22q11.2 deletion syndrome (22q11.2DS) have focused primarily on children and adolescents. In this study we investigated the prevalence and characteristics of seizures and epilepsy in an adult 22q11.2DS population. The medical records of 202 adult patients with 22q11.2DS were retrospectively reviewed for documentation of seizures, electroencephalography (EEG) reports, and magnetic resonance imaging (MRI) findings. Epilepsy status was assigned in accordance with 2010 International League Against Epilepsy Classification. Of 202 patients, 32 (15.8%) had a documented history of seizure. Of these 32, 23 (71.8%) had acute symptomatic seizures, usually associated with hypocalcemia and/or antipsychotic or antidepressant use. Nine patients (9/32, 28%; 9/202, 4%) met diagnostic criteria for epilepsy. Two patients had genetic generalized epilepsy; two patients had focal seizures of unknown etiology; two had epilepsy due to malformations of cortical development; in two the epilepsy was due to acquired structural changes; and in one patient the epilepsy could not be further classified. Similarly to children, the prevalence of epilepsy and acute symptomatic seizures in adults with 22q11.2DS is higher than in the general population. Hypocalcemia continues to be a risk factor for adults, but differently from kids, the main cause of seizures in adults with 22q11.2DS is exposure to antipsychotics and antidepressants. Further prospective studies are warranted to investigate how 22q11.2 microdeletion leads to an overall decreased seizure threshold. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  16. Depth of interaction and bias voltage depenence of the spectral response in a pixellated CdTe detector operating in time-over-threshold mode subjected to monochromatic X-rays

    Science.gov (United States)

    Fröjdh, E.; Fröjdh, C.; Gimenez, E. N.; Maneuski, D.; Marchal, J.; Norlin, B.; O'Shea, V.; Stewart, G.; Wilhelm, H.; Modh Zain, R.; Thungström, G.

    2012-03-01

    High stopping power is one of the most important figures of merit for X-ray detectors. CdTe is a promising material but suffers from: material defects, non-ideal charge transport and long range X-ray fluorescence. Those factors reduce the image quality and deteriorate spectral information. In this project we used a monochromatic pencil beam collimated through a 20μm pinhole to measure the detector spectral response in dependance on the depth of interaction. The sensor was a 1mm thick CdTe detector with a pixel pitch of 110μm, bump bonded to a Timepix readout chip operating in Time-Over-Threshold mode. The measurements were carried out at the Extreme Conditions beamline I15 of the Diamond Light Source. The beam was entering the sensor at an angle of \\texttildelow20 degrees to the surface and then passed through \\texttildelow25 pixels before leaving through the bottom of the sensor. The photon energy was tuned to 77keV giving a variation in the beam intensity of about three orders of magnitude along the beam path. Spectra in Time-over-Threshold (ToT) mode were recorded showing each individual interaction. The bias voltage was varied between -30V and -300V to investigate how the electric field affected the spectral information. For this setup it is worth noticing the large impact of fluorescence. At -300V the photo peak and escape peak are of similar height. For high bias voltages the spectra remains clear throughout the whole depth but for lower voltages as -50V, only the bottom part of the sensor carries spectral information. This is an effect of the low hole mobility and the longer range the electrons have to travel in a low field.

  17. Olfaction and environment: Tsimane' of Bolivian rainforest have lower threshold of odor detection than industrialized German people.

    Directory of Open Access Journals (Sweden)

    Agnieszka Sorokowska

    Full Text Available Olfactory sensitivity varies between individuals. However, data regarding cross-cultural and inter-group differences are scarce. We compared the thresholds of odor detection of the traditional society of Tsimane' (native Amazonians of the Bolivian rainforest; n = 151 and people living in Dresden (Germany; n = 286 using "Sniffin' Sticks" threshold subtest. Tsimane' detected n-butanol at significantly lower concentrations than the German subjects. The distribution of thresholds of the Tsimane' was very specific, with 25% of Tsimane' obtaining better results in the olfactory test than any member of the German group. These data suggest that differences in olfactory sensitivity seem to be especially salient between industrialized and non-industrialized populations inhabiting different environmental conditions. We hypothesize that the possible sources of such differences are: (i the impact of pollution which impairs the olfactory abilities of people from industrialized countries; (ii better training of olfaction because of the higher importance of smell in traditional populations; (iii environmental pressures shaping olfactory abilities in these populations.

  18. Exercise Lowers Threshold and Increases Severity, but Wheat-Dependent, Exercise-Induced Anaphylaxis Can Be Elicited at Rest

    DEFF Research Database (Denmark)

    Christensen, Morten J.; Eller, Esben; Mortz, Charlotte G.

    2018-01-01

    of specific IgE (sIgE) were followed by an oral food challenge with gluten at rest and in combination with treadmill exercise. Results: A clinical reaction was elicited in 47 of 71 (66%), and in 26 of these (37%) the reaction could be elicited at rest. The median dose required at rest was 48 g (8-80 g...... with exercise. Conclusions: A challenge test with gluten at rest and combined exercise is a safe confirmatory test for WDEIA. A reaction can be elicited at rest (without exercise), but exercise is able to lower the threshold and increase the severity....

  19. Determination of the threshold-energy surface for copper using in-situ electrical-resistivity measurements in the high-voltage electron microscope

    International Nuclear Information System (INIS)

    King, W.E.; Merkle, K.L.; Meshii, M.

    1981-01-01

    A detailed study of the anisotropy of the threshold energy for Frenkel-pair production in copper was carried out experimentally, using in-situ electrical-resistivity measurements in the high-voltage electron microscope. These electrical-resistivity measurements, which are sensitive to small changes in point-defect concentration, were used to determine the damage or defect production rate. Damage-rate measurements in copper single crystals were carried out for approx.40 incident electron-beam directions and six electron energies from 0.4 to 1.1 MeV. The total cross section for Frenkel-pair production is proportional to the measured damage rate and can be theoretically calculated if the form of the threshold-energy surface is known. Trial threshold-energy surfaces were systematically altered until a ''best fit'' of the calculated to the measured total cross sections for Frenkel-pair production was obtained. The average threshold energy of this surface is 28.5 eV. The minimum threshold energy is 18 +- 2 eV and is located near . A ring of very high threshold energy (>50 eV) surrounds the direction. A damage function for single-defect production was derived from this surface and was applied to defect-production calculations at higher recoil energies. This function rises rather sharply from a value of zero at 17 eV to 0.8 at 42 eV. It has the value of 0.5 at 24.5 eV. Above 30 eV the slope of the curve begins to decrease, reflecting the presence of the high-energy regions of the threshold-energy surface. Both topographical and quantitative comparisons of the present surface with those in the literature were presented. Based on a chi 2 goodness-of-fit test, the present surface was found to predict the experimentally observed total cross sections for Frenkel-pair production significantly better than the other available surfaces. Also, the goodness of fit varied substantially less with energy and direction for the present surface

  20. Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

    International Nuclear Information System (INIS)

    Sen, A.K.; Bhattacharya, S.

    2006-12-01

    In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

  1. Control of the threshold voltage by using the oxygen partial pressure in sputter-deposited InGaZnO4 thin-film transistors

    International Nuclear Information System (INIS)

    Ahn, Jeung Sun; Lee, Kwang Bae

    2012-01-01

    We investigate the controllability of the threshold voltage (V th ) by varying the O 2 partial pressure in sputter-deposited of InGaZnO 4 thin-film transistors (IGZO TFTs). We showed that the V th values could be linearly controlled from a depletion-type of V th ∼ -6 V to an enhancement-type of V th ∼ 2 V, without any abrupt change in μ sat , I on/off , and S, by only changing the O 2 partial pressure in a fixed region of the Ar partial pressure. Such V th controllability is thought to be due to the proper reduction of defect states and, in turn, to the preservation of high-performance TFT behavior.

  2. Effects of surface plasma treatment on threshold voltage hysteresis and instability in metal-insulator-semiconductor (MIS) AlGaN/GaN heterostructure HEMTs

    Science.gov (United States)

    Zaidi, Z. H.; Lee, K. B.; Roberts, J. W.; Guiney, I.; Qian, H.; Jiang, S.; Cheong, J. S.; Li, P.; Wallis, D. J.; Humphreys, C. J.; Chalker, P. R.; Houston, P. A.

    2018-05-01

    In a bid to understand the commonly observed hysteresis in the threshold voltage (VTH) in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors during forward gate bias stress, we have analyzed a series of measurements on devices with no surface treatment and with two different plasma treatments before the in-situ Al2O3 deposition. The observed changes between samples were quasi-equilibrium VTH, forward bias related VTH hysteresis, and electrical response to reverse bias stress. To explain these effects, a disorder induced gap state model, combined with a discrete level donor, at the dielectric/semiconductor interface was employed. Technology Computer-Aided Design modeling demonstrated the possible differences in the interface state distributions that could give a consistent explanation for the observations.

  3. Annealing, temperature, and bias-induced threshold voltage instabilities in integrated E/D-mode InAlN/GaN MOS HEMTs

    Science.gov (United States)

    Blaho, M.; Gregušová, D.; Haščík, Š.; Ťapajna, M.; Fröhlich, K.; Šatka, A.; Kuzmík, J.

    2017-07-01

    Threshold voltage instabilities are examined in self-aligned E/D-mode n++ GaN/InAlN/GaN MOS HEMTs with a gate length of 2 μm and a source-drain spacing of 10 μm integrated in a logic invertor. The E-mode MOS HEMT technology is based on selective dry etching of the cap layer which is combined with Al2O3 grown by atomic-layer deposition at 380 K. In the D-mode MOS HEMT, the gate recessing is skipped. The nominal threshold voltage (VT) of E/D-mode MOS HEMTs was 0.6 and -3.4 V, respectively; the technology invariant maximal drain current was about 0.45 A/mm. Analysis after 580 K/15 min annealing step and at an elevated temperature up to 430 K reveals opposite device behavior depending on the HEMT operational mode. It was found that the annealing step decreases VT of the D-mode HEMT due to a reduced electron injection into the modified oxide. On the other hand, VT of the E-mode HEMT increases with reduced density of surface donors at the oxide/InAlN interface. Operation at the elevated temperature produces reversible changes: increase/decrease in the VT of the respective D-/E-mode HEMTs. Additional bias-induced experiments exhibit complex trapping phenomena in the devices: Coaction of shallow (˜0.1 eV below EC) traps in the GaN buffer and deep levels at the oxide/InAlN interface was identified for the E-mode device, while trapping in the D-mode HEMTs was found to be consistent with a thermo-ionic injection of electrons into bulk oxide traps (˜0.14 eV above EF) and trapping at the oxide/GaN cap interface states.

  4. Multiple Colliding Electromagnetic Pulses: A Way to Lower the Threshold of e+e- Pair Production from Vacuum

    International Nuclear Information System (INIS)

    Bulanov, S. S.; Mur, V. D.; Narozhny, N. B.; Nees, J.; Popov, V. S.

    2010-01-01

    The scheme of a simultaneous multiple pulse focusing on one spot naturally arises from the structural features of projected new laser systems, such as the Extreme Light Infrastructure (ELI) and High Power laser Energy Research (HiPER). It is shown that the multiple pulse configuration is beneficial for observing e + e - pair production from a vacuum under the action of sufficiently strong electromagnetic fields. The field of focused pulses is described using a realistic three-dimensional model based on an exact solution of the Maxwell equations. The e + e - pair production threshold in terms of electromagnetic field energy can be substantially lowered if, instead of one or even two colliding pulses, multiple pulses are focused on one spot. The multiple pulse interaction geometry gives rise to subwavelength field features in the focal region. These features result in the production of extremely short e + e - bunches.

  5. CLA supplementation and aerobic exercise lower blood triacylglycerol, but have no effect on peak oxygen uptake or cardiorespiratory fatigue thresholds.

    Science.gov (United States)

    Jenkins, Nathaniel D M; Buckner, Samuel L; Cochrane, Kristen C; Bergstrom, Haley C; Goldsmith, Jacob A; Weir, Joseph P; Housh, Terry J; Cramer, Joel T

    2014-09-01

    This study examined the effects of 6 weeks of conjugated linoleic acid (CLA) supplementation and moderate aerobic exercise on peak oxygen uptake (VO2 peak), the gas exchange threshold (GET), the respiratory compensation point (RCP), and serum concentrations of cholesterol, triacylglycerol, and glucose in humans. Thirty-four untrained to moderately trained men (mean ± SD; age = 21.5 ± 2.8 years; mass = 77.2 ± 9.5 kg) completed this double-blind, placebo controlled study and were randomly assigned to either a CLA (Clarinol A-80; n = 18) or placebo (PLA; sunflower oil; n = 16) group. Prior to and following 6 weeks of aerobic training (50% VO2 peak for 30 min, twice per week) and supplementation (5.63 g of total CLA isomers [of which 2.67 g was c9, t11 and 2.67 g was t10, c12] or 7.35 g high oleic sunflower oil per day), each participant completed an incremental cycle ergometer test to exhaustion to determine their [Formula: see text] peak, GET, and RCP and fasted blood draws were performed to measure serum concentrations of cholesterol, triacylglycerol, and glucose. Serum triacylglycerol concentrations were lower (p interactions (p 0.05) between the CLA and PLA groups. GET and RCP increased (p < 0.05) from pre- to post-training for both the CLA and PLA groups. Overall, these data suggested that CLA and aerobic exercise may have synergistic, blood triacylglycerol lowering effects, although CLA may be ineffective for enhancing aerobic exercise performance in conjunction with a 6-week aerobic exercise training program in college-age men.

  6. Highly Stable, Dual-Gated MoS2 Transistors Encapsulated by Hexagonal Boron Nitride with Gate-Controllable Contact, Resistance, and Threshold Voltage.

    Science.gov (United States)

    Lee, Gwan-Hyoung; Cui, Xu; Kim, Young Duck; Arefe, Ghidewon; Zhang, Xian; Lee, Chul-Ho; Ye, Fan; Watanabe, Kenji; Taniguchi, Takashi; Kim, Philip; Hone, James

    2015-07-28

    Emerging two-dimensional (2D) semiconductors such as molybdenum disulfide (MoS2) have been intensively studied because of their novel properties for advanced electronics and optoelectronics. However, 2D materials are by nature sensitive to environmental influences, such as temperature, humidity, adsorbates, and trapped charges in neighboring dielectrics. Therefore, it is crucial to develop device architectures that provide both high performance and long-term stability. Here we report high performance of dual-gated van der Waals (vdW) heterostructure devices in which MoS2 layers are fully encapsulated by hexagonal boron nitride (hBN) and contacts are formed using graphene. The hBN-encapsulation provides excellent protection from environmental factors, resulting in highly stable device performance, even at elevated temperatures. Our measurements also reveal high-quality electrical contacts and reduced hysteresis, leading to high two-terminal carrier mobility (33-151 cm(2) V(-1) s(-1)) and low subthreshold swing (80 mV/dec) at room temperature. Furthermore, adjustment of graphene Fermi level and use of dual gates enable us to separately control contact resistance and threshold voltage. This novel vdW heterostructure device opens up a new way toward fabrication of stable, high-performance devices based on 2D materials.

  7. A two-stage cognitive theory of the positive symptoms of psychosis. Highlighting the role of lowered decision thresholds.

    Science.gov (United States)

    Moritz, Steffen; Pfuhl, Gerit; Lüdtke, Thies; Menon, Mahesh; Balzan, Ryan P; Andreou, Christina

    2017-09-01

    We outline a two-stage heuristic account for the pathogenesis of the positive symptoms of psychosis. A narrative review on the empirical evidence of the liberal acceptance (LA) account of positive symptoms is presented. At the heart of our theory is the idea that psychosis is characterized by a lowered decision threshold, which results in the premature acceptance of hypotheses that a nonpsychotic individual would reject. Once the hypothesis is judged as valid, counterevidence is not sought anymore due to a bias against disconfirmatory evidence as well as confirmation biases, consolidating the false hypothesis. As a result of LA, confidence in errors is enhanced relative to controls. Subjective probabilities are initially low for hypotheses in individuals with delusions, and delusional ideas at stage 1 (belief formation) are often fragile. In the course of the second stage (belief maintenance), fleeting delusional ideas evolve into fixed false beliefs, particularly if the delusional idea is congruent with the emotional state and provides "meaning". LA may also contribute to hallucinations through a misattribution of (partially) normal sensory phenomena. Interventions such as metacognitive training that aim to "plant the seeds of doubt" decrease positive symptoms by encouraging individuals to seek more information and to attenuate confidence. The effect of antipsychotic medication is explained by its doubt-inducing properties. The model needs to be confirmed by longitudinal designs that allow an examination of causal relationships. Evidence is currently weak for hallucinations. The theory may account for positive symptoms in a subgroup of patients. Future directions are outlined. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Diagnostic thresholds for ambulatory blood pressure moving lower: a review based on a meta-analysis-clinical implications

    DEFF Research Database (Denmark)

    Hansen, T.W.; Kikuya, M.; Thijs, L.

    2008-01-01

    Upper limits of normal ambulatory blood pressure (ABP) have been a matter of debate in recent years. Current diagnostic thresholds for ABP rely mainly on statistical parameters derived from reference populations. Recent findings from the International Database of Ambulatory Blood Pressure...... in Relation to Cardiovascular Outcome (IDACO) provide outcome-driven thresholds for ABP. Rounded systolic/diastolic thresholds for optimal ABP were found to be 115/75 mm Hg for 24 hours, 120/80 mm Hg for daytime, and 100/65 mm Hg for nighttime. The corresponding rounded thresholds for normal ABP were 125...... database is therefore being updated with additional population cohorts to enable the construction of multifactorial risk score charts, which also include ABP Udgivelsesdato: 2008/5...

  9. Sensitivity of on-resistance and threshold voltage to buffer-related deep level defects in AlGaN/GaN high electron mobility transistors

    International Nuclear Information System (INIS)

    Armstrong, Andrew M; Allerman, Andrew A; Baca, Albert G; Sanchez, Carlos A

    2013-01-01

    The influence of deep levels defects located in highly resistive GaN:C buffers on the on-resistance (R ON ) and threshold voltage (V th ) of AlGaN/GaN high electron mobility transistors (HEMTs) power devices was studied by a combined photocapacitance deep level optical spectroscopy (C-DLOS) and photoconductance deep level optical spectroscopy (G-DLOS) methodology as a function of electrical stress. Two carbon-related deep levels at 1.8 and 2.85 eV below the conduction band energy minimum were identified from C-DLOS measurements under the gate electrode. It was found that buffer-related defects under the gate shifted V th positively by approximately 10%, corresponding to a net areal density of occupied defects of 8 × 10 12 cm −2 . The effect of on-state drain stress and off-state gate stress on buffer deep level occupancy and R ON was also investigated via G-DLOS. It was found that the same carbon-related deep levels observed under the gate were also active in the access region. Off-state gate stress produced significantly more trapping and degradation of R ON (∼140%) compared to on-state drain stress (∼75%). Greater sensitivity of R ON to gate stress was explained by a more sharply peaked lateral distribution of occupied deep levels between the gate and drain compared to drain stress. The overall greater sensitivity of R ON compared to V th to buffer defects suggests that electron trapping is significantly greater in the access region compared to under the gate, likely due to the larger electric fields in the latter region. (invited paper)

  10. Analysis of GIS data to investigate natural resource impacts of high-voltage overhead lines in the examples in Lower Saxony and North Rhine-Westphalia

    International Nuclear Information System (INIS)

    Thinh, Nguyen Xuan; Sander, Leon; Kopec, Jakob; Muehlnickel, Kai

    2013-01-01

    In this paper we describe shortly Lower Saxony and North Rhine-Westphalia as study areas and the legal framework, both in the context of natural resource impacts of high-voltage overhead lines. We then conduct the buffer analysis of a GIS dataset in order to investigate natural resource impacts of existing high-voltage overhead lines in the two mentioned study areas. The paper is based upon the first results of the interdisciplinary research and development project ''Power Network Planning'' funded as part of the 6th Energy research program ''Research for an environmentally friendly, reliable and affordable energy supply'' by the German Federal Ministry of Economics and Technology (BMWi). (orig.)

  11. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  12. Lowered threshold energy for femtosecond laser induced optical breakdown in a water based eye model by aberration correction with adaptive optics.

    Science.gov (United States)

    Hansen, Anja; Géneaux, Romain; Günther, Axel; Krüger, Alexander; Ripken, Tammo

    2013-06-01

    In femtosecond laser ophthalmic surgery tissue dissection is achieved by photodisruption based on laser induced optical breakdown. In order to minimize collateral damage to the eye laser surgery systems should be optimized towards the lowest possible energy threshold for photodisruption. However, optical aberrations of the eye and the laser system distort the irradiance distribution from an ideal profile which causes a rise in breakdown threshold energy even if great care is taken to minimize the aberrations of the system during design and alignment. In this study we used a water chamber with an achromatic focusing lens and a scattering sample as eye model and determined breakdown threshold in single pulse plasma transmission loss measurements. Due to aberrations, the precise lower limit for breakdown threshold irradiance in water is still unknown. Here we show that the threshold energy can be substantially reduced when using adaptive optics to improve the irradiance distribution by spatial beam shaping. We found that for initial aberrations with a root-mean-square wave front error of only one third of the wavelength the threshold energy can still be reduced by a factor of three if the aberrations are corrected to the diffraction limit by adaptive optics. The transmitted pulse energy is reduced by 17% at twice the threshold. Furthermore, the gas bubble motions after breakdown for pulse trains at 5 kilohertz repetition rate show a more transverse direction in the corrected case compared to the more spherical distribution without correction. Our results demonstrate how both applied and transmitted pulse energy could be reduced during ophthalmic surgery when correcting for aberrations. As a consequence, the risk of retinal damage by transmitted energy and the extent of collateral damage to the focal volume could be minimized accordingly when using adaptive optics in fs-laser surgery.

  13. The physical mechanism on the threshold voltage temperature stability improvement for GaN HEMTs with pre-fluorination argon treatment

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yun-Hsiang [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 119260 (Singapore); A*STAR Institute of Microelectronics, Singapore 117685 (Singapore); Liang, Yung C., E-mail: chii@nus.edu.sg [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 119260 (Singapore); National University of Singapore (Suzhou) Research Institute, Suzhou 215123 (China); Samudra, Ganesh S. [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 119260 (Singapore); Huang, Chih-Fang [Department of Electrical Engineering, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Kuo, Wei-Hung [Industrial Technology Research Institute, Chutung 31040, Taiwan (China); Lo, Guo-Qiang [A*STAR Institute of Microelectronics, Singapore 117685 (Singapore)

    2016-06-06

    In this paper, a normally-off AlGaN/GaN MIS-HEMT with improved threshold voltage (V{sub TH}) thermal stability is reported with investigations on its physical mechanism. The normally-off operation of the device is achieved from novel short argon plasma treatment (APT) prior to the fluorine plasma treatment (FPT) on Al{sub 2}O{sub 3} gate dielectrics. For the MIS-HEMT with FPT only, its V{sub TH} drops from 4.2 V at room temperature to 0.5 V at 200 °C. Alternatively, for the device with APT-then-FPT process, its V{sub TH} can retain at 2.5 V at 200 °C due to the increased amount of deep-level traps that do not emit electrons at 200 °C. This thermally stable V{sub TH} makes this device suitable for high power applications. The depth profile of the F atoms in Al{sub 2}O{sub 3}, measured by the secondary ion mass spectroscopy, reveals a significant increase in the F concentration when APT is conducted prior to FPT. The X-ray photoelectron spectroscopy (XPS) analysis on the plasma-treated Al{sub 2}O{sub 3} surfaces observes higher composition of Al-F bonds if APT was applied before FPT. The enhanced breaking of Al-O bonds due to Ar bombardment assisted in the increased incorporation of F radicals at the surface during the subsequent FPT process. The Schrödinger equation of Al{sub 2}O{sub x}F{sub y} cells, with the same Al-F compositions as obtained from XPS, was solved by Gaussian 09 molecular simulations to extract electron state distribution as a function of energy. The simulation results show creation of the deeper trap states in the Al{sub 2}O{sub 3} bandgap when APT is used before FPT. Finally, the trap distribution extracted from the simulations is verified by the gate-stress experimental characterization to confirm the physical mechanism described.

  14. Lowering data retention voltage in static random access memory array by post fabrication self-improvement of cell stability by multiple stress application

    Science.gov (United States)

    Mizutani, Tomoko; Takeuchi, Kiyoshi; Saraya, Takuya; Kobayashi, Masaharu; Hiramoto, Toshiro

    2018-04-01

    We propose a new version of the post fabrication static random access memory (SRAM) self-improvement technique, which utilizes multiple stress application. It is demonstrated that, using a device matrix array (DMA) test element group (TEG) with intrinsic channel fully depleted (FD) silicon-on-thin-buried-oxide (SOTB) six-transistor (6T) SRAM cells fabricated by the 65 nm technology, the lowering of data retention voltage (DRV) is more effectively achieved than using the previously proposed single stress technique.

  15. A lower dose threshold for the in vivo protective adaptive response to radiation. Tumorigenesis in chronically exposed normal and Trp53 heterozygous C57BL/6 mice

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Burchart, P.; Wyatt, H.

    2008-01-01

    Low doses of ionizing radiation to cells and animals may induce adaptive responses that reduce the risk of cancer. However, there are upper dose thresholds above which these protective adaptive responses do not occur. We have now tested the hypothesis that there are similar lower dose thresholds that must be exceeded in order to induce protective effects in vivo. We examined the effects of low dose/low dose rate fractionated exposures on cancer formation in Trp53 normal or cancer-prone Trp53 heterozygous female C57BL/6 mice. Beginning at 6 weeks of age, mice were exposed 5 days/week to single daily doses (0.33 mGy, 0.7 mGy/h) totaling 48, 97 or 146 mGy over 30, 60 or 90 weeks. The exposures for shorter times (up to 60 weeks) appeared to be below the level necessary to induce overall protective adaptive responses in Trp53 normal mice, and detrimental effects (shortened lifespan, increased frequency) evident for only specific tumor types (B- and T-cell lymphomas), were produced. Only when the exposures were continued for 90 weeks did the dose become sufficient to induce protective adaptive responses, balancing the detrimental effects for these specific cancers, and reducing the risk level back to that of the unexposed animals. Detrimental effects were not seen for other tumor types, and a protective effect was seen for sarcomas after 60 weeks of exposure, which was then lost when the exposure continued for 90 weeks. As previously shown for the upper dose threshold for protection by low doses, the lower dose boundary between protection and harm was influenced by Trp53 functionality. Neither protection nor harm was observed in exposed Trp53 heterozygous mice, indicating that reduced Trp53 function raises the lower dose/dose rate threshold for both detrimental and protective tumorigenic effects. (author)

  16. Luminescence imaging of water during irradiation of X-ray photons lower energy than Cerenkov- light threshold

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Seiichi; Koyama, Shuji; Komori, Masataka [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine (Japan); Toshito, Toshiyuki [Department of Proton Therapy Physics, Nagoya Proton Therapy Center, Nagoya City West Medical Center (Japan)

    2016-10-01

    Luminescence imaging of water using X-ray photon irradiation at energy lower than maximum energy of ~200 keV is thought to be impossible because the secondary electrons produced in this energy range do not emit Cerenkov- light. Contrary to this consensus assumption, we show that the luminescence imaging of water can be achieved by X-ray irradiation at energy lower than 120 keV. We placed water phantoms on a table with a conventional X-ray imaging system, and luminescence images of these phantoms were measured with a high-sensitivity, cooled charge coupled device (CCD) camera during X-ray photon irradiation at energy below 120 keV. We also carried out such imaging of an acrylic block and plastic scintillator. The luminescence images of water phantoms taken during X-ray photon irradiation clearly showed X-ray photon distribution. The intensity of the X-ray photon images of the phantom increased almost proportionally to the number of X-ray irradiations. Lower-energy X-ray photon irradiation showed lower-intensity luminescence at the deeper parts of the phantom due to the higher X-ray absorption in the water phantom. Furthermore, lower-intensity luminescence also appeared at the deeper parts of the acrylic phantom due to its higher density than water. The intensity of the luminescence for water was 0.005% of that for plastic scintillator. Luminescence imaging of water during X-ray photon irradiation at energy lower than 120 keV was possible. This luminescence imaging method is promising for dose estimation in X-ray imaging systems.

  17. Luminescence imaging of water during irradiation of X-ray photons lower energy than Cerenkov- light threshold

    Science.gov (United States)

    Yamamoto, Seiichi; Koyama, Shuji; Komori, Masataka; Toshito, Toshiyuki

    2016-10-01

    Luminescence imaging of water using X-ray photon irradiation at energy lower than maximum energy of 200 keV is thought to be impossible because the secondary electrons produced in this energy range do not emit Cerenkov- light. Contrary to this consensus assumption, we show that the luminescence imaging of water can be achieved by X-ray irradiation at energy lower than 120 keV. We placed water phantoms on a table with a conventional X-ray imaging system, and luminescence images of these phantoms were measured with a high-sensitivity, cooled charge coupled device (CCD) camera during X-ray photon irradiation at energy below 120 keV. We also carried out such imaging of an acrylic block and plastic scintillator. The luminescence images of water phantoms taken during X-ray photon irradiation clearly showed X-ray photon distribution. The intensity of the X-ray photon images of the phantom increased almost proportionally to the number of X-ray irradiations. Lower-energy X-ray photon irradiation showed lower-intensity luminescence at the deeper parts of the phantom due to the higher X-ray absorption in the water phantom. Furthermore, lower-intensity luminescence also appeared at the deeper parts of the acrylic phantom due to its higher density than water. The intensity of the luminescence for water was 0.005% of that for plastic scintillator. Luminescence imaging of water during X-ray photon irradiation at energy lower than 120 keV was possible. This luminescence imaging method is promising for dose estimation in X-ray imaging systems.

  18. Improvement in Brightness Uniformity by Compensating for the Threshold Voltages of Both the Driving Thin-Film Transistor and the Organic Light-Emitting Diode for Active-Matrix Organic Light-Emitting Diode Displays

    Directory of Open Access Journals (Sweden)

    Ching-Lin Fan

    2014-01-01

    Full Text Available This paper proposes a novel pixel circuit design and driving method for active-matrix organic light-emitting diode (AM-OLED displays that use low-temperature polycrystalline-silicon thin-film transistors (LTPS-TFTs as driving element. The automatic integrated circuit modeling simulation program with integrated circuit emphasis (AIM-SPICE simulator was used to verify that the proposed pixel circuit, which comprises five transistors and one capacitor, can supply uniform output current. The voltage programming method of the proposed pixel circuit comprises three periods: reset, compensation with data input, and emission periods. The simulated results reflected excellent performance. For instance, when ΔVTH=±0.33 V, the average error rate of the OLED current variation was low (<0.8%, and when ΔVTH_OLED=+0.33 V, the error rate of the OLED current variation was 4.7%. Moreover, when the I×R (current × resistance drop voltage of a power line was 0.3 V, the error rate of the OLED current variation was 5.8%. The simulated results indicated that the proposed pixel circuit exhibits high immunity to the threshold voltage deviation of both the driving poly-Si TFTs and OLEDs, and simultaneously compensates for the I×R drop voltage of a power line.

  19. High-field quench behavior and dependence of hot spot temperature on quench detection voltage threshold in a Bi2Sr2CaCu2Ox coil

    International Nuclear Information System (INIS)

    Shen, Tengming; Ye, Liyang; Turrioni, Daniele; Li, Pei

    2015-01-01

    Small insert solenoids have been built using a multifilamentary Ag/Bi 2 Sr 2 CaCu 2 O x round wire insulated with a mullite sleeve (∼100 μm in thickness) and characterized in background fields to explore the quench behaviors and limits of Bi 2 Sr 2 CaCu 2 O x superconducting magnets, with an emphasis on assessing the impact of slow normal zone propagation on quench detection. Using heaters of various lengths to initiate a small normal zone, a coil was quenched safely more than 70 times without degradation, with the maximum coil temperature reaching 280 K. Coils withstood a resistive voltage of tens of mV for seconds without quenching, showing the high stability of these coils and suggesting that the quench detection voltage should be greater than 50 mV in order not to falsely trigger protection. The hot spot temperature for the resistive voltage of the normal zone to reach 100 mV increased from ∼40–∼80 K while increasing the operating wire current density J o from 89 A mm −2 to 354 A mm −2 , whereas for the voltage to reach 1 V, it increased from ∼60–∼140 K. This shows the increasing negative impact of slow normal zone propagation on quench detection with increasing J o and the need to limit the quench detection voltage to <1 V. These measurements, coupled with an analytical quench model, were used to assess the impact of the maximum allowable detection voltage and temperature upon quench detection on the quench protection, assuming a limit of the hot spot temperature to <300 K. (paper)

  20. Mechanistic dissimilarities between environmentally-influenced fatigue-crack propagation at near-threshold and higher growth rates in lower-strength steels

    Energy Technology Data Exchange (ETDEWEB)

    Suresh, S.; Ritchie, R. O.

    1981-11-01

    The role of hydrogen gas in influencing fatigue crack propagation is examined for several classes of lower strength pressure vessel and piping steels. Based on measurements over a wide range of growth rates from 10/sup -8/ to 10/sup -2/ mm/cycle, crack propagation rates are found to be significantly higher in dehumidified gaseous hydrogen compared to moist air in two distinct regimes of crack growth, namely (i) at the intermediate range of growth typically above approx. 10/sup -5/ mm/cycle, and (ii) at the near-threshold region below approx. 10/sup -6/ mm/cycle approaching lattice dimensions per cycle. Both effects are seen at maximum stress intensities (K/sub max/) far below the sustained-load threshold stress intensity for hydrogen-assisted cracking (K/sub Iscc/). Characteristics of environmentally influenced fatigue crack growth in each regime are shown to be markedly different with regard to fractography and the effect of such variables as load ratio and frequency. It is concluded that the primary mechanisms responsible for the influence of the environment in each regime are distinctly different. Whereas corrosion fatigue behavior at intermediate growth rates can be attributed to hydrogen embrittlement processes, the primary role of moist environments at near-threshold levels is shown to involve a contribution from enhanced crack closure due to the formation of crack surface corrosion deposits at low load ratios.

  1. Evolution of cell resistance, threshold voltage and crystallization temperature during cycling of line-cell phase-change random access memory

    NARCIS (Netherlands)

    Oosthoek, J. L. M.; Attenborough, K.; Hurkx, G. A. M.; Jedema, F. J.; Gravesteijn, D. J.; Kooi, B. J.

    2011-01-01

    Doped SbTe phase change (PRAM) line cells produced by e-beam lithography were cycled 100 million times. During cell cycling the evolution of many cell properties were monitored, in particular the crystalline and amorphous resistance, amorphous resistance drift exponent, time-dependent threshold

  2. Non-traditional method-based solution for elimination of lower order harmonics in voltage source inverter feeding an induction motor drive

    Directory of Open Access Journals (Sweden)

    Vargese Jegathesan

    2008-01-01

    Full Text Available This paper presents an efficient and reliable Genetic Algorithm-based solution for Specific Harmonic Elimination (SHE switching pattern. This method eliminates considerable amount of lower order line voltage harmonics in Pulse Width Modulation (PWM inverter. The determination of pulse pattern for the elimination of some lower order harmonics of a PWM inverter necessitates solving a system of nonlinear transcendental equations. Genetic Algorithm is used to solve nonlinear transcendental equations for PWM-SHE. In this proposed method, harmonics up to 17th are eliminated using Genetic Algorithm without using Dual transformer. Simulations using Matlab 7.0 and PSIM 6.1 are carried out so as to validate the solution.

  3. Lowering the background level and the energy threshold of Micromegas x-ray detectors for axion searches

    CERN Document Server

    Iguaz, F J; Aznar, F; Castel, J F; Dafni, T; Davenport, M; Ferrer-Ribas, E; Galan, J; Garcia, J A; Garza, J G; Giomataris, I; Irastorza, I G; Papaevangelou, T; Rodriguez, A; Tomas, A; Vafeiadis, T; Yildiz, S C

    2014-01-01

    Axion helioscopes search for solar axions by their conversion in x-rays in the presence of high magnetic fields. The use of low background x-ray detectors is an essential component contributing to the sensitivity of these searches. In this work, we review the recent advances on Micromegas detectors used in the CERN Axion Solar Telescope (CAST) and proposed for the future International Axion Observatory (IAXO). The actual setup in CAST has achieved background levels below 10$^{-6}$ keV$^{-1}$ cm$^{-2}$ s$^{-1}$, a factor 100 lower than the first generation of Micromegas detectors. This reduction is based on active and passive shielding techniques, the selection of radiopure materials, offline discrimination techniques and the high granularity of the readout. We describe in detail the background model of the detector, based on its operation at CAST site and at the Canfranc Underground Laboratory (LSC), as well as on Geant4 simulations. The best levels currently achieved at LSC are low than 10$^{-7}$ keV$^{-1}$ ...

  4. Quick-low-density parity check and dynamic threshold voltage optimization in 1X nm triple-level cell NAND flash memory with comprehensive analysis of endurance, retention-time, and temperature variation

    Science.gov (United States)

    Doi, Masafumi; Tokutomi, Tsukasa; Hachiya, Shogo; Kobayashi, Atsuro; Tanakamaru, Shuhei; Ning, Sheyang; Ogura Iwasaki, Tomoko; Takeuchi, Ken

    2016-08-01

    NAND flash memory’s reliability degrades with increasing endurance, retention-time and/or temperature. After a comprehensive evaluation of 1X nm triple-level cell (TLC) NAND flash, two highly reliable techniques are proposed. The first proposal, quick low-density parity check (Quick-LDPC), requires only one cell read in order to accurately estimate a bit-error rate (BER) that includes the effects of temperature, write and erase (W/E) cycles and retention-time. As a result, 83% read latency reduction is achieved compared to conventional AEP-LDPC. Also, W/E cycling is extended by 100% compared with conventional Bose-Chaudhuri-Hocquenghem (BCH) error-correcting code (ECC). The second proposal, dynamic threshold voltage optimization (DVO) has two parts, adaptive V Ref shift (AVS) and V TH space control (VSC). AVS reduces read error and latency by adaptively optimizing the reference voltage (V Ref) based on temperature, W/E cycles and retention-time. AVS stores the optimal V Ref’s in a table in order to enable one cell read. VSC further improves AVS by optimizing the voltage margins between V TH states. DVO reduces BER by 80%.

  5. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    Science.gov (United States)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  6. Low-intensity repetitive magnetic stimulation lowers action potential threshold and increases spike firing in layer 5 pyramidal neurons in vitro.

    Science.gov (United States)

    Tang, Alexander D; Hong, Ivan; Boddington, Laura J; Garrett, Andrew R; Etherington, Sarah; Reynolds, John N J; Rodger, Jennifer

    2016-10-29

    Repetitive transcranial magnetic stimulation (rTMS) has become a popular method of modulating neural plasticity in humans. Clinically, rTMS is delivered at high intensities to modulate neuronal excitability. While the high-intensity magnetic field can be targeted to stimulate specific cortical regions, areas adjacent to the targeted area receive stimulation at a lower intensity and may contribute to the overall plasticity induced by rTMS. We have previously shown that low-intensity rTMS induces molecular and structural plasticity in vivo, but the effects on membrane properties and neural excitability have not been investigated. Here we investigated the acute effect of low-intensity repetitive magnetic stimulation (LI-rMS) on neuronal excitability and potential changes on the passive and active electrophysiological properties of layer 5 pyramidal neurons in vitro. Whole-cell current clamp recordings were made at baseline prior to subthreshold LI-rMS (600 pulses of iTBS, n=9 cells from 7 animals) or sham (n=10 cells from 9 animals), immediately after stimulation, as well as 10 and 20min post-stimulation. Our results show that LI-rMS does not alter passive membrane properties (resting membrane potential and input resistance) but hyperpolarises action potential threshold and increases evoked spike-firing frequency. Increases in spike firing frequency were present throughout the 20min post-stimulation whereas action potential (AP) threshold hyperpolarization was present immediately after stimulation and at 20min post-stimulation. These results provide evidence that LI-rMS alters neuronal excitability of excitatory neurons. We suggest that regions outside the targeted region of high-intensity rTMS are susceptible to neuromodulation and may contribute to rTMS-induced plasticity. Copyright © 2016 IBRO. All rights reserved.

  7. Inhibition of Glycogen Synthase Kinase or the Apoptotic Protein p53 Lowers the Threshold of Helium Cardioprotection In Vivo: The Role of Mitochondrial Permeability Transition

    Science.gov (United States)

    Pagel, Paul S.; Krolikowski, John G.; Pratt, Phillip F.; Shim, Yon Hee; Amour, Julien; Warltier, David C.; Weihrauch, Dorothee

    2008-01-01

    BACKGROUND Prosurvival signaling kinases inhibit glycogen synthase kinase-3β (GSK-3β) activity and stimulate apoptotic protein p53 degradation. Helium produces cardioprotection by activating prosurvival kinases, but whether GSK and p53 inhibition mediate this process is unknown. We tested the hypothesis that inhibition of GSK or p53 lowers the threshold of helium cardioprotection via a mitochondrial permeability transition pore (mPTP)-dependent mechanism. METHODS Rabbits (n = 85) instrumented for hemodynamic measurement and subjected to a 30 min left anterior descending coronary artery (LAD) occlusion and 3 h reperfusion received 0.9% saline (control), or 1, 3, or 5 cycles of 70% helium-30% oxygen administered for 5 min interspersed with 5 min of an air-oxygen mixture (fraction of inspired oxygen concentration = 0.30) before LAD occlusion. Other rabbits received the GSK inhibitor SB 216763 (SB21; 0.2 or 0.6 mg/kg), the p53 inhibitor pifithrin-α (PIF; 1.5 or 3.0 mg/kg), or SB21 (0.2 mg/kg) or PIF (1.5 mg/kg) plus helium (1 cycle) before LAD occlusion in the presence or absence of the mPTP opener atractyloside (5 mg/kg). RESULTS Helium reduced (P < 0.05) myocardial infarct size (35 ± 6 [n = 7], 25 ± 4 [n = 7], and 20 ± 3% [n = 6] of area at risk, 1, 3, and 5 cycles, respectively) compared with control (44 ± 6% [n = 7]). SB21 (0.6 [n = 7] but not 0.2 mg/kg [n = 6]) and PIF (3.0 [n = 6] but not 1.5 mg/kg [n = 7]) also reduced necrosis. SB21 (0.2 mg/kg) or 1.5 mg/kg PIF (1.5 mg/kg) plus helium (1 cycle; n = 6 per group) decreased infarct size to an equivalent degree as three cycles of helium alone, and this cardioprotection was blocked by atractyloside (n = 7 per group). CONCLUSIONS Inhibition of GSK or p53 lowers the threshold of helium-induced preconditioning via a mPTP-dependent mechanism in vivo. PMID:18713881

  8. Low-tube-voltage (80 kVp) CT aortography using 320-row volume CT with adaptive iterative reconstruction: lower contrast medium and radiation dose

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chien-Ming; Chu, Sung-Yu; Hsu, Ming-Yi [Chang Gung University, Department of Medical Imaging and Intervention, Chang Gung Memorial Hospital Linkou, College of Medicine, Taoyuan (China); Liao, Ying-Lan [National Tsing Hua University, Department of Biomedical Engineering and Environmental Sciences, Hsinchu (China); Tsai, Hui-Yu [Chang Gung University, Department of Medical Imaging and Radiological Sciences, College of Medicine, Taoyuan (China); Chang Gung University, Healthy Aging Research Center, Taoyuan (China); Chang Gung University, Department of Medical Imaging and Radiological Sciences, Taoyuan (China)

    2014-02-15

    To evaluate CT aortography at reduced tube voltage and contrast medium dose while maintaining image quality through iterative reconstruction (IR). The Institutional Review Board approved a prospective study of 48 patients who underwent follow-up CT aortography. We performed intra-individual comparisons of arterial phase images using 120 kVp (standard tube voltage) and 80 kVp (low tube voltage). Low-tube-voltage imaging was performed on a 320-detector CT with IR following injection of 40 ml of contrast medium. We assessed aortic attenuation, aortic attenuation gradient, image noise, contrast-to-noise ratio (CNR), volume CT dose index (CTDI{sub vol}), and figure of merit (FOM) of image noise and CNR. Two readers assessed images for diagnostic quality, image noise, and artefacts. The low-tube-voltage protocol showed 23-31 % higher mean aortic attenuation and image noise (both P < 0.01) than the standard-tube-voltage protocol, but no significant difference in the CNR and aortic attenuation gradients. The low-tube-voltage protocol showed a 48 % reduction in CTDI{sub vol} and an 80 % increase in FOM of CNR. Subjective diagnostic quality was similar for both protocols, but low-tube-voltage images showed greater image noise (P = 0.01). Application of IR to an 80-kVp CT aortography protocol allows radiation dose and contrast medium reduction without affecting image quality. (orig.)

  9. Investigations on Substrate Temperature-Induced Growth Modes of Organic Semiconductors at Dielectric/semiconductor Interface and Their Correlation with Threshold Voltage Stability in Organic Field-Effect Transistors.

    Science.gov (United States)

    Padma, Narayanan; Maheshwari, Priya; Bhattacharya, Debarati; Tokas, Raj B; Sen, Shashwati; Honda, Yoshihide; Basu, Saibal; Pujari, Pradeep Kumar; Rao, T V Chandrasekhar

    2016-02-10

    Influence of substrate temperature on growth modes of copper phthalocyanine (CuPc) thin films at the dielectric/semiconductor interface in organic field effect transistors (OFETs) is investigated. Atomic force microscopy (AFM) imaging at the interface reveals a change from 'layer+island' to "island" growth mode with increasing substrate temperatures, further confirmed by probing the buried interfaces using X-ray reflectivity (XRR) and positron annihilation spectroscopic (PAS) techniques. PAS depth profiling provides insight into the details of molecular ordering while positron lifetime measurements reveal the difference in packing modes of CuPc molecules at the interface. XRR measurements show systematic increase in interface width and electron density correlating well with the change from layer + island to coalesced huge 3D islands at higher substrate temperatures. Study demonstrates the usefulness of XRR and PAS techniques to study growth modes at buried interfaces and reveals the influence of growth modes of semiconductor at the interface on hole and electron trap concentrations individually, thereby affecting hysteresis and threshold voltage stability. Minimum hole trapping is correlated to near layer by layer formation close to the interface at 100 °C and maximum to the island formation with large voids between the grains at 225 °C.

  10. 1.5-V-threshold-voltage Schottky barrier normally-off AlGaN/GaN high-electron-mobility transistors with f T/f max of 41/125 GHz

    Science.gov (United States)

    Hou, Bin; Ma, Xiaohua; Yang, Ling; Zhu, Jiejie; Zhu, Qing; Chen, Lixiang; Mi, Minhan; Zhang, Hengshuang; Zhang, Meng; Zhang, Peng; Zhou, Xiaowei; Hao, Yue

    2017-07-01

    In this paper, a normally-off AlGaN/GaN high-electron-mobility transistors (HEMT) fabricated using inductively coupled plasma (ICP) CF4 plasma recessing and an implantation technique is reported. A gate-to-channel distance of ˜10 nm and an equivalent negative fluorine sheet charge density of -1.21 × 1013 cm-2 extracted using a simple threshold voltage (V th) analytical model result in a high V th of 1.5 V, a peak transconductance of 356 mS/mm, and a subthreshold slope of 133 mV/decade. A small degradation of channel mobility leads to a high RF performance with f T/f max of 41/125 GHz, resulting in a record high f T × L g product of 10.66 GHz·µm among Schottky barrier AlGaN/GaN normally-off HEMTs with V th exceeding 1 V, to the best of our knowledge.

  11. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  12. Implications of lower risk thresholds for statin treatment in primary prevention: analysis of CPRD and simulation modelling of annual cholesterol monitoring.

    Science.gov (United States)

    McFadden, Emily; Stevens, Richard; Glasziou, Paul; Perera, Rafael

    2015-01-01

    To estimate numbers affected by a recent change in UK guidelines for statin use in primary prevention of cardiovascular disease. We modelled cholesterol ratio over time using a sample of 45,151 men (≥40years) and 36,168 women (≥55years) in 2006, without statin treatment or previous cardiovascular disease, from the Clinical Practice Research Datalink. Using simulation methods, we estimated numbers indicated for new statin treatment, if cholesterol was measured annually and used in the QRISK2 CVD risk calculator, using the previous 20% and newly recommended 10% thresholds. We estimate that 58% of men and 55% of women would be indicated for treatment by five years and 71% of men and 73% of women by ten years using the 20% threshold. Using the proposed threshold of 10%, 84% of men and 90% of women would be indicated for treatment by 5years and 92% of men and 98% of women by ten years. The proposed change of risk threshold from 20% to 10% would result in the substantial majority of those recommended for cholesterol testing being indicated for statin treatment. Implications depend on the value of statins in those at low to medium risk, and whether there are harms. Copyright © 2014. Published by Elsevier Inc.

  13. A cost effectiveness study establishing the impact and accuracy of implementing the NICE guidelines lowering plasma NTproBNP threshold in patients with clinically suspected heart failure at our institution.

    Science.gov (United States)

    Webb, Jessica; Draper, Jane; Rua, Tiago; Yiu, Yee; Piper, Susan; Teall, Thomas; Fovargue, Lauren; Bolca, Elena; Jackson, Tom; Claridge, Simon; Sieniewicz, Ben; Porter, Bradley; McDiarmid, Adam; Rajani, Ronak; Kapetanakis, Stamatis; Rinaldi, Christopher A; Razavi, Reza; McDonagh, Theresa A; Carr-White, Gerald

    2018-04-15

    The 2014 National Institute of Clinical Excellence (NICE) guidelines on the management of acute heart failure recommended using a plasma NT-proBNP threshold of 300pg/ml to assist in ruling out the diagnosis of heart failure (HF), updating previous guidelines recommending using a threshold of 400pg/ml. NICE based their recommendations on 6 studies performed in other countries. This study sought to determine the diagnostic and economic implications of using these thresholds in a large unselected UK population. Patient and clinical demographics were recorded for all consecutive suspected HF patients over 12months, as well as clinical outcomes including time to HF hospitalisation and time to death (follow up 15.8months). Of 1995 unselected patients admitted with clinically suspected HF, 1683 (84%) had a NTproBNP over the current NICE recommended threshold, of which 35% received a final diagnosis of HF. Lowering the threshold from 400 to 300pg/ml would have involved screening an additional 61 patients and only would have identified one new patient with HF (sensitivity 0.985, NPV 0.976, area under the curve (AUC) at 300pg/ml 0.67; sensitivity 0.983, NPV 0.977, AUC 0.65 at 400pg/ml). The economic implications of lowering the threshold would have involved additional costs of £42,842.04 (£702.33 per patient screened, or £ 42,824.04 per new HF patient). Applying the recent updated NICE guidelines to an unselected real world population increases the AUC but would have a significant economic impact and only identified one new patient with heart failure. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The generation of a lower threshold multiwavelength fiber laser in the L-band region assisted by a Sagnac loop mirror

    International Nuclear Information System (INIS)

    Aziz, Siti Narimah; Arsad, Norhana; Bakar, Ahmad Ashrif Abu; Elias, Sayidatul Nadia; Menon, P Sushita; Shaari, Sahbudin

    2015-01-01

    A low threshold multiwavelength laser generated with the assistance of a Sagnac loop mirror is proposed. Two simple ring cavity designs are studied, namely a standard design ring cavity (design A) and a ring cavity with a Sagnac loop mirror (design B). Design B, which integrates a Sagnac loop mirror together with a polarization controller, exhibits the most optimum performance, generating seven lasing modes. Using only a 40 mW pump power from the erbium-doped fiber amplifier (EDFA), design B is the preferred ring cavity design, as it successfully produces seven lasing modes simultaneously within a 0.42 nm channel spacing in the L-band region. The ring cavity is characterized by investigating the lasing threshold through the tuning output power of the EDFA, the percentages of extracted power and cavity loss. (paper)

  15. Doubler system quench detection threshold

    International Nuclear Information System (INIS)

    Kuepke, K.; Kuchnir, M.; Martin, P.

    1983-01-01

    The experimental study leading to the determination of the sensitivity needed for protecting the Fermilab Doubler from damage during quenches is presented. The quench voltage thresholds involved were obtained from measurements made on Doubler cable of resistance x temperature and voltage x time during quenches under several currents and from data collected during operation of the Doubler Quench Protection System as implemented in the B-12 string of 20 magnets. At 4kA, a quench voltage threshold in excess of 5.OV will limit the peak Doubler cable temperature to 452K for quenches originating in the magnet coils whereas a threshold of 0.5V is required for quenches originating outside of coils

  16. Is action potential threshold lowest in the axon?

    NARCIS (Netherlands)

    Kole, Maarten H. P.; Stuart, Greg J.

    2008-01-01

    Action potential threshold is thought to be lowest in the axon, but when measured using conventional techniques, we found that action potential voltage threshold of rat cortical pyramidal neurons was higher in the axon than at other neuronal locations. In contrast, both current threshold and voltage

  17. Dental age estimation: periodontal ligament visibility (PLV)-pattern recognition of a conclusive mandibular maturity marker related to the lower left third molar at the 18-year threshold.

    Science.gov (United States)

    Lucas, Victoria S; McDonald, Fraser; Andiappan, Manoharan; Roberts, Graham

    2017-05-01

    The purpose of this study was to explore the applicability of periodontal ligament visibility (PLV) at the 18-year threshold. This mandibular maturity marker is graded into four separate age related stages, PLV-A, PLV-B, PLV-C, and PLV-D. These are discernible on a dental panoramic tomograph (DPT). The sample comprised a total of 2000 DPTs evenly divided into half yearly age bands from 16.00 to 25.99 years with 50 females and 50 males in each age band. It was found that PLV-A and PLV-B had minimum values below the 18-year threshold. PLV-C and PLV-D in females had minimum values of 18.08 and 18.58 years, respectively. In males, the minimum values for PLV-C was 18.10 years and PLV-D was 18.67 years. It was concluded that the presence of PLV-C or PLV-D indicates that a subject is over 18 years with a very high level of probability.

  18. Constant-current regulator improves tunnel diode threshold-detector performance

    Science.gov (United States)

    Cancro, C. A.

    1965-01-01

    Grounded-base transistor is placed in a tunnel diode threshold detector circuit, and a bias voltage is applied to the tunnel diode. This provides the threshold detector with maximum voltage output and overload protection.

  19. Effect of gold nano-particles on switch-on voltage and relaxation frequency of nematic liquid crystal cell

    Directory of Open Access Journals (Sweden)

    M. Inam

    2011-12-01

    Full Text Available We report the observation of large changes in the electro-optical properties of nematic liquid crystal (NLC due to inclusion of small concentration of 10 nm diameter gold nanoparticles (GNPs. It is observed that GNPs lower switch-on voltage and also lower the relaxation frequency with applied voltage (AC field to NLC cell. These studies of GNP doped NLC cell have been done using optical interferometry and capacity measurement by impedance analyzer. The change in threshold voltage and relaxation frequency by doping GNPs in NLC is explained theoretically.

  20. Lowered operation voltage in Pt/SBi2Ta2O9/HfO2/Si ferroelectric-gate field-effect transistors by oxynitriding Si

    International Nuclear Information System (INIS)

    Horiuchi, Takeshi; Takahashi, Mitsue; Li, Qiu-Hong; Wang, Shouyu; Sakai, Shigeki

    2010-01-01

    Oxynitrided Si (SiON) surfaces show smaller subthreshold swings than do directly nitrided Si (SiN) surfaces when used in ferroelectric-gate field-effect transistors (FeFETs) having the following stacked-gate structure: Pt/SrBi 2 Ta 2 O 9 (SBT)/HfO 2 /Si. SiON/Si substrates for FeFETs were prepared by rapid thermal oxidation (RTO) in O 2 at 1000 °C and subsequent rapid thermal nitridation (RTN) in NH 3 at various temperatures in the range 950–1150 °C. The electrical properties of the Pt/SBT/HfO 2 /SiON/Si FeFET were compared with those of reference FETs, i.e. Pt/SBT/HfO 2 gate stacks formed on Si substrates subjected to various treatments: SiN x /Si formed by RTN, SiO 2 /Si formed by RTO and untreated Si. The Pt/SBT/HfO 2 /SiON/Si FeFET had a larger memory window than all the other reference FeFETs, particularly at low operation voltages when the RTN temperature was 1050 °C

  1. Threshold switching uniformity in In2Se3 nanowire-based phase change memory

    International Nuclear Information System (INIS)

    Chen Jian; Du Gang; Liu Xiao-Yan

    2015-01-01

    The uniformity of threshold voltage and threshold current in the In 2 Se 3 nanowire-based phase change memory (PCM) devices is investigated. Based on the trap-limited transport model, amorphous layer thickness, trap density, and trap depth are considered to clarify their influences upon the threshold voltage and threshold current through simulations. (paper)

  2. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  3. High voltage bus and auxiliary heater control system for an electric or hybrid vehicle

    Science.gov (United States)

    Murty, Balarama Vempaty

    2000-01-01

    A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.

  4. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  5. Design and simulation for the pulse high-voltage DC power supply (HVPS) of 1.2 MW/2.45 GHz HT-7U lower hybrid current drive system

    International Nuclear Information System (INIS)

    Huang Yiyun; Kuang Guangli; Xu Weihua; Liu Baohua; Lin Jianan; Wu Junshuan; Zheng Guanghua; Yang Chunshen

    2000-01-01

    The superconducting tokamak HT-7U has been designed by the Institute of Plasma Physics since 1998 and will be set up before 2003. The 1.2 MW/2.45 GHz HT-7U LHCD (Lower hybrid current drive) system which being the most efficient non-induction device can heat the plasma and drive the plasma current has been efficiently in operation now, and a particular design of the 2.8 MW/-35 kV high-voltage DC power supply has been already completed and will apply to the klystron of LHCD on HT-7 and the future HT-7U, and the project of the power supply has been examined and approved professionally by an authorized group of high-level specialist in the Institute of Plasma Physics. The detailed design of the power supply and the simulation results are referred

  6. Ultra Low-Voltage Energy Harvesting

    Science.gov (United States)

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  7. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  8. Voltage-Controlled Floating Resistor Using DDCC

    Directory of Open Access Journals (Sweden)

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  9. A low-voltage flash memory cell utilizing the gate-injection program/erase method with a recessed channel structure

    International Nuclear Information System (INIS)

    Wu Dake; Huang Ru; Wang Pengfei; Tang Poren; Wang Yangyuan

    2008-01-01

    In this paper, a low-voltage recessed channel SONOS flash memory using the gate-injection program/erase method is proposed and investigated for NAND application. It is shown that the proposed flash memory can achieve 8 V lower programming voltage compared with planar flash memory, due to the effective capacitance coupling and the electric-field enhancement by combining the recessed channel structure and the gate-injection program/erase method. In addition, more than 30% larger threshold voltage window and improved short channel effects can be obtained in the proposed flash memory

  10. Analytical modeling of Schottky tunneling source impact ionization MOSFET with reduced breakdown voltage

    Directory of Open Access Journals (Sweden)

    Sangeeta Singh

    2016-03-01

    Full Text Available In this paper, we have investigated a novel Schottky tunneling source impact ionization MOSFET (STS-IMOS to lower the breakdown voltage of conventional impact ionization MOS (IMOS and developed an analytical model for the same. In STS-IMOS there is an accumulative effect of both impact ionization and source induced barrier tunneling. The silicide source offers very low parasitic resistance, the outcome of which is an increment in voltage drop across the intrinsic region for the same applied bias. This reduces operating voltage and hence, it exhibits a significant reduction in both breakdown and threshold voltage. STS-IMOS shows high immunity against hot electron damage. As a result of this the device reliability increases magnificently. The analytical model for impact ionization current (Iii is developed based on the integration of ionization integral (M. Similarly, to get Schottky tunneling current (ITun expression, Wentzel–Kramers–Brillouin (WKB approximation is employed. Analytical models for threshold voltage and subthreshold slope is optimized against Schottky barrier height (ϕB variation. The expression for the drain current is computed as a function of gate-to-drain bias via integral expression. It is validated by comparing it with the technology computer-aided design (TCAD simulation results as well. In essence, this analytical framework provides the physical background for better understanding of STS-IMOS and its performance estimation.

  11. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  12. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  13. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  14. Prospective ECG-triggered axial CT at 140-kV tube voltage improves coronary in-stent restenosis visibility at a lower radiation dose compared with conventional retrospective ECG-gated helical CT

    Energy Technology Data Exchange (ETDEWEB)

    Horiguchi, Jun; Fujioka, Chikako; Kiguchi, Masao; Kohno, Shingo [Hiroshima University Hospital, Department of Clinical Radiology, Hiroshima (Japan); Yamamoto, Hideya; Kitagawa, Toshiro [Hiroshima University, Department of Molecular and Internal Medicine, Division of Clinical Medical Science, Programs for Applied Biomedicine, Graduate School of Biomedical Sciences, Hiroshima (Japan); Ito, Katsuhide [Hiroshima University, Department of Radiology, Division of Medical Intelligence and Informatics, Programs for Applied Biomedicine, Graduate School of Biomedical Sciences, Hiroshima (Japan)

    2009-10-15

    The purpose of this study was to compare coronary 64-slice CT angiography (CTA) protocols, specifically prospective electrocardiograph (ECG)-triggered and retrospective ECG-gated CT acquisition performed using a tube voltage of 140 kV and 120 kV, regarding intracoronary stent imaging. Coronary artery stents (n=12) with artificial in-stent restenosis (50% luminal reduction, 40 HU) on a cardiac phantom were examined by CT at heart rates of 50-75 beats per minute (bpm). The subjective visibility of in-stent restenosis was evaluated with a three-point scale (1 clearly visible, 2 visible, and 3 not visible), and artificial lumen narrowing [(inner stent diameter - measured lumen diameter)/inner stent diameter], lumen attenuation increase ratio [(in-stent attenuation - coronary lumen attenuation)/coronary lumen attenuation], and signal-to-noise ratio of in-stent lumen were determined. The effective dose was estimated. The artificial lumen narrowing (mean 43%), the increase of lumen attenuation (mean 46%), and signal-to-noise ratio (mean 7.8) were not different between CT acquisitions (p=0.12-0.91). However, the visibility scores of in-stent restenosis were different (p<0.05) between ECG-gated CTA techniques: (a) 140-kV prospective (effective dose 4.6 mSv), 1.6; (b) 120-kV prospective (3.3 mSv), 1.8; (c) 140-kV retrospective (16.4-18.8 mSv), 1.9; and (d) 120-kV retrospective (11.0-13.4 mSv), 1.9. Thus, 140-kV prospective ECG-triggered CTA improves coronary in-stent restenosis visibility at a lower radiation dose compared with retrospective ECG-gated CTA. (orig.)

  15. Evaluation of the threshold trimming method for micro inertial fluidic switch based on electrowetting technology

    Directory of Open Access Journals (Sweden)

    Tingting Liu

    2014-03-01

    Full Text Available The switch based on electrowetting technology has the advantages of no moving part, low contact resistance, long life and adjustable acceleration threshold. The acceleration threshold of switch can be fine-tuned by adjusting the applied voltage. This paper is focused on the electrowetting properties of switch and the influence of microchannel structural parameters, applied voltage and droplet volume on acceleration threshold. In the presence of process errors of micro inertial fluidic switch and measuring errors of droplet volume, there is a deviation between test acceleration threshold and target acceleration threshold. Considering the process errors and measuring errors, worst-case analysis is used to analyze the influence of parameter tolerance on the acceleration threshold. Under worst-case condition the total acceleration threshold tolerance caused by various errors is 9.95%. The target acceleration threshold can be achieved by fine-tuning the applied voltage. The acceleration threshold trimming method of micro inertial fluidic switch is verified.

  16. CARA Risk Assessment Thresholds

    Science.gov (United States)

    Hejduk, M. D.

    2016-01-01

    Warning remediation threshold (Red threshold): Pc level at which warnings are issued, and active remediation considered and usually executed. Analysis threshold (Green to Yellow threshold): Pc level at which analysis of event is indicated, including seeking additional information if warranted. Post-remediation threshold: Pc level to which remediation maneuvers are sized in order to achieve event remediation and obviate any need for immediate follow-up maneuvers. Maneuver screening threshold: Pc compliance level for routine maneuver screenings (more demanding than regular Red threshold due to additional maneuver uncertainty).

  17. Reduced Voltage Scaling in Clock Distribution Networks

    Directory of Open Access Journals (Sweden)

    Khader Mohammad

    2009-01-01

    Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.

  18. Modelling of capacitance and threshold voltage for ultrathin normally ...

    Indian Academy of Sciences (India)

    2016-12-02

    Dec 2, 2016 ... National Institute of Technology Silchar, Silchar 788 010, India. ∗ ... MS received 21 January 2015; revised 16 February 2016; accepted 6 May 2016; published online 2 ... a vital role [2,3] and it has a strong dependence on.

  19. A Novel Threshold Voltage Defined Multiplexer for Interconnect Camouflaging

    Science.gov (United States)

    2017-03-01

    piracy of nalysis due to gates has been ates. However, ower and delay amouflaging of tect the IP. A or multiplexer is since transistor e proposed...is hidden cost is higher tsourcing the ncreasing the s effective in ld loss during rmore, it still ly processes. propose an o hide the nceptually

  20. Coloring geographical threshold graphs

    Energy Technology Data Exchange (ETDEWEB)

    Bradonjic, Milan [Los Alamos National Laboratory; Percus, Allon [Los Alamos National Laboratory; Muller, Tobias [EINDHOVEN UNIV. OF TECH

    2008-01-01

    We propose a coloring algorithm for sparse random graphs generated by the geographical threshold graph (GTG) model, a generalization of random geometric graphs (RGG). In a GTG, nodes are distributed in a Euclidean space, and edges are assigned according to a threshold function involving the distance between nodes as well as randomly chosen node weights. The motivation for analyzing this model is that many real networks (e.g., wireless networks, the Internet, etc.) need to be studied by using a 'richer' stochastic model (which in this case includes both a distance between nodes and weights on the nodes). Here, we analyze the GTG coloring algorithm together with the graph's clique number, showing formally that in spite of the differences in structure between GTG and RGG, the asymptotic behavior of the chromatic number is identical: {chi}1n 1n n / 1n n (1 + {omicron}(1)). Finally, we consider the leading corrections to this expression, again using the coloring algorithm and clique number to provide bounds on the chromatic number. We show that the gap between the lower and upper bound is within C 1n n / (1n 1n n){sup 2}, and specify the constant C.

  1. Autonomous Voltage Oscillations in a Direct Methanol Fuel Cell

    International Nuclear Information System (INIS)

    Nogueira, Jéssica A.; Peña Arias, Ivonne K.; Hanke-Rauschenbach, Richard; Vidakovic-Koch, Tanja; Varela, Hamilton; Sundmacher, Kai

    2016-01-01

    Proton exchange membrane fuel cells fed with H_2/CO mixtures at the anode have a considerably lower performance than fuel cells fed with pure hydrogen. However, when operated in an autonomous oscillatory regime, the overall voltage loss decreases due to a self-cleaning mechanism. Another molecule, also widely used as feed in the fuel cell and susceptible to kinetic instabilities, is methanol. To the best of our knowledge, there are no reports on autonomous voltage oscillations in the direct methanol fuel cell (DMFC). The purpose of this work was to explore if such instabilities also occur in the DMFC system. Initially, half-cell experiments with a gas diffusion electrode were performed. Then, a DMFC was operated under current control and studied by means of electrochemical impedance spectroscopy. The half-cell measurements revealed that the induction period for oscillations depends on the mass transfer conditions, where on stagnant electrode the induction time was shorter than in the case of forced convection. The DMFC showed also autonomous voltage oscillations above a certain threshold current. The results obtained by electrochemical impedance spectroscopy give evidence of a negative differential resistance in the fuel cell, hitherto not described in the literature, which can be related to the appearance of oscillations during galvanostatic methanol electro-oxidation. These results open the possibility to evaluate the performance of low-temperature fuel cells fed with carbon-containing fuels under oscillatory operating conditions.

  2. Threshold quantum cryptography

    International Nuclear Information System (INIS)

    Tokunaga, Yuuki; Okamoto, Tatsuaki; Imoto, Nobuyuki

    2005-01-01

    We present the concept of threshold collaborative unitary transformation or threshold quantum cryptography, which is a kind of quantum version of threshold cryptography. Threshold quantum cryptography states that classical shared secrets are distributed to several parties and a subset of them, whose number is greater than a threshold, collaborates to compute a quantum cryptographic function, while keeping each share secretly inside each party. The shared secrets are reusable if no cheating is detected. As a concrete example of this concept, we show a distributed protocol (with threshold) of conjugate coding

  3. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  4. Theory of threshold phenomena

    International Nuclear Information System (INIS)

    Hategan, Cornel

    2002-01-01

    Theory of Threshold Phenomena in Quantum Scattering is developed in terms of Reduced Scattering Matrix. Relationships of different types of threshold anomalies both to nuclear reaction mechanisms and to nuclear reaction models are established. Magnitude of threshold effect is related to spectroscopic factor of zero-energy neutron state. The Theory of Threshold Phenomena, based on Reduced Scattering Matrix, does establish relationships between different types of threshold effects and nuclear reaction mechanisms: the cusp and non-resonant potential scattering, s-wave threshold anomaly and compound nucleus resonant scattering, p-wave anomaly and quasi-resonant scattering. A threshold anomaly related to resonant or quasi resonant scattering is enhanced provided the neutron threshold state has large spectroscopic amplitude. The Theory contains, as limit cases, Cusp Theories and also results of different nuclear reactions models as Charge Exchange, Weak Coupling, Bohr and Hauser-Feshbach models. (author)

  5. Successful application of Low Voltage Electron Microscopy to practical materials problems

    International Nuclear Information System (INIS)

    Bell, David C.; Mankin, Max; Day, Robert W.; Erdman, Natasha

    2014-01-01

    Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely

  6. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  7. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  8. A high-efficiency low-voltage CMOS rectifier for harvesting energy in implantable devices.

    Science.gov (United States)

    Hashemi, S Saeid; Sawan, Mohamad; Savaria, Yvon

    2012-08-01

    We present, in this paper, a new full-wave CMOS rectifier dedicated for wirelessly-powered low-voltage biomedical implants. It uses bootstrapped capacitors to reduce the effective threshold voltage of selected MOS switches. It achieves a significant increase in its overall power efficiency and low voltage-drop. Therefore, the rectifier is good for applications with low-voltage power supplies and large load current. The rectifier topology does not require complex circuit design. The highest voltages available in the circuit are used to drive the gates of selected transistors in order to reduce leakage current and to lower their channel on-resistance, while having high transconductance. The proposed rectifier was fabricated using the standard TSMC 0.18 μm CMOS process. When connected to a sinusoidal source of 3.3 V peak amplitude, it allows improving the overall power efficiency by 11% compared to the best recently published results given by a gate cross-coupled-based structure.

  9. A high sensitivity process variation sensor utilizing sub-threshold operation

    OpenAIRE

    Meterelliyoz, Mesut; Song, Peilin; Stellari, Franco; Kulkarni, Jaydeep P.; Roy, Kaushik

    2008-01-01

    In this paper, we propose a novel low-power, bias-free, high-sensitivity process variation sensor for monitoring random variations in the threshold voltage. The proposed sensor design utilizes the exponential current-voltage relationship of sub-threshold operation thereby improving the sensitivity by 2.3X compared to the above-threshold operation. A test-chip containing 128 PMOS and 128 NMOS devices has been fabri...

  10. Drain-induced barrier lowering effect for short channel dual material gate 4H silicon carbide metal—semiconductor field-effect transistor

    Science.gov (United States)

    Zhang, Xian-Jun; Yang, Yin-Tang; Duan, Bao-Xing; Chai, Chang-Chun; Song, Kun; Chen, Bin

    2012-09-01

    Sub-threshold characteristics of the dual material gate 4H-SiC MESFET (DMGFET) are investigated and the analytical models to describe the drain-induced barrier lowering (DIBL) effect are derived by solving one- and two-dimensional Poisson's equations. Using these models, we calculate the bottom potential of the channel and the threshold voltage shift, which characterize the drain-induced barrier lowering (DIBL) effect. The calculated results reveal that the dual material gate (DMG) structure alleviates the deterioration of the threshold voltage and thus suppresses the DIBL effect due to the introduced step function, which originates from the work function difference of the two gate materials when compared with the conventional single material gate metal—semiconductor field-effect transistor (SMGFET).

  11. Drain-induced barrier lowering effect for short channel dual material gate 4H silicon carbide metal—semiconductor field-effect transistor

    International Nuclear Information System (INIS)

    Zhang Xian-Jun; Yang Yin-Tang; Duan Bao-Xing; Chai Chang-Chun; Song Kun; Chen Bin

    2012-01-01

    Sub-threshold characteristics of the dual material gate 4H-SiC MESFET (DMGFET) are investigated and the analytical models to describe the drain-induced barrier lowering (DIBL) effect are derived by solving one- and two-dimensional Poisson's equations. Using these models, we calculate the bottom potential of the channel and the threshold voltage shift, which characterize the drain-induced barrier lowering (DIBL) effect. The calculated results reveal that the dual material gate (DMG) structure alleviates the deterioration of the threshold voltage and thus suppresses the DIBL effect due to the introduced step function, which originates from the work function difference of the two gate materials when compared with the conventional single material gate metal—semiconductor field-effect transistor (SMGFET)

  12. Measuring Input Thresholds on an Existing Board

    Science.gov (United States)

    Kuperman, Igor; Gutrich, Daniel G.; Berkun, Andrew C.

    2011-01-01

    A critical PECL (positive emitter-coupled logic) interface to Xilinx interface needed to be changed on an existing flight board. The new Xilinx input interface used a CMOS (complementary metal-oxide semiconductor) type of input, and the driver could meet its thresholds typically, but not in worst-case, according to the data sheet. The previous interface had been based on comparison with an external reference, but the CMOS input is based on comparison with an internal divider from the power supply. A way to measure what the exact input threshold was for this device for 64 inputs on a flight board was needed. The measurement technique allowed an accurate measurement of the voltage required to switch a Xilinx input from high to low for each of the 64 lines, while only probing two of them. Directly driving an external voltage was considered too risky, and tests done on any other unit could not be used to qualify the flight board. The two lines directly probed gave an absolute voltage threshold calibration, while data collected on the remaining 62 lines without probing gave relative measurements that could be used to identify any outliers. The PECL interface was forced to a long-period square wave by driving a saturated square wave into the ADC (analog to digital converter). The active pull-down circuit was turned off, causing each line to rise rapidly and fall slowly according to the input s weak pull-down circuitry. The fall time shows up as a change in the pulse width of the signal ready by the Xilinx. This change in pulse width is a function of capacitance, pulldown current, and input threshold. Capacitance was known from the different trace lengths, plus a gate input capacitance, which is the same for all inputs. The pull-down current is the same for all inputs including the two that are probed directly. The data was combined, and the Excel solver tool was used to find input thresholds for the 62 lines. This was repeated over different supply voltages and

  13. Reaction thresholds in doubly special relativity

    International Nuclear Information System (INIS)

    Heyman, Daniel; Major, Seth; Hinteleitner, Franz

    2004-01-01

    Two theories of special relativity with an additional invariant scale, 'doubly special relativity', are tested with calculations of particle process kinematics. Using the Judes-Visser modified conservation laws, thresholds are studied in both theories. In contrast with some linear approximations, which allow for particle processes forbidden in special relativity, both the Amelino-Camelia and Magueijo-Smolin frameworks allow no additional processes. To first order, the Amelino-Camelia framework thresholds are lowered and the Magueijo-Smolin framework thresholds may be raised or lowered

  14. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  15. The gradual nature of threshold switching

    International Nuclear Information System (INIS)

    Wimmer, M; Salinga, M

    2014-01-01

    The recent commercialization of electronic memories based on phase change materials proved the usability of this peculiar family of materials for application purposes. More advanced data storage and computing concepts, however, demand a deeper understanding especially of the electrical properties of the amorphous phase and the switching behaviour. In this work, we investigate the temporal evolution of the current through the amorphous state of the prototypical phase change material, Ge 2 Sb 2 Te 5 , under constant voltage. A custom-made electrical tester allows the measurement of delay times over five orders of magnitude, as well as the transient states of electrical excitation prior to the actual threshold switching. We recognize a continuous current increase over time prior to the actual threshold-switching event to be a good measure for the electrical excitation. A clear correlation between a significant rise in pre-switching-current and the later occurrence of threshold switching can be observed. This way, we found experimental evidence for the existence of an absolute minimum for the threshold voltage (or electric field respectively) holding also for time scales far beyond the measurement range. (paper)

  16. Voltage harmonic elimination with RLC based interface smoothing filter

    International Nuclear Information System (INIS)

    Chandrasekaran, K; Ramachandaramurthy, V K

    2015-01-01

    A method is proposed for designing a Dynamic Voltage Restorer (DVR) with RLC interface smoothing filter. The RLC filter connected between the IGBT based Voltage Source Inverter (VSI) is attempted to eliminate voltage harmonics in the busbar voltage and switching harmonics from VSI by producing a PWM controlled harmonic voltage. In this method, the DVR or series active filter produces PWM voltage that cancels the existing harmonic voltage due to any harmonic voltage source. The proposed method is valid for any distorted busbar voltage. The operating VSI handles no active power but only harmonic power. The DVR is able to suppress the lower order switching harmonics generated by the IGBT based VSI. Good dynamic and transient results obtained. The Total Harmonic Distortion (THD) is minimized to zero at the sensitive load end. Digital simulations are carried out using PSCAD/EMTDC to validate the performance of RLC filter. Simulated results are presented. (paper)

  17. Threshold Signature Schemes Application

    Directory of Open Access Journals (Sweden)

    Anastasiya Victorovna Beresneva

    2015-10-01

    Full Text Available This work is devoted to an investigation of threshold signature schemes. The systematization of the threshold signature schemes was done, cryptographic constructions based on interpolation Lagrange polynomial, elliptic curves and bilinear pairings were examined. Different methods of generation and verification of threshold signatures were explored, the availability of practical usage of threshold schemes in mobile agents, Internet banking and e-currency was shown. The topics of further investigation were given and it could reduce a level of counterfeit electronic documents signed by a group of users.

  18. Particles near threshold

    International Nuclear Information System (INIS)

    Bhattacharya, T.; Willenbrock, S.

    1993-01-01

    We propose returning to the definition of the width of a particle in terms of the pole in the particle's propagator. Away from thresholds, this definition of width is equivalent to the standard perturbative definition, up to next-to-leading order; however, near a threshold, the two definitions differ significantly. The width as defined by the pole position provides more information in the threshold region than the standard perturbative definition and, in contrast with the perturbative definition, does not vanish when a two-particle s-wave threshold is approached from below

  19. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  20. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  1. Comparative study of InGaP/GaAs high electron mobility transistors with upper and lower delta-doped supplied layers

    International Nuclear Information System (INIS)

    Tsai, Jung-Hui; Ye, Sheng-Shiun; Guo, Der-Feng; Lour, Wen-Shiung

    2012-01-01

    Influence corresponding to the position of δ-doped supplied layer on InGaP/GaAs high electron mobility transistors is comparatively studied by two-dimensional simulation analysis. The simulated results exhibit that the device with lower δ-doped supplied layer shows a higher gate potential barrier height, a higher saturation output current, a larger magnitude of negative threshold voltage, and broader gate voltage swing, as compared to the device with upper δ-doped supplied layer. Nevertheless, it has smaller transconductance and inferior high-frequency characteristics in the device with lower δ-doped supplied layer. Furthermore, a knee effect in current-voltage curves is observed at low drain-to-source voltage in the two devices, which is investigated in this article.

  2. Modelling voltage sag mitigation using dynamic voltage restorer and analyzing power quality issue

    Science.gov (United States)

    Ismail, Nor Laili; Hidzir, Hizrin Dayana Mohd; Thanakodi, Suresh; Nazar, Nazatul Shiema Moh; Ibrahim, Pungut; Ali, Che Ku Muhammad Sabri Che Ku

    2018-02-01

    Power quality problem which are arise due to a fault or a pulsed load can have caused an interruption of critical load. The modern power systems are becoming more sensitive to the quality of the power supplied by the utility company. Voltage sags and swells, flicker, interruptions, harmonic distortion and other distortion to the sinusoidal waveform are the examples of the power quality problems. The most affected due to these problems is industrial customers who use a lot of sensitive equipment. There has suffered a huge loss to these problems. Resulting of broken or damage equipment if voltage sag exceeds the sensitive threshold of the equipment. Thus, device such as Static Synchronous Compensator (STATCOM) and Dynamic Voltage Restorer (DVR) has been created to solve this problem among users. DVR is a custom power device that most effective and efficient. This paper intended to report the DVR operations during voltage sag compensation.

  3. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  4. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  5. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  6. A novel gate and drain engineered charge plasma tunnel field-effect transistor for low sub-threshold swing and ambipolar nature

    Science.gov (United States)

    Yadav, Dharmendra Singh; Raad, Bhagwan Ram; Sharma, Dheeraj

    2016-12-01

    In this paper, we focus on the improvement of figures of merit for charge plasma based tunnel field-effect transistor (TFET) in terms of ON-state current, threshold voltage, sub-threshold swing, ambipolar nature, and gate to drain capacitance which provides better channel controlling of the device with improved high frequency response at ultra-low supply voltages. Regarding this, we simultaneously employ work function engineering on the drain and gate electrode of the charge plasma TFET. The use of gate work function engineering modulates the barrier on the source/channel interface leads to improvement in the ON-state current, threshold voltage, and sub-threshold swing. Apart from this, for the first time use of work function engineering on the drain electrode increases the tunneling barrier for the flow of holes on the drain/channel interface, it results into suppression of ambipolar behavior. The lowering of gate to drain capacitance therefore enhanced high frequency parameters. Whereas, the presence of dual work functionality at the gate electrode and over the drain region improves the overall performance of the charge plasma based TFET.

  7. Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

    Directory of Open Access Journals (Sweden)

    Dung Vo Tien

    2018-01-01

    Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

  8. Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

    Science.gov (United States)

    Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

    2014-04-01

    Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Impacts of DEM resolution and area threshold value uncertainty on ...

    African Journals Online (AJOL)

    ... that DEM resolution influences the selected flow accumulation threshold value; the suitable flow accumulation threshold value increases as the DEM resolution increases, and shows greater variability for basins with lower drainage densities. The link between drainage area threshold value and stream network extraction ...

  10. Calculated sputtering and atomic displacement cross-sections for applications to medium voltage analytical electron microscopy

    International Nuclear Information System (INIS)

    Bradley, C.R.; Zaluzec, N.J.

    1987-08-01

    The development of medium voltage electron microscopes having high brightness electron sources and ultra-high vacuum environments has been anticipated by the microscopy community now for several years. The advantages of such a configuration have been discussed to great lengths, while the potential disadvantages have for the most part been neglected. The most detrimental of these relative to microcharacterization are the effects of electron sputtering and atomic displacement to the local specimen composition. These effects have in the past been considered mainly in the high voltage electron microscope regime and generally were ignored in lower voltage instruments. Recent experimental measurements have shown that the effects of electron sputtering as well as radiation induced segregation can be observed in conventional transmission electron microscopes. It is, therefore, important to determine at what point the effects will begin to manifest themselves in the new generation of medium voltage analytical electron microscopes. In this manuscript we present new calculations which allow the individual experimentalist to determine the potential threshold levels for a particular elemental system and thus avoid the dangers of introducing artifacts during microanalysis. 12 refs., 3 figs

  11. A micro-power LDO with piecewise voltage foldback current limit protection

    International Nuclear Information System (INIS)

    Wei Hailong; Liu Youbao; Guo Zhongjie; Liao Xue

    2012-01-01

    To achieve a constant current limit, low power consumption and high driving capability, a micro-power LDO with a piecewise voltage-foldback current-limit circuit is presented. The current-limit threshold is dynamically adjusted to achieve a maximum driving capability and lower quiescent current of only 300 nA. To increase the loop stability of the proposed LDO, a high impedance transconductance buffer under a micro quiescent current is designed for splitting the pole that exists at the gate of the pass transistor to the dominant pole, and a zero is designed for the purpose of the second pole phase compensation. The proposed LDO is fabricated in a BiCMOS process. The measurement results show that the short-circuit current of the LDO is 190 mA, the constant limit current under a high drop-out voltage is 440 mA, and the maximum load current under a low drop-out voltage is up to 800 mA. In addition, the quiescent current of the LDO is only 7 μA, the load regulation is about 0.56% on full scale, the line regulation is about 0.012%/V, the PSRR at 120 Hz is 58 dB and the drop-out voltage is only 70 mV when the load current is 250 mA. (semiconductor integrated circuits)

  12. Double Photoionization Near Threshold

    Science.gov (United States)

    Wehlitz, Ralf

    2007-01-01

    The threshold region of the double-photoionization cross section is of particular interest because both ejected electrons move slowly in the Coulomb field of the residual ion. Near threshold both electrons have time to interact with each other and with the residual ion. Also, different theoretical models compete to describe the double-photoionization cross section in the threshold region. We have investigated that cross section for lithium and beryllium and have analyzed our data with respect to the latest results in the Coulomb-dipole theory. We find that our data support the idea of a Coulomb-dipole interaction.

  13. Thresholds in radiobiology

    International Nuclear Information System (INIS)

    Katz, R.; Hofmann, W.

    1982-01-01

    Interpretations of biological radiation effects frequently use the word 'threshold'. The meaning of this word is explored together with its relationship to the fundamental character of radiation effects and to the question of perception. It is emphasised that although the existence of either a dose or an LET threshold can never be settled by experimental radiobiological investigations, it may be argued on fundamental statistical grounds that for all statistical processes, and especially where the number of observed events is small, the concept of a threshold is logically invalid. (U.K.)

  14. PLATEAUING COSMIC RAY DETECTORS TO ACHIEVE OPTIMUM OPERATING VOLTAGE

    Energy Technology Data Exchange (ETDEWEB)

    Knoff, E.N.; Peterson, R.S.

    2008-01-01

    Through QuarkNet, students across the country have access to cosmic ray detectors in their high school classrooms. These detectors operate using a scintillator material and a photomultiplier tube (PMT). A data acquisition (DAQ) board counts cosmic ray hits from the counters. Through an online e-Lab, students can analyze and share their data. In order to collect viable data, the PMTs should operate at their plateau voltages. In these plateau ranges, the number of counts per minute remains relatively constant with small changes in PMT voltage. We sought to plateau the counters in the test array and to clarify the plateauing procedure itself. In order to most effectively plateau the counters, the counters should be stacked and programmed to record the number of coincident hits as well as their singles rates. We also changed the threshold value that a signal must exceed in order to record a hit and replateaued the counters. For counter 1, counter 2, and counter 3, we found plateau voltages around 1V. The singles rate plateau was very small, while the coincidence plateau was very long. The plateau voltages corresponded to a singles rate of 700–850 counts per minute. We found very little effect of changing the threshold voltages. Our chosen plateau voltages produced good performance studies on the e-Lab. Keeping in mind the nature of the experiments conducted by the high school students, we recommend a streamlined plateauing process. Because changing the threshold did not drastically affect the plateau voltage or the performance study, students should choose a threshold value, construct plateau graphs, and analyze their data using a performance study. Even if the counters operate slightly off their plateau voltage, they should deliver good performance studies and return reliable results.

  15. Hyper-arousal decreases human visual thresholds.

    Directory of Open Access Journals (Sweden)

    Adam J Woods

    Full Text Available Arousal has long been known to influence behavior and serves as an underlying component of cognition and consciousness. However, the consequences of hyper-arousal for visual perception remain unclear. The present study evaluates the impact of hyper-arousal on two aspects of visual sensitivity: visual stereoacuity and contrast thresholds. Sixty-eight participants participated in two experiments. Thirty-four participants were randomly divided into two groups in each experiment: Arousal Stimulation or Sham Control. The Arousal Stimulation group underwent a 50-second cold pressor stimulation (immersing the foot in 0-2° C water, a technique known to increase arousal. In contrast, the Sham Control group immersed their foot in room temperature water. Stereoacuity thresholds (Experiment 1 and contrast thresholds (Experiment 2 were measured before and after stimulation. The Arousal Stimulation groups demonstrated significantly lower stereoacuity and contrast thresholds following cold pressor stimulation, whereas the Sham Control groups showed no difference in thresholds. These results provide the first evidence that hyper-arousal from sensory stimulation can lower visual thresholds. Hyper-arousal's ability to decrease visual thresholds has important implications for survival, sports, and everyday life.

  16. Adaptive Supply Voltage Management for Low Power Logic Circuitry Operating at Subthreshold

    OpenAIRE

    Rehan Ahmed

    2015-01-01

    With the rise in demand of portable hand held devices and with the rise in application of wireless sensor networks and RFID reduction of total power consumption has become a necessity. To save power we operate the logic circuitry of our devices at sub-threshold. In sub-threshold the drain current is exponentially dependent on the threshold voltage hence the threshold variation causes profound variation of ION and IOFF the ratio of which affect the speed of a circuit drastically. S...

  17. Regional Seismic Threshold Monitoring

    National Research Council Canada - National Science Library

    Kvaerna, Tormod

    2006-01-01

    ... model to be used for predicting the travel times of regional phases. We have applied these attenuation relations to develop and assess a regional threshold monitoring scheme for selected subregions of the European Arctic...

  18. A light-powered sub-threshold microprocessor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Ming; Chen Hong; Zhang Chun; Li Changmeng; Wang Zhihua, E-mail: lium02@mails.tsinghua.edu.cn [Institute of Microelectronics, Tsinghua University, Beijing 100084 (China)

    2010-11-15

    This paper presents an 8-bit sub-threshold microprocessor which can be powered by an integrated photosensitive diode. With a custom designed sub-threshold standard cell library and 1 kbit sub-threshold SRAM design, the leakage power of 58 nW, dynamic power of 385 nW - 165 kHz, EDP 13 pJ/inst and the operating voltage of 350 mV are achieved. Under a light of about 150 kLux, the microprocessor can run at a rate of up to 500 kHz. The microprocessor can be used for wireless-sensor-network nodes.

  19. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  20. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  1. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  2. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  3. A 50–60 GHz mm-wave rectifier with bulk voltage bias in 65-nm CMOS

    NARCIS (Netherlands)

    Gao, H.; Matters-Kammerer, M.; Harpe, P.; Baltus, P.

    2016-01-01

    This letter presents a 50∼60 GHz fully integrated 3-stage rectifier with bulk voltage bias for threshold voltage modulation in a 65-nm CMOS technology, which can be integrated in a mm-wave hybrid rectifier structure as the main rectifier. In this letter, the new technique of bulk voltage bias is

  4. Threshold guidance update

    International Nuclear Information System (INIS)

    Wickham, L.E.

    1986-01-01

    The Department of Energy (DOE) is developing the concept of threshold quantities for use in determining which waste materials must be handled as radioactive waste and which may be disposed of as nonradioactive waste at its sites. Waste above this concentration level would be managed as radioactive or mixed waste (if hazardous chemicals are present); waste below this level would be handled as sanitary waste. Last years' activities (1984) included the development of a threshold guidance dose, the development of threshold concentrations corresponding to the guidance dose, the development of supporting documentation, review by a technical peer review committee, and review by the DOE community. As a result of the comments, areas have been identified for more extensive analysis, including an alternative basis for selection of the guidance dose and the development of quality assurance guidelines. Development of quality assurance guidelines will provide a reasonable basis for determining that a given waste stream qualifies as a threshold waste stream and can then be the basis for a more extensive cost-benefit analysis. The threshold guidance and supporting documentation will be revised, based on the comments received. The revised documents will be provided to DOE by early November. DOE-HQ has indicated that the revised documents will be available for review by DOE field offices and their contractors

  5. Ultra-low power high temperature and radiation hard complementary metal-oxide-semiconductor (CMOS) silicon-on-insulator (SOI) voltage reference.

    Science.gov (United States)

    Boufouss, El Hafed; Francis, Laurent A; Kilchytska, Valeriya; Gérard, Pierre; Simon, Pascal; Flandre, Denis

    2013-12-13

    This paper presents an ultra-low power CMOS voltage reference circuit which is robust under biomedical extreme conditions, such as high temperature and high total ionized dose (TID) radiation. To achieve such performances, the voltage reference is designed in a suitable 130 nm Silicon-on-Insulator (SOI) industrial technology and is optimized to work in the subthreshold regime of the transistors. The design simulations have been performed over the temperature range of -40-200 °C and for different process corners. Robustness to radiation was simulated using custom model parameters including TID effects, such as mobilities and threshold voltages degradation. The proposed circuit has been tested up to high total radiation dose, i.e., 1 Mrad (Si) performed at three different temperatures (room temperature, 100 °C and 200 °C). The maximum drift of the reference voltage V(REF) depends on the considered temperature and on radiation dose; however, it remains lower than 10% of the mean value of 1.5 V. The typical power dissipation at 2.5 V supply voltage is about 20 μW at room temperature and only 75 μW at a high temperature of 200 °C. To understand the effects caused by the combination of high total ionizing dose and temperature on such voltage reference, the threshold voltages of the used SOI MOSFETs were extracted under different conditions. The evolution of V(REF) and power consumption with temperature and radiation dose can then be explained in terms of the different balance between fixed oxide charge and interface states build-up. The total occupied area including pad-ring is less than 0.09 mm2.

  6. Three-level boost converter with zero voltage transition

    Directory of Open Access Journals (Sweden)

    Kuo-Ing Hwu

    2017-06-01

    Full Text Available As compared with the traditional boost converter, the three-level boost converter possesses several advantages, such as lower switch voltage stresses and lower inductor current ripple. To improve the efficiency, this paper proposes a zero voltage transition (ZVT three-level boost converter. With the proposed ZVT circuit, the switches can achieve soft switching. Moreover, by using the voltage balance control, the output voltage can be equally across the output capacitors. In this study, the effectiveness of the proposed topology is verified by the experimental results based on the field-programmable gate array control.

  7. Near threshold fatigue testing

    Science.gov (United States)

    Freeman, D. C.; Strum, M. J.

    1993-01-01

    Measurement of the near-threshold fatigue crack growth rate (FCGR) behavior provides a basis for the design and evaluation of components subjected to high cycle fatigue. Typically, the near-threshold fatigue regime describes crack growth rates below approximately 10(exp -5) mm/cycle (4 x 10(exp -7) inch/cycle). One such evaluation was recently performed for the binary alloy U-6Nb. The procedures developed for this evaluation are described in detail to provide a general test method for near-threshold FCGR testing. In particular, techniques for high-resolution measurements of crack length performed in-situ through a direct current, potential drop (DCPD) apparatus, and a method which eliminates crack closure effects through the use of loading cycles with constant maximum stress intensity are described.

  8. Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter

    Science.gov (United States)

    Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun

    2018-03-01

    The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.

  9. Possible precursors of ball lightning. Observation of closed loops in high voltage discharges

    International Nuclear Information System (INIS)

    Alexeff, I.; Rader, M.

    1995-01-01

    Several hundred photographs of ultrahigh voltage discharges have been obtained that show closed current loops. These closed current loops may be precursors of ball lightning. One feature of these discharges may explain why observations of ball lightning may be infrequent; that is, there is a distinct threshold in voltage and/or current below which the closed loops do not occur. This threshold current fits other experimental data but is well above the usually observed currents in natural lightning. 10 refs., 3 figs

  10. A nanoscale piezoelectric transformer for low-voltage transistors.

    Science.gov (United States)

    Agarwal, Sapan; Yablonovitch, Eli

    2014-11-12

    A novel piezoelectric voltage transformer for low-voltage transistors is proposed. Placing a piezoelectric transformer on the gate of a field-effect transistor results in the piezoelectric transformer field-effect transistor that can switch at significantly lower voltages than a conventional transistor. The piezoelectric transformer operates by using one piezoelectric to squeeze another piezoelectric to generate a higher output voltage than the input voltage. Multiple piezoelectrics can be used to squeeze a single piezoelectric layer to generate an even higher voltage amplification. Coupled electrical and mechanical modeling in COMSOL predicts a 12.5× voltage amplification for a six-layer piezoelectric transformer. This would lead to more than a 150× reduction in the power needed for communications.

  11. Voltage scheduling for low power/energy

    Science.gov (United States)

    Manzak, Ali

    2001-07-01

    Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

  12. Threshold factorization redux

    Science.gov (United States)

    Chay, Junegone; Kim, Chul

    2018-05-01

    We reanalyze the factorization theorems for the Drell-Yan process and for deep inelastic scattering near threshold, as constructed in the framework of the soft-collinear effective theory (SCET), from a new, consistent perspective. In order to formulate the factorization near threshold in SCET, we should include an additional degree of freedom with small energy, collinear to the beam direction. The corresponding collinear-soft mode is included to describe the parton distribution function (PDF) near threshold. The soft function is modified by subtracting the contribution of the collinear-soft modes in order to avoid double counting on the overlap region. As a result, the proper soft function becomes infrared finite, and all the factorized parts are free of rapidity divergence. Furthermore, the separation of the relevant scales in each factorized part becomes manifest. We apply the same idea to the dihadron production in e+e- annihilation near threshold, and show that the resultant soft function is also free of infrared and rapidity divergences.

  13. Elaborating on Threshold Concepts

    Science.gov (United States)

    Rountree, Janet; Robins, Anthony; Rountree, Nathan

    2013-01-01

    We propose an expanded definition of Threshold Concepts (TCs) that requires the successful acquisition and internalisation not only of knowledge, but also its practical elaboration in the domains of applied strategies and mental models. This richer definition allows us to clarify the relationship between TCs and Fundamental Ideas, and to account…

  14. Modulation of voltage-gated channel currents by harmaline and harmane.

    Science.gov (United States)

    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

    2005-01-01

    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

  15. Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

    DEFF Research Database (Denmark)

    Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

    2016-01-01

    : off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

  16. Effect of thermal insulation on the electrical characteristics of NbOx threshold switches

    Science.gov (United States)

    Wang, Ziwen; Kumar, Suhas; Wong, H.-S. Philip; Nishi, Yoshio

    2018-02-01

    Threshold switches based on niobium oxide (NbOx) are promising candidates as bidirectional selector devices in crossbar memory arrays and building blocks for neuromorphic computing. Here, it is experimentally demonstrated that the electrical characteristics of NbOx threshold switches can be tuned by engineering the thermal insulation. Increasing the thermal insulation by ˜10× is shown to produce ˜7× reduction in threshold current and ˜45% reduction in threshold voltage. The reduced threshold voltage leads to ˜5× reduction in half-selection leakage, which highlights the effectiveness of reducing half-selection leakage of NbOx selectors by engineering the thermal insulation. A thermal feedback model based on Poole-Frenkel conduction in NbOx can explain the experimental results very well, which also serves as a piece of strong evidence supporting the validity of the Poole-Frenkel based mechanism in NbOx threshold switches.

  17. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  18. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  19. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  20. Hadron production near threshold

    Indian Academy of Sciences (India)

    Abstract. Final state interaction effects in pp → pΛK+ and pd → 3He η reactions are explored near threshold to study the sensitivity of the cross-sections to the pΛ potential and the ηN scattering matrix. The final state scattering wave functions between Λ and p and η and 3He are described rigorously. The Λ production is ...

  1. Casualties and threshold effects

    International Nuclear Information System (INIS)

    Mays, C.W.; National Cancer Inst., Bethesda

    1988-01-01

    Radiation effects like cancer are denoted as casualties. Other radiation effects occur almost in everyone when the radiation dose is sufficiently high. One then speaks of radiation effects with a threshold dose. In this article the author puts his doubt about this classification of radiation effects. He argues that some effects of exposure to radiation do not fit in this classification. (H.W.). 19 refs.; 2 figs.; 1 tab

  2. Resonance phenomena near thresholds

    International Nuclear Information System (INIS)

    Persson, E.; Mueller, M.; Rotter, I.; Technische Univ. Dresden

    1995-12-01

    The trapping effect is investigated close to the elastic threshold. The nucleus is described as an open quantum mechanical many-body system embedded in the continuum of decay channels. An ensemble of compound nucleus states with both discrete and resonance states is investigated in an energy-dependent formalism. It is shown that the discrete states can trap the resonance ones and also that the discrete states can directly influence the scattering cross section. (orig.)

  3. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  4. Total Ionizing Dose Effects on Threshold Switching in 1T-Tantalum Disulfide Charge-Density-Wave Devices

    OpenAIRE

    Liu, G.; Zhang, E. X.; Liang, C. D.; Bloodgood, M. A.; Salguero, T. T.; Fleetwood, D. M.; Balandin, A. A.

    2017-01-01

    The 1T polytype of TaS2 exhibits voltage-triggered threshold switching as a result of a phase transition from nearly commensurate to incommensurate charge density wave states. Threshold switching, persistent above room temperature, can be utilized in a variety of electronic devices, e.g., voltage controlled oscillators. We evaluated the total-ionizing-dose response of thin film 1T-TaS2 at doses up to 1 Mrad(SiO2). The threshold voltage changed by less than 2% after irradiation, with persisten...

  5. Epidemic threshold in directed networks

    Science.gov (United States)

    Li, Cong; Wang, Huijuan; Van Mieghem, Piet

    2013-12-01

    Epidemics have so far been mostly studied in undirected networks. However, many real-world networks, such as the online social network Twitter and the world wide web, on which information, emotion, or malware spreads, are directed networks, composed of both unidirectional links and bidirectional links. We define the directionality ξ as the percentage of unidirectional links. The epidemic threshold τc for the susceptible-infected-susceptible (SIS) epidemic is lower bounded by 1/λ1 in directed networks, where λ1, also called the spectral radius, is the largest eigenvalue of the adjacency matrix. In this work, we propose two algorithms to generate directed networks with a given directionality ξ. The effect of ξ on the spectral radius λ1, principal eigenvector x1, spectral gap (λ1-λ2), and algebraic connectivity μN-1 is studied. Important findings are that the spectral radius λ1 decreases with the directionality ξ, whereas the spectral gap and the algebraic connectivity increase with the directionality ξ. The extent of the decrease of the spectral radius depends on both the degree distribution and the degree-degree correlation ρD. Hence, in directed networks, the epidemic threshold is larger and a random walk converges to its steady state faster than that in undirected networks with the same degree distribution.

  6. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...

  7. Mitigation of Voltage Swells by Static Series Compensator

    DEFF Research Database (Denmark)

    Awad, Hilmy; Blaabjerg, Frede

    2004-01-01

    Swells and overvoltages can cause overheating, tripping or even destruction of industrial equipment such as motor drives and control relays. This paper investigates the possibility of employing the Static Series Compensator (SSC) to mitigate voltage swells/overvoltages. In the case of voltage...... is lower than a predetermined voltage level, the active power is employed to charge the ESC to this voltage level; 2) otherwise, the overvoltage protection of the SSC must operate. This paper also applies an overvoltage protection scheme based on a combination of a dc resistor with a chopper and the valves...

  8. Dynamic range of low-voltage cascode current mirrors

    DEFF Research Database (Denmark)

    Bruun, Erik; Shah, Peter Jivan

    1995-01-01

    Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...

  9. Comparison between intensity- duration thresholds and cumulative rainfall thresholds for the forecasting of landslide

    Science.gov (United States)

    Lagomarsino, Daniela; Rosi, Ascanio; Rossi, Guglielmo; Segoni, Samuele; Catani, Filippo

    2014-05-01

    This work makes a quantitative comparison between the results of landslide forecasting obtained using two different rainfall threshold models, one using intensity-duration thresholds and the other based on cumulative rainfall thresholds in an area of northern Tuscany of 116 km2. The first methodology identifies rainfall intensity-duration thresholds by means a software called MaCumBA (Massive CUMulative Brisk Analyzer) that analyzes rain-gauge records, extracts the intensities (I) and durations (D) of the rainstorms associated with the initiation of landslides, plots these values on a diagram, and identifies thresholds that define the lower bounds of the I-D values. A back analysis using data from past events can be used to identify the threshold conditions associated with the least amount of false alarms. The second method (SIGMA) is based on the hypothesis that anomalous or extreme values of rainfall are responsible for landslide triggering: the statistical distribution of the rainfall series is analyzed, and multiples of the standard deviation (σ) are used as thresholds to discriminate between ordinary and extraordinary rainfall events. The name of the model, SIGMA, reflects the central role of the standard deviations in the proposed methodology. The definition of intensity-duration rainfall thresholds requires the combined use of rainfall measurements and an inventory of dated landslides, whereas SIGMA model can be implemented using only rainfall data. These two methodologies were applied in an area of 116 km2 where a database of 1200 landslides was available for the period 2000-2012. The results obtained are compared and discussed. Although several examples of visual comparisons between different intensity-duration rainfall thresholds are reported in the international literature, a quantitative comparison between thresholds obtained in the same area using different techniques and approaches is a relatively undebated research topic.

  10. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  11. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  12. Double photoionization of helium near threshold

    International Nuclear Information System (INIS)

    Levin, J.C.; Armen, G.B.; Sellin, I.A.

    1996-01-01

    There has been substantial recent experimental interest in the ratio of double-to-single photoionization of He near threshold following several theoretical observations that earlier measurements appear to overestimate the ratio, perhaps by as much as 25%, in the first several hundred eV above threshold. The authors recent measurements are 10%-15% below these earlier results and more recent results of Doerner et al. and Samson et al. are yet another 10% lower. The authors will compare these measurement with new data, not yet analyzed, and available theory

  13. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  14. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  15. Determinants of Change in the Cost-effectiveness Threshold.

    Science.gov (United States)

    Paulden, Mike; O'Mahony, James; McCabe, Christopher

    2017-02-01

    The cost-effectiveness threshold in health care systems with a constrained budget should be determined by the cost-effectiveness of displacing health care services to fund new interventions. Using comparative statics, we review some potential determinants of the threshold, including the budget for health care, the demand for existing health care interventions, the technical efficiency of existing interventions, and the development of new health technologies. We consider the anticipated direction of impact that would affect the threshold following a change in each of these determinants. Where the health care system is technically efficient, an increase in the health care budget unambiguously raises the threshold, whereas an increase in the demand for existing, non-marginal health interventions unambiguously lowers the threshold. Improvements in the technical efficiency of existing interventions may raise or lower the threshold, depending on the cause of the improvement in efficiency, whether the intervention is already funded, and, if so, whether it is marginal. New technologies may also raise or lower the threshold, depending on whether the new technology is a substitute for an existing technology and, again, whether the existing technology is marginal. Our analysis permits health economists and decision makers to assess if and in what direction the threshold may change over time. This matters, as threshold changes impact the cost-effectiveness of interventions that require decisions now but have costs and effects that fall in future periods.

  16. Ionization smoke detectors - the high-voltage issues

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Production of high-voltage ionization smoke detectors ceased in 1978 following the development of lower voltage models which used much smaller amounts of radioactive material. Despite this fact, thousands of high-voltage detectors are still in use today in many large UK companies. The major users argue that there is no reason to stop using their detectors if they are still fit for their purpose - many could last for another 15 to 20 years if properly maintained. But pressure has been mounting on businesses to replace all their high-voltage detectors with new low-voltage models within the next couple of years. This could place a huge financial burden on the companies concerned, with costs possibly running into millions of pounds. Traditionally, the major detector installers offered cleaning and maintenance services for high-voltage detectors to their customers but these have now been withdrawn. The installers give no clear reasons for this decision except that the detectors are outmoded and should be disposed of as soon as possible. Most users would agree that conversion to low-voltage types is inevitable but their main worry is the financial strain of replacing all their detectors - and associated equipment - in one go. They would prefer to phase out their high-voltage detectors in stages over a number of years to spread the costs of conversion. The problems of maintenance is discussed. A dual voltage fire alarm panel which allows the high-voltage detectors to be phased out is mentioned. (Author)

  17. A study on the temperature dependence of the threshold switching characteristics of Ge2Sb2Te5

    Science.gov (United States)

    Lee, Suyoun; Jeong, Doo Seok; Jeong, Jeung-hyun; Zhe, Wu; Park, Young-Wook; Ahn, Hyung-Woo; Cheong, Byung-ki

    2010-01-01

    We investigated the temperature dependence of the threshold switching characteristics of a memory-type chalcogenide material, Ge2Sb2Te5. We found that the threshold voltage (Vth) decreased linearly with temperature, implying the existence of a critical conductivity of Ge2Sb2Te5 for its threshold switching. In addition, we investigated the effect of bias voltage and temperature on the delay time (tdel) of the threshold switching of Ge2Sb2Te5 and described the measured relationship by an analytic expression which we derived based on a physical model where thermally activated hopping is a dominant transport mechanism in the material.

  18. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  19. Thermal voltage noise in layered superconductors

    International Nuclear Information System (INIS)

    Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

    1995-01-01

    Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

  20. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  1. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  2. Intermediate structure and threshold phenomena

    International Nuclear Information System (INIS)

    Hategan, Cornel

    2004-01-01

    The Intermediate Structure, evidenced through microstructures of the neutron strength function, is reflected in open reaction channels as fluctuations in excitation function of nuclear threshold effects. The intermediate state supporting both neutron strength function and nuclear threshold effect is a micro-giant neutron threshold state. (author)

  3. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  4. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  5. Fluorescent Protein Voltage Probes Derived from ArcLight that Respond to Membrane Voltage Changes with Fast Kinetics

    Science.gov (United States)

    Han, Zhou; Jin, Lei; Platisa, Jelena; Cohen, Lawrence B.; Baker, Bradley J.; Pieribone, Vincent A.

    2013-01-01

    We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms) are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ) less than 6ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9%) is not as large as the Ciona-based ArcLight (~35%), they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals. PMID:24312287

  6. Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics.

    Directory of Open Access Journals (Sweden)

    Zhou Han

    Full Text Available We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ less than 6 ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9% is not as large as the Ciona-based ArcLight (~35%, they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals.

  7. Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement

    International Nuclear Information System (INIS)

    Boudjella, Aissa

    2011-01-01

    The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.

  8. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  9. Specific features of a single-pulse sliding discharge in neon near the threshold for spark breakdown

    Science.gov (United States)

    Trusov, K. K.

    2017-08-01

    Experimental data on the spatial structure of a single-pulse sliding discharge in neon at voltages below, equal to, and above the threshold for spark breakdown are discussed. The experiments were carried at gas pressures of 30 and 100 kPa and different polarities of the discharge voltage. Photographs of the plasma structure in two discharge chambers with different dimensions of the discharge zone and different thicknesses of an alumina dielectric plate on the surface of which the discharge develops are inspected. Common features of the prebreakdown discharge and its specific features depending on the voltage polarity and gas pressure are analyzed. It is shown that, at voltages below the threshold for spark breakdown, a low-current glow discharge with cathode and anode spots develops in the electrode gap. Above the breakdown threshold, regardless of the voltage polarity, spark channels directed from the cathode to the anode develop against the background of a low-current discharge.

  10. Current-Voltage Characteristics of the Composites Based on Epoxy Resin and Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Iwona Pełech

    2015-01-01

    Full Text Available Polymer composites based on epoxy resin were prepared. Multiwalled carbon nanotubes synthesized on iron-cobalt catalyst were applied as a filler in a polymer matrix. Chlorine or hydroxyl groups were incorporated on the carbon nanotubes surface via chlorination or chlorination followed by hydroxylation. The effect of functionalized carbon nanotubes on the epoxy resin matrix is discussed in terms of the state of CNTs dispersion in composites as well as electrical properties. For the obtained materials current-voltage characteristics were determined. They had a nonlinear character and were well described by an exponential-type equation. For all the obtained materials the percolation threshold occurred at a concentration of about 1 wt%. At a higher filler concentration >2 wt%, better conductivity was demonstrated by polymer composites with raw carbon nanotubes. At a lower filler concentration <2 wt%, higher values of electrical conductivity were obtained for polymer composites with modified carbon nanotubes.

  11. Crossing the Petawatt threshold

    International Nuclear Information System (INIS)

    Perry, M.

    1996-01-01

    A revolutionary new laser called the Petawatt, developed by Lawrence Livermore researchers after an intensive three-year development effort, has produced more than 1,000 trillion (open-quotes petaclose quotes) watts of power, a world record. By crossing the petawatt threshold, the extraordinarily powerful laser heralds a new age in laser research. Lasers that provide a petawatt of power or more in a picosecond may make it possible to achieve fusion using significantly less energy than currently envisioned, through a novel Livermore concept called open-quotes fast ignition.close quotes The petawatt laser will also enable researchers to study the fundamental properties of matter, thereby aiding the Department of Energy's Stockpile Stewardship efforts and opening entirely new physical regimes to study. The technology developed for the Petawatt has also provided several spinoff technologies, including a new approach to laser material processing

  12. Low heat pain thresholds in migraineurs between attacks.

    Science.gov (United States)

    Schwedt, Todd J; Zuniga, Leslie; Chong, Catherine D

    2015-06-01

    Between attacks, migraine is associated with hypersensitivities to sensory stimuli. The objective of this study was to investigate hypersensitivity to pain in migraineurs between attacks. Cutaneous heat pain thresholds were measured in 112 migraineurs, migraine free for ≥ 48 hours, and 75 healthy controls. Pain thresholds at the head and at the arm were compared between migraineurs and controls using two-tailed t-tests. Among migraineurs, correlations between heat pain thresholds and headache frequency, allodynia symptom severity, and time interval until next headache were calculated. Migraineurs had lower pain thresholds than controls at the head (43.9 ℃ ± 3.2 ℃ vs. 45.1 ℃ ± 3.0 ℃, p = 0.015) and arm (43.2 ℃ ± 3.4 ℃ vs. 44.8 ℃ ± 3.3 ℃, p pain thresholds and headache frequency or allodynia symptom severity. For the 41 migraineurs for whom time to next headache was known, there were positive correlations between time to next headache and pain thresholds at the head (r = 0.352, p = 0.024) and arm (r = 0.312, p = 0.047). This study provides evidence that migraineurs have low heat pain thresholds between migraine attacks. Mechanisms underlying these lower pain thresholds could also predispose migraineurs to their next migraine attack, a hypothesis supported by finding positive correlations between pain thresholds and time to next migraine attack. © International Headache Society 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  14. Model Development for Current–Voltage and Transconductance Characteristics of Normally-off AlN/GaN MOSHEMT

    International Nuclear Information System (INIS)

    Swain, R.; Jena, K.; Lenka, T. R.

    2016-01-01

    In this paper, an AlN/GaN-based MOSHEMT is proposed, in accordance to this, a charge control model has been developed analytically and simulated with MATLAB to predict the characteristics of threshold voltage, drain currents and transconductance. The physics based models for 2DEG density, threshold voltage and quantum capacitance in the channel has been put forward. By using these developed models, the drain current for both linear and saturation models is derived. The predicted threshold voltage with the variation of barrier thickness has been plotted. A positive threshold voltage can be obtained by decreasing the barrier thickness which builds up the foundation for enhancement mode MOSHEMT devices. The predicted I_d–V_g_s, I_d–V_d_s and transconductance characteristics show an excellent agreement with the experimental results and hence validate the model.

  15. Regional rainfall thresholds for landslide occurrence using a centenary database

    Science.gov (United States)

    Vaz, Teresa; Luís Zêzere, José; Pereira, Susana; Cruz Oliveira, Sérgio; Garcia, Ricardo A. C.; Quaresma, Ivânia

    2018-04-01

    This work proposes a comprehensive method to assess rainfall thresholds for landslide initiation using a centenary landslide database associated with a single centenary daily rainfall data set. The method is applied to the Lisbon region and includes the rainfall return period analysis that was used to identify the critical rainfall combination (cumulated rainfall duration) related to each landslide event. The spatial representativeness of the reference rain gauge is evaluated and the rainfall thresholds are assessed and calibrated using the receiver operating characteristic (ROC) metrics. Results show that landslide events located up to 10 km from the rain gauge can be used to calculate the rainfall thresholds in the study area; however, these thresholds may be used with acceptable confidence up to 50 km from the rain gauge. The rainfall thresholds obtained using linear and potential regression perform well in ROC metrics. However, the intermediate thresholds based on the probability of landslide events established in the zone between the lower-limit threshold and the upper-limit threshold are much more informative as they indicate the probability of landslide event occurrence given rainfall exceeding the threshold. This information can be easily included in landslide early warning systems, especially when combined with the probability of rainfall above each threshold.

  16. Room Temperature Ultralow Threshold GaN Nanowire Polariton Laser

    KAUST Repository

    Das, Ayan

    2011-08-01

    We report ultralow threshold polariton lasing from a single GaN nanowire strongly coupled to a large-area dielectric microcavity. The threshold carrier density is 3 orders of magnitude lower than that of photon lasing observed in the same device, and 2 orders of magnitude lower than any existing room-temperature polariton devices. Spectral, polarization, and coherence properties of the emission were measured to confirm polariton lasing. © 2011 American Physical Society.

  17. A high voltage ratio and low ripple interleaved DC-DC converter for fuel cell applications.

    Science.gov (United States)

    Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih

    2012-01-01

    This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters.

  18. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  19. Crossing the threshold

    Science.gov (United States)

    Bush, John; Tambasco, Lucas

    2017-11-01

    First, we summarize the circumstances in which chaotic pilot-wave dynamics gives rise to quantum-like statistical behavior. For ``closed'' systems, in which the droplet is confined to a finite domain either by boundaries or applied forces, quantum-like features arise when the persistence time of the waves exceeds the time required for the droplet to cross its domain. Second, motivated by the similarities between this hydrodynamic system and stochastic electrodynamics, we examine the behavior of a bouncing droplet above the Faraday threshold, where a stochastic element is introduced into the drop dynamics by virtue of its interaction with a background Faraday wave field. With a view to extending the dynamical range of pilot-wave systems to capture more quantum-like features, we consider a generalized theoretical framework for stochastic pilot-wave dynamics in which the relative magnitudes of the drop-generated pilot-wave field and a stochastic background field may be varied continuously. We gratefully acknowledge the financial support of the NSF through their CMMI and DMS divisions.

  20. Effects of stimulation parameters and electrode location on thresholds for epidural stimulation of cat motor cortex

    Science.gov (United States)

    Wongsarnpigoon, Amorn; Grill, Warren M.

    2011-12-01

    Epidural electrical stimulation (ECS) of the motor cortex is a developing therapy for neurological disorders. Both placement and programming of ECS systems may affect the therapeutic outcome, but the treatment parameters that will maximize therapeutic outcomes and minimize side effects are not known. We delivered ECS to the motor cortex of anesthetized cats and investigated the effects of electrode placement and stimulation parameters on thresholds for evoking motor responses in the contralateral forelimb. Thresholds were inversely related to stimulation frequency and the number of pulses per stimulus train. Thresholds were lower over the forelimb representation in motor cortex (primary site) than surrounding sites (secondary sites), and thresholds at sites 4 mm away. Electrode location and montage influenced the effects of polarity on thresholds: monopolar anodic and cathodic thresholds were not significantly different over the primary site, cathodic thresholds were significantly lower than anodic thresholds over secondary sites and bipolar thresholds were significantly lower with the anode over the primary site than with the cathode over the primary site. A majority of bipolar thresholds were either between or equal to the respective monopolar thresholds, but several bipolar thresholds were greater than or less than the monopolar thresholds of both the anode and cathode. During bipolar stimulation, thresholds were influenced by both electric field superposition and indirect, synaptically mediated interactions. These results demonstrate the influence of stimulation parameters and electrode location during cortical stimulation, and these effects should be considered during the programming of systems for therapeutic cortical stimulation.

  1. Albania - Thresholds I and II

    Data.gov (United States)

    Millennium Challenge Corporation — From 2006 to 2011, the government of Albania (GOA) received two Millennium Challenge Corporation (MCC) Threshold Programs totaling $29.6 million. Albania received...

  2. Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

    International Nuclear Information System (INIS)

    Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel; Sebastian, Abu

    2016-01-01

    In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current in doped Ge 2 Sb 2 Te 5 nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters

  3. Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors

    Directory of Open Access Journals (Sweden)

    Busi Rambabu

    2014-01-01

    Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.

  4. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  5. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  6. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  7. Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter

    DEFF Research Database (Denmark)

    Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus

    2011-01-01

    This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...

  8. Effect of threshold quantization in opportunistic splitting algorithm

    KAUST Repository

    Nam, Haewoon

    2011-12-01

    This paper discusses algorithms to find the optimal threshold and also investigates the impact of threshold quantization on the scheduling outage performance of the opportunistic splitting scheduling algorithm. Since this algorithm aims at finding the user with the highest channel quality within the minimal number of mini-slots by adjusting the threshold every mini-slot, optimizing the threshold is of paramount importance. Hence, in this paper we first discuss how to compute the optimal threshold along with two tight approximations for the optimal threshold. Closed-form expressions are provided for those approximations for simple calculations. Then, we consider linear quantization of the threshold to take the limited number of bits for signaling messages in practical systems into consideration. Due to the limited granularity for the quantized threshold value, an irreducible scheduling outage floor is observed. The numerical results show that the two approximations offer lower scheduling outage probability floors compared to the conventional algorithm when the threshold is quantized. © 2006 IEEE.

  9. Threshold Concepts and Information Literacy

    Science.gov (United States)

    Townsend, Lori; Brunetti, Korey; Hofer, Amy R.

    2011-01-01

    What do we teach when we teach information literacy in higher education? This paper describes a pedagogical approach to information literacy that helps instructors focus content around transformative learning thresholds. The threshold concept framework holds promise for librarians because it grounds the instructor in the big ideas and underlying…

  10. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  11. Triple Line-Voltage Cascaded VIENNA Converter Applied as the Medium-Voltage AC Drive

    Directory of Open Access Journals (Sweden)

    Jia Zou

    2018-04-01

    Full Text Available A novel rectifier based on a triple line-voltage cascaded VIENNA converter (LVC-VC was proposed. Compared to the conventional cascaded H-bridge converters, the switch voltage stress is lower, and the numbers of switches and dc capacitors are fewer under similar operating conditions in the proposed new multilevel converter. The modeling and control for the LVC-VC ware presented. Based on the analysis of the operation principle of the new converter, the power factor correction of the proposed converter was realized by employing a traditional one-cycle control strategy. The minimum average value and maximum harmonic components of the dc-link voltages of the three VIENNA rectifier modules ware calculated. Three VIENNA dc-link voltages were unbalanced under the unbalanced load conditions, so the zero sequence current was injected to the three inner currents for balancing three VIENNA dc-link voltages. Simulation and the results of the experiment verified the availability of the new proposed multilevel converter and the effectiveness of the corresponding control strategy applied.

  12. Reduction of ripple voltage in a dynamitron

    International Nuclear Information System (INIS)

    Langsdorf, A. Jr.

    1982-01-01

    We determined that a precise neutralization of the RF ripple voltage on the high-voltage terminal of a Dynamitron has previously been prevented by a nonegligible phase shift of RF currents in the two halves of the approx. 100-kHz class C oscillator tank circuit, which is actually constituted of two slightly unequal high-Q coupled circuits because it has two ground points: the inescapable center-tap-ground in the capacitive legs and a center-tap-ground lead to the induction coil. The latter is needed to prevent damage by flashover transients; equivalent to its removal was the adjusting of RF ground return current to a null by aid of a current transformer on this lead and the suitable adjusting of trimmer capacitance. While the phase shift was thus held to a null, the actual ripple amplitude on the hv terminal was minimized by adjusting additional trimmer capacitances installed in the terminal of the machine. Then p/p 100-kHz ripple at 2-MV dc output was reduced to about 50V and RMS resolution by (p,#betta#) resonance threshold data near 1 MV was about 250 V. The limit to resolution has various causes including mechanical vibrations and unbalanced harmonics of the RF

  13. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  14. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  15. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    International Nuclear Information System (INIS)

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  16. Nano silver diffusion behaviour on conductive polymer during doping process for high voltage application

    Science.gov (United States)

    Mohammad, A.; Mahmood, A.; Chin, K. T.; Danquah, M. K.; van Stratan, S.

    2017-06-01

    Conductive polymer had opened a new era of engineering for microelectronics and semiconductor applications. However, it is still a challenge for high voltage applications due to lower electrical conductivity compare to metals. This results tremendous energy losses during transmission and restricts its usage. In order to address such problem a novel method was investigated using nano silver particle doped iodothiophene since silver is the highest electrical conductive material. The experiments were carried out to study the organometallic diffusion behaviour of nanosilver doped iodothiophene with different concentration of iodothiophene. Five different mixing ratio between nanosilver and the solution of iodothiophene dissolved in diethyl ether were used which are 1:1.25, 1:1.5, 1:2.5, 1:3 and l:5. It was revealed that there is an effective threshold concentration of which the nano silver evenly distributed and there was no coagulation observed. These parameters laid the foundation of better doping process between the nano silver and the polymer significantly which would contribute developing conductive polymer towards high voltage application for industries that are vulnerable to corrosive environment.

  17. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  18. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  19. Spike-threshold adaptation predicted by membrane potential dynamics in vivo.

    Directory of Open Access Journals (Sweden)

    Bertrand Fontaine

    2014-04-01

    Full Text Available Neurons encode information in sequences of spikes, which are triggered when their membrane potential crosses a threshold. In vivo, the spiking threshold displays large variability suggesting that threshold dynamics have a profound influence on how the combined input of a neuron is encoded in the spiking. Threshold variability could be explained by adaptation to the membrane potential. However, it could also be the case that most threshold variability reflects noise and processes other than threshold adaptation. Here, we investigated threshold variation in auditory neurons responses recorded in vivo in barn owls. We found that spike threshold is quantitatively predicted by a model in which the threshold adapts, tracking the membrane potential at a short timescale. As a result, in these neurons, slow voltage fluctuations do not contribute to spiking because they are filtered by threshold adaptation. More importantly, these neurons can only respond to input spikes arriving together on a millisecond timescale. These results demonstrate that fast adaptation to the membrane potential captures spike threshold variability in vivo.

  20. Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors

    DEFF Research Database (Denmark)

    Mucha, Igor

    1999-01-01

    current memory cells were designed using a CMOS process with threshold voltages V-T0n = \\V-T0p\\ = 0.9 V for the n- and p-channel devices. Both hand calculations and PSPICE simulations showed that the designed example switched current memory cell allowed a maximum signal range better than +/-18 mu......A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages....... This paper presents the theoretical basis for the design of "floating-gate'' switched current memory cells by giving a detailed description and analysis of the most important impacts degrading the performance of the cells. To support the theoretical assumptions circuits based on "floating-gate'' switched...

  1. Organic dielectrics in high voltage cables

    Energy Technology Data Exchange (ETDEWEB)

    Vermeer, J

    1962-03-01

    It appears that the limit has been reached in the applicability of oil-impregnated paper as the dielectric for ehv cables, as with rising voltages the prevention of conductor losses becomes increasingly difficult, while the dielectric losses of the insulation, increasing as the square of the voltage, contribute to a greater extent to the temperature rise of the conductor. The power transmitting capacity of ehv cables reaches a maximum at 500 to 600 kV for these reasons. Apart from artificial cooling, a substantial improvement can be obtained only with the use of insulating materials with much lower dielectric losses; these can moreover be applied with a smaller wall thickness, but this means higher field strengths. Synthetic polymer materials meet these requirements but can be used successfully only in the form of lapped film tapes impregnated with suitable liquids. The electrical properties of these heterogeneous dielectrics, in particular, their impulse breakdown strengths are studied in detail.

  2. IGCC crosses the threshold

    Energy Technology Data Exchange (ETDEWEB)

    Broderick, J E

    1986-07-01

    This paper describes the development of the Texaco Coal Gasification Process (TCGP), the first of the advanced gasification processes to become commercialized. The utilization of this process in various demonstration and commercial plants is described. The design of the Cool Water integrated gasification combined cycle (IGCC) plant in California is discussed in some detail. This plant has been operating successfully since June 1984, and has demonstrated that the Texaco gasification technology for electric power generation is commercially viable, can use many different feedstocks, has substantial efficiency growth potential, can provide competitively lower cost electric power, and offers vastly superior environmental performance.

  3. Testing for a Debt-Threshold Effect on Output Growth.

    Science.gov (United States)

    Lee, Sokbae; Park, Hyunmin; Seo, Myung Hwan; Shin, Youngki

    2017-12-01

    Using the Reinhart-Rogoff dataset, we find a debt threshold not around 90 per cent but around 30 per cent, above which the median real gross domestic product (GDP) growth falls abruptly. Our work is the first to formally test for threshold effects in the relationship between public debt and median real GDP growth. The null hypothesis of no threshold effect is rejected at the 5 per cent significance level for most cases. While we find no evidence of a threshold around 90 per cent, our findings from the post-war sample suggest that the debt threshold for economic growth may exist around a relatively small debt-to-GDP ratio of 30 per cent. Furthermore, countries with debt-to-GDP ratios above 30 per cent have GDP growth that is 1 percentage point lower at the median.

  4. Results of the 2015 testbeam of a 180 nm AMS High-Voltage CMOS sensor prototype

    CERN Document Server

    Benoit, M.

    2016-07-21

    Active pixel sensors based on the High-Voltage CMOS technology are being investigated as a viable option for the future pixel tracker of the ATLAS experiment at the High-Luminosity LHC. This paper reports on the testbeam measurements performed at the H8 beamline of the CERN Super Proton Synchrotron on a High-Voltage CMOS sensor prototype produced in 180 nm AMS technology. Results in terms of tracking efficiency and timing performance, for different threshold and bias conditions, are shown.

  5. A Robust Ultra-Low Voltage CPU Utilizing Timing-Error Prevention

    OpenAIRE

    Hiienkari, Markus; Teittinen, Jukka; Koskinen, Lauri; Turnquist, Matthew; Mäkipää, Jani; Rantala, Arto; Sopanen, Matti; Kaltiokallio, Mikko

    2015-01-01

    To minimize energy consumption of a digital circuit, logic can be operated at sub- or near-threshold voltage. Operation at this region is challenging due to device and environment variations, and resulting performance may not be adequate to all applications. This article presents two variants of a 32-bit RISC CPU targeted for near-threshold voltage. Both CPUs are placed on the same die and manufactured in 28 nm CMOS process. They employ timing-error prevention with clock stretching to enable ...

  6. Choice of operating voltage for a transmission electron microscope

    International Nuclear Information System (INIS)

    Egerton, R.F.

    2014-01-01

    An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

  7. Music effect on pain threshold evaluated with current perception threshold

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    AIM: Music relieves anxiety and psychotic tension. This effect of music is applied to surgical operation in the hospital and dental office. It is still unclear whether this music effect is only limited to the psychological aspect but not to the physical aspect or whether its music effect is influenced by the mood or emotion of audience. To elucidate these issues, we evaluated the music effect on pain threshold by current perception threshold (CPT) and profile of mood states (POMC) test. METHODS: Healthy 30 subjects (12 men, 18 women, 25-49 years old, mean age 34.9) were tested. (1)After POMC test, all subjects were evaluated pain threshold with CPT by Neurometer (Radionics, USA) under 6 conditions, silence, listening to the slow tempo classic music, nursery music, hard rock music, classic paino music and relaxation music with 30 seconds interval. (2)After Stroop color word test as the stresser, pain threshold was evaluated with CPT under 2 conditions, silence and listening to the slow tempo classic music. RESULTS: Under litening to the music, CPT sores increased, especially 2 000 Hz level related with compression, warm and pain sensation. Type of music, preference of music and stress also affected CPT score. CONCLUSION: The present study demonstrated that the concentration on the music raise the pain threshold and that stress and mood influence the music effect on pain threshold.

  8. Thresholds of Toxicological Concern - Setting a threshold for testing below which there is little concern.

    Science.gov (United States)

    Hartung, Thomas

    2017-01-01

    Low dose, low risk; very low dose, no real risk. Setting a pragmatic threshold below which concerns become negligible is the purpose of thresholds of toxicological concern (TTC). The idea is that such threshold values do not need to be established for each and every chemical based on experimental data, but that by analyzing the distribution of lowest or no-effect doses of many chemicals, a TTC can be defined - typically using the 5th percentile of this distribution and lowering it by an uncertainty factor of, e.g., 100. In doing so, TTC aims to compare exposure information (dose) with a threshold below which any hazard manifestation is very unlikely to occur. The history and current developments of this concept are reviewed and the application of TTC for different regulated products and their hazards is discussed. TTC lends itself as a pragmatic filter to deprioritize testing needs whenever real-life exposures are much lower than levels where hazard manifestation would be expected, a situation that is called "negligible exposure" in the REACH legislation, though the TTC concept has not been fully incorporated in its implementation (yet). Other areas and regulations - especially in the food sector and for pharmaceutical impurities - are more proactive. Large, curated databases on toxic effects of chemicals provide us with the opportunity to set TTC for many hazards and substance classes and thus offer a precautionary second tier for risk assessments if hazard cannot be excluded. This allows focusing testing efforts better on relevant exposures to chemicals.

  9. Scientific evidence contradicts findings and assumptions of Canadian Safety Panel 6: microwaves act through voltage-gated calcium channel activation to induce biological impacts at non-thermal levels, supporting a paradigm shift for microwave/lower frequency electromagnetic field action.

    Science.gov (United States)

    Pall, Martin L

    2015-01-01

    This review considers a paradigm shift on microwave electromagnetic field (EMF) action from only thermal effects to action via voltage-gated calcium channel (VGCC) activation. Microwave/lower frequency EMFs were shown in two dozen studies to act via VGCC activation because all effects studied were blocked by calcium channel blockers. This mode of action was further supported by hundreds of studies showing microwave changes in calcium fluxes and intracellular calcium [Ca2+]i signaling. The biophysical properties of VGCCs/similar channels make them particularly sensitive to low intensity, non-thermal EMF exposures. Non-thermal studies have shown that in most cases pulsed fields are more active than are non-pulsed fields and that exposures within certain intensity windows have much large biological effects than do either lower or higher intensity exposures; these are both consistent with a VGCC role but inconsistent with only a heating/thermal role. Downstream effects of VGCC activation include calcium signaling, elevated nitric oxide (NO), NO signaling, peroxynitrite, free radical formation, and oxidative stress. Downstream effects explain repeatedly reported biological responses to non-thermal exposures: oxidative stress; single and double strand breaks in cellular DNA; cancer; male and female infertility; lowered melatonin/sleep disruption; cardiac changes including tachycardia, arrhythmia, and sudden cardiac death; diverse neuropsychiatric effects including depression; and therapeutic effects. Non-VGCC non-thermal mechanisms may occur, but none have been shown to have effects in mammals. Biologically relevant safety standards can be developed through studies of cell lines/cell cultures with high levels of different VGCCs, measuring their responses to different EMF exposures. The 2014 Canadian Report by a panel of experts only recognizes thermal effects regarding safety standards for non-ionizing radiation exposures. Its position is therefore contradicted by each

  10. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  11. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  12. Parton distributions with threshold resummation

    CERN Document Server

    Bonvini, Marco; Rojo, Juan; Rottoli, Luca; Ubiali, Maria; Ball, Richard D.; Bertone, Valerio; Carrazza, Stefano; Hartland, Nathan P.

    2015-01-01

    We construct a set of parton distribution functions (PDFs) in which fixed-order NLO and NNLO calculations are supplemented with soft-gluon (threshold) resummation up to NLL and NNLL accuracy respectively, suitable for use in conjunction with any QCD calculation in which threshold resummation is included at the level of partonic cross sections. These resummed PDF sets, based on the NNPDF3.0 analysis, are extracted from deep-inelastic scattering, Drell-Yan, and top quark pair production data, for which resummed calculations can be consistently used. We find that, close to threshold, the inclusion of resummed PDFs can partially compensate the enhancement in resummed matrix elements, leading to resummed hadronic cross-sections closer to the fixed-order calculation. On the other hand, far from threshold, resummed PDFs reduce to their fixed-order counterparts. Our results demonstrate the need for a consistent use of resummed PDFs in resummed calculations.

  13. Effect of Electron Seeding on Experimentally Measured Multipactor Discharge Threshold

    Science.gov (United States)

    Noland, Jonathan; Graves, Timothy; Lemon, Colby; Looper, Mark; Farkas, Alex

    2012-10-01

    Multipactor is a vacuum phenomenon in which electrons, moving in resonance with an externally applied electric field, impact material surfaces. If the number of secondary electrons created per primary electron impact averages more than unity, the resonant interaction can lead to an electron avalanche. Multipactor is a generally undesirable phenomenon, as it can cause local heating, absorb power, or cause detuning of RF circuits. In order to increase the probability of multipactor initiation, test facilities often employ various seeding sources such as radioactive sources (Cesium 137, Strontium 90), electron guns, or photon sources. Even with these sources, the voltage for multipactor initiation is not certain as parameters such as material type, RF pulse length, and device wall thickness can all affect seed electron flux and energy in critical gap regions, and hence the measured voltage threshold. This study investigates the effects of seed electron source type (e.g., photons versus beta particles), material type, gap size, and RF pulse length variation on multipactor threshold. In addition to the experimental work, GEANT4 simulations will be used to estimate the production rate of low energy electrons (< 5 keV) by high energy electrons and photons. A comparison of the experimental fluxes to the typical energetic photon and particle fluxes experienced by spacecraft in various orbits will also be made. Initial results indicate that for a simple, parallel plate device made of aluminum, there is no threshold variation (with seed electrons versus with no seed electrons) under continuous-wave RF exposure.

  14. Conceptions of nuclear threshold status

    International Nuclear Information System (INIS)

    Quester, G.H.

    1991-01-01

    This paper reviews some alternative definitions of nuclear threshold status. Each of them is important, and major analytical confusions would result if one sense of the term is mistaken for another. The motives for nations entering into such threshold status are a blend of civilian and military gains, and of national interests versus parochial or bureaucratic interests. A portion of the rationale for threshold status emerges inevitably from the pursuit of economic goals, and another portion is made more attraction by the derives of the domestic political process. Yet the impact on international security cannot be dismissed, especially where conflicts among the states remain real. Among the military or national security motives are basic deterrence, psychological warfare, war-fighting and, more generally, national prestige. In the end, as the threshold phenomenon is assayed for lessons concerning the role of nuclear weapons more generally in international relations and security, one might conclude that threshold status and outright proliferation coverage to a degree in the motives for all of the states involved and in the advantages attained. As this paper has illustrated, nuclear threshold status is more subtle and more ambiguous than outright proliferation, and it takes considerable time to sort out the complexities. Yet the world has now had a substantial amount of time to deal with this ambiguous status, and this may tempt more states to exploit it

  15. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...

  16. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  17. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  18. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  19. Regulation of granule cell excitability by a low-threshold calcium spike in turtle olfactory bulb

    DEFF Research Database (Denmark)

    Pinato, Giulietta; Midtgaard, Jens

    2003-01-01

    of the cell usually increased their amplitude so that they more easily boosted Na spike initiation. The LTS persisted in the presence of TTX but was antagonized by blockers of T-type calcium channels. The voltage dependence, kinetics, and inactivation properties of the LTS were characteristic of a low......-threshold calcium spike. The threshold of the LTS was slightly above the resting potential but well below the Na spike threshold, and the LTS was often evoked in isolation in normal medium. Tetraethylammonium (TEA) and 4-aminopyridine (4-AP) had only minimal effects on the LTS but revealed the presence of a high...

  20. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  1. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  2. High voltage generator circuit with low power and high efficiency applied in EEPROM

    International Nuclear Information System (INIS)

    Liu Yan; Zhang Shilin; Zhao Yiqiang

    2012-01-01

    This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

  3. Language and motor function thresholds during pediatric extra-operative electrical cortical stimulation brain mapping.

    Science.gov (United States)

    Zea Vera, Alonso; Aungaroon, Gewalin; Horn, Paul S; Byars, Anna W; Greiner, Hansel M; Tenney, Jeffrey R; Arthur, Todd M; Crone, Nathan E; Holland, Katherine D; Mangano, Francesco T; Arya, Ravindra

    2017-10-01

    To examine current thresholds and their determinants for language and motor mapping with extra-operative electrical cortical stimulation (ECS). ECS electrocorticograph recordings were reviewed to determine functional thresholds. Predictors of functional thresholds were found with multivariable analyses. In 122 patients (age 11.9±5.4years), average minimum, frontal, and temporal language thresholds were 7.4 (± 3.0), 7.8 (± 3.0), and 7.4 (± 3.1) mA respectively. Average minimum, face, upper and lower extremity motor thresholds were 5.4 (± 2.8), 6.1 (± 2.8), 4.9 (± 2.3), and 5.3 (± 3.3) mA respectively. Functional and after-discharge (AD)/seizure thresholds were significantly related. Minimum, frontal, and temporal language thresholds were higher than AD thresholds at all ages. Minimum motor threshold was higher than minimum AD threshold up to 8.0years of age, face motor threshold was higher than frontal AD threshold up to 11.8years age, and lower subsequently. UE motor thresholds remained below frontal AD thresholds throughout the age range. Functional thresholds are frequently above AD thresholds in younger children. These findings raise concerns about safety and neurophysiologic validity of ECS mapping. Functional and AD/seizure thresholds relationships suggest individual differences in cortical excitability which cannot be explained by clinical variables. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

  4. Effect of particle size ratio on the conducting percolation threshold of granular conductive-insulating composites

    International Nuclear Information System (INIS)

    He Da; Ekere, N N

    2004-01-01

    In this paper, we apply Monte Carlo simulation to investigate the conductive percolation threshold of granular composite of conductive and insulating powders with amorphous structure. We focus on the effect of insulating to conductive particle size ratio λ = d i /d c on the conducting percolation threshold p c (the volume fraction of the conductive powder). Simulation results show that, for λ = 1, the percolation threshold p c lies between simple cubic and body centred cubic site percolation thresholds, and that as λ increases the percolation threshold decreases. We also use the structural information obtained by the simulation to study the nonlinear current-voltage characteristics of composite with solid volume fraction of conductive powder below p c in terms of electron tunnelling for nanoscale powders, dielectric breakdown for microscale or larger powders, and pressing induced conduction for non-rigid insulating powders

  5. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Science.gov (United States)

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  6. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  7. Thermotactile perception thresholds measurement conditions.

    Science.gov (United States)

    Maeda, Setsuo; Sakakibara, Hisataka

    2002-10-01

    The purpose of this paper is to investigate the effects of posture, push force and rate of temperature change on thermotactile thresholds and to clarify suitable measuring conditions for Japanese people. Thermotactile (warm and cold) thresholds on the right middle finger were measured with an HVLab thermal aesthesiometer. Subjects were eight healthy male Japanese students. The effects of posture in measurement were examined in the posture of a straight hand and forearm placed on a support, the same posture without a support, and the fingers and hand flexed at the wrist with the elbow placed on a desk. The finger push force applied to the applicator of the thermal aesthesiometer was controlled at a 0.5, 1.0, 2.0 and 3.0 N. The applicator temperature was changed to 0.5, 1.0, 1.5, 2.0 and 2.5 degrees C/s. After each measurement, subjects were asked about comfort under the measuring conditions. Three series of experiments were conducted on different days to evaluate repeatability. Repeated measures ANOVA showed that warm thresholds were affected by the push force and the rate of temperature change and that cold thresholds were influenced by posture and push force. The comfort assessment indicated that the measurement posture of a straight hand and forearm laid on a support was the most comfortable for the subjects. Relatively high repeatability was obtained under measurement conditions of a 1 degrees C/s temperature change rate and a 0.5 N push force. Measurement posture, push force and rate of temperature change can affect the thermal threshold. Judging from the repeatability, a push force of 0.5 N and a temperature change of 1.0 degrees C/s in the posture with the straight hand and forearm laid on a support are recommended for warm and cold threshold measurements.

  8. DOE approach to threshold quantities

    International Nuclear Information System (INIS)

    Wickham, L.E.; Kluk, A.F.; Department of Energy, Washington, DC)

    1985-01-01

    The Department of Energy (DOE) is developing the concept of threshold quantities for use in determining which waste materials must be handled as radioactive waste and which may be disposed of as nonradioactive waste at its sites. Waste above this concentration level would be managed as radioactive or mixed waste (if hazardous chemicals are present); waste below this level would be handled as sanitary waste. Ideally, the threshold must be set high enough to significantly reduce the amount of waste requiring special handling. It must also be low enough so that waste at the threshold quantity poses a very small health risk and multiple exposures to such waste would still constitute a small health risk. It should also be practical to segregate waste above or below the threshold quantity using available instrumentation. Guidance is being prepared to aid DOE sites in establishing threshold quantity values based on pathways analysis using site-specific parameters (waste stream characteristics, maximum exposed individual, population considerations, and site specific parameters such as rainfall, etc.). A guidance dose of between 0.001 to 1.0 mSv/y (0.1 to 100 mrem/y) was recommended with 0.3 mSv/y (30 mrem/y) selected as the guidance dose upon which to base calculations. Several tasks were identified, beginning with the selection of a suitable pathway model for relating dose to the concentration of radioactivity in the waste. Threshold concentrations corresponding to the guidance dose were determined for waste disposal sites at a selected humid and arid site. Finally, cost-benefit considerations at the example sites were addressed. The results of the various tasks are summarized and the relationship of this effort with related developments at other agencies discussed

  9. High-frequency (8 to 16 kHz) reference thresholds and intrasubject threshold variability relative to ototoxicity criteria using a Sennheiser HDA 200 earphone.

    Science.gov (United States)

    Frank, T

    2001-04-01

    The first purpose of this study was to determine high-frequency (8 to 16 kHz) thresholds for standardizing reference equivalent threshold sound pressure levels (RETSPLs) for a Sennheiser HDA 200 earphone. The second and perhaps more important purpose of this study was to determine whether repeated high-frequency thresholds using a Sennheiser HDA 200 earphone had a lower intrasubject threshold variability than the ASHA 1994 significant threshold shift criteria for ototoxicity. High-frequency thresholds (8 to 16 kHz) were obtained for 100 (50 male, 50 female) normally hearing (0.25 to 8 kHz) young adults (mean age of 21.2 yr) in four separate test sessions using a Sennheiser HDA 200 earphone. The mean and median high-frequency thresholds were similar for each test session and increased as frequency increased. At each frequency, the high-frequency thresholds were not significantly (p > 0.05) different for gender, test ear, or test session. The median thresholds at each frequency were similar to the 1998 interim ISO RETSPLs; however, large standard deviations and wide threshold distributions indicated very high intersubject threshold variability, especially at 14 and 16 kHz. Threshold repeatability was determined by finding the threshold differences between each possible test session comparison (N = 6). About 98% of all of the threshold differences were within a clinically acceptable range of +/-10 dB from 8 to 14 kHz. The threshold differences between each subject's second, third, and fourth minus their first test session were also found to determine whether intrasubject threshold variability was less than the ASHA 1994 criteria for determining a significant threshold shift due to ototoxicity. The results indicated a false-positive rate of 0% for a threshold shift > or = 20 dB at any frequency and a false-positive rate of 2% for a threshold shift >10 dB at two consecutive frequencies. This study verified that the output of high-frequency audiometers at 0 dB HL using

  10. Novel Step-Up DC/DC Converter with No Right Half Plane Zero and Reduced Switched Voltage Stress Characteristics

    DEFF Research Database (Denmark)

    Mostaan, Ali; Alizadeh, Ebrahim; Soltani, Mohsen

    2014-01-01

    and the voltage transfer gain is obtained. It is also demonstrated that the voltage stress on all semiconductor devices is restricted to input voltage which allows the utilization of a power switch with lower drain source resistance. In order to further increase the voltage gain another switched capacitor voltage......Novel step-up DC/DC converter is introduced in this paper. This converter is realized with adding the switched capacitor voltage multiplier cell to the three switch step-down DC/DC converter that has been proposed in the literature. The proposed converter is analyzed in the steady state...

  11. A threshold for dissipative fission

    International Nuclear Information System (INIS)

    Thoennessen, M.; Bertsch, G.F.

    1993-01-01

    The empirical domain of validity of statistical theory is examined as applied to fission data on pre-fission data on pre-fission neutron, charged particle, and γ-ray multiplicities. Systematics are found of the threshold excitation energy for the appearance of nonstatistical fission. From the data on systems with not too high fissility, the relevant phenomenological parameter is the ratio of the threshold temperature T thresh to the (temperature-dependent) fission barrier height E Bar (T). The statistical model reproduces the data for T thresh /E Bar (T) thresh /E Bar (T) independent of mass and fissility of the systems

  12. Thresholds in chemical respiratory sensitisation.

    Science.gov (United States)

    Cochrane, Stella A; Arts, Josje H E; Ehnes, Colin; Hindle, Stuart; Hollnagel, Heli M; Poole, Alan; Suto, Hidenori; Kimber, Ian

    2015-07-03

    There is a continuing interest in determining whether it is possible to identify thresholds for chemical allergy. Here allergic sensitisation of the respiratory tract by chemicals is considered in this context. This is an important occupational health problem, being associated with rhinitis and asthma, and in addition provides toxicologists and risk assessors with a number of challenges. In common with all forms of allergic disease chemical respiratory allergy develops in two phases. In the first (induction) phase exposure to a chemical allergen (by an appropriate route of exposure) causes immunological priming and sensitisation of the respiratory tract. The second (elicitation) phase is triggered if a sensitised subject is exposed subsequently to the same chemical allergen via inhalation. A secondary immune response will be provoked in the respiratory tract resulting in inflammation and the signs and symptoms of a respiratory hypersensitivity reaction. In this article attention has focused on the identification of threshold values during the acquisition of sensitisation. Current mechanistic understanding of allergy is such that it can be assumed that the development of sensitisation (and also the elicitation of an allergic reaction) is a threshold phenomenon; there will be levels of exposure below which sensitisation will not be acquired. That is, all immune responses, including allergic sensitisation, have threshold requirement for the availability of antigen/allergen, below which a response will fail to develop. The issue addressed here is whether there are methods available or clinical/epidemiological data that permit the identification of such thresholds. This document reviews briefly relevant human studies of occupational asthma, and experimental models that have been developed (or are being developed) for the identification and characterisation of chemical respiratory allergens. The main conclusion drawn is that although there is evidence that the

  13. Optimization Problems on Threshold Graphs

    Directory of Open Access Journals (Sweden)

    Elena Nechita

    2010-06-01

    Full Text Available During the last three decades, different types of decompositions have been processed in the field of graph theory. Among these we mention: decompositions based on the additivity of some characteristics of the graph, decompositions where the adjacency law between the subsets of the partition is known, decompositions where the subgraph induced by every subset of the partition must have predeterminate properties, as well as combinations of such decompositions. In this paper we characterize threshold graphs using the weakly decomposition, determine: density and stability number, Wiener index and Wiener polynomial for threshold graphs.

  14. Threshold current for fireball generation

    Science.gov (United States)

    Dijkhuis, Geert C.

    1982-05-01

    Fireball generation from a high-intensity circuit breaker arc is interpreted here as a quantum-mechanical phenomenon caused by severe cooling of electrode material evaporating from contact surfaces. According to the proposed mechanism, quantum effects appear in the arc plasma when the radius of one magnetic flux quantum inside solid electrode material has shrunk to one London penetration length. A formula derived for the threshold discharge current preceding fireball generation is found compatible with data reported by Silberg. This formula predicts linear scaling of the threshold current with the circuit breaker's electrode radius and concentration of conduction electrons.

  15. Nuclear threshold effects and neutron strength function

    International Nuclear Information System (INIS)

    Hategan, Cornel; Comisel, Horia

    2003-01-01

    One proves that a Nuclear Threshold Effect is dependent, via Neutron Strength Function, on Spectroscopy of Ancestral Neutron Threshold State. The magnitude of the Nuclear Threshold Effect is proportional to the Neutron Strength Function. Evidence for relation of Nuclear Threshold Effects to Neutron Strength Functions is obtained from Isotopic Threshold Effect and Deuteron Stripping Threshold Anomaly. The empirical and computational analysis of the Isotopic Threshold Effect and of the Deuteron Stripping Threshold Anomaly demonstrate their close relationship to Neutron Strength Functions. It was established that the Nuclear Threshold Effects depend, in addition to genuine Nuclear Reaction Mechanisms, on Spectroscopy of (Ancestral) Neutron Threshold State. The magnitude of the effect is proportional to the Neutron Strength Function, in their dependence on mass number. This result constitutes also a proof that the origins of these threshold effects are Neutron Single Particle States at zero energy. (author)

  16. Prediction of windings temperature rise in induction motors supplied with distorted voltage

    Energy Technology Data Exchange (ETDEWEB)

    Gnacinski, P. [Gdynia Maritime University, Department of Ship Electrical Power Engineering, Morska Street 83, 81-225 Gdynia (Poland)

    2008-04-15

    One of the features of ship power systems is a different level and intensity of disturbances appearing during routine operation - the rms voltage value and frequency deviation, voltage unbalance and waveform voltage distortion. As a result, marine induction machines are exposed to overheating due to the lowered voltage quality. This paper is devoted to windings temperature rise prediction in marine induction cage machines supplied with distorted voltage, which means real voltage conditions. The proposed method of prediction does not require detailed knowledge of the thermal properties of a machine. Although the method was developed for marine induction motors, it is applicable for industry machines supplied with distorted voltage. It can also be generalized and used for estimation of the steady state windings temperature rise of any electrical machinery in various work conditions. (author)

  17. Prediction of windings temperature rise in induction motors supplied with distorted voltage

    International Nuclear Information System (INIS)

    Gnacinski, P.

    2008-01-01

    One of the features of ship power systems is a different level and intensity of disturbances appearing during routine operation - the rms voltage value and frequency deviation, voltage unbalance and waveform voltage distortion. As a result, marine induction machines are exposed to overheating due to the lowered voltage quality. This paper is devoted to windings temperature rise prediction in marine induction cage machines supplied with distorted voltage, which means real voltage conditions. The proposed method of prediction does not require detailed knowledge of the thermal properties of a machine. Although the method was developed for marine induction motors, it is applicable for industry machines supplied with distorted voltage. It can also be generalized and used for estimation of the steady state windings temperature rise of any electrical machinery in various work conditions

  18. Output Force Enhancement of Scratch Drive Actuator in Low-Voltage Region by Using Flexible Joint

    Directory of Open Access Journals (Sweden)

    Shawn CHEN

    2010-04-01

    Full Text Available Here a low-voltage scratch drive actuator (LVSDA is proposed by incorporating flexible joint into the conventional SDA to improve performance in low-voltage region. Experimental results show that, at the same total plate length of 80 mm and width of 65 mm, the proposed LVSDA can be actuated as low as 40 V, much lower than 80 V, the minimum required input voltage of the conventional SDA. From finite element analysis by CosmosWorks, yielding effect is found to be a critical factor. Before yielding, LVSDA can provide better performance than SDA at the same input voltage. However, the yielding stress in flexible joint would limit the achievable maximum output force in high-voltage region. By varying joint length, width, or location, LVSDA is shown to be operated in low-voltage region where the conventional SDA can not be operated, and can still provide comparable performance as SDA in high-voltage region.

  19. Quantum phase slips and voltage fluctuations in superconducting nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Semenov, Andrew G. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); National Research University Higher School of Economics, Moscow (Russian Federation); Zaikin, Andrei D. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); Institute of Nanotechnology, Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany)

    2017-06-15

    We argue that quantum phase slips (QPS) may generate non-equilibrium voltage fluctuations in superconducting nanowires. In the low frequency limit we evaluate all cumulants of the voltage operator which obey Poisson statistics and show a power law dependence on the external bias. We specifically address quantum shot noise which power spectrum S{sub Ω} may depend non-monotonously on temperature. In the long wire limit S{sub Ω} decreases with increasing frequency Ω and vanishes beyond a threshold value of Ω at T → 0. Our predictions can be directly tested in future experiments with superconducting nanowires. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  20. Review of mixer design for low voltage - low power applications

    Science.gov (United States)

    Nurulain, D.; Musa, F. A. S.; Isa, M. Mohamad; Ahmad, N.; Kasjoo, S. R.

    2017-09-01

    A mixer is used in almost all radio frequency (RF) or microwave systems for frequency translation. Nowadays, the increase market demand encouraged the industry to deliver circuit designs to create proficient and convenient equipment with very low power (LP) consumption and low voltage (LV) supply in both digital and analogue circuits. This paper focused on different Complementary Metal Oxide Semiconductor (CMOS) design topologies for LV and LP mixer design. Floating Gate Metal Oxide Semiconductor (FGMOS) is an alternative technology to replace CMOS due to their high ability for LV and LP applications. FGMOS only required a few transistors per gate and can have a shift in threshold voltage (VTH) to increase the LP and LV performances as compared to CMOS, which makes an attractive option to replace CMOS.

  1. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  2. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  3. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  4. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  5. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  6. Effects of trap-assisted tunneling on gate-induced drain leakage in silicon-germanium channel p-type FET for scaled supply voltages

    Science.gov (United States)

    Tiwari, Vishal A.; Divakaruni, Rama; Hook, Terence B.; Nair, Deleep R.

    2016-04-01

    Silicon-germanium is considered as an alternative channel material to silicon p-type FET (pFET) for the development of energy efficient high performance transistors for 28 nm and beyond in a high-k metal gate technology because of its lower threshold voltage and higher mobility. However, gate-induced drain leakage (GIDL) is a concern for high threshold voltage device design because of tunneling at reduced bandgap. In this work, the trap-assisted tunneling and band-to-band tunneling (BTBT) effects on GIDL is analyzed and modeled for SiGe pFETs. Experimental results and Monte Carlo simulation results reveal that the pre-halo germanium pre-amorphization implant used to contain the short channel effects contribute to GIDL at the drain sidewall in addition to GIDL due to BTBT in SiGe devices. The results are validated by comparing the experimental observations with the numerical simulation and a set of calibrated models are used to describe the GIDL mechanisms for various drain and gate bias.

  7. Percolation Threshold Parameters of Fluids

    Czech Academy of Sciences Publication Activity Database

    Škvor, J.; Nezbeda, Ivo

    2009-01-01

    Roč. 79, č. 4 (2009), 041141-041147 ISSN 1539-3755 Institutional research plan: CEZ:AV0Z40720504 Keywords : percolation threshold * universality * infinite cluster Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.400, year: 2009

  8. Threshold analyses and Lorentz violation

    International Nuclear Information System (INIS)

    Lehnert, Ralf

    2003-01-01

    In the context of threshold investigations of Lorentz violation, we discuss the fundamental principle of coordinate independence, the role of an effective dynamical framework, and the conditions of positivity and causality. Our analysis excludes a variety of previously considered Lorentz-breaking parameters and opens an avenue for viable dispersion-relation investigations of Lorentz violation

  9. Threshold enhancement of diphoton resonances

    Directory of Open Access Journals (Sweden)

    Aoife Bharucha

    2016-10-01

    Full Text Available We revisit a mechanism to enhance the decay width of (pseudo-scalar resonances to photon pairs when the process is mediated by loops of charged fermions produced near threshold. Motivated by the recent LHC data, indicating the presence of an excess in the diphoton spectrum at approximately 750 GeV, we illustrate this threshold enhancement mechanism in the case of a 750 GeV pseudoscalar boson A with a two-photon decay mediated by a charged and uncolored fermion having a mass at the 12MA threshold and a small decay width, <1 MeV. The implications of such a threshold enhancement are discussed in two explicit scenarios: i the Minimal Supersymmetric Standard Model in which the A state is produced via the top quark mediated gluon fusion process and decays into photons predominantly through loops of charginos with masses close to 12MA and ii a two Higgs doublet model in which A is again produced by gluon fusion but decays into photons through loops of vector-like charged heavy leptons. In both these scenarios, while the mass of the charged fermion has to be adjusted to be extremely close to half of the A resonance mass, the small total widths are naturally obtained if only suppressed three-body decay channels occur. Finally, the implications of some of these scenarios for dark matter are discussed.

  10. Novel Interleaved Converter with Extra-High Voltage Gain to Process Low-Voltage Renewable-Energy Generation

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2016-10-01

    Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.

  11. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  12. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  13. High voltage power network construction

    CERN Document Server

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  14. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  15. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  16. Effects of polarization and absorption on laser induced optical breakdown threshold for skin rejuvenation

    Science.gov (United States)

    Varghese, Babu; Bonito, Valentina; Turco, Simona; Verhagen, Rieko

    2016-03-01

    Laser induced optical breakdown (LIOB) is a non-linear absorption process leading to plasma formation at locations where the threshold irradiance for breakdown is surpassed. In this paper we experimentally demonstrate the influence of polarization and absorption on laser induced breakdown threshold in transparent, absorbing and scattering phantoms made from water suspensions of polystyrene microspheres. We demonstrate that radially polarized light yields a lower irradiance threshold for creating optical breakdown compared to linearly polarized light. We also demonstrate that the thermal initiation pathway used for generating seed electrons results in a lower irradiance threshold compared to multiphoton initiation pathway used for optical breakdown.

  17. Energy reduction through voltage scaling and lightweight checking

    Science.gov (United States)

    Kadric, Edin

    As the semiconductor roadmap reaches smaller feature sizes and the end of Dennard Scaling, design goals change, and managing the power envelope often dominates delay minimization. Voltage scaling remains a powerful tool to reduce energy. We find that it results in about 60% geomean energy reduction on top of other common low-energy optimizations with 22nm CMOS technology. However, when voltage is reduced, it becomes easier for noise and particle strikes to upset a node, potentially causing Silent Data Corruption (SDC). The 60% energy reduction, therefore, comes with a significant drop in reliability. Duplication with checking and triple-modular redundancy are traditional approaches used to combat transient errors, but spending 2--3x the energy for redundant computation can diminish or reverse the benefits of voltage scaling. As an alternative, we explore the opportunity to use checking operations that are cheaper than the base computation they are guarding. We devise a classification system for applications and their lightweight checking characteristics. In particular, we identify and evaluate the effectiveness of lightweight checks in a broad set of common tasks in scientific computing and signal processing. We find that the lightweight checks cost only a fraction of the base computation (0-25%) and allow us to recover the reliability losses from voltage scaling. Overall, we show about 50% net energy reduction without compromising reliability compared to operation at the nominal voltage. We use FPGAs (Field-Programmable Gate Arrays) in our work, although the same ideas can be applied to different systems. On top of voltage scaling, we explore other common low-energy techniques for FPGAs: transmission gates, gate boosting, power gating, low-leakage (high-Vth) processes, and dual-V dd architectures. We do not scale voltage for memories, so lower voltages help us reduce logic and interconnect energy, but not memory energy. At lower voltages, memories become dominant

  18. Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing

    KAUST Repository

    Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni

    2017-01-01

    mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

  19. Measurement of Standard Deviation for Threshold Voltage Using Parallel-Connected MOSFETs

    OpenAIRE

    寺田,和夫; 最上,徹

    1996-01-01

    大量の同一構造MOSFETを並列接続したテスト回路を用いて,しきい値電圧の標準偏差を簡単に測定する方法を提案している.このテスト回路を一つのMOSFETとみなし,そのドレーン電流とゲート電圧の関係からしきい値電圧を抽出すると,その値は同回路に含まれるすべてのMOSFETのしきい値電圧の平均値よりも標準偏差に関係した量だけ異なる値を示す.このことを利用すると,MOSFETのしきい値電圧標準偏差を簡単に測定することができる.本論文はその測定原理,単体MOSFETを用いたその実験的確認,そして精度に関する議論を述べている....

  20. Mechanisms of thermally induced threshold voltage instability in GaN-based heterojunction transistors

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Shu; Liu, Shenghou; Liu, Cheng; Lu, Yunyou; Chen, Kevin J., E-mail: eekjchen@ust.hk [Department of Electronic and Computer Engineering, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon (Hong Kong)

    2014-12-01

    In this work, we attempt to reveal the underlying mechanisms of divergent V{sub TH}-thermal-stabilities in III-nitride metal-insulator-semiconductor high-electron-mobility transistor (MIS-HEMT) and MOS-Channel-HEMT (MOSC-HEMT). In marked contrast to MOSC-HEMT featuring temperature-independent V{sub TH}, MIS-HEMT with the same high-quality gate-dielectric/III-nitride interface and similar interface trap distribution exhibits manifest thermally induced V{sub TH} shift. The temperature-dependent V{sub TH} of MIS-HEMT is attributed to the polarized III-nitride barrier layer, which spatially separates the critical gate-dielectric/III-nitride interface from the channel and allows “deeper” interface trap levels emerging above the Fermi level at pinch-off. This model is further experimentally validated by distinct V{sub G}-driven Fermi level movements at the critical interfaces in MIS-HEMT and MOSC-HEMT. The mechanisms of polarized III-nitride barrier layer in influencing V{sub TH}-thermal-stability provide guidelines for the optimization of insulated-gate III-nitride power switching devices.

  1. Mechanisms of thermally induced threshold voltage instability in GaN-based heterojunction transistors

    International Nuclear Information System (INIS)

    Yang, Shu; Liu, Shenghou; Liu, Cheng; Lu, Yunyou; Chen, Kevin J.

    2014-01-01

    In this work, we attempt to reveal the underlying mechanisms of divergent V TH -thermal-stabilities in III-nitride metal-insulator-semiconductor high-electron-mobility transistor (MIS-HEMT) and MOS-Channel-HEMT (MOSC-HEMT). In marked contrast to MOSC-HEMT featuring temperature-independent V TH , MIS-HEMT with the same high-quality gate-dielectric/III-nitride interface and similar interface trap distribution exhibits manifest thermally induced V TH shift. The temperature-dependent V TH of MIS-HEMT is attributed to the polarized III-nitride barrier layer, which spatially separates the critical gate-dielectric/III-nitride interface from the channel and allows “deeper” interface trap levels emerging above the Fermi level at pinch-off. This model is further experimentally validated by distinct V G -driven Fermi level movements at the critical interfaces in MIS-HEMT and MOSC-HEMT. The mechanisms of polarized III-nitride barrier layer in influencing V TH -thermal-stability provide guidelines for the optimization of insulated-gate III-nitride power switching devices

  2. Voltage linear transformation circuit design

    Science.gov (United States)

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  3. Novel T-Z source inverter with high voltage gain and reduced transformer turn ratio

    DEFF Research Database (Denmark)

    Mostaan, Ali; Sharifi Malfejani, Saeed; Soltani, Mohsen

    2015-01-01

    Novel voltage source inverter based on the Z source inverter structure is introduced in this paper. In this new inverter, two inductors of the impedance network in conventional Z source inverter are replaced with two transformers or coupled inductors, but unlike the T-Z source inverter that it......'s voltage gain is raised with increasing the transformers turn ratio, the voltage gain in the proposed inverter is raised with lowering the transformer turn ratio. Therefore, transformers with lower turn ratio are required in the proposed inverter in compare with T- Z source inverter that can lead to lower...

  4. Threshold of decay instability in an inhomogeneous plasma (Leningrad 1973)

    International Nuclear Information System (INIS)

    Piliia, A.D.

    It is shown that in a spatially inhomogeneous plasma there can exist an absolute decay instability with a threshold lower than that found earlier. This instability arises when two parametrically coupled waves have turning points inside the plasma layer. The cause of the instability is a positive inverse coupling, caused by a nonlinear conversion and a reflection of the waves

  5. The issue of threshold states

    International Nuclear Information System (INIS)

    Luck, L.

    1994-01-01

    The states which have not joined the Non-proliferation Treaty nor have undertaken any other internationally binding commitment not to develop or otherwise acquire nuclear weapons are considered a threshold states. Their nuclear status is rendered opaque as a conscious policy. Nuclear threshold status remains a key disarmament issue. For those few states, as India, Pakistan, Israel, who have put themselves in this position, the security returns have been transitory and largely illusory. The cost to them, and to the international community committed to the norm of non-proliferation, has been huge. The decisions which could lead to recovery from the situation in which they find themselves are essentially at their own hands. Whatever assistance the rest of international community is able to extend, it will need to be accompanied by a vital political signal

  6. Multiscalar production amplitudes beyond threshold

    CERN Document Server

    Argyres, E N; Kleiss, R H

    1993-01-01

    We present exact tree-order amplitudes for $H^* \\to n~H$, for final states containing one or two particles with non-zero three-momentum, for various interaction potentials. We show that there are potentials leading to tree amplitudes that satisfy unitarity, not only at threshold but also in the above kinematical configurations and probably beyond. As a by-product, we also calculate $2\\to n$ tree amplitudes at threshold and show that for the unbroken $\\phi^4$ theory they vanish for $n>4~$, for the Standard Model Higgs they vanish for $n\\ge 3~$ and for a model potential, respecting tree-order unitarity, for $n$ even and $n>4~$. Finally, we calculate the imaginary part of the one-loop $1\\to n$ amplitude in both symmetric and spontaneously broken $\\phi^4$ theory.

  7. Realistic Realizations Of Threshold Circuits

    Science.gov (United States)

    Razavi, Hassan M.

    1987-08-01

    Threshold logic, in which each input is weighted, has many theoretical advantages over the standard gate realization, such as reducing the number of gates, interconnections, and power dissipation. However, because of the difficult synthesis procedure and complicated circuit implementation, their use in the design of digital systems is almost nonexistant. In this study, three methods of NMOS realizations are discussed, and their advantages and shortcomings are explored. Also, the possibility of using the methods to realize multi-valued logic is examined.

  8. Root finding with threshold circuits

    Czech Academy of Sciences Publication Activity Database

    Jeřábek, Emil

    2012-01-01

    Roč. 462, Nov 30 (2012), s. 59-69 ISSN 0304-3975 R&D Projects: GA AV ČR IAA100190902; GA MŠk(CZ) 1M0545 Institutional support: RVO:67985840 Keywords : root finding * threshold circuit * power series Subject RIV: BA - General Mathematics Impact factor: 0.489, year: 2012 http://www.sciencedirect.com/science/article/pii/S0304397512008006#

  9. Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

    Science.gov (United States)

    Fernandez, Fernando R.; Malerba, Paola; White, John A.

    2015-01-01

    The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

  10. Design proposal for door thresholds

    Directory of Open Access Journals (Sweden)

    Smolka Radim

    2017-01-01

    Full Text Available Panels for openings in structures have always been an essential and integral part of buildings. Their importance in terms of a building´s functionality was not recognised. However, the general view on this issue has changed from focusing on big planar segments and critical details to sub-elements of these structures. This does not only focus on the forms of connecting joints but also on the supporting systems that keep the panels in the right position and ensure they function properly. One of the most strained segments is the threshold structure, especially the entrance door threshold structure. It is the part where substantial defects in construction occur in terms of waterproofing, as well as in the static, thermal and technical functions thereof. In conventional buildings, this problem is solved by pulling the floor structure under the entrance door structure and subsequently covering it with waterproofing material. This system cannot work effectively over the long term so local defects occur. A proposal is put forward to solve this problem by installing a sub-threshold door coupler made of composite materials. The coupler is designed so that its variability complies with the required parameters for most door structures on the European market.

  11. Inertial cavitation threshold of nested microbubbles.

    Science.gov (United States)

    Wallace, N; Dicker, S; Lewin, Peter; Wrenn, S P

    2015-04-01

    Cavitation of ultrasound contrast agents (UCAs) promotes both beneficial and detrimental bioeffects in vivo (Radhakrishnan et al., 2013) [1]. The ability to determine the inertial cavitation threshold of UCA microbubbles has potential application in contrast imaging, development of therapeutic agents, and evaluation of localized effects on the body (Ammi et al., 2006) [2]. This study evaluates a novel UCA and its inertial cavitation behavior as determined by a home built cavitation detection system. Two 2.25 MHz transducers are placed at a 90° angle to one another where one transducer is driven by a high voltage pulser and the other transducer receives the signal from the oscillating microbubble. The sample chamber is placed in the overlap of the focal region of the two transducers where the microbubbles are exposed to a pulser signal consisting of 600 pulse trains per experiment at a pulse repetition frequency of 5 Hz where each train has four pulses of four cycles. The formulation being analyzed is comprised of an SF6 microbubble coated by a DSPC PEG-3000 monolayer nested within a poly-lactic acid (PLA) spherical shell. The effect of varying shell diameters and microbubble concentration on cavitation threshold profile for peak negative pressures ranging from 50 kPa to 2 MPa are presented and discussed in this paper. The nesting shell decreases inertial cavitation events from 97.96% for an un-nested microbubble to 19.09% for the same microbubbles nested within a 2.53 μm shell. As shell diameter decreases, the percentage of inertially cavitating microbubbles also decreases. For nesting formulations with average outer capsule diameters of 20.52, 14.95, 9.95, 5.55, 2.53, and 1.95 μm, the percentage of sample destroyed at 1 MPa was 51.02, 38.94, 33.25, 25.27, 19.09, and 5.37% respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Cochlear neuropathy and the coding of supra-threshold sound.

    Science.gov (United States)

    Bharadwaj, Hari M; Verhulst, Sarah; Shaheen, Luke; Liberman, M Charles; Shinn-Cunningham, Barbara G

    2014-01-01

    Many listeners with hearing thresholds within the clinically normal range nonetheless complain of difficulty hearing in everyday settings and understanding speech in noise. Converging evidence from human and animal studies points to one potential source of such difficulties: differences in the fidelity with which supra-threshold sound is encoded in the early portions of the auditory pathway. Measures of auditory subcortical steady-state responses (SSSRs) in humans and animals support the idea that the temporal precision of the early auditory representation can be poor even when hearing thresholds are normal. In humans with normal hearing thresholds (NHTs), paradigms that require listeners to make use of the detailed spectro-temporal structure of supra-threshold sound, such as selective attention and discrimination of frequency modulation (FM), reveal individual differences that correlate with subcortical temporal coding precision. Animal studies show that noise exposure and aging can cause a loss of a large percentage of auditory nerve fibers (ANFs) without any significant change in measured audiograms. Here, we argue that cochlear neuropathy may reduce encoding precision of supra-threshold sound, and that this manifests both behaviorally and in SSSRs in humans. Furthermore, recent studies suggest that noise-induced neuropathy may be selective for higher-threshold, lower-spontaneous-rate nerve fibers. Based on our hypothesis, we suggest some approaches that may yield particularly sensitive, objective measures of supra-threshold coding deficits that arise due to neuropathy. Finally, we comment on the potential clinical significance of these ideas and identify areas for future investigation.

  13. Cochlear Neuropathy and the Coding of Supra-threshold Sound

    Directory of Open Access Journals (Sweden)

    Hari M Bharadwaj

    2014-02-01

    Full Text Available Many listeners with hearing thresholds within the clinically normal range nonetheless complain of difficulty hearing in everyday settings and understanding speech in noise. Converging evidence from human and animal studies points to one potential source of such difficulties: differences in the fidelity with which supra-threshold sound is encoded in the early portions of the auditory pathway. Measures of auditory subcortical steady-state responses in humans and animals support the idea that the temporal precision of the early auditory representation can be poor even when hearing thresholds are normal. In humans with normal hearing thresholds, behavioral ability in paradigms that require listeners to make use of the detailed spectro-temporal structure of supra-threshold sound, such as selective attention and discrimination of frequency modulation, correlate with subcortical temporal coding precision. Animal studies show that noise exposure and aging can cause a loss of a large percentage of auditory nerve fibers without any significant change in measured audiograms. Here, we argue that cochlear neuropathy may reduce encoding precision of supra-threshold sound, and that this manifests both behaviorally and in subcortical steady-state responses in humans. Furthermore, recent studies suggest that noise-induced neuropathy may be selective for higher-threshold, lower-spontaneous-rate nerve fibers. Based on our hypothesis, we suggest some approaches that may yield particularly sensitive, objective measures of supra-threshold coding deficits that arise due to neuropathy. Finally, we comment on the potential clinical significance of these ideas and identify areas for future investigation.

  14. Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)

    2016-07-11

    High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.

  15. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    International Nuclear Information System (INIS)

    Smallwood, Jeremy; Swenson, David E

    2011-01-01

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest 'peaks' and 'valleys' of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  16. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    Science.gov (United States)

    Smallwood, Jeremy; Swenson, David E.

    2011-06-01

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest "peaks" and "valleys" of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  17. Evaluation of performance of footwear and flooring systems in combination with personnel using voltage probability analysis

    Energy Technology Data Exchange (ETDEWEB)

    Smallwood, Jeremy [Electrostatic Solutions Ltd (United Kingdom); Swenson, David E, E-mail: jeremys@static-sol.com [Affinity Static Control Consulting LLC (United States)

    2011-06-23

    Evaluation of electrostatic performance of footwear and flooring in combination is necessary in applications such as electrostatic discharge (ESD) control in electronics manufacture, evaluation of equipment for avoidance of factory process electrostatic ignition risks and avoidance of electrostatic shocks to personnel in working environments. Typical standards use a walking test in which the voltage produced on a subject is evaluated by identification and measurement of the magnitude of the 5 highest 'peaks' and 'valleys' of the recorded voltage waveform. This method does not lend itself to effective analysis of the risk that the voltage will exceed a hazard threshold. This paper shows the advantages of voltage probability analysis and recommends that the method is adopted for use in future standards.

  18. Congestion management considering voltage security of power systems

    International Nuclear Information System (INIS)

    Esmaili, Masoud; Shayanfar, Heidar Ali; Amjady, Nima

    2009-01-01

    Congestion in a power network is turned up due to system operating limits. To relieve congestion in a deregulated power market, the system operator pays to market participants, GENCOs and DISCOs, to alter their active powers considering their bids. After performing congestion management, the network may be operated with a low security level because of hitting some flows their upper limit and some voltages their lower limit. In this paper, a novel congestion management method based on the voltage stability margin sensitivities is introduced. Using the proposed method, the system operator so alleviates the congestion that the network can more retain its security. The proposed method not only makes the system more secure after congestion management than other methods already presented for this purpose but also its cost of providing security is lower than the earlier methods. Test results of the proposed method along with the earlier ones on the New-England test system elaborate the efficiency of the proposed method from the viewpoint of providing a better voltage stability margin and voltage profile as well as a lower security cost. (author)

  19. Color difference thresholds in dentistry.

    Science.gov (United States)

    Paravina, Rade D; Ghinea, Razvan; Herrera, Luis J; Bona, Alvaro D; Igiel, Christopher; Linninger, Mercedes; Sakai, Maiko; Takahashi, Hidekazu; Tashkandi, Esam; Perez, Maria del Mar

    2015-01-01

    The aim of this prospective multicenter study was to determine 50:50% perceptibility threshold (PT) and 50:50% acceptability threshold (AT) of dental ceramic under simulated clinical settings. The spectral radiance of 63 monochromatic ceramic specimens was determined using a non-contact spectroradiometer. A total of 60 specimen pairs, divided into 3 sets of 20 specimen pairs (medium to light shades, medium to dark shades, and dark shades), were selected for psychophysical experiment. The coordinating center and seven research sites obtained the Institutional Review Board (IRB) approvals prior the beginning of the experiment. Each research site had 25 observers, divided into five groups of five observers: dentists-D, dental students-S, dental auxiliaries-A, dental technicians-T, and lay persons-L. There were 35 observers per group (five observers per group at each site ×7 sites), for a total of 175 observers. Visual color comparisons were performed using a viewing booth. Takagi-Sugeno-Kang (TSK) fuzzy approximation was used for fitting the data points. The 50:50% PT and 50:50% AT were determined in CIELAB and CIEDE2000. The t-test was used to evaluate the statistical significance in thresholds differences. The CIELAB 50:50% PT was ΔEab  = 1.2, whereas 50:50% AT was ΔEab  = 2.7. Corresponding CIEDE2000 (ΔE00 ) values were 0.8 and 1.8, respectively. 50:50% PT by the observer group revealed differences among groups D, A, T, and L as compared with 50:50% PT for all observers. The 50:50% AT for all observers was statistically different than 50:50% AT in groups T and L. A 50:50% perceptibility and ATs were significantly different. The same is true for differences between two color difference formulas ΔE00 /ΔEab . Observer groups and sites showed high level of statistical difference in all thresholds. Visual color difference thresholds can serve as a quality control tool to guide the selection of esthetic dental materials, evaluate clinical performance, and

  20. Rainfall thresholds for the possible occurrence of landslides in Italy

    Directory of Open Access Journals (Sweden)

    M. T. Brunetti

    2010-03-01

    Full Text Available In Italy, rainfall is the primary trigger of landslides that frequently cause fatalities and large economic damage. Using a variety of information sources, we have compiled a catalogue listing 753 rainfall events that have resulted in landslides in Italy. For each event in the catalogue, the exact or approximate location of the landslide and the time or period of initiation of the slope failure is known, together with information on the rainfall duration D, and the rainfall mean intensity I, that have resulted in the slope failure. The catalogue represents the single largest collection of information on rainfall-induced landslides in Italy, and was exploited to determine the minimum rainfall conditions necessary for landslide occurrence in Italy, and in the Abruzzo Region, central Italy. For the purpose, new national rainfall thresholds for Italy and new regional rainfall thresholds for the Abruzzo Region were established, using two independent statistical methods, including a Bayesian inference method and a new Frequentist approach. The two methods proved complementary, with the Bayesian method more suited to analyze small data sets, and the Frequentist method performing better when applied to large data sets. The new regional thresholds for the Abruzzo Region are lower than the new national thresholds for Italy, and lower than the regional thresholds proposed in the literature for the Piedmont and Lombardy Regions in northern Italy, and for the Campania Region in southern Italy. This is important, because it shows that landslides in Italy can be triggered by less severe rainfall conditions than previously recognized. The Frequentist method experimented in this work allows for the definition of multiple minimum rainfall thresholds, each based on a different exceedance probability level. This makes the thresholds suited for the design of probabilistic schemes for the prediction of rainfall-induced landslides. A scheme based on four

  1. Output pressure and harmonic characteristics of a CMUT as function of bias and excitation voltage

    DEFF Research Database (Denmark)

    Lei, Anders; Diederichsen, Søren Elmin; Hansen, Sebastian Molbech

    2015-01-01

    of the transmitted signal. The generation of intrinsic harmonics by the CMUT can be minimized by decreasing the excitation signal. This, however, leads to lower fundamental pressure which limits the desired generation of harmonics in the medium. This work examines the output pressure and harmonic characteristics...... of a CMUT as function of bias and excitation voltage. The harmonic to fundamental ratio of the surface pressures declines for decreasing excitation voltage and increasing bias voltage. The ratio, however, becomes unchanged for bias levels close to the pull-in voltage. The harmonic limitations of the CMUT...

  2. BEHAVIOUR OF BACKFILL MATERIALS FOR ELECTRICAL GROUNDING SYSTEMS UNDER HIGH VOLTAGE CONDITIONS

    Directory of Open Access Journals (Sweden)

    S. C. LIM

    2015-06-01

    Full Text Available Backfill materials like Bentonite and cement are effective in lowering grounding resistance of electrodes for a considerable period. During lightning, switching impulses and earth fault occurrences in medium and high voltage networks, the grounding system needs to handle extremely high currents either for a short duration or prolonged period respectively. This paper investigates the behaviour of bentonite, cement and sand under impulse and alternating high voltage (50Hz conditions. Fulguritic-formation was observed in all materials under alternating high voltage. The findings reveal that performance of grounding systems under high voltage conditions may significantly change from the outcomes anticipated at design stage.

  3. Bedding material affects mechanical thresholds, heat thresholds and texture preference

    Science.gov (United States)

    Moehring, Francie; O’Hara, Crystal L.; Stucky, Cheryl L.

    2015-01-01

    It has long been known that the bedding type animals are housed on can affect breeding behavior and cage environment. Yet little is known about its effects on evoked behavior responses or non-reflexive behaviors. C57BL/6 mice were housed for two weeks on one of five bedding types: Aspen Sani Chips® (standard bedding for our institute), ALPHA-Dri®, Cellu-Dri™, Pure-o’Cel™ or TEK-Fresh. Mice housed on Aspen exhibited the lowest (most sensitive) mechanical thresholds while those on TEK-Fresh exhibited 3-fold higher thresholds. While bedding type had no effect on responses to punctate or dynamic light touch stimuli, TEK-Fresh housed animals exhibited greater responsiveness in a noxious needle assay, than those housed on the other bedding types. Heat sensitivity was also affected by bedding as animals housed on Aspen exhibited the shortest (most sensitive) latencies to withdrawal whereas those housed on TEK-Fresh had the longest (least sensitive) latencies to response. Slight differences between bedding types were also seen in a moderate cold temperature preference assay. A modified tactile conditioned place preference chamber assay revealed that animals preferred TEK-Fresh to Aspen bedding. Bedding type had no effect in a non-reflexive wheel running assay. In both acute (two day) and chronic (5 week) inflammation induced by injection of Complete Freund’s Adjuvant in the hindpaw, mechanical thresholds were reduced in all groups regardless of bedding type, but TEK-Fresh and Pure-o’Cel™ groups exhibited a greater dynamic range between controls and inflamed cohorts than Aspen housed mice. PMID:26456764

  4. Investigation of excimer laser ablation threshold of polymers using a microphone

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Joerg; Niino, Hiroyuki; Yabe, Akira

    2002-09-30

    KrF excimer laser ablation of polyethylene terephthalate (PET), polyimide (PI) and polycarbonate (PC) in air was studied by an in situ monitoring technique using a microphone. The microphone signal generated by a short acoustic pulse represented the etch rate of laser ablation depending on the laser fluence, i.e., the ablation 'strength'. From a linear relationship between the microphone output voltage and the laser fluence, the single-pulse ablation thresholds were found to be 30 mJ cm{sup -2} for PET, 37 mJ cm{sup -2} for PI and 51 mJ cm{sup -2} for PC (20-pulses threshold). The ablation thresholds of PET and PI were not influenced by the number of pulses per spot, while PC showed an incubation phenomenon. A microphone technique provides a simple method to determine the excimer laser ablation threshold of polymer films.

  5. Voltage and pace-capture mapping of linear ablation lesions overestimates chronic ablation gap size.

    Science.gov (United States)

    O'Neill, Louisa; Harrison, James; Chubb, Henry; Whitaker, John; Mukherjee, Rahul K; Bloch, Lars Ølgaard; Andersen, Niels Peter; Dam, Høgni; Jensen, Henrik K; Niederer, Steven; Wright, Matthew; O'Neill, Mark; Williams, Steven E

    2018-04-26

    Conducting gaps in lesion sets are a major reason for failure of ablation procedures. Voltage mapping and pace-capture have been proposed for intra-procedural identification of gaps. We aimed to compare gap size measured acutely and chronically post-ablation to macroscopic gap size in a porcine model. Intercaval linear ablation was performed in eight Göttingen minipigs with a deliberate gap of ∼5 mm left in the ablation line. Gap size was measured by interpolating ablation contact force values between ablation tags and thresholding at a low force cut-off of 5 g. Bipolar voltage mapping and pace-capture mapping along the length of the line were performed immediately, and at 2 months, post-ablation. Animals were euthanized and gap sizes were measured macroscopically. Voltage thresholds to define scar were determined by receiver operating characteristic analysis as voltage, pace-capture, and ablation contact force maps. All modalities overestimated chronic gap size, by 1.4 ± 2.0 mm (ablation contact force map), 5.1 ± 3.4 mm (pace-capture), and 9.5 ± 3.8 mm (voltage mapping). Error on ablation contact force map gap measurements were significantly less than for voltage mapping (P = 0.003, Tukey's multiple comparisons test). Chronically, voltage mapping and pace-capture mapping overestimated macroscopic gap size by 11.9 ± 3.7 and 9.8 ± 3.5 mm, respectively. Bipolar voltage and pace-capture mapping overestimate the size of chronic gap formation in linear ablation lesions. The most accurate estimation of chronic gap size was achieved by analysis of catheter-myocardium contact force during ablation.

  6. Analyzing randomly occurring voltage breakdowns

    International Nuclear Information System (INIS)

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  7. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  8. Low Voltage Current Mode Switched-Current-Mirror Mixer

    Directory of Open Access Journals (Sweden)

    Chunhua Wang

    2009-09-01

    Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.

  9. A new temperature threshold detector - Application to missile monitoring

    Science.gov (United States)

    Coston, C. J.; Higgins, E. V.

    Comprehensive thermal surveys within the case of solid propellant ballistic missile flight motors are highly desirable. For example, a problem involving motor failures due to insulator cracking at motor ignition, which took several years to solve, could have been identified immediately on the basis of a suitable thermal survey. Using conventional point measurements, such as those utilizing typical thermocouples, for such a survey on a full scale motor is not feasible because of the great number of sensors and measurements required. An alternate approach recognizes that temperatures below a threshold (which depends on the material being monitored) are acceptable, but higher temperatures exceed design margins. In this case hot spots can be located by a grid of wire-like sensors which are sensitive to temperature above the threshold anywhere along the sensor. A new type of temperature threshold detector is being developed for flight missile use. The considered device consists of KNO3 separating copper and Constantan metals. Above the KNO3 MP, galvanic action provides a voltage output of a few tenths of a volt.

  10. Frequency modulation television analysis: Threshold impulse analysis. [with computer program

    Science.gov (United States)

    Hodge, W. H.

    1973-01-01

    A computer program is developed to calculate the FM threshold impulse rates as a function of the carrier-to-noise ratio for a specified FM system. The system parameters and a vector of 1024 integers, representing the probability density of the modulating voltage, are required as input parameters. The computer program is utilized to calculate threshold impulse rates for twenty-four sets of measured probability data supplied by NASA and for sinusoidal and Gaussian modulating waveforms. As a result of the analysis several conclusions are drawn: (1) The use of preemphasis in an FM television system improves the threshold by reducing the impulse rate. (2) Sinusoidal modulation produces a total impulse rate which is a practical upper bound for the impulse rates of TV signals providing the same peak deviations. (3) As the moment of the FM spectrum about the center frequency of the predetection filter increases, the impulse rate tends to increase. (4) A spectrum having an expected frequency above (below) the center frequency of the predetection filter produces a higher negative (positive) than positive (negative) impulse rate.

  11. High-voltage CMOS detectors

    International Nuclear Information System (INIS)

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  12. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  13. High-voltage CMOS detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  14. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  15. Empirical assessment of a threshold model for sylvatic plague

    DEFF Research Database (Denmark)

    Davis, Stephen; Leirs, Herwig; Viljugrein, H.

    2007-01-01

    Plague surveillance programmes established in Kazakhstan, Central Asia, during the previous century, have generated large plague archives that have been used to parameterize an abundance threshold model for sylvatic plague in great gerbil (Rhombomys opimus) populations. Here, we assess the model...... examine six hypotheses that could explain the resulting false positive predictions, namely (i) including end-of-outbreak data erroneously lowers the estimated threshold, (ii) too few gerbils were tested, (iii) plague becomes locally extinct, (iv) the abundance of fleas was too low, (v) the climate...

  16. [Development of residual voltage testing equipment].

    Science.gov (United States)

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  17. Influence of negative substrate bias voltage on the impurity concentrations in Zr films

    International Nuclear Information System (INIS)

    Lim, J.-W.; Bae, J.W.; Mimura, K.; Isshiki, M.

    2006-01-01

    Zr films were deposited on Si(1 0 0) substrates without a substrate bias voltage and with substrate bias voltages of -50 V and -100 V using a non-mass separated ion beam deposition system. Secondary ion mass spectrometry and glow discharge mass spectrometry were used to determine the impurity concentrations in a Zr target and Zr films. It was found that the total amount of impurities in the Zr film deposited at the substrate bias voltage of -50 V was much lower than that in the Zr film deposited without the substrate bias voltage. It means that applying a negative bias voltage to the substrate can suppress the increase in impurities of Zr films. Furthermore, it was confirmed that dominant impurity elements such as C, N and O have a considerable effect on the purity of Zr films and these impurities can be remarkably reduced by applying the negative substrate bias voltage

  18. Application of high voltage electric field (HVEF) drying technology in potato chips

    International Nuclear Information System (INIS)

    Bai, Yaxiang; Shi, Hua; Yang, Yaxin

    2013-01-01

    In order to improve the drying efficiency and qualities of vegetable by high voltage electric field (HVEF), potato chips as a representative of vegetable was dried using a high voltage electric drying systems at 20°C. The shrinkage rate, water absorption and rehydration ratio of dried potato chips were measured. The results indicated that the drying rate of potato chips was significantly improved in the high voltage electric drying systems. The shrinkage rate of potato chips dried by high voltage electric field was 1.1% lower than that by oven drying method. And the rehydration rate of high voltage electric field was 24.6% higher than that by oven drying method. High voltage electric field drying is very advantageous and can be used as a substitute for traditional drying method.

  19. Coulomb blockade threshold in finite one-dimensional arrays of small tunnel junctions

    International Nuclear Information System (INIS)

    Lien, Nguyen V.; Dat, Nguyen T.; Nam, Nguyen H.

    2001-11-01

    The current-voltage characteristics of one-dimensional tunnel junction arrays are simulated using the semiclassical and full capacitance matrix description. The threshold voltage V th of the Coulomb blockade (CB) is evaluated and analyzed in detail as a function of the gate capacitance C 0 , the array length N, the temperature, and the degree of disorder. The disordered effect is found to be essential, while the long range interaction included in the full capacitance matrix calculations, when decreasing V th , weakly affects the qualitative behaviour of the CB for the V th (C 0 ) - and the V th (N)-dependences. (author)

  20. Symmetric voltage-controlled variable resistance

    Science.gov (United States)

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  1. Distributed stability control using intelligent voltage-margin relay

    Energy Technology Data Exchange (ETDEWEB)

    Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology (Poland); Klimek, A. [Powertech Labs Inc., Surrey, BC (Canada)

    2010-07-01

    This paper presented an intelligent relay that operates if the load to source impedance ratio decreases to a level that is dangerously close to the stability limit, which leads to power system blackouts. The intelligent voltage-margin/difference relay installed at receiving substations automatically initiates action if the voltage stability margin drops to a dangerously low level. The relay decides if the tap changing devices are to be blocked and if under-voltage load shedding should be initiated, thereby mitigating an evolving instability. The intelligent relay has two levels of operation. At the first stage, which corresponds to the higher load to source impedance ratio, the relay initiates blocking of the tap changer. At the second stage, corresponding to the lower source to load impedance ratio, load shedding is initiated. The relay operates when the load to source impedance ratio reaches a certain predetermined level, but it does not depend either on the level of the source voltage or on the difference of source and load impedance phase angles. The algorithm for the relay is relatively simple and uses only locally available signals. Consequently, the transformer is well controlled to eliminate the cases of voltage instability. 6 refs., 7 figs.

  2. Piezoelectric transformers for low-voltage generation of gas discharges and ionic winds in atmospheric air

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Michael J. [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Go, David B., E-mail: dgo@nd.edu [Department of Aerospace and Mechanical Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States); Department of Chemical and Biomolecular Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556 (United States)

    2015-12-28

    To generate a gas discharge (plasma) in atmospheric air requires an electric field that exceeds the breakdown threshold of ∼30 kV/cm. Because of safety, size, or cost constraints, the large applied voltages required to generate such fields are often prohibitive for portable applications. In this work, piezoelectric transformers are used to amplify a low input applied voltage (<30 V) to generate breakdown in air without the need for conventional high-voltage electrical equipment. Piezoelectric transformers (PTs) use their inherent electromechanical resonance to produce a voltage amplification, such that the surface of the piezoelectric exhibits a large surface voltage that can generate corona-like discharges on its corners or on adjacent electrodes. In the proper configuration, these discharges can be used to generate a bulk air flow called an ionic wind. In this work, PT-driven discharges are characterized by measuring the discharge current and the velocity of the induced ionic wind with ionic winds generated using input voltages as low as 7 V. The characteristics of the discharge change as the input voltage increases; this modifies the resonance of the system and subsequent required operating parameters.

  3. Optimizing Systems of Threshold Detection Sensors

    National Research Council Canada - National Science Library

    Banschbach, David C

    2008-01-01

    .... Below the threshold all signals are ignored. We develop a mathematical model for setting individual sensor thresholds to obtain optimal probability of detecting a significant event, given a limit on the total number of false positives allowed...

  4. 11 CFR 9036.1 - Threshold submission.

    Science.gov (United States)

    2010-01-01

    ... credit or debit card, including one made over the Internet, the candidate shall provide sufficient... section shall not count toward the threshold amount. (c) Threshold certification by Commission. (1) After...

  5. Nonlinear current-voltage behavior in PZT thin films

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)

    2017-05-15

    In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)

  6. Nuclear thermodynamics below particle threshold

    International Nuclear Information System (INIS)

    Schiller, A.; Agvaanluvsan, U.; Algin, E.; Bagheri, A.; Chankova, R.; Guttormsen, M.; Hjorth-Jensen, M.; Rekstad, J.; Siem, S.; Sunde, A. C.; Voinov, A.

    2005-01-01

    From a starting point of experimentally measured nuclear level densities, we discuss thermodynamical properties of nuclei below the particle emission threshold. Since nuclei are essentially mesoscopic systems, a straightforward generalization of macroscopic ensemble theory often yields unphysical results. A careful critique of traditional thermodynamical concepts reveals problems commonly encountered in mesoscopic systems. One of which is the fact that microcanonical and canonical ensemble theory yield different results, another concerns the introduction of temperature for small, closed systems. Finally, the concept of phase transitions is investigated for mesoscopic systems

  7. Voltage Quality of Grid Connected Wind Turbines

    DEFF Research Database (Denmark)

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  8. Manufacturing technology for practical Josephson voltage normals

    International Nuclear Information System (INIS)

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  9. 49 CFR 234.221 - Lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  10. Bootstrapped Low-Voltage Analog Switches

    DEFF Research Database (Denmark)

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  11. Voltage generators of high voltage high power accelerators

    International Nuclear Information System (INIS)

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  12. Compositional threshold for Nuclear Waste Glass Durability

    International Nuclear Information System (INIS)

    Kruger, Albert A.; Farooqi, Rahmatullah; Hrma, Pavel R.

    2013-01-01

    Within the composition space of glasses, a distinct threshold appears to exist that separates 'good' glasses, i.e., those which are sufficiently durable, from 'bad' glasses of a low durability. The objective of our research is to clarify the origin of this threshold by exploring the relationship between glass composition, glass structure and chemical durability around the threshold region

  13. Threshold Concepts in Finance: Student Perspectives

    Science.gov (United States)

    Hoadley, Susan; Kyng, Tim; Tickle, Leonie; Wood, Leigh N.

    2015-01-01

    Finance threshold concepts are the essential conceptual knowledge that underpin well-developed financial capabilities and are central to the mastery of finance. In this paper we investigate threshold concepts in finance from the point of view of students, by establishing the extent to which students are aware of threshold concepts identified by…

  14. Reversible audiometric threshold changes in children with uncomplicated malaria

    DEFF Research Database (Denmark)

    Adjei, George O; Goka, Bamenla Q; Kitcher, Emmanuel

    2013-01-01

    Background. Plasmodium falciparum malaria, as well as certain antimalarial drugs, is associated with hearing impairment in adults. There is little information, however, on the extent, if any, of this effect in children, and the evidence linking artemisinin combination therapies (ACTs) with hearing...... is inconclusive. Methods. Audiometry was conducted in children with uncomplicated malaria treated with artesunate-amodiaquine (n = 37), artemether-lumefantrine (n = 35), or amodiaquine (n = 8) in Accra, Ghana. Audiometry was repeated 3, 7, and 28 days later and after 9 months. Audiometric thresholds were compared...... evident between treated children and controls after 9 months. The hearing thresholds of children treated with the two ACT regimens were comparable but lower than those of amodiaquine-treated children during acute illness. Interpretation. Malaria is the likely cause of the elevated hearing threshold levels...

  15. Pain thresholds, supra-threshold pain and lidocaine sensitivity in patients with erythromelalgia, including the I848Tmutation in NaV 1.7.

    Science.gov (United States)

    Helås, T; Sagafos, D; Kleggetveit, I P; Quiding, H; Jönsson, B; Segerdahl, M; Zhang, Z; Salter, H; Schmelz, M; Jørum, E

    2017-09-01

    Nociceptive thresholds and supra-threshold pain ratings as well as their reduction upon local injection with lidocaine were compared between healthy subjects and patients with erythromelalgia (EM). Lidocaine (0.25, 0.50, 1.0 or 10 mg/mL) or placebo (saline) was injected intradermally in non-painful areas of the lower arm, in a randomized, double-blind manner, to test the effect on dynamic and static mechanical sensitivity, mechanical pain sensitivity, thermal thresholds and supra-threshold heat pain sensitivity. Heat pain thresholds and pain ratings to supra-threshold heat stimulation did not differ between EM-patients (n = 27) and controls (n = 25), neither did the dose-response curves for lidocaine. Only the subgroup of EM-patients with mutations in sodium channel subunits Na V 1.7, 1.8 or 1.9 (n = 8) had increased lidocaine sensitivity for supra-threshold heat stimuli, contrasting lower sensitivity to strong mechanical stimuli. This pattern was particularly clear in the two patients carrying the Na V 1.7 I848T mutations in whom lidocaine's hyperalgesic effect on mechanical pain sensitivity contrasted more effective heat analgesia. Heat pain thresholds are not sensitized in EM patients, even in those with gain-of-function mutations in Na V 1.7. Differential lidocaine sensitivity was overt only for noxious stimuli in the supra-threshold range suggesting that sensitized supra-threshold encoding is important for the clinical pain phenotype in EM in addition to lower activation threshold. Intracutaneous lidocaine dose-dependently blocked nociceptive sensations, but we did not identify EM patients with particular high lidocaine sensitivity that could have provided valuable therapeutic guidance. Acute pain thresholds and supra-threshold heat pain in controls and patients with erythromelalgia do not differ and have the same lidocaine sensitivity. Acute heat pain thresholds even in EM patients with the Na V 1.7 I848T mutation are normal and only nociceptor

  16. Computational gestalts and perception thresholds.

    Science.gov (United States)

    Desolneux, Agnès; Moisan, Lionel; Morel, Jean-Michel

    2003-01-01

    In 1923, Max Wertheimer proposed a research programme and method in visual perception. He conjectured the existence of a small set of geometric grouping laws governing the perceptual synthesis of phenomenal objects, or "gestalt" from the atomic retina input. In this paper, we review this set of geometric grouping laws, using the works of Metzger, Kanizsa and their schools. In continuation, we explain why the Gestalt theory research programme can be translated into a Computer Vision programme. This translation is not straightforward, since Gestalt theory never addressed two fundamental matters: image sampling and image information measurements. Using these advances, we shall show that gestalt grouping laws can be translated into quantitative laws allowing the automatic computation of gestalts in digital images. From the psychophysical viewpoint, a main issue is raised: the computer vision gestalt detection methods deliver predictable perception thresholds. Thus, we are set in a position where we can build artificial images and check whether some kind of agreement can be found between the computationally predicted thresholds and the psychophysical ones. We describe and discuss two preliminary sets of experiments, where we compared the gestalt detection performance of several subjects with the predictable detection curve. In our opinion, the results of this experimental comparison support the idea of a much more systematic interaction between computational predictions in Computer Vision and psychophysical experiments.

  17. Threshold enhancement of diphoton resonances

    CERN Document Server

    Bharucha, Aoife; Goudelis, Andreas

    2016-10-10

    The data collected by the LHC collaborations at an energy of 13 TeV indicates the presence of an excess in the diphoton spectrum that would correspond to a resonance of a 750 GeV mass. The apparently large production cross section is nevertheless very difficult to explain in minimal models. We consider the possibility that the resonance is a pseudoscalar boson $A$ with a two--photon decay mediated by a charged and uncolored fermion having a mass at the $\\frac12 M_A$ threshold and a very small decay width, $\\ll 1$ MeV; one can then generate a large enhancement of the $A\\gamma\\gamma$ amplitude which explains the excess without invoking a large multiplicity of particles propagating in the loop, large electric charges and/or very strong Yukawa couplings. The implications of such a threshold enhancement are discussed in two explicit scenarios: i) the Minimal Supersymmetric Standard Model in which the $A$ state is produced via the top quark mediated gluon fusion process and decays into photons predominantly through...

  18. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    DEFF Research Database (Denmark)

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  19. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    Science.gov (United States)

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  20. Piezo Voltage Controlled Planar Hall Effect Devices.

    Science.gov (United States)

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  1. Input-output relation and energy efficiency in the neuron with different spike threshold dynamics.

    Science.gov (United States)

    Yi, Guo-Sheng; Wang, Jiang; Tsang, Kai-Ming; Wei, Xi-Le; Deng, Bin

    2015-01-01

    Neuron encodes and transmits information through generating sequences of output spikes, which is a high energy-consuming process. The spike is initiated when membrane depolarization reaches a threshold voltage. In many neurons, threshold is dynamic and depends on the rate of membrane depolarization (dV/dt) preceding a spike. Identifying the metabolic energy involved in neural coding and their relationship to threshold dynamic is critical to understanding neuronal function and evolution. Here, we use a modified Morris-Lecar model to investigate neuronal input-output property and energy efficiency associated with different spike threshold dynamics. We find that the neurons with dynamic threshold sensitive to dV/dt generate discontinuous frequency-current curve and type II phase response curve (PRC) through Hopf bifurcation, and weak noise could prohibit spiking when bifurcation just occurs. The threshold that is insensitive to dV/dt, instead, results in a continuous frequency-current curve, a type I PRC and a saddle-node on invariant circle bifurcation, and simultaneously weak noise cannot inhibit spiking. It is also shown that the bifurcation, frequency-current curve and PRC type associated with different threshold dynamics arise from the distinct subthreshold interactions of membrane currents. Further, we observe that the energy consumption of the neuron is related to its firing characteristics. The depolarization of spike threshold improves neuronal energy efficiency by reducing the overlap of Na(+) and K(+) currents during an action potential. The high energy efficiency is achieved at more depolarized spike threshold and high stimulus current. These results provide a fundamental biophysical connection that links spike threshold dynamics, input-output relation, energetics and spike initiation, which could contribute to uncover neural encoding mechanism.

  2. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    DEFF Research Database (Denmark)

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  3. An examination of neuromuscular and metabolic fatigue thresholds

    International Nuclear Information System (INIS)

    Bergstrom, Haley C; Housh, Terry J; Cochrane, Kristen C; Jenkins, Nathaniel D M; Lewis, Robert W Jr; Traylor, Daniel A; Schmidt, Richard J; Johnson, Glen O; Cramer, Joel T; Zuniga, Jorge M

    2013-01-01

    This study examined the relationships among the physical working capacity at the fatigue threshold (PWC FT ), the power outputs associated with the gas exchange threshold (PGET) and the respiratory compensation point (PRCP), and critical power (CP) to identify possible physiological mechanisms underlying the onset of neuromuscular fatigue. Ten participants (mean ± SD age: 20 ± 1 years) performed a maximal incremental cycle ergometer test to determine the PWC FT , PGET, and PRCP. CP was determined from the 3 min all-out test. The PWC FT (197 ± 55 W), PRCP (212 ± 50 W), and CP (208 ± 63 W) were significantly greater than the PGET (168 ± 40 W), but there were no significant differences among the PWC FT , PRCP, and CP. All thresholds were significantly inter-4 (r = 0.794–0.958). The 17% greater estimates for the PWC FT than PGET were likely related to differences in the physiological mechanisms that underlie these fatigue thresholds, while the non-significant difference and high correlation between the PWC FT and the PRCP suggested that hyperkalemia may underlie both thresholds. Furthermore, it is possible that the 5% lower estimate of the PWC FT than CP could more accurately reflect the demarcation of the heavy from severe exercise intensity domains. (paper)

  4. Threshold Studies of the Microwave Instability in Electron Storage Rings

    International Nuclear Information System (INIS)

    Bane, Karl

    2010-01-01

    We use a Vlasov-Fokker-Planck program and a linearized Vlasov solver to study the microwave instability threshold of impedance models: (1) a Q = 1 resonator and (2) shielded coherent synchrotron radiation (CSR), and find the results of the two programs agree well. For shielded CSR we show that only two dimensionless parameters, the shielding parameter Π and the strength parameter S csr , are needed to describe the system. We further show that there is a strong instability associated with CSR, and that the threshold, to good approximation, is given by (S csr )th = 0.5 + 0.12Π. In particular, this means that shielding has little effect in stabilizing the beam for Π ∼ -3/2 . We, in addition, find another instability in the vicinity of Π = 0.7 with a lower threshold, (S csr ) th ∼ 0.2. We find that the threshold to this instability depends strongly on damping time, (S csr ) th ∼ τ p -1/2 , and that the tune spread at threshold is small - both hallmarks of a weak instability.

  5. Hard decoding algorithm for optimizing thresholds under general Markovian noise

    Science.gov (United States)

    Chamberland, Christopher; Wallman, Joel; Beale, Stefanie; Laflamme, Raymond

    2017-04-01

    Quantum error correction is instrumental in protecting quantum systems from noise in quantum computing and communication settings. Pauli channels can be efficiently simulated and threshold values for Pauli error rates under a variety of error-correcting codes have been obtained. However, realistic quantum systems can undergo noise processes that differ significantly from Pauli noise. In this paper, we present an efficient hard decoding algorithm for optimizing thresholds and lowering failure rates of an error-correcting code under general completely positive and trace-preserving (i.e., Markovian) noise. We use our hard decoding algorithm to study the performance of several error-correcting codes under various non-Pauli noise models by computing threshold values and failure rates for these codes. We compare the performance of our hard decoding algorithm to decoders optimized for depolarizing noise and show improvements in thresholds and reductions in failure rates by several orders of magnitude. Our hard decoding algorithm can also be adapted to take advantage of a code's non-Pauli transversal gates to further suppress noise. For example, we show that using the transversal gates of the 5-qubit code allows arbitrary rotations around certain axes to be perfectly corrected. Furthermore, we show that Pauli twirling can increase or decrease the threshold depending upon the code properties. Lastly, we show that even if the physical noise model differs slightly from the hypothesized noise model used to determine an optimized decoder, failure rates can still be reduced by applying our hard decoding algorithm.

  6. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  7. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  8. Risk thresholds for alcohol consumption

    DEFF Research Database (Denmark)

    Wood, Angela M; Kaptoge, Stephen; Butterworth, Adam S

    2018-01-01

    previous cardiovascular disease. METHODS: We did a combined analysis of individual-participant data from three large-scale data sources in 19 high-income countries (the Emerging Risk Factors Collaboration, EPIC-CVD, and the UK Biobank). We characterised dose-response associations and calculated hazard......BACKGROUND: Low-risk limits recommended for alcohol consumption vary substantially across different national guidelines. To define thresholds associated with lowest risk for all-cause mortality and cardiovascular disease, we studied individual-participant data from 599 912 current drinkers without......·4 million person-years of follow-up. For all-cause mortality, we recorded a positive and curvilinear association with the level of alcohol consumption, with the minimum mortality risk around or below 100 g per week. Alcohol consumption was roughly linearly associated with a higher risk of stroke (HR per 100...

  9. Detection thresholds of macaque otolith afferents.

    Science.gov (United States)

    Yu, Xiong-Jie; Dickman, J David; Angelaki, Dora E

    2012-06-13

    The vestibular system is our sixth sense and is important for spatial perception functions, yet the sensory detection and discrimination properties of vestibular neurons remain relatively unexplored. Here we have used signal detection theory to measure detection thresholds of otolith afferents using 1 Hz linear accelerations delivered along three cardinal axes. Direction detection thresholds were measured by comparing mean firing rates centered on response peak and trough (full-cycle thresholds) or by comparing peak/trough firing rates with spontaneous activity (half-cycle thresholds). Thresholds were similar for utricular and saccular afferents, as well as for lateral, fore/aft, and vertical motion directions. When computed along the preferred direction, full-cycle direction detection thresholds were 7.54 and 3.01 cm/s(2) for regular and irregular firing otolith afferents, respectively. Half-cycle thresholds were approximately double, with excitatory thresholds being half as large as inhibitory thresholds. The variability in threshold among afferents was directly related to neuronal gain and did not depend on spike count variance. The exact threshold values depended on both the time window used for spike count analysis and the filtering method used to calculate mean firing rate, although differences between regular and irregular afferent thresholds were independent of analysis parameters. The fact that minimum thresholds measured in macaque otolith afferents are of the same order of magnitude as human behavioral thresholds suggests that the vestibular periphery might determine the limit on our ability to detect or discriminate small differences in head movement, with little noise added during downstream processing.

  10. Regional rainfall thresholds for landslide occurrence using a centenary database

    Science.gov (United States)

    Vaz, Teresa; Luís Zêzere, José; Pereira, Susana; Cruz Oliveira, Sérgio; Quaresma, Ivânia

    2017-04-01

    Rainfall is one of the most important triggering factors for landslides occurrence worldwide. The relation between rainfall and landslide occurrence is complex and some approaches have been focus on the rainfall thresholds identification, i.e., rainfall critical values that when exceeded can initiate landslide activity. In line with these approaches, this work proposes and validates rainfall thresholds for the Lisbon region (Portugal), using a centenary landslide database associated with a centenary daily rainfall database. The main objectives of the work are the following: i) to compute antecedent rainfall thresholds using linear and potential regression; ii) to define lower limit and upper limit rainfall thresholds; iii) to estimate the probability of critical rainfall conditions associated with landslide events; and iv) to assess the thresholds performance using receiver operating characteristic (ROC) metrics. In this study we consider the DISASTER database, which lists landslides that caused fatalities, injuries, missing people, evacuated and homeless people occurred in Portugal from 1865 to 2010. The DISASTER database was carried out exploring several Portuguese daily and weekly newspapers. Using the same newspaper sources, the DISASTER database was recently updated to include also the landslides that did not caused any human damage, which were also considered for this study. The daily rainfall data were collected at the Lisboa-Geofísico meteorological station. This station was selected considering the quality and completeness of the rainfall data, with records that started in 1864. The methodology adopted included the computation, for each landslide event, of the cumulative antecedent rainfall for different durations (1 to 90 consecutive days). In a second step, for each combination of rainfall quantity-duration, the return period was estimated using the Gumbel probability distribution. The pair (quantity-duration) with the highest return period was

  11. Observability of Low Voltage grids

    DEFF Research Database (Denmark)

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  12. Low-threshold amplitude discriminator circuit with tunnel diode and two transistors in differential connection

    International Nuclear Information System (INIS)

    Ryba, J.; Volny, J.

    1973-01-01

    The connection is designed of a low-threshold amplitude discriminator and a tunnel diode with two transistors in differential connection. The discriminator is by its simple connection, its low consumption and high temperature stability suitable especially for portable radiation detectors. The tunnel diode is connected by one pole to a collector clamp and by the other to the supply voltage. A suitable resistor is connected in parallel with the tunnel diode to meet demands for higher sensitivity. (Z.S.)

  13. Fatigue threshold studies in Fe, Fe-Si, and HSLA steel: Part II. Thermally activated behavior of the effective stress intensity at threshold

    International Nuclear Information System (INIS)

    Yu, W.; Esaklul, K.; Gerberich, W.W.

    1984-01-01

    It is shown that closure mechanisms alone cannot fully explain increasing fatigue thresholds with decreasing test temperature. Implications are that fatigue crack propagation near threshold is a thermally activated process. The effective threshold stress intensity correlate to the thermal component of the flow stress. A fractographic study of the fatigue surface was performed. Water vapor in room air promotes the formation of oxide and intergranular crack growth. At lower temperatures, a brittle-type cyclic cleavage fatigue surface was observed but the ductile process persisted even at 123 K. Arrest marks found on all three modes of fatigue crack growth suggest that fatigue crack growth controlled by the subcell structure near threshold. The effective fatigue threshold may be related to the square root of (one plus the strain rate sensitivity)

  14. Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

    Science.gov (United States)

    Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

    2017-10-23

    The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

  15. Effects of low strength pedaling exercise on stress sensitivity and pain threshold

    OpenAIRE

    坂野, 裕洋

    2017-01-01

     This study conducted a comparative assessment of the effects of low intensity lower limb pedaling exercise on the stress sensitivity and pain threshold in healthy subjects and those with chronic stiff neck or lower back pain. The results showed a reduction in pain threshold depending on the applied mechanical stress in both healthy and chronic pain groups. The individuals with chronic pain felt pain more intensely compared to the healthy individuals, and showed a significant reduction in pai...

  16. A Three-Level Quasi-Two-Stage Single-Phase PFC Converter with Flexible Output Voltage and Improved Conversion Efficiency

    DEFF Research Database (Denmark)

    Tang, Yi; Zhu, Dexuan; Jin, Chi

    2015-01-01

    voltages, and it will be very suitable for high-power applications where the output voltage can be either lower or higher than the peak ac input voltage, e.g., plug-in hybrid electric vehicle charging systems. Moreover, the involved dc/dc buck conversion stage may only need to process partial input power...

  17. A Robust Ultra-Low Voltage CPU Utilizing Timing-Error Prevention

    Directory of Open Access Journals (Sweden)

    Markus Hiienkari

    2015-04-01

    Full Text Available To minimize energy consumption of a digital circuit, logic can be operated at sub- or near-threshold voltage. Operation at this region is challenging due to device and environment variations, and resulting performance may not be adequate to all applications. This article presents two variants of a 32-bit RISC CPU targeted for near-threshold voltage. Both CPUs are placed on the same die and manufactured in 28 nm CMOS process. They employ timing-error prevention with clock stretching to enable operation with minimal safety margins while maximizing performance and energy efficiency at a given operating point. Measurements show minimum energy of 3.15 pJ/cyc at 400 mV, which corresponds to 39% energy saving compared to operation based on static signoff timing.

  18. Laser-induced damage thresholds of gold, silver and their alloys in air and water

    Energy Technology Data Exchange (ETDEWEB)

    Starinskiy, Sergey V.; Shukhov, Yuri G.; Bulgakov, Alexander V., E-mail: bulgakov@itp.nsc.ru

    2017-02-28

    Highlights: • Laser damage thresholds of Ag, Au and Ag-Au alloys in air and water are measured. • Alloy thresholds are lower than those of Ag and Au due to low thermal conductivity. • Laser damage thresholds in water are ∼1.5 times higher than those in air. • Light scattering mechanisms responsible for high thresholds in water are suggested. • Light scattering mechanisms are supported by optical reflectance measurements. - Abstract: The nanosecond-laser-induced damage thresholds of gold, silver and gold-silver alloys of various compositions in air and water have been measured for single-shot irradiation conditions. The experimental results are analyzed theoretically by solving the heat flow equation for the samples irradiated in air and in water taking into account vapor nucleation at the solid-water interface. The damage thresholds of Au-Ag alloys are systematically lower than those for pure metals, both in air and water that is explained by lower thermal conductivities of the alloys. The thresholds measured in air agree well with the calculated melting thresholds for all samples. The damage thresholds in water are found to be considerably higher, by a factor of ∼1.5, than the corresponding thresholds in air. This cannot be explained, in the framework of the used model, neither by the conductive heat transfer to water nor by the vapor pressure effect. Possible reasons for the high damage thresholds in water such as scattering of the incident laser light by the vapor-liquid interface and the critical opalescence in the superheated water are suggested. Optical pump-probe measurements have been performed to study the reflectance dynamics of the surface irradiated in air and water. Comparison of the transient reflectance signal with the calculated nucleation dynamics provides evidence that the both suggested scattering mechanisms are likely to occur during metal ablation in water.

  19. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  20. High-voltage pixel sensors for ATLAS upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Perić, I., E-mail: ivan.peric@ziti.uni-heidelberg.de [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Kreidl, C.; Fischer, P. [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Bompard, F.; Breugnon, P.; Clemens, J.-C.; Fougeron, D.; Liu, J.; Pangaud, P.; Rozanov, A.; Barbero, M. [CPPM, Marseille (France); Feigl, S.; Capeans, M.; Ferrere, D.; Pernegger, H.; Ristic, B. [CERN, Geneve (Switzerland); Muenstermann, D.; Gonzalez Sevilla, S.; La Rosa, A.; Miucci, A. [University of Geneve (Switzerland); and others

    2014-11-21

    The high-voltage (HV-) CMOS pixel sensors offer several good properties: a fast charge collection by drift, the possibility to implement relatively complex CMOS in-pixel electronics and the compatibility with commercial processes. The sensor element is a deep n-well diode in a p-type substrate. The n-well contains CMOS pixel electronics. The main charge collection mechanism is drift in a shallow, high field region, which leads to a fast charge collection and a high radiation tolerance. We are currently evaluating the use of the high-voltage detectors implemented in 180 nm HV-CMOS technology for the high-luminosity ATLAS upgrade. Our approach is replacing the existing pixel and strip sensors with the CMOS sensors while keeping the presently used readout ASICs. By intelligence we mean the ability of the sensor to recognize a particle hit and generate the address information. In this way we could benefit from the advantages of the HV sensor technology such as lower cost, lower mass, lower operating voltage, smaller pitch, smaller clusters at high incidence angles. Additionally we expect to achieve a radiation hardness necessary for ATLAS upgrade. In order to test the concept, we have designed two HV-CMOS prototypes that can be readout in two ways: using pixel and strip readout chips. In the case of the pixel readout, the connection between HV-CMOS sensor and the readout ASIC can be established capacitively.

  1. Low-threshold pure UV electroluminescence from n-ZnO:Al/i-layer/n-GaN heterojunction

    International Nuclear Information System (INIS)

    Li Songzhan; Fang Guojia; Long Hao; Wang Haoning; Huang Huihui; Mo Xiaoming; Zhao Xingzhong

    2012-01-01

    Ultraviolet (UV) electroluminescence (EL) of n-ZnO:Al (AZO)/i-layer/n-GaN heterojunctions with different intrinsic layers has been obtained. Rectifying behavior and EL spectra of the heterojunctions are investigated at room temperature. Under positive voltage, a dominant UV emission peak around ∼370 nm is observed for both AZO/i-ZnO/n-GaN and AZO/i-MgO/n-GaN heterojunctions. Nevertheless, the UV emission peak intensity of AZO/i-MgO/n-GaN heterojunction is much stronger than that of AZO/i-ZnO/n-GaN heterojunction at the same voltage. The threshold voltage of AZO/i-MgO/n-GaN heterostructured device is as low as 2.3 V. The difference of EL spectra and the emission mechanism in these devices are discussed. - Highlights: ► UV electroluminescence of n-ZnO:Al/i-layer/n-GaN heterojunctions has been obtained. ► Under positive voltage, a dominant UV emission peak around ∼370 nm is observed for both heterojunctions. ► The UV emission peak intensity of the heterojunction with i-MgO layer is much stronger than that with i-ZnO layer at the same voltage. ► The threshold voltage of n-ZnO:Al/i-MgO/n-GaN heterostructured device is as low as 2.3 V.

  2. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  3. Sausage instability threshold in a low energy plasma focus

    International Nuclear Information System (INIS)

    Zakaullah, M.; Nasir, M.; Khattak, F.Y.; Murtaza, G.

    1993-01-01

    Development of sausage instability (m = 0 mode) is studied in a small low energy Mather-type plasma focus. A shadow graphic study of the current sheath has shown that the focused plasma necks off during the radial phase before the maximum compression. This may indicate the lowering of the instability threshold. Three hook-type structures are observed which may not be due to the multifoci formation. The bubble shape structure is observed to be developed in the expansion phase. (author)

  4. Bound-Electron Nonlinearity Beyond the Ionization Threshold

    Science.gov (United States)

    Wahlstrand, J. K.; Zahedpour, S.; Bahl, A.; Kolesik, M.; Milchberg, H. M.

    2018-05-01

    We present absolute space- and time-resolved measurements of the ultrafast laser-driven nonlinear polarizability in argon, krypton, xenon, nitrogen, and oxygen up to ionization fractions of a few percent. These measurements enable determination of the strongly nonperturbative bound-electron nonlinear polarizability well beyond the ionization threshold, where it is found to remain approximately quadratic in the laser field, a result normally expected at much lower intensities where perturbation theory applies.

  5. Theoretical analysis of magnetic sensor output voltage

    International Nuclear Information System (INIS)

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  6. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  7. Threshold behavior in electron-atom scattering

    International Nuclear Information System (INIS)

    Sadeghpour, H.R.; Greene, C.H.

    1996-01-01

    Ever since the classic work of Wannier in 1953, the process of treating two threshold electrons in the continuum of a positively charged ion has been an active field of study. The authors have developed a treatment motivated by the physics below the double ionization threshold. By modeling the double ionization as a series of Landau-Zener transitions, they obtain an analytical formulation of the absolute threshold probability which has a leading power law behavior, akin to Wannier's law. Some of the noteworthy aspects of this derivation are that the derivation can be conveniently continued below threshold giving rise to a open-quotes cuspclose quotes at threshold, and that on both sides of the threshold, absolute values of the cross sections are obtained

  8. A numerical study of threshold states

    International Nuclear Information System (INIS)

    Ata, M.S.; Grama, C.; Grama, N.; Hategan, C.

    1979-01-01

    There are some experimental evidences of charged particle threshold states. On the statistical background of levels, some simple structures were observed in excitation spectrum. They occur near the coulombian threshold and have a large reduced width for the decay in the threshold channel. These states were identified as charged cluster threshold states. Such threshold states were observed in sup(15,16,17,18)O, sup(18,19)F, sup(19,20)Ne, sup(24)Mg, sup(32)S. The types of clusters involved were d, t, 3 He, α and even 12 C. They were observed in heavy-ions transfer reactions in the residual nucleus as strong excited levels. The charged particle threshold states occur as simple structures at high excitation energy. They could be interesting both from nuclear structure as well as nuclear reaction mechanism point of view. They could be excited as simple structures both in compound and residual nucleus. (author)

  9. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    OpenAIRE

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  10. High voltage investigations for ITER coils

    International Nuclear Information System (INIS)

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  11. Propagation of disturbances as voltage fluctuations in transmission networks

    Directory of Open Access Journals (Sweden)

    Albert Hermina

    2016-08-01

    Full Text Available Significant changes occurred in the power system in Romania in recent years by reducing the power used in the system, the number of classic power sources in operation as well as by implementing renewable energy sources, have determined short circuit power reduction (node rigidity in the points where disturbing users are connected, that in the absence of adequate measures, result in disturbances above acceptable levels. The paper analyzes two power systems areas in which are connected users that cause voltage fluctuation. Disturbances as voltage fluctuations resulting in these nodes may exceed the acceptable values and can spread in the transmission network affecting power quality over large system areas. The analysis conducted reveals the influence of short circuit power in nodes where these users are connected and highlights the fact that in some cases (e.g. lines out of operation for maintenance, shutdown of classic units in the area the disturbances in the transmission network sent to the users at lower voltages may have values above those allowed. Technical Code of existing power transmission network makes no reference to voltage fluctuations, as a rule, in the electricity transmission network was considered that this phenomenon should not exist.

  12. Iran: the next nuclear threshold state?

    OpenAIRE

    Maurer, Christopher L.

    2014-01-01

    Approved for public release; distribution is unlimited A nuclear threshold state is one that could quickly operationalize its peaceful nuclear program into one capable of producing a nuclear weapon. This thesis compares two known threshold states, Japan and Brazil, with Iran to determine if the Islamic Republic could also be labeled a threshold state. Furthermore, it highlights the implications such a status could have on U.S. nonproliferation policy. Although Iran's nuclear program is mir...

  13. Dynamical thresholds for complete fusion

    International Nuclear Information System (INIS)

    Davies, K.T.R.; Sierk, A.J.; Nix, J.R.

    1983-01-01

    It is our purpose here to study the effect of nuclear dissipation and shape parametrization on dynamical thresholds for compound-nucleus formation in symmetric heavy-ion reactions. This is done by solving numerically classical equations of motion for head-on collisions to determine whether the dynamical trajectory in a multidimensional deformation space passes inside the fission saddle point and forms a compound nucleus, or whether it passes outside the fission saddle point and reseparates in a fast-fission or deep-inelastic reaction. Specifying the nuclear shape in terms of smoothly joined portions of three quadratic surfaces of revolution, we take into account three symmetric deformation coordinates. However, in some cases we reduce the number of coordinates to two by requiring the ends of the fusing system to be spherical in shape. The nuclear potential energy of deformation is determined in terms of a Coulomb energy and a double volume energy of a Yukawa-plus-exponential folding function. The collective kinetic energy is calculated for incompressible, nearly irrotational flow by means of the Werner-Wheeler approximation. Four possibilities are studied for the transfer of collective kinetic energy into internal single-particle excitation energy: zero dissipation, ordinary two body viscosity, one-body wall-formula dissipation, and one-body wall-and-window dissipation

  14. Identification of voltage stability condition of a power system using measurements of bus variables

    Directory of Open Access Journals (Sweden)

    Durlav Hazarika

    2014-12-01

    Full Text Available Several online methods were proposed for investigating the voltage stability condition of an interconnected power system using the measurements of voltage and current phasors at a bus. For this purpose, phasor measurement units (PMUs are used. A PMU is a device which measures the electrical waves on an electrical network, using a common time source (reference bus for synchronisation. This study proposes a method for online monitoring of voltage stability condition of a power system using measurements of bus variables namely – (i real power, (ii reactive power and (iii bus voltage magnitude at a bus. The measurements of real power, reactive power and bus voltage magnitude could be extracted/captured from a smart energy meter. The financial involvement for implementation of the proposed method would significantly lower compared with the PMU-based method.

  15. Maximum permissible voltage of YBCO coated conductors

    Energy Technology Data Exchange (ETDEWEB)

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  16. Microprocessor-controlled, programmable ramp voltage generator

    International Nuclear Information System (INIS)

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  17. Low-Voltage Switched-Capacitor Circuits

    DEFF Research Database (Denmark)

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  18. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  19. Voltage spike detection in high field superconducting accelerator magnets

    Energy Technology Data Exchange (ETDEWEB)

    Orris, D.F.; Carcagno, R.; Feher, S.; Makulski, A.; Pischalnikov, Y.M.; /Fermilab

    2004-12-01

    A measurement system for the detection of small magnetic flux changes in superconducting magnets, which are due to either mechanical motion of the conductor or flux jump, has been developed at Fermilab. These flux changes are detected as small amplitude, short duration voltage spikes, which are {approx}15mV in magnitude and lasts for {approx}30 {micro}sec. The detection system combines an analog circuit for the signal conditioning of two coil segments and a fast data acquisition system for digitizing the results, performing threshold detection, and storing the resultant data. The design of the spike detection system along with the modeling results and noise analysis will be presented. Data from tests of high field Nb{sub 3}Sn magnets at currents up to {approx}20KA will also be shown.

  20. Voltage spike detection in high field superconducting accelerator magnets

    International Nuclear Information System (INIS)

    Orris, D.F.; Carcagno, R.; Feher, S.; Makulski, A.; Pischalnikov, Y.M.

    2004-01-01

    A measurement system for the detection of small magnetic flux changes in superconducting magnets, which are due to either mechanical motion of the conductor or flux jump, has been developed at Fermilab. These flux changes are detected as small amplitude, short duration voltage spikes, which are ∼15mV in magnitude and lasts for ∼30(micro)sec. The detection system combines an analog circuit for the signal conditioning of two coil segments and a fast data acquisition system for digitizing the results, performing threshold detection, and storing the resultant data. The design of the spike detection system along with the modeling results and noise analysis will be presented. Data from tests of high field Nb3Sn magnets at currents up to ∼20KA will also be shown

  1. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  2. MOS Current Mode Logic Near Threshold Circuits

    Directory of Open Access Journals (Sweden)

    Alexander Shapiro

    2014-06-01

    Full Text Available Near threshold circuits (NTC are an attractive and promising technology that provides significant power savings with some delay penalty. The combination of NTC technology with MOS current mode logic (MCML is examined in this work. By combining MCML with NTC, the constant power consumption of MCML is reduced to leakage power levels that can be tolerated in certain modern applications. Additionally, the speed of NTC is improved due to the high speed nature of MCML technology. A 14 nm Fin field effect transistor (FinFET technology is used to evaluate these combined circuit techniques. A 32-bit Kogge Stone adder is chosen as a demonstration vehicle for feasibility analysis. MCML with NTC is shown to yield enhanced power efficiency when operated above 1 GHz with a 100% activity factor as compared to standard CMOS. MCML with NTC is more power efficient than standard CMOS beyond 9 GHz over a wide range of activity factors. MCML with NTC also exhibits significantly lower noise levels as compared to standard CMOS. The results of the analysis demonstrate that pairing NTC and MCML is efficient when operating at high frequencies and activity factors.

  3. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  4. Influence of Ambient Humidity on the Voltage Response of Ionic Polymer-Metal Composite Sensor.

    Science.gov (United States)

    Zhu, Zicai; Horiuchi, Tetsuya; Kruusamäe, Karl; Chang, Longfei; Asaka, Kinji

    2016-03-31

    Electrical potential based on ion migration exists not only in natural systems but also in ionic polymer materials. In order to investigate the influence of ambient humidity on voltage response, classical Au-Nafion IPMC was chosen as the reference sample. Voltage response under a bending deformation was measured in two ways: first, continuous measurement of voltage response in the process of absorption and desorption of water to study the tendency of voltage variation at all water states; second, measurements at multiple fixed ambient humidity levels to characterize the process of voltage response quantitatively. Ambient humidity influences the voltage response mainly by varying water content in ionic polymer. Under a step bending, the amplitude of initial voltage peak first increases and then decreases as the ambient humidity and the inherent water content decrease. This tendency is explained semiquantitatively by mass storage capacity related to the stretchable state of the Nafion polymer network. Following the initial peak, the voltage shows a slow decay to a steady state, which is first characterized in this paper. The relative voltage decay during the steady state always decreases as the ambient humidity is lowered. It is ascribed to progressive increase of the ratio between the water molecules in the cation hydration shell to the free water. Under sinusoidal mechanical bending excitation in the range of 0.1-10 Hz, the voltage magnitude increases with frequency at high ambient humidity but decreases with frequency at low ambient humidity. The relationship is mainly controlled by the voltage decay effect and the response speed.

  5. Influence of microstructure on laser damage threshold of IBS coatings

    International Nuclear Information System (INIS)

    Stolz, C.J.; Genin, F.Y.; Kozlowski, M.R.; Long, D.; Lalazari, R.; Wu, Z.L.; Kuo, P.K.

    1996-01-01

    Ion-beam sputtering (IBS) coatings were developed for the laser gyro industry to meet significantly different requirements than those of fusion lasers. Laser gyro mirrors are small ( 26 J/cm 2 at 1,064 nm with 3-ns pulses). As part of the National Ignition Facility (NIF) coating development effort, IBS coatings are being studied to explore the possible benefits of this technology to NIF optics. As an initial step to achieving the NIF size and damage threshold requirements, the coating process is being scaled to uniformly coat a 20 x 40 cm 2 area with reduced spectral, reflected wavefront, and laser damage threshold requirements. Here, multilayer coatings deposited by ion-beam sputtering with amorphous layers were found to have lower damage thresholds at 1,064 nm than similar coatings with crystalline layers. Interestingly, at higher fluences the damage was less severe for the amorphous coatings. The magnitude of the difference in damage thresholds between the two different microstructures was strongly influenced by the size of the tested area. To better understand the microstructure effects, single layers of HfO 2 with different microstructures were studied using transmission electron microscopy, ellipsometry, and a photothermal deflection technique. Since the laser damage initiated at defects, the influence of thermal diffusivity on thermal gradients in nodular defects is also presented

  6. Torque-onset determination: Unintended consequences of the threshold method.

    Science.gov (United States)

    Dotan, Raffy; Jenkins, Glenn; O'Brien, Thomas D; Hansen, Steve; Falk, Bareket

    2016-12-01

    Compared with visual torque-onset-detection (TOD), threshold-based TOD produces onset bias, which increases with lower torques or rates of torque development (RTD). To compare the effects of differential TOD-bias on common contractile parameters in two torque-disparate groups. Fifteen boys and 12 men performed maximal, explosive, isometric knee-extensions. Torque and EMG were recorded for each contraction. Best contractions were selected by peak torque (MVC) and peak RTD. Visual-TOD-based torque-time traces, electromechanical delays (EMD), and times to peak RTD (tRTD) were compared with corresponding data derived from fixed 4-Nm- and relative 5%MVC-thresholds. The 5%MVC TOD-biases were similar for boys and men, but the corresponding 4-Nm-based biases were markedly different (40.3±14.1 vs. 18.4±7.1ms, respectively; ptorque kinetics tended to be faster than the boys' (NS), but the 4-Nm-based kinetics erroneously depicted the boys as being much faster to any given %MVC (p<0.001). When comparing contractile properties of dissimilar groups, e.g., children vs. adults, threshold-based TOD methods can misrepresent reality and lead to erroneous conclusions. Relative-thresholds (e.g., 5% MVC) still introduce error, but group-comparisons are not confounded. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A Framework for Optimizing Phytosanitary Thresholds in Seed Systems.

    Science.gov (United States)

    Choudhury, Robin Alan; Garrett, Karen A; Klosterman, Steven J; Subbarao, Krishna V; McRoberts, Neil

    2017-10-01

    Seedborne pathogens and pests limit production in many agricultural systems. Quarantine programs help prevent the introduction of exotic pathogens into a country, but few regulations directly apply to reducing the reintroduction and spread of endemic pathogens. Use of phytosanitary thresholds helps limit the movement of pathogen inoculum through seed, but the costs associated with rejected seed lots can be prohibitive for voluntary implementation of phytosanitary thresholds. In this paper, we outline a framework to optimize thresholds for seedborne pathogens, balancing the cost of rejected seed lots and benefit of reduced inoculum levels. The method requires relatively small amounts of data, and the accuracy and robustness of the analysis improves over time as data accumulate from seed testing. We demonstrate the method first and illustrate it with a case study of seedborne oospores of Peronospora effusa, the causal agent of spinach downy mildew. A seed lot threshold of 0.23 oospores per seed could reduce the overall number of oospores entering the production system by 90% while removing 8% of seed lots destined for distribution. Alternative mitigation strategies may result in lower economic losses to seed producers, but have uncertain efficacy. We discuss future challenges and prospects for implementing this approach.

  8. Does more energy consumption bolster economic growth? An application of the nonlinear threshold regression model

    International Nuclear Information System (INIS)

    Huang, B.-N.; Hwang, M.J.; Yang, C.W.

    2008-01-01

    This paper separates data extending from 1971 to 2002 into the energy crisis period (1971-1980) and the post-energy crisis period (1981-2000) for 82 countries. The cross-sectional data (yearly averages) in these two periods are used to investigate the nonlinear relationships between energy consumption growth and economic growth when threshold variables are used. If threshold variables are higher than certain optimal threshold levels, there is either no significant relationship or else a significant negative relationship between energy consumption and economic growth. However, when these threshold variables are lower than certain optimal levels, there is a significant positive relationship between the two. In 48 out of the 82 countries studied, none of the four threshold variables is found to be higher than the optimal levels. It is inferred that these 48 countries should adopt a more aggressive energy policy. As for the other 34 countries, at least one threshold variable is higher than the optimal threshold level and thus these countries should adopt energy policies with varying degrees of conservation based on the number of threshold variables that are higher than the optimal threshold levels

  9. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...

  10. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  11. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  12. Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

    DEFF Research Database (Denmark)

    Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

    2014-01-01

    This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

  13. On-site voltage measurement with capacitive sensors on high voltage systems

    NARCIS (Netherlands)

    Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

    2011-01-01

    In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

  14. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    Science.gov (United States)

    2011-11-22

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

  15. Log canonical thresholds of smooth Fano threefolds

    International Nuclear Information System (INIS)

    Cheltsov, Ivan A; Shramov, Konstantin A

    2008-01-01

    The complex singularity exponent is a local invariant of a holomorphic function determined by the integrability of fractional powers of the function. The log canonical thresholds of effective Q-divisors on normal algebraic varieties are algebraic counterparts of complex singularity exponents. For a Fano variety, these invariants have global analogues. In the former case, it is the so-called α-invariant of Tian; in the latter case, it is the global log canonical threshold of the Fano variety, which is the infimum of log canonical thresholds of all effective Q-divisors numerically equivalent to the anticanonical divisor. An appendix to this paper contains a proof that the global log canonical threshold of a smooth Fano variety coincides with its α-invariant of Tian. The purpose of the paper is to compute the global log canonical thresholds of smooth Fano threefolds (altogether, there are 105 deformation families of such threefolds). The global log canonical thresholds are computed for every smooth threefold in 64 deformation families, and the global log canonical thresholds are computed for a general threefold in 20 deformation families. Some bounds for the global log canonical thresholds are computed for 14 deformation families. Appendix A is due to J.-P. Demailly.

  16. Thresholding magnetic resonance images of human brain

    Institute of Scientific and Technical Information of China (English)

    Qing-mao HU; Wieslaw L NOWINSKI

    2005-01-01

    In this paper, methods are proposed and validated to determine low and high thresholds to segment out gray matter and white matter for MR images of different pulse sequences of human brain. First, a two-dimensional reference image is determined to represent the intensity characteristics of the original three-dimensional data. Then a region of interest of the reference image is determined where brain tissues are present. The non-supervised fuzzy c-means clustering is employed to determine: the threshold for obtaining head mask, the low threshold for T2-weighted and PD-weighted images, and the high threshold for T1-weighted, SPGR and FLAIR images. Supervised range-constrained thresholding is employed to determine the low threshold for T1-weighted, SPGR and FLAIR images. Thresholding based on pairs of boundary pixels is proposed to determine the high threshold for T2- and PD-weighted images. Quantification against public data sets with various noise and inhomogeneity levels shows that the proposed methods can yield segmentation robust to noise and intensity inhomogeneity. Qualitatively the proposed methods work well with real clinical data.

  17. Time-efficient multidimensional threshold tracking method

    DEFF Research Database (Denmark)

    Fereczkowski, Michal; Kowalewski, Borys; Dau, Torsten

    2015-01-01

    Traditionally, adaptive methods have been used to reduce the time it takes to estimate psychoacoustic thresholds. However, even with adaptive methods, there are many cases where the testing time is too long to be clinically feasible, particularly when estimating thresholds as a function of anothe...

  18. 40 CFR 68.115 - Threshold determination.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Regulated Substances for Accidental Release Prevention... process exceeds the threshold. (b) For the purposes of determining whether more than a threshold quantity... portion of the process is less than 10 millimeters of mercury (mm Hg), the amount of the substance in the...

  19. Applying Threshold Concepts to Finance Education

    Science.gov (United States)

    Hoadley, Susan; Wood, Leigh N.; Tickle, Leonie; Kyng, Tim

    2016-01-01

    Purpose: The purpose of this paper is to investigate and identify threshold concepts that are the essential conceptual content of finance programmes. Design/Methodology/Approach: Conducted in three stages with finance academics and students, the study uses threshold concepts as both a theoretical framework and a research methodology. Findings: The…

  20. Modeling and Simulation of Low Voltage Arcs

    NARCIS (Netherlands)

    Ghezzi, L.; Balestrero, A.

    2010-01-01

    Modeling and Simulation of Low Voltage Arcs is an attempt to improve the physical understanding, mathematical modeling and numerical simulation of the electric arcs that are found during current interruptions in low voltage circuit breakers. An empirical description is gained by refined electrical

  1. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  2. Time isolation high-voltage impulse generator

    International Nuclear Information System (INIS)

    Chodorow, A.M.

    1975-01-01

    Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation

  3. High-voltage engineering and testing

    CERN Document Server

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  4. Improving transition voltage spectroscopy of molecular junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...

  5. Reducing Ripple In A Switching Voltage Regulator

    Science.gov (United States)

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  6. Wide-range voltage modulation

    International Nuclear Information System (INIS)

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  7. A Novel Quasi-SEPIC High-Voltage Boost DC-DC Converter

    DEFF Research Database (Denmark)

    Siwakoti, Yam Prasad; N. Soltani, Mohsen; Blaabjerg, Frede

    2017-01-01

    This paper proposes a modified coupled-inductor SEPIC dc-dc converter for low power and high voltage gain applications such as for piezoelectric drive systems. The converter uses the same components as of SEPIC converter with an additional diode. Compared to conventional topologies with similar...... voltage gain expression, the proposed topology uses less components to achieve same or even higher voltage gain. This helps to design a very compact and light weight converter with higher power density at lower cost. Due to brevity, the principle of operation, theoretical analysis and comparison supported...

  8. Summary of DOE threshold limits efforts

    International Nuclear Information System (INIS)

    Wickham, L.E.; Smith, C.F.; Cohen, J.J.

    1987-01-01

    The Department of Energy (DOE) has been developing the concept of threshold quantities for use in determining which waste materials may be disposed of as nonradioactive waste in DOE sanitary landfills. Waste above a threshold level could be managed as radioactive or mixed waste (if hazardous chemicals are present); waste below this level would be handled as sanitary waste. After extensive review of a draft threshold guidance document in 1985, a second draft threshold background document was produced in March 1986. The second draft included a preliminary cost-benefit analysis and quality assurance considerations. The review of the second draft has been completed. Final changes to be incorporated include an in-depth cost-benefit analysis of two example sites and recommendations of how to further pursue (i.e. employ) the concept of threshold quantities within the DOE. 3 references

  9. Solution-processed PCDTBT capped low-voltage InGaZnO{sub x} thin film phototransistors for visible-light detection

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Han; Xiao, Yubin; Chen, Zefeng; Xu, Wangying; Long, Mingzhu; Xu, Jian-Bin, E-mail: jbxu@ee.cuhk.edu.hk [Department of Electronic Engineering and Materials Science and Technology Research Center, The Chinese University of Hong Kong, Shatin, N.T., Hong Kong (China)

    2015-06-15

    The effects of visible-light detection based on solution processed poly[N-9′′-hepta-decanyl-2,7-carbazole-alt-5,5-(4′,7′-di-2-thienyl-2′,1′, 3′benzothiadiazole) (PCDTBT) capped InGaZnOx (IGZO) phototransistors with Al{sub 2}O{sub x} serving as gate dielectric are investigated in this paper. The high-k dielectric is used to lower the device operating voltage down to 2 V. Photons emitted from laser sources with the wavelengths (λ) of 532 nm and 635 nm are absorbed through the layer of PCDTBT to generate electron-hole-pairs (EHPs). After the separation of EHPs, electrons are injected into IGZO layer through the p-n junction formed between the IGZO (n-type semiconductor) and the PCDTBT (p-type semiconductor). The photo-generated carriers boost the drain current of the transistors as well as bring about the negative threshold voltage shift. Significant enhanced detection performance is achieved under the laser wavelength of 532 nm. The highest photoresponsivity reaches up to 20 A/W, while the photoresponse rise time comes to 10 ms and the fall time comes to approximate 76 ms, which is much faster than trap assisted IGZO visible light detection. The fabricated phototransistors favor the application of visible-light detectors and/or optical switches.

  10. Differential distribution of voltage-gated channels in myelinated and unmyelinated baroreceptor afferents.

    Science.gov (United States)

    Schild, John H; Kunze, Diana L

    2012-12-24

    Voltage gated ion channels (VGC) make possible the frequency coding of arterial pressure and the neurotransmission of this information along myelinated and unmyelinated fiber pathways. Although many of the same VGC isoforms are expressed in both fiber types, it is the relative expression of each that defines the unique discharge properties of myelinated A-type and unmyelinated C-type baroreceptors. For example, the fast inward Na⁺ current is a major determinant of the action potential threshold and the regenerative transmembrane current needed to sustain repetitive discharge. In A-type baroreceptors the TTX-sensitive Na(v)1.7 VGC contributes to the whole cell Na⁺ current. Na(v)1.7 is expressed at a lower density in C-type neurons and in conjunction with TTX-insensitive Na(v)1.8 and Na(v)1.9 VGC. As a result, action potentials of A-type neurons have firing thresholds that are 15-20 mV more negative and upstroke velocities that are 5-10 times faster than unmyelinated C-type neurons. A more depolarized threshold in conjunction with a broader complement of non-inactivating K(V) VGC subtypes produces C-type action potentials that are 3-4 times longer in duration than A-type neurons and at markedly lower levels of cell excitability. Unmyelinated baroreceptors also express KCa1.1 which provides approximately 25% of the total outward K⁺ current. KCa1.1 plays a critically important role in shaping the action potential profile of C-type neurons and strongly impacts neuronal excitability. A-type neurons do not functionally express the KCa1.1 channel despite having a whole cell Ca(V) current quite similar to that of C-type neurons. As a result, A-type neurons do not have the frequency-dependent braking forces of KCa1.1. Lack of a KCa current and only a limited complement of non-inactivating K(V) VGC in addition to a hyperpolarization activated HCN1 current that is nearly 10 times larger than in C-type neurons leads to elevated levels of discharge in A-type neurons, a

  11. Practical considerations in voltage stability assessment

    Energy Technology Data Exchange (ETDEWEB)

    Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)

    1994-12-31

    This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.

  12. Voltage-assisted polymer wafer bonding

    International Nuclear Information System (INIS)

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  13. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  14. Non-contact current and voltage sensor

    Science.gov (United States)

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  15. Coordinated Voltage Control of Active Distribution Network

    Directory of Open Access Journals (Sweden)

    Xie Jiang

    2016-01-01

    Full Text Available This paper presents a centralized coordinated voltage control method for active distribution network to solve off-limit problem of voltage after incorporation of distributed generation (DG. The proposed method consists of two parts, it coordinated primal-dual interior point method-based voltage regulation schemes of DG reactive powers and capacitors with centralized on-load tap changer (OLTC controlling method which utilizes system’s maximum and minimum voltages, to improve the qualified rate of voltage and reduce the operation numbers of OLTC. The proposed coordination has considered the cost of capacitors. The method is tested using a radial edited IEEE-33 nodes distribution network which is modelled using MATLAB.

  16. Effect of Advanced Plasma Source bias voltage on properties of HfO2 films prepared by plasma ion assisted electron evaporation from metal hafnium

    International Nuclear Information System (INIS)

    Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda

    2013-01-01

    HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V

  17. Evaluation of treatment thresholds for unconjugated hyperbilirubinemia in preterm infants: effects on serum bilirubin and on hearing loss?

    Directory of Open Access Journals (Sweden)

    Christian V Hulzebos

    Full Text Available BACKGROUND: Severe unconjugated hyperbilirubinemia may cause deafness. In the Netherlands, 25% lower total serum bilirubin (TSB treatment thresholds were recently implemented for preterm infants. OBJECTIVE: To determine the rate of hearing loss in jaundiced preterms treated at high or at low TSB thresholds. DESIGN/METHODS: In this retrospective study conducted at two neonatal intensive care units in the Netherlands, we included preterms (gestational age 35 dB. RESULTS: There were 479 patients in the high and 144 in the low threshold group. Both groups had similar gestational ages (29.5 weeks and birth weights (1300 g. Mean and mean peak TSB levels were significantly lower after the implementation of the novel thresholds: 152 ± 43 µmol/L and 212 ± 52 µmol/L versus 131 ± 37 µmol/L and 188 ± 46 µmol/L for the high versus low thresholds, respectively (P<0.001. The incidence of hearing loss was 2.7% (13/479 in the high and 0.7% (1/144 in the low TSB threshold group (NNT = 50, 95% CI, 25-3302. CONCLUSIONS: Implementation of lower treatment thresholds resulted in reduced mean and peak TSB levels. The incidence of hearing impairment in preterms with a gestational age <32 weeks treated at low TSB thresholds was substantially lower compared to preterms treated at high TSB thresholds. Further research with larger sample sizes and power is needed to determine if this effect is statistically significant.

  18. A Threshold Continuum for Aeolian Sand Transport

    Science.gov (United States)

    Swann, C.; Ewing, R. C.; Sherman, D. J.

    2015-12-01

    The threshold of motion for aeolian sand transport marks the initial entrainment of sand particles by the force of the wind. This is typically defined and modeled as a singular wind speed for a given grain size and is based on field and laboratory experimental data. However, the definition of threshold varies significantly between these empirical models, largely because the definition is based on visual-observations of initial grain movement. For example, in his seminal experiments, Bagnold defined threshold of motion when he observed that 100% of the bed was in motion. Others have used 50% and lesser values. Differences in threshold models, in turn, result is large errors in predicting the fluxes associated with sand and dust transport. Here we use a wind tunnel and novel sediment trap to capture the fractions of sand in creep, reptation and saltation at Earth and Mars pressures and show that the threshold of motion for aeolian sand transport is best defined as a continuum in which grains progress through stages defined by the proportion of grains in creep and saltation. We propose the use of scale dependent thresholds modeled by distinct probability distribution functions that differentiate the threshold based on micro to macro scale applications. For example, a geologic timescale application corresponds to a threshold when 100% of the bed in motion whereas a sub-second application corresponds to a threshold when a single particle is set in motion. We provide quantitative measurements (number and mode of particle movement) corresponding to visual observations, percent of bed in motion and degrees of transport intermittency for Earth and Mars. Understanding transport as a continuum provides a basis for revaluating sand transport thresholds on Earth, Mars and Titan.

  19. Atypical Exit Wound in High-Voltage Electrocution.

    Science.gov (United States)

    Parakkattil, Jamshid; Kandasamy, Shanmugam; Das, Siddhartha; Devnath, Gerard Pradeep; Chaudhari, Vinod Ashok; Shaha, Kusa Kumar

    2017-12-01

    Electrocution fatality cases are difficult to investigate. High-voltage electrocution burns resemble burns caused by other sources, especially if the person survives for few days. In that case, circumstantial evidence if correlated with the autopsy findings helps in determining the cause and manner of death. In addition, the crime scene findings also help to explain the pattern of injuries observed at autopsy. A farmer came in contact with a high-voltage transmission wire and sustained superficial to deep burns over his body. A charred and deeply scorched area was seen over the face, which was suggestive of the electric entry wound. The exit wound was present over both feet and lower leg and was atypical in the form of a burnt area of peeled blistered skin, charring, and deep scorching. The injuries were correlated with crime scene findings, and the circumstances that lead to his electrocution are discussed here.

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.