Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Nonlinear current-voltage characteristics of WO3-x nano-/micro-rods

Science.gov (United States)

Shen, Zhenguang; Peng, Zhijian; Zhao, Zengying; Fu, Xiuli

2018-04-01

A series of crystalline tungsten oxide nano-/micro-rods with different compositions of WO3, WO2.90, W19O55 (WO2.89) and W18O49 (WO2.72) but identical morphology feature were first prepared. Then, various nanoscaled electrical devices were fabricated from them by micro-fabrication through a focused ion beam technique. Interestingly, the devices from the oxygen-deficient WO3-x display significantly nonlinear current-voltage characteristics. The calculated nonlinear coefficients of the WO2.90, WO2.83, and WO2.72 varistors are 2.52, 3.32 and 4.91, respectively. The breakdown voltage of the WO2.90, WO2.83, and WO2.72 varistors are 1.93, 1.28 and 0.93 V, respectively. Such WO3-x nano-varistors might be promising for low-voltage electrical/electronic devices.

High voltage transmission lines - what are the hazards

International Nuclear Information System (INIS)

Repacholi, M.H.

1985-01-01

With the increasing use of high voltage alternating current (HVAC) transmission lines there is a growing concern among the public about possible human health effects resulting from exposure to the electric fields associated with these lines. While there is no definitive evidence of such effects, mounting public fear and activism over hypothesized health risks is already causing delays in the licensing and constuction of major power transmission facilities, and is encouraging the formation of regulatory policy. This paper briefly reviews the concerns, biological effects data and standards for HVAC transmission lines

Radio and television interference caused by corona discharges from high-voltage transmission lines

International Nuclear Information System (INIS)

Sarmadi, M.

1996-01-01

Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather

Induced voltages in metallic pipelines near power transmission lines

International Nuclear Information System (INIS)

Grcev, Leonid; Jankov, Voislav; Filiposki, Velimir

2002-01-01

With the continuous development of the electric power system and the pipeline networks used to convey oil or natural gas, cases of close proximity of high voltage structures and metallic pipelines become more and more frequent. Accordingly there is a growing concern about possible hazards resulting from voltages induced in the metallic pipelines by magnetic coupling with nearby power transmission lines. This paper presents a methodology for computation of the induced voltages in buried isolated metallic pipelines. A practical example of computation is also presented. (Author)

Technical and economic aspects of the transmission of energy at extra high voltages

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1967-01-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

Optimizing real power loss and voltage stability limit of a large transmission network using firefly algorithm

Directory of Open Access Journals (Sweden)

P. Balachennaiah

2016-06-01

Full Text Available This paper proposes a Firefly algorithm based technique to optimize the control variables for simultaneous optimization of real power loss and voltage stability limit of the transmission system. Mathematically, this issue can be formulated as nonlinear equality and inequality constrained optimization problem with an objective function integrating both real power loss and voltage stability limit. Transformers taps, unified power flow controller and its parameters have been included as control variables in the problem formulation. The effectiveness of the proposed algorithm has been tested on New England 39-bus system. Simulation results obtained with the proposed algorithm are compared with the real coded genetic algorithm for single objective of real power loss minimization and multi-objective of real power loss minimization and voltage stability limit maximization. Also, a classical optimization method known as interior point successive linear programming technique is considered here to compare the results of firefly algorithm for single objective of real power loss minimization. Simulation results confirm the potentiality of the proposed algorithm in solving optimization problems.

Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

OpenAIRE

Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.

2015-01-01

The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...

A Case Study Of Turkish Transmission System For VoltageDips

DEFF Research Database (Denmark)

Inan, E.; Alboyaci, B.; Bak, Claus Leth

2009-01-01

Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short-duration vo......Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short...... analysis of voltage dip performance of the whole transmission system, is used to compare with results constructed fault statics from SIMPOW DIPS analysis program real data. SIMPOW DIPS software enables to calculate dip frequency for all busses and lines....

Technical and economic evaluation of voltage level in transmission network expansion planning using GA

International Nuclear Information System (INIS)

Jalilzadeh, S.; Kazemi, A.; Shayeghi, H.; Madavi, M.

2008-01-01

Transmission network expansion planning is an important part of power system planning. Its task is to determine an optimal network configuration according to load growth. It determines where, when and how many new transmission lines should be installed. Up to now, various methods have been presented to solve the static transmission network expansion planning (STNEP) problem, but in all of these methods, the STNEP problem has been solved regardless of voltage level of the lines. In this paper, due to different voltage levels in the transmission network, which cause different annual losses, STNEP has been studied considering the voltage level of the transmission lines and the network loss using the genetic algorithm (GA). Finally, the proposed idea has been examined on Garvers 6 bus network. The results show that considering the loss in a network with different voltage levels decreases the operational costs considerably, and the network satisfies the requirement of delivering electric power more safely and reliably to load centers

Concept design of the high voltage transmission system for the collider tunnel

International Nuclear Information System (INIS)

Norman, L.S.

1992-03-01

In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations -- such as the Channel Tunnel -- demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

Concept design of the high-voltage transmission system for the collider tunnel

International Nuclear Information System (INIS)

Norman, L.S.

1992-01-01

In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations-such as the Channel Tunnel-demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

Fractional analysis for nonlinear electrical transmission line and nonlinear Schroedinger equations with incomplete sub-equation

Science.gov (United States)

Fendzi-Donfack, Emmanuel; Nguenang, Jean Pierre; Nana, Laurent

2018-02-01

We use the fractional complex transform with the modified Riemann-Liouville derivative operator to establish the exact and generalized solutions of two fractional partial differential equations. We determine the solutions of fractional nonlinear electrical transmission lines (NETL) and the perturbed nonlinear Schroedinger (NLS) equation with the Kerr law nonlinearity term. The solutions are obtained for the parameters in the range (0<α≤1) of the derivative operator and we found the traditional solutions for the limiting case of α =1. We show that according to the modified Riemann-Liouville derivative, the solutions found can describe physical systems with memory effect, transient effects in electrical systems and nonlinear transmission lines, and other systems such as optical fiber.

Unidirectional transmission in 1D nonlinear photonic crystal based on topological phase reversal by optical nonlinearity

Directory of Open Access Journals (Sweden)

Chong Li

2017-02-01

Full Text Available We propose a scheme of unidirectional transmission in a 1D nonlinear topological photonic crystal based on the topological edge state and three order optical nonlinearity. The 1D photonic crystals consists of a nonlinear photonic crystal L and a linear photonic crystal R. In the backward direction, light is totally reflected for the photons transmission prohibited by the bandgap. While in the forward direction, light interacts with the nonlinear photonic crystal L by optical Kerr effect, bringing a topological phase reversal and results the topological edge mode arising at the interface which could transmit photons through the bandgaps both of the photonic crystal L and R. When the signal power intensity larger than a moderate low threshold value of 10.0 MW/cm2, the transmission contrast ratio could remain at 30 steadily.

Literature Survey on Operational Voltage Control and Reactive Power Management on Transmission and Sub-Transmission Networks

Energy Technology Data Exchange (ETDEWEB)

Elizondo, Marcelo A.; Samaan, Nader A.; Makarov, Yuri V.; Holzer, Jesse T.; Vallem, Mallikarjuna R.; Huang, Renke; Vyakaranam, Bharat GNVSR; Ke, Xinda; Pan, Feng

2017-10-02

Voltage and reactive power system control is generally performed following usual patterns of loads, based on off-line studies for daily and seasonal operations. This practice is currently challenged by the inclusion of distributed renewable generation, such as solar. There has been focus on resolving this problem at the distribution level; however, the transmission and sub-transmission levels have received less attention. This paper provides a literature review of proposed methods and solution approaches to coordinate and optimize voltage control and reactive power management, with an emphasis on applications at transmission and sub-transmission level. The conclusion drawn from the survey is that additional research is needed in the areas of optimizing switch shunt actions and coordinating all available resources to deal with uncertain patterns from increasing distributed renewable generation in the operational time frame. These topics are not deeply explored in the literature.

Study on Control Scheme for the Inverters in Low Voltage Microgrid with Nonlinear Loads

Science.gov (United States)

Xu, Jiqiang; Lu, Wenzhou; Wu, Lei

2017-05-01

There are a lot of nonlinear loads in real low voltage microgrid system. It will cause serious output voltage and grid current harmonic distortions problems in island and grid-connected modes, respectively. To solve this problem, this paper proposes a droop control scheme with quasi-proportion and resonant (quasi-PR) controller based on αβ stationary reference frame to make microgrid smoothly switch between grid-connected and island modes without changing control method. Moreover, in island mode, not only stable output voltage and frequency, but also reduced output voltage harmonics with added nonlinear loads can be achieved; In grid-connected mode, not only constant power, but also reduced grid current harmonics can be achieved. Simulation results verify the effectiveness of the proposed control scheme.

Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

Directory of Open Access Journals (Sweden)

Bulyga Leonid L.

2015-01-01

Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.

High Voltage Power Transmission for Wind Energy

Science.gov (United States)

Kim, Young il

The high wind speeds and wide available area at sea have recently increased the interests on offshore wind farms in the U.S.A. As offshore wind farms become larger and are placed further from the shore, the power transmission to the onshore grid becomes a key feature. Power transmission of the offshore wind farm, in which good wind conditions and a larger installation area than an onshore site are available, requires the use of submarine cable systems. Therefore, an underground power cable system requires unique design and installation challenges not found in the overhead power cable environment. This paper presents analysis about the benefit and drawbacks of three different transmission solutions: HVAC, LCC/VSC HVDC in the grid connecting offshore wind farms and also analyzed the electrical characteristics of underground cables. In particular, loss of HV (High Voltage) subsea power of the transmission cables was evaluated by the Brakelmann's theory, taking into account the distributions of current and temperature.

Voltage adjusting characteristics in terahertz transmission through Fabry-Pérot-based metamaterials

Directory of Open Access Journals (Sweden)

Jun Luo

2015-10-01

Full Text Available Metallic electric split-ring resonators (SRRs with featured size in micrometer scale, which are connected by thin metal wires, are patterned to form a periodically distributed planar array. The arrayed metallic SRRs are fabricated on an n-doped gallium arsenide (n-GaAs layer grown directly over a semi-insulating gallium arsenide (SI-GaAs wafer. The patterned metal microstructures and n-GaAs layer construct a Schottky diode, which can support an external voltage applied to modify the device properties. The developed architectures present typical functional metamaterial characters, and thus is proposed to reveal voltage adjusting characteristics in the transmission of terahertz waves at normal incidence. We also demonstrate the terahertz transmission characteristics of the voltage controlled Fabry-Pérot-based metamaterial device, which is composed of arrayed metallic SRRs. To date, many metamaterials developed in earlier works have been used to regulate the transmission amplitude or phase at specific frequencies in terahertz wavelength range, which are mainly dominated by the inductance-capacitance (LC resonance mechanism. However, in our work, the external voltage controlled metamaterial device is developed, and the extraordinary transmission regulation characteristics based on both the Fabry-Pérot (FP resonance and relatively weak surface plasmon polariton (SPP resonance in 0.025-1.5 THz range, are presented. Our research therefore shows a potential application of the dual-mode-resonance-based metamaterial for improving terahertz transmission regulation.

Voltage control in the future power transmission systems

DEFF Research Database (Denmark)

Qin, Nan

Wind energy in Denmark covers 42% of the total power consumption in 2015, and will share up to 50% by 2020. Consequently, the conventional power plants are decommissioning. Under the progress of the green transition, the national decision leads to underground many overhead lines in the future...... stages. The voltage uncertainty caused by the wind power forecasting errors is estimated, which is applied as a voltage security margin to further constrain the voltage magnitude in the optimization problem. The problem under the uncertainty is therefore converted to a deterministic problem, which...... to ensure a highly reliable transmission, e.g. balancing the generation and the consumption in large geographic regions, the exchange capacities will be enlarged by upgrading the interconnections. The Danish power system, the electricity transportation hub between the Nordic and continental European systems...

Explanation of the Inverse Doppler Effect Observed in Nonlinear Transmission Lines

International Nuclear Information System (INIS)

Kozyrev, Alexander B.; Weide, Daniel W. van der

2005-01-01

The theory of the inverse Doppler effect recently observed in magnetic nonlinear transmission lines is developed. We explain the crucial role of the backward spatial harmonic in the occurrence of an inverse Doppler effect and draw analogies of the magnetic nonlinear transmission line to the backward wave oscillator

Nonlinear left-handed transmission line metamaterials

International Nuclear Information System (INIS)

Kozyrev, A B; Weide, D W van der

2008-01-01

Metamaterials, exhibiting simultaneously negative permittivity ε and permeability μ, more commonly referred to as left-handed metamaterials (LHMs) and also known as negative-index materials, have received substantial attention in the scientific and engineering communities [1]. Most studies of LHMs (and electromagnetic metamaterials in general) have been in the linear regime of wave propagation and have already inspired new types of microwave circuits and devices. The results of these studies have already been the subject of numerous reviews and books. This review covers a less explored but rapidly developing area of investigation involving media that combine nonlinearity (dependence of the permittivity and permeability on the magnitude of the propagating field) with the anomalous dispersion exhibited by LHM. The nonlinear phenomena in such media will be considered on the example of a model system: the nonlinear left-handed transmission line. These nonlinear phenomena include parametric generation and amplification, harmonic and subharmonic generation as well as modulational instabilities and envelope solitons. (topical review)

Distance protection of multiple-circuit shared tower transmission lines with different voltages

DEFF Research Database (Denmark)

Silva, Filipe Miguel Faria da; Bak, Claus Leth

2017-01-01

Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...

Time-Domain Voltage Sag State Estimation Based on the Unscented Kalman Filter for Power Systems with Nonlinear Components

Directory of Open Access Journals (Sweden)

Rafael Cisneros-Magaña

2018-06-01

Full Text Available This paper proposes a time-domain methodology based on the unscented Kalman filter to estimate voltage sags and their characteristics, such as magnitude and duration in power systems represented by nonlinear models. Partial and noisy measurements from the electrical network with nonlinear loads, used as data, are assumed. The characteristics of voltage sags can be calculated in a discrete form with the unscented Kalman filter to estimate all the busbar voltages; being possible to determine the rms voltage magnitude and the voltage sag starting and ending time, respectively. Voltage sag state estimation results can be used to obtain the power quality indices for monitored and unmonitored busbars in the power grid and to design adequate mitigating techniques. The proposed methodology is successfully validated against the results obtained with the time-domain system simulation for the power system with nonlinear components, being the normalized root mean square error less than 3%.

Nonlinear current-voltage behavior in PZT thin films

Energy Technology Data Exchange (ETDEWEB)

Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)

2017-05-15

In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)

The design, construction, and operation of long-distance high-voltage electricity transmission technologies.

Energy Technology Data Exchange (ETDEWEB)

Molburg, J. C.; Kavicky, J. A.; Picel, K. C.

2008-03-03

This report focuses on transmission lines, which operate at voltages of 115 kV and higher. Currently, the highest voltage lines comprising the North American power grid are at 765 kV. The grid is the network of transmission lines that interconnect most large power plants on the North American continent. One transmission line at this high voltage was built near Chicago as part of the interconnection for three large nuclear power plants southwest of the city. Lines at this voltage also serve markets in New York and New England, also very high demand regions. The large power transfers along the West Coast are generally at 230 or 500 kV. Just as there are practical limits to centralization of power production, there are practical limits to increasing line voltage. As voltage increases, the height of the supporting towers, the size of the insulators, the distance between conductors on a tower, and even the width of the right-of-way (ROW) required increase. These design features safely isolate the electric power, which has an increasing tendency to arc to ground as the voltage (or electrical potential) increases. In addition, very high voltages (345 kV and above) are subject to corona losses. These losses are a result of ionization of the atmosphere, and can amount to several megawatts of wasted power. Furthermore, they are a local nuisance to radio transmission and can produce a noticeable hum. Centralized power production has advantages of economies of scale and special resource availability (for instance, hydro resources), but centralized power requires long-distance transfers of power both to reach customers and to provide interconnections for reliability. Long distances are most economically served at high voltages, which require large-scale equipment and impose a substantial footprint on the corridors through which power passes. The most visible components of the transmission system are the conductors that provide paths for the power and the towers that keep these

New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

Energy Technology Data Exchange (ETDEWEB)

Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B. [Groupe de Recherche en Electronique et en Electrotechnique de Nancy - INPL - Nancy Universite, 2, Avenue de la Foret de Haye, 54516 Vandoeuvre-les-Nancy Cedex (France)

2010-01-15

In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control. (author)

New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

International Nuclear Information System (INIS)

Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.

2010-01-01

In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.

Analytical study for the ability of nonlinear transmission lines to generate solitons

International Nuclear Information System (INIS)

Mostafa, S.I.

2009-01-01

The ability of the nonlinear transmission lines (NLTL) has been studied analytically, in this paper to generate solitons and to cause waveform spreading. This can be achieved by balancing nonlinearity and dispersion. A new technique of improved tanh method (ITM) and improved sech methods (ISM) is applied to the nonlinear partial differential equation that describes the NLTL. It is found that the parameters of the transmission line play an important role in controlling the shape of the soliton.

Co-operation of digital nonlinear equalizers and soft-decision LDPC FEC in nonlinear transmission.

Science.gov (United States)

Tanimura, Takahito; Oda, Shoichiro; Hoshida, Takeshi; Aoki, Yasuhiko; Tao, Zhenning; Rasmussen, Jens C

2013-12-30

We experimentally and numerically investigated the characteristics of 128 Gb/s dual polarization - quadrature phase shift keying signals received with two types of nonlinear equalizers (NLEs) followed by soft-decision (SD) low-density parity-check (LDPC) forward error correction (FEC). Successful co-operation among SD-FEC and NLEs over various nonlinear transmissions were demonstrated by optimization of parameters for NLEs.

Calculation of Voltages in Electric Power Transmission Lines During Historic Geomagnetic Storms: An Investigation Using Realistic Earth Impedances

Science.gov (United States)

Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

2018-02-01

Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

DEFF Research Database (Denmark)

Liu, Chengxi; Qin, Nan; Bak, Claus Leth

2015-01-01

This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

Effect of Nonlinearity by the Amplitude Variation in coherent transmission in Laser Heterodyne Interferometric

International Nuclear Information System (INIS)

Chen, H F; Ding, X M; Zhong, Z; Xie, Z L; Yue, H

2006-01-01

To reduce the nonlinearity of nanometer measurement in laser heterodyne interferometric, the influence mechanics of the amplitude variation in coherent transmission upon nonlinearity must be confirmed. Based on the mechanics of nonlinearity, the models about how first-harmonic and second-harmonic nonlinearity caused by the amplitude variation in coherent transmission are proposed. The emulation result shows that different amplitude between measurement arm and reference arm increases the first-harmonic nonlinearity when laser beams nonorthogonality errors exist, but it doesn't change the relationship between nonlinearity and half wavelength. When the rotation angle error β of polarizing beam splitter (PBS) exists, amplitude variation only affects the first-harmonic nonlinearity. With a constant rotation angle of PBS β = 4 0 , when the amplitude factor of measurement arm reduces from 1 to 0.6, the nonlinearity increases from 0.25 nm to 3.81 nm, and the nonlinearity is simple superposition of first-harmonic and second-harmonic. Theoretic analysis and emulation show that the reduction of amplitude variation in coherent transmission can reduce influence on nonlinearity

Polynomially decaying transmission for the nonlinear schrodinger equation in a random medium

International Nuclear Information System (INIS)

Devillard, P.; Sovillard, B.

1986-01-01

This is the first study of one the transmission problems associate to the nonlinear Schrodinger equation with a random potential. We show that for almost every realization of the medium the rate of transmission vanishes when increasing the size of the medium; however, whereas it decays exponentially in the linear regime, it decays polynomially in the nonlinear one

Distributed Nonlinear Control with Event-Triggered Communication to Achieve Current-Sharing and Voltage Regulation in DC Microgrids

DEFF Research Database (Denmark)

Han, Renke; Meng, Lexuan; Guerrero, Josep M.

2018-01-01

combining the state-dependent tolerance with a nonnegative offset. In order to design the event-triggered principle and guarantee the global stability, a generalized dc microgrid model is proposed and proven to be positive definite, based on which Lyapunov-based approach is applied. Furthermore, considering......A distributed nonlinear controller is presented to achieve both accurate current-sharing and voltage regulation simultaneously in dc microgrids considering different line impedances’ effects among converters. Then, an improved event-triggered principle for the controller is introduced through...... for precise real-time information transmission, without sacrificing system performance. Experimental results obtained from a dc microgrid setup show the robustness of the new proposal under normal, communication failure, communication delay and plug-and-play operation conditions. Finally, communication...

Calculation of voltages in electric power transmission lines during historic geomagnetic storms: An investigation using realistic earth impedances

Science.gov (United States)

Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

2018-01-01

Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

Proximity effects of high voltage electric power transmission lines on ...

African Journals Online (AJOL)

The proximity effects of high voltage electric power transmission lines on Leyland Cypress (xCupressocyparis leylandii (Dallim. and A.B. Jacks.) Dallim) and Japanese Privet (Ligustrum japonicum Thunb.) growth were examined in a private nursery located in Sakarya, Turkey. Five transect were randomly chosen in both ...

Marine High Voltage Power Conditioning and Transmission System with Integrated Storage DE-EE0003640 Final Report

Energy Technology Data Exchange (ETDEWEB)

Frank Hoffmann, PhD; Aspinall, Rik

2012-12-10

Design, Development, and test of the three-port power converter for marine hydrokinetic power transmission. Converter provides ports for AC/DC conversion of hydrokinetic power, battery storage, and a low voltage to high voltage DC port for HVDC transmission to shore. The report covers the design, development, implementation, and testing of a prototype built by PPS.

Experimental investigation of alternative transmission functions: Quantitative evidence for the importance of nonlinear transmission dynamics in host-parasite systems.

Science.gov (United States)

Orlofske, Sarah A; Flaxman, Samuel M; Joseph, Maxwell B; Fenton, Andy; Melbourne, Brett A; Johnson, Pieter T J

2018-05-01

Understanding pathogen transmission is crucial for predicting and managing disease. Nonetheless, experimental comparisons of alternative functional forms of transmission remain rare, and those experiments that are conducted are often not designed to test the full range of possible forms. To differentiate among 10 candidate transmission functions, we used a novel experimental design in which we independently varied four factors-duration of exposure, numbers of parasites, numbers of hosts and parasite density-in laboratory infection experiments. We used interactions between amphibian hosts and trematode parasites as a model system and all candidate models incorporated parasite depletion. An additional manipulation involving anaesthesia addressed the effects of host behaviour on transmission form. Across all experiments, nonlinear transmission forms involving either a power law or a negative binomial function were the best-fitting models and consistently outperformed the linear density-dependent and density-independent functions. By testing previously published data for two other host-macroparasite systems, we also found support for the same nonlinear transmission forms. Although manipulations of parasite density are common in transmission studies, the comprehensive set of variables tested in our experiments revealed that variation in density alone was least likely to differentiate among competing transmission functions. Across host-pathogen systems, nonlinear functions may often more accurately represent transmission dynamics and thus provide more realistic predictions for infection. © 2017 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

Science.gov (United States)

Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

2015-12-30

A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

Offshore wind power plants with VSC-HVDC transmission : Grid code compliance optimization and the effect on high voltage ac transmission system

NARCIS (Netherlands)

Ndreko, M.

2017-01-01

The development of large offshore wind power generation in the North Sea has been significantly accelerated in the last years. The large distance from shore in combination with the need for large transmission capacity has raised the interest for the voltage source converter high voltage direct

Chameleon's behavior of modulable nonlinear electrical transmission line

Science.gov (United States)

Togueu Motcheyo, A. B.; Tchinang Tchameu, J. D.; Fewo, S. I.; Tchawoua, C.; Kofane, T. C.

2017-12-01

We show that modulable discrete nonlinear transmission line can adopt Chameleon's behavior due to the fact that, without changing its appearance structure, it can become alternatively purely right or left handed line which is different to the composite one. Using a quasidiscrete approximation, we derive a nonlinear Schrödinger equation, that predicts accurately the carrier frequency threshold from the linear analysis. It appears that the increasing of the linear capacitor in parallel in the series branch induced the selectivity of the filter in the right-handed region while it increases band pass filter in the left-handed region. Numerical simulations of the nonlinear model confirm the forward wave in the right handed line and the backward wave in the left handed one.

Determinants of Rotavirus Transmission: A Lag Nonlinear Time Series Analysis.

Science.gov (United States)

van Gaalen, Rolina D; van de Kassteele, Jan; Hahné, Susan J M; Bruijning-Verhagen, Patricia; Wallinga, Jacco

2017-07-01

Rotavirus is a common viral infection among young children. As in many countries, the infection dynamics of rotavirus in the Netherlands are characterized by an annual winter peak, which was notably low in 2014. Previous study suggested an association between weather factors and both rotavirus transmission and incidence. From epidemic theory, we know that the proportion of susceptible individuals can affect disease transmission. We investigated how these factors are associated with rotavirus transmission in the Netherlands, and their impact on rotavirus transmission in 2014. We used available data on birth rates and rotavirus laboratory reports to estimate rotavirus transmission and the proportion of individuals susceptible to primary infection. Weather data were directly available from a central meteorological station. We developed an approach for detecting determinants of seasonal rotavirus transmission by assessing nonlinear, delayed associations between each factor and rotavirus transmission. We explored relationships by applying a distributed lag nonlinear regression model with seasonal terms. We corrected for residual serial correlation using autoregressive moving average errors. We inferred the relationship between different factors and the effective reproduction number from the most parsimonious model with low residual autocorrelation. Higher proportions of susceptible individuals and lower temperatures were associated with increases in rotavirus transmission. For 2014, our findings suggest that relatively mild temperatures combined with the low proportion of susceptible individuals contributed to lower rotavirus transmission in the Netherlands. However, our model, which overestimated the magnitude of the peak, suggested that other factors were likely instrumental in reducing the incidence that year.

Voltage Analysis Improvement of 150 kV Transmission Subsystem Using Static Synchronous Compensator (STATCOM)

Science.gov (United States)

Akbar, P. A.; Hakim, D. L.; Sucita, T.

2018-02-01

In this research, testing improvements to the distribution voltage electricity at 150 kV transmission subsystem Bandung Selatan and New Ujungberung using Flexible AC Transmission System (FACTS) technology. One of them is by doing the control of active and reactive power through the power electronics equipment Static Synchronous Compensator (STATCOM). The subsystem is tested because it has a voltage profile are relatively less well when based on the IEEE / ANSI C.84.1 (142.5 - 157.5 kV). This study was conducted by analyzing the Newton-Raphson power flow on the simulator DigSilent Power Factory 15 to determine the profile of the voltage (V) on the system. Bus which has the lowest voltage to be a reference in the installation of STATCOM. From this research is known that the voltage on the conditions of the existing bus 28, as many as 21-23 still below standard buses (142.5 kV), after the installation is done using STATCOM, voltage on the buses improved by increasing the number of tracks that follow the standard / is in the range 142.5 kV -157.5 kV as many as 23-27 buses or 78.6% - 96%, with the optimum mounting on a bus Rancaekek STATCOM II with a capacity of 300 MVA.

Nonlinear Seismic Behavior of Different Boundary Conditions of Transmission Line Systems under Earthquake Loading

Directory of Open Access Journals (Sweden)

Li Tian

2016-01-01

Full Text Available Nonlinear seismic behaviors of different boundary conditions of transmission line system under earthquake loading are investigated in this paper. The transmission lines are modeled by cable element accounting for the nonlinearity of the cable. For the suspension type, three towers and two span lines with spring model (Model 1 and three towers and four span lines’ model (Model 2 are established, respectively. For the tension type, three towers and two span lines’ model (Model 3 and three towers and four span lines’ model (Model 4 are created, respectively. The frequencies of the transmission towers and transmission lines of the suspension type and tension type are calculated, respectively. The responses of the suspension type and tension type are investigated using nonlinear time history analysis method, respectively. The results show that the responses of the transmission tower and transmission line of the two models of the suspension type are slightly different. However, the responses of transmission tower and transmission line of the two models of the tension type are significantly different. Therefore, in order to obtain accurate results, a reasonable model should be considered. The results could provide a reference for the seismic analysis of the transmission tower-line system.

Method and system for a gas tube switch-based voltage source high voltage direct current transmission system

Science.gov (United States)

She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William

2016-12-13

A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.

Non-Linear Transmission Line (NLTL) Microwave Source Lecture Notes the United States Particle Accelerator School

Energy Technology Data Exchange (ETDEWEB)

Russell, Steven J. [Los Alamos National Laboratory; Carlsten, Bruce E. [Los Alamos National Laboratory

2012-06-26

We will quickly go through the history of the non-linear transmission lines (NLTLs). We will describe how they work, how they are modeled and how they are designed. Note that the field of high power, NLTL microwave sources is still under development, so this is just a snap shot of their current state. Topics discussed are: (1) Introduction to solitons and the KdV equation; (2) The lumped element non-linear transmission line; (3) Solution of the KdV equation; (4) Non-linear transmission lines at microwave frequencies; (5) Numerical methods for NLTL analysis; (6) Unipolar versus bipolar input; (7) High power NLTL pioneers; (8) Resistive versus reactive load; (9) Non-lineaer dielectrics; and (10) Effect of losses.

Distance protection of multiple-circuit shared tower transmission lines with different voltages

DEFF Research Database (Denmark)

Silva, Filipe Miguel Faria da; Bak, Claus Leth

2017-01-01

combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...

High Power, Pulsed, RF Generation from Nonlinear Lumped Element Transmission Lines (NLETLs)

Science.gov (United States)

2011-02-05

in order to focus on the primary technology tinder consideration. Their practicality at very high powers and frequencies is questionable due to...also possessed suitably large CXL ratios. Measuring capacitive nonlinearity tinder high voltage proved to be more tricky than first imagi- ned

System for Relay Protection Command Transmission by High-Voltage Lines

Directory of Open Access Journals (Sweden)

D. A. Yenkov

2009-01-01

Full Text Available Development of a system for relay protection command transmission by high-voltage lines is shown in the paper. The paper describes an architecture of the system, main principles of its operation, engineering aspects of the development that is accomplishment of technical requirements, solution of trades-off. Justification of the selected design and an algorithm of the reliable detection of relay protection signals are given in the paper.

Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

Science.gov (United States)

Fernandez, Fernando R.; Malerba, Paola; White, John A.

2015-01-01

The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

Protection relay of phase-shifting device with thyristor switch for high voltage power transmission lines

Science.gov (United States)

Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.

2014-12-01

Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.

Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission

Energy Technology Data Exchange (ETDEWEB)

1977-11-01

For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.

Nonlinear force feedback control of piezoelectric-hydraulic pump actuator for automotive transmission shift control

Science.gov (United States)

Kim, Gi-Woo; Wang, K. W.

2008-03-01

In recent years, researchers have investigated the feasibility of utilizing piezoelectric-hydraulic pump based actuation systems for automotive transmission controls. This new concept could eventually reduce the complexity, weight, and fuel consumption of the current transmissions. In this research, we focus on how to utilize this new approach on the shift control of automatic transmissions (AT), which generally requires pressure profiling for friction elements during the operation. To illustrate the concept, we will consider the 1--> 2 up shift control using band brake friction elements. In order to perform the actuation force tracking for AT shift control, nonlinear force feedback control laws are designed based on the sliding mode theory for the given nonlinear system. This paper will describe the modeling of the band brake actuation system, the design of the nonlinear force feedback controller, and simulation and experimental results for demonstration of the new concept.

New schemes for high-voltage pulsed generators based on stepped transmission lines

International Nuclear Information System (INIS)

Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

1993-01-01

Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

Multilayered Functional Insulation System (MFIS) for AC Power Transmission in High Voltage Hybrid Electrical Propulsion

Science.gov (United States)

Lizcano, Maricela

2017-01-01

High voltage hybrid electric propulsion systems are now pushing new technology development efforts for air transportation. A key challenge in hybrid electric aircraft is safe high voltage distribution and transmission of megawatts of power (>20 MW). For the past two years, a multidisciplinary materials research team at NASA Glenn Research Center has investigated the feasibility of distributing high voltage power on future hybrid electric aircraft. This presentation describes the team's approach to addressing this challenge, significant technical findings, and next steps in GRC's materials research effort for MW power distribution on aircraft.

Market Report : The high-voltage transmission market in Poland

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-06-01

In order to meet the accession requirements for membership to the European Union, Poland is currently restructuring its energy sector, and the initiative to privatise the electric power industry to full competition by 2005 is on course. This report describes the opportunities for foreign investors and suppliers of electrical equipment and services, particularly at this time when power demand is growing, the power grid infrastructure is ageing and obsolete components must be replaced. The total installed capacity in Poland is about 33,000 megawatts. This includes all installations of power plants and combined heat and power plants. An investment of $23 billion is anticipated by 2010 in order to modernize the electricity power industry and to meet the growing energy demand. Polski Siece Elektroenergetyczne, S.A. (PSE) is the state-owned company which controls Poland's high-voltage transmission grid. It operates a 220 kilovolt and 40 kV grid and holds the monopoly on acquiring and transmitting electricity in the country. Poland maintains grid interconnections with several other European countries and is looking to expand its network. Opportunities for Canadian suppliers lie in the areas of high-voltage power transmission equipment and services. Other opportunities lie in commercial prospects in sales of equipment and services. The report includes a section on international competition, and the Canadian position for both private- and public-sector companies. A section on market logistics describes distribution channels, market-entry considerations, import regulations, and export credit risks. A list of key contacts and support services is included with this report. refs., tabs.

Experimental observation on asymmetric energy flux within the forbidden frequency band in the LC transmission line

International Nuclear Information System (INIS)

Tao Feng; Chen Weizhong; Pan Junting; Xu Wen; Du Sidan

2012-01-01

We study the energy flux in a nonlinear electrical transmission line consisting of two coupled segments which are identical in structure and different in parameters. The asymmetry of energy flux caused by nonlinear wave has been observed experimentally in the forbidden band of the line. The experiment shows whether the energy can flow through the transmission line depends on the amplitude of the boundary driving voltages, which can be well explained in the theoretical framework of nonlinear supratransmission. The numerical simulation based on Kirchhoff’s laws further verifies the existence of the asymmetric energy flux in the forbidden band.

Interactions Between Indirect DC-Voltage Estimation and Circulating Current Controllers of MMC-Based HVDC Transmission Systems

DEFF Research Database (Denmark)

Wickramasinghe, Harith R.; Konstantinou, Georgios; Pou, Josep

2018-01-01

Estimation-based indirect dc-voltage control in MMCs interacts with circulating current control methods. This paper proposes an estimation-based indirect dc-voltage control method for MMC-HVDC systems and analyzes its performance compared to alternative estimations. The interactions between......-state and transient performance is demonstrated using a benchmark MMC-HVDC transmission system, implemented in a real-time digital simulator. The results verify the theoretical evaluations and illustrate the operation and performance of the proposed indirect dc-voltage control method....

Automatic Voltage Control (AVC) of Danish Transmission System - Concept design

DEFF Research Database (Denmark)

Qin, Nan; Abildgaard, Hans; Lund, P.

2014-01-01

For more than 20 years it has been a consistent plan by all Danish governments to turn the Danish power production away from fossil fuels towards renewable energy. The result today is that 37% of the total Danish power consumption was covered by mainly wind energy in 2013 aiming at 50% by 2020......, objectives, constraints, algorithms for optimal power flow and some special functions in particular systems, which inspires the concept design of a Danish AVC system to address the future challenges of voltage control. In the concept, the Danish AVC design is based on a centralized control scheme. All...... the substation loses the telecommunications to the control center. RPCs will be integrated to the AVC system as normative regulators in the later stage. Distributed generation units can be organized as virtual power plants and participate in voltage control at transmission level. Energinet.dk as the Danish TSO...

Hybrid AC-High Voltage DC Grid Stability and Controls

Science.gov (United States)

Yu, Jicheng

The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient

Impact of distributed generators on the power loss and voltage profile of sub-transmission network

Directory of Open Access Journals (Sweden)

A.S.O. Ogunjuyigbe

2016-05-01

Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

Broadband microwave frequency doubler based on left-handed nonlinear transmission lines

International Nuclear Information System (INIS)

Huang Jie; Gu Wenwen; Zhao Qian

2017-01-01

A bandwidth microwave second harmonic generator is successfully designed using composite right/left-handed nonlinear transmission lines (CRLH NLTLs) in a GaAs monolithic microwave integrated circuit (MMIC) technology. The structure parameters of CRLH NLTLs, e.g. host transmission line, rectangular spiral inductor, and nonlinear capacitor, have a great impact on the second harmonic performance enhancement in terms of second harmonic frequency, output power, and conversion efficiency. It has been experimentally demonstrated that the second harmonic frequency is determined by the anomalous dispersion of CRLH NLTLs and can be significantly improved by effectively adjusting these structure parameters. A good agreement between the measured and simulated second harmonic performances of Ka-band CRLH NLTLs frequency multipliers is successfully achieved, which further validates the design approach of frequency multipliers on CRLH NLTLs and indicates the potentials of CRLH NLTLs in terms of the generation of microwave and millimeter-wave signal source. (paper)

A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

DEFF Research Database (Denmark)

Xu, Fengda; Guo, Qinglai; Sun, Hongbin

2015-01-01

For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

High-voltage isolation transformer for sub-nanosecond rise time pulses constructed with annular parallel-strip transmission lines.

Science.gov (United States)

Homma, Akira

2011-07-01

A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.

Improved transmission of electrostatic accelerator in a wide range of terminal voltages by controlling the focal strength of entrance acceleration tube

Science.gov (United States)

Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter

2018-04-01

Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.

Some problems relating to the transmission of electrical power at very high voltage

Energy Technology Data Exchange (ETDEWEB)

Goldstein, A

1965-01-01

Some of the technical and economic factors which influence the choice of a transmission system, particularly a very high voltage one, are discussed. The stability of transmission overvoltages at mains frequency and their control by means of compensating reactances is described. Overvoltages due to circuit-breaker operation and those of atmospheric origin, and appropriate protective devices, the behaviour of equipment at 750 kV, and problems of testing are included. Finally, the 735 kV network now being installed to carry 5300 MW of hydroelectric power 650 km from the Manicouagan River to Quebec and Montreal is described.

Performance Analysis of a Voltage Source Converter (VSC based HVDC Transmission System under Faulted Conditions

Directory of Open Access Journals (Sweden)

Amiri RABIE

2009-12-01

Full Text Available Voltage Source Converter (VSC based HVDC transmission technology hasbeen selected as the basis for several recent projects due to its controllability,compact modular design, ease of system interface, and low environmentalimpact. This paper investigates the dynamic performance of a 200MW,±100kV VSC-HVDC transmission system under some faulted conditionsusing MATLAB/Simulink. Simulation results confirm the satisfactoryperformance of the proposed system under active and reactive powervariations and fault conditions.

Image statistics and nonlinear artifacts in composed transmission x-ray tomography

International Nuclear Information System (INIS)

Duerinckx, A.J.G.

1979-01-01

Knowledge of the image quality and image statistics in Computed Tomography (CT) images obtained with transmission x-ray CT scanners can increase the amount of clinically useful information that can be retrieved. Artifacts caused by nonlinear shadows are strongly object-dependent and are visible over larger areas of the image. No simple technique exists for their complete elimination. One source of artifacts in the first order statistics is the nonlinearities in the measured shadow or projection data used to reconstruct the image. One of the leading causes is the polychromaticity of the x-ray beam used in transmission CT scanners. Ways to improve the resulting image quality and techniques to extract additional information using dual energy scanning are discussed. A unique formalism consisting of a vector representation of the material dependence of the photon-tissue interactions is generalized to allow an in depth analysis. Poly-correction algorithms are compared using this analytic approach. Both quantum and detector electronic noise decrease the quality or information content of first order statistics. Preliminary results are presented using an heuristic adaptive nonlinear noise filter system for projection data. This filter system can be improved and/or modified to remove artifacts in both first and second order image statistics. Artifacts in the second order image statistics arise from the contribution of quantum noise. This can be described with a nonlinear detection equivalent model, similar to the model used to study artifacts in first order statistics. When analyzing these artifacts in second order statistics, one can divide them into linear artifacts, which do not present any problem of interpretation, and nonlinear artifacts, referred to as noise artifacts. A study of noise artifacts is presented together with a discussion of their relative importance in diagnostic radiology

Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission

Energy Technology Data Exchange (ETDEWEB)

Myhre, Joergen Chr.

2001-07-01

This study was initiated to investigate if it could be feasible to supply offshore oil installations in the North Sea with electrical power from land. A prestudy of alternative converter topologies indicated that the most promising solution would be to investigate a conventional system with reduced synchronous compensator rating. The study starts with a summary of the state of power supply to offshore installations today, and a short review of classical HVDC transmission. It goes on to analyse how a passive network without sources influences the inverter. The transmission, with its current controlled rectifier and large inductance, is simulated as a current source. Under these circumstances the analysis shows that the network frequency has to adapt in order to keep the active and reactive power balance until the controllers are able to react. The concept of firing angle for a thyristor is limited in a system with variable frequency, the actual control parameter is the firing delay time. Sensitivity analysis showed some astonishing consequences. The frequency rises both by an increase in the active and in the reactive load. The voltage falls by an increase in the active load, but rises by an increase in the inductive load. Two different control principles for the system of inverter, synchronous compensator and load are defined. The first takes the reference for the firing delay time from the fundamental voltage at the point of common coupling. The second takes the reference for the firing delay time from the simulated EMF of the synchronous compensator. Of these, the second is the more stable and should be chosen as the basis for a possible control system. Two simulation tools are applied. The first is a quasi-phasor model running on Matlab with Simulink. The other is a time domain model in KREAN. The time domain model is primarily used for the verification of the quasi-phasor model, and shows that quasi-phasors is still a valuable tool for making a quick analysis

A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

Directory of Open Access Journals (Sweden)

Yufei Teng

2017-03-01

Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

DGA-based VAR rescheduling for transmission loss reduction

Energy Technology Data Exchange (ETDEWEB)

Mishra, S. [Indian Inst. of Technology, Delhi (India); Taylor, G.A. [Brunel Univ., London (United Kingdom). Brunel Inst. of Power Systems; Reddy, J.B.V. [Government of India, New Delhi (India). Dept. of Science and Technology; Naeem, M.H. [Multimedia Univ. (Malaysia). Faculty of Engineering

2009-07-01

Power losses in power transmission lines can be minimized by adjusting transformer taps and switchable VAR sources. Optimal power flow (OPF) is a static, nonlinear, multi-objective optimization challenge in which the optimal settings of control variables must be determined for minimizing the cost of generation, emissions, transmission losses and voltage and power flow deviations. OPF is important in power system operation because a small savings per hour can mean a large annual savings. This paper presented a method to reduce transmission power losses using a Differential Genetic Algorithm (DGA) for VAR rescheduling. The New England 39-bus power system was used as a test case. Power losses were minimized by changing the tap settings of various transformers and by varying the injected reactive power. The paper showed that certain buses in the system can improve the voltage profile and reduce transmission losses through reactive power injections from capacitor banks. In this study, minimum reactive power output of generators was maintained at zero to ensure that the generators did not draw reactive power. The DGA was shown to produce better results than the Conventional Genetic Algorithm in terms of power loss minimization. 12 refs., 1 tab., 2 figs.

EAM-based high-speed 100-km OFDM transmission featuring tolerant modulator operation enabled using SSII cancellation.

Science.gov (United States)

Chen, Hsing-Yu; Wei, Chia-Chien; Lu, I-Cheng; Chen, Yu-Chao; Chu, Hsuan-Hao; Chen, Jyehong

2014-06-16

In this study, a technique was developed to compensate for nonlinear distortion through cancelling subcarrier-to-subcarrier intermixing interference (SSII) in an electroabsorption modulator (EAM)-based orthogonal frequency-division multiplexing (OFDM) transmission system. The nonlinear distortion to be compensated for is induced by both EAM nonlinearity and fiber dispersion. Because an OFDM signal features an inherently high peak-to-average power ratio, a trade-off exists between the optical modulation index (OMI) and modulator nonlinearity. Therefore, the nonlinear distortion limits the operational tolerance of the bias voltage and the driving power to a small region. After applying the proposed SSII cancellation, the OMI of an OFDM signal was increased yielding only a small increment of nonlinear distortion, and the tolerance region of the operational conditions was also increased. By employing the proposed scheme, this study successfully demonstrates 50-Gbps OFDM transmission over 100-km dispersion-uncompensated single-mode fiber based on a single 10-GHz EAM.

METHODICAL APPROACHES TO THE CHOICE OF THE NEW GENERATION OF HIGH-VOLTAGE POWER TRANSMISSION LINE 220 kV OPTIONS

Directory of Open Access Journals (Sweden)

POSTOLATI V.M.

2010-08-01

Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

Manitoba Hydro long-term high-voltage transmission line magnetic field monitoring project

International Nuclear Information System (INIS)

Wong, P.S.; Ng, C.K.

2008-01-01

As part of the licensing process to construct a new 230 kV transmission line on an existing right-of-way in Manitoba, an electrical effects study was conducted in 1998. The study was part of the environmental assessment program crucial in obtaining government approval to construct the line. Some residents living adjacent to the new transmission circuit expressed concerns about alleged adverse health effects associated with long-term exposure to magnetic fields from high voltage transmission lines. In order to verify the accuracy of the predicted magnetic field levels submitted to the regulatory body in the the electrical effects study and to instill confidence in the residents of the affected communities, a three-year magnetic monitoring project was conducted between 2003 and 2005 along the right-of-way after the new 230kV transmission line was energized by Manitoba Hydro. This paper described the monitoring program, with reference to location; equipment; data analysis; and discussion of results. It was concluded that the long-term monitoring project demonstrated that the magnetic field prediction methodology was well understood and accurate, and provided valuable long-term magnetic field characteristics at the edge of the right-of-way. In addition, when there is opposition to a transmission line, public consultation and education were found to be the best options to arrive at a solution. 3 refs., 1 tab., 12 figs

Single-Wire Electric-Field Coupling Power Transmission Using Nonlinear Parity-Time-Symmetric Model with Coupled-Mode Theory

Directory of Open Access Journals (Sweden)

Xujian Shu

2018-03-01

Full Text Available The output power and transmission efficiency of the traditional single-wire electric-field coupling power transmission (ECPT system will drop sharply with the increase of the distance between transmitter and receiver, thus, in order to solve the above problem, in this paper, a new nonlinear parity-time (PT-symmetric model for single-wire ECPT system based on coupled-mode theory (CMT is proposed. The proposed model for single-wire ECPT system not only achieves constant output power but also obtains a high constant transmission efficiency against variable distance, and the steady-state characteristics of the single-wire ECPT system are analyzed. Based on the theoretical analysis and circuit simulation, it shows that the transmission efficiency with constant output power remains 60% over a transmission distance of approximately 34 m without the need for any tuning. Furthermore, the application of a nonlinear PT-symmetric circuit based on CMT enables robust electric power transfer to moving devices or vehicles.

Experimental demonstration of non-reciprocal transmission in a nonlinear photonic-crystal Fano structure

DEFF Research Database (Denmark)

Yu, Yi; Chen, Yaohui; Hu, Hao

2015-01-01

We suggest and experimentally demonstrate a photonic-crystal structure with more than 30 dB difference between forward and backward transmission levels. The non-reciprocity relies on the combination of ultrafast carrier nonlinearities and spatial symmetry breaking in a Fano structure employing...

Development of large high-voltage pressure insulators for the Princeton TFTR [Tokamak Fusion Test Reactor] flexible transmission lines

International Nuclear Information System (INIS)

Scalise, D.T.; Fong, E.; Haughian, J.; Prechter, R.

1986-10-01

Specially formulated insulator materials with improved strength and high-voltage properties were developed and used for critical components of the flexible transmission lines to the TFTR neutral beam ion sources. These critical components are plates which support central conductors as they exit the high-voltage power supply and enter the ion source enclosure. Each plate acts both as a high-voltage insulator and as a pressure barrier to the SF 6 insulating gas. The original plate was made of commercial glass-epoxy laminate which limited the plate voltage capacity. The newly developed insulator is made of specially-formulated cycloalphatic Di-epoxide whose isotropic properties exhibit increased arc resistance. It is cast in one piece with skirts which greatly increase the breakdown voltage. This paper discusses the design, fabrication and testing of the new insulator

Energy and Transmissibility in Nonlinear Viscous Base Isolators

Science.gov (United States)

Markou, Athanasios A.; Manolis, George D.

2016-09-01

High damping rubber bearings (HDRB) are the most commonly used base isolators in buildings and are often combined with other systems, such as sliding bearings. Their mechanical behaviour is highly nonlinear and dependent on a number of factors. At first, a physical process is suggested here to explain the empirical formula introduced by J.M. Kelly in 1991, where the dissipated energy of a HDRB under cyclic testing, at constant frequency, is proportional to the amplitude of the shear strain, raised to a power of approximately 1.50. This physical process is best described by non-Newtonian fluid behaviour, originally developed by F.H. Norton in 1929 to describe creep in steel at high-temperatures. The constitutive model used includes a viscous term, that depends on the absolute value of the velocity, raised to a non-integer power. The identification of a three parameter Kelvin model, the simplest possible system with nonlinear viscosity, is also suggested here. Furthermore, a more advanced model with variable damping coefficient is implemented to better model in this complex mechanical process. Next, the assumption of strain-rate dependence in their rubber layers under cyclic loading is examined in order to best interpret experimental results on the transmission of motion between the upper and lower surfaces of HDRB. More specifically, the stress-relaxation phenomenon observed with time in HRDB can be reproduced numerically, only if the constitutive model includes a viscous term, that depends on the absolute value of the velocity raised to a non-integer power, i. e., the Norton fluid previously mentioned. Thus, it becomes possible to compute the displacement transmissibility function between the top and bottom surfaces of HDRB base isolator systems and to draw engineering-type conclusions, relevant to their design under time-harmonic loads.

Single-phased Fault Location on Transmission Lines Using Unsynchronized Voltages

Directory of Open Access Journals (Sweden)

ISTRATE, M.

2009-10-01

Full Text Available The increased accuracy into the fault's detection and location makes it easier for maintenance, this being the reason to develop new possibilities for a precise estimation of the fault location. In the field literature, many methods for fault location using voltages and currents measurements at one or both terminals of power grids' lines are presented. The double-end synchronized data algorithms are very precise, but the current transformers can limit the accuracy of these estimations. The paper presents an algorithm to estimate the location of the single-phased faults which uses only voltage measurements at both terminals of the transmission lines by eliminating the error due to current transformers and without introducing the restriction of perfect data synchronization. In such conditions, the algorithm can be used with the actual equipment of the most power grids, the installation of phasor measurement units with GPS system synchronized timer not being compulsory. Only the positive sequence of line parameters and sources are used, thus, eliminating the incertitude in zero sequence parameter estimation. The algorithm is tested using the results of EMTP-ATP simulations, after the validation of the ATP models on the basis of registered results in a real power grid.

Influence of current limitation on voltage stability with voltage sourced converter HVDC

DEFF Research Database (Denmark)

Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

2013-01-01

A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

Optimal condition of memristance enhancement circuit using external voltage source

Directory of Open Access Journals (Sweden)

Hiroya Tanaka

2014-05-01

Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

Extreme control of impulse transmission by cylinder-based nonlinear phononic crystals

Science.gov (United States)

Chaunsali, Rajesh; Toles, Matthew; Yang, Jinkyu; Kim, Eunho

2017-10-01

We present a novel device that can offer two extremes of elastic wave propagation - nearly complete transmission and strong attenuation under impulse excitation. The mechanism of this highly tunable device relies on intermixing effects of dispersion and nonlinearity. The device consists of identical cylinders arranged in a chain, which interact with each other as per nonlinear Hertz contact law. For a 'dimer' configuration, i.e., two different contact angles alternating in the chain, we analytically, numerically, and experimentally show that impulse excitation can either propagate as a localized wave, or it can travel as a highly dispersive wave. Remarkably, these extremes can be achieved in this periodic arrangement simply by in-situ control of contact angles between cylinders. We close the discussion by highlighting the key characteristics of the mechanisms that facilitate strong attenuation of incident impulse. These include low-to-high frequency scattering, and turbulence-like cascading in a periodic system. We thus envision that these adaptive, cylinder-based nonlinear phononic crystals, in conjunction with conventional impact mitigation mechanisms, could be used to design highly tunable and efficient impact manipulation devices.

Modular high-voltage bias generator powered by dual-looped self-adaptive wireless power transmission.

Science.gov (United States)

Xie, Kai; Huang, An-Feng; Li, Xiao-Ping; Guo, Shi-Zhong; Zhang, Han-Lu

2015-04-01

We proposed a modular high-voltage (HV) bias generator powered by a novel transmitter-sharing inductive coupled wireless power transmission technology, aimed to extend the generator's flexibility and configurability. To solve the problems caused through an uncertain number of modules, a dual-looped self-adaptive control method is proposed that is capable of tracking resonance frequency while maintaining a relatively stable induction voltage for each HV module. The method combines a phase-locked loop and a current feedback loop, which ensures an accurate resonance state and a relatively constant boost ratio for each module, simplifying the architecture of the boost stage and improving the total efficiency. The prototype was built and tested. The input voltage drop of each module is less than 14% if the module number varies from 3 to 10; resonance tracking is completed within 60 ms. The efficiency of the coupling structure reaches up to 95%, whereas the total efficiency approaches 73% for a rated output. Furthermore, this technology can be used in various multi-load wireless power supply applications.

High-voltage direct current (HVDC) transmission - a key technology for our power supply

International Nuclear Information System (INIS)

Dorn, J.

2016-01-01

The phasing-out of nuclear power in some countries and the aspirations of reducing carbon dioxide emissions have far-reaching implications for electric power generation in Europe. In the future, renewable electricity generation will account for a considerable share of the energy mix, but this type of production is often far from the load centers. In Germany, for example, large quantities of wind energy are already generated in the north and in the North Sea, but large load centers are located several hundred kilometers south of there. This requires an expansion of the transmission network with innovative solutions. High-voltage direct-current (HVDC) transmission plays an important role, since it brings a number of advantages over conventional AC technology and makes certain requirements feasible, for example Cable transmission over longer distances. The lecture presents the advantages of HVDC, the semiconductors used as well as the basic functions and typical performance of the used converter topopologies. The plant configurations and main components are illustrated using current projects. (rössner) [de

Structure-property relationships in an Al matrix Ca nanofilamentary composite conductor with potential application in high-voltage power transmission

Science.gov (United States)

Tian, Liang

This study investigated the processing-structure-properties relationships in an Al/Ca composites using both experiments and modeling/simulation. A particular focus of the project was understanding how the strength and electrical conductivity of the composite are related to its microstructure in the hope that a conducting material with light weight, high strength, and high electrical conductivity can be developed to produce overhead high-voltage power transmission cables. The current power transmission cables (e.g., Aluminum Conductor Steel Reinforced (ACSR)) have acceptable performance for high-voltage AC transmission, but are less well suited for high-voltage DC transmission due to the poorly conducting core materials that support the cable weight. This Al/Ca composite was produced by powder metallurgy and severe plastic deformation by extrusion and swaging. The fine Ca metal powders have been produced by centrifugal atomization with rotating liquid oil quench bath, and a detailed study about the atomization process and powder characteristics has been conducted. The microstructure of Al/Ca composite was characterized by electron microscopy. Microstructure changes at elevated temperature were characterized by thermal analysis and indirect resistivity tests. The strength and electrical conductivity were measured by tensile tests and four-point probe resistivity tests. Predicting the strength and electrical conductivity of the composite was done by micro-mechanics-based analytical modeling. Microstructure evolution was studied by mesoscale-thermodynamics-based phase field modeling and a preliminary atomistic molecular dynamics simulation. The application prospects of this composite was studied by an economic analysis. This study suggests that the Al/Ca (20 vol. %) composite shows promise for use as overhead power transmission cables. Further studies are needed to measure the corrosion resistance, fatigue properties and energized field performance of this composite.

A new algorithm for optimum voltage and reactive power control for minimizing transmission lines losses

International Nuclear Information System (INIS)

Ghoudjehbaklou, H.; Danai, B.

2001-01-01

Reactive power dispatch for voltage profile modification has been of interest to power utilities. Usually local bus voltages can be altered by changing generator voltages, reactive shunts, ULTC transformers and SVCs. Determination of optimum values for control parameters, however, is not simple for modern power system networks. Heuristic and rather intelligent algorithms have to be sought. In this paper a new algorithm is proposed that is based on a variant of a genetic algorithm combined with simulated annealing updates. In this algorithm a fuzzy multi-objective a approach is used for the fitness function of the genetic algorithm. This fuzzy multi-objective function can efficiently modify the voltage profile in order to minimize transmission lines losses, thus reducing the operating costs. The reason for such a combination is to utilize the best characteristics of each method and overcome their deficiencies. The proposed algorithm is much faster than the classical genetic algorithm and cna be easily integrated into existing power utilities software. The proposed algorithm is tested on an actual system model of 1284 buses, 799 lines, 1175 fixed and ULTC transformers, 86 generators, 181 controllable shunts and 425 loads

Development of real-time voltage stability monitoring tool for power system transmission network using Synchrophasor data

Science.gov (United States)

Pulok, Md Kamrul Hasan

Intelligent and effective monitoring of power system stability in control centers is one of the key issues in smart grid technology to prevent unwanted power system blackouts. Voltage stability analysis is one of the most important requirements for control center operation in smart grid era. With the advent of Phasor Measurement Unit (PMU) or Synchrophasor technology, real time monitoring of voltage stability of power system is now a reality. This work utilizes real-time PMU data to derive a voltage stability index to monitor the voltage stability related contingency situation in power systems. The developed tool uses PMU data to calculate voltage stability index that indicates relative closeness of the instability by producing numerical indices. The IEEE 39 bus, New England power system was modeled and run on a Real-time Digital Simulator that stream PMU data over the Internet using IEEE C37.118 protocol. A Phasor data concentrator (PDC) is setup that receives streaming PMU data and stores them in Microsoft SQL database server. Then the developed voltage stability monitoring (VSM) tool retrieves phasor measurement data from SQL server, performs real-time state estimation of the whole network, calculate voltage stability index, perform real-time ranking of most vulnerable transmission lines, and finally shows all the results in a graphical user interface. All these actions are done in near real-time. Control centers can easily monitor the systems condition by using this tool and can take precautionary actions if needed.

The Effect of Friction on the Nonlinear Vibration of the Cracked One-Stage Power Transmission

Directory of Open Access Journals (Sweden)

M. Rezaee

2016-01-01

Full Text Available : The gear systems are widely used in industry to transmit the power or change the direction of the torque. Due to the extensive usage of the gears, the detailed designing and the subsequent maintenance of these systems are more and more evident. System recognition can be achieved through modeling the system, investigating the system behavior, and comparing the results obtained through the model with the actual system behavior. Up to now, the effect of dry friction has not been taken into account in nonlinear vibration analysis and modeling of a cracked one-stage gear power transmission system. In this paper, the nonlinear vibration of a pair of cracked spur-gear system in presence of dry friction, static transmission error, clearance and time-variant mesh stiffness is investigated. To this end, the time-variant mesh stiffness of an intact tooth is calculated analytically. Then, the tooth root crack is modeled as a cracked cantilever beam. The governing nonlinear equation of motion is extracted accordingly, and in order to consider the effect of dry friction, the governing equation solved by Rung- Kutta method in three separate time spans. Finally, the frequency response and bifurcation diagrams are used to study the effect of the friction and tooth root crack on the nonlinear vibration behavior of the system.

L1 adaptive control of uncertain gear transmission servo systems with deadzone nonlinearity.

Science.gov (United States)

Zuo, Zongyu; Li, Xiao; Shi, Zhiguang

2015-09-01

This paper deals with the adaptive control problem of Gear Transmission Servo (GTS) systems in the presence of unknown deadzone nonlinearity and viscous friction. A global differential homeomorphism based on a novel differentiable deadzone model is proposed first. Since there exist both matched and unmatched state-dependent unknown nonlinearities, a full-state feedback L1 adaptive controller is constructed to achieve uniformly bounded transient response in addition to steady-state performance. Finally, simulation results are included to show the elimination of limit cycles, in addition to demonstrating the main results in this paper. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Adaptive Modulation for DFIG and STATCOM With High-Voltage Direct Current Transmission.

Science.gov (United States)

Tang, Yufei; He, Haibo; Ni, Zhen; Wen, Jinyu; Huang, Tingwen

2016-08-01

This paper develops an adaptive modulation approach for power system control based on the approximate/adaptive dynamic programming method, namely, the goal representation heuristic dynamic programming (GrHDP). In particular, we focus on the fault recovery problem of a doubly fed induction generator (DFIG)-based wind farm and a static synchronous compensator (STATCOM) with high-voltage direct current (HVDC) transmission. In this design, the online GrHDP-based controller provides three adaptive supplementary control signals to the DFIG controller, STATCOM controller, and HVDC rectifier controller, respectively. The mechanism is to observe the system states and their derivatives and then provides supplementary control to the plant according to the utility function. With the GrHDP design, the controller can adaptively develop an internal goal representation signal according to the observed power system states, therefore, to achieve more effective learning and modulating. Our control approach is validated on a wind power integrated benchmark system with two areas connected by HVDC transmission lines. Compared with the classical direct HDP and proportional integral control, our GrHDP approach demonstrates the improved transient stability under system faults. Moreover, experiments under different system operating conditions with signal transmission delays are also carried out to further verify the effectiveness and robustness of the proposed approach.

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1993-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse

Application of Magnetically Insulated Transmission Lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1991-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

Science.gov (United States)

Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.

Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.

Rogue waves generation in a left-handed nonlinear transmission line with series varactor diodes

Science.gov (United States)

Onana Essama, B. G.; Atangana, J.; Biya Motto, F.; Mokhtari, B.; Cherkaoui Eddeqaqi, N.; Kofane, Timoleon C.

2014-07-01

We investigate the electromagnetic wave behavior and its characterization using collective variables technique. Second-order dispersion, first- and second-order nonlinearities, which strongly act in a left-handed nonlinear transmission line with series varactor diodes, are taken into account. Four frequency ranges have been found. The first one gives the so-called energetic soliton due to a perfect combination of second-order dispersion and first-order nonlinearity. The second frequency range presents a dispersive soliton leading to the collapse of the electromagnetic wave at the third frequency range. But the fourth one shows physical conditions which are able to provoke the appearance of wave trains generation with some particular waves, the rogue waves. Moreover, we demonstrate that the number of rogue waves increases with frequency. The soliton, thereafter, gains a relative stability when second-order nonlinearity comes into play with some specific values in the fourth frequency range. Furthermore, the stability conditions of the electromagnetic wave at high frequencies have been also discussed.

Thermal Rectification in Graded Nonlinear Transmission Lines

International Nuclear Information System (INIS)

Xu Wen; Chen Wei-Zhong; Tao Feng

2011-01-01

We consider heat conduction in a nonlinear inductance-capacitance (LC) transmission line with an inductance gradient by adding white-noise signals. It is found that the heat flux in the direction of inductance decrease is larger than that in the direction of inductance increase. When the low-inductance end is at higher temperature, the phonon density decreases due to conversion to high-frequency phonons, which can not move to the high-inductance end due to its lower cutoff frequency. However, when the high-inductance end is at higher temperature, the loss of phonon density can be compensated for because some high-frequency phonons can move to the low-inductance end dur to its higher cutoff frequency. This leads to the asymmetry of energy transfer. Discussion shows that this asymmetry exists in a particular range of temperatures, and increases with the increase of the difference between heat baths and the inductance gradient. (fundamental areas of phenomenology(including applications))

Parametric amplifications in the nonlinear transmission line

Energy Technology Data Exchange (ETDEWEB)

Kawata, T; Sakai, J; Inoue, H [Toyama Univ., Takaoka (Japan). Faculty of Engineering

1980-03-01

The parametric amplification in a transmission line with nonlinear capacitors is analysed theoretically using the equations of three wave interactions. Since this line has two modes, high frequency and low frequency modes, there may occur some mode coupling phenomena through the resonant interactions. We consider three waves with wave number k sub(j) and frequency ..omega..sub(j) in resonance with each other, that is, ..omega../sub 1/ + ..omega../sub 2/ = ..omega../sub 3/ and k/sub 1/ + k/sub 2/ = k/sub 3/, where 0 <= ..omega../sub 1/ <= ..omega../sub 2/ <= ..omega../sub 3/ and k/sub 3/ >= 0. Such conditions are realized in our network and there exist two states: ''forward state'' (each group velocity is positive) and ''backward state'' (one of the group velocities is negative). The coupled equations of three waves has two constant pumps: high frequency (HF) pump and low frequency (LF) pump. Using linear approximations, we examine the possible types of parametric amplification and obtain the power gains depending on the frequency deviation. For only the case of HF pump we get the gain between signals with seme frequency and also get the gain from the low frequency signal to the high frequency signal (''up-conversion'') for the LF pump. The nonlinear analysis gives the exact relation between input and output signals. For the forward state the gain is absolutely suppressed by the ratio of pumping power to input power, while the gain of backward state has no finite maximum and there may appear an ''oscillating state'' if the pumping power is comparatively small.

The Study of a Nonlinear Duffing – Type Oscillator Driven by Two Voltage Sources

Directory of Open Access Journals (Sweden)

J. O. Maaita

2013-10-01

Full Text Available In the present work, a detailed study of a nonlinear electrical oscillator with damping and external excitation is presented. The system under study consists of a Duffing-type circuit driven by two sinusoidal voltage sources having different frequencies. The dynamical behavior of the proposed system is investigated numerically, by solving the system of state equations and simulating its behavior as a circuit using MultiSim. The tools of the theoretical approach are the bifurcation diagrams, the Poincaré sections, the phase portraits, and the maximum Lyapunov exponent. The numerical investigation showed that the system has rich complex dynamics including phenomena such as quasiperiodicity, 3-tori, and chaos.

Choice of operating voltage for a transmission electron microscope

International Nuclear Information System (INIS)

Egerton, R.F.

2014-01-01

An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

High voltage engineering

CERN Document Server

Rizk, Farouk AM

2014-01-01

Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

Optical stealth transmission based on super-continuum generation in highly nonlinear fiber over WDM network.

Science.gov (United States)

Zhu, Huatao; Wang, Rong; Pu, Tao; Fang, Tao; Xiang, Peng; Zheng, Jilin; Chen, Dalei

2015-06-01

In this Letter, the optical stealth transmission carried by super-continuum spectrum optical pulses generated in highly nonlinear fiber is proposed and experimentally demonstrated. In the proposed transmission scheme, super-continuum signals are reshaped in the spectral domain through a wavelength-selective switch and are temporally spread by a chromatic dispersion device to achieve the same noise-like characteristic as the noise in optical networks, so that in both the time domain and the spectral domain, the stealth signals are hidden in public channel. Our experimental results show that compared with existing schemes where stealth channels are carried by amplified spontaneous emission noise, super-continuum signal can increase the transmission performance and robustness.

Effect of particle size, filler loadings and x-ray tube voltage on the transmitted x-ray transmission in tungsten oxide—epoxy composites

International Nuclear Information System (INIS)

Noor Azman, N.Z.; Siddiqui, S.A.; Hart, R.; Low, I.M.

2013-01-01

The effect of particle size, filler loadings and x-ray tube voltage on the x-ray transmission in WO 3 -epoxy composites has been investigated using the mammography unit and a general radiography unit. Results indicate that nano-sized WO 3 has a better ability to attenuate the x-ray beam generated by lower tube voltages (25–35 kV) when compared to micro-sized WO 3 of the same filler loading. However, the effect of particle size on x-ray transmission was negligible at the higher x-ray tube voltages (40–120 kV). - Highlights: ► Investigated the effect of particle size of WO 3 on the x-ray attenuation ability. ► Nano-sized WO 3 has a better ability to attenuate lower x-ray energies (22–49 kV p ). ► Particle size has negligible effect at the higher x-ray energy range (40–120 kV p ).

DEVELOPMENT AND INVESTIGATION OF LAYOUT OF ACTIVE SCREENING SYSTEM OF THE MAGNETIC FIELD GENERATED BY GROUP OF OVERHEAD TRANSMISSION LINES

Directory of Open Access Journals (Sweden)

B. I. Kuznetsov

2018-04-01

Full Text Available Purpose. Development and field experimental research of layout of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area is given. Methodology. Mathematical model of magnetic field, generated by group of high voltage transmission lines in residential area, based of the experimental values of magnetic field flux density in given points on the basis of optimization problem solving is improved. The objective of the synthesis of the single circuit active screening system is to determine their number, configuration, spatial arrangement, wiring diagrams and compensation cables currents, setting algorithm of the control systems as well as the resulting value of the magnetic flux density at the points of the protected space. Synthesis of the full-scale model of active screening system is reduced to the problem of multiobjective nonlinear programming with constraints in which calculation of the objective functions and constraints are carried out on the basis of the Maxwell equations solutions in the quasi-stationary approximation. The problem is solved by a stochastic multiswarm multi-agent particles optimization. Results. The single-circuit active screening system synthesis results for reduction of a magnetic field generated by group of high voltage transmission lines in residential area is given. Field experimental researches of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area with various control algorithms is given. Originality. For the first time out the development and field experimental studies of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area are carried out. Practical value. Practical recommendations on reasonable choice of the spatial arrangement of compensating cables of single

Effect of driving voltages in dual capacitively coupled radio frequency plasma: A study by nonlinear global model

International Nuclear Information System (INIS)

Bora, B.

2015-01-01

On the basis of nonlinear global model, a dual frequency capacitively coupled radio frequency plasma driven by 13.56 MHz and 27.12 MHz has been studied to investigate the influences of driving voltages on the generation of dc self-bias and plasma heating. Fluid equations for the ions inside the plasma sheath have been considered to determine the voltage-charge relations of the plasma sheath. Geometrically symmetric as well as asymmetric cases with finite geometrical asymmetry of 1.2 (ratio of electrodes area) have been considered to make the study more reasonable to experiment. The electrical asymmetry effect (EAE) and finite geometrical asymmetry is found to work differently in controlling the dc self-bias. The amount of EAE has been primarily controlled by the phase angle between the two consecutive harmonics waveforms. The incorporation of the finite geometrical asymmetry in the calculations shift the dc self-bias towards negative polarity direction while increasing the amount of EAE is found to increase the dc self-bias in either direction. For phase angle between the two waveforms ϕ = 0 and ϕ = π/2, the amount of EAE increases significantly with increasing the low frequency voltage, whereas no such increase in the amount of EAE is found with increasing high frequency voltage. In contrast to the geometrically symmetric case, where the variation of the dc self-bias with driving voltages for phase angle ϕ = 0 and π/2 are just opposite in polarity, the variation for the geometrically asymmetric case is different for ϕ = 0 and π/2. In asymmetric case, for ϕ = 0, the dc self-bias increases towards the negative direction with increasing both the low and high frequency voltages, but for the ϕ = π/2, the dc-self bias is increased towards positive direction with increasing low frequency voltage while dc self-bias increases towards negative direction with increasing high frequency voltage

Nonlinear Vibroimpact Characteristics of a Planetary Gear Transmission System

Directory of Open Access Journals (Sweden)

Jianxing Zhou

2016-01-01

Full Text Available In order to research the vibroimpact characteristics of a planetary gear transmission system under high speed and lightly loaded conditions, a new modeling method is proposed. In the modeling process, linear spring was used to simulate gear mesh elasticity under heavy load cases, and Hertz contact theory was used to calculate the contact force of gear pair under light load cases. Then, effects of the working conditions on the system vibroimpact characteristics are analyzed. The results show that, with input speed growing, the mesh force produced obvious fluctuations on the resonance frequencies of the sun gear and carrier torsion vibration, ring gear’s transverse vibration under the heavy load. Under light load condition, the collision vibration occurs in the gear pair; the changing trend of the contact force shows strongly nonlinear characteristics. The time of mesh-apart in gears pair decreases gradually as the load is increased; until it reaches collision vibration threshold value, the gear pair is no longer mesh-apart. With increasing of the input speed, the time of mesh-apart is decreased gradually; the fluctuation amplitude of contact force shows a linearly increasing trend. The study provides useful theoretical guideline for planetary gear transmission low-noise design.

Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

International Nuclear Information System (INIS)

Ekonomou, L; Karampelas, P; Vita, V; Chatzarakis, G E

2011-01-01

One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service

Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

Science.gov (United States)

Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.

2011-04-01

One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.

based dynamic voltage restorer

African Journals Online (AJOL)

HOD

operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

DC power flow control for radial offshore multi-terminal HVDC transmission system by considering steady-state DC voltage operation range

DEFF Research Database (Denmark)

Irnawan, Roni; Silva, Filipe Miguel Faria da; Bak, Claus Leth

2017-01-01

This paper deals with a radial offshore multi-terminal HVDC (MTDC) transmission system which is formed by interconnection several existing offshore wind farm (OWF) HVDC links with a shore-to-shore (StS) HVDC link. A challenge arises when deciding the steady-state DC voltage operating level...

Ion diode performance on a positive polarity inductive voltage adder with layered magnetically insulated transmission line flow

International Nuclear Information System (INIS)

Hinshelwood, D. D.; Schumer, J. W.; Allen, R. J.; Commisso, R. J.; Jackson, S. L.; Murphy, D. P.; Phipps, D.; Swanekamp, S. B.; Weber, B. V.; Ottinger, P. F.; Apruzese, J. P.; Cooperstein, G.; Young, F. C.

2011-01-01

A pinch-reflex ion diode is fielded on the pulsed-power machine Mercury (R. J. Allen, et al., 15th IEEE Intl. Pulsed Power Conf., Monterey, CA, 2005, p. 339), which has an inductive voltage adder (IVA) architecture and a magnetically insulated transmission line (MITL). Mercury is operated in positive polarity resulting in layered MITL flow as emitted electrons are born at a different potential in each of the adder cavities. The usual method for estimating the voltage by measuring the bound current in the cathode and anode of the MITL is not accurate with layered flow, and the interaction of the MITL flow with a pinched-beam ion diode load has not been studied previously. Other methods for determining the diode voltage are applied, ion diode performance is experimentally characterized and evaluated, and circuit and particle-in-cell (PIC) simulations are performed. Results indicate that the ion diode couples efficiently to the machine operating at a diode voltage of about 3.5 MV and a total current of about 325 kA, with an ion current of about 70 kA of which about 60 kA is proton current. It is also found that the layered flow impedance of the MITL is about half the vacuum impedance.

Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

DEFF Research Database (Denmark)

Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

2004-01-01

power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

Investigation of nonlinear I–V behavior of CNTs filled polymer composites

International Nuclear Information System (INIS)

Wang, Jian; Yu, Shuhui; Luo, Suibin; Chu, Baojin; Sun, Rong; Wong, Ching-Ping

2016-01-01

Graphical abstract: - Highlights: • Mechanism of nonlinear behavior of the CNT composites was systematically investigated. • There are one linear region (I) and two nonlinear regions (II and III) in the I–V curves. • This phenomenon was analyzed based on hopping, tunneling and Joule heating effects. - Abstract: Nonlinear current–voltage (I–V) behavior is a typical feature of polymeric composites containing conductor or semiconductor fillers, which are desired to handle the transient voltage and electrostatic discharge (ESD) of microelectronic devices. In this paper, the mechanism of nonlinear behavior of carbon nanotubes (CNTs) filled polymer composites in the applied electric field was explored. The I–V curves of the composites exhibited three regions. The variation of current at low voltages (region I) is linear. Under relatively higher voltages (region II), the variation is nonlinear and grows rapidly with voltage. As the voltage is further increased, the I–V curve is still non-linear (region III), but the growth rate is significantly slowed down. The I–V characteristics in the above three regions were analyzed systematically based on the calculation of the electrons hopping from the conduction band of CNTs to epoxy, the induced current under electric field, as well as Joule-heating and tunneling effect.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-01-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

Response analysis and energy transmissibility of a vibration isolation system with real-power nonlinearities under a NMPPF controller

International Nuclear Information System (INIS)

Huang, Dongmei; Xu, Wei; Shi, Lingling

2016-01-01

Highlights: • The nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. • The primary resonance, dynamical stability and energy transmissibility of the real-power vibration isolation system are studied. • The sensitivity of the controller parameters on the responses has been analyzed. • In order to suppress the amplitude peak, the feedback parameters have been determined by the frequency response. • The energy transmissibility is investigated. - Abstract: In this paper, the nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. Based on the method of multiple scales, the frequency response, the stability and the energy transmissibility of the real-power vibration isolation system are studied. It is found that the controlled isolation system exhibits a softening behavior for sub-linear restoring force, while it exhibits the two peak response characteristic rather than a hardening behavior for over-linear restoring force. Further, the sensitivity of the feedback parameters on the responses is discussed. The results, compared to the conventional PPF and IRC methods, show that the proposed method is significantly more effective in controlling the steady-state response, and slightly advantageous for the steady-state dynamics control. The effectiveness of this method is also verified by time domain analysis. Then, the suitable feedback and controller parameters are derived by simulation results in which the amplitude peak is suppressed and the resonance stability is maintained. Finally, the energy transmissibility of the vibration isolation system is investigated. The results show that the feedback gain can reduce the whole transmissibility level and greatly suppress vibration

Linearity and Nonlinearity in HIV/STI Transmission: Implications for the Evaluation of Sexual Risk Reduction Interventions

Science.gov (United States)

Pinkerton, Steven D.; Chesson, Harrell W.; Crosby, Richard A.; Layde, Peter M.

2011-01-01

A mathematical model of HIV/sexually transmitted infections (STI) transmission was used to examine how linearity or nonlinearity in the relationship between the number of unprotected sex acts (or the number of sex partners) and the risk of acquiring HIV or a highly infectious STI (such as gonorrhea or chlamydia) affects the utility of sexual…

Study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission from overhead High-Voltage Transmission Lines

International Nuclear Information System (INIS)

Parthasarathy, S.R.; Roha Tukimin; Wan Saffiey Wan Abdullah; Zulkifli Yusof; Mohd Azizi Mohd Jali

2016-01-01

The paper highlights the study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission performed at an overhead 275-kV High-Voltage Transmission Lines. The study comprised of assessment at the transmission lines on 3 different cases and locations in Klang Valley, specifically on a vacant land near the transmission line, inside and around the house at the vicinity of the transmission line and the area directly under the transmission line. The instrument setup and measurement protocols during the assessment were adopted from standard measurement method and procedures stipulated under the Institute of Electrical and Electronics Engineers (IEEE) Standard. The results were compared with the standards recommended in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. The results showed that the measured field strengths are within the safety limit with the highest measured exposure was 10.8 % and 1.8 % of the permissible exposure limit for the electric and magnetic field respectively. Both the field strengths were found to drop significantly against distance from the transmission lines where closer distances showed higher field strengths. Furthermore, the study revealed that buildings and other object such as trees and shrubs screen out the electric field, resulting in a lower value at indoor measurements and near the stated objects. In addition, higher value of electric and magnetic field strengths were recorded when assessment was being done directly under the transmission line compared to the lateral measurement. (author)

Global exponential stability of BAM neural networks with transmission delays and nonlinear impulses

International Nuclear Information System (INIS)

Huang Zhenkun; Xia Yonghui

2008-01-01

In this paper, a class of bidirectional associative memory (BAM) networks with transmission delays and nonlinear impulses are studied. Some new sufficient conditions are established for the existence and global exponential stability of a unique equilibrium, which generalize and improve the previously known results. The sufficient conditions are easy to verify and when the impulsive jumps are linear or absent the results reduce to those of common impulsive or non-impulsive systems. Finally, an example is given to show the feasibility and effectiveness of our results

Recommendation on the Environmental Effect Report for the high-voltage transmission line between Netherlands and Norway

International Nuclear Information System (INIS)

1998-01-01

The recommendation on the title subject was addressed to the Dutch Minister of Economic Affairs and concerns the environmental impact of the new high-voltage transmission line (NorNed cable) from Norway to the Eemshaven in Groningen, Netherlands. In planning this power cable the environmental impact on the Wadden Sea has to be taken into account. Therefore an environmental effect report (MER, abbreviated in Dutch) has been drafted by the Dutch cooperative of electric power generating companies, Sep, and commented by the WaddenAdviesRaad

Voltage Quality Improvement in Islanded Microgrids Supplying Nonlinear Loads

DEFF Research Database (Denmark)

T. Dehghani, Mohammad; Vahedi, Abolfazl; Savaghebi, Mehdi

2012-01-01

The aim of this paper is to improve voltage quality at the terminals of distributed generators (DGs) in an islanded microgrid. To achieve this goal, it is proposed to include separate voltage and current control loops for the fundamental and harmonics frequencies. This way, it is not necessary...

A Novel Modulation Function-Based Control of Modular Multilevel Converters for High Voltage Direct Current Transmission Systems

Directory of Open Access Journals (Sweden)

Majid Mehrasa

2016-10-01

Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.

Nonlinear empirical model of gas humidity-related voltage dynamics of a polymer-electrolyte-membrane fuel cell stack

Science.gov (United States)

Meiler, M.; Andre, D.; Schmid, O.; Hofer, E. P.

Intelligent energy management is a cost-effective key path to realize efficient automotive drive trains [R. O'Hayre, S.W. Cha, W. Colella, F.B. Prinz. Fuel Cell Fundamentals, John Wiley & Sons, Hoboken, 2006]. To develop operating strategy in fuel cell drive trains, precise and computational efficient models of all system components, especially the fuel cell stack, are needed. Should these models further be used in diagnostic or control applications, then some major requirements must be fulfilled. First, the model must predict the mean fuel cell voltage very precisely in all possible operating conditions, even during transients. The model output should be as smooth as possible to support best efficient optimization strategies of the complete system. At least, the model must be computational efficient. For most applications, a difference between real fuel cell voltage and model output of less than 10 mV and 1000 calculations per second will be sufficient. In general, empirical models based on system identification offer a better accuracy and consume less calculation resources than detailed models derived from theoretical considerations [J. Larminie, A. Dicks. Fuel Cell Systems Explained, John Wiley & Sons, West Sussex, 2003]. In this contribution, the dynamic behaviour of the mean cell voltage of a polymer-electrolyte-membrane fuel cell (PEMFC) stack due to variations in humidity of cell's reactant gases is investigated. The validity of the overall model structure, a so-called general Hammerstein model (or Uryson model), was introduced recently in [M. Meiler, O. Schmid, M. Schudy, E.P. Hofer. Dynamic fuel cell stack model for real-time simulation based on system identification, J. Power Sources 176 (2007) 523-528]. Fuel cell mean voltage is calculated as the sum of a stationary and a dynamic voltage component. The stationary component of cell voltage is represented by a lookup-table and the dynamic voltage by a parallel placed, nonlinear transfer function. A

Stochastic reactive power market with volatility of wind power considering voltage security

International Nuclear Information System (INIS)

Kargarian, A.; Raoofat, M.

2011-01-01

While wind power generation is growing rapidly around the globe; its stochastic nature affects the system operation in many different aspects. In this paper, the impact of wind power volatility on the reactive power market is taken into account. The paper presents a novel stochastic method for optimal reactive power market clearing considering voltage security and volatile nature of the wind. The proposed optimization algorithm uses a multiobjective nonlinear programming technique to minimize market payment and simultaneously maximize voltage security margin. Considering a set of probable wind speeds, in the first stage, the proposed algorithm seeks to minimize expected system payment which is summation of reactive power payment and transmission loss cost. The object of the second stage is maximization of expected voltage security margin to increase the system loadability and security. Finally, in the last stage, a multiobjective function is presented to schedule the stochastic reactive power market using results of two previous stages. The proposed algorithm is applied to IEEE 14-bus test system. As a benchmark, Monte Carlo Simulation method is utilized to simulate the actual market of given period of time to evaluate results of the proposed algorithm, and satisfactory results are achieved. -- Highlights: →The paper proposes a new algorithm for stochastic reactive power market clearing. →The stochastic nature of the wind which impacts the system operation and market clearing process, is taken into account. →The paper suggests an expected voltage stability margin and optimizes it in conjunction with expected total market payment. →To clear the market with two mentioned objective functions, a three-stage multiobjective nonlinear programming is implemented. →Also, a simple method is suggested to determine a suitable priority coefficient between two individual objective functions.

Modelling, stability and control of voltage behaviour in power supply systems

Energy Technology Data Exchange (ETDEWEB)

Hill, David J [Sydney Univ., NSW (Australia). Dept. of Electrical Engineering; Hisken, Ian A [Newcastle Univ., NSW (Australia). Dept. of Electrical and Computer Engineering

1994-12-31

This paper gives an overview of a line of work on mid to long term voltages stability analysis and control in power systems. The results are based on use of a novel approach to dynamic load modelling using aggregate nonlinear structures. In general, the model for the transmission network and supply end dynamics is of the hybrid differential - algebraic - discrete kind. Various stability questions are precisely formulated and analysed in terms of network and load characteristics (steady-state and transient). The results are shown to be a useful framework for deriving criteria of the where, when and how much kind for various control actions such as load Thedding and tap-blocking. (author) 47 refs., 15 figs., 1 tab.

A novel concept of fault current limiter based on saturable core in high voltage DC transmission system

Science.gov (United States)

Yuan, Jiaxin; Zhou, Hang; Gan, Pengcheng; Zhong, Yongheng; Gao, Yanhui; Muramatsu, Kazuhiro; Du, Zhiye; Chen, Baichao

2018-05-01

To develop mechanical circuit breaker in high voltage direct current (HVDC) system, a fault current limiter is required. Traditional method to limit DC fault current is to use superconducting technology or power electronic devices, which is quite difficult to be brought to practical use under high voltage circumstances. In this paper, a novel concept of high voltage DC transmission system fault current limiter (DCSFCL) based on saturable core was proposed. In the DCSFCL, the permanent magnets (PM) are added on both up and down side of the core to generate reverse magnetic flux that offset the magnetic flux generated by DC current and make the DC winding present a variable inductance to the DC system. In normal state, DCSFCL works as a smoothing reactor and its inductance is within the scope of the design requirements. When a fault occurs, the inductance of DCSFCL rises immediately and limits the steepness of the fault current. Magnetic field simulations were carried out, showing that compared with conventional smoothing reactor, DCSFCL can decrease the high steepness of DC fault current by 17% in less than 10ms, which verifies the feasibility and effectiveness of this method.

Clutch pressure estimation for a power-split hybrid transmission using nonlinear robust observer

Science.gov (United States)

Zhou, Bin; Zhang, Jianwu; Gao, Ji; Yu, Haisheng; Liu, Dong

2018-06-01

For a power-split hybrid transmission, using the brake clutch to realize the transition from electric drive mode to hybrid drive mode is an available strategy. Since the pressure information of the brake clutch is essential for the mode transition control, this research designs a nonlinear robust reduced-order observer to estimate the brake clutch pressure. Model uncertainties or disturbances are considered as additional inputs, thus the observer is designed in order that the error dynamics is input-to-state stable. The nonlinear characteristics of the system are expressed as the lookup tables in the observer. Moreover, the gain matrix of the observer is solved by two optimization procedures under the constraints of the linear matrix inequalities. The proposed observer is validated by offline simulation and online test, the results have shown that the observer achieves significant performance during the mode transition, as the estimation error is within a reasonable range, more importantly, it is asymptotically stable.

Square-Wave Voltage Injection Algorithm for PMSM Position Sensorless Control With High Robustness to Voltage Errors

DEFF Research Database (Denmark)

Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede

2017-01-01

relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...

Formation of 1.4 MeV runaway electron flows in air using a solid-state generator with 10 MV/ns voltage rise rate

Science.gov (United States)

Mesyats, G. A.; Pedos, M. S.; Rukin, S. N.; Rostov, V. V.; Romanchenko, I. V.; Sadykova, A. G.; Sharypov, K. A.; Shpak, V. G.; Shunailov, S. A.; Ul'masculov, M. R.; Yalandin, M. I.

2018-04-01

Fulfillment of the condition that the voltage rise time across an air gap is comparable with the time of electron acceleration from a cathode to an anode allows a flow of runaway electrons (REs) to be formed with relativistic energies approaching that determined by the amplitude of the voltage pulse. In the experiment described here, an RE energy of 1.4 MeV was observed by applying a negative travelling voltage pulse of 860-kV with a maximum rise rate of 10 MV/ns and a rise time of 100-ps. The voltage pulse amplitude was doubled at the cathode of the 2-cm-long air gap due to the delay of conventional pulsed breakdown. The above-mentioned record-breaking voltage pulse of ˜120 ps duration with a peak power of 15 GW was produced by an all-solid-state pulsed power source utilising pulse compression/sharpening in a multistage gyromagnetic nonlinear transmission line.

Offshore Transmission Technology

Energy Technology Data Exchange (ETDEWEB)

NONE

2012-10-15

The purpose of this document is to give an overview of offshore electricity transmission technologies. In particular this document is concerned with the use of High Voltage Direct Current (HVDC) systems and more specifically with the development of Voltage Source Converter (VSC) technology. This report outlines the current state of the main technology groups required for offshore HVDC transmission as well as giving examples of offshore projects (both current and future). Finally some indications of likely unit costs for HV assets are given.

Linear versus non-linear structural information limit in high-resolution transmission electron microscopy

International Nuclear Information System (INIS)

Van Aert, S.; Chen, J.H.; Van Dyck, D.

2010-01-01

A widely used performance criterion in high-resolution transmission electron microscopy (HRTEM) is the information limit. It corresponds to the inverse of the maximum spatial object frequency that is linearly transmitted with sufficient intensity from the exit plane of the object to the image plane and is limited due to partial temporal coherence. In practice, the information limit is often measured from a diffractogram or from Young's fringes assuming a weak phase object scattering beyond the inverse of the information limit. However, for an aberration corrected electron microscope, with an information limit in the sub-angstrom range, weak phase objects are no longer applicable since they do not scatter sufficiently in this range. Therefore, one relies on more strongly scattering objects such as crystals of heavy atoms observed along a low index zone axis. In that case, dynamical scattering becomes important such that the non-linear and linear interaction may be equally important. The non-linear interaction may then set the experimental cut-off frequency observed in a diffractogram. The goal of this paper is to quantify both the linear and the non-linear information transfer in terms of closed form analytical expressions. Whereas the cut-off frequency set by the linear transfer can be directly related with the attainable resolution, information from the non-linear transfer can only be extracted using quantitative, model-based methods. In contrast to the historic definition of the information limit depending on microscope parameters only, the expressions derived in this paper explicitly incorporate their dependence on the structure parameters as well. In order to emphasize this dependence and to distinguish from the usual information limit, the expressions derived for the inverse cut-off frequencies will be referred to as the linear and non-linear structural information limit. The present findings confirm the well-known result that partial temporal coherence has

Nonlinear absorption and transmission properties of Ge, Te and InAs using tuneable IR FEL

Energy Technology Data Exchange (ETDEWEB)

Amirmadhi, F.; Becker, K.; Brau, C.A. [Vanderbilt Univ., Nashville, TN (United States)

1995-12-31

Nonlinear absorption properties of Ge, Te and InAs are being investigated using the transmission of FEL optical pulses through these semiconductors (z-scan method). Wavelength, intensity and macropulse dependence are used to differentiate between two-photon and free-carrier absorption properties of these materials. Macropulse dependence is resolved by using a Pockles Cell to chop the 4-{mu}s macropulse down to 100 ns. Results of these experiments will be presented and discussed.

Response analysis on nonuniform transmission line

Directory of Open Access Journals (Sweden)

Cvetković Zlata

2005-01-01

Full Text Available Transients on a loss less exponential transmission line with a pure resistance load are presented in this paper. The approach is based on the two-port presentation of the transmission line. Using Picard-Carson's method the transmission line equations are solved. The relationship between source voltage and the load voltage in s-domain is derived. All the results are plotted using program package Mathematica 3.0.

Harmonic current interaction at a low voltage customer's installations

NARCIS (Netherlands)

Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.

2009-01-01

The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low

Transmission positron microscopes

International Nuclear Information System (INIS)

Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki

2006-01-01

Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons

Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects

International Nuclear Information System (INIS)

Braekevelt, P.N.

1991-01-01

Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized

Insulation co-ordination in high-voltage electric power systems

CERN Document Server

Diesendorf, W

2015-01-01

Insulation Co-ordination in High-Voltage Electric Power Systems deals with the methods of insulation needed in different circumstances. The book covers topics such as overvoltages and lightning surges; disruptive discharge and withstand voltages; self-restoring and non-self-restoring insulation; lightning overvoltages on transmission lines; and the attenuation and distortion of lightning surges. Also covered in the book are topics such as the switching surge designs of transmission lines, as well as the insulation coordination of high-voltage stations. The text is recommended for electrical en

Electric transmission technology

International Nuclear Information System (INIS)

Shah, K.R.

1990-01-01

Electric transmission technology has matured and can transmit bulk power more reliably and economically than the technology 10 years ago.In 1882, Marcel Depres transmitted 15 kW electric power at 2 kV, using a constant direct current; present transmission voltages have risen to ± 600 kV direct current (DC) and 765 kV alternating current (AC), and it is now possible to transmit bulk electric power at voltages as high as ± 1000 kV DC and 1500 kV AC. Affordable computer systems are now available to optimize transmission reliably. New materials have reduced the bulk of insulation for lines and equipment. New conducting materials and configurations have reduced losses in transmission. Advances in line structures and conductor motion, understanding of flashover characteristics of insulators and air-gaps and electrical performance of lines have resulted in more compact urban transmission lines. (author). 15 refs., 7 tabs., 11 figs

Global Harmonic Current Rejection of Nonlinear Backstepping Control with Multivariable Adaptive Internal Model Principle for Grid-Connected Inverter under Distorted Grid Voltage

Directory of Open Access Journals (Sweden)

Yang Yu

2013-01-01

Full Text Available Based on a brief review on current harmonics generation mechanism for grid-connected inverter under distorted grid voltage, the harmonic disturbances and uncertain items are immersed into the original state-space differential equation of grid-connected inverter. A new algorithm of global current harmonic rejection based on nonlinear backstepping control with multivariable internal model principle is proposed for grid-connected inverter with exogenous disturbances and uncertainties. A type of multivariable internal model for a class of nonlinear harmonic disturbances is constructed. Based on application of backstepping control law of the nominal system, a multivariable adaptive state feedback controller combined with multivariable internal model and adaptive control law is designed to guarantee the closed-loop system globally uniformly bounded, which is proved by a constructed Lyapunov function. The presented algorithm extends rejection of nonlinear single-input systems to multivariable globally defined normal form, the correctness and effectiveness of which are verified by the simulation results.

High-voltage direct-current circuit breakers

International Nuclear Information System (INIS)

Yoshioka, Y.; Hirasawa, K.

1991-01-01

This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system

High-output microwave detector using voltage-induced ferromagnetic resonance

International Nuclear Information System (INIS)

Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji

2014-01-01

We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque

Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

International Nuclear Information System (INIS)

Klofai, Yerima; Essimbi, B Z; Jaeger, D

2011-01-01

Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

Energy Technology Data Exchange (ETDEWEB)

Klofai, Yerima [Department of Physics, Higher Teacher Training College, University of Maroua, PO Box 46 Maroua (Cameroon); Essimbi, B Z [Department of Physics, Faculty of Science, University of Yaounde 1, PO Box 812 Yaounde (Cameroon); Jaeger, D, E-mail: bessimb@yahoo.fr [ZHO, Optoelectronik, Universitaet Duisburg-Essen, D-47048 Duisburg (Germany)

2011-10-15

Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

Directory of Open Access Journals (Sweden)

N Hatefi Kargan

2013-09-01

Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

Multi-Period Optimization for Voltage Control System in Transmission Grids

DEFF Research Database (Denmark)

Qin, Nan; Chen, Si; Liu, Chengxi

2015-01-01

Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...

A Direct Voltage Unbalance Compensation Strategy for Islanded Microgrids

DEFF Research Database (Denmark)

Zhao, Xin; Wu, Xiaohua; Meng, Lexuan

2015-01-01

and nonlinear loads. Moreover, by adjusting voltage references according to the amplitude of the negative sequence voltage, the unbalance factor, which is mainly caused by single phase generators/loads, can be mitigated to an extremely low value. Finally, an AC microgrid which includes three three-phase three...

Self-commutated high-voltage direct current transmission with DC circuit breakers. Backbone for the energy policy turnaround; Selbstgefuehrte Hochspannungs-Gleichstromuebertragung mit DC-Leistungsschalter. Rueckgrat fuer die Energiewende

Energy Technology Data Exchange (ETDEWEB)

Goerner, Raphael [ABB AG, Mannheim (Germany). Marketing und Vertrieb, Geschaeftsbereich Grid Systems

2013-06-01

The 'current war' between direct current and alternating current is extended by a new location. In the future, both technologies work together in order to provide a reliable power transmission in Germany and long-term in Europe. This is based on the self-guided high-voltage direct current transmission. In conjunction with direct current circuit breakers (DC circuit breaker) the power circuit breakers may help to make the transmission grids more flexible and to minimize losses.

Nonlinear gearshifts control of dual-clutch transmissions during inertia phase.

Science.gov (United States)

Hu, Yunfeng; Tian, Lu; Gao, Bingzhao; Chen, Hong

2014-07-01

In this paper, a model-based nonlinear gearshift controller is designed by the backstepping method to improve the shift quality of vehicles with a dual-clutch transmission (DCT). Considering easy-implementation, the controller is rearranged into a concise structure which contains a feedforward control and a feedback control. Then, robustness of the closed-loop error system is discussed in the framework of the input to state stability (ISS) theory, where model uncertainties are considered as the additive disturbance inputs. Furthermore, due to the application of the backstepping method, the closed-loop error system is ordered as a linear system. Using the linear system theory, a guideline for selecting the controller parameters is deduced which could reduce the workload of parameters tuning. Finally, simulation results and Hardware in the Loop (HiL) simulation are presented to validate the effectiveness of the designed controller. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Improving the Energy Market: Algorithms, Market Implications, and Transmission Switching

Science.gov (United States)

Lipka, Paula Ann

corresponding to the accuracy and AC-feasiblity of the solution. This linearization was tested on the IEEE and Polish systems, which range from 14 to 3375 buses and 20 to 4161 transmission lines. It had an accuracy of 0.5% or less for all but the 30-bus system. It also solved in linear time with CPLEX, while the non-linear version solved in O(n1.11) to O(n1.39). The sequential linearization is slower than the nonlinear formulation for smaller problems, but faster for larger problems, and its linear computational time means it would continue solving faster for larger problems. A major consideration to implementing algorithms to solve the optimal generator dispatch is ensuring that the resulting prices from the algorithm will support the market. Since the sequential linearization is linear, it is convex, its marginal values are well-defined, and there is no duality gap. The prices and settlements obtained from the sequential linearization therefore can be used to run a market. This market will include extra prices and settlements for reactive power and voltage, compared to the present-day market, which is based on real power. An advantage of this is that there is a very clear pool that can be used for reactive power/voltage support payments, while presently there is not a clear pool to take them out of. This method also reveals how valuable reactive power and voltage are at different locations, which can enable better planning of reactive resource construction. Transmission switching increases the feasible region of the generator dispatch, which means there may be a better solution than without transmission switching. Power flows on transmission lines are not directly controllable; rather, the power flows according to how it is injected and the physical characteristics of the lines. Changing the network topology changes the physical characteristics, which changes the flows. This means that sets of generator dispatch that may have previously been infeasible due to the flow

Mathematical modeling of agricultural fires beneath high voltage transmission lines

International Nuclear Information System (INIS)

El-Zohri, Emad H.; Shafey, Hamdy M.; Abdel-Salam, M.; Ahmed, A.

2011-01-01

This paper presents a mathematical model for agricultural fires based on a multi-phase formulation. The model includes dehydration and pyrolysis of agricultural fuel and pyrolysis products. The model considers a homogeneous distribution of the agricultural solid fuel particles, interacting with the gas flow via source terms. These terms include: drag forces, production of water vapour and pyrolysis products, radiative and convective heat exchange. A multi-phase radiative transfer equation for absorbing-emitting medium is considered to account for the radiative heat exchange between the gas and solid phases of the fire. The main outputs of the present model are most important to study the influence of agricultural fire occurring beneath high voltage transmission lines. The agricultural fire causes a flashover due to the ambient temperature rise and soot accumulation on the insulator of these transmission lines. Numerical results of the present model are obtained for flat grassland fires to study the effects of wind velocity, solid fuel moisture content and ignition length on some selected fire outputs. These outputs include the temperature, velocity, soot volume fraction fields of the gas phase, together with fire propagation rate and flame geometry. The numerical results are compared to the available experimental work in the literature. -- Research highlights: → The model is sensitive to the initial condition of the ignition length affecting the fire propagation rate and width. → The model predicts the effects of both the wind velocity and the fuel moisture content on fire propagation rate, in agreement with the available experimental work in the literature. → The model shows that both the wind velocity and the fuel moisture content are important factors affecting the fire plume thickness, location, and inclination. → The model is able to visualize the flame geometry through tracing radiative heat rates exceeding a threshold value for flame visibility (60 k

HVDC transmission preferred to 750 kV ac

Energy Technology Data Exchange (ETDEWEB)

1965-06-25

It is unlikely that there will be a need in Britain for ac transmission voltages above 400 kV. But with the growing load density in the large conurbations with no possibility of local generation, high voltage dc transmission is likely to be most useful. It was concluded that by 1971 the 400 kV supergrid would be nation-wide and 6,200 circuit miles should be in service. With the expansion to accommodate the large new generating stations, the 400 kV supergrid would become an extremely high power distribution network rather than a transmission system. A higher voltage for transmission is outside the rational limit of speculation for a country the size of Britain.

Quantifying transition voltage spectroscopy of molecular junctions: Ab initio calculations

DEFF Research Database (Denmark)

Chen, Jingzhe; Markussen, Troels; Thygesen, Kristian Sommer

2010-01-01

Transition voltage spectroscopy (TVS) has recently been introduced as a spectroscopic tool for molecular junctions where it offers the possibility to probe molecular level energies at relatively low bias voltages. In this work we perform extensive ab initio calculations of the nonlinear current...

Transmission line capital costs

International Nuclear Information System (INIS)

Hughes, K.R.; Brown, D.R.

1995-05-01

The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

Effects of Cascaded Voltage Collapse and Protection of Many Induction Machine Loads upon Load Characteristics Viewed from Bulk Transmission System

Science.gov (United States)

Kumano, Teruhisa

As known well, two of the fundamental processes which give rise to voltage collapse in power systems are the on load tap changers of transformers and dynamic characteristics of loads such as induction machines. It has been well established that, comparing among these two, the former makes slower collapse while the latter makes faster. However, in realistic situations, the load level of each induction machine is not uniform and it is well expected that only a part of loads collapses first, followed by collapse process of each load which did not go into instability during the preceding collapses. In such situations the over all equivalent collapse behavior viewed from bulk transmission level becomes somewhat different from the simple collapse driven by one aggregated induction machine. This paper studies the process of cascaded voltage collapse among many induction machines by time simulation, where load distribution on a feeder line is modeled by several hundreds of induction machines and static impedance loads. It is shown that in some cases voltage collapse really cascades among induction machines, where the macroscopic load dynamics viewed from upper voltage level makes slower collapse than expected by the aggregated load model. Also shown is the effects of machine protection of induction machines, which also makes slower collapse.

Dynamic Pull-In Investigation of a Clamped-Clamped Nanoelectromechanical Beam under Ramp-Input Voltage and the Casimir Force

Directory of Open Access Journals (Sweden)

Amir R. Askari

2014-01-01

Full Text Available The influence of the Casimir excitation on dynamic pull-in instability of a nanoelectromechanical beam under ramp-input voltage is studied. The ramp-input actuation has applications in frequency sweeping of RF-N/MEMS. The presented model is nonlinear due to the inherent nonlinearity of electrostatics and the Casimir excitations as well as the geometric nonlinearity of midplane stretching. A Galerkin based reduced order modeling is utilized. It is found that the calculated dynamic pull-in ramp input voltage leads to dynamic pull-in step input voltage by increasing the slope of voltage-time diagram. This fact is utilized to verify the results of present study.

Method for conducting nonlinear electrochemical impedance spectroscopy

Science.gov (United States)

Adler, Stuart B.; Wilson, Jamie R.; Huff, Shawn L.; Schwartz, Daniel T.

2015-06-02

A method for conducting nonlinear electrochemical impedance spectroscopy. The method includes quantifying the nonlinear response of an electrochemical system by measuring higher-order current or voltage harmonics generated by moderate-amplitude sinusoidal current or voltage perturbations. The method involves acquisition of the response signal followed by time apodization and fast Fourier transformation of the data into the frequency domain, where the magnitude and phase of each harmonic signal can be readily quantified. The method can be implemented on a computer as a software program.

Voltage-Controlled Floating Resistor Using DDCC

Directory of Open Access Journals (Sweden)

M. Kumngern

2011-04-01

Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity

Directory of Open Access Journals (Sweden)

John H. Miller Jr.

2011-04-01

Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.

Nonlinear charge transport in bipolar semiconductors due to electron heating

International Nuclear Information System (INIS)

Molina-Valdovinos, S.; Gurevich, Yu.G.

2016-01-01

It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

Nonlinear charge transport in bipolar semiconductors due to electron heating

Energy Technology Data Exchange (ETDEWEB)

Molina-Valdovinos, S., E-mail: sergiom@fisica.uaz.edu.mx [Universidad Autónoma de Zacatecas, Unidad Académica de Física, Calzada Solidaridad esq. Paseo, La Bufa s/n, CP 98060, Zacatecas, Zac, México (Mexico); Gurevich, Yu.G. [Centro de Investigación y de Estudios Avanzados del IPN, Departamento de Física, Av. IPN 2508, México D.F., CP 07360, México (Mexico)

2016-05-27

It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

A GaAs planar Schottky varactor diode for left-handed nonlinear transmission line applications

International Nuclear Information System (INIS)

Dong Jun-Rong; Yang Hao; Tian Chao; Huang Jie; Zhang Hai-Ying

2012-01-01

The left-handed nonlinear transmission line (LH-NLTL) based on monolithic microwave integrated circuit (MMIC) technology possesses significant advantages such as wide frequency band, high operating frequency, high conversion efficiency, and applications in millimeter and submillimeter wave frequency multiplier. The planar Schottky varactor diode (PSVD) is a major limitation to the performance of the LH-NLTL frequency multiplier as a nonlinear component. The design and the fabrication of the diode for such an application are presented. An accurate large-signal model of the diode is proposed. A 16 GHz-39.6 GHz LH-NLTL frequency doubler using our large-signal model is reported for the first time. The measured maximum output powers of the 2nd harmonic are up to 8 dBm at 26.4 GHz, and above 0 dBm from 16 GHz to 39.6 GHz when the input power is 20 dBm. The application of the LH-NLTL frequency doubler furthermore validates the accuracy of the large-signal model of the PSVD. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Large third-order optical nonlinearity in vertically oriented mesoporous silica thin films embedded with Ag nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Tan, Min; Liu, Qiming, E-mail: qmliu@whu.edu.cn [Wuhan University, Key Laboratory of Artificial Micro- and Nano-structures of Ministry of Education, School of Physics and Technology (China)

2016-12-15

Taking advantage of the channel confinement of mesoporous films to prevent the agglomeration of Ag nanoparticles to achieve large third-order optical nonlinearity in amorphous materials, Ag-loaded composite mesoporous silica film was prepared by the electrochemical deposition method on ITO substrate. Ag ions were firstly transported into the channels of mesoporous film by the diffusion and binding force of channels, which were reduced to nanoparticles by applying suitable voltage. The existence and uniform distribution of Ag nanoparticles ranging in 1–10 nm in the mesoporous silica thin films were exhibited by UV spectrophotometer, X-ray powder diffraction (XRD), transmission electron microscopy (TEM), and X-ray photoelectron spectroscopy (XPS) measurements. The third-order optical nonlinearity induced by Ag nanoparticles was studied by the Z-scan technique. Due to the local field surface plasmon resonance, the maximum third-order nonlinear optical susceptibility of Ag-loaded composite mesoporous silica film is 1.53×10{sup −10} esu, which is 1000 times larger than that of the Ag-contained chalcogenide glasses which showed large nonlinearity in amorphous materials.

Determination of nonlinear resistance voltage-current relationships by measuring harmonics

Science.gov (United States)

Stafford, J. M.

1971-01-01

Test configuration measures harmonic signal amplitudes generated in nonlinear resistance. Vacuum-type voltmeter measures low frequency sinusoidal input signal amplitude and wave-analyzer measures amplitude of harmonic signals generated in junction. Input signal harmonics amplitude must not exceed that of harmonics generated in nonlinear resistance.

AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

Directory of Open Access Journals (Sweden)

Rui Li

2016-12-01

Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

Parallel plate transmission line transformer

NARCIS (Netherlands)

Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.

2011-01-01

A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the

75 FR 63826 - Transmission Infrastructure Program-TransWest Express Transmission Project Capacity

Science.gov (United States)

2010-10-18

... Administration (Western), a Federal power marketing administration of the United States Department of Energy (DOE... operates an integrated 17,000 circuit mile, high-voltage transmission system across 15 western states... transmission lines and related facilities with at least one terminus in Western's marketing area, that deliver...

Microwave integrated circuit for Josephson voltage standards

Science.gov (United States)

Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)

1980-01-01

A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.

Characteristics of a four element gyromagnetic nonlinear transmission line array high power microwave source

Energy Technology Data Exchange (ETDEWEB)

Johnson, J. M., E-mail: jared.johnson@ttu.edu; Reale, D. V.; Garcia, R. S.; Cravey, W. H.; Neuber, A. A.; Dickens, J. C.; Mankowski, J. J. [Center for Pulsed Power and Power Electronics Department of Electrical and Computer Engineering, Texas Tech University, Lubbock, Texas 79409 (United States); Krile, J. T. [Department of Electromagnetics and Sensor Systems, Naval Surface Warfare Center - Dahlgren Division, Dahlgren, Virginia 22448 (United States)

2016-05-15

In this paper, a solid-state four element array gyromagnetic nonlinear transmission line high power microwave system is presented as well as a detailed description of its subsystems and general output capabilities. This frequency agile S-band source is easily adjusted from 2-4 GHz by way of a DC driven biasing magnetic field and is capable of generating electric fields of 7.8 kV/m at 10 m correlating to 4.2 MW of RF power with pulse repetition frequencies up to 1 kHz. Beam steering of the array at angles of ±16.7° is also demonstrated, and the associated general radiation pattern is detailed.

Expansion of the high-voltage direct current transmission systems; Netzausbau mit Hochspannungs-Gleichstrom-Uebertragung

Energy Technology Data Exchange (ETDEWEB)

Spahic, Ervin; Benz, Thomas; Goerner, Raphael; Sass, Florian [ABB AG, Mannheim (Germany)

2012-12-15

In September 2010 the German federal government announced its energy concept for an environmentally friendly, reliable and affordable energy supply. This concept describes a ''path into the era of renewable energy'' up to the year 2050, with electricity production from photovoltaics and wind power taking centre stage. Since the expansion of renewable energy production is mainly taking place in the North (wind power) and the South (PV), this poses a great challenge to the electricity networks. It necessitates the expansion of power transmission systems, notably for transporting electricity generated by wind power in the North to the consumer centres in Western and Southern Germany. However, progress to this end has been very slow. For this reason a technical question now presents itself, namely whether high-voltage direct current technology could possibly offer a solution to the electricity transport problems associated with the energy turnaround.

Non-linear thermal fluctuations in a diode

NARCIS (Netherlands)

Kampen, N.G. van

As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being

High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC

Science.gov (United States)

Lizcano, M.

2017-01-01

High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.

Photonic surfaces for designable nonlinear power shaping

Energy Technology Data Exchange (ETDEWEB)

Biswas, Roshni, E-mail: rbiswas@usc.edu; Povinelli, Michelle L. [Ming Hsieh Department of Electrical Engineering, University of Southern California, Los Angeles, California 90089 (United States)

2015-02-09

We propose a method for designing nonlinear input-output power response based on absorptive resonances of nanostructured surfaces. We show that various power transmission trends can be obtained by placing a photonic resonance mode at the appropriate detuning from the laser wavelength. We demonstrate our results in a silicon photonic crystal slab at a laser wavelength of 808 nm. We quantify the overall spectral red shift as a function of laser power. The shift results from absorptive heating and the thermo-optic effect. We then demonstrate devices with increasing, decreasing, and non-monotonic transmission as a function of laser power. The transmission changes are up to 7.5 times larger than in unpatterned silicon. The strong nonlinear transmission is due to a combination of resonantly enhanced absorption, reduced thermal conductivity, and the resonant transmission lineshape. Our results illustrate the possibility of designing different nonlinear power trends within a single materials platform at a given wavelength of interest.

Photonic surfaces for designable nonlinear power shaping

International Nuclear Information System (INIS)

Biswas, Roshni; Povinelli, Michelle L.

2015-01-01

We propose a method for designing nonlinear input-output power response based on absorptive resonances of nanostructured surfaces. We show that various power transmission trends can be obtained by placing a photonic resonance mode at the appropriate detuning from the laser wavelength. We demonstrate our results in a silicon photonic crystal slab at a laser wavelength of 808 nm. We quantify the overall spectral red shift as a function of laser power. The shift results from absorptive heating and the thermo-optic effect. We then demonstrate devices with increasing, decreasing, and non-monotonic transmission as a function of laser power. The transmission changes are up to 7.5 times larger than in unpatterned silicon. The strong nonlinear transmission is due to a combination of resonantly enhanced absorption, reduced thermal conductivity, and the resonant transmission lineshape. Our results illustrate the possibility of designing different nonlinear power trends within a single materials platform at a given wavelength of interest

Reduction of Voltage Harmonics for Parallel-operated Inverters

DEFF Research Database (Denmark)

Zhong, Qing-Chang; Blaabjerg, Frede; Guerrero, Josep M.

2011-01-01

The inherent limitations of the conventional droop control scheme have recently been revealed and a robust droop controller to achieve exact proportional load sharing has been proposed. This paper continues the work with a strategy to improve the voltage quality so that the total harmonic...... distortion of the output voltage can be maintained small even when nonlinear loads are connected. Experimental results are provided to verify the analysis and design....

Effect of localized states on the current-voltage characteristics of metal-semiconductor contacts with thin interfacial layer

Science.gov (United States)

Chattopadhyay, P.

1994-10-01

The role of discrete localized states on the current-voltage characteristics of metal-semiconductor contact is examined. It is seen that, because of these localized states, the logarithmic current vs voltage characteristics become nonlinear. Such nonlinearity is found sensitive to the temperature, and the energy and density of the localized states. The predicted temperature dependence of barrier height and the current-voltage characteristics are in agreement with the experimental results of Aboelfotoh [ Phys. Rev. B39, 5070 (1989)].

An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

Science.gov (United States)

Tanaka, Kazuyuki; Sakashita, Tadashi

The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

Transmission Line Series Compensation for Wind Energy Transmission

International Nuclear Information System (INIS)

Palanichamy, C; Wong, Y C

2015-01-01

Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)

Giant, Voltage-Actuated Deformation of a Dielectric Elastomer under Dead Load

OpenAIRE

Huang, Jiangshui; Li, Tiefeng; Foo, Choon Chiang; Clarke, David R.; Zhu, Jian; Suo, Zhigang

2012-01-01

Far greater voltage-actuated deformation is achievable for a dielectric elastomer under equal-biaxial dead load than under rigid constraint usually employed. Areal strains of 488% are demonstrated. The dead load suppresses electric breakdown, enabling the elastomer to survive the snap-through electromechanical instability. The breakdown voltage is found to increase with the voltage ramp rate. A nonlinear model for viscoelastic dielectric elastomers is developed and shown to be consistent with...

AC transmission, with very high voltages and the 750 kV line

Energy Technology Data Exchange (ETDEWEB)

Bocker, H

1964-01-01

The economic case for adoption of extra-high voltages for transmitting electric power over distances of the order of 1000 km is discussed. Some special technical developments for solving the problems attached to such high voltages are briefly discussed, particularly in the fields of switching and transients suppression. The first 750-kV projects in Canada and Russia are mentioned. Equipment, e.g., bushings, transformers, etc., operating at such voltages are illustrated.

Modulation linearization of a frequency-modulated voltage controlled oscillator, part 3

Science.gov (United States)

Honnell, M. A.

1975-01-01

An analysis is presented for the voltage versus frequency characteristics of a varactor modulated VHF voltage controlled oscillator in which the frequency deviation is linearized by using the nonlinear characteristics of a field effect transistor as a signal amplifier. The equations developed are used to calculate the oscillator output frequency in terms of pertinent circuit parameters. It is shown that the nonlinearity exponent of the FET has a pronounced influence on frequency deviation linearity, whereas the junction exponent of the varactor controls total frequency deviation for a given input signal. A design example for a 250 MHz frequency modulated oscillator is presented.

Nonlinearity effect of electro-optical modulator response in double spread CDMA radio-over-fiber transmissions

Science.gov (United States)

Huang, Jen-Fa; Yen, Chih-Ta; Li, Tzung-Yen

2008-07-01

This study presents a double-spread code-division multiple-access (CDMA) scheme for radio-over-fiber (RoF) transmissions. The network coder/decoders (codecs) are implemented using arrayed-waveguide grating (AWG) routers coded with maximal-length sequence ( M-sequence) codes. The effects of phase-induced intensity noise (PIIN) and multiple-access interference (MAI) on the system performance are evaluated numerically for different values of the optical modulation index (OMI) during the nonlinear electro-optical modulator (EOM) response. At low OMI optical device noise is dominant, but at high OMI nonlinear effect becomes significant. Numerical result shows that the system performance is highly sensitive to the OMI. Therefore, specifying an appropriate value of the OMI is essential in optimizing the system performance. The influence of the degree of polarization (DOP) in the system is also discussed. By employing the scrambler in front of the balanced photo-detector, the system performance can be enhanced. The high-performance, low-cost characteristics of the double-spread CDMA render the scheme an ideal solution for radio-CDMA wireless system cascaded with optical CDMA network.

Application of Multipoint DC Voltage Control in VSC-MTDC System

Directory of Open Access Journals (Sweden)

Yang Xi

2013-01-01

Full Text Available The voltage-source-converter- (VSC- based multiterminal VSC-HVDC power transmission system (VSC-MTDC is an ideal approach to connect wind farm with power grid. Analyzing the characteristics of doubly fed induction generators as well as the basic principle and the control strategy of VSC-MTDC, a multiterminal DC voltage control strategy suitable for wind farm connected with VSC-MTDC is proposed. By use of PSCAD/EMTDC, the proposed control strategy is simulated, and simulation results show that using the proposed control strategy the conversion between constant power control mode and constant DC voltage control mode can be automatically implemented; thus the DC voltage stability control and reliable power output of wind farm can be ensured after the fault-caused outage of converter station controlled by constant DC voltage and under other faults. The simulation result shows that the model can fulfill multiterminal power transmission and fast response control.

Homotopy analysis approach for nonlinear piezoelectric vibration energy harvesting

Directory of Open Access Journals (Sweden)

Shahlaei-Far Shahram

2016-01-01

Full Text Available Piezoelectric energy harvesting from a vertical geometrically nonlinear cantilever beam with a tip mass subject to transverse harmonic base excitations is analyzed. One piezoelectric patch is placed on the slender beam to convert the tension and compression into electrical voltage. Applying the homotopy analysis method to the coupled electromechanical governing equations, we derive analytical solutions for the horizontal displacement of the tip mass and consequently the output voltage from the piezoelectric patch. Analytical approximation for the frequency response and phase of the geometrically forced nonlinear vibration system are also obtained. The research aims at a rigorous analytical perspective on a nonlinear problem which has previously been solely investigated by numerical and experimental methods.

Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

Science.gov (United States)

Xu, Kaili

Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also

Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band

International Nuclear Information System (INIS)

Fang Chao; Zhou Dongxiang; Gong Shuping

2010-01-01

A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.

The Characteristics of Vibration Isolation System with Damping and Stiffness Geometrically Nonlinear

Science.gov (United States)

Lu, Ze-Qi; Chen, Li-Qun; Brennan, Michael J.; Li, Jue-Ming; Ding, Hu

2016-09-01

The paper concerns an investigation into the use of both stiffness and damping nonlinearity in the vibration isolator to improve its effectiveness. The nonlinear damping and nonlinear stiffness are both achieved by horizontal damping and stiffness as the way of the geometrical nonlinearity. The harmonic balance method is used to analyze the force transmissibility of such vibration isolation system. It is found that as the horizontal damping increasing, the height of the force transmissibility peak is decreased and the high-frequency force transmissibility is almost the same. The results are also validated by some numerical method. Then the RMS of transmissibility under Gaussian white noise is calculated numerically, the results demonstrate that the beneficial effects of the damping nonlinearity can be achieved under random excitation.

High frequency relay protection channels on super high voltage lines

Energy Technology Data Exchange (ETDEWEB)

Mikutskii, G V

1964-08-01

General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.

Current-voltage model of LED light sources

DEFF Research Database (Denmark)

Beczkowski, Szymon; Munk-Nielsen, Stig

2012-01-01

Amplitude modulation is rarely used for dimming light-emitting diodes in polychromatic luminaires due to big color shifts caused by varying magnitude of LED driving current and nonlinear relationship between intensity of a diode and driving current. Current-voltage empirical model of light...

Dynamic voltage-current characteristics for a water jet plasma arc

International Nuclear Information System (INIS)

Yang Jiaxiang; Lan Sheng; Xu Zuoming

2008-01-01

A virtual instrument technology is used to measure arc current, arc voltage, dynamic V-I characteristics, and nonlinear conductance for a cone-shaped water jet plasma arc under ac voltage. Experimental results show that ac arc discharge mainly happens in water vapor evaporated from water when heated. However, due to water's cooling effect and its conductance, arc conductance, reignition voltage, extinguish voltage, and current zero time are very different from those for ac arc discharge in gas work fluid. These can be valuable to further studies on mechanism and characteristics of plasma ac discharge in water, and even in gas work fluid

Technique and Calculation Results of Currents and Voltages in the Circuits of the Measuring Element of the Protection Device of the Transmission Line Based on the Control of Transient Processes

Science.gov (United States)

Lachugin, V. F.; Kulikov, A. L.; Platonov, P. S.; Vucolov, V. Yu.

2017-12-01

The specifics of generation of the signals of current and voltage in the circuits of a directional element of wave relay protection during short circuit (SC) in overhead power transmission lines are considered. The computing method of transient processes in the protection circuits, including frequency filters, that attenuate the parameters of currents and voltages of the mode taking into account the higher harmonic components and probable deviations of the frequency of transmission line from the rated value is presented. It is revealed that it is advisable to implement the measuring circuits of the directional elements of wave relay protection with the three-section filter attenuating the frequencies from 45 to 55 Hz and the low pass filter with cutoff frequency that does not exceed 1 kHz.

Method and system for a gas tube-based current source high voltage direct current transmission system

Science.gov (United States)

She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di

2017-08-29

A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.

Fretting Wear Behaviors of Aluminum Cable Steel Reinforced (ACSR Conductors in High-Voltage Transmission Line

Directory of Open Access Journals (Sweden)

Xingchi Ma

2017-09-01

Full Text Available This work reports the fretting wear behavior of aluminum cable steel reinforced (ACSR conductors for use in high-voltage transmission line. Fretting wear tests of Al wires were conducted on a servo-controlled fatigue testing machine with self-made assistant apparatus, and their fretting process characteristics, friction force, wear damage, and wear surface morphology were detailed analyzed. The results show that the running regime of Al wires changes from a gross slip regime to a mixed regime more quickly as increasing contact load. With increasing amplitudes, gross slip regimes are more dominant under contact loads of lower than 30 N. The maximum friction force is relatively smaller in the NaCl solution than in a dry friction environment. The primary wear mechanisms in dry friction environments are abrasive wear and adhesive wear whereas abrasive wear and fatigue damage are dominant in NaCl solution.

Atlas transmission line breakdown analysis

CERN Document Server

Nielsen, K E; Ballard, E O; Elizondo, J M; Gribble, R F; McCuistian, B T; Parsons, W M

1999-01-01

The Atlas facility will use 24 radially converging, vertically oriented and tapered, oil insulated, triplate transmission lines between the Marx generators and the central load region. Among the requirements of the transmission lines are low inductance and high reliability. The inter-conductor gap is nominally 2 cm and the lines taper from a height of 1.75 m at the Marx end to 0.32 m at the output end. The aluminum conductors, held together by 20 insulating spacers, are assembled and inserted as a unit into radial oil-filled steel tanks. The negative, high-voltage, center conductor is 2.54-cm thick and the outer ground conductors are 1.59-cm thick. All 24 triplate transmission lines connect to a transition section at near 1 m radius that couples the transmission lines to a disk/conical solid- dielectric-insulated power flow channel transmission line terminating at the load. Peak operating voltage on the lines can be as high as 240 kV with an effective stress time of 0.8 mu s. Testing of small sections of the ...

A nonlinear analysis of the terahertz serpentine waveguide traveling-wave amplifier

International Nuclear Information System (INIS)

Li, Ke; Cao, Miaomiao; Liu, Wenxin; Wang, Yong

2015-01-01

A nonlinear model for the numerical simulation of terahertz serpentine waveguide traveling-wave tube (SW-TWT) is described. In this model, the electromagnetic wave transmission in the SW is represented as an infinite set of space harmonics to interact with an electron beam. Analytical expressions for axial electric fields in axisymmetric interaction gaps of SW-TWTs are derived and compared with the results from CST simulation. The continuous beam is treated as discrete macro-particles with different initial phases. The beam-tunnel field equations, space-charge field equations, and motion equations are combined to solve the beam-wave interaction. The influence of backward wave and relativistic effect is also considered in the series of equations. The nonlinear model is used to design a 340 GHz SW-TWT. Several favorable comparisons of model predictions with results from a 3-D Particle-in-cell simulation code CHIPIC are presented, in which the output power versus beam voltage and interaction periods are illustrated. The relative error of the predicted output power is less than 15% in the 3 dB bandwidth and the relative error of the saturated length is less than 8%.The results show that the 1-D nonlinear analysis model is appropriate to solve the terahertz SW-TWT operation characteristics

High-voltage pulsed generator for dynamic fragmentation of rocks.

Science.gov (United States)

Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

High-voltage pulsed generator for dynamic fragmentation of rocks

Science.gov (United States)

Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

Coiled transmission line pulse generators

Science.gov (United States)

McDonald, Kenneth Fox

2010-11-09

Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

Index-based reactive power compensation scheme for voltage regulation

Science.gov (United States)

Dike, Damian Obioma

2008-10-01

Increasing demand for electrical power arising from deregulation and the restrictions posed to the construction of new transmission lines by environment, socioeconomic, and political issues had led to higher grid loading. Consequently, voltage instability has become a major concern, and reactive power support is vital to enhance transmission grid performance. Improved reactive power support to distressed grid is possible through the application of relatively unfamiliar emerging technologies of "Flexible AC Transmission Systems (FACTS)" devices and "Distributed Energy Resources (DERS)." In addition to these infrastructure issues, a lack of situational awareness by system operators can cause major power outages as evidenced by the August 14, 2003 widespread North American blackout. This and many other recent major outages have highlighted the inadequacies of existing power system indexes. In this work, a novel "Index-based reactive compensation scheme" appropriate for both on-line and off-line computation of grid status has been developed. A new voltage stability index (Ls-index) suitable for long transmission lines was developed, simulated, and compared to the existing two-machine modeled L-index. This showed the effect of long distance power wheeling amongst regional transmission organizations. The dissertation further provided models for index modulated voltage source converters (VSC) and index-based load flow analysis of both FACTS and microgrid interconnected power systems using the Newton-Raphson's load flow model incorporated with multi-FACTS devices. The developed package has been made user-friendly through the embodiment of interactive graphical user interface and implemented on the IEEE 14, 30, and 300 bus systems. The results showed reactive compensation has system wide-effect, provided readily accessible system status indicators, ensured seamless DERs interconnection through new islanding modes and enhanced VSC utilization. These outcomes may contribute

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Directory of Open Access Journals (Sweden)

R. N. Bhowmik

2015-06-01

Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Science.gov (United States)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Phasor Alternatives to Friis’ Transmission Equation

DEFF Research Database (Denmark)

Franek, Ondrej

2018-01-01

Two alternatives to Friis’ transmission equation in terms of phasor voltage waves are presented. In one formulation antennas are characterized by the complex effective length vectors. An additional form introducing field gain, that serves effectively as a phasor counterpart to the power gain......, is proposed. Both forms show the same degree of symmetry and modularity as the original Friis’ equation, but thanks to using phasors instead of power quantities they allow for superposition of fields or voltages. Although the new transmission equations are formulated in frequency domain, they also constitute...

DESIGN AND IMPLEMENTATION OF POTENTIOMETER-BASED NONLINEAR TRANSDUCER EMULATOR

Directory of Open Access Journals (Sweden)

Sheroz Khan

2011-05-01

Full Text Available This work attempts to design and implement in hardware a transducer with a nonlinear response using potentiometer. Potentiometer is regarded as a linear transducer, while a the response of a nonlinear transducer can be treated as a concatenation of linear segments made out of the response curve of an actual nonlinear transducer at the points of inflections being exhibited by the nonlinear curve. Each straight line segment is characterized by its slope and a constant, called the y-intercept, which is ultimately realized by a corresponding electronic circuit. The complete circuit diagram is made of three stages: (i the input stage for range selection, (ii a digital logic to make appropriate selection, (iii a conditioning circuit for realizing a given straight-line segment identified by its relevant slope and reference voltage. The simulation of the circuit is carried using MULTISIM, and the designed circuit is afterward tested to verify that variations of the input voltage give us an output voltage very close to the response pattern envisaged in the analytical stage of the design. The utility of this work lies in its applications in emulating purpose built transducers that could be used to nicely emulate a transducer in a real world system that is to be controlled by a programmable digital system.

A high-voltage pulse generator for corona plasma generation

NARCIS (Netherlands)

Yan, K.; Heesch, van E.J.M.; Pemen, A.J.M.; Huijbrechts, P.A.H.J.; Gompel, van F.M.; Leuken, van H.E.M.; Matyas, Z.

2002-01-01

This paper discusses a high-voltage pulse generator for producing corona plasma. The generator consists of three resonant charging circuits, a transmission line transformer, and a triggered spark-gap switch. Voltage pulses in the order of 30-100 kV with a rise time of 10-20 ns, a pulse duration of

Direct harmonic voltage control strategy for shunt active power filter

DEFF Research Database (Denmark)

Munir, Hafiz Mudassir; Zou, JianXiao; Xie, Chuan

2017-01-01

generation system (DPGS) where the nonlinear loads are highly dispersed. Local harmonic voltage detection based Resistive-APF (R-APF) seems more suitable to be applied in the DPGS, however, R-APF suffers from poor compensation performance and difficulty of parameter tuning. In this paper, a direct harmonic...... voltage control strategy for the S-APF is proposed with local point of common coupling (PCC) voltage detection only. The control strategy design procedure is given in detail. Simulation is conducted in Matlab/Simulink to compare the performance between the R-APF and the proposed method. The results...

The account of sagging of wires at definition of specific potential factors of air High-Voltage Power Transmission Lines

Directory of Open Access Journals (Sweden)

Suslov V.M.

2005-12-01

Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.

76 FR 79206 - Commercial Renewable Energy Transmission on the Outer Continental Shelf (OCS) Offshore Mid...

Science.gov (United States)

2011-12-21

...-circuit, high-voltage direct current (HVDC) transmission line that would collect power generated by wind...-voltage alternating current into HVDC using voltage sourced converters. Each offshore converter platform... transmission grid at up to seven locations where AWC terrestrial converter stations would convert the HVDC...

Nonlinear estimation and control of automotive drivetrains

CERN Document Server

Chen, Hong

2014-01-01

Nonlinear Estimation and Control of Automotive Drivetrains discusses the control problems involved in automotive drivetrains, particularly in hydraulic Automatic Transmission (AT), Dual Clutch Transmission (DCT) and Automated Manual Transmission (AMT). Challenging estimation and control problems, such as driveline torque estimation and gear shift control, are addressed by applying the latest nonlinear control theories, including constructive nonlinear control (Backstepping, Input-to-State Stable) and Model Predictive Control (MPC). The estimation and control performance is improved while the calibration effort is reduced significantly. The book presents many detailed examples of design processes and thus enables the readers to understand how to successfully combine purely theoretical methodologies with actual applications in vehicles. The book is intended for researchers, PhD students, control engineers and automotive engineers. Hong Chen is a professor at the State Key Laboratory of Automotive Simulation and...

Voltage control of cavity magnon polariton

Energy Technology Data Exchange (ETDEWEB)

Kaur, S., E-mail: kaurs3@myumanitoba.ca; Rao, J. W.; Gui, Y. S.; Hu, C.-M., E-mail: hu@physics.umanitoba.ca [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); Yao, B. M. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); National Laboratory for Infrared Physics, Chinese Academy of Sciences, Shanghai 200083 (China)

2016-07-18

We have experimentally investigated the microwave transmission of the cavity-magnon-polariton (CMP) generated by integrating a low damping magnetic insulator onto a 2D microwave cavity. The high tunability of our planar cavity allows the cavity resonance frequency to be precisely controlled using a DC voltage. By appropriately tuning the voltage and magnetic bias, we can observe the cavity photon magnon coupling and the magnetic coupling between a magnetostatic mode and the generated CMP. The dispersion of the generated CMP was measured by either tuning the magnetic field or the applied voltage. This electrical control of CMP may open up avenues for designing advanced on-chip microwave devices that utilize light-matter interaction.

Electromagnetic pulses at the boundary of a nonlinear plasma

International Nuclear Information System (INIS)

Satorius, E.H.

1975-01-01

An investigation was made of the behavior of strong electromagnetic pulses at the boundary of a nonlinear, cold, collisionless, and uniform plasma. The nonlinearity considered here is due to the nonlinear terms in the fluid equation which is used to describe the plasma. Two cases are studied. First, the case where there is a voltage pulse applied across the plane boundary of a semi-infinite, nonlinear plasma. Two different voltage pulses are considered, i.e., a delta function pulse and a suddenly turned-on sinusoidal pulse. The resulting electromagnetic fields propagating in the nonlinear plasma are found in this case. In the second case, the reflection of incident E-polarized and H-polarized, electromagnetic pulses at various angles of incidence from a nonlinear, semi-infinite plasma are considered. Again, two forms of incident pulses are considered: a delta function pulse and a suddenly turned-on sinusoidal pulse. In case two, the reflected electromagnetic fields are found. In both cases, the method used for finding the fields is to first solve the fluid equation (which describes the plasma) for the nonlinear conduction current in terms of the electric field using a perturbation method (since the nonlinear effects are assumed to be small). Next, this current is substituted into Maxwell's equations, and finally the electromagnetic fields which satisfy the boundary conditions are found. (U.S.)

Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

Science.gov (United States)

Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

2011-11-30

We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

Compensation of nonlinearity in a fiber-optic transmission system using frequency-degenerate phase conjugation through counter-propagating dual pump FWM in a semiconductor optical amplifier

Science.gov (United States)

Anchal, Abhishek; K, Pradeep Kumar; O'Duill, Sean; Anandarajah, Prince M.; Landais, Pascal

2018-04-01

We present a scheme of frequency-degenerate mid-span spectral inversion (MSSI) for nonlinearity compensation in fiber-optic transmission systems. The spectral inversion is obtained by using counter-propagating dual pump four-wave mixing in a semiconductor optical amplifier (SOA). Frequency-degeneracy between signal and conjugate is achieved by keeping two pump frequencies symmetrical about the signal frequency. We simulate the performance of MSSI for nonlinearity compensation by scrutinizing the improvement of the Q-factor of a 200 Gbps QPSK signal transmitted over a standard single mode fiber, as a function of launch power for different span lengths and number of spans. We demonstrate a 7.5 dB improvement in the input power dynamic range and an almost 83% increase in the transmission length for optimum MSSI parameters of -2 dBm pump power and 400 mA SOA current.

Nonlinear effects in varactor-tuned resonators.

Science.gov (United States)

Everard, Jeremy; Zhou, Liang

2006-05-01

This paper describes the effects of RF power level on the performance of varactor-tuned resonator circuits. A variety of topologies are considered, including series and parallel resonators operating in both unbalanced and balanced modes. As these resonators were designed to produce oscillators with minimum phase noise, the initial small signal insertion loss was set to 6 dB and, hence, QL/Q0 = 1/2. To enable accurate analysis and simulation, S parameter and PSPICE models for the varactors were optimized and developed. It is shown that these resonators start to demonstrate nonlinear operation at very low power levels demonstrating saturation and lowering of the resonant frequency. On occasion squegging is observed for modified bias conditions. The nonlinear effects are dependent on the unloaded Q (Q0), the ratio of loaded to unloaded Q (QL/Q0), the bias voltage, and circuit configurations with typical nonlinear effects occurring at -8 dBm in a circuit with a loaded Q of 63 and a varactor bias voltage of 3 V. Analysis, simulation, and measurements that show close correlation are presented.

Wind Power Plant Voltage Stability Evaluation: Preprint

Energy Technology Data Exchange (ETDEWEB)

Muljadi, E.; Zhang, Y. C.

2014-09-01

Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

Reduced Order Extended Luenberger Observer Based Sensorless Vector Control Fed by Matrix Converter with Non-linearity Modeling

DEFF Research Database (Denmark)

Lee, Kyo-Beum; Blaabjerg, Frede

2004-01-01

This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with non-linearity compensation. The nonlinear voltage distortion that is caused by commutation delay and on-state voltage drop in switching device is corrected by a new...

Unidirectional reflection and invisibility in nonlinear media with an incoherent nonlinearity

Science.gov (United States)

Mostafazadeh, Ali; Oflaz, Neslihan

2017-11-01

We give explicit criteria for the reflectionlessness, transparency, and invisibility of a finite-range potential in the presence of an incoherent (intensity-dependent) nonlinearity that is confined to the range of the potential. This allows us to conduct a systematic study of the effects of such a nonlinearity on a locally periodic class of finite-range potentials that display perturbative unidirectional invisibility. We use our general results to examine the effects of a weak Kerr nonlinearity on the behavior of these potentials and show that the presence of nonlinearity destroys the unidirectional invisibility of these potentials. If the strength of the Kerr nonlinearity is so weak that the first-order perturbation theory is reliable, the presence of nonlinearity does not affect the unidirectional reflectionlessness and transmission reciprocity of the potential. We show that the expected violation of the latter is a second order perturbative effect.

Modeling generalized interline power-flow controller (GIPFC using 48-pulse voltage source converters

Directory of Open Access Journals (Sweden)

Amir Ghorbani

2018-05-01

Full Text Available Generalized interline power-flow controller (GIPFC is one of the voltage-source controller (VSC-based flexible AC transmission system (FACTS controllers that can independently regulate the power-flow over each transmission line of a multiline system. This paper presents the modeling and performance analysis of GIPFC based on 48-pulsed voltage-source converters. This paper deals with a cascaded multilevel converter model, which is a 48-pulse (three levels voltage source converter. The voltage source converter described in this paper is a harmonic neutralized, 48-pulse GTO converter. The GIPFC controller is based on d-q orthogonal coordinates. The algorithm is verified using simulations in MATLAB/Simulink environment. Comparisons between unified power flow controller (UPFC and GIPFC are also included. Keywords: Generalized interline power-flow controller (GIPFC, Voltage source converter (VCS, 48-pulse GTO converter

Non-linear dielectric monitoring of biological suspensions

International Nuclear Information System (INIS)

Treo, E F; Felice, C J

2007-01-01

Non-linear dielectric spectroscopy as a tool for in situ monitoring of enzyme assumes a non-linear behavior of the sample when a sinusoidal voltage is applied to it. Even many attempts have been made to improve the original experiments, all of them had limited success. In this paper we present upgrades made to a non-linear dielectric spectrometer developed and the results obtained when using different cells. We emphasized on the electrode surface, characterizing the grinding and polishing procedure. We found that the biological medium does not behave as expected, and the non-linear response is generated in the electrode-electrolyte interface. The electrochemistry of this interface can bias unpredictably the measured non-linear response

Analysis of operating conditions of the voltage transformer

Directory of Open Access Journals (Sweden)

Fastiy G. P.

2017-12-01

Full Text Available In electrical networks, constant monitoring of the electrical equipment operation is necessary. To accomplish this task, current transformers and voltage transformers (VT are used, on which the accuracy of electrical measurements, electricity metering, and the reliability of the emergency control system depend. The results of the analysis of the conditions for forming the magnetization of a voltage transformer in the mode with unilateral connection of overhead transmission lines, as well as variants of violations in the 110 kV network that may exist for a relatively long time have been presented. It should be noted that the considered network has its own peculiarities: the overhead transmission lines connected in series have a significant length and a low level of load, which may be a condition for the appearance of a transmission lines capacitive effect (the Ferranti effect, the latter can cause overvoltage. Overvoltage occurs when the operating modes are temporary in terms of operation, adverse combinations of network parameters take place, and can continue until the circuit and network modes change. Most often they appear in asymmetric modes, with short circuits to ground, etc. Asymmetric modes caused by incomplete-phase commutations and wire breaks on the overhead line, as well as wire breaks with subsequent disconnection of power transformers that can affect the voltage level on the VT have been considered. The possibility of VT magnetizing with a prolonged voltage rise in symmetric modes, namely, the manifestation of the Ferranti effect with various loads at substations up to complete switching-off and power transformers switching off has been investigated. The analysis of the measuring voltage transformer operating conditions has been based on materials provided by the "Kolenergo" services.

Model for the ready definition and approximate comparison of alternative high voltage transmission systems. Phases II and III. Application to electric systems within the contiguous United States. [800 and 1200 kV; 400, 600, and 800 kV dc

Energy Technology Data Exchange (ETDEWEB)

1979-08-01

Research on power delivery alternatives is reported. The first phase of this work was to develop a model of overhead transmission systems in the range of 362 to 1200 kV ac, and +-400 to +-800 kV dc. Such systems included transmission from generation to load and inter-connection of two large integrated systems, with and without the existence of an underlying lower voltage network in either case. This phase has been completed. The second and third phases involved application of the model to electric systems within selected regions of the US, and the entire US, respectively, dealing with real situations and including projected expansion to year 1987. The potential benefits and costs of using higher than existing transmission voltages were to be evaluated on this basis. Additionally, the most advantageous new voltage was to be determined taking into account direct and indirect benefits and costs. The results of the second and third phases are presented.

Non-linear time variant model intended for polypyrrole-based actuators

Science.gov (United States)

Farajollahi, Meisam; Madden, John D. W.; Sassani, Farrokh

2014-03-01

Polypyrrole-based actuators are of interest due to their biocompatibility, low operation voltage and relatively high strain and force. Modeling and simulation are very important to predict the behaviour of each actuator. To develop an accurate model, we need to know the electro-chemo-mechanical specifications of the Polypyrrole. In this paper, the non-linear time-variant model of Polypyrrole film is derived and proposed using a combination of an RC transmission line model and a state space representation. The model incorporates the potential dependent ionic conductivity. A function of ionic conductivity of Polypyrrole vs. local charge is proposed and implemented in the non-linear model. Matching of the measured and simulated electrical response suggests that ionic conductivity of Polypyrrole decreases significantly at negative potential vs. silver/silver chloride and leads to reduced current in the cyclic voltammetry (CV) tests. The next stage is to relate the distributed charging of the polymer to actuation via the strain to charge ratio. Further work is also needed to identify ionic and electronic conductivities as well as capacitance as a function of oxidation state so that a fully predictive model can be created.

LED-Based High-Voltage Lines Warning System

Directory of Open Access Journals (Sweden)

Eldar MUSA

2013-04-01

Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

Strongly nonlinear dynamics of electrolytes in large ac voltages

DEFF Research Database (Denmark)

Olesen, Laurits Højgaard; Bazant, Martin Z.; Bruus, Henrik

2010-01-01

to suppress the strongly nonlinear regime in the limit of concentrated electrolytes, ionic liquids, and molten salts. Beyond the model problem, our reduced equations for thin double layers, based on uniformly valid matched asymptotic expansions, provide a useful mathematical framework to describe additional...

Transmission Line Adapted Analytical Power Charts Solution

Science.gov (United States)

Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu

2017-08-01

The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

MOSFET-based high voltage short pulse generator for ultrasonic transducer excitation

Science.gov (United States)

Hidayat, Darmawan; Setianto, Syafei, Nendi Suhendi; Wibawa, Bambang Mukti

2018-02-01

This paper presents the generation of a high-voltage short pulse for the excitation of high frequency ultrasonic transducers. This is highly required in the purpose of various ultrasonic-based evaluations, particularly when high resolution measurement is necessary. A high voltage (+760 V) DC voltage source was pulsated by an ultrafast switching MOSFET which was driven by a pulse generator circuit consisting of an astable multivibrator, a one-shot multivibrator with Schmitt trigger input and a high current MOSFET driver. The generated pulses excited a 200-kHz and a 1-MHz ultrasonic transducers and tested in the transmission mode propagation to evaluate the performances of the generated pulse. The test results showed the generator were able to produce negative spike pulses up to -760 V voltage with the shortest time-width of 107.1 nanosecond. The transmission-received ultrasonic waves show frequency oscillation at 200 and 961 kHz and their amplitudes varied with the voltage of excitation pulse. These results conclude that the developed pulse generator is applicable to excite transducer for the generation of high frequency ultrasonic waves.

Planning aspects of ac extra high voltage lines

Energy Technology Data Exchange (ETDEWEB)

Engelhardt, H

1964-01-01

The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

Quasiperiodic AlGaAs superlattices for neuromorphic networks and nonlinear control systems

Energy Technology Data Exchange (ETDEWEB)

Malyshev, K. V., E-mail: malyshev@bmstu.ru [Electronics and Laser Technology Department, Bauman Moscow State Technical University, Moscow 105005 (Russian Federation)

2015-01-28

The application of quasiperiodic AlGaAs superlattices as a nonlinear element of the FitzHugh–Nagumo neuromorphic network is proposed and theoretically investigated on the example of Fibonacci and figurate superlattices. The sequences of symbols for the figurate superlattices were produced by decomposition of the Fibonacci superlattices' symbolic sequences. A length of each segment of the decomposition was equal to the corresponding figurate number. It is shown that a nonlinear network based upon Fibonacci and figurate superlattices provides better parallel filtration of a half-tone picture; then, a network based upon traditional diodes which have cubic voltage-current characteristics. It was found that the figurate superlattice F{sup 0}{sub 11}(1) as a nonlinear network's element provides the filtration error almost twice less than the conventional “cubic” diode. These advantages are explained by a wavelike shape of the decreasing part of the quasiperiodic superlattice's voltage-current characteristic, which leads to multistability of the network's cell. This multistability promises new interesting nonlinear dynamical phenomena. A variety of wavy forms of voltage-current characteristics opens up new interesting possibilities for quasiperiodic superlattices and especially for figurate superlattices in many areas—from nervous system modeling to nonlinear control systems development.

Mitigation of Flicker using STATCOM with Three-Level 12-pulse Voltage Source Inverter

OpenAIRE

Ali Z a'fari

2011-01-01

Voltage flicker is a disturbance in electrical power systems. The reason for this disturbance is mainly the large nonlinear loads such as electric arc furnaces. Synchronous static compensator (STATCOM) is considered as a proper technique to mitigate the voltage flicker. Application of more suitable and precise power electronic converter leads to a more precise performance of the compensator. In this paper a three-level 12-pulse voltage source inverter (VSI) with a 12-term...

Accurate determination of the voltage of a transmission electron ...

Indian Academy of Sciences (India)

The techniques established are found to be suitable for TEMs operating at a setting voltage of about 250 kV. For the TEM studies, a regular double-tilt specimen holder is required in order to be able to get to the desired zone axes. When the experiments were repeated using a cryogenic double-tilt holder, an improvement in ...

The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model

Directory of Open Access Journals (Sweden)

Marius Birlea

2012-08-01

Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.

A model of electric breakdown in polycrystalline semiconductors with highly nonlinear I - V characteristics

International Nuclear Information System (INIS)

Yildirim, E.H.; Tanatar, B.; Canessa, E.

1993-07-01

A deterministic algorithm to study the nonlinear current-voltage characteristics of polycrystalline semiconductors, such as ZnO-based metal oxide varistors, under dc bias and at room temperature is developed based on the electrical properties of individual grain boundaries. Assuming a thermionic emission type mechanism between individual grains and a nonuniform distribution of barrier heights at grain boundaries, the set of nonlinear Kirchhoff equations that determines the macroscopic current across the specimen and the nonlinearity coefficient α is solved numerically. The applied voltage dependence of the barrier height is found to be crucial to obtain α values reaching ∼50, indicating high nonlinearity as required by potential commercial applications. (author). 20 refs, 3 figs

Single-step emulation of nonlinear fiber-optic link with gaussian mixture model

DEFF Research Database (Denmark)

Borkowski, Robert; Doberstein, Andy; Haisch, Hansjörg

2015-01-01

We use a fast and low-complexity statistical signal processing method to emulate nonlinear noise in fiber links. The proposed emulation technique stands in good agreement with the numerical NLSE simulation for 32 Gbaud DP-16QAM nonlinear transmission.......We use a fast and low-complexity statistical signal processing method to emulate nonlinear noise in fiber links. The proposed emulation technique stands in good agreement with the numerical NLSE simulation for 32 Gbaud DP-16QAM nonlinear transmission....

The eGo grid model: An open source approach towards a model of German high and extra-high voltage power grids

Science.gov (United States)

Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen

2018-02-01

There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.

Boolean gates on actin filaments

International Nuclear Information System (INIS)

Siccardi, Stefano; Tuszynski, Jack A.; Adamatzky, Andrew

2016-01-01

Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

Boolean gates on actin filaments

Energy Technology Data Exchange (ETDEWEB)

Siccardi, Stefano, E-mail: ssiccardi@2ssas.it [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom); Tuszynski, Jack A., E-mail: jackt@ualberta.ca [Department of Oncology, University of Alberta, Edmonton, Alberta (Canada); Adamatzky, Andrew, E-mail: andrew.adamatzky@uwe.ac.uk [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom)

2016-01-08

Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

Science.gov (United States)

Cai, Yuanji; Guan, Yonggang; Liu, Weidong

2017-06-01

Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

Voltage Flicker Mitigation in Electric Arc Furnace using D-STATCOM

OpenAIRE

Deepthisree Madathil; Ilango Karuppasamy; Kirthika Devi V S; Manjula G Nair

2014-01-01

The major power quality issue of voltage flicker has resulted as a serious concern for the customers and heavy power companies. Voltage flicker is an impression of unsteadiness of visual sensation induced by a light source whose luminance fluctuates with time. This phenomenon is experienced when an Electric Arc Furnace (EAF) as load is connected to the power system. Flexible AC transmission devices (FACTS) devices were gradually utilized for voltage flicker reduction. In this paper the FACTS ...

Topology optimization of nonlinear optical devices

DEFF Research Database (Denmark)

Jensen, Jakob Søndergaard

2011-01-01

This paper considers the design of nonlinear photonic devices. The nonlinearity stems from a nonlinear material model with a permittivity that depends on the local time-averaged intensity of the electric field. A finite element model is developed for time-harmonic wave propagation and an incremen......This paper considers the design of nonlinear photonic devices. The nonlinearity stems from a nonlinear material model with a permittivity that depends on the local time-averaged intensity of the electric field. A finite element model is developed for time-harmonic wave propagation...... limiter. Here, air, a linear and a nonlinear material are distributed so that the wave transmission displays a strong sensitivity to the amplitude of the incoming wave....

Selective virtual capacitive impedance loop for harmonics voltage compensation in islanded microgrids

DEFF Research Database (Denmark)

Micallef, Alexander; Apap, Maurice; Spiteri-Staines, Cyril

2013-01-01

Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead of in...... resistance for selective harmonic compensation in islanded microgrids. Simulation results were given to show the suitability of the proposed algorithms in reducing the voltage harmonics at the PCC.......Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead...... of introducing additional active or passive filters into the system that could compromise the stability of the microgrid. However, the performance of these compensation loops becomes degraded when a virtual resistance is introduced with the aim to improve the overall stability of the parallel inverters...

Nonlinear dynamics modelling of multistage micro-planetary gear transmission

Directory of Open Access Journals (Sweden)

Li Jianying

2018-01-01

Full Text Available The transmission structure of a 2K-H multistage micro-planetary gear transmission reducer is described in detail, and three assumptions are supposed in dynamic modelling. On basis of these assumptions, a three stages 2K-H micro-planetary gear transmission dynamic model is established, in which the relative displacement each meshing gear pairs can be obtained after including the comprehensive transmission error. According to gear kinematics, the friction arms between the sun gear, the ring gear and the nth planet are also obtained, and the friction coefficient in the mixed elastohydrodynamic lubrication is considered, the transmission system motion differential equations are obtained, including above factors and the time-varying meshing stiffness, damping and backlash, inter-stage coupling stiffness, it can be provided an theoretical foundation for further analysing the parameter sensitivity, dynamic stability and designing.

Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

DEFF Research Database (Denmark)

Micallef, A.; Apap, M.; Spitero-Stanies, C.

2012-01-01

This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

: off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

Dissimilar trend of nonlinearity in ultrasound transducers and systems at resonance and non-resonance frequencies

DEFF Research Database (Denmark)

Ghasemi, Negareh; Zare, Firuz; Davari, Pooya

2017-01-01

Several factors can affect performance of an ultrasound system such as quality of excitation signal and ultrasound transducer behaviour. Nonlinearity of piezoelectric ultrasound transducers is a key determinant in designing a proper driving power supply. Although, the nonlinearity of piezoelectric...... was excited at different frequencies. Different excitation signals were generated using a linear power amplifier and a multilevel converter within a range of 30–200 V. Empirical relation was developed to express the resistance of the piezoelectric transducer as a nonlinear function of both excitation voltage...... and resonance frequency. The impedance measurements revealed that at higher voltage ranges, the piezoelectric transducer can be easily saturated. Also, it was shown that for the developed ultrasound system composed of two transducers (one transmitter and one receiver), the output voltage measured across...

Semisupervised Community Detection by Voltage Drops

Directory of Open Access Journals (Sweden)

Min Ji

2016-01-01

Full Text Available Many applications show that semisupervised community detection is one of the important topics and has attracted considerable attention in the study of complex network. In this paper, based on notion of voltage drops and discrete potential theory, a simple and fast semisupervised community detection algorithm is proposed. The label propagation through discrete potential transmission is accomplished by using voltage drops. The complexity of the proposal is OV+E for the sparse network with V vertices and E edges. The obtained voltage value of a vertex can be reflected clearly in the relationship between the vertex and community. The experimental results on four real networks and three benchmarks indicate that the proposed algorithm is effective and flexible. Furthermore, this algorithm is easily applied to graph-based machine learning methods.

Performance Improvement of Sensorless Vector Control for Induction Motor Drives Fed by Matrix Converter Using Nonlinear Model and Disturbance Observer

DEFF Research Database (Denmark)

Lee, Kyo-Beum; Blaabjerg, Frede

2004-01-01

This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with a non-linearity compensation and disturbance observer. The nonlinear voltage distortion that is caused by communication delay and on-state voltage drop in switching...

High-voltage test and measuring techniques

CERN Document Server

Hauschild, Wolfgang

2014-01-01

It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

Directory of Open Access Journals (Sweden)

Josef Burian

2012-12-01

Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

Advanced nonlinear control of three phase series active power filter

Directory of Open Access Journals (Sweden)

Abouelmahjoub Y.

2014-01-01

Full Text Available The problem of controlling three-phase series active power filter (TPSAPF is addressed in this paper in presence of the perturbations in the voltages of the electrical supply network. The control objective of the TPSAPF is twofold: (i compensation of all voltage perturbations (voltage harmonics, voltage unbalance and voltage sags, (ii regulation of the DC bus voltage of the inverter. A controller formed by two nonlinear regulators is designed, using the Backstepping technique, to provide the above compensation. The regulation of the DC bus voltage of the inverter is ensured by the use of a diode bridge rectifier which its output is in parallel with the DC bus capacitor. The Analysis of controller performances is illustrated by numerical simulation in Matlab/Simulink environment.

Reconnection of the islanded portion of the CIGRE low voltage distribution network

DEFF Research Database (Denmark)

Bhutto, G.M.; Bak, Claus Leth; Somro, Duur M.

2016-01-01

Islanding is phenomena in which a part of the distribution grid is electrically disconnected from the main transmission system. Islanded operation is encouraged in order to operate the electrical power networks in reliable manners. However, the reliability of the small networks operating is island...... is less as compared to that of the grid connected system. The islanded portion of the distribution network can be reconnected to the transmission grid if the voltage magnitudes, voltage phase angles and the frequencies of the two systems are synchronized. The main objective of this paper is to facilitate...

Grid-forming VSC control in four-wire systems with unbalanced nonlinear loads

DEFF Research Database (Denmark)

Lliuyacca, Ruben; Mauricioa, Juan M.; Gomez-Exposito, Antonio

2017-01-01

A grid-forming voltage source converter (VSC) is responsible to hold voltage and frequency in autonomous operation of isolated systems. In the presence of unbalanced loads, a fourth leg is added to provide current path for neutral currents. In this paper, a novel control scheme for a four-leg VSC...... feeding unbalanced linear and nonlinear loads is proposed. The control is based on two control blocks. A main control commands the switching sequence to the three-phase VSC ensuring balanced three-phase voltage at the output; and an independent control to the fourth leg drives neutral currents that might...... response during system disturbances and mitigation of harmonics when nonlinear loads are present. Simulations and experimental results are presented to verify the performance of the proposed control strategy....

Local Dynamic Reactive Power for Correction of System Voltage Problems

Energy Technology Data Exchange (ETDEWEB)

Kueck, John D [ORNL; Rizy, D Tom [ORNL; Li, Fangxing [ORNL; Xu, Yan [ORNL; Li, Huijuan [University of Tennessee, Knoxville (UTK); Adhikari, Sarina [ORNL; Irminger, Philip [ORNL

2008-12-01

Distribution systems are experiencing outages due to a phenomenon known as local voltage collapse. Local voltage collapse is occurring in part because modern air conditioner compressor motors are much more susceptible to stalling during a voltage dip than older motors. These motors can stall in less than 3 cycles (.05s) when a fault, such as on the sub-transmission system, causes voltage to sag to 70 to 60%. The reasons for this susceptibility are discussed in the report. During the local voltage collapse, voltages are depressed for a period of perhaps one or two minutes. There is a concern that these local events are interacting together over larger areas and may present a challenge to system reliability. An effective method of preventing local voltage collapse is the use of voltage regulation from Distributed Energy Resources (DER) that can supply or absorb reactive power. DER, when properly controlled, can provide a rapid correction to voltage dips and prevent motor stall. This report discusses the phenomenon and causes of local voltage collapse as well as the control methodology we have developed to counter voltage sag. The problem is growing because of the use of low inertia, high efficiency air conditioner (A/C) compressor motors and because the use of electric A/C is growing in use and becoming a larger percentage of system load. A method for local dynamic voltage regulation is discussed which uses reactive power injection or absorption from local DER. This method is independent, rapid, and will not interfere with conventional utility system voltage control. The results of simulations of this method are provided. The method has also been tested at the ORNL s Distributed Energy Communications and Control (DECC) Laboratory using our research inverter and synchronous condenser. These systems at the DECC Lab are interconnected to an actual distribution system, the ORNL distribution system, which is fed from TVA s 161kV sub-transmission backbone. The test results

Nonlinear behavior of three-terminal graphene junctions at room temperature

International Nuclear Information System (INIS)

Kim, Wonjae; Riikonen, Juha; Lipsanen, Harri; Pasanen, Pirjo

2012-01-01

We demonstrate nonlinear behavior in three-terminal T-branch graphene devices at room temperature. A rectified nonlinear output at the center branch is observed when the device is biased by a push–pull configuration. Nonlinearity is assumed to arise from a difference in charge transfer through the metal–graphene contact barrier between two contacts. The sign of the rectification can be altered by changing the carrier type using the back-gate voltage. (paper)

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

Directory of Open Access Journals (Sweden)

Seok-Yong Lee

2009-03-01

Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Nonlinear Source Emulator

DEFF Research Database (Denmark)

Nguyen-Duy, Khiem

of a proposed NSE system with high dynamic performance. The goal of the work is to achieve a state-of-the art transient time of 10 µs. In order to produce the arbitrary nonlinear curve, the exponential function of a typical diode is used, but the diode can be replaced by other nonlinear curve reference...... of conductive common-mode current produced by the high rate of change of voltage over time (high dv/dt) at the NSE output. v/xvii The contributions of the thesis are based on the development of both units: the low Cio isolated power supply and the high dynamic performance NSE. Both units are investigated......-of-the-art dynamic performance among devices of the same kind. It also offers a complete solution for simulation of nonlinear source systems of different sizes, both in terrestrial and non-terrestrial applications. Key words: Current transformers, dc-dc power converters, hysteresis, parasitic capacitance, system...

Nonlinear behaviour of cantilevered carbon nanotube resonators based on a new nonlinear electrostatic load model

Science.gov (United States)

Farokhi, Hamed; Païdoussis, Michael P.; Misra, Arun K.

2018-04-01

The present study examines the nonlinear behaviour of a cantilevered carbon nanotube (CNT) resonator and its mass detection sensitivity, employing a new nonlinear electrostatic load model. More specifically, a 3D finite element model is developed in order to obtain the electrostatic load distribution on cantilevered CNT resonators. A new nonlinear electrostatic load model is then proposed accounting for the end effects due to finite length. Additionally, a new nonlinear size-dependent continuum model is developed for the cantilevered CNT resonator, employing the modified couple stress theory (to account for size-effects) together with the Kelvin-Voigt model (to account for nonlinear damping); the size-dependent model takes into account all sources of nonlinearity, i.e. geometrical and inertial nonlinearities as well as nonlinearities associated with damping, small-scale, and electrostatic load. The nonlinear equation of motion of the cantilevered CNT resonator is obtained based on the new models developed for the CNT resonator and the electrostatic load. The Galerkin method is then applied to the nonlinear equation of motion, resulting in a set of nonlinear ordinary differential equations, consisting of geometrical, inertial, electrical, damping, and size-dependent nonlinear terms. This high-dimensional nonlinear discretized model is solved numerically utilizing the pseudo-arclength continuation technique. The nonlinear static and dynamic responses of the system are examined for various cases, investigating the effect of DC and AC voltages, length-scale parameter, nonlinear damping, and electrostatic load. Moreover, the mass detection sensitivity of the system is examined for possible application of the CNT resonator as a nanosensor.

Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x

International Nuclear Information System (INIS)

Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O

2006-01-01

We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results

Preliminary Modeling of Permanent Magnet Probe Flowmeter for Voltage Signal Estimation

Energy Technology Data Exchange (ETDEWEB)

Jeong, Uiju; Kim, Sung Joong [Hanyang Univ., Seoul (Korea, Republic of); Jeong, Ji Young; Kim, Tae Joon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2013-10-15

An experimental study on performance analysis of the flowmeter has been performed. The study shows that sodium flow rate is linearly proportional to the induced voltage signal from the flowmeter under the turbulent flow condition. The experimental results support its availability in the PDRC system. But, the flowmeter should be able to measure sodium flow at low Reynolds number as well. That is because the PDRC system uses sodium natural convection for its operation. Thus, calibration of the flowmeter should be done at very low sodium flow rates. However, Von Weissenfluh et al. showed that the relationship between flow rate and measured voltage signal from the flowmeter may become non-linear at very low flow rates. The nonlinearity restricts the utilization of level sensor which provide reference flow rate in the calibration experiment. The primary objective of this study is to predict the sodium flow rate range where the induced voltage signals are linearly proportional to flow rates by estimating the induced voltage signals against sodium flow rates for a wide range of flows numerically. A commercial code FLUENT is adopted for the analysis of flow field. And MAXWELL which is an electromagnetic analysis software using a finite volume method has been used to analyze the magnetic field generated by permanent magnet of the flowmeter. The induced voltage signals have been estimated by coupling the sodium flow field and the magnetic field using FLUENT MHD module. It is expected that the PMPF voltage signals are linearly proportional to flow rates range of 0.0059 to 1.96 lps. This suggests that simple calibration technique using the linearity between flow rate and the voltage signal can be adopted in calibration of the PMPF.

Non-linear leak currents affect mammalian neuron physiology

Directory of Open Access Journals (Sweden)

Shiwei eHuang

2015-11-01

Full Text Available In their seminal works on squid giant axons, Hodgkin and Huxley approximated the membrane leak current as Ohmic, i.e. linear, since in their preparation, sub-threshold current rectification due to the influence of ionic concentration is negligible. Most studies on mammalian neurons have made the same, largely untested, assumption. Here we show that the membrane time constant and input resistance of mammalian neurons (when other major voltage-sensitive and ligand-gated ionic currents are discounted varies non-linearly with membrane voltage, following the prediction of a Goldman-Hodgkin-Katz-based passive membrane model. The model predicts that under such conditions, the time constant/input resistance-voltage relationship will linearize if the concentration differences across the cell membrane are reduced. These properties were observed in patch-clamp recordings of cerebellar Purkinje neurons (in the presence of pharmacological blockers of other background ionic currents and were more prominent in the sub-threshold region of the membrane potential. Model simulations showed that the non-linear leak affects voltage-clamp recordings and reduces temporal summation of excitatory synaptic input. Together, our results demonstrate the importance of trans-membrane ionic concentration in defining the functional properties of the passive membrane in mammalian neurons as well as other excitable cells.

Experimental Investigation of the Corona Discharge in Electrical Transmission due to AC/DC Electric Fields

Directory of Open Access Journals (Sweden)

Fuangpian Phanupong

2016-01-01

Full Text Available Nowadays, using of High Voltage Direct Current (HVDC transmission to maximize the transmission efficiency, bulk power transmission, connection of renewable power source from wind farm to the grid is of prime concern for the utility. However, due to the high electric field stress from Direct Current (DC line, the corona discharge can easily be occurred at the conductor surface leading to transmission loss. Therefore, the polarity effect of DC lines on corona inception and breakdown voltage should be investigated. In this work, the effect of DC polarity and Alternating Current (AC field stress on corona inception voltage and corona discharge is investigated on various test objects, such as High Voltage (HV needle, needle at ground plane, internal defect, surface discharge, underground cable without cable termination, cable termination with simulated defect and bare overhead conductor. The corona discharge is measured by partial discharge measurement device with high-frequency current transformer. Finally, the relationship between supply voltage and discharge intensity on each DC polarity and AC field stress can be successfully determined.

Quantum dynamics of a Josephson junction driven cavity mode system in the presence of voltage bias noise

Science.gov (United States)

Wang, Hui; Blencowe, M. P.; Armour, A. D.; Rimberg, A. J.

2017-09-01

We give a semiclassical analysis of the average photon number as well as photon number variance (Fano factor F ) for a Josephson junction (JJ) embedded microwave cavity system, where the JJ is subject to a fluctuating (i.e., noisy) bias voltage with finite dc average. Through the ac Josephson effect, the dc voltage bias drives the effectively nonlinear microwave cavity mode into an amplitude squeezed state (F Armour et al., Phys. Rev. Lett. 111, 247001 (2013), 10.1103/PhysRevLett.111.247001], but bias noise acts to degrade this squeezing. We find that the sensitivity of the Fano factor to bias voltage noise depends qualitatively on which stable fixed point regime the system is in for the corresponding classical nonlinear steady-state dynamics. Furthermore, we show that the impact of voltage bias noise is most significant when the cavity is excited to states with large average photon number.

Electrical transmission

Energy Technology Data Exchange (ETDEWEB)

Sayers, D P

1960-05-01

After briefly tracing the history of electricity transmission, trends in high voltage transmission and experiments being conducted on 650 kV are discussed. 5000 miles of the U.K. grid are operated at 132 kV and 1000 at 275 kV, ultimately to provide a super grid at 380 kV. Problems are insulation, radio interference and the cost of underground lines (16 times that of overhead lines). Also considered are the economics of the grid as a means of transporting energy and as a means of spreading the peak load over the power stations in the most efficient manner. Finally, the question of amenities is discussed.

Void formation in NiTi shape memory alloys by medium-voltage electron irradiation

International Nuclear Information System (INIS)

Schlossmacher, P.; Stober, T.

1995-01-01

In-situ electron irradiation experiments of NiTi shape memory alloys, using high-voltage transmission electron microscopes, result in amorphization of the intermetallic compound. In all of these experiments high-voltages more than 1.0 MeV had to be applied in order to induce the crystalline-to-amorphous transformation. To their knowledge no irradiation effects of medium-voltage electrons of e.g. 0.5 MeV have been reported in the literature. In this contribution, the authors describe void formation in two different NiTi shape memory alloys, resulting from in-situ electron irradiation, using a 300 kV electron beam in a transmission electron microscope. First evidence is presented that void formation is correlated with the total oxygen content of the alloys

Possibilities for Advanced Encoding Techniques at Signal Transmission in the Optical Transmission Medium

Directory of Open Access Journals (Sweden)

Filip Čertík

2016-01-01

Full Text Available This paper presents a possible simulation of negative effects in the optical transmission medium and an analysis for the utilization of different signal processing techniques at the optical signal transmission. An attention is focused on the high data rate signal transmission in the optical fiber influenced by linear and nonlinear environmental effects presented by the prepared simulation model. The analysis includes possible utilization of OOK, BPSK, DBPSK, BFSK, QPSK, DQPSK, 8PSK, and 16QAM modulation techniques together with RS, BCH, and LDPC encoding techniques for the signal transmission in the optical fiber. Moreover, the prepared simulation model is compared with real optical transmission systems. In the final part, a comparison of the selected modulation techniques with different encoding techniques and their implementation in real transmission systems is shown.

LIMIT SOLUTIONS OF EQUATIONS OF A DC HIGH-VOLTAGE CASCADE GENERATOR

Directory of Open Access Journals (Sweden)

V. O. Brzhezitsky

2015-04-01

Full Text Available In the paper the issue of calculating the high voltage cascade mode oscillator with a nonlinear load using the analytical method under different conditions of selection values of its components is presented. The peculiarity of the method of the study is that during multivariate calculations output parameters load generator remain unchanged. For high-voltage cascade direct current power found conditions under which can be significantly reduced high capacity capacitors cascade generator. The calculations show that acceptable for practical applications of high-voltage characteristics of cascade generators can be achieved with substantial reduction of the volume of their constituents, and thus substantial decline in their value.

Frequency pulling in a low-voltage medium-power gyrotron

Science.gov (United States)

Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun

2018-04-01

Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.

Nanopore Current Oscillations: Nonlinear Dynamics on the Nanoscale.

Science.gov (United States)

Hyland, Brittany; Siwy, Zuzanna S; Martens, Craig C

2015-05-21

In this Letter, we describe theoretical modeling of an experimentally realized nanoscale system that exhibits the general universal behavior of a nonlinear dynamical system. In particular, we consider the description of voltage-induced current fluctuations through a single nanopore from the perspective of nonlinear dynamics. We briefly review the experimental system and its behavior observed and then present a simple phenomenological nonlinear model that reproduces the qualitative behavior of the experimental data. The model consists of a two-dimensional deterministic nonlinear bistable oscillator experiencing both dissipation and random noise. The multidimensionality of the model and the interplay between deterministic and stochastic forces are both required to obtain a qualitatively accurate description of the physical system.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

Energy Technology Data Exchange (ETDEWEB)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Lightning-induced overvoltages in low-voltage systems

Energy Technology Data Exchange (ETDEWEB)

Hoeidalen, Hans Kristian

1997-12-31

Lightning-induced overvoltages (LIOs) are a main source of failures in low-voltage overhead line systems. This thesis deals mainly with calculations of LIOs aiming to enable the design of a proper voltage protection. Models for calculation of LIOs are adapted from the literature or developed based on measurements. The models used are believed to be fairly accurate for the first few microseconds, which is usually sufficient for predicting the maximum induced voltage in the system. The lightning channel is modelled by the Modified Transmission Line (MTL) model with the Transmission Line (TL) model as a special case. The coupling between the electrical fields from a lightning channel and an overhead line is modelled by Agrawal`s model. The attenuation of electrical fields over a lossy ground is modelled by Norton`s- or the Surface Impedance methods. The validity of all the applied models is analysed. In addition, measurements have been performed in order to develop models of distribution transformers and low-voltage power installation (LVPI) networks. Simple models of typical transformers and LVPIs are developed for calculations when specific data are unavailable. The practical range of values and its influence on the LIOs in a system is investigated. The main frequency range of interest related to LIOs is 10 kHz - 1 MHz in which all the models are accurate. The adapted or developed models are used to calculate LIOs in low-voltage systems. The influence of various key parameters in the system is investigated. Most important are the return stroke amplitude and rise time, the overhead line height and location, the termination of overhead line segments, neutral grounding, and the ground conductivity. 135 refs., 136 figs., 12 tabs.

Buck supplies output voltage ripple reduction using fuzzy control

Directory of Open Access Journals (Sweden)

Nicu BIZON

2007-12-01

Full Text Available Using the PWM control for switching power supplies the peaks EMI noise appear at the switching frequency and its harmonics. Using randomize or chaotic PWM control techniques in these systems the power spectrum is spread out in all frequencies band spectral emissions, but with a bigger ripple in the output voltage. The proposed nonlinear feedback control method, which induces chaos, is based by fuzzy rules that minimize the output voltage ripple. The feasibility and effectiveness of this relative simple method is shown by simulation. A comparison with the previous control method is included, too.

Low voltage-activated calcium channels gate transmitter release at the dorsal root ganglion sandwich synapse.

Science.gov (United States)

Rozanski, Gabriela M; Nath, Arup R; Adams, Michael E; Stanley, Elise F

2013-11-15

A subpopulation of dorsal root ganglion (DRG) neurons are intimately attached in pairs and separated solely by thin satellite glial cell membrane septa. Stimulation of one neuron leads to transglial activation of its pair by a bi-, purinergic/glutamatergic synaptic pathway, a transmission mechanism that we term sandwich synapse (SS) transmission. Release of ATP from the stimulated neuron can be attributed to a classical mechanism involving Ca(2+) entry via voltage-gated calcium channels (CaV) but via an unknown channel type. Specific blockers and toxins ruled out CaV1, 2.1 and 2.2. Transmission was, however, blocked by a moderate depolarization (-50 mV) or low-concentration Ni(2+) (0.1 mM). Transmission persisted using a voltage pulse to -40 mV from a holding potential of -80 mV, confirming the involvement of a low voltage-activated channel type and limiting the candidate channel type to either CaV3.2 or a subpopulation of inactivation- and Ni(2+)-sensitive CaV2.3 channels. Resistance of the neuron calcium current and SS transmission to SNX482 argue against the latter. Hence, we conclude that inter-somatic transmission at the DRG SS is gated by CaV3.2 type calcium channels. The use of CaV3 family channels to gate transmission has important implications for the biological function of the DRG SS as information transfer would be predicted to occur not only in response to action potentials but also to sub-threshold membrane voltage oscillations. Thus, the SS synapse may serve as a homeostatic signalling mechanism between select neurons in the DRG and could play a role in abnormal sensation such as neuropathic pain.

Nonlinear Control Structure of Grid Connected Modular Multilevel Converters

DEFF Research Database (Denmark)

Hajizadeh, Amin; Norum, Lars; Ahadpour Shal, Alireza

2017-01-01

in the prediction step in order to preserve the stochastic characteristics of a nonlinear system. In order to design adaptive robust control strategy and nonlinear observer, mathematical model of MMC using rotating d-q theory has been used. Digital time-domain simulation studies are carried out in the Matlab......This paper implements nonlinear control structure based on Adaptive Fuzzy Sliding Mode (AFSM) Current Control and Unscented Kalman Filter (UKF) to estimate the capacitor voltages from the measurement of arm currents of Modular Multilevel Converter (MMC). UKF use nonlinear unscented transforms....../Simulink environment to verify the performance of the overall proposed control structure during different case studies....

Distance Protection of Cross-Bonded Transmission Cable-Systems

DEFF Research Database (Denmark)

Bak, Claus Leth; F. Jensen, Christian

2014-01-01

In this paper the problems of protecting a cross-bonded cable system using distance protection are analysed. The combination of the desire to expand the high voltage transmission grid and the public's opinion towards new installations of overhead lines (OHL), more and more transmission cable syst...

Coplanar strips for Josephson voltage standard circuits

International Nuclear Information System (INIS)

Schubert, M.; May, T.; Wende, G.; Fritzsch, L.; Meyer, H.-G.

2001-01-01

We present a microwave circuit for Josephson voltage standards. Here, the Josephson junctions are integrated in a microwave transmission line designed as coplanar strips (CPS). The new layout offers the possibility of achieving a higher scale of integration and to considerably simplify the fabrication technology. The characteristic impedance of the CPS is about 50 Ω, and this should be of interest for programmable Josephson voltage standard circuits with SNS or SINIS junctions. To demonstrate the function of the microwave circuit design, conventional 10 V Josephson voltage standard circuits with 17000 Nb/AlO x /Nb junctions were prepared and tested. Stable Shapiro steps at the 10 V level were generated. Furthermore, arrays of 1400 SINIS junctions in this microwave layout exhibited first-order Shapiro steps. Copyright 2001 American Institute of Physics

A novel approach for voltage secure operation using Probabilistic Neural Network in transmission network

Directory of Open Access Journals (Sweden)

Santi Behera

2016-05-01

Full Text Available This work proposes a unique approach for improving voltage stability limit using a Probabilistic Neural Network (PNN classifier that gives corrective controls available in the system in the scenario of contingencies. The sensitivity of system is analyzed to identify weak buses with ENVCI evaluation approaching zero. The input to the classifier, termed as voltage stability enhancing neural network (VSENN classifier, for training are line flows and bus voltages near the notch point of the P–V curve and the output of the VSENN is a control variable. For various contingencies the control action that improves the voltage profile as well as stability index is identified and trained accordingly. The trained VSENN is finally tested for its robustness to improve load margin and ENVCI as well, apart from trained set of operating condition of the system along with contingencies. The proposed approach is verified in IEEE 39-bus test system.

A model for voltage collapse study considering load characteristics

Energy Technology Data Exchange (ETDEWEB)

Aguiar, L B [Companhia de Energia Eletrica da Bahia (COELBA), Salvador, BA (Brazil)

1994-12-31

This paper presents a model for analysis of voltage collapse and instability problem considering the load characteristics. The model considers fundamentally the transmission lines represented by exact from through the generalized constants A, B, C, D and the loads as function of the voltage, emphasizing the cases of constant power, constant current and constant impedance. the study treats of the system behavior on steady state and presents illustrative graphics about the problem. (author) 12 refs., 4 figs.

Nonlinear Dielectric Response of Water Treed XLPE Cable Insulation

Energy Technology Data Exchange (ETDEWEB)

Hvidsten, Sverre

1999-07-01

Condition assessment of XLPE power cables is becoming increasingly important for the utilities, due to a large number of old cables in service with high probability of failure caused by water tree degradation. The commercial available techniques are generally based upon measurements of the dielectric response, either by time (polarisation/depolarisation current or return voltage) or frequency domain measurements. Recently it has been found that a high number of water trees in XLPE insulated cables causes the dielectric response to increase more than linearly with increasing test voltage. This nonlinear feature of water tree degraded XLPE insulation has been suggested to be of a great importance, both for diagnostic purposes, and for fundamental understanding of the water tree phenomenon itself. The main purpose of this thesis have been to study the nonlinear feature of the dielectric response measured on watertreed XLPE insulation. This has been performed by dielectric response measurements in both time and frequency domain, numerical calculations of losses of simplified water tree models, and fmally water content and water permeation measurements on single water trees. The dielectric response measurements were performed on service aged cable samples and laboratory aged Rogowski type objects. The main reason for performing laboratory ageing was to facilitate diagnostic testing as a function of ageing time of samples containing mainly vented water trees. A new method, based upon inserting NaC1 particles at the interface between the upper semiconductive screen and the insulation, was found to successfully enhance initiation and growth of vented water trees. AC breakdown strength testing show that it is the vented water trees that reduce the breakdown level of both the laboratory aged test objects and service aged cable samples. Vented water treeing was found to cause the dielectric response to become nonlinear at a relatively low voltage level. However, the measured

Performance Evaluation of Three Different Inverter Configurations of DVR for Mitigation of Voltage Events

Directory of Open Access Journals (Sweden)

Miska Prasad

2016-12-01

Full Text Available The voltage events namely voltage sags and voltage swells represent the most common, frequent and important power quality events in today’s power system. Dynamic voltage restorer (DVR is one of the key components used to mitigate the supply voltage quality disturbances in terms of voltage sags and swells in the distribution system. It consists of an energy storage unit, a voltage source inverter, a filter, a coupling transformer and the control system. This paper presents three different inverter configurations of dynamic voltage restorer (DVR for mitigation of voltage events such as voltage sags and swells with sudden addition or removal of the nonlinear load. These three configurations are voltage source inverter based DVR (VSI-DVR, current source inverter based DVR (CSI-DVR and impedance or Z-source inverter based DVR (ZSI-DVR. The d-q control technique is used to control the operation of the DVR. The response of ZSI-DVR for mitigation of voltage sags and swells are investigated and compared with VSI-DVR and CSI-DVR using MATLAB/SIMULINK environment.

Experiences in simulating and testing coordinated voltage control provided by multiple wind power plants

Energy Technology Data Exchange (ETDEWEB)

Arlaban, T.; Alonso, O.; Ortiz, D. [Acciona Windpower S.A. (Spain); Peiro, J.; Rivas, R. [Red Electrica de Espana SAU (Spain); Quinonez-Varela, G.; Lorenzo, P. [Acciona Energia S.A. (Spain)

2011-07-01

This document presents some field tests performed in a transmission system node in order to check the adequacy of voltage control performance by multiple wind power plants, with an overall capacity of 395 MW. It briefly explains the Spanish TSO motivation towards new voltage control requirements and the necessity of performing such tests in order to set the most convenient voltage control parameters and to verify the stable operation. It presents how different the voltage control capability between modern wind turbines (DFIG) and older ones (SCIG) specifically retrofitted for voltage control is. (orig.)

Self-consistent nonlinear transmission line model of standing wave effects in a capacitive discharge

International Nuclear Information System (INIS)

Chabert, P.; Raimbault, J.L.; Rax, J.M.; Lieberman, M.A.

2004-01-01

It has been shown previously [Lieberman et al., Plasma Sources Sci. Technol. 11, 283 (2002)], using a non-self-consistent model based on solutions of Maxwell's equations, that several electromagnetic effects may compromise capacitive discharge uniformity. Among these, the standing wave effect dominates at low and moderate electron densities when the driving frequency is significantly greater than the usual 13.56 MHz. In the present work, two different global discharge models have been coupled to a transmission line model and used to obtain the self-consistent characteristics of the standing wave effect. An analytical solution for the wavelength λ was derived for the lossless case and compared to the numerical results. For typical plasma etching conditions (pressure 10-100 mTorr), a good approximation of the wavelength is λ/λ 0 ≅40 V 0 1/10 l -1/2 f -2/5 , where λ 0 is the wavelength in vacuum, V 0 is the rf voltage magnitude in volts at the discharge center, l is the electrode spacing in meters, and f the driving frequency in hertz

The super high-voltage as examined from the ecological viewpoint, particularly considering the risk of biological damages and public rights

International Nuclear Information System (INIS)

Ubisch, H. von.

1980-06-01

The power-transmission lines utilizing system voltages of 800 kV, are justified by the long distances of transmission. The lines interfere in the landscape and may also affect human beings. The voltage is put in relation to alternative ways of energy transmission and thereafter to lower voltages and other electrical phenomena which have similar biological effects in the society. Possible causal connections are examined and available protective measures are pointed out. The general picture will simplify the appraisement of the biological observations and the relevance and validity of the postulates of environmental damage. The position taken to the question by all parties will thus be facilitated. (GB)

Alternative approaches to transmission investment

Energy Technology Data Exchange (ETDEWEB)

Welch, J.L. [International Transmission Co., Detroit, MI (United States)

2004-07-01

The International Transmission Company (ITC) is an independent power transmission company that owns, operates and maintains the high voltage transmission system in southeastern Michigan. The company's current focus is on investing in the transmission infrastructure to improve reliability, relieve congestion, improve access to generation and reduce energy costs for consumers. There is a need for investment in power transmission. Trends indicate that power transactions are on the rise while transmission investment is lagging because pricing protocols are inadequate and there is no regional tariff mechanism to allocate the benefits of new investment. The presentation reviewed the applicability of FTRs to transmission owners and the pitfalls of participant funding pricing. It also outlined the regional benefit allocation mechanism (RBAM) with an illustrative example. It was concluded that existing pricing policies must be improved to address the growing need for transmission investment. RBAM is needed to help investors recover costs from project beneficiaries. figs.

Flexible AC transmission systems modelling and control

CERN Document Server

Zhang, Xiao-Ping; Pal, Bikash

2012-01-01

The extended and revised second edition of this successful monograph presents advanced modeling, analysis and control techniques of Flexible AC Transmission Systems (FACTS). The book covers comprehensively a range of power-system control problems: from steady-state voltage and power flow control, to voltage and reactive power control, to voltage stability control, to small signal stability control using FACTS controllers. In the six years since the first edition of the book has been published research on the FACTS has continued to flourish while renewable energy has developed into a mature and

Superconducting nanowires as nonlinear inductive elements for qubits

Science.gov (United States)

Ku, Jaseung; Manucharyan, Vladimir; Bezryadin, Alexey

2011-03-01

We report microwave transmission measurements of superconducting Fabry-Perot resonators, having a superconducting nanowire placed at a supercurrent antinode. As the plasma oscillation is excited, the supercurrent is forced to flow through the nanowire. The microwave transmission of the resonator-nanowire device shows a nonlinear resonance behavior, significantly dependent on the amplitude of the supercurrent oscillation. We show that such amplitude-dependent response is due to the nonlinearity of the current-phase relationship of the nanowire. The results are explained within a nonlinear oscillator model of the Duffing oscillator, in which the nanowire acts as a purely inductive element, in the limit of low temperatures and low amplitudes. The low-quality factor sample exhibits a ``crater'' at the resonance peak at higher driving power, which is due to dissipation. We observe a hysteretic bifurcation behavior of the transmission response to frequency sweep in a sample with a higher quality factor. The Duffing model is used to explain the Duffing bistability diagram. NSF DMR-1005645, DOE DO-FG02-07ER46453.

Multivariable polynomial fitting of controlled single-phase nonlinear load of input current total harmonic distortion

Science.gov (United States)

Sikora, Roman; Markiewicz, Przemysław; Pabjańczyk, Wiesława

2018-04-01

The power systems usually include a number of nonlinear receivers. Nonlinear receivers are the source of disturbances generated to the power system in the form of higher harmonics. The level of these disturbances describes the total harmonic distortion coefficient THD. Its value depends on many factors. One of them are the deformation and change in RMS value of supply voltage. A modern LED luminaire is a nonlinear receiver as well. The paper presents the results of the analysis of the influence of change in RMS value of supply voltage and the level of dimming of the tested luminaire on the value of the current THD. The analysis was made using a mathematical model based on multivariable polynomial fitting.

Nonlinear Deadbeat Current Control of a Switched Reluctance Motor

OpenAIRE

Rudolph, Benjamin

2009-01-01

High performance current control is critical to the success of the switched reluctance motor (SRM). Yet high motor phase nonlinearities in the SRM place extra burden on the current controller, rendering it the weakest link in SRM control. In contrast to linear motor control techniques that respond to current error, the deadbeat controller calculates the control voltage by the current command, phase current, rotor position and applied phase voltage. The deadbeat controller has demonstrated sup...

Improvement of Voltage Stability in Electrical Network by Using a STATCOM

Directory of Open Access Journals (Sweden)

Kamel MERINI

2014-02-01

Full Text Available This paper aims to clarify power flow without and with static synchronous compensator (STATCOM and searching the best location of STATCOM to improve voltage in the Algerian network. In daily operation where there are all kinds of disturbances such as voltage fluctuations, voltage sags, swells, voltage unbalances and harmonics. STATCOM is modeled as a controllable voltage source. To validate the effectiveness of the Newton-Raphson method algorithm was implemented to solve power flow equations in presence of STATCOM. Case studies are carried out on 59-bus Algerian network test to demonstrate the performance of proposed models. Simulation results show the effectiveness and capability of STATCOM in improving voltage regulation in transmission systems; moreover the power solution using the Newton-Raphson algorithm developed. The STATCOM and the detailed simulation are performed using Matlab program.

Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units

DEFF Research Database (Denmark)

Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede

2018-01-01

-area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...

Non-linear dielectric spectroscopy of microbiological suspensions

Science.gov (United States)

Treo, Ernesto F; Felice, Carmelo J

2009-01-01

Background Non-linear dielectric spectroscopy (NLDS) of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA) was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar measurements, but maximum were not

Non-linear dielectric spectroscopy of microbiological suspensions

Directory of Open Access Journals (Sweden)

Felice Carmelo J

2009-09-01

Full Text Available Abstract Background Non-linear dielectric spectroscopy (NLDS of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar

Influence of Wind Plant Ancillary Voltage Control on System Small Signal Stability

DEFF Research Database (Denmark)

Su, Chi; Chen, Zhe

2012-01-01

As a common tendency, large-scale wind farms are increasingly connected to the transmission system of modern power grids. This introduces some new challenges to the connected power systems, and the transmission system operators (TSOs) have to put some new requirements as part of the grid codes...... on the integration of wind farms. One common requirement to wind farms is the function of system voltage control which can be implemented in the grid-side convertor controller of a variable speed wind turbine. This ancillary voltage control provided by wind farms could have some influence on the system small signal...... stability. This paper implements an ancillary voltage control strategy on a direct-drive-full-convertor-based wind farm and studies its influence on the damping ratio values of the dominant oscillation mode within the connected power system. All the calculations and simulations are conducted in DIg...

Excitation of voltage oscillations in an induction voltage adder

Directory of Open Access Journals (Sweden)

Nichelle Bruner

2009-07-01

Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

Nonlinear dynamics of capacitive charging and desalination by porous electrodes

Science.gov (United States)

Biesheuvel, P. M.; Bazant, M. Z.

2010-03-01

The rapid and efficient exchange of ions between porous electrodes and aqueous solutions is important in many applications, such as electrical energy storage by supercapacitors, water desalination and purification by capacitive deionization, and capacitive extraction of renewable energy from a salinity difference. Here, we present a unified mean-field theory for capacitive charging and desalination by ideally polarizable porous electrodes (without Faradaic reactions or specific adsorption of ions) valid in the limit of thin double layers (compared to typical pore dimensions). We illustrate the theory for the case of a dilute, symmetric, binary electrolyte using the Gouy-Chapman-Stern (GCS) model of the double layer, for which simple formulae are available for salt adsorption and capacitive charging of the diffuse part of the double layer. We solve the full GCS mean-field theory numerically for realistic parameters in capacitive deionization, and we derive reduced models for two limiting regimes with different time scales: (i) in the “supercapacitor regime” of small voltages and/or early times, the porous electrode acts like a transmission line, governed by a linear diffusion equation for the electrostatic potential, scaled to the RC time of a single pore, and (ii) in the “desalination regime” of large voltages and long times, the porous electrode slowly absorbs counterions, governed by coupled, nonlinear diffusion equations for the pore-averaged potential and salt concentration.

Environmental impact of high voltage aerial transmission lines

International Nuclear Information System (INIS)

Silva, R.P.; Mouallen, M.C.; Quintella, S.E.A.

1989-01-01

The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig

Regional study on investment for transmission infrastructure in China based on the State Grid data

Science.gov (United States)

Wei, Wendong; Wu, Xudong; Wu, Xiaofang; Xi, Qiangmin; Ji, Xi; Li, Guoping

2017-03-01

Transmission infrastructure is an integral component of safeguarding the stability of electricity delivery. However, existing studies of transmission infrastructure mostly rely on a simple review of the network, while the analysis of investments remains rudimentary. This study conducted the first regionally focused analysis of investments in transmission infrastructure in China to help optimize its structure and reduce investment costs. Using State Grid data, the investment costs, under various voltages, for transmission lines and transformer substations are calculated. By analyzing the regional profile of cumulative investment in transmission infrastructure, we assess correlations between investment, population, and economic development across the regions. The recent development of ultra-high-voltage transmission networks will provide policy-makers new options for policy development.

Kerr nonlinearity mitigation in 5 × 28-GBd PDM16-QAM signal transmission over a dispersion-uncompensated link with backward-pumpeddistributed Raman amplification

DEFF Research Database (Denmark)

Sackey, I.; Da Ros, Francesco; Jazayerifar, M.

2014-01-01

We present experimental and numerical investigations of Kerr nonlinearity compensation in a 400-km standard single-mode fiber link with distributed Raman amplification with backward pumping. A dual-pump polarization-independent fiber-based optical parametric amplifier is used for mid-link spectra...... to numerical simulations with good agreement. It is also shown with simulations that a maximum transmission reach of 2400 km enabled by the optical phase conjugator is possible for the WDM signal...

Effect of Circuit Breaker Shunt Resistance on Chaotic Ferroresonance in Voltage Transformer

Directory of Open Access Journals (Sweden)

RADMANESH, H.

2010-08-01

Full Text Available Ferroresonance or nonlinear resonance is a complex electrical phenomenon, which may cause over voltages and over currents in the electrical power system which endangers the system reliability and continuous safe operating. This paper studies the effect of circuit breaker shunt resistance on the control of chaotic ferroresonance in a voltage transformer. It is expected that this resistance generally can cause ferroresonance dropout. For confirmation this aspect Simulation has been done on a one phase voltage transformer rated 100VA, 275kV. The magnetization characteristic of the transformer is modeled by a single-value two-term polynomial with q=7. The simulation results reveal that considering the shunt resistance on the circuit breaker, exhibits a great mitigating effect on ferroresonance over voltages. Significant effect on the onset of chaos, the range of parameter values that may lead to chaos along with ferroresonance voltages has been obtained and presented.

STUDY ON PERFORMANCE OF 21M 132kV TRANSMISSION TOWER WITH MEDIUM WIND INTENSITY

OpenAIRE

V. LAKSHMI; A. RAJAGOPALA RAO

2012-01-01

Electric Power is today playing an increasingly important role in the life of the community. In the electric power system the production and transmission of power are two predominant factors. For the purpose of transmission of electricity towers are the main medium with some wires at required distances and altitudes. The remotehydroelectric power plants have given rise to the need for extra high voltage. Prior to 1950, 150 kV electric transmission lines were considered and still higher voltag...

Real-time transient stabilization and voltage regulation of power generators with unknown mechanical power input

International Nuclear Information System (INIS)

Kenne, Godpromesse; Goma, Raphael; Nkwawo, Homere; Lamnabhi-Lagarrigue, Francoise; Arzande, Amir; Vannier, Jean Claude

2010-01-01

A nonlinear adaptive excitation controller is proposed to enhance the transient stability and voltage regulation of synchronous generators with unknown power angle and mechanical power input. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of relative angular speed, active electric power, infinite bus and generator terminal voltages. The operating conditions are computed online using the above physical available measurements, the terminal voltage reference value and the estimate of the mechanical power input. The proposed design is therefore capable of providing satisfactory voltage in the presence of unknown variations of the power system operating conditions. Using the concept of sliding mode equivalent control techniques, a robust decentralized adaptive controller which insures the exponential convergence of the outputs to the desired ones, is obtained. Real-time experimental results are reported, comparing the performance of the proposed adaptive nonlinear control scheme to one of the conventional AVR/PSS controller. The high simplicity of the overall adaptive control scheme and its robustness with respect to line impedance variation including critical unbalanced operating condition and temporary turbine fault, constitute the main positive features of the proposed approach.

Real-time transient stabilization and voltage regulation of power generators with unknown mechanical power input

Energy Technology Data Exchange (ETDEWEB)

Kenne, Godpromesse, E-mail: gokenne@yahoo.co [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun (Cameroon); Goma, Raphael, E-mail: raphael.goma@lss.supelec.f [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere, E-mail: homere.nkwawo@iutv.univ-paris13.f [Departement GEII, Universite Paris XIII, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Lamnabhi-Lagarrigue, Francoise, E-mail: lamnabhi@lss.supelec.f [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Arzande, Amir, E-mail: Amir.arzande@supelec.f [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Vannier, Jean Claude, E-mail: Jean-claude.vannier@supelec.f [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)

2010-01-15

A nonlinear adaptive excitation controller is proposed to enhance the transient stability and voltage regulation of synchronous generators with unknown power angle and mechanical power input. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of relative angular speed, active electric power, infinite bus and generator terminal voltages. The operating conditions are computed online using the above physical available measurements, the terminal voltage reference value and the estimate of the mechanical power input. The proposed design is therefore capable of providing satisfactory voltage in the presence of unknown variations of the power system operating conditions. Using the concept of sliding mode equivalent control techniques, a robust decentralized adaptive controller which insures the exponential convergence of the outputs to the desired ones, is obtained. Real-time experimental results are reported, comparing the performance of the proposed adaptive nonlinear control scheme to one of the conventional AVR/PSS controller. The high simplicity of the overall adaptive control scheme and its robustness with respect to line impedance variation including critical unbalanced operating condition and temporary turbine fault, constitute the main positive features of the proposed approach.

Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features.

Science.gov (United States)

Kasimova, M A; Granata, D; Carnevale, V

2016-01-01

Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.

Voltage stability evaluation of the Paraguayan system; Evaluacion de la estabilidad de tension del sistema paraguayo

Energy Technology Data Exchange (ETDEWEB)

Cardozo Sanchez, Freddy [Mirant Americas (United States); Fernandez Krekeler, Ubaldo [Administracion Nacional de Electricidad (ANDE), Asuncion (Paraguay)

2001-07-01

This document presents analyses of permanent status of the ANDE transmission system, seeking to evaluate the voltage stability and impact that would have possible reinforcements in 500 kV. The transmission under this new voltage level, besides to be a reinforcement to the system for satisfying the national demand, will permit the increase of energy exportation to Brazil, depending on the adopted reinforcement. The system current status and its evolution according to the planning of short and medium period are analysed. In the voltage stability evolution, static analysis techniques to draw the Q-V and P-V curves were used, as well as for determination of the system self-values and stability margins.

On the power amplifier nonlinearity in MIMO transmit beamforming systems

KAUST Repository

Qi, Jian

2012-03-01

In this paper, single-carrier multiple-input multiple-output (MIMO) transmit beamforming (TB) systems in the presence of high-power amplifier (HPA) nonlinearity are investigated. Specifically, due to the suboptimality of the conventional maximal ratio transmission/maximal ratio combining (MRT/MRC) under HPA nonlinearity, we propose the optimal TB scheme with the optimal beamforming weight vector and combining vector, for MIMO systems with nonlinear HPAs. Moreover, an alternative suboptimal but much simpler TB scheme, namely, quantized equal gain transmission (QEGT), is proposed. The latter profits from the property that the elements of the beamforming weight vector have the same constant modulus. The performance of the proposed optimal TB scheme and QEGT/MRC technique in the presence of the HPA nonlinearity is evaluated in terms of the average symbol error probability and mutual information with the Gaussian input, considering the transmission over uncorrelated quasi-static frequency-flat Rayleigh fading channels. Numerical results are provided and show the effects on the performance of several system parameters, namely, the HPA parameters, numbers of antennas, quadrature amplitude modulation modulation order, number of pilot symbols, and cardinality of the beamforming weight vector codebook for QEGT. © 2012 IEEE.

On the power amplifier nonlinearity in MIMO transmit beamforming systems

KAUST Repository

Qi, Jian; Aissa, Sonia

2012-01-01

In this paper, single-carrier multiple-input multiple-output (MIMO) transmit beamforming (TB) systems in the presence of high-power amplifier (HPA) nonlinearity are investigated. Specifically, due to the suboptimality of the conventional maximal ratio transmission/maximal ratio combining (MRT/MRC) under HPA nonlinearity, we propose the optimal TB scheme with the optimal beamforming weight vector and combining vector, for MIMO systems with nonlinear HPAs. Moreover, an alternative suboptimal but much simpler TB scheme, namely, quantized equal gain transmission (QEGT), is proposed. The latter profits from the property that the elements of the beamforming weight vector have the same constant modulus. The performance of the proposed optimal TB scheme and QEGT/MRC technique in the presence of the HPA nonlinearity is evaluated in terms of the average symbol error probability and mutual information with the Gaussian input, considering the transmission over uncorrelated quasi-static frequency-flat Rayleigh fading channels. Numerical results are provided and show the effects on the performance of several system parameters, namely, the HPA parameters, numbers of antennas, quadrature amplitude modulation modulation order, number of pilot symbols, and cardinality of the beamforming weight vector codebook for QEGT. © 2012 IEEE.

Spin-current emission governed by nonlinear spin dynamics.

Science.gov (United States)

Tashiro, Takaharu; Matsuura, Saki; Nomura, Akiyo; Watanabe, Shun; Kang, Keehoon; Sirringhaus, Henning; Ando, Kazuya

2015-10-16

Coupling between conduction electrons and localized magnetization is responsible for a variety of phenomena in spintronic devices. This coupling enables to generate spin currents from dynamical magnetization. Due to the nonlinearity of magnetization dynamics, the spin-current emission through the dynamical spin-exchange coupling offers a route for nonlinear generation of spin currents. Here, we demonstrate spin-current emission governed by nonlinear magnetization dynamics in a metal/magnetic insulator bilayer. The spin-current emission from the magnetic insulator is probed by the inverse spin Hall effect, which demonstrates nontrivial temperature and excitation power dependences of the voltage generation. The experimental results reveal that nonlinear magnetization dynamics and enhanced spin-current emission due to magnon scatterings are triggered by decreasing temperature. This result illustrates the crucial role of the nonlinear magnon interactions in the spin-current emission driven by dynamical magnetization, or nonequilibrium magnons, from magnetic insulators.

Wave propagation in elastic medium with heterogeneous quadratic nonlinearity

International Nuclear Information System (INIS)

Tang Guangxin; Jacobs, Laurence J.; Qu Jianmin

2011-01-01

This paper studies the one-dimensional wave propagation in an elastic medium with spatially non-uniform quadratic nonlinearity. Two problems are solved analytically. One is for a time-harmonic wave propagating in a half-space where the displacement is prescribed on the surface of the half-space. It is found that spatial non-uniformity of the material nonlinearity causes backscattering of the second order harmonic, which when combined with the forward propagating waves generates a standing wave in steady-state wave motion. The second problem solved is the reflection from and transmission through a layer of finite thickness embedded in an otherwise linearly elastic medium of infinite extent, where it is assumed that the layer has a spatially non-uniform quadratic nonlinearity. The results show that the transmission coefficient for the second order harmonic is proportional to the spatial average of the nonlinearity across the thickness of the layer, independent of the spatial distribution of the nonlinearity. On the other hand, the coefficient of reflection is proportional to a weighted average of the nonlinearity across the layer thickness. The weight function in this weighted average is related to the propagating phase, thus making the coefficient of reflection dependent on the spatial distribution of the nonlinearity. Finally, the paper concludes with some discussions on how to use the reflected and transmitted second harmonic waves to evaluate the variance and autocorrelation length of nonlinear parameter β when the nonlinearity distribution in the layer is a stochastic process.

Multivariable polynomial fitting of controlled single-phase nonlinear load of input current total harmonic distortion

Directory of Open Access Journals (Sweden)

Sikora Roman

2018-04-01

Full Text Available The power systems usually include a number of nonlinear receivers. Nonlinear receivers are the source of disturbances generated to the power system in the form of higher harmonics. The level of these disturbances describes the total harmonic distortion coefficient THD. Its value depends on many factors. One of them are the deformation and change in RMS value of supply voltage. A modern LED luminaire is a nonlinear receiver as well. The paper presents the results of the analysis of the influence of change in RMS value of supply voltage and the level of dimming of the tested luminaire on the value of the current THD. The analysis was made using a mathematical model based on multivariable polynomial fitting.

Power Quality Assessment in Real Shipboard Microgrid Systems under Unbalanced and Harmonic AC Bus Voltage

DEFF Research Database (Denmark)

Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz

2018-01-01

were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....

Puget Sound Area Electric Reliability Plan : Appendix E, Transmission Reinforcement Analysis.

Energy Technology Data Exchange (ETDEWEB)

United States. Bonneville Power Administration.

1992-04-01

The purpose of this appendix to the draft environmental impact statement (EIS) report is to provide an update of the latest study work done on transmission system options for the Puget Sound Area Electric Reliability Plan. Also included in the attachments to the EIS are 2 reports analyzing the voltage stability of the Puget Sound transmission system and a review by Power Technologies, Inc. of the BPA voltage stability analysis and reactive options. Five transmission line options and several reactive options are presently being considered as possible solutions to the PSAFRP by the Transmission Team. The first two line options would be built on new rights-of way adjacent (as much as possible) to existing corridors. The reactive options would optimize the existing transmission system capability by adding new stations for series capacitors and/or switchgear. The other three line options are rebuilds or upgrades of existing cross mountain transmission lines. These options are listed below and include a preliminary assessment of the additional transmission system reinforcement required to integrate the new facilities into the existing transmission system. Plans were designed to provide at least 500 MVAR reactive margin.

Percolation-enhanced nonlinear scattering from semicontinuous metal films

Science.gov (United States)

Breit, M.; von Plessen, G.; Feldmann, J.; Podolskiy, V. A.; Sarychev, A. K.; Shalaev, V. M.; Gresillon, S.; Rivoal, J. C.; Gadenne, P.

2001-03-01

Strongly enhanced second-harmonic generation (SHG), which is characterized by nearly isotropic distribution, is observed for gold-glass films near the percolation threshold. The diffuse-like SHG scattering, which can be thought of as nonlinear critical opalescence, is in sharp contrast with highly collimated linear reflection and transmission from these nanostructured semicontinuous metal films. Our observations, which can be explained by giant fluctuations of local nonlinear sources for SHG, verify recent predictions of percolation-enhanced nonlinear scattering.

Wireless data transmission from inside electromagnetic fields.

Science.gov (United States)

Huertas, José Ignacio; Barraza, Roberto; Echeverry, Julian Mauricio

2010-01-01

This paper describes analytical and experimental work developed to evaluate the effects of the electromagnetic fields produced by high-voltage lines (400 kV) on wireless data transmission at the 900MHz band. In this work the source of the data transmission is located inside the electromagnetic field and the reception station is located at different distances from the power lines. Different atmospheric conditions are considered.

Synchronization of uncertain chaotic systems using a single transmission channel

International Nuclear Information System (INIS)

Feng Yong; Yu Xinghuo; Sun Lixia

2008-01-01

This paper proposes a robust sliding mode observer for synchronization of uncertain chaotic systems with multi-nonlinearities. A new control strategy is proposed for the construction of the robust sliding mode observer, which can avoid the strict conditions in the design process of Walcott-Zak observer. A new method of multi-dimensional signal transmission via single transmission channel is proposed and applied to chaos synchronization of uncertain chaotic systems with multi-nonlinearities. The simulation results are presented to validate the method

A comprehensive analysis and hardware implementation of control strategies for high output voltage DC-DC boost power converter

OpenAIRE

Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel

2017-01-01

Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...

Characteristics of a large vacuum wave precursor on the SABRE voltage adder MITL and extraction ion diode

International Nuclear Information System (INIS)

Cuneo, M.E.; Hanson, D.L.; Menge, P.R.; Poukey, J.W.; Savage, M.E.

1994-01-01

SABRE (Sandia Accelerator and Beam Research Experiment) is a ten-cavity linear induction magnetically insulated voltage adder (6 MV, 300 kA) operated in positive polarity to investigate issues relevant to ion beam production and propagation for inertial confinement fusion. The voltage adder section is coupled to an applied-B extraction ion diode via a long coaxial output transmission line. Observations indicate that the power propagates in a vacuum wave prior to electron emission. After the electron emission threshold is reached, power propagates in a magnetically insulated wave. The precursor is observed to have a dominant impact on he turn-on, impedance history, and beam characteristics of applied-B ion diodes since the precursor voltage is large enough to cause electron emission at the diode from both the cathode feed and cathode tips. The amplitude of the precursor at the load (3--4.5 MV) is a significant fraction of the maximum load voltage (5--6 MV) because (1) the transmission line gaps ( ∼ 9 cm at output) and therefore impedances are relatively large, and hence the electric field threshold for electron emission (200 to 300 kV/cm) is not reached until well into the power pulse rise time; and (2) the rapidly falling forward wave and diode impedance reduces the ratio of main pulse voltage to precursor voltage. Experimental voltage and current data from the transmission line and the ion diode will be presented and compared with TWOQUICK (2-D electromagnetic PIC code) simulations and analytic models

High voltage direct current transmission converters, systems and DC grids

CERN Document Server

Jovcic, Dragan

2015-01-01

This comprehensive reference guides the reader through all HVDC technologies, including LCC (Line Commutated Converter), 2-level VSC and VSC HVDC based on modular multilevel converters (MMC) for an in-depth understanding of converters, system level design, operating principles and modeling. Written in a tutorial style, the book also describes the key principles of design, control, protection and operation of DC transmission grids, which will be substantially different from the practice with AC transmission grids. The first dedicated reference to the latest HVDC technologies and DC grid developments; this is an essential resource for graduate students and researchers as well as engineers and professionals working on the design, modeling and operation of DC grids and HVDC.

High-performance control of a three-phase voltage-source converter including feedforward compensation of the estimated load current

International Nuclear Information System (INIS)

Leon, Andres E.; Solsona, Jorge A.; Busada, Claudio; Chiacchiarini, Hector; Valla, Maria Ines

2009-01-01

In this paper a new control strategy for voltage-source converters (VSC) is introduced. The proposed strategy consists of a nonlinear feedback controller based on feedback linearization plus a feedforward compensation of the estimated load current. In our proposal an energy function and the direct-axis current are considered as outputs, in order to avoid the internal dynamics. In this way, a full linearization is obtained via nonlinear transformation and feedback. An estimate of the load current is feedforwarded to improve the performance of the whole system and to diminish the capacitor size. This estimation allows to obtain a more rugged and cheaper implementation. The estimate is calculated by using a nonlinear reduced-order observer. The proposal is validated through different tests. These tests include performance in presence of switching frequency, measurement filters delays, parameters uncertainties and disturbances in the input voltage.

Low-Frequency MEMS Electrostatic Vibration Energy Harvester With Corona-Charged Vertical Electrets and Nonlinear Stoppers

Science.gov (United States)

Lu, Y.; Cottone, F.; Boisseau, S.; Galayko, D.; Marty, F.; Basset, P.

2015-12-01

This paper reports for the first time a MEMS electrostatic vibration energy harvester (e-VEH) with corona-charged vertical electrets on its electrodes. The bandwidth of the 1-cm2 device is extended in low and high frequencies by nonlinear elastic stoppers. With a bias voltage of 46 V (electret@21 V + DC external source@25 V) between the electrodes, the RMS power of the device reaches 0.89 μW at 33 Hz and 6.6 μW at 428 Hz. The -3dB frequency band including the hysteresis is 223∼432 Hz, the one excluding the hysteresis 88∼166 Hz. We also demonstrate the charging of a 47 μF capacitor used for powering a wireless and autonomous temperature sensor node with a data transmission beyond 10 m at 868 MHz.

Manifestation of vortex depinning transition in nonlinear current-voltage characteristics of polycrystalline superconductor Y1-xPrxBa2Cu3O7-δ

International Nuclear Information System (INIS)

Rivera, V.A.G.; Stari, C.; Sergeenkov, S.; Marega, E.; Araujo-Moreira, F.M.

2008-01-01

We present our recent results on the temperature dependence of current-voltage characteristics for polycrystalline Y 1-x Pr x Ba 2 Cu 3 O 7-δ superconductors with x=0.0, 0.1 and 0.3. The experimental results are found to be reasonably well fitted for all samples by a power like law of the form V=R(I-I c ) a(T) . Here, we assume that a(T)=1+Φ 0 I C (T)/2πk B T and I C (T)=I C (0)(1-T/T C ) 3/2 for the temperature dependences of the power exponent and critical current, respectively. According to the theoretical interpretation of the obtained results, nonlinear deviation of our current-voltage characteristics curves from Ohmic behavior (with a(T C )=1) below T C is attributed to the manifestation of dissipation processes. They have a characteristic temperature T p defined via the power exponent as a(T p )=2 and are related to the current induced depinning of Abrikosov vortices. Both T C (x) and T p (x) are found to decrease with an increase of Pr concentration x reflecting deterioration of the superconducting properties of the doped samples

GECM-Based Voltage Stability Assessment Using Wide-Area Synchrophasors

Directory of Open Access Journals (Sweden)

Heng-Yi Su

2017-10-01

Full Text Available Voltage instability is a crucial issue in the secure operation of power grids. Several methods for voltage stability assessment were presented. Some of them are highly computationally intensive, while others are reported not to work properly under all circumstances. This paper proposes a new methodology based on the generator equivalent circuit model (GECM and the phasor measurement unit (PMU technology for online voltage stability monitoring of a power grid. First, the proposed methodology utilizes synchronized phasor (synchrophasor measurements to determine the impedance parameters of a transmission grid by means of the recursive least squares (RLS algorithm. Furthermore, it incorporates the dynamic models of generators to handle the cases with generator reactive power limit violations. After that, an enhanced voltage stability index with GECMs incorporated is developed for reliable and accurate voltage stability assessment. The proposed methodology was first demonstrated on several standard IEEE power systems, and then applied to a practical power system, the Taiwan power (Taipower system. The test results demonstrate the flexibility and effectiveness of the proposed methodology.

Nonlinear focal shift beyond the geometrical focus in moderately focused acoustic beams.

Science.gov (United States)

Camarena, Francisco; Adrián-Martínez, Silvia; Jiménez, Noé; Sánchez-Morcillo, Víctor

2013-08-01

The phenomenon of the displacement of the position along the axis of the pressure, intensity, and radiation force maxima of focused acoustic beams under increasing driving voltages (nonlinear focal shift) is studied for the case of a moderately focused beam. The theoretical and experimental results show the existence of this shift along the axis when the initial pressure in the transducer increases until the acoustic field reaches the fully developed nonlinear regime of propagation. Experimental data show that at high amplitudes and for moderate focusing, the position of the on-axis pressure maximum and radiation force maximum can surpass the geometrical focal length. On the contrary, the on-axis pressure minimum approaches the transducer under increasing driving voltages, increasing the distance between the positive and negative peak pressure in the beam. These results are in agreement with numerical KZK model predictions and the existed data of other authors and can be explained according to the effect of self-refraction characteristic of the nonlinear regime of propagation.

First 735 kV transmission, Manicouagan, Montreal

Energy Technology Data Exchange (ETDEWEB)

Cahill, L

1964-11-01

The 735 kV transmission network of Hydro Quebec is described giving reasons for choice of voltage, stability factors level of insulation, disposition of conductors, insulators, equipment used and state of readiness of the project.

Magnetic-field asymmetry of nonlinear thermoelectric and heat transport

International Nuclear Information System (INIS)

Hwang, Sun-Yong; Sánchez, David; López, Rosa; Lee, Minchul

2013-01-01

Nonlinear transport coefficients do not obey, in general, reciprocity relations. We here discuss the magnetic-field asymmetries that arise in thermoelectric and heat transport of mesoscopic systems. Based on a scattering theory of weakly nonlinear transport, we analyze the leading-order symmetry parameters in terms of the screening potential response to either voltage or temperature shifts. We apply our general results to a quantum Hall antidot system. Interestingly, we find that certain symmetry parameters show a dependence on the measurement configuration. (paper)

Method for Measuring Small Nonlinearities of Electric Characteristics

DEFF Research Database (Denmark)

Guldbrandsen, Tom; Meyer, Niels I; Schjær-Jacobsen, Jørgen

1965-01-01

A method is described for measuring very small deviations from linearity in electric characteristics. The measurement is based on the harmonics generated by the nonlinear element when subjected to a sine wave signal. A special bridge circuit is used to balance out the undesired harmonics...... of the signal generator together with the first harmonic frequency. The set-up measures the small-signal value and the first and second derivative with respect to voltage. The detailed circuits are given for measuring nonlinearities in Ohmic and capacitive components. In the Ohmic case, a sensitivity...

An FFT-accelerated time-domain multiconductor transmission line simulator

KAUST Repository

Bagci, Hakan

2010-02-01

A fast time-domain multiconductor transmission line (MTL) simulator for analyzing general MTL networks is presented. The simulator models the networks as homogeneous MTLs that are excited by external fields and driven/terminated/ connected by potentially nonlinear lumped circuitry. It hybridizes an MTL solver derived from time-domain integral equations (TDIEs) in unknown wave coefficients for each MTL with a circuit solver rooted in modified nodal analysis equations in unknown node voltages and voltage-source currents for each circuit. These two solvers are rigorously interfaced at MTL and circuit terminals, and the resulting coupled system of equations is solved simultaneously for all MTL and circuit unknowns at each time step. The proposed simulator is amenable to hybridization, is fast Fourier transform (FFT)-accelerated, and is highly accurate: 1) It can easily be hybridized with TDIE-based field solvers (in a fully rigorous mathematical framework) for performing electromagnetic interference and compatibility analysis on electrically large and complex structures loaded with MTL networks. 2) It is accelerated by an FFT algorithm that calculates temporal convolutions of time-domain MTL Green functions in only O(Ntlog2 N t) rather than O(Ntt2) operations, where N t is the number of time steps of simulation. Moreover, the algorithm, which operates on temporal samples of MTL Green functions, is indifferent to the method used to obtain them. 3) It approximates MTL voltages, currents, and wave coefficients, using high-order temporal basis functions. Various numerical examples, including the crosstalk analysis of a (twisted) unshielded twisted-pair (UTP)-CAT5 cable and the analysis of field coupling into UTP-CAT5 and RG-58 cables located on an airplane, are presented to demonstrate the accuracy, efficiency, and versatility of the proposed simulator. © 2010 IEEE.

Transmission performance of a 400 Gbit s−1 all-optical orthogonal frequency division multiplexing system

International Nuclear Information System (INIS)

Tang, Jing; Xia, Min; Li, Wei; Yang, Kecheng; Liu, Deming; Huang, Benxiong

2013-01-01

The performance of a 400 Gbit s −1 all-optical orthogonal frequency division multiplexing (AO-OFDM) transmission system is researched with the effects of chromatic dispersion, fiber nonlinearities and amplified spontaneous emission (ASE) noise. The numerical simulation results show that the AO-OFDM system can provide a higher spectral efficiency (SE) and a better sensitivity than a dense wavelength division multiplexing (DWDM) system. The accumulated dispersion tolerance of the system reaches 330 ps nm −1 . When transmitted over single-span 80 km single-mode fiber (SMF), AO-OFDM signals have a 1.5 dB power penalty at BER=10 −3 due to the fiber Kerr nonlinearities, and the receiver sensitivity of the AO-OFDM system is obviously degraded with increasing incident optical power. In multispan transmission, the interaction of the fiber Kerr nonlinearity with the ASE noise is analyzed. A 1320 km maximum transmission distance is realized at 0 dBm incident optical power. The transmission discount due to the ASE noise and fiber nonlinearities in the AO-OFDM system is calculated. Fiber Kerr nonlinearities impose a greater limitation on the performance of the AO-OFDM system for long-distance transmission. All results clearly indicate the feasibility of AO-OFDM technology for next generation 400 Gbit s −1 fiber communication and multiservice networks. (paper)

Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

Directory of Open Access Journals (Sweden)

Stanković Koviljka

2009-01-01

Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

DEFF Research Database (Denmark)

Mousazadeh, Seyyed Yousef; Jalilian, Alireza; Savaghebi, Mehdi

2017-01-01

In recent years, the harmonics and unbalance problem endanger the voltage and current quality of power systems due to increasing usage of nonlinear and unbalance loads. Using DG interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method...... is proposed to compensate voltage and current unbalance and harmonics using the Distributed Generation (DG) interfacing inverters. This method is applicable to both grid-connected and islanded microgrids. In the proposed method, not only the proper control of active and reactive powers can be achieved......) frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. The results show that depending on the compensation mode, the harmonics and unbalance compensation of DGs’ output current, MG’s injected current to the grid as well...

Offshore VSC-HVDC Networks : Impact on Transient Stability of AC Transmission Systems

NARCIS (Netherlands)

van der Meer, A.A.

2017-01-01

The transition towards a sustainable society calls for the massive deployment of renewable energy sources such as large wind parks located far offshore. High-voltage direct current transmission based on voltage sourced converter technology (VSC-HVDC) offers a wide range of technological benefits

Transmission line component testing for the ITER Ion Cyclotron Heating and Current Drive System

Science.gov (United States)

Goulding, Richard; Bell, G. L.; Deibele, C. E.; McCarthy, M. P.; Rasmussen, D. A.; Swain, D. W.; Barber, G. C.; Barbier, C. N.; Cambell, I. H.; Moon, R. L.; Pesavento, P. V.; Fredd, E.; Greenough, N.; Kung, C.

2014-10-01

High power RF testing is underway to evaluate transmission line components for the ITER Ion Cyclotron Heating and Current Drive System. The transmission line has a characteristic impedance Z0 = 50 Ω and a nominal outer diameter of 305 mm. It is specified to carry up to 6 MW at VSWR = 1.5 for 3600 s pulses, with transient voltages up to 40 kV. The transmission line is actively cooled, with turbulent gas flow (N2) used to transfer heat from the inner to outer conductor, which is water cooled. High voltage and high current testing of components has been performed using resonant lines generating steady state voltages of 35 kV and transient voltages up to 60 kV. A resonant ring, which has operated with circulating power of 6 MW for 1 hr pulses, is being used to test high power, low VSWR operation. Components tested to date include gas barriers, straight sections of various lengths, and 90 degree elbows. Designs tested include gas barriers fabricated from quartz and aluminum nitride, and transmission lines with quartz and alumina inner conductor supports. The latest results will be presented. This manuscript has been authored by UT-Battelle, LLC, under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy.

Voltage-controlled spin selection in a magnetic resonant tunneling diode.

Science.gov (United States)

Slobodskyy, A; Gould, C; Slobodskyy, T; Becker, C R; Schmidt, G; Molenkamp, L W

2003-06-20

We have fabricated all II-VI semiconductor resonant tunneling diodes based on the (Zn,Mn,Be)Se material system, containing dilute magnetic material in the quantum well, and studied their current-voltage characteristics. When subjected to an external magnetic field the resulting spin splitting of the levels in the quantum well leads to a splitting of the transmission resonance into two separate peaks. This is interpreted as evidence of tunneling transport through spin polarized levels, and could be the first step towards a voltage controlled spin filter.

The nonlinear carrier transport in a bipolar semiconductor sample

International Nuclear Information System (INIS)

Konin, A

2008-01-01

A theory of formation of the voltage across a bipolar semiconductor sample due to the current flow accounting for the energy band bending near the semiconductor surfaces is presented. The non-equilibrium space charge layers near the sample surfaces and the boundary conditions in the real metal-semiconductor junction have been taken into account. It is shown that the voltage-current relation of a thin sample at weak injection differs essentially from the classical Ohm's law and becomes nonlinear for certain semiconductor surface parameters. Complex voltage-current relations and the photo-induced electromotive force measurements allow determining the surface recombination rate in the real metal-semiconductor junction and the semiconductor surface potential

Nonlinear behaviors in a pulsed dielectric barrier discharge at atmospheric pressure

Energy Technology Data Exchange (ETDEWEB)

Zhang Jiao; Wang Yanhui, E-mail: wangyh@dlut.edu.cn; Wang Dezhen

2011-08-01

In this paper, the temporal nonlinear behaviors of pulsed dielectric barrier discharge in atmospheric helium are studied numerically by a one-dimensional fluid model. The results show that the common single-period pulsed discharge with two current pulses per single voltage pulse can take place over a broad parameter range. The rising and falling times of the voltage pulse can affect the discharge characteristics greatly. When the discharge is ignited by a pulse voltage with long rising and falling times, a single-period pulsed discharge with multiple current peaks can be observed. Under appropriate rising and falling times of the voltage pulse, a stable period-two discharge can occur over wide frequency and voltage ranges. Also this period-two discharge can exhibit different current and voltage characteristics with changing the duty cycle. With other parameters fixed, the pulsed DBD could be driven to chaos through period-doubling route by increasing either the falling time or the frequency of voltage pulse.

Control voltage and power fluctuations when connecting wind farms

Science.gov (United States)

Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

2015-12-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

Control voltage and power fluctuations when connecting wind farms

International Nuclear Information System (INIS)

Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana

2015-01-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve

Control voltage and power fluctuations when connecting wind farms

Energy Technology Data Exchange (ETDEWEB)

Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

2015-12-23

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

Harmonic voltage excess problem test and analysis in UHV and EHV grid particular operation mode

Science.gov (United States)

Lv, Zhenhua; Shi, Mingming; Fei, Juntao

2018-02-01

The test and analysis of the power quality of some 1000kV UHV transmission lines and 500kV EHV transmission lines is carried out. It is found that there is harmonic voltage excess problems when the power supply of the UHV and EHV voltage line is single-ended or single-loop, the problem basically disappeared after the operation mode change, different operating conditions, the harmonic current has not been greatly affected, indicating that the harmonic voltage changes mainly caused by the system harmonic impedance. With the analysis of MATLAB Simulink system model, it can be seen that there are specific harmonic voltage excess in the system under the specific operating mode, which results in serious distortion of the specific harmonic voltage. Since such phenomena are found in 500kV and 1000kV systems, it is suggested that the test evaluation work should be done under the typical mode of operation in 500kV, 1000kV Planning and construction process to prevent the occurrence of serious distortion and the regional harmonic current monitoring and suppression work should be done.

Nonlinear Mechanics of MEMS Rectangular Microplates under Electrostatic Actuation

KAUST Repository

Saghir, Shahid

2016-12-01

The first objective of the dissertation is to develop a suitable reduced order model capable of investigating the nonlinear mechanical behavior of von-Karman plates under electrostatic actuation. The second objective is to investigate the nonlinear static and dynamic behavior of rectangular microplates under small and large actuating forces. In the first part, we present and compare various approaches to develop reduced order models for the nonlinear von-Karman rectangular microplates actuated by nonlinear electrostatic forces. The reduced-order models aim to investigate the static and dynamic behavior of the plate under small and large actuation forces. A fully clamped microplate is considered. Different types of basis functions are used in conjunction with the Galerkin method to discretize the governing equations. First we investigate the convergence with the number of modes retained in the model. Then for validation purpose, a comparison of the static results is made with the results calculated by a nonlinear finite element model. The linear eigenvalue problem for the plate under the electrostatic force is solved for a wide range of voltages up to pull-in. In the second part, we present an investigation of the static and dynamic behavior of a fully clamped microplate. We investigate the effect of different non-dimensional design parameters on the static response. The forced-vibration response of the plate is then investigated when the plate is excited by a harmonic AC load superimposed to a DC load. The dynamic behavior is examined near the primary and secondary (superharmonic and subharmonic) resonances. The microplate shows a strong hardening behavior due to the cubic nonlinearity of midplane stretching. However, the behavior switches to softening as the DC load is increased. Next, near-square plates are studied to understand the effect of geometric imperfections of microplates. In the final part of the dissertation, we investigate the mechanical behavior of

Scheduling and Voltage Scaling for Energy/Reliability Trade-offs in Fault-Tolerant Time-Triggered Embedded Systems

DEFF Research Database (Denmark)

Pop, Paul; Poulsen, Kåre Harbo; Izosimov, Viacheslav

2007-01-01

-execution and dynamic voltage scaling-based low-power techniques are competing for the slack in the schedules. Our approach decides the voltage levels and start times of processes and the transmission times of messages, such that the transient faults are tolerated, the timing constraints of the application...

Analysis of a back flashover across insulator strings on a 115 kV transmission line tower by PSCAD

Directory of Open Access Journals (Sweden)

Worakit Anekthanasuwan

2015-09-01

Full Text Available Lightning striking on a transmission tower induces high ground potential rise and high voltage at tower arms in which potential is normally at ground level, and subsequently causes overvoltage across an insulator string. If this overvoltage is higher than the withstanding voltage of the insulator string according to the v-t (voltage-time curve, back flashover phenomena will occur and this event may cause outage. The main objective of this paper is to study the factors influencing the back flashover phenomena. The computer program PSCAD/EMTDC (Power System Computer Aided Design/Electromagnetic Transients including DC is used to simulate lightning striking on a transmission tower 115kV. Lightning current, transmission towers, ground resistance, insulator strings and back flashover phenomena are modeled. Main simulations are lightning striking on different towers, different soil resistivity, different lightning current magnitudes and wave shapes, different locations, and different phase angles of source voltage. Simulation results show that the higher tower encounters higher induced voltage. A back flashover occurs at the top tower arm easier than at the middle and lower arms. The higher soil resistivity induces higher voltage. The larger lightning current magnitude impacts on higher induced voltage. The longer rise time of lightning current generates lower induced voltage. Lightning strikes directly on tower generate higher voltage than that of striking on overhead ground wires.

High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

1993-01-01

During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

Voltage-carrying states in superconducting microstrips

International Nuclear Information System (INIS)

Stuivinga, M.E.C.

1983-01-01

When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

Science.gov (United States)

Agarwal, Ruchi; Singh, Sanjeev

2017-12-01

The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

Site Selection Strategy of Single-Frequency Tuned R-APF for Background Harmonic Voltage Damping in Power Systems

DEFF Research Database (Denmark)

Sun, Xiaofeng; Zeng, Jian; Chen, Zhe

2013-01-01

, and analyze the harmonic voltage propagation caused by the background harmonic voltage in power systems. Then, a new strategy is proposed for the site selection of resistive active power filter to damp the background harmonic voltage in power systems. Experiments have been performed to verify the theoretical......Series resonance between capacitance and line inductance may magnify background harmonic voltage and worsen the harmonic voltage distortion in power systems. To solve this problem, in this paper, the transmission line theory is used to set up the distributed parameter model of power system feeders...

Guinea_WADC00320_ADBG_Guinea_Electricity_Transmission_Network

Data.gov (United States)

United Nations Cartographic Section — Data for medium and high voltage transmission lines were compiled for the AICD study led by the World Bank. A variety of sources were consulted, including regional...

New trends in the development of high voltage technology

Energy Technology Data Exchange (ETDEWEB)

Aleksandrov, G N

1964-07-01

The question is raised as to what type of transmission should be developed to transfer power over long distances from the eastern to the western part of Russia, and what principles should be utilized to combine power transmission into single power system in the USSR. Aleksandrov indicates the need for higher voltage power transmission, and stresses that ac is more economical than dc. The author compares +-750 kV dc with 1000 kV ac. The economic comparison is conducted for the same level of insulation, and it is stated that it will result in the same amount of power transmitted. New insulation materials are mentioned, and wider use of fiberglass and other plastics is predicted.

Piezoelectric self sensing actuators for high voltage excitation

International Nuclear Information System (INIS)

Grasso, E; Totaro, N; Janocha, H; Naso, D

2013-01-01

Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)

Nonlinear vibration of an electrically actuated microresonator tuned by combined DC piezoelectric and electric actuations

International Nuclear Information System (INIS)

Zamanian, M; Khadem, S E

2010-01-01

This paper studies the nonlinear vibration of a clamped–clamped microresonator under combined electric and piezoelectric actuations. The electric actuation is induced by applying an AC–DC voltage between the microbeam and the electrode plate that lies on opposite sides of the microbeam, and the piezoelectric actuation is induced by applying the DC voltage between upper and lower sides of the piezoelectric layer deposited on the microbeam length. It is assumed that the neutral axis of bending is stretched when the microbeam is deflected. The equations of motion are derived using Newton's second law, and are solved using the multiple-scale perturbation method. It is shown that, depending on the value of DC electric and piezoelectric actuations, geometry and the bending stiffness of the system. A softening or hardening behavior may be realized. It demonstrates that nonlinear behavior of an electrically actuated microresonator may be tuned to a linear behavior by applying a convenient DC electric voltage to the piezoelectric layer, and so an undesirable shift of resonance frequency may be removed. If one lets the applied voltage to the piezoelectric layer be equal to zero, this paper would be an effort to tailor the linear and nonlinear stiffness coefficients of two layered electrically actuated microresonators without the assumption that the lengths of the two layers are equal

Performance Evaluation of UPQC under Nonlinear Unbalanced Load Conditions Using Synchronous Reference Frame Based Control

Science.gov (United States)

Kota, Venkata Reddy; Vinnakoti, Sudheer

2017-12-01

Today, maintaining Power Quality (PQ) is very important in the growing competent world. With new equipments and devices, new challenges are also being put before power system operators. Unified Power Quality Conditioner (UPQC) is proposed to mitigate many power quality problems and to improve the performance of the power system. In this paper, an UPQC with Fuzzy Logic controller for capacitor voltage balancing is proposed in Synchronous Reference Frame (SRF) based control with Modified Phased Locked Loop (MPLL). The proposed controller with SRF-MPLL based control is tested under non-linear and unbalanced load conditions. The system is developed in Matlab/Simulink and its performance is analyzed under various conditions like non-linear, unbalanced load and polluted supply voltage including voltage sag/swells. Active and reactive power flow in the system, power factor and %THD of voltages and currents before and after compensation are also analyzed in this work. Results prove the applicability of the proposed scheme for power quality improvement. It is observed that the fuzzy controller gives better performance than PI controller with faster capacitor voltage balancing and also improves the dynamic performance of the system.

Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films

International Nuclear Information System (INIS)

Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David

2007-01-01

We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching

Proximity effects of high voltage electric power transmission lines on ...

African Journals Online (AJOL)

Yomi

2010-08-18

Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.

A Broadband Ultrathin Nonlinear Switching Metamaterial

Directory of Open Access Journals (Sweden)

E. Zarnousheh Farahani

2017-05-01

Full Text Available In this paper, an ultrathin planar nonlinear metamaterial slab is designed and simulated. Nonlinearity is provided through placing diodes in each metamaterial unit cell. The diodes are auto-biased and activated by an incident wave. The proposed structure represents a broadband switching property between two transmission and reflection states depending on the intensity of the incident wave. High permittivity values are presented creating a near zero effective impedance at low power states, around the second resonant mode of the structure unit cell; as the result, the incident wave is reflected. Increasing the incident power to the level which can activate the loaded diodes in the structure results in elimination of the resonance and consequently a drop in the permittivity values near the permeability one as well as a switch to the transmission state. A full wave as well as a nonlinear simulations are performed. An optimization method based on weed colonization is applied to the unit cell of the metamaterial slab to achieve the maximum switching bandwidth. The structure represents a 24% switching bandwidth of a 10 dB reduction in the reflection coefficient.

Voltage regulator placement in radial distribution system using plant ...

African Journals Online (AJOL)

user

location and number along with tap setting of the voltage regulators that ... can be fixed or switched type; they are considered integer multiple of a capacitor unit ..... By simulating the growth process of plant phototropism, a probability model ..... He is referee for IEE Proceedings - Generation Transmission and Distribution and ...

Small disturbance voltage stability assessment of power systems by modal analysis and dynamic simulation

International Nuclear Information System (INIS)

Amjady, Nima; Ansari, Mohammad Reza

2008-01-01

The introduction of liberalized electricity markets in many countries has resulted in more highly stressed power systems. On the other hand, operating points of a power system are acceptable in the feasible region, which is surrounded by the borders of different stabilities. Power system instability is critical for all participants of the electricity market. Determination of different stability margins can result in the optimum utilization of power system with minimum risk. This paper focuses on the small disturbance voltage stability, which is an important subset of the power system global stability. This kind of voltage stability is usually evaluated by static analysis tools such as continuation power flow, while it essentially has dynamic nature. Besides, a combination of linear and nonlinear analysis tools is required to correctly analyze it. In this paper, a hybrid evaluation method composed of static, dynamic, linear, and nonlinear analysis tools is proposed for this purpose. Effect of load scenario, generation pattern, branch and generator contingency on the small disturbance voltage stability are evaluated by the hybrid method. The test results are given for New England and IEEE68 bus test systems. (author)

Modeling and Simulation of Nonlinear Micro-electromechanical Circular Plate

Directory of Open Access Journals (Sweden)

Chin-Chia Liu

2013-09-01

Full Text Available In the present study, the hybrid differential transformation and finite difference method is applied to analyze the dynamic behavior of the nonlinear micro-electromechanical circular plate actuated by combined DC / AC loading schemes. The analysis takes account of the axial residual stress and hydrostatic pressure acting on micro circular plate upper surface. The dynamic response of the plate as a function of the magnitude of the AC driving voltage is explored. Moreover, the effect of the initial gap height on the pull-in voltage of the plate is systematically explored.

Technical Training Seminar: Low-Voltage Differential Signaling (LVDS): Technology and Applications

CERN Multimedia

Monique Duval

2004-01-01

Tuesday 26 October TECHNICAL TRAINING SEMINAR from 14:00 to 16:30, Auditorium 40-SS-C01 Low-Voltage Differential Signaling (LVDS): Technology and Applications Herbert Eisenring, Kai Peters / NATIONAL SEMICONDUCTOR (Europe) National Semiconductor pioneered the Low-Voltage Differential Signaling (LVDS) technology, and is a recognized leader in high speed differential products and design tools. National Semiconductor offers a wide range of innovative, affordable interconnect solutions including serializer-deserializers (SerDes), drivers-receivers-transceivers, crosspoint switches and clock drivers. LVDS is a new technology addressing the needs of todays high performance data transmission applications, and the LVDS standard is becoming the most popular differential data transmission standard in the industry. This Technical Training Seminar will present National Semiconductor existing and future products, and some applications relevant to the activities carried out at CERN. 14:00 - 14:15 Presentation of Nati...

Technical Training Seminar: Low-Voltage Differential Signaling (LVDS): Technology and Applications

CERN Multimedia

Monique Duval

2004-01-01

Tuesday 26 October TECHNICAL TRAINING SEMINAR from 14:00 to 16:30, Auditorium 40-SS-C01 Low-Voltage Differential Signaling (LVDS): Technology and Applications Herbert Eisenring, Kai Peters / NATIONAL SEMICONDUCTOR (Europe) National Semiconductor pioneered the Low-Voltage Differential Signaling (LVDS) technology, and is a recognized leader in high speed differential products and design tools. National Semiconductor offers a wide range of innovative, affordable interconnect solutions including serializer-deserializers (SerDes), drivers-receivers-transceivers, crosspoint switches and clock drivers. LVDS is a new technology addressing the needs of todays high performance data transmission applications, and the LVDS standard is becoming the most popular differential data transmission standard in the industry. This Technical Training Seminar will present National Semiconductor existing and future products, and some applications relevant to the activities carried out at CERN. 14:00 - 14:15 Presentation of Nat...

Tracing the transition of a macro electron shuttle into nonlinear response

Energy Technology Data Exchange (ETDEWEB)

Kim, Chulki [Sensor System Research Center, Korea Institute of Science and Technology, Seoul 136791 (Korea, Republic of); Prada, Marta [I. Institut für Theoretische Physik, Universität Hamburg, Jungiusstr. 9, Hamburg 20355 (Germany); Qin, Hua [Key Laboratory of Nanodevices, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, 398 Ruoshui Road, Industrial Park, Suzhou City, Jiangsu 215123 (China); Kim, Hyun-Seok [Division of Electronics and Electrical Engineering, Dongguk University-Seoul, 100715 Seoul (Korea, Republic of); Blick, Robert H., E-mail: rblick@physnet.uni-hamburg.de [Department of Physics, University of Wisconsin-Madison, 1150 University Avenue, Madison, Wisconsin-53706 (United States); Center for Hybrid Nanostructures, Universität Hamburg, Jungiusstr. 11c, Hamburg 20355 (Germany); Department of Electrical and Computer Engineering, University of Wisconsin-Madison, 1415 Engineering Dr. Madison, Wisconsin-53706 (United States)

2015-02-09

We present a study on a macroscopic electron shuttle in the transition from linear to nonlinear response. The shuttle consists of a classical mechanical pendulum situated between two capacitor plates. The metallic pendulum enables mechanical transfer of electrons between the plates, hence allowing to directly trace electron shuttling in the time domain. By applying a high voltage to the plates, we drive the system into a controlled nonlinear response, where we observe period doubling.

A support vector machine (SVM) based voltage stability classifier

Energy Technology Data Exchange (ETDEWEB)

Dosano, R.D.; Song, H. [Kunsan National Univ., Kunsan, Jeonbuk (Korea, Republic of); Lee, B. [Korea Univ., Seoul (Korea, Republic of)

2007-07-01

Power system stability has become even more complex and critical with the advent of deregulated energy markets and the growing desire to completely employ existing transmission and infrastructure. The economic pressure on electricity markets forces the operation of power systems and components to their limit of capacity and performance. System conditions can be more exposed to instability due to greater uncertainty in day to day system operations and increase in the number of potential components for system disturbances potentially resulting in voltage stability. This paper proposed a support vector machine (SVM) based power system voltage stability classifier using local measurements of voltage and active power of load. It described the procedure for fast classification of long-term voltage stability using the SVM algorithm. The application of the SVM based voltage stability classifier was presented with reference to the choice of input parameters; input data preconditioning; moving window for feature vector; determination of learning samples; and other considerations in SVM applications. The paper presented a case study with numerical examples of an 11-bus test system. The test results for the feasibility study demonstrated that the classifier could offer an excellent performance in classification with time-series measurements in terms of long-term voltage stability. 9 refs., 14 figs.

Nonlinear and Nonequilibrium Spin Injection in Magnetic Tunneling Junctions

Science.gov (United States)

Guo, Hong

2007-03-01

Quantitative analysis of charge and spin quantum transport in spintronic devices requires an atomistic first principles approach that can handle nonlinear and nonequilibrium transport conditions. We have developed an approach for this purpose based on real space density functional theory (DFT) carried out within the Keldysh nonequilibrium Green's function formalism (NEGF). We report theoretical analysis of nonlinear and nonequilibrium spin injection and quantum transport in Fe/MgO/Fe trilayer structures as a function of external bias voltage. Devices with well relaxed atomic structures and with FeO oxidization layers are investigated as a function of external bias voltage. We also report calculations of nonequilibrium spin injection into molecular layers and graphene. Comparisons to experimental data will be presented. Work in collaborations with: Derek Waldron, Vladimir Timochevski (McGill University); Ke Xia (Institute of Physics, Chinese Academy of Science, Beijing, China); Eric Zhu, Jian Wang (University of Hong Kong); Paul Haney, and Allan MacDonald (University of Texas at Austin).

Nonlinear viscous vortex motion in two-dimensional Josephson-junction arrays

International Nuclear Information System (INIS)

Hagenaars, T.J.; Tiesinga, P.H.E.; van Himbergen, J.E.; Jose, J.V.

1994-01-01

When a vortex in a two-dimensional Josephson-junction array is driven by a constant external current it may move as a particle in a viscous medium. Here we study the nature of this viscous motion. We model the junctions in a square array as resistively and capacitively shunted Josephson junctions and carry out numerical calculations of the current-voltage characteristics. We find that the current-voltage characteristics in the damped regime are well described by a model with a nonlinear viscous force of the form F D =η(y)y=[A/(1+By]y, where y is the vortex velocity, η(y) is the velocity-dependent viscosity, and A and B are constants for a fixed value of the Stewart-McCumber parameter. This result is found to apply also for triangular lattices in the overdamped regime. Further qualitative understanding of the nature of the nonlinear friction on the vortex motion is obtained from a graphic analysis of the microscopic vortex dynamics in the array. The consequences of having this type of nonlinear friction law are discussed and compared to previous theoretical and experimental studies

Nonlinear effects in propagation of long-range surface plasmon polaritons in gold strip waveguides

DEFF Research Database (Denmark)

Lysenko, Oleg; Bache, Morten; Malureanu, Radu

2016-01-01

cladding. The optical characterization was performed using a high power picosecond laser at 1064 nm. The experiments reveal two nonlinear optical effects: nonlinear power transmission and spectral broadening of the LRSPP mode in the waveguides. Both nonlinear optical effects depend on the gold layer...

Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

Directory of Open Access Journals (Sweden)

Seyyed Yousef Mousazadeh Mousavi

2017-10-01

Full Text Available In recent years, the harmonics and unbalance problems endanger the voltage and current quality of power systems, due to increasing usage of nonlinear and unbalanced loads. Use of Distributed Generation (DG-interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method is proposed to compensate voltage and current unbalance and harmonics using the distributed generation (DG-interfacing inverters. This method is applicable to both grid-connected and islanded Microgrids (MGs. In the proposed method, not only the proper control of active and reactive powers can be achieved, but also there is flexibility in compensating the voltage or current quality problems at DG terminals or Points of Common Coupling (PCCs. This control strategy consists of active and reactive power controllers and a voltage/current quality-improvement block. The controller is designed in a stationary (αβ frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. Depending on the compensation modes, the harmonics and unbalance compensation of DG output current, MG-injected current to the grid, as well as PCC and DG voltages, can be achieved in grid-connected operation of MG while in the islanded operation, and the PCC and DG voltages compensation can be obtained through the proposed control scheme.

Current-voltage curves of atomic-sized transition metal contacts: An explanation of why Au is ohmic and Pt is not

DEFF Research Database (Denmark)

Nielsen, S.K.; Brandbyge, Mads; Hansen, K.

2002-01-01

We present an experimental study of current-voltage (I-V) curves on atomic-sized Au and Pt contacts formed under cryogenic vacuum (4.2 K). Whereas I-V curves for Au are almost Ohmic, the conductance G=I/V for Pt decreases with increasing voltage, resulting in distinct nonlinear I-V behavior...

Experimental Comparison of Probabilistic Shaping Methods for Unrepeated Fiber Transmission

DEFF Research Database (Denmark)

Renner, Julian; Fehenberger, Tobias; Yankov, Metodi Plamenov

2017-01-01

This paper studies the impact of probabilistic shaping on effective signal-to-noise ratios (SNRs) and achievable information rates (AIRs) in a back-to-back configuration and in unrepeated nonlinear fiber transmissions. For back-to-back, various shaped quadrature amplitude modulation (QAM......) distributions are found to have the same implementation penalty as uniform input. By demonstrating in transmission experiments that shaped QAM input leads to lower effective SNR than uniform input at a fixed average launch power, we experimentally confirm that shaping enhances the fiber nonlinearities. However......, shaping is ultimately found to increase the AIR, which is the most relevant figure of merit as it is directly related to spectral efficiency. In a detailed study of these shaping gains for the nonlinear fiber channel, four strategies for optimizing QAM input distributions are evaluated and experimentally...

Hybrid finite difference/finite element solution method development for non-linear superconducting magnet and electrical circuit breakdown transient analysis

International Nuclear Information System (INIS)

Kraus, H.G.; Jones, J.L.

1986-01-01

The problem of non-linear superconducting magnet and electrical protection circuit system transients is formulated. To enable studying the effects of coil normalization transients, coil distortion (due to imbalanced magnetic forces), internal coil arcs and shorts, and other normal and off-normal circuit element responses, the following capabilities are included: temporal, voltage and current-dependent voltage sources, current sources, resistors, capacitors and inductors. The concept of self-mutual inductance, and the form of the associated inductance matrix, is discussed for internally shorted coils. This is a Kirchhoff's voltage loop law and Kirchhoff's current node law formulation. The non-linear integrodifferential equation set is solved via a unique hybrid finite difference/integral finite element technique. (author)

Modeling and non-linear responses of MEMS capacitive accelerometer

Directory of Open Access Journals (Sweden)

Sri Harsha C.

2014-01-01

Full Text Available A theoretical investigation of an electrically actuated beam has been illustrated when the electrostatic-ally actuated micro-cantilever beam is separated from the electrode by a moderately large gap for two distinct types of geometric configurations of MEMS accelerometer. Higher order nonlinear terms have been taken into account for studying the pull in voltage analysis. A nonlinear model of gas film squeezing damping, another source of nonlinearity in MEMS devices is included in obtaining the dynamic responses. Moreover, in the present work, the possible source of nonlinearities while formulating the mathematical model of a MEMS accelerometer and their influences on the dynamic responses have been investigated. The theoretical results obtained by using MATLAB has been verified with the results obtained in FE software and has been found in good agreement. Criterion towards stable micro size accelerometer for each configuration has been investigated. This investigation clearly provides an understanding of nonlinear static and dynamics characteristics of electrostatically micro cantilever based device in MEMS.

Project resumes: biological effects from electric fields associated with high-voltage transmission lines

Energy Technology Data Exchange (ETDEWEB)

None

1980-01-01

Abstracts of research projects are presented in the following areas: measurements and special facilities; cellular and subcellular studies; physiology; behavior; environmental effects; modeling, scaling and dosimetry; and high voltage direct current. (ACR)

The application of structural nonlinearity in the development of linearly tunable MEMS capacitors

International Nuclear Information System (INIS)

Shavezipur, M; Khajepour, A; Hashemi, S M

2008-01-01

Electrostatically actuated parallel-plate tunable capacitors are the most desired MEMS capacitors because of their smaller sizes and higher Q-factors. However, these capacitors suffer from low tunability and exhibit high sensitivity near the pull-in voltage which counters the concept of tunability. In this paper, a novel design for parallel-plate tunable capacitors with high tunability and linear capacitance–voltage (C–V) response is developed. The design uses nonlinear structural rigidities to relieve intrinsic electrostatic nonlinearity in MEMS capacitors. Based on the force–displacement characteristic of an ideally linear capacitor, a real beam-like nonlinear spring model is developed. The variable stiffness coefficients of such springs improve the linearity of the C–V curve. Moreover, because the structural stiffness increases with deformations, the pull-in is delayed and higher tunability is achieved. Finite element simulations reveal that capacitors with air gaps larger than 4 µm and supporting beams thinner than 1 µm can generate highly linear C–V responses and tunabilities over 120%. Experimental results for capacitors fabricated by PolyMUMPs verify the effect of weak nonlinear geometric stiffness on improving the tunability for designs with a small air gap and relatively thick structural layers

Large nonlinear absorption and refraction coefficients of carbon nanotubes estimated from femtosecond z-scan measurements

Science.gov (United States)

Kamaraju, N.; Kumar, Sunil; Sood, A. K.; Guha, Shekhar; Krishnamurthy, Srinivasan; Rao, C. N. R.

2007-12-01

Nonlinear transmission of 80 and 140fs pulsed light with 0.79μm wavelength through single walled carbon nanotubes suspended in water containing sodium dodecyl sulfate is studied. Pulse-width independent saturation absorption and negative cubic nonlinearity are observed, respectively, in open and closed aperture z-scan experiments. The theoretical expressions derived to analyze the z-dependent transmission in the saturable limit require two photon absorption coefficient β0˜1.4cm/MW and a nonlinear index γ ˜-5.5×10-11cm2/W to fit the data.

Measurement of magnetically insulated line voltage using a Thomson Parabola Charged Particle Analyser

International Nuclear Information System (INIS)

Stanley, T.D.; Stinnett, R.W.

1981-01-01

The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed

Optimal Design of a Resonance-Based Voltage Boosting Rectifier for Wireless Power Transmission.

Science.gov (United States)

Lim, Jaemyung; Lee, Byunghun; Ghovanloo, Maysam

2018-02-01

This paper presents the design procedure for a new multi-cycle resonance-based voltage boosting rectifier (MCRR) capable of delivering a desired amount of power to the load (PDL) at a designated high voltage (HV) through a loosely-coupled inductive link. This is achieved by shorting the receiver (Rx) LC-tank for several cycles to harvest and accumulate the wireless energy in the RX inductor before boosting the voltage by breaking the loop and transferring the energy to the load in a quarter cycle. By optimizing the geometries of the transmitter (Tx) and Rx coils and the number of cycles, N , for energy harvesting, through an iterative design procedure, the MCRR can achieve the highest PDL under a given set of design constraints. Governing equations in the MCRR operation are derived to identify key specifications and the design guidelines. Using an exemplary set of specs, the optimized MCRR was able to generate 20.9 V DC across a 100 kΩ load from a 1.8 V p , 6.78 MHz sinusoid input in the ISM-band at a Tx/Rx coil separation of 1.3 cm, power transfer efficiency (PTE) of 2.2%, and N = 9 cycles. At the same coil distance and loading, coils optimized for a conventional half-wave rectifier (CHWR) were able to reach only 13.6 V DC from the same source.

The prediction and prevention of voltage collapse in the Finnish power system

Energy Technology Data Exchange (ETDEWEB)

Bastman, J; Lakervi, E [Tampere Univ. of Tech. (Finland); Hirvonen, R; Kuronen, P; Hagman, E [IVO Group (Finland)

1994-12-31

The Finnish power system is a part of the Nordic power system (NORDEL), which includes Finland, Sweden, Norway and the eastern part of Denmark. In NORDEL the transmission distances are long, which implies that the power transmission capacities are determined by stability criteria . The methods to prevent and predict the voltage collapse during severe disturbances are studied using advances simulation program. Results are presented. (author) 10 figs., 1 tab.

Nontrivial transition of transmission in a highly open quantum point contact in the quantum Hall regime

Science.gov (United States)

Hong, Changki; Park, Jinhong; Chung, Yunchul; Choi, Hyungkook; Umansky, Vladimir

2017-11-01

Transmission through a quantum point contact (QPC) in the quantum Hall regime usually exhibits multiple resonances as a function of gate voltage and high nonlinearity in bias. Such behavior is unpredictable and changes sample by sample. Here, we report the observation of a sharp transition of the transmission through an open QPC at finite bias, which was observed consistently for all the tested QPCs. It is found that the bias dependence of the transition can be fitted to the Fermi-Dirac distribution function through universal scaling. The fitted temperature matches quite nicely to the electron temperature measured via shot-noise thermometry. While the origin of the transition is unclear, we propose a phenomenological model based on our experimental results that may help to understand such a sharp transition. Similar transitions are observed in the fractional quantum Hall regime, and it is found that the temperature of the system can be measured by rescaling the quasiparticle energy with the effective charge (e*=e /3 ). We believe that the observed phenomena can be exploited as a tool for measuring the electron temperature of the system and for studying the quasiparticle charges of the fractional quantum Hall states.

The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.

Science.gov (United States)

Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge

2017-11-17

The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.

Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

International Nuclear Information System (INIS)

Gao, Tao; Xu, Ruimin; Kong, Yuechan; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng

2015-01-01

We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr 0.52 Ti 0.48 )-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g m -V g ) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric

Nonlinear Robust Control for Low Voltage Direct-Current Residential Microgrids with Constant Power Loads

Directory of Open Access Journals (Sweden)

Martín-Antonio Rodríguez-Licea

2018-05-01

Full Text Available A Direct Current (DC microgrid is a concept derived from a smart grid integrating DC renewable sources. The DC microgrids have three particularities: (1 integration of different power sources and local loads through a DC link; (2 on-site power source generation; and (3 alternating loads (on-off state. This kind of arrangement achieves high efficiency, reliability and versatility characteristics. The key device in the development of the DC microgrid is the power electronic converter (PEC, since it allows an efficient energy conversion between power sources and loads. However, alternating loads with strictly-controlled PECs can provide negative impedance behavior to the microgrid, acting as constant power loads (CPLs, such that the overall closed-loop system becomes unstable. Traditional CPL compensation techniques rely on a damping increment by the adaptation of the source or load voltage level, adding external circuitry or by using some advanced control technique. However, none of them provide a simple and general solution for the CPL problem when abrupt changes in parameters and/or in alternating loads/sources occur. This paper proposes a mathematical modeling and a robust control for the basic PECs dealing with CPLs in continuous conduction mode. In particular, the case of the low voltage residential DC microgrid with CPLs is taken as a benchmark. The proposed controller can be easily tuned for the desired response even by the non-expert. Basic converters with voltage mode control are taken as a basis to show the feasibility of this analysis, and experimental tests on a 100-W testbed include abrupt parameter changes such as input voltage.

A Pilot Directional Protection for HVDC Transmission Line Based on Relative Entropy of Wavelet Energy

Directory of Open Access Journals (Sweden)

Sheng Lin

2015-07-01

Full Text Available On the basis of analyzing high-voltage direct current (HVDC transmission system and its fault superimposed circuit, the direction of the fault components of the voltage and the current measured at one end of transmission line is certified to be different for internal faults and external faults. As an estimate of the differences between two signals, relative entropy is an effective parameter for recognizing transient signals in HVDC transmission lines. In this paper, the relative entropy of wavelet energy is applied to distinguish internal fault from external fault. For internal faults, the directions of fault components of voltage and current are opposite at the two ends of the transmission line, indicating a huge difference of wavelet energy relative entropy; for external faults, the directions are identical, indicating a small difference. The simulation results based on PSCAD/EMTDC show that the proposed pilot protection system acts accurately for faults under different conditions, and its performance is not affected by fault type, fault location, fault resistance and noise.

Grain boundary effect of ZnO voltage sensitive ceramic

International Nuclear Information System (INIS)

Zhu Ziying; Lei Deming; Li Jingde

1991-01-01

Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary

Nonlinear switching dynamics in a photonic-crystal nanocavity

International Nuclear Information System (INIS)

Yu, Yi; Palushani, Evarist; Heuck, Mikkel; Vukovic, Dragana; Peucheret, Christophe; Yvind, Kresten; Mork, Jesper

2014-01-01

We report the experimental observation of nonlinear switching dynamics in an InP photonic crystal nanocavity. Usually, the regime of relatively small cavity perturbations is explored, where the signal transmitted through the cavity follows the temporal variation of the cavity resonance. When the cavity is perturbed by strong pulses, we observe several nonlinear effects, i.e., saturation of the switching contrast, broadening of the switching window, and even initial reduction of the transmission. The effects are analyzed by comparison with nonlinear coupled mode theory and explained in terms of large dynamical variations of the cavity resonance in combination with nonlinear losses. The results provide insight into the nonlinear optical processes that govern the dynamics of nanocavities and are important for applications in optical signal processing, where one wants to optimize the switching contrast.

Nonlinear switching dynamics in a photonic-crystal nanocavity

DEFF Research Database (Denmark)

Yu, Yi; Palushani, Evarist; Heuck, Mikkel

2014-01-01

We report the experimental observation of nonlinear switching dynamics in an InP photonic crystal nanocavity. Usually, the regime of relatively small cavity perturbations is explored, where the signal transmitted through the cavity follows the temporal variation of the cavity resonance. When...... of large dynamical variations of the cavity resonance in combination with nonlinear losses. The results provide insight into the nonlinear optical processes that govern the dynamics of nanocavities and are important for applications in optical signal processing, where one wants to optimize the switching...... the cavity is perturbed by strong pulses, we observe several nonlinear effects, i.e., saturation of the switching contrast, broadening of the switching window, and even initial reduction of the transmission. The effects are analyzed by comparison with nonlinear coupled mode theory and explained in terms...

Engineering aspect of the microwave ionosphere nonlinear interaction experiment (MINIX) with a sounding rocket

Science.gov (United States)

Nagatomo, Makoto; Kaya, Nobuyuki; Matsumoto, Hiroshi

The Microwave Ionosphere Nonlinear Interaction Experiment (MINIX) is a sounding rocket experiment to study possible effects of strong microwave fields in case it is used for energy transmission from the Solar Power Satellite (SPS) upon the Earth's atmosphere. Its secondary objective is to develop high power microwave technology for space use. Two rocket-borne magnetrons were used to emit 2.45 GHz microwave in order to make a simulated condition of power transmission from an SPS to a ground station. Sounding of the environment radiated by microwave was conducted by the diagnostic package onboard the daughter unit which was separated slowly from the mother unit. The main design drivers of this experiment were to build such high power equipments in a standard type of sounding rocket, to keep the cost within the budget and to perform a series of experiments without complete loss of the mission. The key technology for this experiment is a rocket-borne magnetron and high voltage converter. Location of position of the daughter unit relative to the mother unit was a difficult requirement for a spin-stabilized rocket. These problems were solved by application of such a low cost commercial products as a magnetron for microwave oven and a video tape recorder and camera.

Topologically protected loop flows in high voltage AC power grids

International Nuclear Information System (INIS)

Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I

2016-01-01

Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

Nonlinear dynamics of biomimetic micro air vehicles

Energy Technology Data Exchange (ETDEWEB)

Hou, Y; Kong, J [College of Mechanical Automation, Wuhan University of Science and Technology, Wuhan, 430081 (China)], E-mail: fly_houyu@163.com.cn

2008-02-15

Flapping-wing micro air vehicles (FMAV) are new conceptual air vehicles that mimic the flying modes of birds and insects. They surpass the research fields of traditional airplane design and aerodynamics on application technologies, and initiate the applications of MEMS technologies on aviation fields. This paper studies a micro flapping mechanism that based upon insect thorax and actuated by electrostatic force. Because there are strong nonlinear coupling between the two physical domains, electrical and mechanical, the static and dynamic characteristics of this system are very complicated. Firstly, the nonlinear dynamic model of the electromechanical coupling system is set up according to the physical model of the flapping mechanism. The dynamic response of the system in constant voltage is studied by numerical method. Then the effect of damping and initial condition on dynamic characteristics of the system is analyzed in phase space. In addition, the dynamic responses of the system in sine voltage excitation are discussed. The results of research are helpful to the design, fabrication and application of the micro flapping mechanism of FMAV, and also to other micro electromechanical system that actuated by electrostatic force.

E-beam high voltage switching power supply

Science.gov (United States)

Shimer, Daniel W.; Lange, Arnold C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

E-beam high voltage switching power supply

International Nuclear Information System (INIS)

Shimer, D.W.; Lange, A.C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

An impact analysis of the fault impedance on voltage sags

Energy Technology Data Exchange (ETDEWEB)

Ramos, Alessandro Candido Lopes [CELG - Companhia Energetica de Goias, Goiania, GO (Brazil). Generation and Transmission. System' s Operation Center], E-mail: alessandro.clr@celg.com.br; Batista, Adalberto Jose [Federal University of Goias (UFG), Goiania, GO (Brazil)], E-mail: batista@eee.ufg.br; Leborgne, Roberto Chouhy [Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil)], E-mail: rcl@ece.ufrgs.br; Emiliano, Pedro Henrique Mota, E-mail: ph@phph.com.br

2009-07-01

This paper presents an impact analysis of the fault impedance, in terms of its module and angle, on voltage sags caused by faults. Symmetrical and asymmetrical faults are simulated, at transmission and distribution lines, by using a frequency-domain fault simulation software called ANAFAS. Voltage sags are monitored at buses where sensitive end-users are connected. In order to overcome some intrinsic limitations of this software concerning its automatic execution for several cases, a computational tool was developed in Java programming language. This solution allows the automatic simulation of cases including the effect of the fault position, the fault type, and the proper fault impedance. The main conclusion is that the module and angle of the fault impedance can have a significant influence on voltage sag depending on the fault characteristics. (author)

Prospective single and multi-phase short-circuit current levels in the Dutch transmission, sub-transmission and distribution grids

NARCIS (Netherlands)

Janssen, A.L.J.; van Riet, M.J.M.; Smeets, R.P.P.; Kanters, J.; van den Akker, W.F.; Aanhaanen, G.L.P.

2012-01-01

As elsewhere in the world, also in the Netherlands utilities face an increase in the actual and future short-circuit current levels at all voltages. This development is provoked by the required increase in transmission capacity as well as the concentration of power generation capacity. Large

Regional transmission subsystem planning

Energy Technology Data Exchange (ETDEWEB)

Costa Bortoni, Edson da [Quadrante Softwares Especializados Ltda., Itajuba, MG (Brazil); Bajay, Sergio Valdir; Barros Correia, Paulo de [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Santos, Afonso Henriques Moreira; Haddad, Jamil [Escola Federal de Engenharia de Itajuba, MG (Brazil)

1994-12-31

This work presents an approach for the planning of transmission systems by employing mixed--integer linear programming to obtain a cost and operating characteristics optimized system. The voltage loop equations are written in a modified form, so that, at the end of the analysis, the model behaves as a DC power flow, with the help of the two Kirchhoff`s laws, exempting the need of interaction with an external power flow program for analysis of the line loading. The model considers the occurrence of contingencies, so that the final result is a network robust to the most severe contingencies. This whole technique is adapted to the regional electric power transmission subsystems. (author) 9 refs., 4 figs.

AC Transmission Emulation Control Strategies for the BTB VSC HVDC System in the Metropolitan Area of Seoul

Directory of Open Access Journals (Sweden)

Sungyoon Song

2017-08-01

Full Text Available In the Korean power system, growing power loads have recently created the problems of voltage instability and fault current in the Seoul Capital Area (SCA. Accordingly, the back-to-back (BTB voltage source converter (VSC high-voltage direct-current (HVDC system is emerging to resolve such problems with grid segmentation. However, non-convergence problems occur in this metropolitan area, due to the large change of power flow in some contingencies. Therefore, this paper proposes two kinds of AC transmission emulation control (ATEC strategies to improve the metropolitan transient stability, and to resolve the non-convergence problem. The proposed ATEC strategies are able to mitigate possible overloading of adjacent AC transmission, and maintain power balance between metropolitan regions. The first ATEC strategy uses a monitoring system that permits the reverse power flow of AC transmission, and thus effectively improves the grid stability based on the power transfer equation. The second ATEC strategy emulates AC transmission with DC link capacitors in a permissible DC-link voltage range according to angle difference, and securely improves the gird stability, without requiring grid operator schedule decisions. This paper compares two kinds of ATEC schemes: it demonstrates the first ATEC strategy with specific fault scenario with PSS/E (Power Transmission System Planning Software, and evaluates the second ATEC strategy with internal controller performance with PSCAD/EMTDC (Power System Electromagnetic Transients Simulation Software.

Artificial intelligence techniques for voltage control

Energy Technology Data Exchange (ETDEWEB)

Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

1997-12-31

In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

Nonlinear electron transport in InAs/AlGaSb three-terminal ballistic junctions

International Nuclear Information System (INIS)

Koyama, M; Inoue, T; Amano, N; Maemoto, T; Sasa, S; Inoue, M

2008-01-01

We have fabricated and characterized an InAs/AlGaSb three-terminal ballistic junction device. The fabricated device exhibited nonlinear electron transport properties because of ballistic motion of electrons in this structure that is comparable to the electron mean free path. When the left branch is biased to a finite voltage Vand the right to a voltage of -V (push-pull fashion), negative voltages appeared at the floating central branch regardless of the polarity of the input voltages. In the case of the central branch grounded in push-pull fashion, the clear current rectification effect also observed in the current flow of the central branch at 4.2K to even at 300K

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

The Nonlinear Distortions in the Oscillatory System of Generator on CFOA

Directory of Open Access Journals (Sweden)

Yuriy Konstantinovich Rybin

2012-01-01

Full Text Available In recent years, many articles came out where one could find the analysis of oscillatory systems of electric sinusoid signals generators with amplifiers called CFOA—current feedback operational amplifiers. As a rule, the analysis of such systems is made by applying mathematical modeling methods on the basis of the amplifier linear model, which does not allow estimating advantages and disadvantages of the systems realized with those amplifiers in comparison with classical systems. A nonlinear model of a current feedback operational amplifier (CFOA is introduced in the paper; nonlinearity of “current mirror” is reflected in the form of current double limiting. The analysis of two known oscillatory systems has been carried out with the use of this non-linear model. Dependence between current limiting level, output voltage amplitude, and maximum oscillation frequency has been obtained. The paper shows that output current limiting under current output connection of capacitive load reduces frequency range and output voltage amplitude considerably and increases harmonic distortions in comparison with classical oscillatory systems. The research done has found that the application of new amplifiers does not give considerable advantages to the oscillatory systems with CFOA.

Nonlinear control of permanent magnet synchronous motor driving a ...

African Journals Online (AJOL)

This paper presents a non-linear control of permanent magnet synchronous motor (PMSM) fed by a PWM voltage source inverter. To improve the performance of this control technique, the input-output linearization technique is proposed for a system driving a mechanical load with two masses. In order to ensure a steady ...

Electrostatic potential profile and nonlinear current in an interacting ...

Indian Academy of Sciences (India)

Unknown

Since the Poisson distribution crucially depends on charge densities ... formedon a large number of systems using semi-empirical to first-principles ... known by now that the current in these systems is a nonlinear function of the voltage and ..... the middle of the molecule and the potential drop is smaller near the interfaces.

Metamaterial-Enhanced Nonlinear Terahertz Spectroscopy

Directory of Open Access Journals (Sweden)

Zhang X.

2013-03-01

Full Text Available We demonstrate large nonlinear terahertz responses in the gaps of metamaterial split ring resonators in several materials and use nonlinear THz transmission and THz-pump/THz-probe spectroscopy to study the nonlinear responses and dynamics. We use the field enhancement in the SRR gaps to initiate high-field phenomena at lower incident fields. In vanadium dioxide, we drive the insulator-to-metal phase transition with high-field THz radiation. The film conductivity increases by over two orders of magnitude and the phase transition occurs on a several picosecond timescale. In gallium arsenide, we observe high-field transport phenomena, including mobility saturation and impact ionization. The carrier density increases by up to ten orders of magnitude at high fields. At the highest fields, we demonstrate THz-induced damage in both vanadium dioxide and gallium arsenide.

Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

Energy Technology Data Exchange (ETDEWEB)

Gao, Tao [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China); Xu, Ruimin [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Kong, Yuechan, E-mail: kycfly@163.com; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng [Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China)

2015-06-15

We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr{sub 0.52}Ti{sub 0.48})-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g{sub m}-V{sub g}) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric.

Nonlinear dynamics analysis of the spur gear system for railway locomotive

Science.gov (United States)

Wang, Junguo; He, Guangyue; Zhang, Jie; Zhao, Yongxiang; Yao, Yuan

2017-02-01

Considering the factors such as the nonlinearity backlash, static transmission error and time-varying meshing stiffness, a three-degree-of-freedom torsional vibration model of spur gear transmission system for a typical locomotive is developed, in which the wheel/rail adhesion torque is considered as uncertain but bounded parameter. Meantime, the Ishikawa method is used for analysis and calculation of the time-varying mesh stiffness of the gear pair in meshing process. With the help of bifurcation diagrams, phase plane diagrams, Poincaré maps, time domain response diagrams and amplitude-frequency spectrums, the effects of the pinion speed and stiffness on the dynamic behavior of gear transmission system for locomotive are investigated in detail by using the numerical integration method. Numerical examples reveal various types of nonlinear phenomena and dynamic evolution mechanism involving one-period responses, multi-periodic responses, bifurcation and chaotic responses. Some research results present useful information to dynamic design and vibration control of the gear transmission system for railway locomotive.

Metering error quantification under voltage and current waveform distortion

Science.gov (United States)

Wang, Tao; Wang, Jia; Xie, Zhi; Zhang, Ran

2017-09-01

With integration of more and more renewable energies and distortion loads into power grid, the voltage and current waveform distortion results in metering error in the smart meters. Because of the negative effects on the metering accuracy and fairness, it is an important subject to study energy metering combined error. In this paper, after the comparing between metering theoretical value and real recorded value under different meter modes for linear and nonlinear loads, a quantification method of metering mode error is proposed under waveform distortion. Based on the metering and time-division multiplier principles, a quantification method of metering accuracy error is proposed also. Analyzing the mode error and accuracy error, a comprehensive error analysis method is presented which is suitable for new energy and nonlinear loads. The proposed method has been proved by simulation.

The role of facts and HVDC in the future pan-European transmission system development

NARCIS (Netherlands)

L'Abbate, A.; Migliavacca, G.; Hager, U.; Rehtanz, C.; Ruberg, S.; Lopes Ferreira, H.M.; Fulli, G.; Purvins, A.

2010-01-01

The present paper focuses on FACTS (Flexible Alternating Current Transmission System) and HVDC (High Voltage Direct Current) transmission technologies. Particular attention is paid to different specific technical, economic and environmental features of these power electronics-based devices. Final

Optimal beamforming in MIMO systems with HPA nonlinearity

KAUST Repository

Qi, Jian

2010-09-01

In this paper, multiple-input multiple-output (MIMO) transmit beamforming (TB) systems under the consideration of nonlinear high-power amplifiers (HPAs) are investigated. The optimal beamforming scheme, with the optimal beamforming weight vector and combining vector, is proposed for MIMO systems with HPA nonlinearity. The performance of the proposed MIMO beamforming scheme in the presence of HPA nonlinearity is evaluated in terms of average symbol error probability (SEP), outage probability and system capacity, considering transmission over uncorrelated quasi-static frequency-flat Rayleigh fading channels. Numerical results are provided and show the effects of several system parameters, namely, parameters of nonlinear HPA, numbers of transmit and receive antennas, and modulation order of phase-shift keying (PSK), on performance. ©2010 IEEE.

Optimal beamforming in MIMO systems with HPA nonlinearity

KAUST Repository

Qi, Jian; Aissa, Sonia

2010-01-01

In this paper, multiple-input multiple-output (MIMO) transmit beamforming (TB) systems under the consideration of nonlinear high-power amplifiers (HPAs) are investigated. The optimal beamforming scheme, with the optimal beamforming weight vector and combining vector, is proposed for MIMO systems with HPA nonlinearity. The performance of the proposed MIMO beamforming scheme in the presence of HPA nonlinearity is evaluated in terms of average symbol error probability (SEP), outage probability and system capacity, considering transmission over uncorrelated quasi-static frequency-flat Rayleigh fading channels. Numerical results are provided and show the effects of several system parameters, namely, parameters of nonlinear HPA, numbers of transmit and receive antennas, and modulation order of phase-shift keying (PSK), on performance. ©2010 IEEE.

Superconducting Nanowires as Nonlinear Inductive Elements for Qubits

OpenAIRE

Ku, Jaseung; Manucharyan, Vladimir; Bezryadin, Alexey

2010-01-01

We report microwave transmission measurements of superconducting Fabry-Perot resonators (SFPR), having a superconducting nanowire placed at a supercurrent antinode. As the plasma oscillation is excited, the supercurrent is forced to flow through the nanowire. The microwave transmission of the resonator-nanowire device shows a nonlinear resonance behavior, significantly dependent on the amplitude of the supercurrent oscillation. We show that such amplitude-dependent response is due to the nonl...

Currents and voltages in the MFTF coils during the formation of a normal zone

International Nuclear Information System (INIS)

Owen, E.W.

1980-08-01

Expressions are obtained for the currents and voltages in a pair of inductively coupled superconducting coils under two conditions: formation of a normal zone and during a change in the level of the current in one coil. A dump resistor of low resistance and a detector bridge is connected across each coil. Calculated results are given for the MFTF coils. The circuit equations during formation of a normal zone are nonlinear and time-varying, consequently, only a series solution is possible. The conditions during a change in current are more easily found. After the transient has died away, the voltages in the coil associated with the changing source are all self-inductive, while the voltages in the other coil are all mutually inductive

Light propagation and transmission in hybrid-aligned nematic liquid crystal cells: Geometrical optics calculations

Science.gov (United States)

Mendoza, Carlos I.; Reyes, J. Adrian

2006-08-01

The authors present a geometrical approach to calculate the transmission of light in a hybrid-aligned nematic cell under the influence of an applied electric field. Using the framework of geometrical optics they present results for the ray tracing as well as the transmission of light as a function of the applied low frequency voltage. Dispersion effects are included through a wavelength dependent dielectric function. Their results for the transmittance as a function of the applied voltage show oscillations that are in good qualitative agreement with previously obtained experimental measurements.

Local Voltage Control in Distribution Networks: A Game-Theoretic Perspective

Energy Technology Data Exchange (ETDEWEB)

Zhou, Xinyang; Tian, Jie; Chen, Lijun; Dall' Anese, Emiliano

2016-11-21

Inverter-based voltage regulation is gaining importance to alleviate emerging reliability and power-quality concerns related to distribution systems with high penetration of photovoltaic (PV) systems. This paper seeks contribution in the domain of reactive power compensation by establishing stability of local Volt/VAr controllers. In lieu of the approximate linear surrogate used in the existing work, the paper establishes existence and uniqueness of an equilibrium point using nonlinear AC power flow model. Key to this end is to consider a nonlinear dynamical system with non-incremental local Volt/VAr control, cast the Volt/VAr dynamics as a game, and leverage the fixed-point theorem as well as pertinent contraction mapping argument. Numerical examples are provided to complement the analytical results.

Online Location of Faults on AC Cables in Underground Transmission Systems

DEFF Research Database (Denmark)

Jensen, Christian Flytkjær

under fault conditions well, but the accuracy of the calculated impedance is low for fault location purposes. The neural networks can therefore not be trained and no impedance-based fault location method can be used for crossbonded cables or hybrid lines. The use of travelling wave-based methods...... connection to verify the proposed method. Faults, at reduced a voltage are artificially applied in the cable system and the transient response is measured at two terminals at the cable’s ends. The measurements are time-synchronised and it is found that a very accurate estimation of the fault location can......A transmission grid is normally laid out as an almost pure overhead line (OHL) network. The introduction of transmission voltage level XLPE cables and the increasing interest in the environmental impact of OHL has resulted in an increasing interest in the use of underground cables on transmission...

An Energy Saving Green Plug Device for Nonlinear Loads

Science.gov (United States)

Bloul, Albe; Sharaf, Adel; El-Hawary, Mohamed

2018-03-01

The paper presents a low cost a FACTS Based flexible fuzzy logic based modulated/switched tuned arm filter and Green Plug compensation (SFC-GP) scheme for single-phase nonlinear loads ensuring both voltage stabilization and efficient energy utilization. The new Green Plug-Switched filter compensator SFC modulated LC-Filter PWM Switched Capacitive Compensation Devices is controlled using a fuzzy logic regulator to enhance power quality, improve power factor at the source and reduce switching transients and inrush current conditions as well harmonic contents in source current. The FACTS based SFC-GP Device is a member of family of Green Plug/Filters/Compensation Schemes used for efficient energy utilization, power quality enhancement and voltage/inrush current/soft starting control using a dynamic error driven fuzzy logic controller (FLC). The device with fuzzy logic controller is validated using the Matlab / Simulink Software Environment for enhanced power quality (PQ), improved power factor and reduced inrush currents. This is achieved using modulated PWM Switching of the Filter-Capacitive compensation scheme to cope with dynamic type nonlinear and inrush cyclical loads..

Stop wheeling and start dealing. Resolving the transmission dilemma

International Nuclear Information System (INIS)

Ruff, L.E.

1996-01-01

The author distinguishes the role of a Gridco that owns actual transmission assets from that of a Poolco that must dispatch generation and transmission optimally to meet time- and space-differentiated customer demands. He contends that present wheeling orders that convert high-voltage wires of generation and transmission companies into 'open access' transmission providers while maintaining their control of dispatch are skewed; rather, the Poolco must charge the same prices for comparable transmission services provided to any customer. Transmission plant must always be dispatched in a least-cost fashion; contracts-for-differences enable customers to hedge against extreme price fluctuations that may arise. Poolco payments should be made to an independent Gridco as compensation for providing its physical grid; necessary revenues must be recovered from Poolco customers. 6 figs

Stop wheeling and start dealing. Resolving the transmission dilemma

Energy Technology Data Exchange (ETDEWEB)

Ruff, L.E. [Putnam, Hayes and Bartlett, Inc., Washington, DC (United States)

1996-12-31

The author distinguishes the role of a Gridco that owns actual transmission assets from that of a Poolco that must dispatch generation and transmission optimally to meet time- and space-differentiated customer demands. He contends that present wheeling orders that convert high-voltage wires of generation and transmission companies into `open access` transmission providers while maintaining their control of dispatch are skewed; rather, the Poolco must charge the same prices for comparable transmission services provided to any customer. Transmission plant must always be dispatched in a least-cost fashion; contracts-for-differences enable customers to hedge against extreme price fluctuations that may arise. Poolco payments should be made to an independent Gridco as compensation for providing its physical grid; necessary revenues must be recovered from Poolco customers. 6 figs.

Observation of Nonlinear Self-Trapping of Broad Beams in Defocusing Waveguide Arrays

International Nuclear Information System (INIS)

Bennet, Francis H.; Haslinger, Franz; Neshev, Dragomir N.; Kivshar, Yuri S.; Alexander, Tristram J.; Mitchell, Arnan

2011-01-01

We demonstrate experimentally the localization of broad optical beams in periodic arrays of optical waveguides with defocusing nonlinearity. This observation in optics is linked to nonlinear self-trapping of Bose-Einstein-condensed atoms in stationary periodic potentials being associated with the generation of truncated nonlinear Bloch states, existing in the gaps of the linear transmission spectrum. We reveal that unlike gap solitons, these novel localized states can have an arbitrary width defined solely by the size of the input beam while independent of nonlinearity.

Nonlinear Dynamic Analysis and Optimization of Closed-Form Planetary Gear System

Directory of Open Access Journals (Sweden)

Qilin Huang

2013-01-01

Full Text Available A nonlinear purely rotational dynamic model of a multistage closed-form planetary gear set formed by two simple planetary stages is proposed in this study. The model includes time-varying mesh stiffness, excitation fluctuation and gear backlash nonlinearities. The nonlinear differential equations of motion are solved numerically using variable step-size Runge-Kutta. In order to obtain function expression of optimization objective, the nonlinear differential equations of motion are solved analytically using harmonic balance method (HBM. Based on the analytical solution of dynamic equations, the optimization mathematical model which aims at minimizing the vibration displacement of the low-speed carrier and the total mass of the gear transmission system is established. The optimization toolbox in MATLAB program is adopted to obtain the optimal solution. A case is studied to demonstrate the effectiveness of the dynamic model and the optimization method. The results show that the dynamic properties of the closed-form planetary gear transmission system have been improved and the total mass of the gear set has been decreased significantly.

Scattering theory of nonlinear thermoelectricity in quantum coherent conductors.

Science.gov (United States)

Meair, Jonathan; Jacquod, Philippe

2013-02-27

We construct a scattering theory of weakly nonlinear thermoelectric transport through sub-micron scale conductors. The theory incorporates the leading nonlinear contributions in temperature and voltage biases to the charge and heat currents. Because of the finite capacitances of sub-micron scale conducting circuits, fundamental conservation laws such as gauge invariance and current conservation require special care to be preserved. We do this by extending the approach of Christen and Büttiker (1996 Europhys. Lett. 35 523) to coupled charge and heat transport. In this way we write relations connecting nonlinear transport coefficients in a manner similar to Mott's relation between the linear thermopower and the linear conductance. We derive sum rules that nonlinear transport coefficients must satisfy to preserve gauge invariance and current conservation. We illustrate our theory by calculating the efficiency of heat engines and the coefficient of performance of thermoelectric refrigerators based on quantum point contacts and resonant tunneling barriers. We identify, in particular, rectification effects that increase device performance.

Pulse reshaping in photonic crystal waveguides and microcavities with Kerr nonlinearity: Critical issues for all-optical switching

International Nuclear Information System (INIS)

Vujic, Dragan; John, Sajeev

2005-01-01

We delineate critical issues for 'controlling light with light' in photonic crystal (PC) waveguides coupled to Kerr-nonlinear microresonators. These arise from (a) fundamental trade-off between switching speed and switching intensity threshold inherent in high-quality Q-factor cavities and (b) the dynamical nonlinear oscillation of such cavities in response to incident light pulses. Using finite-difference time-domain simulations of electromagnetic pulse propagation, we consider both (i) a nonlinear Fabry-Perot microresonator (embedded within a PC waveguide) exhibiting a narrow transmission resonance and (ii) a nonlinear point defect (side-coupled to a PC waveguide) exhibiting a narrow reflection spectrum. We describe self-induced switching from transmission to reflection induced by pulse intensity tuning as well as control of pulse transmission induced by the secondary, continuous (cw) laser field propagating through the same PC waveguide. For the Fabry-Perot microresonator, a well-defined self-switching threshold is obtained. However, this is accompanied by considerable temporal and spectral distortion of the pulse caused by the oscillatory nonlinear response of the microresonator. When the quality factor of the microresonator is increased, the switching intensity threshold can be lowered but the pulse transit (switching) time and the pulse distortion are increased. For the side-coupled microresonator, a gradual (not sharp) self-switching behavior as a function of incident intensity is obtained. For both the Fabry-Perot and side-coupled nonlinear microresonators, control of pulse transmission can be achieved by means of a secondary cw laser field. The cw power required for switching with realistic Kerr nonlinearities is in excess of 1 W/μm 2 and may cause optical damage to the semiconducting PC backbone. Both instantaneous and noninstantaneous Kerr-response models are considered. Our results underscore the limitations and trade-offs inherent in the possible

Nonlinear dynamic response of electro-thermo-mechanically loaded piezoelectric cylindrical shell reinforced with BNNTs

International Nuclear Information System (INIS)

Yang, J H; Yang, J; Kitipornchai, S

2012-01-01

This paper presents an investigation on the nonlinear dynamic response of piezoelectric cylindrical shells reinforced with boron nitride nanotubes (BNNTs) under a combined axisymmetric electro-thermo-mechanical loading. By employing the classical Donnell shell theory, the von Kármán–Donnell kinematic relationship, and a piezo-elastic constitutive law including thermal effects, the nonlinear governing equations of motion of the shell are derived through the Reissner variational principle. The finite difference method and a time-integration scheme are used to obtain the nonlinear dynamic response of the BNNT-reinforced piezoelectric shell. A parametric study is conducted, showing the effects of geometrically nonlinear deformation, applied voltage, temperature change, mechanical load, BNNT volume fraction and boundary conditions on the nonlinear dynamic response. (paper)

Advanced High Voltage Power Device Concepts

CERN Document Server

Baliga, B Jayant

2012-01-01

Advanced High Voltage Power Device Concepts describes devices utilized in power transmission and distribution equipment, and for very high power motor control in electric trains and steel-mills. Since these devices must be capable of supporting more than 5000-volts in the blocking mode, this books covers operation of devices rated at 5,000-V, 10,000-V and 20,000-V. Advanced concepts (the MCT, the BRT, and the EST) that enable MOS-gated control of power thyristor structures are described and analyzed in detail. In addition, detailed analyses of the silicon IGBT, as well as the silicon carbide MOSFET and IGBT, are provided for comparison purposes. Throughout the book, analytical models are generated to give a better understanding of the physics of operation for all the structures. This book provides readers with: The first comprehensive treatment of high voltage (over 5000-volts) power devices suitable for the power distribution, traction, and motor-control markets;  Analytical formulations for all the device ...

On-Site Measurements for Voltage Unbalance Studies Associated with the AC Railway Operation

DEFF Research Database (Denmark)

Stamatopoulos, Athanasios; Silva, Filipe Miguel Faria da; Bak, Claus Leth

2017-01-01

unbalance with regards to traction loads has been augmented since the decision to expand the electric railway. Towards this direction, and on the occasion of a newly built electrified line, voltage unbalance measurements were carried out and are presented in this paper. The information from the extracted......On-site measurements in Electrical Power Systems can provide valuable information about the performance of the network and also, can be of great assistance to the validation and assessment of simulation models developed for power system studies. Lately, the noticeable increase of non......-conventional types of loads, such as the AC railway, has raised concerns regarding the secure operation of power transmission networks. This renders the monitoring and reporting of various aspects of system’s power quality even more necessary. For the Danish transmission grid, in particular, the relevance of voltage...

Magnetic flux pumping in 3D nonlinear magnetohydrodynamic simulations

Science.gov (United States)

Krebs, I.; Jardin, S. C.; Günter, S.; Lackner, K.; Hoelzl, M.; Strumberger, E.; Ferraro, N.

2017-10-01

A self-regulating magnetic flux pumping mechanism in tokamaks that maintains the core safety factor at q ≈1 , thus preventing sawteeth, is analyzed in nonlinear 3D magnetohydrodynamic simulations using the M3D-C1 code. In these simulations, the most important mechanism responsible for the flux pumping is that a saturated (m =1 ,n =1 ) quasi-interchange instability generates an effective negative loop voltage in the plasma center via a dynamo effect. It is shown that sawtoothing is prevented in the simulations if β is sufficiently high to provide the necessary drive for the (m =1 ,n =1 ) instability that generates the dynamo loop voltage. The necessary amount of dynamo loop voltage is determined by the tendency of the current density profile to centrally peak which, in our simulations, is controlled by the peakedness of the applied heat source profile.

MODELING OF VOLTAGE CONTROL FOR THE EVALUATING OF THE TRANSMISSION SYSTEM LOADING

OpenAIRE

BERNARDO HENRIQUE TODT SEELIG

1999-01-01

A falta de recursos e a questão ecológica tem limitado a expansão do sistema de transmissão. Esta realidade, em conjunto com o crescimento da carga, faz com que os sistemas elétricos trabalhem bastante carregados. Esta nova condição pode levar a situações de colapso de tensão. O desenvolvimento de métodos para a avaliação do carregamento da rede de transmissão tornou-se necessário e imprescindível para que se possa entender o funcionamento do sistema nestas con...

Slow voltage oscillations in Ag-doped superconducting Y-Ba-Cu-O

International Nuclear Information System (INIS)

Altinkok, A.; Yetis, H.; Kilic, K.; Kilic, A.; Olutas, M.

2008-01-01

The time effects in Ag-doped YBa 2 Cu 3 O 7-x sample (YBCO/Ag) were examined by means of transport relaxation measurements (V-t curves). At well-defined values of transport current (I), temperature (T) and external magnetic field (H), an abrupt rise in sample voltage was observed at the early stage of the relaxation process. After reducing the initial current to a finite value, the sample voltage levels off within a very short time. The rapid voltage drops seen in V-t curves were attributed to the rapid dynamic reorganization of flux lines traversing the sample edges. These observations were also interpreted as an indication of doping of YBCO with Ag and easy suppression of superconducting order parameter due to the presence of Ag. In addition, we investigated the influence of bidirectional square wave (BSW) current on the evolution of V-t curves at different temperatures and external magnetic fields. It was observed that a nonlinear response seen in V-t curves to BSW current with sufficiently short periods or sufficiently low amplitude reflects itself as regular sinusoidal- type voltage oscillations, which were discussed mainly in terms of the dynamic competition between pinning and depinning

Nonlinear transport theory in the metal with tunnel barrier

Science.gov (United States)

Zubov, E. E.

2018-02-01

Within the framework of the scattering matrix formalism, the nonlinear Kubo theory for electron transport in the metal with a tunnel barrier has been considered. A general expression for the mean electrical current was obtained. It significantly simplifies the calculation of nonlinear contributions to the conductivity of various hybrid structures. In the model of the tunnel Hamiltonian, all linear and nonlinear contributions to a mean electrical current are evaluated. The linear approximation agrees with results of other theories. For effective barrier transmission ?, the ballistic transport is realised with a value of the Landauer conductivity equal to ?.

Improvement of diagnostic techniques and electrical circuit in azo dye degradation by high voltage electrical discharge

International Nuclear Information System (INIS)

Shen Yongjun; Lei Lecheng; Zhang Xingwang; Zhou Minghua; Zhang Yi

2008-01-01

Fast electrical diagnostics and improvement of electrical circuits for methyl orange (MO) degradation by high voltage pulsed electrical discharge were investigated. To eliminate electromagnetic radiation, several effective methods were employed. RG 218 coaxial cable was substituted for the common transmission lines to transmit high voltage pulses, and multi-lines in parallel were earthed to avoid electromagnetic interference and, additionally, to reduce the stray inductance of the electrical circuit and increase the pulse rise rate to reduce the energy losses in the transmission system. The problem of the differences in the bandwidths of voltage and current probes causing an error in the calculation of energy dissipation was avoided by reducing the bandwidths of voltage and current measurements to the same value. The real discharge current was obtained by subtracting the capacitive current from the total current. The energy per pulse obtained in the reactor before and after improvement of the diagnostics and electrical circuit were 15.5 mJ and 26.8 mJ, respectively, and the energy efficiencies of MO degradation were 1.34 x 10 -9 mol/J and 1.95 x 10 -9 mol/J, respectively

Reactive Power Compensation of a 24 MW Wind Farm using a 12-Pulse Voltage Source Converter

DEFF Research Database (Denmark)

Pedersen, Knud Ole Helgesen; Pedersen, Jørgen Kaas

1998-01-01

Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop and investig......Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop...... and investigate the use of a STATCOM by modelling and field testing an 8 MVar unit in a 24 MW wind farm....

800 kW transmission line research at Leatherhead

Energy Technology Data Exchange (ETDEWEB)

1964-05-29

The experimental transmission line was installed at Leatherhead to enable the Central Electricity Research Laboratories to study the insulators, fittings, and conductors likely to be needed for ac power transmission at voltages up to the equivalent of 800 kV three-phase. Continuous recording will be made of corona power loss and radio and television interference. For this purpose C.E.R.L. has developed a statistical radio-interference recorder. The instrumentation also includes an automatic corona-loss bridge and data logger.

Environmental Audits of High Voltage Objects from the View Point of Investors

International Nuclear Information System (INIS)

Marek Szuba, M.

2007-01-01

The localization of high voltage objects, e.g., overhead transmission lines, under the spatial planning and environmental protection regulations is discussed. The most important elements of the localization procedure concerning high voltage overhead lines are presented. One of the elements of this procedure is the assessment of the investment environmental impact. The environmental audit is an essential document, in which this impact is described. It seems that its scope specified in the Environmental Protection Act is not adjusted to the specificity of line investments. This gives rise to some problems in preparing environmental audits for overhead lines, e.g., possible influence of high voltage lines on the Natura 2000 area zones. Several other related problems are also highlighted in this paper. (author)

Decomposition of Composite Electric Field in a Three-Phase D-Dot Voltage Transducer Measuring System

Directory of Open Access Journals (Sweden)

Xueqi Hu

2016-10-01

Full Text Available In line with the wider application of non-contact voltage transducers in the engineering field, transducers are required to have better performance for different measuring environments. In the present study, the D-dot voltage transducer is further improved based on previous research in order to meet the requirements for long-distance measurement of electric transmission lines. When measuring three-phase electric transmission lines, problems such as synchronous data collection and composite electric field need to be resolved. A decomposition method is proposed with respect to the superimposed electric field generated between neighboring phases. The charge simulation method is utilized to deduce the decomposition equation of the composite electric field and the validity of the proposed method is verified by simulation calculation software. With the deduced equation as the algorithm foundation, this paper improves hardware circuits, establishes a measuring system and constructs an experimental platform for examination. Under experimental conditions, a 10 kV electric transmission line was tested for steady-state errors, and the measuring results of the transducer and the high-voltage detection head were compared. Ansoft Maxwell Stimulation Software was adopted to obtain the electric field intensity in different positions under transmission lines; its values and the measuring values of the transducer were also compared. Experimental results show that the three-phase transducer is characterized by a relatively good synchronization for data measurement, measuring results with high precision, and an error ratio within a prescribed limit. Therefore, the proposed three-phase transducer can be broadly applied and popularized in the engineering field.

Characterization of Li-rich layered oxides by using transmission electron microscope

Directory of Open Access Journals (Sweden)

Hu Zhao

2017-07-01

Full Text Available Lithium-rich layered oxides (LrLOs deliver extremely high specific capacities and are considered to be promising candidates for electric vehicle and smart grid applications. However, the application of LrLOs needs further understanding of the structural complexity and dynamic evolution of monoclinic and rhombohedral phases, in order to overcome the issues including voltage decay, poor rate capability, initial irreversible capacity loss and etc. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, have fueled rapid progress in the understanding of the mechanism of such issues. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, migration of transition metal, and the activation of oxygen of LrLOs are then explored in detail, with a particular focus on the mechanism of voltage decay. Keywords: Lithium-ion battery, Transmission electron microscope, Lithium-rich layered oxide, Cathode material

A Decentralized Multivariable Robust Adaptive Voltage and Speed Regulator for Large-Scale Power Systems

Science.gov (United States)

Okou, Francis A.; Akhrif, Ouassima; Dessaint, Louis A.; Bouchard, Derrick

2013-05-01

This papter introduces a decentralized multivariable robust adaptive voltage and frequency regulator to ensure the stability of large-scale interconnnected generators. Interconnection parameters (i.e. load, line and transormer parameters) are assumed to be unknown. The proposed design approach requires the reformulation of conventiaonal power system models into a multivariable model with generator terminal voltages as state variables, and excitation and turbine valve inputs as control signals. This model, while suitable for the application of modern control methods, introduces problems with regards to current design techniques for large-scale systems. Interconnection terms, which are treated as perturbations, do not meet the common matching condition assumption. A new adaptive method for a certain class of large-scale systems is therefore introduces that does not require the matching condition. The proposed controller consists of nonlinear inputs that cancel some nonlinearities of the model. Auxiliary controls with linear and nonlinear components are used to stabilize the system. They compensate unknown parametes of the model by updating both the nonlinear component gains and excitation parameters. The adaptation algorithms involve the sigma-modification approach for auxiliary control gains, and the projection approach for excitation parameters to prevent estimation drift. The computation of the matrix-gain of the controller linear component requires the resolution of an algebraic Riccati equation and helps to solve the perturbation-mismatching problem. A realistic power system is used to assess the proposed controller performance. The results show that both stability and transient performance are considerably improved following a severe contingency.