WorldWideScience

Sample records for voltage nonlinear transmission

  1. Gyromagnetic nonlinear transmission line generator of high voltage pulses modulated at 4 GHz frequency with 1000 Hz pulse repetition rate

    International Nuclear Information System (INIS)

    Ulmasculov, M R; Sharypov, K A; Shunailov, S A; Shpak, V G; Yalandin, M I; Pedos, M S; Rukin, S N

    2017-01-01

    Results of testing of a generator based on a solid-state drive and the parallel gyromagnetic nonlinear transmission lines with external bias are presented. Stable rf-modulated high-voltage nanosecond pulses were shaped in each of the four channels in 1 s packets with 1000 Hz repetition frequencies. Pulse amplitude reaches -175 kV, at a modulation depth of rf-oscillations to 50 % and the effective frequency ∼4 GHz. (paper)

  2. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  3. Wave transmission in nonlinear lattices

    International Nuclear Information System (INIS)

    Hennig, D.; Tsironis, G.P.

    1999-01-01

    The interplay of nonlinearity with lattice discreteness leads to phenomena and propagation properties quite distinct from those appearing in continuous nonlinear systems. For a large variety of condensed matter and optics applications the continuous wave approximation is not appropriate. In the present review we discuss wave transmission properties in one dimensional nonlinear lattices. Our paradigmatic equations are discrete nonlinear Schroedinger equations and their study is done through a dynamical systems approach. We focus on stationary wave properties and utilize well known results from the theory of dynamical systems to investigate various aspects of wave transmission and wave localization. We analyze in detail the more general dynamical system corresponding to the equation that interpolates between the non-integrable discrete nonlinear Schroedinger equation and the integrable Albowitz-Ladik equation. We utilize this analysis in a nonlinear Kronig-Penney model and investigate transmission and band modification properties. We discuss the modifications that are effected through an electric field and the nonlinear Wannier-Stark localization effects that are induced. Several applications are described, such as polarons in one dimensional lattices, semiconductor superlattices and one dimensional nonlinear photonic band gap systems. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  4. Transmission of power at high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Lane, F J

    1963-01-01

    High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.

  5. Considering system non-linearity in transmission pricing

    International Nuclear Information System (INIS)

    Oloomi-Buygi, M.; Salehizadeh, M. Reza

    2008-01-01

    In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)

  6. High Voltage Power Transmission for Wind Energy

    Science.gov (United States)

    Kim, Young il

    The high wind speeds and wide available area at sea have recently increased the interests on offshore wind farms in the U.S.A. As offshore wind farms become larger and are placed further from the shore, the power transmission to the onshore grid becomes a key feature. Power transmission of the offshore wind farm, in which good wind conditions and a larger installation area than an onshore site are available, requires the use of submarine cable systems. Therefore, an underground power cable system requires unique design and installation challenges not found in the overhead power cable environment. This paper presents analysis about the benefit and drawbacks of three different transmission solutions: HVAC, LCC/VSC HVDC in the grid connecting offshore wind farms and also analyzed the electrical characteristics of underground cables. In particular, loss of HV (High Voltage) subsea power of the transmission cables was evaluated by the Brakelmann's theory, taking into account the distributions of current and temperature.

  7. High voltage transmission of electrical energy over long distances

    Energy Technology Data Exchange (ETDEWEB)

    Tewari, S W

    1962-07-01

    Technical aspects of ac transmission lines, additional means of improving stability ac transmisson lines, insulation problems, ac transmission by cables, high voltage dc transmission, advantages of dc over ac transmission, disadvantages of dc transmission, use of underground cables for dc transmission, history of the development of conversion equipment; transmission schemes adopted on Gotland Island, Sweden; and economics of ac and dc transmission are discussed.

  8. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

  9. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  10. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Science.gov (United States)

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  11. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Science.gov (United States)

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  12. An Annotated Bibliography of High-Voltage Direct-Current Transmission and Flexible AC Transmission (FACTS) Devices, 1991-1993.

    Energy Technology Data Exchange (ETDEWEB)

    Litzenberger, Wayne; Lava, Val

    1994-08-01

    References are contained for HVDC systems, converter stations and components, overhead transmission lines, cable transmission, system design and operations, simulation of high voltage direct current systems, high-voltage direct current installations, and flexible AC transmission system (FACTS).

  13. Nonlinear left-handed transmission line metamaterials

    International Nuclear Information System (INIS)

    Kozyrev, A B; Weide, D W van der

    2008-01-01

    Metamaterials, exhibiting simultaneously negative permittivity ε and permeability μ, more commonly referred to as left-handed metamaterials (LHMs) and also known as negative-index materials, have received substantial attention in the scientific and engineering communities [1]. Most studies of LHMs (and electromagnetic metamaterials in general) have been in the linear regime of wave propagation and have already inspired new types of microwave circuits and devices. The results of these studies have already been the subject of numerous reviews and books. This review covers a less explored but rapidly developing area of investigation involving media that combine nonlinearity (dependence of the permittivity and permeability on the magnitude of the propagating field) with the anomalous dispersion exhibited by LHM. The nonlinear phenomena in such media will be considered on the example of a model system: the nonlinear left-handed transmission line. These nonlinear phenomena include parametric generation and amplification, harmonic and subharmonic generation as well as modulational instabilities and envelope solitons. (topical review)

  14. Bottlenecks reduction using superconductors in high voltage transmission lines

    Directory of Open Access Journals (Sweden)

    Daloub Labib

    2016-01-01

    Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.

  15. Induced voltages in metallic pipelines near power transmission lines

    International Nuclear Information System (INIS)

    Grcev, Leonid; Jankov, Voislav; Filiposki, Velimir

    2002-01-01

    With the continuous development of the electric power system and the pipeline networks used to convey oil or natural gas, cases of close proximity of high voltage structures and metallic pipelines become more and more frequent. Accordingly there is a growing concern about possible hazards resulting from voltages induced in the metallic pipelines by magnetic coupling with nearby power transmission lines. This paper presents a methodology for computation of the induced voltages in buried isolated metallic pipelines. A practical example of computation is also presented. (Author)

  16. Propagation of disturbances as voltage fluctuations in transmission networks

    Directory of Open Access Journals (Sweden)

    Albert Hermina

    2016-08-01

    Full Text Available Significant changes occurred in the power system in Romania in recent years by reducing the power used in the system, the number of classic power sources in operation as well as by implementing renewable energy sources, have determined short circuit power reduction (node rigidity in the points where disturbing users are connected, that in the absence of adequate measures, result in disturbances above acceptable levels. The paper analyzes two power systems areas in which are connected users that cause voltage fluctuation. Disturbances as voltage fluctuations resulting in these nodes may exceed the acceptable values and can spread in the transmission network affecting power quality over large system areas. The analysis conducted reveals the influence of short circuit power in nodes where these users are connected and highlights the fact that in some cases (e.g. lines out of operation for maintenance, shutdown of classic units in the area the disturbances in the transmission network sent to the users at lower voltages may have values above those allowed. Technical Code of existing power transmission network makes no reference to voltage fluctuations, as a rule, in the electricity transmission network was considered that this phenomenon should not exist.

  17. Proximity effects of high voltage electric power transmission lines on ...

    African Journals Online (AJOL)

    The proximity effects of high voltage electric power transmission lines on Leyland Cypress (xCupressocyparis leylandii (Dallim. and A.B. Jacks.) Dallim) and Japanese Privet (Ligustrum japonicum Thunb.) growth were examined in a private nursery located in Sakarya, Turkey. Five transect were randomly chosen in both ...

  18. Voltage Balancing Method on Expert System for 51-Level MMC in High Voltage Direct Current Transmission

    Directory of Open Access Journals (Sweden)

    Yong Chen

    2016-01-01

    Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.

  19. High voltage transmission lines - what are the hazards

    International Nuclear Information System (INIS)

    Repacholi, M.H.

    1985-01-01

    With the increasing use of high voltage alternating current (HVAC) transmission lines there is a growing concern among the public about possible human health effects resulting from exposure to the electric fields associated with these lines. While there is no definitive evidence of such effects, mounting public fear and activism over hypothesized health risks is already causing delays in the licensing and constuction of major power transmission facilities, and is encouraging the formation of regulatory policy. This paper briefly reviews the concerns, biological effects data and standards for HVAC transmission lines

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  1. Voltage control in the future power transmission systems

    DEFF Research Database (Denmark)

    Qin, Nan

    Wind energy in Denmark covers 42% of the total power consumption in 2015, and will share up to 50% by 2020. Consequently, the conventional power plants are decommissioning. Under the progress of the green transition, the national decision leads to underground many overhead lines in the future...... stages. The voltage uncertainty caused by the wind power forecasting errors is estimated, which is applied as a voltage security margin to further constrain the voltage magnitude in the optimization problem. The problem under the uncertainty is therefore converted to a deterministic problem, which...... to ensure a highly reliable transmission, e.g. balancing the generation and the consumption in large geographic regions, the exchange capacities will be enlarged by upgrading the interconnections. The Danish power system, the electricity transportation hub between the Nordic and continental European systems...

  2. Parametric amplifications in the nonlinear transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Kawata, T; Sakai, J; Inoue, H [Toyama Univ., Takaoka (Japan). Faculty of Engineering

    1980-03-01

    The parametric amplification in a transmission line with nonlinear capacitors is analysed theoretically using the equations of three wave interactions. Since this line has two modes, high frequency and low frequency modes, there may occur some mode coupling phenomena through the resonant interactions. We consider three waves with wave number k sub(j) and frequency ..omega..sub(j) in resonance with each other, that is, ..omega../sub 1/ + ..omega../sub 2/ = ..omega../sub 3/ and k/sub 1/ + k/sub 2/ = k/sub 3/, where 0 <= ..omega../sub 1/ <= ..omega../sub 2/ <= ..omega../sub 3/ and k/sub 3/ >= 0. Such conditions are realized in our network and there exist two states: ''forward state'' (each group velocity is positive) and ''backward state'' (one of the group velocities is negative). The coupled equations of three waves has two constant pumps: high frequency (HF) pump and low frequency (LF) pump. Using linear approximations, we examine the possible types of parametric amplification and obtain the power gains depending on the frequency deviation. For only the case of HF pump we get the gain between signals with seme frequency and also get the gain from the low frequency signal to the high frequency signal (''up-conversion'') for the LF pump. The nonlinear analysis gives the exact relation between input and output signals. For the forward state the gain is absolutely suppressed by the ratio of pumping power to input power, while the gain of backward state has no finite maximum and there may appear an ''oscillating state'' if the pumping power is comparatively small.

  3. Nonlinear control of voltage source converters in AC-DC power system.

    Science.gov (United States)

    Dash, P K; Nayak, N

    2014-07-01

    This paper presents the design of a robust nonlinear controller for a parallel AC-DC power system using a Lyapunov function-based sliding mode control (LYPSMC) strategy. The inputs for the proposed control scheme are the DC voltage and reactive power errors at the converter station and the active and reactive power errors at the inverter station of the voltage-source converter-based high voltage direct current transmission (VSC-HVDC) link. The stability and robust tracking of the system parameters are ensured by applying the Lyapunov direct method. Also the gains of the sliding mode control (SMC) are made adaptive using the stability conditions of the Lyapunov function. The proposed control strategy offers invariant stability to a class of systems having modeling uncertainties due to parameter changes and exogenous inputs. Comprehensive computer simulations are carried out to verify the proposed control scheme under several system disturbances like changes in short-circuit ratio, converter parametric changes, and faults on the converter and inverter buses for single generating system connected to the power grid in a single machine infinite-bus AC-DC network and also for a 3-machine two-area power system. Furthermore, a second order super twisting sliding mode control scheme has been presented in this paper that provides a higher degree of nonlinearity than the LYPSMC and damps faster the converter and inverter voltage and power oscillations. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  4. Unidirectional transmission in 1D nonlinear photonic crystal based on topological phase reversal by optical nonlinearity

    OpenAIRE

    Chong Li; Xiaoyong Hu; Hong Yang; Qihuang Gong

    2017-01-01

    We propose a scheme of unidirectional transmission in a 1D nonlinear topological photonic crystal based on the topological edge state and three order optical nonlinearity. The 1D photonic crystals consists of a nonlinear photonic crystal L and a linear photonic crystal R. In the backward direction, light is totally reflected for the photons transmission prohibited by the bandgap. While in the forward direction, light interacts with the nonlinear photonic crystal L by optical Kerr effect, brin...

  5. Thermal Rectification in Graded Nonlinear Transmission Lines

    International Nuclear Information System (INIS)

    Xu Wen; Chen Wei-Zhong; Tao Feng

    2011-01-01

    We consider heat conduction in a nonlinear inductance-capacitance (LC) transmission line with an inductance gradient by adding white-noise signals. It is found that the heat flux in the direction of inductance decrease is larger than that in the direction of inductance increase. When the low-inductance end is at higher temperature, the phonon density decreases due to conversion to high-frequency phonons, which can not move to the high-inductance end due to its lower cutoff frequency. However, when the high-inductance end is at higher temperature, the loss of phonon density can be compensated for because some high-frequency phonons can move to the low-inductance end dur to its higher cutoff frequency. This leads to the asymmetry of energy transfer. Discussion shows that this asymmetry exists in a particular range of temperatures, and increases with the increase of the difference between heat baths and the inductance gradient. (fundamental areas of phenomenology(including applications))

  6. Nonlinear current-voltage behavior in PZT thin films

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)

    2017-05-15

    In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)

  7. Measurements of Voltage Harmonics in 400 kV Transmission Network

    Directory of Open Access Journals (Sweden)

    Ryszard Pawełek

    2014-06-01

    Full Text Available The paper deals with the analysis of voltage harmonics measurements performed in the 400 kV transmission network. The voltage was measured by means of three transducers: resistive voltage divider, inductive measuring transformer and capacitive voltage measuring transformer. Instrument errors were estimated for measuring transformers with reference to the harmonic values obtained from the voltage divider.

  8. Automatic Voltage Control (AVC) of Danish Transmission System - Concept design

    DEFF Research Database (Denmark)

    Qin, Nan; Abildgaard, Hans; Lund, P.

    2014-01-01

    For more than 20 years it has been a consistent plan by all Danish governments to turn the Danish power production away from fossil fuels towards renewable energy. The result today is that 37% of the total Danish power consumption was covered by mainly wind energy in 2013 aiming at 50% by 2020......, objectives, constraints, algorithms for optimal power flow and some special functions in particular systems, which inspires the concept design of a Danish AVC system to address the future challenges of voltage control. In the concept, the Danish AVC design is based on a centralized control scheme. All...... the substation loses the telecommunications to the control center. RPCs will be integrated to the AVC system as normative regulators in the later stage. Distributed generation units can be organized as virtual power plants and participate in voltage control at transmission level. Energinet.dk as the Danish TSO...

  9. Voltage-Induced Nonlinear Conduction Properties of Epoxy Resin/Micron-Silver Particles Composites

    Science.gov (United States)

    Qu, Zhaoming; Lu, Pin; Yuan, Yang; Wang, Qingguo

    2018-01-01

    The nonlinear conduction properties of epoxy resin (ER)/micron-silver particles (MP) composites were investigated. Under sufficient high intensity applied constant voltage, the obvious nonlinear conduction properties of the samples with volume fraction 25% were found. With increments in the voltage, the conductive switching effect was observed. The nonlinear conduction mechanism of the ER/MP composites under high applied voltages could be attributed to the electrical current conducted via discrete paths of conductive particles induced by the electric field. The test results show that the ER/MP composites with nonlinear conduction properties are of great potential application in electromagnetic protection of electron devices and systems.

  10. Market Report : The high-voltage transmission market in Poland

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-06-01

    In order to meet the accession requirements for membership to the European Union, Poland is currently restructuring its energy sector, and the initiative to privatise the electric power industry to full competition by 2005 is on course. This report describes the opportunities for foreign investors and suppliers of electrical equipment and services, particularly at this time when power demand is growing, the power grid infrastructure is ageing and obsolete components must be replaced. The total installed capacity in Poland is about 33,000 megawatts. This includes all installations of power plants and combined heat and power plants. An investment of $23 billion is anticipated by 2010 in order to modernize the electricity power industry and to meet the growing energy demand. Polski Siece Elektroenergetyczne, S.A. (PSE) is the state-owned company which controls Poland's high-voltage transmission grid. It operates a 220 kilovolt and 40 kV grid and holds the monopoly on acquiring and transmitting electricity in the country. Poland maintains grid interconnections with several other European countries and is looking to expand its network. Opportunities for Canadian suppliers lie in the areas of high-voltage power transmission equipment and services. Other opportunities lie in commercial prospects in sales of equipment and services. The report includes a section on international competition, and the Canadian position for both private- and public-sector companies. A section on market logistics describes distribution channels, market-entry considerations, import regulations, and export credit risks. A list of key contacts and support services is included with this report. refs., tabs.

  11. Determinants of Rotavirus Transmission: A Lag Nonlinear Time Series Analysis.

    Science.gov (United States)

    van Gaalen, Rolina D; van de Kassteele, Jan; Hahné, Susan J M; Bruijning-Verhagen, Patricia; Wallinga, Jacco

    2017-07-01

    Rotavirus is a common viral infection among young children. As in many countries, the infection dynamics of rotavirus in the Netherlands are characterized by an annual winter peak, which was notably low in 2014. Previous study suggested an association between weather factors and both rotavirus transmission and incidence. From epidemic theory, we know that the proportion of susceptible individuals can affect disease transmission. We investigated how these factors are associated with rotavirus transmission in the Netherlands, and their impact on rotavirus transmission in 2014. We used available data on birth rates and rotavirus laboratory reports to estimate rotavirus transmission and the proportion of individuals susceptible to primary infection. Weather data were directly available from a central meteorological station. We developed an approach for detecting determinants of seasonal rotavirus transmission by assessing nonlinear, delayed associations between each factor and rotavirus transmission. We explored relationships by applying a distributed lag nonlinear regression model with seasonal terms. We corrected for residual serial correlation using autoregressive moving average errors. We inferred the relationship between different factors and the effective reproduction number from the most parsimonious model with low residual autocorrelation. Higher proportions of susceptible individuals and lower temperatures were associated with increases in rotavirus transmission. For 2014, our findings suggest that relatively mild temperatures combined with the low proportion of susceptible individuals contributed to lower rotavirus transmission in the Netherlands. However, our model, which overestimated the magnitude of the peak, suggested that other factors were likely instrumental in reducing the incidence that year.

  12. Optimizing real power loss and voltage stability limit of a large transmission network using firefly algorithm

    Directory of Open Access Journals (Sweden)

    P. Balachennaiah

    2016-06-01

    Full Text Available This paper proposes a Firefly algorithm based technique to optimize the control variables for simultaneous optimization of real power loss and voltage stability limit of the transmission system. Mathematically, this issue can be formulated as nonlinear equality and inequality constrained optimization problem with an objective function integrating both real power loss and voltage stability limit. Transformers taps, unified power flow controller and its parameters have been included as control variables in the problem formulation. The effectiveness of the proposed algorithm has been tested on New England 39-bus system. Simulation results obtained with the proposed algorithm are compared with the real coded genetic algorithm for single objective of real power loss minimization and multi-objective of real power loss minimization and voltage stability limit maximization. Also, a classical optimization method known as interior point successive linear programming technique is considered here to compare the results of firefly algorithm for single objective of real power loss minimization. Simulation results confirm the potentiality of the proposed algorithm in solving optimization problems.

  13. Mathematical modeling of agricultural fires beneath high voltage transmission lines

    International Nuclear Information System (INIS)

    El-Zohri, Emad H.; Shafey, Hamdy M.; Abdel-Salam, M.; Ahmed, A.

    2011-01-01

    This paper presents a mathematical model for agricultural fires based on a multi-phase formulation. The model includes dehydration and pyrolysis of agricultural fuel and pyrolysis products. The model considers a homogeneous distribution of the agricultural solid fuel particles, interacting with the gas flow via source terms. These terms include: drag forces, production of water vapour and pyrolysis products, radiative and convective heat exchange. A multi-phase radiative transfer equation for absorbing-emitting medium is considered to account for the radiative heat exchange between the gas and solid phases of the fire. The main outputs of the present model are most important to study the influence of agricultural fire occurring beneath high voltage transmission lines. The agricultural fire causes a flashover due to the ambient temperature rise and soot accumulation on the insulator of these transmission lines. Numerical results of the present model are obtained for flat grassland fires to study the effects of wind velocity, solid fuel moisture content and ignition length on some selected fire outputs. These outputs include the temperature, velocity, soot volume fraction fields of the gas phase, together with fire propagation rate and flame geometry. The numerical results are compared to the available experimental work in the literature. -- Research highlights: → The model is sensitive to the initial condition of the ignition length affecting the fire propagation rate and width. → The model predicts the effects of both the wind velocity and the fuel moisture content on fire propagation rate, in agreement with the available experimental work in the literature. → The model shows that both the wind velocity and the fuel moisture content are important factors affecting the fire plume thickness, location, and inclination. → The model is able to visualize the flame geometry through tracing radiative heat rates exceeding a threshold value for flame visibility (60 k

  14. Unidirectional transmission in 1D nonlinear photonic crystal based on topological phase reversal by optical nonlinearity

    Directory of Open Access Journals (Sweden)

    Chong Li

    2017-02-01

    Full Text Available We propose a scheme of unidirectional transmission in a 1D nonlinear topological photonic crystal based on the topological edge state and three order optical nonlinearity. The 1D photonic crystals consists of a nonlinear photonic crystal L and a linear photonic crystal R. In the backward direction, light is totally reflected for the photons transmission prohibited by the bandgap. While in the forward direction, light interacts with the nonlinear photonic crystal L by optical Kerr effect, bringing a topological phase reversal and results the topological edge mode arising at the interface which could transmit photons through the bandgaps both of the photonic crystal L and R. When the signal power intensity larger than a moderate low threshold value of 10.0 MW/cm2, the transmission contrast ratio could remain at 30 steadily.

  15. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

    OpenAIRE

    Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.

    2015-01-01

    The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...

  16. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

    Directory of Open Access Journals (Sweden)

    Bulyga Leonid L.

    2015-01-01

    Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.

  17. Technical and economic aspects of the transmission of energy at extra high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1967-01-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  18. Voltage Quality Improvement in Islanded Microgrids Supplying Nonlinear Loads

    DEFF Research Database (Denmark)

    T. Dehghani, Mohammad; Vahedi, Abolfazl; Savaghebi, Mehdi

    2012-01-01

    The aim of this paper is to improve voltage quality at the terminals of distributed generators (DGs) in an islanded microgrid. To achieve this goal, it is proposed to include separate voltage and current control loops for the fundamental and harmonics frequencies. This way, it is not necessary...

  19. Fractional analysis for nonlinear electrical transmission line and nonlinear Schroedinger equations with incomplete sub-equation

    Science.gov (United States)

    Fendzi-Donfack, Emmanuel; Nguenang, Jean Pierre; Nana, Laurent

    2018-02-01

    We use the fractional complex transform with the modified Riemann-Liouville derivative operator to establish the exact and generalized solutions of two fractional partial differential equations. We determine the solutions of fractional nonlinear electrical transmission lines (NETL) and the perturbed nonlinear Schroedinger (NLS) equation with the Kerr law nonlinearity term. The solutions are obtained for the parameters in the range (0<α≤1) of the derivative operator and we found the traditional solutions for the limiting case of α =1. We show that according to the modified Riemann-Liouville derivative, the solutions found can describe physical systems with memory effect, transient effects in electrical systems and nonlinear transmission lines, and other systems such as optical fiber.

  20. Co-operation of digital nonlinear equalizers and soft-decision LDPC FEC in nonlinear transmission.

    Science.gov (United States)

    Tanimura, Takahito; Oda, Shoichiro; Hoshida, Takeshi; Aoki, Yasuhiko; Tao, Zhenning; Rasmussen, Jens C

    2013-12-30

    We experimentally and numerically investigated the characteristics of 128 Gb/s dual polarization - quadrature phase shift keying signals received with two types of nonlinear equalizers (NLEs) followed by soft-decision (SD) low-density parity-check (LDPC) forward error correction (FEC). Successful co-operation among SD-FEC and NLEs over various nonlinear transmissions were demonstrated by optimization of parameters for NLEs.

  1. Protection relay of phase-shifting device with thyristor switch for high voltage power transmission lines

    Science.gov (United States)

    Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.

    2014-12-01

    Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.

  2. Technical and economic evaluation of voltage level in transmission network expansion planning using GA

    International Nuclear Information System (INIS)

    Jalilzadeh, S.; Kazemi, A.; Shayeghi, H.; Madavi, M.

    2008-01-01

    Transmission network expansion planning is an important part of power system planning. Its task is to determine an optimal network configuration according to load growth. It determines where, when and how many new transmission lines should be installed. Up to now, various methods have been presented to solve the static transmission network expansion planning (STNEP) problem, but in all of these methods, the STNEP problem has been solved regardless of voltage level of the lines. In this paper, due to different voltage levels in the transmission network, which cause different annual losses, STNEP has been studied considering the voltage level of the transmission lines and the network loss using the genetic algorithm (GA). Finally, the proposed idea has been examined on Garvers 6 bus network. The results show that considering the loss in a network with different voltage levels decreases the operational costs considerably, and the network satisfies the requirement of delivering electric power more safely and reliably to load centers

  3. Choice of operating voltage for a transmission electron microscope

    International Nuclear Information System (INIS)

    Egerton, R.F.

    2014-01-01

    An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

  4. Chameleon's behavior of modulable nonlinear electrical transmission line

    Science.gov (United States)

    Togueu Motcheyo, A. B.; Tchinang Tchameu, J. D.; Fewo, S. I.; Tchawoua, C.; Kofane, T. C.

    2017-12-01

    We show that modulable discrete nonlinear transmission line can adopt Chameleon's behavior due to the fact that, without changing its appearance structure, it can become alternatively purely right or left handed line which is different to the composite one. Using a quasidiscrete approximation, we derive a nonlinear Schrödinger equation, that predicts accurately the carrier frequency threshold from the linear analysis. It appears that the increasing of the linear capacitor in parallel in the series branch induced the selectivity of the filter in the right-handed region while it increases band pass filter in the left-handed region. Numerical simulations of the nonlinear model confirm the forward wave in the right handed line and the backward wave in the left handed one.

  5. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...

  6. Radio and television interference caused by corona discharges from high-voltage transmission lines

    International Nuclear Information System (INIS)

    Sarmadi, M.

    1996-01-01

    Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather

  7. Strongly nonlinear dynamics of electrolytes in large ac voltages

    DEFF Research Database (Denmark)

    Olesen, Laurits Højgaard; Bazant, Martin Z.; Bruus, Henrik

    2010-01-01

    to suppress the strongly nonlinear regime in the limit of concentrated electrolytes, ionic liquids, and molten salts. Beyond the model problem, our reduced equations for thin double layers, based on uniformly valid matched asymptotic expansions, provide a useful mathematical framework to describe additional...

  8. Accurate determination of the voltage of a transmission electron ...

    Indian Academy of Sciences (India)

    The techniques established are found to be suitable for TEMs operating at a setting voltage of about 250 kV. For the TEM studies, a regular double-tilt specimen holder is required in order to be able to get to the desired zone axes. When the experiments were repeated using a cryogenic double-tilt holder, an improvement in ...

  9. A Case Study Of Turkish Transmission System For VoltageDips

    DEFF Research Database (Denmark)

    Inan, E.; Alboyaci, B.; Bak, Claus Leth

    2009-01-01

    Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short-duration vo......Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short...... analysis of voltage dip performance of the whole transmission system, is used to compare with results constructed fault statics from SIMPOW DIPS analysis program real data. SIMPOW DIPS software enables to calculate dip frequency for all busses and lines....

  10. Study on Control Scheme for the Inverters in Low Voltage Microgrid with Nonlinear Loads

    Science.gov (United States)

    Xu, Jiqiang; Lu, Wenzhou; Wu, Lei

    2017-05-01

    There are a lot of nonlinear loads in real low voltage microgrid system. It will cause serious output voltage and grid current harmonic distortions problems in island and grid-connected modes, respectively. To solve this problem, this paper proposes a droop control scheme with quasi-proportion and resonant (quasi-PR) controller based on αβ stationary reference frame to make microgrid smoothly switch between grid-connected and island modes without changing control method. Moreover, in island mode, not only stable output voltage and frequency, but also reduced output voltage harmonics with added nonlinear loads can be achieved; In grid-connected mode, not only constant power, but also reduced grid current harmonics can be achieved. Simulation results verify the effectiveness of the proposed control scheme.

  11. Proximity effects of high voltage electric power transmission lines on ...

    African Journals Online (AJOL)

    Yomi

    2010-08-18

    Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.

  12. Transmission congestion and voltage profile management coordination in competitive electricity markets

    International Nuclear Information System (INIS)

    Yamin, H.Y.; Shahidehpour, S.M.

    2003-01-01

    This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)

  13. High voltage transmission lines studies with the use of artificial intelligence

    Energy Technology Data Exchange (ETDEWEB)

    Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)

    2009-12-15

    The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)

  14. Literature Survey on Operational Voltage Control and Reactive Power Management on Transmission and Sub-Transmission Networks

    Energy Technology Data Exchange (ETDEWEB)

    Elizondo, Marcelo A.; Samaan, Nader A.; Makarov, Yuri V.; Holzer, Jesse T.; Vallem, Mallikarjuna R.; Huang, Renke; Vyakaranam, Bharat GNVSR; Ke, Xinda; Pan, Feng

    2017-10-02

    Voltage and reactive power system control is generally performed following usual patterns of loads, based on off-line studies for daily and seasonal operations. This practice is currently challenged by the inclusion of distributed renewable generation, such as solar. There has been focus on resolving this problem at the distribution level; however, the transmission and sub-transmission levels have received less attention. This paper provides a literature review of proposed methods and solution approaches to coordinate and optimize voltage control and reactive power management, with an emphasis on applications at transmission and sub-transmission level. The conclusion drawn from the survey is that additional research is needed in the areas of optimizing switch shunt actions and coordinating all available resources to deal with uncertain patterns from increasing distributed renewable generation in the operational time frame. These topics are not deeply explored in the literature.

  15. Method and system for a gas tube switch-based voltage source high voltage direct current transmission system

    Science.gov (United States)

    She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William

    2016-12-13

    A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.

  16. Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

    Science.gov (United States)

    Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

    2015-12-30

    A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

  17. High voltage direct current transmission converters, systems and DC grids

    CERN Document Server

    Jovcic, Dragan

    2015-01-01

    This comprehensive reference guides the reader through all HVDC technologies, including LCC (Line Commutated Converter), 2-level VSC and VSC HVDC based on modular multilevel converters (MMC) for an in-depth understanding of converters, system level design, operating principles and modeling. Written in a tutorial style, the book also describes the key principles of design, control, protection and operation of DC transmission grids, which will be substantially different from the practice with AC transmission grids. The first dedicated reference to the latest HVDC technologies and DC grid developments; this is an essential resource for graduate students and researchers as well as engineers and professionals working on the design, modeling and operation of DC grids and HVDC.

  18. Environmental impact of high voltage aerial transmission lines

    International Nuclear Information System (INIS)

    Silva, R.P.; Mouallen, M.C.; Quintella, S.E.A.

    1989-01-01

    The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig

  19. Nonlinear current-voltage characteristics of WO3-x nano-/micro-rods

    Science.gov (United States)

    Shen, Zhenguang; Peng, Zhijian; Zhao, Zengying; Fu, Xiuli

    2018-04-01

    A series of crystalline tungsten oxide nano-/micro-rods with different compositions of WO3, WO2.90, W19O55 (WO2.89) and W18O49 (WO2.72) but identical morphology feature were first prepared. Then, various nanoscaled electrical devices were fabricated from them by micro-fabrication through a focused ion beam technique. Interestingly, the devices from the oxygen-deficient WO3-x display significantly nonlinear current-voltage characteristics. The calculated nonlinear coefficients of the WO2.90, WO2.83, and WO2.72 varistors are 2.52, 3.32 and 4.91, respectively. The breakdown voltage of the WO2.90, WO2.83, and WO2.72 varistors are 1.93, 1.28 and 0.93 V, respectively. Such WO3-x nano-varistors might be promising for low-voltage electrical/electronic devices.

  20. Impact of distributed generators on the power loss and voltage profile of sub-transmission network

    Directory of Open Access Journals (Sweden)

    A.S.O. Ogunjuyigbe

    2016-05-01

    Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

  1. High Voltage AC underground cable systems for power transmission

    DEFF Research Database (Denmark)

    Bak, Claus Leth; Silva, Filipe Miguel Faria da

    2016-01-01

    researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with AC Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....

  2. High Voltage AC underground cable systems for power transmission

    DEFF Research Database (Denmark)

    Bak, Claus Leth; Silva, Filipe Miguel Faria da

    2016-01-01

    researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with Ac Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....

  3. Multilayered Functional Insulation System (MFIS) for AC Power Transmission in High Voltage Hybrid Electrical Propulsion

    Science.gov (United States)

    Lizcano, Maricela

    2017-01-01

    High voltage hybrid electric propulsion systems are now pushing new technology development efforts for air transportation. A key challenge in hybrid electric aircraft is safe high voltage distribution and transmission of megawatts of power (>20 MW). For the past two years, a multidisciplinary materials research team at NASA Glenn Research Center has investigated the feasibility of distributing high voltage power on future hybrid electric aircraft. This presentation describes the team's approach to addressing this challenge, significant technical findings, and next steps in GRC's materials research effort for MW power distribution on aircraft.

  4. Voltage adjusting characteristics in terahertz transmission through Fabry-Pérot-based metamaterials

    Directory of Open Access Journals (Sweden)

    Jun Luo

    2015-10-01

    Full Text Available Metallic electric split-ring resonators (SRRs with featured size in micrometer scale, which are connected by thin metal wires, are patterned to form a periodically distributed planar array. The arrayed metallic SRRs are fabricated on an n-doped gallium arsenide (n-GaAs layer grown directly over a semi-insulating gallium arsenide (SI-GaAs wafer. The patterned metal microstructures and n-GaAs layer construct a Schottky diode, which can support an external voltage applied to modify the device properties. The developed architectures present typical functional metamaterial characters, and thus is proposed to reveal voltage adjusting characteristics in the transmission of terahertz waves at normal incidence. We also demonstrate the terahertz transmission characteristics of the voltage controlled Fabry-Pérot-based metamaterial device, which is composed of arrayed metallic SRRs. To date, many metamaterials developed in earlier works have been used to regulate the transmission amplitude or phase at specific frequencies in terahertz wavelength range, which are mainly dominated by the inductance-capacitance (LC resonance mechanism. However, in our work, the external voltage controlled metamaterial device is developed, and the extraordinary transmission regulation characteristics based on both the Fabry-Pérot (FP resonance and relatively weak surface plasmon polariton (SPP resonance in 0.025-1.5 THz range, are presented. Our research therefore shows a potential application of the dual-mode-resonance-based metamaterial for improving terahertz transmission regulation.

  5. The design, construction, and operation of long-distance high-voltage electricity transmission technologies.

    Energy Technology Data Exchange (ETDEWEB)

    Molburg, J. C.; Kavicky, J. A.; Picel, K. C.

    2008-03-03

    This report focuses on transmission lines, which operate at voltages of 115 kV and higher. Currently, the highest voltage lines comprising the North American power grid are at 765 kV. The grid is the network of transmission lines that interconnect most large power plants on the North American continent. One transmission line at this high voltage was built near Chicago as part of the interconnection for three large nuclear power plants southwest of the city. Lines at this voltage also serve markets in New York and New England, also very high demand regions. The large power transfers along the West Coast are generally at 230 or 500 kV. Just as there are practical limits to centralization of power production, there are practical limits to increasing line voltage. As voltage increases, the height of the supporting towers, the size of the insulators, the distance between conductors on a tower, and even the width of the right-of-way (ROW) required increase. These design features safely isolate the electric power, which has an increasing tendency to arc to ground as the voltage (or electrical potential) increases. In addition, very high voltages (345 kV and above) are subject to corona losses. These losses are a result of ionization of the atmosphere, and can amount to several megawatts of wasted power. Furthermore, they are a local nuisance to radio transmission and can produce a noticeable hum. Centralized power production has advantages of economies of scale and special resource availability (for instance, hydro resources), but centralized power requires long-distance transfers of power both to reach customers and to provide interconnections for reliability. Long distances are most economically served at high voltages, which require large-scale equipment and impose a substantial footprint on the corridors through which power passes. The most visible components of the transmission system are the conductors that provide paths for the power and the towers that keep these

  6. Energy and Transmissibility in Nonlinear Viscous Base Isolators

    Science.gov (United States)

    Markou, Athanasios A.; Manolis, George D.

    2016-09-01

    High damping rubber bearings (HDRB) are the most commonly used base isolators in buildings and are often combined with other systems, such as sliding bearings. Their mechanical behaviour is highly nonlinear and dependent on a number of factors. At first, a physical process is suggested here to explain the empirical formula introduced by J.M. Kelly in 1991, where the dissipated energy of a HDRB under cyclic testing, at constant frequency, is proportional to the amplitude of the shear strain, raised to a power of approximately 1.50. This physical process is best described by non-Newtonian fluid behaviour, originally developed by F.H. Norton in 1929 to describe creep in steel at high-temperatures. The constitutive model used includes a viscous term, that depends on the absolute value of the velocity, raised to a non-integer power. The identification of a three parameter Kelvin model, the simplest possible system with nonlinear viscosity, is also suggested here. Furthermore, a more advanced model with variable damping coefficient is implemented to better model in this complex mechanical process. Next, the assumption of strain-rate dependence in their rubber layers under cyclic loading is examined in order to best interpret experimental results on the transmission of motion between the upper and lower surfaces of HDRB. More specifically, the stress-relaxation phenomenon observed with time in HRDB can be reproduced numerically, only if the constitutive model includes a viscous term, that depends on the absolute value of the velocity raised to a non-integer power, i. e., the Norton fluid previously mentioned. Thus, it becomes possible to compute the displacement transmissibility function between the top and bottom surfaces of HDRB base isolator systems and to draw engineering-type conclusions, relevant to their design under time-harmonic loads.

  7. Performance Analysis of a Voltage Source Converter (VSC based HVDC Transmission System under Faulted Conditions

    Directory of Open Access Journals (Sweden)

    Amiri RABIE

    2009-12-01

    Full Text Available Voltage Source Converter (VSC based HVDC transmission technology hasbeen selected as the basis for several recent projects due to its controllability,compact modular design, ease of system interface, and low environmentalimpact. This paper investigates the dynamic performance of a 200MW,±100kV VSC-HVDC transmission system under some faulted conditionsusing MATLAB/Simulink. Simulation results confirm the satisfactoryperformance of the proposed system under active and reactive powervariations and fault conditions.

  8. Nonlinear Vibroimpact Characteristics of a Planetary Gear Transmission System

    Directory of Open Access Journals (Sweden)

    Jianxing Zhou

    2016-01-01

    Full Text Available In order to research the vibroimpact characteristics of a planetary gear transmission system under high speed and lightly loaded conditions, a new modeling method is proposed. In the modeling process, linear spring was used to simulate gear mesh elasticity under heavy load cases, and Hertz contact theory was used to calculate the contact force of gear pair under light load cases. Then, effects of the working conditions on the system vibroimpact characteristics are analyzed. The results show that, with input speed growing, the mesh force produced obvious fluctuations on the resonance frequencies of the sun gear and carrier torsion vibration, ring gear’s transverse vibration under the heavy load. Under light load condition, the collision vibration occurs in the gear pair; the changing trend of the contact force shows strongly nonlinear characteristics. The time of mesh-apart in gears pair decreases gradually as the load is increased; until it reaches collision vibration threshold value, the gear pair is no longer mesh-apart. With increasing of the input speed, the time of mesh-apart is decreased gradually; the fluctuation amplitude of contact force shows a linearly increasing trend. The study provides useful theoretical guideline for planetary gear transmission low-noise design.

  9. Voltage Analysis Improvement of 150 kV Transmission Subsystem Using Static Synchronous Compensator (STATCOM)

    Science.gov (United States)

    Akbar, P. A.; Hakim, D. L.; Sucita, T.

    2018-02-01

    In this research, testing improvements to the distribution voltage electricity at 150 kV transmission subsystem Bandung Selatan and New Ujungberung using Flexible AC Transmission System (FACTS) technology. One of them is by doing the control of active and reactive power through the power electronics equipment Static Synchronous Compensator (STATCOM). The subsystem is tested because it has a voltage profile are relatively less well when based on the IEEE / ANSI C.84.1 (142.5 - 157.5 kV). This study was conducted by analyzing the Newton-Raphson power flow on the simulator DigSilent Power Factory 15 to determine the profile of the voltage (V) on the system. Bus which has the lowest voltage to be a reference in the installation of STATCOM. From this research is known that the voltage on the conditions of the existing bus 28, as many as 21-23 still below standard buses (142.5 kV), after the installation is done using STATCOM, voltage on the buses improved by increasing the number of tracks that follow the standard / is in the range 142.5 kV -157.5 kV as many as 23-27 buses or 78.6% - 96%, with the optimum mounting on a bus Rancaekek STATCOM II with a capacity of 300 MVA.

  10. Time-Domain Voltage Sag State Estimation Based on the Unscented Kalman Filter for Power Systems with Nonlinear Components

    Directory of Open Access Journals (Sweden)

    Rafael Cisneros-Magaña

    2018-06-01

    Full Text Available This paper proposes a time-domain methodology based on the unscented Kalman filter to estimate voltage sags and their characteristics, such as magnitude and duration in power systems represented by nonlinear models. Partial and noisy measurements from the electrical network with nonlinear loads, used as data, are assumed. The characteristics of voltage sags can be calculated in a discrete form with the unscented Kalman filter to estimate all the busbar voltages; being possible to determine the rms voltage magnitude and the voltage sag starting and ending time, respectively. Voltage sag state estimation results can be used to obtain the power quality indices for monitored and unmonitored busbars in the power grid and to design adequate mitigating techniques. The proposed methodology is successfully validated against the results obtained with the time-domain system simulation for the power system with nonlinear components, being the normalized root mean square error less than 3%.

  11. Distributed Nonlinear Control with Event-Triggered Communication to Achieve Current-Sharing and Voltage Regulation in DC Microgrids

    DEFF Research Database (Denmark)

    Han, Renke; Meng, Lexuan; Guerrero, Josep M.

    2018-01-01

    combining the state-dependent tolerance with a nonnegative offset. In order to design the event-triggered principle and guarantee the global stability, a generalized dc microgrid model is proposed and proven to be positive definite, based on which Lyapunov-based approach is applied. Furthermore, considering......A distributed nonlinear controller is presented to achieve both accurate current-sharing and voltage regulation simultaneously in dc microgrids considering different line impedances’ effects among converters. Then, an improved event-triggered principle for the controller is introduced through...... for precise real-time information transmission, without sacrificing system performance. Experimental results obtained from a dc microgrid setup show the robustness of the new proposal under normal, communication failure, communication delay and plug-and-play operation conditions. Finally, communication...

  12. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...

  13. Concept design of the high voltage transmission system for the collider tunnel

    International Nuclear Information System (INIS)

    Norman, L.S.

    1992-03-01

    In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations -- such as the Channel Tunnel -- demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

  14. Concept design of the high-voltage transmission system for the collider tunnel

    International Nuclear Information System (INIS)

    Norman, L.S.

    1992-01-01

    In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations-such as the Channel Tunnel-demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

  15. Polynomially decaying transmission for the nonlinear schrodinger equation in a random medium

    International Nuclear Information System (INIS)

    Devillard, P.; Sovillard, B.

    1986-01-01

    This is the first study of one the transmission problems associate to the nonlinear Schrodinger equation with a random potential. We show that for almost every realization of the medium the rate of transmission vanishes when increasing the size of the medium; however, whereas it decays exponentially in the linear regime, it decays polynomially in the nonlinear one

  16. Explanation of the Inverse Doppler Effect Observed in Nonlinear Transmission Lines

    International Nuclear Information System (INIS)

    Kozyrev, Alexander B.; Weide, Daniel W. van der

    2005-01-01

    The theory of the inverse Doppler effect recently observed in magnetic nonlinear transmission lines is developed. We explain the crucial role of the backward spatial harmonic in the occurrence of an inverse Doppler effect and draw analogies of the magnetic nonlinear transmission line to the backward wave oscillator

  17. Marine High Voltage Power Conditioning and Transmission System with Integrated Storage DE-EE0003640 Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Frank Hoffmann, PhD; Aspinall, Rik

    2012-12-10

    Design, Development, and test of the three-port power converter for marine hydrokinetic power transmission. Converter provides ports for AC/DC conversion of hydrokinetic power, battery storage, and a low voltage to high voltage DC port for HVDC transmission to shore. The report covers the design, development, implementation, and testing of a prototype built by PPS.

  18. Analytical study for the ability of nonlinear transmission lines to generate solitons

    International Nuclear Information System (INIS)

    Mostafa, S.I.

    2009-01-01

    The ability of the nonlinear transmission lines (NLTL) has been studied analytically, in this paper to generate solitons and to cause waveform spreading. This can be achieved by balancing nonlinearity and dispersion. A new technique of improved tanh method (ITM) and improved sech methods (ISM) is applied to the nonlinear partial differential equation that describes the NLTL. It is found that the parameters of the transmission line play an important role in controlling the shape of the soliton.

  19. Experimental investigation of alternative transmission functions: Quantitative evidence for the importance of nonlinear transmission dynamics in host-parasite systems.

    Science.gov (United States)

    Orlofske, Sarah A; Flaxman, Samuel M; Joseph, Maxwell B; Fenton, Andy; Melbourne, Brett A; Johnson, Pieter T J

    2018-05-01

    Understanding pathogen transmission is crucial for predicting and managing disease. Nonetheless, experimental comparisons of alternative functional forms of transmission remain rare, and those experiments that are conducted are often not designed to test the full range of possible forms. To differentiate among 10 candidate transmission functions, we used a novel experimental design in which we independently varied four factors-duration of exposure, numbers of parasites, numbers of hosts and parasite density-in laboratory infection experiments. We used interactions between amphibian hosts and trematode parasites as a model system and all candidate models incorporated parasite depletion. An additional manipulation involving anaesthesia addressed the effects of host behaviour on transmission form. Across all experiments, nonlinear transmission forms involving either a power law or a negative binomial function were the best-fitting models and consistently outperformed the linear density-dependent and density-independent functions. By testing previously published data for two other host-macroparasite systems, we also found support for the same nonlinear transmission forms. Although manipulations of parasite density are common in transmission studies, the comprehensive set of variables tested in our experiments revealed that variation in density alone was least likely to differentiate among competing transmission functions. Across host-pathogen systems, nonlinear functions may often more accurately represent transmission dynamics and thus provide more realistic predictions for infection. © 2017 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

  20. New schemes for high-voltage pulsed generators based on stepped transmission lines

    International Nuclear Information System (INIS)

    Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

    1993-01-01

    Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

  1. Some problems relating to the transmission of electrical power at very high voltage

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, A

    1965-01-01

    Some of the technical and economic factors which influence the choice of a transmission system, particularly a very high voltage one, are discussed. The stability of transmission overvoltages at mains frequency and their control by means of compensating reactances is described. Overvoltages due to circuit-breaker operation and those of atmospheric origin, and appropriate protective devices, the behaviour of equipment at 750 kV, and problems of testing are included. Finally, the 735 kV network now being installed to carry 5300 MW of hydroelectric power 650 km from the Manicouagan River to Quebec and Montreal is described.

  2. System for Relay Protection Command Transmission by High-Voltage Lines

    Directory of Open Access Journals (Sweden)

    D. A. Yenkov

    2009-01-01

    Full Text Available Development of a system for relay protection command transmission by high-voltage lines is shown in the paper. The paper describes an architecture of the system, main principles of its operation, engineering aspects of the development that is accomplishment of technical requirements, solution of trades-off. Justification of the selected design and an algorithm of the reliable detection of relay protection signals are given in the paper.

  3. The Study of a Nonlinear Duffing – Type Oscillator Driven by Two Voltage Sources

    Directory of Open Access Journals (Sweden)

    J. O. Maaita

    2013-10-01

    Full Text Available In the present work, a detailed study of a nonlinear electrical oscillator with damping and external excitation is presented. The system under study consists of a Duffing-type circuit driven by two sinusoidal voltage sources having different frequencies. The dynamical behavior of the proposed system is investigated numerically, by solving the system of state equations and simulating its behavior as a circuit using MultiSim. The tools of the theoretical approach are the bifurcation diagrams, the Poincaré sections, the phase portraits, and the maximum Lyapunov exponent. The numerical investigation showed that the system has rich complex dynamics including phenomena such as quasiperiodicity, 3-tori, and chaos.

  4. Offshore wind power plants with VSC-HVDC transmission : Grid code compliance optimization and the effect on high voltage ac transmission system

    NARCIS (Netherlands)

    Ndreko, M.

    2017-01-01

    The development of large offshore wind power generation in the North Sea has been significantly accelerated in the last years. The large distance from shore in combination with the need for large transmission capacity has raised the interest for the voltage source converter high voltage direct

  5. Effect of Nonlinearity by the Amplitude Variation in coherent transmission in Laser Heterodyne Interferometric

    International Nuclear Information System (INIS)

    Chen, H F; Ding, X M; Zhong, Z; Xie, Z L; Yue, H

    2006-01-01

    To reduce the nonlinearity of nanometer measurement in laser heterodyne interferometric, the influence mechanics of the amplitude variation in coherent transmission upon nonlinearity must be confirmed. Based on the mechanics of nonlinearity, the models about how first-harmonic and second-harmonic nonlinearity caused by the amplitude variation in coherent transmission are proposed. The emulation result shows that different amplitude between measurement arm and reference arm increases the first-harmonic nonlinearity when laser beams nonorthogonality errors exist, but it doesn't change the relationship between nonlinearity and half wavelength. When the rotation angle error β of polarizing beam splitter (PBS) exists, amplitude variation only affects the first-harmonic nonlinearity. With a constant rotation angle of PBS β = 4 0 , when the amplitude factor of measurement arm reduces from 1 to 0.6, the nonlinearity increases from 0.25 nm to 3.81 nm, and the nonlinearity is simple superposition of first-harmonic and second-harmonic. Theoretic analysis and emulation show that the reduction of amplitude variation in coherent transmission can reduce influence on nonlinearity

  6. A new algorithm for optimum voltage and reactive power control for minimizing transmission lines losses

    International Nuclear Information System (INIS)

    Ghoudjehbaklou, H.; Danai, B.

    2001-01-01

    Reactive power dispatch for voltage profile modification has been of interest to power utilities. Usually local bus voltages can be altered by changing generator voltages, reactive shunts, ULTC transformers and SVCs. Determination of optimum values for control parameters, however, is not simple for modern power system networks. Heuristic and rather intelligent algorithms have to be sought. In this paper a new algorithm is proposed that is based on a variant of a genetic algorithm combined with simulated annealing updates. In this algorithm a fuzzy multi-objective a approach is used for the fitness function of the genetic algorithm. This fuzzy multi-objective function can efficiently modify the voltage profile in order to minimize transmission lines losses, thus reducing the operating costs. The reason for such a combination is to utilize the best characteristics of each method and overcome their deficiencies. The proposed algorithm is much faster than the classical genetic algorithm and cna be easily integrated into existing power utilities software. The proposed algorithm is tested on an actual system model of 1284 buses, 799 lines, 1175 fixed and ULTC transformers, 86 generators, 181 controllable shunts and 425 loads

  7. Manitoba Hydro long-term high-voltage transmission line magnetic field monitoring project

    International Nuclear Information System (INIS)

    Wong, P.S.; Ng, C.K.

    2008-01-01

    As part of the licensing process to construct a new 230 kV transmission line on an existing right-of-way in Manitoba, an electrical effects study was conducted in 1998. The study was part of the environmental assessment program crucial in obtaining government approval to construct the line. Some residents living adjacent to the new transmission circuit expressed concerns about alleged adverse health effects associated with long-term exposure to magnetic fields from high voltage transmission lines. In order to verify the accuracy of the predicted magnetic field levels submitted to the regulatory body in the the electrical effects study and to instill confidence in the residents of the affected communities, a three-year magnetic monitoring project was conducted between 2003 and 2005 along the right-of-way after the new 230kV transmission line was energized by Manitoba Hydro. This paper described the monitoring program, with reference to location; equipment; data analysis; and discussion of results. It was concluded that the long-term monitoring project demonstrated that the magnetic field prediction methodology was well understood and accurate, and provided valuable long-term magnetic field characteristics at the edge of the right-of-way. In addition, when there is opposition to a transmission line, public consultation and education were found to be the best options to arrive at a solution. 3 refs., 1 tab., 12 figs

  8. Nonlinear dynamics modelling of multistage micro-planetary gear transmission

    Directory of Open Access Journals (Sweden)

    Li Jianying

    2018-01-01

    Full Text Available The transmission structure of a 2K-H multistage micro-planetary gear transmission reducer is described in detail, and three assumptions are supposed in dynamic modelling. On basis of these assumptions, a three stages 2K-H micro-planetary gear transmission dynamic model is established, in which the relative displacement each meshing gear pairs can be obtained after including the comprehensive transmission error. According to gear kinematics, the friction arms between the sun gear, the ring gear and the nth planet are also obtained, and the friction coefficient in the mixed elastohydrodynamic lubrication is considered, the transmission system motion differential equations are obtained, including above factors and the time-varying meshing stiffness, damping and backlash, inter-stage coupling stiffness, it can be provided an theoretical foundation for further analysing the parameter sensitivity, dynamic stability and designing.

  9. Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

    Science.gov (United States)

    Fernandez, Fernando R.; Malerba, Paola; White, John A.

    2015-01-01

    The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

  10. A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

    DEFF Research Database (Denmark)

    Xu, Fengda; Guo, Qinglai; Sun, Hongbin

    2015-01-01

    For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

  11. Nonlinear Seismic Behavior of Different Boundary Conditions of Transmission Line Systems under Earthquake Loading

    Directory of Open Access Journals (Sweden)

    Li Tian

    2016-01-01

    Full Text Available Nonlinear seismic behaviors of different boundary conditions of transmission line system under earthquake loading are investigated in this paper. The transmission lines are modeled by cable element accounting for the nonlinearity of the cable. For the suspension type, three towers and two span lines with spring model (Model 1 and three towers and four span lines’ model (Model 2 are established, respectively. For the tension type, three towers and two span lines’ model (Model 3 and three towers and four span lines’ model (Model 4 are created, respectively. The frequencies of the transmission towers and transmission lines of the suspension type and tension type are calculated, respectively. The responses of the suspension type and tension type are investigated using nonlinear time history analysis method, respectively. The results show that the responses of the transmission tower and transmission line of the two models of the suspension type are slightly different. However, the responses of transmission tower and transmission line of the two models of the tension type are significantly different. Therefore, in order to obtain accurate results, a reasonable model should be considered. The results could provide a reference for the seismic analysis of the transmission tower-line system.

  12. Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

    1993-01-01

    Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse

  13. Application of Magnetically Insulated Transmission Lines for high current, high voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

    1991-01-01

    Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs

  14. Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

    Science.gov (United States)

    Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.

    Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.

  15. High Power, Pulsed, RF Generation from Nonlinear Lumped Element Transmission Lines (NLETLs)

    Science.gov (United States)

    2011-02-05

    in order to focus on the primary technology tinder consideration. Their practicality at very high powers and frequencies is questionable due to...also possessed suitably large CXL ratios. Measuring capacitive nonlinearity tinder high voltage proved to be more tricky than first imagi- ned

  16. High-voltage direct current (HVDC) transmission - a key technology for our power supply

    International Nuclear Information System (INIS)

    Dorn, J.

    2016-01-01

    The phasing-out of nuclear power in some countries and the aspirations of reducing carbon dioxide emissions have far-reaching implications for electric power generation in Europe. In the future, renewable electricity generation will account for a considerable share of the energy mix, but this type of production is often far from the load centers. In Germany, for example, large quantities of wind energy are already generated in the north and in the North Sea, but large load centers are located several hundred kilometers south of there. This requires an expansion of the transmission network with innovative solutions. High-voltage direct-current (HVDC) transmission plays an important role, since it brings a number of advantages over conventional AC technology and makes certain requirements feasible, for example Cable transmission over longer distances. The lecture presents the advantages of HVDC, the semiconductors used as well as the basic functions and typical performance of the used converter topopologies. The plant configurations and main components are illustrated using current projects. (rössner) [de

  17. Adaptive Modulation for DFIG and STATCOM With High-Voltage Direct Current Transmission.

    Science.gov (United States)

    Tang, Yufei; He, Haibo; Ni, Zhen; Wen, Jinyu; Huang, Tingwen

    2016-08-01

    This paper develops an adaptive modulation approach for power system control based on the approximate/adaptive dynamic programming method, namely, the goal representation heuristic dynamic programming (GrHDP). In particular, we focus on the fault recovery problem of a doubly fed induction generator (DFIG)-based wind farm and a static synchronous compensator (STATCOM) with high-voltage direct current (HVDC) transmission. In this design, the online GrHDP-based controller provides three adaptive supplementary control signals to the DFIG controller, STATCOM controller, and HVDC rectifier controller, respectively. The mechanism is to observe the system states and their derivatives and then provides supplementary control to the plant according to the utility function. With the GrHDP design, the controller can adaptively develop an internal goal representation signal according to the observed power system states, therefore, to achieve more effective learning and modulating. Our control approach is validated on a wind power integrated benchmark system with two areas connected by HVDC transmission lines. Compared with the classical direct HDP and proportional integral control, our GrHDP approach demonstrates the improved transient stability under system faults. Moreover, experiments under different system operating conditions with signal transmission delays are also carried out to further verify the effectiveness and robustness of the proposed approach.

  18. Calculation of Voltages in Electric Power Transmission Lines During Historic Geomagnetic Storms: An Investigation Using Realistic Earth Impedances

    Science.gov (United States)

    Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

    2018-02-01

    Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

  19. Calculation of voltages in electric power transmission lines during historic geomagnetic storms: An investigation using realistic earth impedances

    Science.gov (United States)

    Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

    2018-01-01

    Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

  20. Nonlinear force feedback control of piezoelectric-hydraulic pump actuator for automotive transmission shift control

    Science.gov (United States)

    Kim, Gi-Woo; Wang, K. W.

    2008-03-01

    In recent years, researchers have investigated the feasibility of utilizing piezoelectric-hydraulic pump based actuation systems for automotive transmission controls. This new concept could eventually reduce the complexity, weight, and fuel consumption of the current transmissions. In this research, we focus on how to utilize this new approach on the shift control of automatic transmissions (AT), which generally requires pressure profiling for friction elements during the operation. To illustrate the concept, we will consider the 1--> 2 up shift control using band brake friction elements. In order to perform the actuation force tracking for AT shift control, nonlinear force feedback control laws are designed based on the sliding mode theory for the given nonlinear system. This paper will describe the modeling of the band brake actuation system, the design of the nonlinear force feedback controller, and simulation and experimental results for demonstration of the new concept.

  1. Non-Linear Transmission Line (NLTL) Microwave Source Lecture Notes the United States Particle Accelerator School

    Energy Technology Data Exchange (ETDEWEB)

    Russell, Steven J. [Los Alamos National Laboratory; Carlsten, Bruce E. [Los Alamos National Laboratory

    2012-06-26

    We will quickly go through the history of the non-linear transmission lines (NLTLs). We will describe how they work, how they are modeled and how they are designed. Note that the field of high power, NLTL microwave sources is still under development, so this is just a snap shot of their current state. Topics discussed are: (1) Introduction to solitons and the KdV equation; (2) The lumped element non-linear transmission line; (3) Solution of the KdV equation; (4) Non-linear transmission lines at microwave frequencies; (5) Numerical methods for NLTL analysis; (6) Unipolar versus bipolar input; (7) High power NLTL pioneers; (8) Resistive versus reactive load; (9) Non-lineaer dielectrics; and (10) Effect of losses.

  2. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    International Nuclear Information System (INIS)

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.

    2010-01-01

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.

  3. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    Energy Technology Data Exchange (ETDEWEB)

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B. [Groupe de Recherche en Electronique et en Electrotechnique de Nancy - INPL - Nancy Universite, 2, Avenue de la Foret de Haye, 54516 Vandoeuvre-les-Nancy Cedex (France)

    2010-01-15

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control. (author)

  4. Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects

    International Nuclear Information System (INIS)

    Braekevelt, P.N.

    1991-01-01

    Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized

  5. Fretting Wear Behaviors of Aluminum Cable Steel Reinforced (ACSR Conductors in High-Voltage Transmission Line

    Directory of Open Access Journals (Sweden)

    Xingchi Ma

    2017-09-01

    Full Text Available This work reports the fretting wear behavior of aluminum cable steel reinforced (ACSR conductors for use in high-voltage transmission line. Fretting wear tests of Al wires were conducted on a servo-controlled fatigue testing machine with self-made assistant apparatus, and their fretting process characteristics, friction force, wear damage, and wear surface morphology were detailed analyzed. The results show that the running regime of Al wires changes from a gross slip regime to a mixed regime more quickly as increasing contact load. With increasing amplitudes, gross slip regimes are more dominant under contact loads of lower than 30 N. The maximum friction force is relatively smaller in the NaCl solution than in a dry friction environment. The primary wear mechanisms in dry friction environments are abrasive wear and adhesive wear whereas abrasive wear and fatigue damage are dominant in NaCl solution.

  6. Expansion of the high-voltage direct current transmission systems; Netzausbau mit Hochspannungs-Gleichstrom-Uebertragung

    Energy Technology Data Exchange (ETDEWEB)

    Spahic, Ervin; Benz, Thomas; Goerner, Raphael; Sass, Florian [ABB AG, Mannheim (Germany)

    2012-12-15

    In September 2010 the German federal government announced its energy concept for an environmentally friendly, reliable and affordable energy supply. This concept describes a ''path into the era of renewable energy'' up to the year 2050, with electricity production from photovoltaics and wind power taking centre stage. Since the expansion of renewable energy production is mainly taking place in the North (wind power) and the South (PV), this poses a great challenge to the electricity networks. It necessitates the expansion of power transmission systems, notably for transporting electricity generated by wind power in the North to the consumer centres in Western and Southern Germany. However, progress to this end has been very slow. For this reason a technical question now presents itself, namely whether high-voltage direct current technology could possibly offer a solution to the electricity transport problems associated with the energy turnaround.

  7. Single-phased Fault Location on Transmission Lines Using Unsynchronized Voltages

    Directory of Open Access Journals (Sweden)

    ISTRATE, M.

    2009-10-01

    Full Text Available The increased accuracy into the fault's detection and location makes it easier for maintenance, this being the reason to develop new possibilities for a precise estimation of the fault location. In the field literature, many methods for fault location using voltages and currents measurements at one or both terminals of power grids' lines are presented. The double-end synchronized data algorithms are very precise, but the current transformers can limit the accuracy of these estimations. The paper presents an algorithm to estimate the location of the single-phased faults which uses only voltage measurements at both terminals of the transmission lines by eliminating the error due to current transformers and without introducing the restriction of perfect data synchronization. In such conditions, the algorithm can be used with the actual equipment of the most power grids, the installation of phasor measurement units with GPS system synchronized timer not being compulsory. Only the positive sequence of line parameters and sources are used, thus, eliminating the incertitude in zero sequence parameter estimation. The algorithm is tested using the results of EMTP-ATP simulations, after the validation of the ATP models on the basis of registered results in a real power grid.

  8. Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission

    Energy Technology Data Exchange (ETDEWEB)

    Myhre, Joergen Chr.

    2001-07-01

    This study was initiated to investigate if it could be feasible to supply offshore oil installations in the North Sea with electrical power from land. A prestudy of alternative converter topologies indicated that the most promising solution would be to investigate a conventional system with reduced synchronous compensator rating. The study starts with a summary of the state of power supply to offshore installations today, and a short review of classical HVDC transmission. It goes on to analyse how a passive network without sources influences the inverter. The transmission, with its current controlled rectifier and large inductance, is simulated as a current source. Under these circumstances the analysis shows that the network frequency has to adapt in order to keep the active and reactive power balance until the controllers are able to react. The concept of firing angle for a thyristor is limited in a system with variable frequency, the actual control parameter is the firing delay time. Sensitivity analysis showed some astonishing consequences. The frequency rises both by an increase in the active and in the reactive load. The voltage falls by an increase in the active load, but rises by an increase in the inductive load. Two different control principles for the system of inverter, synchronous compensator and load are defined. The first takes the reference for the firing delay time from the fundamental voltage at the point of common coupling. The second takes the reference for the firing delay time from the simulated EMF of the synchronous compensator. Of these, the second is the more stable and should be chosen as the basis for a possible control system. Two simulation tools are applied. The first is a quasi-phasor model running on Matlab with Simulink. The other is a time domain model in KREAN. The time domain model is primarily used for the verification of the quasi-phasor model, and shows that quasi-phasors is still a valuable tool for making a quick analysis

  9. Development of large high-voltage pressure insulators for the Princeton TFTR [Tokamak Fusion Test Reactor] flexible transmission lines

    International Nuclear Information System (INIS)

    Scalise, D.T.; Fong, E.; Haughian, J.; Prechter, R.

    1986-10-01

    Specially formulated insulator materials with improved strength and high-voltage properties were developed and used for critical components of the flexible transmission lines to the TFTR neutral beam ion sources. These critical components are plates which support central conductors as they exit the high-voltage power supply and enter the ion source enclosure. Each plate acts both as a high-voltage insulator and as a pressure barrier to the SF 6 insulating gas. The original plate was made of commercial glass-epoxy laminate which limited the plate voltage capacity. The newly developed insulator is made of specially-formulated cycloalphatic Di-epoxide whose isotropic properties exhibit increased arc resistance. It is cast in one piece with skirts which greatly increase the breakdown voltage. This paper discusses the design, fabrication and testing of the new insulator

  10. Interactions Between Indirect DC-Voltage Estimation and Circulating Current Controllers of MMC-Based HVDC Transmission Systems

    DEFF Research Database (Denmark)

    Wickramasinghe, Harith R.; Konstantinou, Georgios; Pou, Josep

    2018-01-01

    Estimation-based indirect dc-voltage control in MMCs interacts with circulating current control methods. This paper proposes an estimation-based indirect dc-voltage control method for MMC-HVDC systems and analyzes its performance compared to alternative estimations. The interactions between......-state and transient performance is demonstrated using a benchmark MMC-HVDC transmission system, implemented in a real-time digital simulator. The results verify the theoretical evaluations and illustrate the operation and performance of the proposed indirect dc-voltage control method....

  11. Experimental demonstration of non-reciprocal transmission in a nonlinear photonic-crystal Fano structure

    DEFF Research Database (Denmark)

    Yu, Yi; Chen, Yaohui; Hu, Hao

    2015-01-01

    We suggest and experimentally demonstrate a photonic-crystal structure with more than 30 dB difference between forward and backward transmission levels. The non-reciprocity relies on the combination of ultrafast carrier nonlinearities and spatial symmetry breaking in a Fano structure employing...

  12. Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

    Science.gov (United States)

    Xu, Kaili

    Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also

  13. Development of real-time voltage stability monitoring tool for power system transmission network using Synchrophasor data

    Science.gov (United States)

    Pulok, Md Kamrul Hasan

    Intelligent and effective monitoring of power system stability in control centers is one of the key issues in smart grid technology to prevent unwanted power system blackouts. Voltage stability analysis is one of the most important requirements for control center operation in smart grid era. With the advent of Phasor Measurement Unit (PMU) or Synchrophasor technology, real time monitoring of voltage stability of power system is now a reality. This work utilizes real-time PMU data to derive a voltage stability index to monitor the voltage stability related contingency situation in power systems. The developed tool uses PMU data to calculate voltage stability index that indicates relative closeness of the instability by producing numerical indices. The IEEE 39 bus, New England power system was modeled and run on a Real-time Digital Simulator that stream PMU data over the Internet using IEEE C37.118 protocol. A Phasor data concentrator (PDC) is setup that receives streaming PMU data and stores them in Microsoft SQL database server. Then the developed voltage stability monitoring (VSM) tool retrieves phasor measurement data from SQL server, performs real-time state estimation of the whole network, calculate voltage stability index, perform real-time ranking of most vulnerable transmission lines, and finally shows all the results in a graphical user interface. All these actions are done in near real-time. Control centers can easily monitor the systems condition by using this tool and can take precautionary actions if needed.

  14. L1 adaptive control of uncertain gear transmission servo systems with deadzone nonlinearity.

    Science.gov (United States)

    Zuo, Zongyu; Li, Xiao; Shi, Zhiguang

    2015-09-01

    This paper deals with the adaptive control problem of Gear Transmission Servo (GTS) systems in the presence of unknown deadzone nonlinearity and viscous friction. A global differential homeomorphism based on a novel differentiable deadzone model is proposed first. Since there exist both matched and unmatched state-dependent unknown nonlinearities, a full-state feedback L1 adaptive controller is constructed to achieve uniformly bounded transient response in addition to steady-state performance. Finally, simulation results are included to show the elimination of limit cycles, in addition to demonstrating the main results in this paper. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  15. Broadband microwave frequency doubler based on left-handed nonlinear transmission lines

    International Nuclear Information System (INIS)

    Huang Jie; Gu Wenwen; Zhao Qian

    2017-01-01

    A bandwidth microwave second harmonic generator is successfully designed using composite right/left-handed nonlinear transmission lines (CRLH NLTLs) in a GaAs monolithic microwave integrated circuit (MMIC) technology. The structure parameters of CRLH NLTLs, e.g. host transmission line, rectangular spiral inductor, and nonlinear capacitor, have a great impact on the second harmonic performance enhancement in terms of second harmonic frequency, output power, and conversion efficiency. It has been experimentally demonstrated that the second harmonic frequency is determined by the anomalous dispersion of CRLH NLTLs and can be significantly improved by effectively adjusting these structure parameters. A good agreement between the measured and simulated second harmonic performances of Ka-band CRLH NLTLs frequency multipliers is successfully achieved, which further validates the design approach of frequency multipliers on CRLH NLTLs and indicates the potentials of CRLH NLTLs in terms of the generation of microwave and millimeter-wave signal source. (paper)

  16. Nonlinear absorption and transmission properties of Ge, Te and InAs using tuneable IR FEL

    Energy Technology Data Exchange (ETDEWEB)

    Amirmadhi, F.; Becker, K.; Brau, C.A. [Vanderbilt Univ., Nashville, TN (United States)

    1995-12-31

    Nonlinear absorption properties of Ge, Te and InAs are being investigated using the transmission of FEL optical pulses through these semiconductors (z-scan method). Wavelength, intensity and macropulse dependence are used to differentiate between two-photon and free-carrier absorption properties of these materials. Macropulse dependence is resolved by using a Pockles Cell to chop the 4-{mu}s macropulse down to 100 ns. Results of these experiments will be presented and discussed.

  17. The Effect of Friction on the Nonlinear Vibration of the Cracked One-Stage Power Transmission

    Directory of Open Access Journals (Sweden)

    M. Rezaee

    2016-01-01

    Full Text Available : The gear systems are widely used in industry to transmit the power or change the direction of the torque. Due to the extensive usage of the gears, the detailed designing and the subsequent maintenance of these systems are more and more evident. System recognition can be achieved through modeling the system, investigating the system behavior, and comparing the results obtained through the model with the actual system behavior. Up to now, the effect of dry friction has not been taken into account in nonlinear vibration analysis and modeling of a cracked one-stage gear power transmission system. In this paper, the nonlinear vibration of a pair of cracked spur-gear system in presence of dry friction, static transmission error, clearance and time-variant mesh stiffness is investigated. To this end, the time-variant mesh stiffness of an intact tooth is calculated analytically. Then, the tooth root crack is modeled as a cracked cantilever beam. The governing nonlinear equation of motion is extracted accordingly, and in order to consider the effect of dry friction, the governing equation solved by Rung- Kutta method in three separate time spans. Finally, the frequency response and bifurcation diagrams are used to study the effect of the friction and tooth root crack on the nonlinear vibration behavior of the system.

  18. Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

    DEFF Research Database (Denmark)

    Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

    2016-01-01

    : off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

  19. AC transmission, with very high voltages and the 750 kV line

    Energy Technology Data Exchange (ETDEWEB)

    Bocker, H

    1964-01-01

    The economic case for adoption of extra-high voltages for transmitting electric power over distances of the order of 1000 km is discussed. Some special technical developments for solving the problems attached to such high voltages are briefly discussed, particularly in the fields of switching and transients suppression. The first 750-kV projects in Canada and Russia are mentioned. Equipment, e.g., bushings, transformers, etc., operating at such voltages are illustrated.

  20. A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

    Directory of Open Access Journals (Sweden)

    Yufei Teng

    2017-03-01

    Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

  1. Optical stealth transmission based on super-continuum generation in highly nonlinear fiber over WDM network.

    Science.gov (United States)

    Zhu, Huatao; Wang, Rong; Pu, Tao; Fang, Tao; Xiang, Peng; Zheng, Jilin; Chen, Dalei

    2015-06-01

    In this Letter, the optical stealth transmission carried by super-continuum spectrum optical pulses generated in highly nonlinear fiber is proposed and experimentally demonstrated. In the proposed transmission scheme, super-continuum signals are reshaped in the spectral domain through a wavelength-selective switch and are temporally spread by a chromatic dispersion device to achieve the same noise-like characteristic as the noise in optical networks, so that in both the time domain and the spectral domain, the stealth signals are hidden in public channel. Our experimental results show that compared with existing schemes where stealth channels are carried by amplified spontaneous emission noise, super-continuum signal can increase the transmission performance and robustness.

  2. Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission

    Energy Technology Data Exchange (ETDEWEB)

    1977-11-01

    For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.

  3. High-voltage isolation transformer for sub-nanosecond rise time pulses constructed with annular parallel-strip transmission lines.

    Science.gov (United States)

    Homma, Akira

    2011-07-01

    A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.

  4. Determination of nonlinear resistance voltage-current relationships by measuring harmonics

    Science.gov (United States)

    Stafford, J. M.

    1971-01-01

    Test configuration measures harmonic signal amplitudes generated in nonlinear resistance. Vacuum-type voltmeter measures low frequency sinusoidal input signal amplitude and wave-analyzer measures amplitude of harmonic signals generated in junction. Input signal harmonics amplitude must not exceed that of harmonics generated in nonlinear resistance.

  5. Multi-Period Optimization for Voltage Control System in Transmission Grids

    DEFF Research Database (Denmark)

    Qin, Nan; Chen, Si; Liu, Chengxi

    2015-01-01

    Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...

  6. Study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission from overhead High-Voltage Transmission Lines

    International Nuclear Information System (INIS)

    Parthasarathy, S.R.; Roha Tukimin; Wan Saffiey Wan Abdullah; Zulkifli Yusof; Mohd Azizi Mohd Jali

    2016-01-01

    The paper highlights the study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission performed at an overhead 275-kV High-Voltage Transmission Lines. The study comprised of assessment at the transmission lines on 3 different cases and locations in Klang Valley, specifically on a vacant land near the transmission line, inside and around the house at the vicinity of the transmission line and the area directly under the transmission line. The instrument setup and measurement protocols during the assessment were adopted from standard measurement method and procedures stipulated under the Institute of Electrical and Electronics Engineers (IEEE) Standard. The results were compared with the standards recommended in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. The results showed that the measured field strengths are within the safety limit with the highest measured exposure was 10.8 % and 1.8 % of the permissible exposure limit for the electric and magnetic field respectively. Both the field strengths were found to drop significantly against distance from the transmission lines where closer distances showed higher field strengths. Furthermore, the study revealed that buildings and other object such as trees and shrubs screen out the electric field, resulting in a lower value at indoor measurements and near the stated objects. In addition, higher value of electric and magnetic field strengths were recorded when assessment was being done directly under the transmission line compared to the lateral measurement. (author)

  7. Image statistics and nonlinear artifacts in composed transmission x-ray tomography

    International Nuclear Information System (INIS)

    Duerinckx, A.J.G.

    1979-01-01

    Knowledge of the image quality and image statistics in Computed Tomography (CT) images obtained with transmission x-ray CT scanners can increase the amount of clinically useful information that can be retrieved. Artifacts caused by nonlinear shadows are strongly object-dependent and are visible over larger areas of the image. No simple technique exists for their complete elimination. One source of artifacts in the first order statistics is the nonlinearities in the measured shadow or projection data used to reconstruct the image. One of the leading causes is the polychromaticity of the x-ray beam used in transmission CT scanners. Ways to improve the resulting image quality and techniques to extract additional information using dual energy scanning are discussed. A unique formalism consisting of a vector representation of the material dependence of the photon-tissue interactions is generalized to allow an in depth analysis. Poly-correction algorithms are compared using this analytic approach. Both quantum and detector electronic noise decrease the quality or information content of first order statistics. Preliminary results are presented using an heuristic adaptive nonlinear noise filter system for projection data. This filter system can be improved and/or modified to remove artifacts in both first and second order image statistics. Artifacts in the second order image statistics arise from the contribution of quantum noise. This can be described with a nonlinear detection equivalent model, similar to the model used to study artifacts in first order statistics. When analyzing these artifacts in second order statistics, one can divide them into linear artifacts, which do not present any problem of interpretation, and nonlinear artifacts, referred to as noise artifacts. A study of noise artifacts is presented together with a discussion of their relative importance in diagnostic radiology

  8. Effect of driving voltages in dual capacitively coupled radio frequency plasma: A study by nonlinear global model

    International Nuclear Information System (INIS)

    Bora, B.

    2015-01-01

    On the basis of nonlinear global model, a dual frequency capacitively coupled radio frequency plasma driven by 13.56 MHz and 27.12 MHz has been studied to investigate the influences of driving voltages on the generation of dc self-bias and plasma heating. Fluid equations for the ions inside the plasma sheath have been considered to determine the voltage-charge relations of the plasma sheath. Geometrically symmetric as well as asymmetric cases with finite geometrical asymmetry of 1.2 (ratio of electrodes area) have been considered to make the study more reasonable to experiment. The electrical asymmetry effect (EAE) and finite geometrical asymmetry is found to work differently in controlling the dc self-bias. The amount of EAE has been primarily controlled by the phase angle between the two consecutive harmonics waveforms. The incorporation of the finite geometrical asymmetry in the calculations shift the dc self-bias towards negative polarity direction while increasing the amount of EAE is found to increase the dc self-bias in either direction. For phase angle between the two waveforms ϕ = 0 and ϕ = π/2, the amount of EAE increases significantly with increasing the low frequency voltage, whereas no such increase in the amount of EAE is found with increasing high frequency voltage. In contrast to the geometrically symmetric case, where the variation of the dc self-bias with driving voltages for phase angle ϕ = 0 and π/2 are just opposite in polarity, the variation for the geometrically asymmetric case is different for ϕ = 0 and π/2. In asymmetric case, for ϕ = 0, the dc self-bias increases towards the negative direction with increasing both the low and high frequency voltages, but for the ϕ = π/2, the dc-self bias is increased towards positive direction with increasing low frequency voltage while dc self-bias increases towards negative direction with increasing high frequency voltage

  9. A novel approach for voltage secure operation using Probabilistic Neural Network in transmission network

    Directory of Open Access Journals (Sweden)

    Santi Behera

    2016-05-01

    Full Text Available This work proposes a unique approach for improving voltage stability limit using a Probabilistic Neural Network (PNN classifier that gives corrective controls available in the system in the scenario of contingencies. The sensitivity of system is analyzed to identify weak buses with ENVCI evaluation approaching zero. The input to the classifier, termed as voltage stability enhancing neural network (VSENN classifier, for training are line flows and bus voltages near the notch point of the P–V curve and the output of the VSENN is a control variable. For various contingencies the control action that improves the voltage profile as well as stability index is identified and trained accordingly. The trained VSENN is finally tested for its robustness to improve load margin and ENVCI as well, apart from trained set of operating condition of the system along with contingencies. The proposed approach is verified in IEEE 39-bus test system.

  10. Project resumes: biological effects from electric fields associated with high-voltage transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-01-01

    Abstracts of research projects are presented in the following areas: measurements and special facilities; cellular and subcellular studies; physiology; behavior; environmental effects; modeling, scaling and dosimetry; and high voltage direct current. (ACR)

  11. Rogue waves generation in a left-handed nonlinear transmission line with series varactor diodes

    Science.gov (United States)

    Onana Essama, B. G.; Atangana, J.; Biya Motto, F.; Mokhtari, B.; Cherkaoui Eddeqaqi, N.; Kofane, Timoleon C.

    2014-07-01

    We investigate the electromagnetic wave behavior and its characterization using collective variables technique. Second-order dispersion, first- and second-order nonlinearities, which strongly act in a left-handed nonlinear transmission line with series varactor diodes, are taken into account. Four frequency ranges have been found. The first one gives the so-called energetic soliton due to a perfect combination of second-order dispersion and first-order nonlinearity. The second frequency range presents a dispersive soliton leading to the collapse of the electromagnetic wave at the third frequency range. But the fourth one shows physical conditions which are able to provoke the appearance of wave trains generation with some particular waves, the rogue waves. Moreover, we demonstrate that the number of rogue waves increases with frequency. The soliton, thereafter, gains a relative stability when second-order nonlinearity comes into play with some specific values in the fourth frequency range. Furthermore, the stability conditions of the electromagnetic wave at high frequencies have been also discussed.

  12. Clutch pressure estimation for a power-split hybrid transmission using nonlinear robust observer

    Science.gov (United States)

    Zhou, Bin; Zhang, Jianwu; Gao, Ji; Yu, Haisheng; Liu, Dong

    2018-06-01

    For a power-split hybrid transmission, using the brake clutch to realize the transition from electric drive mode to hybrid drive mode is an available strategy. Since the pressure information of the brake clutch is essential for the mode transition control, this research designs a nonlinear robust reduced-order observer to estimate the brake clutch pressure. Model uncertainties or disturbances are considered as additional inputs, thus the observer is designed in order that the error dynamics is input-to-state stable. The nonlinear characteristics of the system are expressed as the lookup tables in the observer. Moreover, the gain matrix of the observer is solved by two optimization procedures under the constraints of the linear matrix inequalities. The proposed observer is validated by offline simulation and online test, the results have shown that the observer achieves significant performance during the mode transition, as the estimation error is within a reasonable range, more importantly, it is asymptotically stable.

  13. Global exponential stability of BAM neural networks with transmission delays and nonlinear impulses

    International Nuclear Information System (INIS)

    Huang Zhenkun; Xia Yonghui

    2008-01-01

    In this paper, a class of bidirectional associative memory (BAM) networks with transmission delays and nonlinear impulses are studied. Some new sufficient conditions are established for the existence and global exponential stability of a unique equilibrium, which generalize and improve the previously known results. The sufficient conditions are easy to verify and when the impulsive jumps are linear or absent the results reduce to those of common impulsive or non-impulsive systems. Finally, an example is given to show the feasibility and effectiveness of our results

  14. Nonlinear empirical model of gas humidity-related voltage dynamics of a polymer-electrolyte-membrane fuel cell stack

    Science.gov (United States)

    Meiler, M.; Andre, D.; Schmid, O.; Hofer, E. P.

    Intelligent energy management is a cost-effective key path to realize efficient automotive drive trains [R. O'Hayre, S.W. Cha, W. Colella, F.B. Prinz. Fuel Cell Fundamentals, John Wiley & Sons, Hoboken, 2006]. To develop operating strategy in fuel cell drive trains, precise and computational efficient models of all system components, especially the fuel cell stack, are needed. Should these models further be used in diagnostic or control applications, then some major requirements must be fulfilled. First, the model must predict the mean fuel cell voltage very precisely in all possible operating conditions, even during transients. The model output should be as smooth as possible to support best efficient optimization strategies of the complete system. At least, the model must be computational efficient. For most applications, a difference between real fuel cell voltage and model output of less than 10 mV and 1000 calculations per second will be sufficient. In general, empirical models based on system identification offer a better accuracy and consume less calculation resources than detailed models derived from theoretical considerations [J. Larminie, A. Dicks. Fuel Cell Systems Explained, John Wiley & Sons, West Sussex, 2003]. In this contribution, the dynamic behaviour of the mean cell voltage of a polymer-electrolyte-membrane fuel cell (PEMFC) stack due to variations in humidity of cell's reactant gases is investigated. The validity of the overall model structure, a so-called general Hammerstein model (or Uryson model), was introduced recently in [M. Meiler, O. Schmid, M. Schudy, E.P. Hofer. Dynamic fuel cell stack model for real-time simulation based on system identification, J. Power Sources 176 (2007) 523-528]. Fuel cell mean voltage is calculated as the sum of a stationary and a dynamic voltage component. The stationary component of cell voltage is represented by a lookup-table and the dynamic voltage by a parallel placed, nonlinear transfer function. A

  15. Effects of Cascaded Voltage Collapse and Protection of Many Induction Machine Loads upon Load Characteristics Viewed from Bulk Transmission System

    Science.gov (United States)

    Kumano, Teruhisa

    As known well, two of the fundamental processes which give rise to voltage collapse in power systems are the on load tap changers of transformers and dynamic characteristics of loads such as induction machines. It has been well established that, comparing among these two, the former makes slower collapse while the latter makes faster. However, in realistic situations, the load level of each induction machine is not uniform and it is well expected that only a part of loads collapses first, followed by collapse process of each load which did not go into instability during the preceding collapses. In such situations the over all equivalent collapse behavior viewed from bulk transmission level becomes somewhat different from the simple collapse driven by one aggregated induction machine. This paper studies the process of cascaded voltage collapse among many induction machines by time simulation, where load distribution on a feeder line is modeled by several hundreds of induction machines and static impedance loads. It is shown that in some cases voltage collapse really cascades among induction machines, where the macroscopic load dynamics viewed from upper voltage level makes slower collapse than expected by the aggregated load model. Also shown is the effects of machine protection of induction machines, which also makes slower collapse.

  16. Ion diode performance on a positive polarity inductive voltage adder with layered magnetically insulated transmission line flow

    International Nuclear Information System (INIS)

    Hinshelwood, D. D.; Schumer, J. W.; Allen, R. J.; Commisso, R. J.; Jackson, S. L.; Murphy, D. P.; Phipps, D.; Swanekamp, S. B.; Weber, B. V.; Ottinger, P. F.; Apruzese, J. P.; Cooperstein, G.; Young, F. C.

    2011-01-01

    A pinch-reflex ion diode is fielded on the pulsed-power machine Mercury (R. J. Allen, et al., 15th IEEE Intl. Pulsed Power Conf., Monterey, CA, 2005, p. 339), which has an inductive voltage adder (IVA) architecture and a magnetically insulated transmission line (MITL). Mercury is operated in positive polarity resulting in layered MITL flow as emitted electrons are born at a different potential in each of the adder cavities. The usual method for estimating the voltage by measuring the bound current in the cathode and anode of the MITL is not accurate with layered flow, and the interaction of the MITL flow with a pinched-beam ion diode load has not been studied previously. Other methods for determining the diode voltage are applied, ion diode performance is experimentally characterized and evaluated, and circuit and particle-in-cell (PIC) simulations are performed. Results indicate that the ion diode couples efficiently to the machine operating at a diode voltage of about 3.5 MV and a total current of about 325 kA, with an ion current of about 70 kA of which about 60 kA is proton current. It is also found that the layered flow impedance of the MITL is about half the vacuum impedance.

  17. Linear versus non-linear structural information limit in high-resolution transmission electron microscopy

    International Nuclear Information System (INIS)

    Van Aert, S.; Chen, J.H.; Van Dyck, D.

    2010-01-01

    A widely used performance criterion in high-resolution transmission electron microscopy (HRTEM) is the information limit. It corresponds to the inverse of the maximum spatial object frequency that is linearly transmitted with sufficient intensity from the exit plane of the object to the image plane and is limited due to partial temporal coherence. In practice, the information limit is often measured from a diffractogram or from Young's fringes assuming a weak phase object scattering beyond the inverse of the information limit. However, for an aberration corrected electron microscope, with an information limit in the sub-angstrom range, weak phase objects are no longer applicable since they do not scatter sufficiently in this range. Therefore, one relies on more strongly scattering objects such as crystals of heavy atoms observed along a low index zone axis. In that case, dynamical scattering becomes important such that the non-linear and linear interaction may be equally important. The non-linear interaction may then set the experimental cut-off frequency observed in a diffractogram. The goal of this paper is to quantify both the linear and the non-linear information transfer in terms of closed form analytical expressions. Whereas the cut-off frequency set by the linear transfer can be directly related with the attainable resolution, information from the non-linear transfer can only be extracted using quantitative, model-based methods. In contrast to the historic definition of the information limit depending on microscope parameters only, the expressions derived in this paper explicitly incorporate their dependence on the structure parameters as well. In order to emphasize this dependence and to distinguish from the usual information limit, the expressions derived for the inverse cut-off frequencies will be referred to as the linear and non-linear structural information limit. The present findings confirm the well-known result that partial temporal coherence has

  18. Recommendation on the Environmental Effect Report for the high-voltage transmission line between Netherlands and Norway

    International Nuclear Information System (INIS)

    1998-01-01

    The recommendation on the title subject was addressed to the Dutch Minister of Economic Affairs and concerns the environmental impact of the new high-voltage transmission line (NorNed cable) from Norway to the Eemshaven in Groningen, Netherlands. In planning this power cable the environmental impact on the Wadden Sea has to be taken into account. Therefore an environmental effect report (MER, abbreviated in Dutch) has been drafted by the Dutch cooperative of electric power generating companies, Sep, and commented by the WaddenAdviesRaad

  19. The account of sagging of wires at definition of specific potential factors of air High-Voltage Power Transmission Lines

    Directory of Open Access Journals (Sweden)

    Suslov V.M.

    2005-12-01

    Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.

  20. Extreme control of impulse transmission by cylinder-based nonlinear phononic crystals

    Science.gov (United States)

    Chaunsali, Rajesh; Toles, Matthew; Yang, Jinkyu; Kim, Eunho

    2017-10-01

    We present a novel device that can offer two extremes of elastic wave propagation - nearly complete transmission and strong attenuation under impulse excitation. The mechanism of this highly tunable device relies on intermixing effects of dispersion and nonlinearity. The device consists of identical cylinders arranged in a chain, which interact with each other as per nonlinear Hertz contact law. For a 'dimer' configuration, i.e., two different contact angles alternating in the chain, we analytically, numerically, and experimentally show that impulse excitation can either propagate as a localized wave, or it can travel as a highly dispersive wave. Remarkably, these extremes can be achieved in this periodic arrangement simply by in-situ control of contact angles between cylinders. We close the discussion by highlighting the key characteristics of the mechanisms that facilitate strong attenuation of incident impulse. These include low-to-high frequency scattering, and turbulence-like cascading in a periodic system. We thus envision that these adaptive, cylinder-based nonlinear phononic crystals, in conjunction with conventional impact mitigation mechanisms, could be used to design highly tunable and efficient impact manipulation devices.

  1. A Novel Modulation Function-Based Control of Modular Multilevel Converters for High Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Majid Mehrasa

    2016-10-01

    Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.

  2. Nonlinear Robust Control for Low Voltage Direct-Current Residential Microgrids with Constant Power Loads

    Directory of Open Access Journals (Sweden)

    Martín-Antonio Rodríguez-Licea

    2018-05-01

    Full Text Available A Direct Current (DC microgrid is a concept derived from a smart grid integrating DC renewable sources. The DC microgrids have three particularities: (1 integration of different power sources and local loads through a DC link; (2 on-site power source generation; and (3 alternating loads (on-off state. This kind of arrangement achieves high efficiency, reliability and versatility characteristics. The key device in the development of the DC microgrid is the power electronic converter (PEC, since it allows an efficient energy conversion between power sources and loads. However, alternating loads with strictly-controlled PECs can provide negative impedance behavior to the microgrid, acting as constant power loads (CPLs, such that the overall closed-loop system becomes unstable. Traditional CPL compensation techniques rely on a damping increment by the adaptation of the source or load voltage level, adding external circuitry or by using some advanced control technique. However, none of them provide a simple and general solution for the CPL problem when abrupt changes in parameters and/or in alternating loads/sources occur. This paper proposes a mathematical modeling and a robust control for the basic PECs dealing with CPLs in continuous conduction mode. In particular, the case of the low voltage residential DC microgrid with CPLs is taken as a benchmark. The proposed controller can be easily tuned for the desired response even by the non-expert. Basic converters with voltage mode control are taken as a basis to show the feasibility of this analysis, and experimental tests on a 100-W testbed include abrupt parameter changes such as input voltage.

  3. Improved transmission of electrostatic accelerator in a wide range of terminal voltages by controlling the focal strength of entrance acceleration tube

    Science.gov (United States)

    Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter

    2018-04-01

    Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.

  4. Optimal Design of a Resonance-Based Voltage Boosting Rectifier for Wireless Power Transmission.

    Science.gov (United States)

    Lim, Jaemyung; Lee, Byunghun; Ghovanloo, Maysam

    2018-02-01

    This paper presents the design procedure for a new multi-cycle resonance-based voltage boosting rectifier (MCRR) capable of delivering a desired amount of power to the load (PDL) at a designated high voltage (HV) through a loosely-coupled inductive link. This is achieved by shorting the receiver (Rx) LC-tank for several cycles to harvest and accumulate the wireless energy in the RX inductor before boosting the voltage by breaking the loop and transferring the energy to the load in a quarter cycle. By optimizing the geometries of the transmitter (Tx) and Rx coils and the number of cycles, N , for energy harvesting, through an iterative design procedure, the MCRR can achieve the highest PDL under a given set of design constraints. Governing equations in the MCRR operation are derived to identify key specifications and the design guidelines. Using an exemplary set of specs, the optimized MCRR was able to generate 20.9 V DC across a 100 kΩ load from a 1.8 V p , 6.78 MHz sinusoid input in the ISM-band at a Tx/Rx coil separation of 1.3 cm, power transfer efficiency (PTE) of 2.2%, and N = 9 cycles. At the same coil distance and loading, coils optimized for a conventional half-wave rectifier (CHWR) were able to reach only 13.6 V DC from the same source.

  5. Modular high-voltage bias generator powered by dual-looped self-adaptive wireless power transmission.

    Science.gov (United States)

    Xie, Kai; Huang, An-Feng; Li, Xiao-Ping; Guo, Shi-Zhong; Zhang, Han-Lu

    2015-04-01

    We proposed a modular high-voltage (HV) bias generator powered by a novel transmitter-sharing inductive coupled wireless power transmission technology, aimed to extend the generator's flexibility and configurability. To solve the problems caused through an uncertain number of modules, a dual-looped self-adaptive control method is proposed that is capable of tracking resonance frequency while maintaining a relatively stable induction voltage for each HV module. The method combines a phase-locked loop and a current feedback loop, which ensures an accurate resonance state and a relatively constant boost ratio for each module, simplifying the architecture of the boost stage and improving the total efficiency. The prototype was built and tested. The input voltage drop of each module is less than 14% if the module number varies from 3 to 10; resonance tracking is completed within 60 ms. The efficiency of the coupling structure reaches up to 95%, whereas the total efficiency approaches 73% for a rated output. Furthermore, this technology can be used in various multi-load wireless power supply applications.

  6. A novel concept of fault current limiter based on saturable core in high voltage DC transmission system

    Science.gov (United States)

    Yuan, Jiaxin; Zhou, Hang; Gan, Pengcheng; Zhong, Yongheng; Gao, Yanhui; Muramatsu, Kazuhiro; Du, Zhiye; Chen, Baichao

    2018-05-01

    To develop mechanical circuit breaker in high voltage direct current (HVDC) system, a fault current limiter is required. Traditional method to limit DC fault current is to use superconducting technology or power electronic devices, which is quite difficult to be brought to practical use under high voltage circumstances. In this paper, a novel concept of high voltage DC transmission system fault current limiter (DCSFCL) based on saturable core was proposed. In the DCSFCL, the permanent magnets (PM) are added on both up and down side of the core to generate reverse magnetic flux that offset the magnetic flux generated by DC current and make the DC winding present a variable inductance to the DC system. In normal state, DCSFCL works as a smoothing reactor and its inductance is within the scope of the design requirements. When a fault occurs, the inductance of DCSFCL rises immediately and limits the steepness of the fault current. Magnetic field simulations were carried out, showing that compared with conventional smoothing reactor, DCSFCL can decrease the high steepness of DC fault current by 17% in less than 10ms, which verifies the feasibility and effectiveness of this method.

  7. METHODICAL APPROACHES TO THE CHOICE OF THE NEW GENERATION OF HIGH-VOLTAGE POWER TRANSMISSION LINE 220 kV OPTIONS

    Directory of Open Access Journals (Sweden)

    POSTOLATI V.M.

    2010-08-01

    Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

  8. A distributed parameter model of transmission line transformer for high voltage nanosecond pulse generation.

    Science.gov (United States)

    Li, Jiangtao; Zhao, Zheng; Li, Longjie; He, Jiaxin; Li, Chenjie; Wang, Yifeng; Su, Can

    2017-09-01

    A transmission line transformer has potential advantages for nanosecond pulse generation including excellent frequency response and no leakage inductance. The wave propagation process in a secondary mode line is indispensable due to an obvious inside transient electromagnetic transition in this scenario. The equivalent model of the transmission line transformer is crucial for predicting the output waveform and evaluating the effects of magnetic cores on output performance. However, traditional lumped parameter models are not sufficient for nanosecond pulse generation due to the natural neglect of wave propagations in secondary mode lines based on a lumped parameter assumption. In this paper, a distributed parameter model of transmission line transformer was established to investigate wave propagation in the secondary mode line and its influential factors through theoretical analysis and experimental verification. The wave propagation discontinuity in the secondary mode line induced by magnetic cores is emphasized. Characteristics of the magnetic core under a nanosecond pulse were obtained by experiments. Distribution and formation of the secondary mode current were determined for revealing essential wave propagation processes in secondary mode lines. The output waveform and efficiency were found to be affected dramatically by wave propagation discontinuity in secondary mode lines induced by magnetic cores. The proposed distributed parameter model was proved more suitable for nanosecond pulse generation in aspects of secondary mode current, output efficiency, and output waveform. In depth, comprehension of underlying mechanisms and a broader view of the working principle of the transmission line transformer for nanosecond pulse generation can be obtained through this research.

  9. Nonlinear gearshifts control of dual-clutch transmissions during inertia phase.

    Science.gov (United States)

    Hu, Yunfeng; Tian, Lu; Gao, Bingzhao; Chen, Hong

    2014-07-01

    In this paper, a model-based nonlinear gearshift controller is designed by the backstepping method to improve the shift quality of vehicles with a dual-clutch transmission (DCT). Considering easy-implementation, the controller is rearranged into a concise structure which contains a feedforward control and a feedback control. Then, robustness of the closed-loop error system is discussed in the framework of the input to state stability (ISS) theory, where model uncertainties are considered as the additive disturbance inputs. Furthermore, due to the application of the backstepping method, the closed-loop error system is ordered as a linear system. Using the linear system theory, a guideline for selecting the controller parameters is deduced which could reduce the workload of parameters tuning. Finally, simulation results and Hardware in the Loop (HiL) simulation are presented to validate the effectiveness of the designed controller. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  10. Characteristics of a four element gyromagnetic nonlinear transmission line array high power microwave source

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J. M., E-mail: jared.johnson@ttu.edu; Reale, D. V.; Garcia, R. S.; Cravey, W. H.; Neuber, A. A.; Dickens, J. C.; Mankowski, J. J. [Center for Pulsed Power and Power Electronics Department of Electrical and Computer Engineering, Texas Tech University, Lubbock, Texas 79409 (United States); Krile, J. T. [Department of Electromagnetics and Sensor Systems, Naval Surface Warfare Center - Dahlgren Division, Dahlgren, Virginia 22448 (United States)

    2016-05-15

    In this paper, a solid-state four element array gyromagnetic nonlinear transmission line high power microwave system is presented as well as a detailed description of its subsystems and general output capabilities. This frequency agile S-band source is easily adjusted from 2-4 GHz by way of a DC driven biasing magnetic field and is capable of generating electric fields of 7.8 kV/m at 10 m correlating to 4.2 MW of RF power with pulse repetition frequencies up to 1 kHz. Beam steering of the array at angles of ±16.7° is also demonstrated, and the associated general radiation pattern is detailed.

  11. A GaAs planar Schottky varactor diode for left-handed nonlinear transmission line applications

    International Nuclear Information System (INIS)

    Dong Jun-Rong; Yang Hao; Tian Chao; Huang Jie; Zhang Hai-Ying

    2012-01-01

    The left-handed nonlinear transmission line (LH-NLTL) based on monolithic microwave integrated circuit (MMIC) technology possesses significant advantages such as wide frequency band, high operating frequency, high conversion efficiency, and applications in millimeter and submillimeter wave frequency multiplier. The planar Schottky varactor diode (PSVD) is a major limitation to the performance of the LH-NLTL frequency multiplier as a nonlinear component. The design and the fabrication of the diode for such an application are presented. An accurate large-signal model of the diode is proposed. A 16 GHz-39.6 GHz LH-NLTL frequency doubler using our large-signal model is reported for the first time. The measured maximum output powers of the 2nd harmonic are up to 8 dBm at 26.4 GHz, and above 0 dBm from 16 GHz to 39.6 GHz when the input power is 20 dBm. The application of the LH-NLTL frequency doubler furthermore validates the accuracy of the large-signal model of the PSVD. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  12. MODELING OF VOLTAGE CONTROL FOR THE EVALUATING OF THE TRANSMISSION SYSTEM LOADING

    OpenAIRE

    BERNARDO HENRIQUE TODT SEELIG

    1999-01-01

    A falta de recursos e a questão ecológica tem limitado a expansão do sistema de transmissão. Esta realidade, em conjunto com o crescimento da carga, faz com que os sistemas elétricos trabalhem bastante carregados. Esta nova condição pode levar a situações de colapso de tensão. O desenvolvimento de métodos para a avaliação do carregamento da rede de transmissão tornou-se necessário e imprescindível para que se possa entender o funcionamento do sistema nestas con...

  13. Assessment of surge arrester failure rate and application studies in Hellenic high voltage transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Christodoulou, C.A.; Fotis, G.P.; Gonos, I.F.; Stathopulos, I.A. [National Technical University of Athens, School of Electrical and Computer Engineering, High Voltage Laboratory, 9 Iroon Politechniou St., Zografou Campus, 157 80 Athens (Greece); Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)

    2010-02-15

    The use of transmission line surge arresters to improve the lightning performance of transmission lines is becoming more common. Especially in areas with high soil resistivity and ground flash density, surge arresters constitute the most effective protection mean. In this paper a methodology for assessing the surge arrester failure rate based on the electrogeometrical model is presented. Critical currents that exceed arresters rated energy stress were estimated by the use of a simulation tool. The methodology is applied on operating Hellenic transmission lines of 150 kV. Several case studies are analyzed by installing surge arresters on different intervals, in relation to the region's tower footing resistance and the ground flash density. The obtained results are compared with real records of outage rate showing the effectiveness of the surge arresters in the reduction of the recorded failure rate. The presented methodology can be proved valuable to the studies of electric power systems designers intending in a more effective lightning protection, reducing the operational costs and providing continuity of service. (author)

  14. Method and system for a gas tube-based current source high voltage direct current transmission system

    Science.gov (United States)

    She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di

    2017-08-29

    A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.

  15. Collapse and pull - down analysis of high voltage electricity transmission towers subjected to cyclonic wind

    International Nuclear Information System (INIS)

    Ahmed, Ammar; Arthur, Craig; Edwards, Mark

    2010-01-01

    Bulk electricity transmission lines are linear assets that can be very exposed to wind effects, particularly where they traverse steep topography or open coastal terrain in cyclonic regions. Interconnected nature of the lattice type towers and conductors also, present complex vulnerabilities. These relate to the direction of wind attack to the conductors and the cascading failure mechanisms in which the failure of a single tower has cascading effects on neighbouring towers. Such behaviour is exacerbated by the finely tuned nature of tower design which serves to minimize cost and reserve strength at design wind speeds. There is a clear need to better quantify the interdependent vulnerabilities of these critical infrastructure assets in the context of the severe wind hazard. This paper presents a novel methodology developed for the Critical Infrastructure Protection Modelling and Analysis (CIPMA) capability for assessing local wind speeds and the likelihood of tower failure for a range of transmission tower and conductor types. CIPMA is a program managed by the Federal Attorney-General's Department and Geoscience Australia is leading the technical development. The methodology then involves the development of heuristically derived vulnerability models that are consistent with Australian industry experience and full-scale static tower testing results, considering isolated tower loss along with three interdependent failure mechanisms to give overall likelihoods of failure.

  16. Linearity and Nonlinearity in HIV/STI Transmission: Implications for the Evaluation of Sexual Risk Reduction Interventions

    Science.gov (United States)

    Pinkerton, Steven D.; Chesson, Harrell W.; Crosby, Richard A.; Layde, Peter M.

    2011-01-01

    A mathematical model of HIV/sexually transmitted infections (STI) transmission was used to examine how linearity or nonlinearity in the relationship between the number of unprotected sex acts (or the number of sex partners) and the risk of acquiring HIV or a highly infectious STI (such as gonorrhea or chlamydia) affects the utility of sexual…

  17. AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-12-01

    Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

  18. Modelling of long High Voltage AC Cables in the Transmission System

    DEFF Research Database (Denmark)

    Gudmundsdottir, Unnur Stella

    : conductor-insulation (with or without SC layers)-conductor-insulation(-conductor-insulation), whereas a transmission line single core XLPE cable will normally have the configuration: conductor-SC layerinsulation-SC layer-conductor-SC layer-conductor-insulation. Furthermore the existing cable models use......, EMTDC/PSCAD is provided. A typical HV AC underground power cable is formed by 4 main layers, namely; Conductor-Insulation-Screen-Insulation. In addition to these main layers, the cable also has semiconductive screens, swelling tapes and metal foil. For high frequency modelling in EMT-based software......-SC layer-solid hollow conductor) is implemented in the model. These improvements result in a more correct series impedance and hence a more correct damping of the simulations. Even though the series impedance is more correct, it does still not include the proximity effect and high frequency oscillations...

  19. EDF's new environment-oriented method for planning the Extra High Voltage transmission network

    International Nuclear Information System (INIS)

    Trogneux, F.; Doquet, M.; Blondel, H.; Mallet, P.

    1996-01-01

    As EDF is experiencing increasing difficulties to develop its transmission network, the time may have come to reconsider the project selection method. In this paper, we point out that the currently used method essentially relies on a classical discounted balance criterion. We then present a new method taking into account the impact of a project on the environment by considering an environmental risk which may jeopardize the project's success. This method helps to evaluate the probability that each possible route of each project will be carried through. A simple probability computation then allows us to derive a global comparison of the eligible projects on the basis of an expected discounted balance criterion. Experiments now in progress will help to decide upon this method's efficiency in the context of an operational use. (author). 5 figs., 1 tab., 4 refs

  20. Impact of Cyber Attacks on High Voltage DC Transmission Damping Control

    Directory of Open Access Journals (Sweden)

    Rui Fan

    2018-04-01

    Full Text Available Hybrid AC/HVDC (AC-HVDC grids have evolved to become huge cyber-physical systems that are vulnerable to cyber attacks because of the wide attack surface and increasing dependence on intelligent electronic devices, computing resources and communication networks. This paper, for the first time, studies the impact of cyber attacks on HVDC transmission oscillation damping control.Three kinds of cyber attack models are considered: timing attack, replay attack and false data injection attack. Followed by a brief introduction of the HVDC model and conventional oscillation damping control method, the design of three attack models is described in the paper. These attacks are tested on a modified IEEE New England 39-Bus AC-HVDC system. Simulation results have shown that all three kinds of attacks are capable of driving the AC-HVDC system into large oscillations or even unstable conditions.

  1. Self-consistent nonlinear transmission line model of standing wave effects in a capacitive discharge

    International Nuclear Information System (INIS)

    Chabert, P.; Raimbault, J.L.; Rax, J.M.; Lieberman, M.A.

    2004-01-01

    It has been shown previously [Lieberman et al., Plasma Sources Sci. Technol. 11, 283 (2002)], using a non-self-consistent model based on solutions of Maxwell's equations, that several electromagnetic effects may compromise capacitive discharge uniformity. Among these, the standing wave effect dominates at low and moderate electron densities when the driving frequency is significantly greater than the usual 13.56 MHz. In the present work, two different global discharge models have been coupled to a transmission line model and used to obtain the self-consistent characteristics of the standing wave effect. An analytical solution for the wavelength λ was derived for the lossless case and compared to the numerical results. For typical plasma etching conditions (pressure 10-100 mTorr), a good approximation of the wavelength is λ/λ 0 ≅40 V 0 1/10 l -1/2 f -2/5 , where λ 0 is the wavelength in vacuum, V 0 is the rf voltage magnitude in volts at the discharge center, l is the electrode spacing in meters, and f the driving frequency in hertz

  2. DC power flow control for radial offshore multi-terminal HVDC transmission system by considering steady-state DC voltage operation range

    DEFF Research Database (Denmark)

    Irnawan, Roni; Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    This paper deals with a radial offshore multi-terminal HVDC (MTDC) transmission system which is formed by interconnection several existing offshore wind farm (OWF) HVDC links with a shore-to-shore (StS) HVDC link. A challenge arises when deciding the steady-state DC voltage operating level...

  3. Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

    International Nuclear Information System (INIS)

    Klofai, Yerima; Essimbi, B Z; Jaeger, D

    2011-01-01

    Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

  4. Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

    Energy Technology Data Exchange (ETDEWEB)

    Klofai, Yerima [Department of Physics, Higher Teacher Training College, University of Maroua, PO Box 46 Maroua (Cameroon); Essimbi, B Z [Department of Physics, Faculty of Science, University of Yaounde 1, PO Box 812 Yaounde (Cameroon); Jaeger, D, E-mail: bessimb@yahoo.fr [ZHO, Optoelectronik, Universitaet Duisburg-Essen, D-47048 Duisburg (Germany)

    2011-10-15

    Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

  5. Global Harmonic Current Rejection of Nonlinear Backstepping Control with Multivariable Adaptive Internal Model Principle for Grid-Connected Inverter under Distorted Grid Voltage

    Directory of Open Access Journals (Sweden)

    Yang Yu

    2013-01-01

    Full Text Available Based on a brief review on current harmonics generation mechanism for grid-connected inverter under distorted grid voltage, the harmonic disturbances and uncertain items are immersed into the original state-space differential equation of grid-connected inverter. A new algorithm of global current harmonic rejection based on nonlinear backstepping control with multivariable internal model principle is proposed for grid-connected inverter with exogenous disturbances and uncertainties. A type of multivariable internal model for a class of nonlinear harmonic disturbances is constructed. Based on application of backstepping control law of the nominal system, a multivariable adaptive state feedback controller combined with multivariable internal model and adaptive control law is designed to guarantee the closed-loop system globally uniformly bounded, which is proved by a constructed Lyapunov function. The presented algorithm extends rejection of nonlinear single-input systems to multivariable globally defined normal form, the correctness and effectiveness of which are verified by the simulation results.

  6. Response analysis and energy transmissibility of a vibration isolation system with real-power nonlinearities under a NMPPF controller

    International Nuclear Information System (INIS)

    Huang, Dongmei; Xu, Wei; Shi, Lingling

    2016-01-01

    Highlights: • The nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. • The primary resonance, dynamical stability and energy transmissibility of the real-power vibration isolation system are studied. • The sensitivity of the controller parameters on the responses has been analyzed. • In order to suppress the amplitude peak, the feedback parameters have been determined by the frequency response. • The energy transmissibility is investigated. - Abstract: In this paper, the nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. Based on the method of multiple scales, the frequency response, the stability and the energy transmissibility of the real-power vibration isolation system are studied. It is found that the controlled isolation system exhibits a softening behavior for sub-linear restoring force, while it exhibits the two peak response characteristic rather than a hardening behavior for over-linear restoring force. Further, the sensitivity of the feedback parameters on the responses is discussed. The results, compared to the conventional PPF and IRC methods, show that the proposed method is significantly more effective in controlling the steady-state response, and slightly advantageous for the steady-state dynamics control. The effectiveness of this method is also verified by time domain analysis. Then, the suitable feedback and controller parameters are derived by simulation results in which the amplitude peak is suppressed and the resonance stability is maintained. Finally, the energy transmissibility of the vibration isolation system is investigated. The results show that the feedback gain can reduce the whole transmissibility level and greatly suppress vibration

  7. A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

    DEFF Research Database (Denmark)

    Liu, Chengxi; Qin, Nan; Bak, Claus Leth

    2015-01-01

    This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

  8. Structure-property relationships in an Al matrix Ca nanofilamentary composite conductor with potential application in high-voltage power transmission

    Science.gov (United States)

    Tian, Liang

    This study investigated the processing-structure-properties relationships in an Al/Ca composites using both experiments and modeling/simulation. A particular focus of the project was understanding how the strength and electrical conductivity of the composite are related to its microstructure in the hope that a conducting material with light weight, high strength, and high electrical conductivity can be developed to produce overhead high-voltage power transmission cables. The current power transmission cables (e.g., Aluminum Conductor Steel Reinforced (ACSR)) have acceptable performance for high-voltage AC transmission, but are less well suited for high-voltage DC transmission due to the poorly conducting core materials that support the cable weight. This Al/Ca composite was produced by powder metallurgy and severe plastic deformation by extrusion and swaging. The fine Ca metal powders have been produced by centrifugal atomization with rotating liquid oil quench bath, and a detailed study about the atomization process and powder characteristics has been conducted. The microstructure of Al/Ca composite was characterized by electron microscopy. Microstructure changes at elevated temperature were characterized by thermal analysis and indirect resistivity tests. The strength and electrical conductivity were measured by tensile tests and four-point probe resistivity tests. Predicting the strength and electrical conductivity of the composite was done by micro-mechanics-based analytical modeling. Microstructure evolution was studied by mesoscale-thermodynamics-based phase field modeling and a preliminary atomistic molecular dynamics simulation. The application prospects of this composite was studied by an economic analysis. This study suggests that the Al/Ca (20 vol. %) composite shows promise for use as overhead power transmission cables. Further studies are needed to measure the corrosion resistance, fatigue properties and energized field performance of this composite.

  9. Nonlinear impairment compensation using expectation maximization for dispersion managed and unmanaged PDM 16-QAM transmission

    DEFF Research Database (Denmark)

    Zibar, Darko; Winther, Ole; Franceschi, Niccolo

    2012-01-01

    In this paper, we show numerically and experimentally that expectation maximization (EM) algorithm is a powerful tool in combating system impairments such as fibre nonlinearities, inphase and quadrature (I/Q) modulator imperfections and laser linewidth. The EM algorithm is an iterative algorithm ...

  10. Effect of particle size, filler loadings and x-ray tube voltage on the transmitted x-ray transmission in tungsten oxide—epoxy composites

    International Nuclear Information System (INIS)

    Noor Azman, N.Z.; Siddiqui, S.A.; Hart, R.; Low, I.M.

    2013-01-01

    The effect of particle size, filler loadings and x-ray tube voltage on the x-ray transmission in WO 3 -epoxy composites has been investigated using the mammography unit and a general radiography unit. Results indicate that nano-sized WO 3 has a better ability to attenuate the x-ray beam generated by lower tube voltages (25–35 kV) when compared to micro-sized WO 3 of the same filler loading. However, the effect of particle size on x-ray transmission was negligible at the higher x-ray tube voltages (40–120 kV). - Highlights: ► Investigated the effect of particle size of WO 3 on the x-ray attenuation ability. ► Nano-sized WO 3 has a better ability to attenuate lower x-ray energies (22–49 kV p ). ► Particle size has negligible effect at the higher x-ray energy range (40–120 kV p ).

  11. Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

    International Nuclear Information System (INIS)

    Ekonomou, L; Karampelas, P; Vita, V; Chatzarakis, G E

    2011-01-01

    One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service

  12. Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

    Science.gov (United States)

    Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.

    2011-04-01

    One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.

  13. RF high voltage performance of RF transmission line components on the DIII-D Fast Wave Current Drive (FWCD) system

    International Nuclear Information System (INIS)

    Ferguson, S.W.; Callis, R.W.; Cary, W.P.; Phelps, D.A.; Ponce, D.; Baity, F.W.; Barber, G.

    1995-01-01

    The performance of the high voltage rf components of the DIII-D Fast Wave Current Drive System (FWCD) have been evaluated under various conditions of insulator configuration, insulator material, insulating gas and gas pressure. The insulator materials that have been investigated are alumina, steatite, pyrex, quartz, and teflon. The results of this evaluation are discussed in this paper. Additionally a rf high potter was developed to aid in the evaluation of rf high voltage components. The high potter consists of a 50 Ω, 1/4 wavelength cavity with a variable position short and a 50 ohm matched tap at one end of the cavity. With this configuration rf voltages were generated in excess of 100 kVp in the frequency range 30 to 60 MHz

  14. RF high voltage performance of RF transmission line components on the DIII-D Fast Wave Current Drive (FWCD) System

    International Nuclear Information System (INIS)

    Ferguson, S.W.; Callis, R.W.; Cary, W.P.; Phelps, D.A.; Ponce, D.; Baity, F.W.; Barber, G.

    1995-12-01

    The performance of the high voltage rf components of the DIII-D Fast Wave Current Drive System (FWCD) have been evaluated under various conditions of insulator configuration, insulator material, insulating gas and gas pressure. The insulator materials that have been investigated are alumina, steatite, pyrex, quartz, and teflon. The results of this evaluation are discussed in this paper. Additionally a rf high potter was developed to aid in the evaluation of rf high voltage components. The high potter consists of a 50 Ω, 1/4 wavelength cavity with a variable position short and a 50 ohm matched tap at one end of the cavity. With this configuration rf voltages were generated in excess of 100 kVp in the frequency range 30 to 60 MHz

  15. Linear and Nonlinear Impairment Compensation in Coherent Optical Transmission with Digital Signal Processing

    DEFF Research Database (Denmark)

    Porto da Silva, Edson

    Digital signal processing (DSP) has become one of the main enabling technologies for the physical layer of coherent optical communication networks. The DSP subsystems are used to implement several functionalities in the digital domain, from synchronization to channel equalization. Flexibility...... nonlinearity compensation, (II) spectral shaping, and (III) adaptive equalization. For (I), original contributions are presented to the study of the nonlinearity compensation (NLC) with digital backpropagation (DBP). Numerical and experimental performance investigations are shown for different application...... scenarios. Concerning (II), it is demonstrated how optical and electrical (digital) pulse shaping can be allied to improve the spectral confinement of a particular class of optical time-division multiplexing (OTDM) signals that can be used as a building block for fast signaling single-carrier transceivers...

  16. Nonlinear observer for synchronization of chaotic systems with application to secure data transmission

    Science.gov (United States)

    Aguilar-López, Ricardo; Martínez-Guerra, Rafael; Perez-Pinacho, Claudia A.

    2014-06-01

    The main issue of this work is related with the design of a class of nonlinear observer in order to synchronize chaotic dynamical systems in a master-slave scheme, considering different initial conditions. The oscillator of Chen is proposed as a benchmark model and a bounded-type observer is proposed to reach synchronicity between both two chaotic systems. The proposed observer contains a proportional and sigmoid form of a bounded function of the synchronization error in order to provide asymptotic synchronization with a satisfactory performance. Some numerical simulations were carrying out in order to show the operation of the proposed methodology, with possible applications to secure data communications issues.

  17. Nonlinearity effect of electro-optical modulator response in double spread CDMA radio-over-fiber transmissions

    Science.gov (United States)

    Huang, Jen-Fa; Yen, Chih-Ta; Li, Tzung-Yen

    2008-07-01

    This study presents a double-spread code-division multiple-access (CDMA) scheme for radio-over-fiber (RoF) transmissions. The network coder/decoders (codecs) are implemented using arrayed-waveguide grating (AWG) routers coded with maximal-length sequence ( M-sequence) codes. The effects of phase-induced intensity noise (PIIN) and multiple-access interference (MAI) on the system performance are evaluated numerically for different values of the optical modulation index (OMI) during the nonlinear electro-optical modulator (EOM) response. At low OMI optical device noise is dominant, but at high OMI nonlinear effect becomes significant. Numerical result shows that the system performance is highly sensitive to the OMI. Therefore, specifying an appropriate value of the OMI is essential in optimizing the system performance. The influence of the degree of polarization (DOP) in the system is also discussed. By employing the scrambler in front of the balanced photo-detector, the system performance can be enhanced. The high-performance, low-cost characteristics of the double-spread CDMA render the scheme an ideal solution for radio-CDMA wireless system cascaded with optical CDMA network.

  18. Experimental study of transmission of a pulsed focused beam through a skull phantom in nonlinear regime

    Energy Technology Data Exchange (ETDEWEB)

    Tsysar, S. A., E-mail: sergey@acs366.phys.msu.ru; Nikolaeva, A. V.; Khokhlova, V. A.; Yuldashev, P. V. [Physics Faculty, Moscow State University, Leninskie Gory, Moscow 119991 (Russian Federation); Svet, V. D. [Andreyev Acoustics Institute, 4, Shvernik Street, Moscow 117036 (Russian Federation); Sapozhnikov, O. A. [Physics Faculty, Moscow State University, Leninskie Gory, Moscow 119991 (Russian Federation); Center for Industrial and Medical Ultrasound, Applied Physics Laboratory, University of Washington, 1013 NE 40th Street, Seattle, WA 98105 (United States)

    2015-10-28

    In the paper the use of receiving and radiating system, which allows to determine the parameters of bone by nonlinear pulse-echo technique and to image of brain structures through the skull bones, was proposed. Accuracy of the skull bone characterization is due to higher measured harmonic and is significantly better than in linear case. In the experimental part focused piezoelectric transducer with diameter 100 mm, focal distance 100 mm, the frequency of 1.092 MHz was used. It was shown that skull bone profiling can be performed with the use of 3rd harmonic since 1st harmonic can be used for visualization of the underlying objects. The use of wideband systems for both skull profiling and brain visualization is restricted by skull attenuation and resulting low effective sensitivity.

  19. Experimental study of transmission of a pulsed focused beam through a skull phantom in nonlinear regime

    International Nuclear Information System (INIS)

    Tsysar, S. A.; Nikolaeva, A. V.; Khokhlova, V. A.; Yuldashev, P. V.; Svet, V. D.; Sapozhnikov, O. A.

    2015-01-01

    In the paper the use of receiving and radiating system, which allows to determine the parameters of bone by nonlinear pulse-echo technique and to image of brain structures through the skull bones, was proposed. Accuracy of the skull bone characterization is due to higher measured harmonic and is significantly better than in linear case. In the experimental part focused piezoelectric transducer with diameter 100 mm, focal distance 100 mm, the frequency of 1.092 MHz was used. It was shown that skull bone profiling can be performed with the use of 3rd harmonic since 1st harmonic can be used for visualization of the underlying objects. The use of wideband systems for both skull profiling and brain visualization is restricted by skull attenuation and resulting low effective sensitivity

  20. Analyzing the Health Risks Resulting from Extending the 400kV High Voltage Transmission Lines on the Human

    Directory of Open Access Journals (Sweden)

    Mohammed Hassan Dervish

    2018-01-01

    Full Text Available Although it is difficult to imagine life without electricity, there are compiling confirmations show thatexposure to magnetic fields correlated electricity and radio frequencies pose magnificent hazards to human health. The most economist method to transfer electricity from power generation stations to users is by measures of high power transmission lines, buoyed by big transmission towers. The cables laced between the towers radiate magnetic and electric fields. In this research study, the magnetic field at ground level under 400 kV network lines extended in residential places have been conducted in two ways, mathematical calculation and practical measurement then the obtained results analyzed and compared with the international standards reference values. the reason of chose this type of transmission line is frequently using. The results indicate that they fall within the safe limiter commended by the WorldHealth Organization. the strength of radiation increasing with high of sea level and moisture ratiobecause of air ionization.

  1. Electrical Structure of Future Off-shore Wind Power Plant with a High Voltage Direct Current Power Transmission

    DEFF Research Database (Denmark)

    Sharma, Ranjan

    The increasing demand of electric power and the growing consciousness towards the changing climate has led to a rapid development of renewable energy in the recent years. Among all, wind energy has been the fastest growing energy source in the last decade. But the growing size of wind power plants......, better wind conditions at off-shore and the general demand to put them out of sight have all contributed to the installation of large wind power plants in off-shore condition. However, moving wind power plants far out in the off-shore comes with many associated problems. One of the main challenges...... is the transmission of power over long distance. Historically, the power transmission from off-shore wind power plants has been done via HVAC submarine cables. This provides a simple solution, but AC cables cannot be arbitrarily long. It is shown in the report that major issues with HVAC cable transmission system...

  2. Self-commutated high-voltage direct current transmission with DC circuit breakers. Backbone for the energy policy turnaround; Selbstgefuehrte Hochspannungs-Gleichstromuebertragung mit DC-Leistungsschalter. Rueckgrat fuer die Energiewende

    Energy Technology Data Exchange (ETDEWEB)

    Goerner, Raphael [ABB AG, Mannheim (Germany). Marketing und Vertrieb, Geschaeftsbereich Grid Systems

    2013-06-01

    The 'current war' between direct current and alternating current is extended by a new location. In the future, both technologies work together in order to provide a reliable power transmission in Germany and long-term in Europe. This is based on the self-guided high-voltage direct current transmission. In conjunction with direct current circuit breakers (DC circuit breaker) the power circuit breakers may help to make the transmission grids more flexible and to minimize losses.

  3. Manifestation of vortex depinning transition in nonlinear current-voltage characteristics of polycrystalline superconductor Y1-xPrxBa2Cu3O7-δ

    International Nuclear Information System (INIS)

    Rivera, V.A.G.; Stari, C.; Sergeenkov, S.; Marega, E.; Araujo-Moreira, F.M.

    2008-01-01

    We present our recent results on the temperature dependence of current-voltage characteristics for polycrystalline Y 1-x Pr x Ba 2 Cu 3 O 7-δ superconductors with x=0.0, 0.1 and 0.3. The experimental results are found to be reasonably well fitted for all samples by a power like law of the form V=R(I-I c ) a(T) . Here, we assume that a(T)=1+Φ 0 I C (T)/2πk B T and I C (T)=I C (0)(1-T/T C ) 3/2 for the temperature dependences of the power exponent and critical current, respectively. According to the theoretical interpretation of the obtained results, nonlinear deviation of our current-voltage characteristics curves from Ohmic behavior (with a(T C )=1) below T C is attributed to the manifestation of dissipation processes. They have a characteristic temperature T p defined via the power exponent as a(T p )=2 and are related to the current induced depinning of Abrikosov vortices. Both T C (x) and T p (x) are found to decrease with an increase of Pr concentration x reflecting deterioration of the superconducting properties of the doped samples

  4. Deploying correct fault loop in distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Bak, Claus Leth; Silva, Filipe Miguel Faria da

    2018-01-01

    Combined faults occurring between different voltage levels in overhead lines present a challenge for distance protection. Previous work has shown that such faults most often appears as single phase to ground (SPTG) faults in a normal type of overhead line. However, it is not obvious that distance...... relays will identify and select the correct fault loop according to being similar to SPTG, as all six fault loops get excited when combined faults occur. This paper presents a study where two distance relays of different manufactures are tested using transient replay and secondary test equipment...

  5. Current transmission and nonlinear effects in un-gated thermionic cathode RF guns

    Energy Technology Data Exchange (ETDEWEB)

    Edelen, J. P. [Fermilab; Harris, J. R. [Air Force Weapons Lab

    2017-05-03

    Un-gated thermionic cathode RF guns are well known as a robust source of electrons for many accelerator applications. These sources are in principle scalable to high currents without degradation of the transverse emittance due to control grids but they are also known for being limited by back-bombardment. While back-bombardment presents a significant limitation, there is still a lack of general understanding on how emission over the whole RF period will affect the nature of the beams produced from these guns. In order to improve our understanding of how these guns can be used in general we develop analytical models that predict the transmission efficiency as a function of the design parameters, study how bunch compression and emission enhancement caused by Schottky barrier lowering affect the output current profile in the gun, and study the onset of space-charge limited effects and the resultant virtual cathode formation leading to a modulation in the output current distribution.

  6. Environmental impact of high voltage aerial transmission lines; Impacto ambiental de linhas de transmissao aereas de alta tensao

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R P [CAEEB, Brasilia, DF (Brazil); Mouallen, M C [Eletricidade de Sao Paulo, SP (Brazil); Quintella, S E.A.

    1990-12-31

    The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig.

  7. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  8. Fast voltage-sensitive dye imaging of excitatory and inhibitory synaptic transmission in the rat granular retrosplenial cortex.

    Science.gov (United States)

    Nixima, Ken'ichi; Okanoya, Kazuo; Ichinohe, Noritaka; Kurotani, Tohru

    2017-09-01

    Rodent granular retrosplenial cortex (GRS) has dense connections between the anterior thalamic nuclei (ATN) and hippocampal formation. GRS superficial pyramidal neurons exhibit distinctive late spiking (LS) firing property and form patchy clusters with prominent apical dendritic bundles. The aim of this study was to investigate spatiotemporal dynamics of signal transduction in the GRS induced by ATN afferent stimulation by using fast voltage-sensitive dye imaging in rat brain slices. In coronal slices, layer 1a stimulation, which presumably activated thalamic fibers, evoked propagation of excitatory synaptic signals from layers 2-4 to layers 5-6 in a direction perpendicular to the layer axis, followed by transverse signal propagation within each layer. In the presence of ionotropic glutamate receptor antagonists, inhibitory responses were observed in superficial layers, induced by direct activation of inhibitory interneurons in layer 1. In horizontal slices, excitatory signals in deep layers propagated transversely mainly from posterior to anterior via superficial layers. Cortical inhibitory responses upon layer 1a stimulation in horizontal slices were weaker than those in the coronal slices. Observed differences between coronal and horizontal planes suggest anisotropy of the intracortical circuitry. In conclusion, ATN inputs are processed differently in coronal and horizontal planes of the GRS and then conveyed to other cortical areas. In both planes, GRS superficial layers play an important role in signal propagation, which suggests that superficial neuronal cascade is crucial in the integration of multiple information sources. NEW & NOTEWORTHY Superficial neurons in the rat granular retrosplenial cortex (GRS) show distinctive late-spiking (LS) firing property. However, little is known about spatiotemporal dynamics of signal transduction in the GRS. We demonstrated LS neuron network relaying thalamic inputs to deep layers and anisotropic distribution of

  9. Single-Wire Electric-Field Coupling Power Transmission Using Nonlinear Parity-Time-Symmetric Model with Coupled-Mode Theory

    Directory of Open Access Journals (Sweden)

    Xujian Shu

    2018-03-01

    Full Text Available The output power and transmission efficiency of the traditional single-wire electric-field coupling power transmission (ECPT system will drop sharply with the increase of the distance between transmitter and receiver, thus, in order to solve the above problem, in this paper, a new nonlinear parity-time (PT-symmetric model for single-wire ECPT system based on coupled-mode theory (CMT is proposed. The proposed model for single-wire ECPT system not only achieves constant output power but also obtains a high constant transmission efficiency against variable distance, and the steady-state characteristics of the single-wire ECPT system are analyzed. Based on the theoretical analysis and circuit simulation, it shows that the transmission efficiency with constant output power remains 60% over a transmission distance of approximately 34 m without the need for any tuning. Furthermore, the application of a nonlinear PT-symmetric circuit based on CMT enables robust electric power transfer to moving devices or vehicles.

  10. Compensation of nonlinearity in a fiber-optic transmission system using frequency-degenerate phase conjugation through counter-propagating dual pump FWM in a semiconductor optical amplifier

    Science.gov (United States)

    Anchal, Abhishek; K, Pradeep Kumar; O'Duill, Sean; Anandarajah, Prince M.; Landais, Pascal

    2018-04-01

    We present a scheme of frequency-degenerate mid-span spectral inversion (MSSI) for nonlinearity compensation in fiber-optic transmission systems. The spectral inversion is obtained by using counter-propagating dual pump four-wave mixing in a semiconductor optical amplifier (SOA). Frequency-degeneracy between signal and conjugate is achieved by keeping two pump frequencies symmetrical about the signal frequency. We simulate the performance of MSSI for nonlinearity compensation by scrutinizing the improvement of the Q-factor of a 200 Gbps QPSK signal transmitted over a standard single mode fiber, as a function of launch power for different span lengths and number of spans. We demonstrate a 7.5 dB improvement in the input power dynamic range and an almost 83% increase in the transmission length for optimum MSSI parameters of -2 dBm pump power and 400 mA SOA current.

  11. Kerr nonlinearity mitigation in 5 × 28-GBd PDM16-QAM signal transmission over a dispersion-uncompensated link with backward-pumpeddistributed Raman amplification

    DEFF Research Database (Denmark)

    Sackey, I.; Da Ros, Francesco; Jazayerifar, M.

    2014-01-01

    We present experimental and numerical investigations of Kerr nonlinearity compensation in a 400-km standard single-mode fiber link with distributed Raman amplification with backward pumping. A dual-pump polarization-independent fiber-based optical parametric amplifier is used for mid-link spectra...... to numerical simulations with good agreement. It is also shown with simulations that a maximum transmission reach of 2400 km enabled by the optical phase conjugator is possible for the WDM signal...

  12. Optimal Siting and Sizing of Multiple DG Units for the Enhancement of Voltage Profile and Loss Minimization in Transmission Systems Using Nature Inspired Algorithms

    Directory of Open Access Journals (Sweden)

    Ambika Ramamoorthy

    2016-01-01

    Full Text Available Power grid becomes smarter nowadays along with technological development. The benefits of smart grid can be enhanced through the integration of renewable energy sources. In this paper, several studies have been made to reconfigure a conventional network into a smart grid. Amongst all the renewable sources, solar power takes the prominent position due to its availability in abundance. Proposed methodology presented in this paper is aimed at minimizing network power losses and at improving the voltage stability within the frame work of system operation and security constraints in a transmission system. Locations and capacities of DGs have a significant impact on the system losses in a transmission system. In this paper, combined nature inspired algorithms are presented for optimal location and sizing of DGs. This paper proposes a two-step optimization technique in order to integrate DG. In a first step, the best size of DG is determined through PSO metaheuristics and the results obtained through PSO is tested for reverse power flow by negative load approach to find possible bus locations. Then, optimal location is found by Loss Sensitivity Factor (LSF and weak (WK bus methods and the results are compared. In a second step, optimal sizing of DGs is determined by PSO, GSA, and hybrid PSOGSA algorithms. Apart from optimal sizing and siting of DGs, different scenarios with number of DGs (3, 4, and 5 and PQ capacities of DGs (P alone, Q alone, and  P and Q both are also analyzed and the results are analyzed in this paper. A detailed performance analysis is carried out on IEEE 30-bus system to demonstrate the effectiveness of the proposed methodology.

  13. Optimal Siting and Sizing of Multiple DG Units for the Enhancement of Voltage Profile and Loss Minimization in Transmission Systems Using Nature Inspired Algorithms.

    Science.gov (United States)

    Ramamoorthy, Ambika; Ramachandran, Rajeswari

    2016-01-01

    Power grid becomes smarter nowadays along with technological development. The benefits of smart grid can be enhanced through the integration of renewable energy sources. In this paper, several studies have been made to reconfigure a conventional network into a smart grid. Amongst all the renewable sources, solar power takes the prominent position due to its availability in abundance. Proposed methodology presented in this paper is aimed at minimizing network power losses and at improving the voltage stability within the frame work of system operation and security constraints in a transmission system. Locations and capacities of DGs have a significant impact on the system losses in a transmission system. In this paper, combined nature inspired algorithms are presented for optimal location and sizing of DGs. This paper proposes a two-step optimization technique in order to integrate DG. In a first step, the best size of DG is determined through PSO metaheuristics and the results obtained through PSO is tested for reverse power flow by negative load approach to find possible bus locations. Then, optimal location is found by Loss Sensitivity Factor (LSF) and weak (WK) bus methods and the results are compared. In a second step, optimal sizing of DGs is determined by PSO, GSA, and hybrid PSOGSA algorithms. Apart from optimal sizing and siting of DGs, different scenarios with number of DGs (3, 4, and 5) and PQ capacities of DGs (P alone, Q alone, and P and Q both) are also analyzed and the results are analyzed in this paper. A detailed performance analysis is carried out on IEEE 30-bus system to demonstrate the effectiveness of the proposed methodology.

  14. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Science.gov (United States)

    Bhowmik, R. N.; Vijayasri, G.

    2015-06-01

    We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  15. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

    Energy Technology Data Exchange (ETDEWEB)

    Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

    2015-06-15

    We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  16. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Directory of Open Access Journals (Sweden)

    R. N. Bhowmik

    2015-06-01

    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  17. Study of HV Dielectrics for High Frequency Operation in Linear & Nonlinear Transmission Lines & Simulation & Development of Hybrid Nonlinear Lines for RF Generation

    Science.gov (United States)

    2015-08-27

    As shown in [4], [5], the capacitors based on PZT (lead-zirconate- titanate) and BT dielectrics have dielectric BD strength of the order of 50 kV/cm...results. Depending on the nonlinearity properties of the capacitor dielectric , input pulse rise time, output pulse sharpening and or RF soliton... capacitors in a frequency range up to 2 MHz, below the resonant frequency of the both dielectrics . As seen in Fig. 1, PZTs have better performance than

  18. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  19. Technique and Calculation Results of Currents and Voltages in the Circuits of the Measuring Element of the Protection Device of the Transmission Line Based on the Control of Transient Processes

    Science.gov (United States)

    Lachugin, V. F.; Kulikov, A. L.; Platonov, P. S.; Vucolov, V. Yu.

    2017-12-01

    The specifics of generation of the signals of current and voltage in the circuits of a directional element of wave relay protection during short circuit (SC) in overhead power transmission lines are considered. The computing method of transient processes in the protection circuits, including frequency filters, that attenuate the parameters of currents and voltages of the mode taking into account the higher harmonic components and probable deviations of the frequency of transmission line from the rated value is presented. It is revealed that it is advisable to implement the measuring circuits of the directional elements of wave relay protection with the three-section filter attenuating the frequencies from 45 to 55 Hz and the low pass filter with cutoff frequency that does not exceed 1 kHz.

  20. Algorithm оf Computer Model Realization оf High-Frequency Processes in Switchgears Containing Non-Linear Over-Voltage Limiters

    Directory of Open Access Journals (Sweden)

    Ye. V. Dmitriev

    2007-01-01

    Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.

  1. Study of HV Dielectrics for High Frequency Operation in Linear and Nonlinear Transmission Lines (NLTLs) and Simulation and Development of Hybrid Nonlinear Lines for RF Generation

    Science.gov (United States)

    2016-01-27

    Microwave & Optolectronics Conf. (IMOC), Rio de Janeiro , RJ, 2013, pp. 1-5. 7) L.P. Silva Neto, J.O. Rossi, J.J. Barroso, A.R. Silva. “Characterization of...Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5. 11) L.P. Silva Neto...transmission lines,” Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5

  2. Experimental observation on asymmetric energy flux within the forbidden frequency band in the LC transmission line

    International Nuclear Information System (INIS)

    Tao Feng; Chen Weizhong; Pan Junting; Xu Wen; Du Sidan

    2012-01-01

    We study the energy flux in a nonlinear electrical transmission line consisting of two coupled segments which are identical in structure and different in parameters. The asymmetry of energy flux caused by nonlinear wave has been observed experimentally in the forbidden band of the line. The experiment shows whether the energy can flow through the transmission line depends on the amplitude of the boundary driving voltages, which can be well explained in the theoretical framework of nonlinear supratransmission. The numerical simulation based on Kirchhoff’s laws further verifies the existence of the asymmetric energy flux in the forbidden band.

  3. Stakeholder involvement in other sectors. High Voltage Electricity Transmission. Case study: CO_2 capture and storage. Common misconceptions on stakeholder involvement - Reviewing deployment of RES

    International Nuclear Information System (INIS)

    Wolsink, Maarten; Komendantova, Nadejda; Kalaydjian, Francois

    2017-01-01

    Session 7 featured several speakers with expertise outside of the nuclear field. High-voltage electricity transmission and carbon capture and storage projects were presented by experts who study and advise on stakeholder involvement in such activities. The session chair provided an overview of stakeholder involvement fundamentals as applied to renewable energy projects. Though the presentations were on non-nuclear projects, the principles presented and discussed were clearly applicable in nuclear contexts as well. Mr Wolsink of University of Amsterdam re-framed the topic of the power supply system as a 'socio-technical system'. He identified three types or levels of societal acceptance for energy innovation: socio-political acceptance, market acceptance and community acceptance. This distinction highlights the different nature of questions, issues, set of actors and challenges that arise at different points or forums around energy infrastructure projects and why general favorability towards a technology does not translate into support of its local implementation. Societal acceptance probably cannot be acquired without meaningful involvement. Arnstein's 'ladder of citizen participation' was referenced by two session speakers. Mr Wolsink explained that inexperienced organisations may target 'consultation', thinking that this is real participation. However, consultation is a relatively low level of involvement which consists of gathering information or views, without promoting two-way dialogue (engagement) or committing to actual influence and indeed some degree of citizen power. He advised that simple consultation should be avoided unless the organisation finds that such stakeholder or public input is essential to the decision and intends to give it due account. The Barendrecht case on carbon capture and storage, as presented by Mr Kalaydjian of IFP Energies Nouvelles, illustrates the danger in overly restricting or compartmentalising stakeholder involvement. Ms

  4. A Nonlinear Transmission Line Model of the Cochlea With Temporal Integration Accounts for Duration Effects in Threshold Fine Structure

    DEFF Research Database (Denmark)

    Verhey, Jesko L.; Mauermann, Manfred; Epp, Bastian

    2017-01-01

    For normal-hearing listeners, auditory pure-tone thresholds in quiet often show quasi periodic fluctuations when measured with a high frequency resolution, referred to as threshold fine structure. Threshold fine structure is dependent on the stimulus duration, with smaller fluctuations for short...... than for long signals. The present study demonstrates how this effect can be captured by a nonlinear and active model of the cochlear in combination with a temporal integration stage. Since this cochlear model also accounts for fine structure and connected level dependent effects, it is superior...

  5. Analysis of the public debate on health hazards due to high-voltage transmission lines. Recommendations for the radiation protection related communication with respect of grid extension

    International Nuclear Information System (INIS)

    Weber, Florian; Kuehne, Olaf; Jenal, Corinna; Sanio, Tina; Langer, Kerstin; Igel, Michael

    2016-01-01

    With its phase-out of nuclear power generation and the expansion of renewably sourced energy, the German energy turnaround ('Energiewende') has radically changed existing power supply structures, with wide geographical repercussions. One aspect of this is changes to the national power grid. Existing networks are to be upgraded and new long-distance north-south power-lines built. This creates resistance and conflict. Commissioned by the Federal Office for Radiation Protection, and the Federal Ministry of the Environment, Nature Conservation, Building and Nuclear Safety, the research project entitled Analysis of public discourse on the health impacts of high-voltage power lines - recommendations for action in radiation-protection discourse related to the extension of the power grid starts precisely at the point of conflict. It first investigates from a discourse theory perspective how power grid extensions and possible health-related consequences are communicatively constructed, and what argumentation patterns dominate the discussion. From this it derives recommendations for action, with a focus on health politics information and discourse. Behind the research project stands a socio-constructivist discourse theory that sees 'social reality' not as a given but as a socially evolved entity, and its meanings, therefore, not as stable but as subject to change. The central mechanism for the communication of an objectivized social world is language. The analyses undertaken here of power grid extension are based on a methodological mix of quantitative and qualitative elements that facilitates both the differentiation of central issues and detailed examination of individual aspects. Analysis focuses on the discussion of health issues not only in the relevant literature and on civic initiative websites, but also in the first 50 Google hits, in articles from the Sueddeutsche Zeitung (SZ) and Focus, and in talk shows. The resultant discourse analysis

  6. The First Find of the Imperial Eagle’s Nest at the Pole of High-Voltage Power Transmission Line in the Republic of Altai, Russia

    Directory of Open Access Journals (Sweden)

    Elvira G. Nikolenko

    2018-03-01

    Full Text Available Inhabited nest of the Imperial Eagle was found on July 27, 2017 on the high-voltage power lines pole in the valley of the river Ursul near the fall of the river Karakol into it (Onguday district of the Altai Republic. Two adult nestlings ready to flyout and also a female bird were in the nest.

  7. Maintenance planning for transmission routes with medium voltage overlines - experience within the framework of two pilot projects; Trassenpflegeplanung fuer Mittel- und Hochspannungsfreileitungen - Erfahrungen von zwei Pilotprojekten

    Energy Technology Data Exchange (ETDEWEB)

    Geiges, H. [Ingenieurbuero Geiges, Freiraum- und Landschaftsplanung, Laumersheim (Germany)

    1997-11-03

    On the basis of the `VDEW Orientation Aid for Maintenance Measures in Transmission Routes` two pilot projects were selected in a 110 kV and a 20 kV overhead transmission route. (orig.) [Deutsch] Auf der Grundlage der `VDEW-Orientierungshilfe zu Pflegemassnahmen in Leitungstrassen` wurden Pilotprojekte in einer 110-kV- und in einer 20-kV-Freileitungstrasse im suedlichen Pfaelzerwald ausgewaehlt. (orig.)

  8. Effects of Degree-Biased Transmission Rate and Nonlinear Infectivity on Rumor Spreading in Complex Social Networks

    International Nuclear Information System (INIS)

    Naimi, Y.; Roshani, F.

    2010-12-01

    We introduce the generalized rumor spreading model and analytically investigate the epidemic spreading for this model on scale-free networks. To generalize the standard rumor spreading model (rumor model in which each node's infectivity equals its degree and all links have a uniform connectivity strength), we introduce not only the infectivity function to determine the simultaneous contacts that a given node (individual) establishes to its connected neighbors but also the connectivity strength function (CSF) for the direct link between two connected nodes that lead to degree-biased propagation of rumors. In the case of nonlinear functions, the generalization enters the infectivity's exponent α and the CSF's exponent β into the analytical rumor model. We show that one can adjust the exponents α and β to control the epidemic threshold which is absent for the standard rumor spreading model. In addition, we obtain the critical threshold for the generalized model on the finite scale-free network and compare our results with the standard model on the same network. We show that the generalized model has a greater threshold than the standard model. (author)

  9. EAM-based high-speed 100-km OFDM transmission featuring tolerant modulator operation enabled using SSII cancellation.

    Science.gov (United States)

    Chen, Hsing-Yu; Wei, Chia-Chien; Lu, I-Cheng; Chen, Yu-Chao; Chu, Hsuan-Hao; Chen, Jyehong

    2014-06-16

    In this study, a technique was developed to compensate for nonlinear distortion through cancelling subcarrier-to-subcarrier intermixing interference (SSII) in an electroabsorption modulator (EAM)-based orthogonal frequency-division multiplexing (OFDM) transmission system. The nonlinear distortion to be compensated for is induced by both EAM nonlinearity and fiber dispersion. Because an OFDM signal features an inherently high peak-to-average power ratio, a trade-off exists between the optical modulation index (OMI) and modulator nonlinearity. Therefore, the nonlinear distortion limits the operational tolerance of the bias voltage and the driving power to a small region. After applying the proposed SSII cancellation, the OMI of an OFDM signal was increased yielding only a small increment of nonlinear distortion, and the tolerance region of the operational conditions was also increased. By employing the proposed scheme, this study successfully demonstrates 50-Gbps OFDM transmission over 100-km dispersion-uncompensated single-mode fiber based on a single 10-GHz EAM.

  10. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo

    2014-01-01

    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  11. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  12. Electrical transmission

    Energy Technology Data Exchange (ETDEWEB)

    Sayers, D P

    1960-05-01

    After briefly tracing the history of electricity transmission, trends in high voltage transmission and experiments being conducted on 650 kV are discussed. 5000 miles of the U.K. grid are operated at 132 kV and 1000 at 275 kV, ultimately to provide a super grid at 380 kV. Problems are insulation, radio interference and the cost of underground lines (16 times that of overhead lines). Also considered are the economics of the grid as a means of transporting energy and as a means of spreading the peak load over the power stations in the most efficient manner. Finally, the question of amenities is discussed.

  13. Model for the ready definition and approximate comparison of alternative high voltage transmission systems. Phases II and III. Application to electric systems within the contiguous United States. [800 and 1200 kV; 400, 600, and 800 kV dc

    Energy Technology Data Exchange (ETDEWEB)

    1979-08-01

    Research on power delivery alternatives is reported. The first phase of this work was to develop a model of overhead transmission systems in the range of 362 to 1200 kV ac, and +-400 to +-800 kV dc. Such systems included transmission from generation to load and inter-connection of two large integrated systems, with and without the existence of an underlying lower voltage network in either case. This phase has been completed. The second and third phases involved application of the model to electric systems within selected regions of the US, and the entire US, respectively, dealing with real situations and including projected expansion to year 1987. The potential benefits and costs of using higher than existing transmission voltages were to be evaluated on this basis. Additionally, the most advantageous new voltage was to be determined taking into account direct and indirect benefits and costs. The results of the second and third phases are presented.

  14. Hybrid AC-High Voltage DC Grid Stability and Controls

    Science.gov (United States)

    Yu, Jicheng

    The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient

  15. Offshore Transmission Technology

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-10-15

    The purpose of this document is to give an overview of offshore electricity transmission technologies. In particular this document is concerned with the use of High Voltage Direct Current (HVDC) systems and more specifically with the development of Voltage Source Converter (VSC) technology. This report outlines the current state of the main technology groups required for offshore HVDC transmission as well as giving examples of offshore projects (both current and future). Finally some indications of likely unit costs for HV assets are given.

  16. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  17. Transmission eigenvalues

    Science.gov (United States)

    Cakoni, Fioralba; Haddar, Houssem

    2013-10-01

    In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

  18. Optimal condition of memristance enhancement circuit using external voltage source

    Directory of Open Access Journals (Sweden)

    Hiroya Tanaka

    2014-05-01

    Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

  19. Amorphous-like interfacial layer between a high-Tc superconducting Tl-1223 film and a Ag substrate examined by high-voltage high-resolution transmission electron microscopy

    International Nuclear Information System (INIS)

    Kim, Bongjun; Kim, Hyuntak; Nagai, Takuro; Matsui, Yoshio; Horiuchi, Shigeo; Jeong, Daeyeong; Deinhofer, Christian; Gritzner, Gerhard; Kim, Youngmin; Kim, Younjoong

    2006-01-01

    The thin amorphous-like layer, formed at the interface between a high-T c superconducting (Tl 0.5 , Pb 0.5 )(Sr 0.8 , Ba 0.2 )Ca 2 Cu 3 O y (Tl-1223) film and a Ag substrate during heating at 910 .deg. C, has been examined by using high-voltage high-resolution transmission electron microscopy. The interfacial layer is less than 10 nm in thickness. It contacts the (001) plane of Tl-1223 and the (113) or (133) planes of Ag in most cases. Its composition is similar to that of Tl-1223, except for the inclusion of a substantial amount of Ag. Its formation proceeds by diffusion of Ag into Tl-1223, during which a structure change first occurs at the layer of CuO 2 + Ca planes. The Tl(Pb)O + the Sr(Ba)O layers are then destroyed to cause the total structure to become amorphous-like. Furthermore, we have found that it is formed under an irradiation of highly energetic electrons.

  20. Amorphous-like interfacial layer between a high-T{sub c} superconducting Tl-1223 film and a Ag substrate examined by high-voltage high-resolution transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Bongjun; Kim, Hyuntak [Electronics and Tele-Communications Research Institute, Daejeon (Korea, Republic of); Nagai, Takuro; Matsui, Yoshio [National Institute for Materials Science, Tsukuba, Ibaraki (Japan); Horiuchi, Shigeo; Jeong, Daeyeong [Electrotechnology Research Institute, Changwon (Korea, Republic of); Deinhofer, Christian; Gritzner, Gerhard [Johannes Kepler University, Linz (Austria); Kim, Youngmin; Kim, Younjoong [Electron Microscopy Team, Korea Basic Science Institute, Daejeon (Korea, Republic of)

    2006-05-15

    The thin amorphous-like layer, formed at the interface between a high-T{sub c} superconducting (Tl{sub 0.5}, Pb{sub 0.5})(Sr{sub 0.8}, Ba{sub 0.2})Ca{sub 2}Cu{sub 3}O{sub y} (Tl-1223) film and a Ag substrate during heating at 910 .deg. C, has been examined by using high-voltage high-resolution transmission electron microscopy. The interfacial layer is less than 10 nm in thickness. It contacts the (001) plane of Tl-1223 and the (113) or (133) planes of Ag in most cases. Its composition is similar to that of Tl-1223, except for the inclusion of a substantial amount of Ag. Its formation proceeds by diffusion of Ag into Tl-1223, during which a structure change first occurs at the layer of CuO{sub 2} + Ca planes. The Tl(Pb)O + the Sr(Ba)O layers are then destroyed to cause the total structure to become amorphous-like. Furthermore, we have found that it is formed under an irradiation of highly energetic electrons.

  1. Supra-transmission and bistability in nonlinear media with a photonic and electronic forbidden band gap; Supratransmission et bistabilite nonlineaire dans les milieux a bandes interdites photoniques et electroniques

    Energy Technology Data Exchange (ETDEWEB)

    Chevriaux, D

    2007-06-15

    We study wave scattering in different nonlinear media possessing a natural forbidden band gap. In particular, we show the existence of a bistable behavior in media governed by the sine-Gordon equation (short pendular chain, Josephson junction array, quantum Hall bilayer), or the nonlinear Schroedinger equation (Kerr and Bragg media), in discrete and continuous models. These different media are submitted to periodic boundary conditions with a frequency in the forbidden band gap and an amplitude that determines their stability states. Indeed, for a sufficient amplitude (supra-transmission), the medium switches from reflector to transmitter, hence allowing the output signal to jump from evanescent to large values. We give a complete analytical description of the bistability that allows to understand the different stationary states observed and to predict the switch of one state to the other. (author)

  2. Parallel plate transmission line transformer

    NARCIS (Netherlands)

    Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.

    2011-01-01

    A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the

  3. Electric transmission technology

    International Nuclear Information System (INIS)

    Shah, K.R.

    1990-01-01

    Electric transmission technology has matured and can transmit bulk power more reliably and economically than the technology 10 years ago.In 1882, Marcel Depres transmitted 15 kW electric power at 2 kV, using a constant direct current; present transmission voltages have risen to ± 600 kV direct current (DC) and 765 kV alternating current (AC), and it is now possible to transmit bulk electric power at voltages as high as ± 1000 kV DC and 1500 kV AC. Affordable computer systems are now available to optimize transmission reliably. New materials have reduced the bulk of insulation for lines and equipment. New conducting materials and configurations have reduced losses in transmission. Advances in line structures and conductor motion, understanding of flashover characteristics of insulators and air-gaps and electrical performance of lines have resulted in more compact urban transmission lines. (author). 15 refs., 7 tabs., 11 figs

  4. Voltage-Controlled Floating Resistor Using DDCC

    Directory of Open Access Journals (Sweden)

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  5. Transmission positron microscopes

    International Nuclear Information System (INIS)

    Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki

    2006-01-01

    Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons

  6. High frequency relay protection channels on super high voltage lines

    Energy Technology Data Exchange (ETDEWEB)

    Mikutskii, G V

    1964-08-01

    General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.

  7. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  8. DGA-based VAR rescheduling for transmission loss reduction

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, S. [Indian Inst. of Technology, Delhi (India); Taylor, G.A. [Brunel Univ., London (United Kingdom). Brunel Inst. of Power Systems; Reddy, J.B.V. [Government of India, New Delhi (India). Dept. of Science and Technology; Naeem, M.H. [Multimedia Univ. (Malaysia). Faculty of Engineering

    2009-07-01

    Power losses in power transmission lines can be minimized by adjusting transformer taps and switchable VAR sources. Optimal power flow (OPF) is a static, nonlinear, multi-objective optimization challenge in which the optimal settings of control variables must be determined for minimizing the cost of generation, emissions, transmission losses and voltage and power flow deviations. OPF is important in power system operation because a small savings per hour can mean a large annual savings. This paper presented a method to reduce transmission power losses using a Differential Genetic Algorithm (DGA) for VAR rescheduling. The New England 39-bus power system was used as a test case. Power losses were minimized by changing the tap settings of various transformers and by varying the injected reactive power. The paper showed that certain buses in the system can improve the voltage profile and reduce transmission losses through reactive power injections from capacitor banks. In this study, minimum reactive power output of generators was maintained at zero to ensure that the generators did not draw reactive power. The DGA was shown to produce better results than the Conventional Genetic Algorithm in terms of power loss minimization. 12 refs., 1 tab., 2 figs.

  9. Harmonic current interaction at a low voltage customer's installations

    NARCIS (Netherlands)

    Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.

    2009-01-01

    The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low

  10. A Direct Voltage Unbalance Compensation Strategy for Islanded Microgrids

    DEFF Research Database (Denmark)

    Zhao, Xin; Wu, Xiaohua; Meng, Lexuan

    2015-01-01

    and nonlinear loads. Moreover, by adjusting voltage references according to the amplitude of the negative sequence voltage, the unbalance factor, which is mainly caused by single phase generators/loads, can be mitigated to an extremely low value. Finally, an AC microgrid which includes three three-phase three...

  11. Quantifying transition voltage spectroscopy of molecular junctions: Ab initio calculations

    DEFF Research Database (Denmark)

    Chen, Jingzhe; Markussen, Troels; Thygesen, Kristian Sommer

    2010-01-01

    Transition voltage spectroscopy (TVS) has recently been introduced as a spectroscopic tool for molecular junctions where it offers the possibility to probe molecular level energies at relatively low bias voltages. In this work we perform extensive ab initio calculations of the nonlinear current...

  12. Transmission line capital costs

    International Nuclear Information System (INIS)

    Hughes, K.R.; Brown, D.R.

    1995-05-01

    The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

  13. Nonlinear Source Emulator

    DEFF Research Database (Denmark)

    Nguyen-Duy, Khiem

    of a proposed NSE system with high dynamic performance. The goal of the work is to achieve a state-of-the art transient time of 10 µs. In order to produce the arbitrary nonlinear curve, the exponential function of a typical diode is used, but the diode can be replaced by other nonlinear curve reference...... of conductive common-mode current produced by the high rate of change of voltage over time (high dv/dt) at the NSE output. v/xvii The contributions of the thesis are based on the development of both units: the low Cio isolated power supply and the high dynamic performance NSE. Both units are investigated......-of-the-art dynamic performance among devices of the same kind. It also offers a complete solution for simulation of nonlinear source systems of different sizes, both in terrestrial and non-terrestrial applications. Key words: Current transformers, dc-dc power converters, hysteresis, parasitic capacitance, system...

  14. Response analysis on nonuniform transmission line

    Directory of Open Access Journals (Sweden)

    Cvetković Zlata

    2005-01-01

    Full Text Available Transients on a loss less exponential transmission line with a pure resistance load are presented in this paper. The approach is based on the two-port presentation of the transmission line. Using Picard-Carson's method the transmission line equations are solved. The relationship between source voltage and the load voltage in s-domain is derived. All the results are plotted using program package Mathematica 3.0.

  15. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  16. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  17. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  18. Alternative approaches to transmission investment

    Energy Technology Data Exchange (ETDEWEB)

    Welch, J.L. [International Transmission Co., Detroit, MI (United States)

    2004-07-01

    The International Transmission Company (ITC) is an independent power transmission company that owns, operates and maintains the high voltage transmission system in southeastern Michigan. The company's current focus is on investing in the transmission infrastructure to improve reliability, relieve congestion, improve access to generation and reduce energy costs for consumers. There is a need for investment in power transmission. Trends indicate that power transactions are on the rise while transmission investment is lagging because pricing protocols are inadequate and there is no regional tariff mechanism to allocate the benefits of new investment. The presentation reviewed the applicability of FTRs to transmission owners and the pitfalls of participant funding pricing. It also outlined the regional benefit allocation mechanism (RBAM) with an illustrative example. It was concluded that existing pricing policies must be improved to address the growing need for transmission investment. RBAM is needed to help investors recover costs from project beneficiaries. figs.

  19. Nonlinear optics

    International Nuclear Information System (INIS)

    Boyd, R.W.

    1992-01-01

    Nonlinear optics is the study of the interaction of intense laser light with matter. This book is a textbook on nonlinear optics at the level of a beginning graduate student. The intent of the book is to provide an introduction to the field of nonlinear optics that stresses fundamental concepts and that enables the student to go on to perform independent research in this field. This book covers the areas of nonlinear optics, quantum optics, quantum electronics, laser physics, electrooptics, and modern optics

  20. Stochastic reactive power market with volatility of wind power considering voltage security

    International Nuclear Information System (INIS)

    Kargarian, A.; Raoofat, M.

    2011-01-01

    While wind power generation is growing rapidly around the globe; its stochastic nature affects the system operation in many different aspects. In this paper, the impact of wind power volatility on the reactive power market is taken into account. The paper presents a novel stochastic method for optimal reactive power market clearing considering voltage security and volatile nature of the wind. The proposed optimization algorithm uses a multiobjective nonlinear programming technique to minimize market payment and simultaneously maximize voltage security margin. Considering a set of probable wind speeds, in the first stage, the proposed algorithm seeks to minimize expected system payment which is summation of reactive power payment and transmission loss cost. The object of the second stage is maximization of expected voltage security margin to increase the system loadability and security. Finally, in the last stage, a multiobjective function is presented to schedule the stochastic reactive power market using results of two previous stages. The proposed algorithm is applied to IEEE 14-bus test system. As a benchmark, Monte Carlo Simulation method is utilized to simulate the actual market of given period of time to evaluate results of the proposed algorithm, and satisfactory results are achieved. -- Highlights: →The paper proposes a new algorithm for stochastic reactive power market clearing. →The stochastic nature of the wind which impacts the system operation and market clearing process, is taken into account. →The paper suggests an expected voltage stability margin and optimizes it in conjunction with expected total market payment. →To clear the market with two mentioned objective functions, a three-stage multiobjective nonlinear programming is implemented. →Also, a simple method is suggested to determine a suitable priority coefficient between two individual objective functions.

  1. Microwave integrated circuit for Josephson voltage standards

    Science.gov (United States)

    Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)

    1980-01-01

    A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.

  2. Nonlinear optics

    CERN Document Server

    Bloembergen, Nicolaas

    1996-01-01

    Nicolaas Bloembergen, recipient of the Nobel Prize for Physics (1981), wrote Nonlinear Optics in 1964, when the field of nonlinear optics was only three years old. The available literature has since grown by at least three orders of magnitude.The vitality of Nonlinear Optics is evident from the still-growing number of scientists and engineers engaged in the study of new nonlinear phenomena and in the development of new nonlinear devices in the field of opto-electronics. This monograph should be helpful in providing a historical introduction and a general background of basic ideas both for expe

  3. A high-voltage pulse generator for corona plasma generation

    NARCIS (Netherlands)

    Yan, K.; Heesch, van E.J.M.; Pemen, A.J.M.; Huijbrechts, P.A.H.J.; Gompel, van F.M.; Leuken, van H.E.M.; Matyas, Z.

    2002-01-01

    This paper discusses a high-voltage pulse generator for producing corona plasma. The generator consists of three resonant charging circuits, a transmission line transformer, and a triggered spark-gap switch. Voltage pulses in the order of 30-100 kV with a rise time of 10-20 ns, a pulse duration of

  4. DEVELOPMENT AND INVESTIGATION OF LAYOUT OF ACTIVE SCREENING SYSTEM OF THE MAGNETIC FIELD GENERATED BY GROUP OF OVERHEAD TRANSMISSION LINES

    Directory of Open Access Journals (Sweden)

    B. I. Kuznetsov

    2018-04-01

    Full Text Available Purpose. Development and field experimental research of layout of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area is given. Methodology. Mathematical model of magnetic field, generated by group of high voltage transmission lines in residential area, based of the experimental values of magnetic field flux density in given points on the basis of optimization problem solving is improved. The objective of the synthesis of the single circuit active screening system is to determine their number, configuration, spatial arrangement, wiring diagrams and compensation cables currents, setting algorithm of the control systems as well as the resulting value of the magnetic flux density at the points of the protected space. Synthesis of the full-scale model of active screening system is reduced to the problem of multiobjective nonlinear programming with constraints in which calculation of the objective functions and constraints are carried out on the basis of the Maxwell equations solutions in the quasi-stationary approximation. The problem is solved by a stochastic multiswarm multi-agent particles optimization. Results. The single-circuit active screening system synthesis results for reduction of a magnetic field generated by group of high voltage transmission lines in residential area is given. Field experimental researches of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area with various control algorithms is given. Originality. For the first time out the development and field experimental studies of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area are carried out. Practical value. Practical recommendations on reasonable choice of the spatial arrangement of compensating cables of single

  5. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  6. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  7. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  8. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  9. Nonlinear Science

    CERN Document Server

    Yoshida, Zensho

    2010-01-01

    This book gives a general, basic understanding of the mathematical structure "nonlinearity" that lies in the depths of complex systems. Analyzing the heterogeneity that the prefix "non" represents with respect to notions such as the linear space, integrability and scale hierarchy, "nonlinear science" is explained as a challenge of deconstruction of the modern sciences. This book is not a technical guide to teach mathematical tools of nonlinear analysis, nor a zoology of so-called nonlinear phenomena. By critically analyzing the structure of linear theories, and cl

  10. Nonlinear oscillations

    CERN Document Server

    Nayfeh, Ali Hasan

    1995-01-01

    Nonlinear Oscillations is a self-contained and thorough treatment of the vigorous research that has occurred in nonlinear mechanics since 1970. The book begins with fundamental concepts and techniques of analysis and progresses through recent developments and provides an overview that abstracts and introduces main nonlinear phenomena. It treats systems having a single degree of freedom, introducing basic concepts and analytical methods, and extends concepts and methods to systems having degrees of freedom. Most of this material cannot be found in any other text. Nonlinear Oscillations uses sim

  11. High-voltage test and measuring techniques

    CERN Document Server

    Hauschild, Wolfgang

    2014-01-01

    It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

  12. Square-Wave Voltage Injection Algorithm for PMSM Position Sensorless Control With High Robustness to Voltage Errors

    DEFF Research Database (Denmark)

    Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede

    2017-01-01

    relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...

  13. Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

    DEFF Research Database (Denmark)

    Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

    2004-01-01

    power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

  14. High-output microwave detector using voltage-induced ferromagnetic resonance

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji

    2014-01-01

    We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque

  15. Nonlinear systems

    CERN Document Server

    Palmero, Faustino; Lemos, M; Sánchez-Rey, Bernardo; Casado-Pascual, Jesús

    2018-01-01

    This book presents an overview of the most recent advances in nonlinear science. It provides a unified view of nonlinear properties in many different systems and highlights many  new developments. While volume 1 concentrates on mathematical theory and computational techniques and challenges, which are essential for the study of nonlinear science, this second volume deals with nonlinear excitations in several fields. These excitations can be localized and transport energy and matter in the form of breathers, solitons, kinks or quodons with very different characteristics, which are discussed in the book. They can also transport electric charge, in which case they are known as polarobreathers or solectrons. Nonlinear excitations can influence function and structure in biology, as for example, protein folding. In crystals and other condensed matter, they can modify transport properties, reaction kinetics and interact with defects. There are also engineering applications in electric lattices, Josephson junction a...

  16. Modelling, stability and control of voltage behaviour in power supply systems

    Energy Technology Data Exchange (ETDEWEB)

    Hill, David J [Sydney Univ., NSW (Australia). Dept. of Electrical Engineering; Hisken, Ian A [Newcastle Univ., NSW (Australia). Dept. of Electrical and Computer Engineering

    1994-12-31

    This paper gives an overview of a line of work on mid to long term voltages stability analysis and control in power systems. The results are based on use of a novel approach to dynamic load modelling using aggregate nonlinear structures. In general, the model for the transmission network and supply end dynamics is of the hybrid differential - algebraic - discrete kind. Various stability questions are precisely formulated and analysed in terms of network and load characteristics (steady-state and transient). The results are shown to be a useful framework for deriving criteria of the where, when and how much kind for various control actions such as load Thedding and tap-blocking. (author) 47 refs., 15 figs., 1 tab.

  17. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  18. Reduction of Voltage Harmonics for Parallel-operated Inverters

    DEFF Research Database (Denmark)

    Zhong, Qing-Chang; Blaabjerg, Frede; Guerrero, Josep M.

    2011-01-01

    The inherent limitations of the conventional droop control scheme have recently been revealed and a robust droop controller to achieve exact proportional load sharing has been proposed. This paper continues the work with a strategy to improve the voltage quality so that the total harmonic...... distortion of the output voltage can be maintained small even when nonlinear loads are connected. Experimental results are provided to verify the analysis and design....

  19. Formation of 1.4 MeV runaway electron flows in air using a solid-state generator with 10 MV/ns voltage rise rate

    Science.gov (United States)

    Mesyats, G. A.; Pedos, M. S.; Rukin, S. N.; Rostov, V. V.; Romanchenko, I. V.; Sadykova, A. G.; Sharypov, K. A.; Shpak, V. G.; Shunailov, S. A.; Ul'masculov, M. R.; Yalandin, M. I.

    2018-04-01

    Fulfillment of the condition that the voltage rise time across an air gap is comparable with the time of electron acceleration from a cathode to an anode allows a flow of runaway electrons (REs) to be formed with relativistic energies approaching that determined by the amplitude of the voltage pulse. In the experiment described here, an RE energy of 1.4 MeV was observed by applying a negative travelling voltage pulse of 860-kV with a maximum rise rate of 10 MV/ns and a rise time of 100-ps. The voltage pulse amplitude was doubled at the cathode of the 2-cm-long air gap due to the delay of conventional pulsed breakdown. The above-mentioned record-breaking voltage pulse of ˜120 ps duration with a peak power of 15 GW was produced by an all-solid-state pulsed power source utilising pulse compression/sharpening in a multistage gyromagnetic nonlinear transmission line.

  20. Neuroglial Transmission

    DEFF Research Database (Denmark)

    Gundersen, Vidar; Storm-Mathisen, Jon; Bergersen, Linda Hildegard

    2015-01-01

    as a signaling substance recently shown to act on specific lactate receptors in the brain. Complementing neurotransmission at a synapse, neuroglial transmission often implies diffusion of the transmitter over a longer distance and concurs with the concept of volume transmission. Transmission from glia modulates...... synaptic neurotransmission based on energetic and other local conditions in a volume of tissue surrounding the individual synapse. Neuroglial transmission appears to contribute significantly to brain functions such as memory, as well as to prevalent neuropathologies....

  1. Nonlinear optics

    CERN Document Server

    Boyd, Robert W

    2013-01-01

    Nonlinear Optics is an advanced textbook for courses dealing with nonlinear optics, quantum electronics, laser physics, contemporary and quantum optics, and electrooptics. Its pedagogical emphasis is on fundamentals rather than particular, transitory applications. As a result, this textbook will have lasting appeal to a wide audience of electrical engineering, physics, and optics students, as well as those in related fields such as materials science and chemistry.Key Features* The origin of optical nonlinearities, including dependence on the polarization of light* A detailed treatment of the q

  2. Coplanar strips for Josephson voltage standard circuits

    International Nuclear Information System (INIS)

    Schubert, M.; May, T.; Wende, G.; Fritzsch, L.; Meyer, H.-G.

    2001-01-01

    We present a microwave circuit for Josephson voltage standards. Here, the Josephson junctions are integrated in a microwave transmission line designed as coplanar strips (CPS). The new layout offers the possibility of achieving a higher scale of integration and to considerably simplify the fabrication technology. The characteristic impedance of the CPS is about 50 Ω, and this should be of interest for programmable Josephson voltage standard circuits with SNS or SINIS junctions. To demonstrate the function of the microwave circuit design, conventional 10 V Josephson voltage standard circuits with 17000 Nb/AlO x /Nb junctions were prepared and tested. Stable Shapiro steps at the 10 V level were generated. Furthermore, arrays of 1400 SINIS junctions in this microwave layout exhibited first-order Shapiro steps. Copyright 2001 American Institute of Physics

  3. Voltage control of cavity magnon polariton

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, S., E-mail: kaurs3@myumanitoba.ca; Rao, J. W.; Gui, Y. S.; Hu, C.-M., E-mail: hu@physics.umanitoba.ca [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); Yao, B. M. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); National Laboratory for Infrared Physics, Chinese Academy of Sciences, Shanghai 200083 (China)

    2016-07-18

    We have experimentally investigated the microwave transmission of the cavity-magnon-polariton (CMP) generated by integrating a low damping magnetic insulator onto a 2D microwave cavity. The high tunability of our planar cavity allows the cavity resonance frequency to be precisely controlled using a DC voltage. By appropriately tuning the voltage and magnetic bias, we can observe the cavity photon magnon coupling and the magnetic coupling between a magnetostatic mode and the generated CMP. The dispersion of the generated CMP was measured by either tuning the magnetic field or the applied voltage. This electrical control of CMP may open up avenues for designing advanced on-chip microwave devices that utilize light-matter interaction.

  4. Semisupervised Community Detection by Voltage Drops

    Directory of Open Access Journals (Sweden)

    Min Ji

    2016-01-01

    Full Text Available Many applications show that semisupervised community detection is one of the important topics and has attracted considerable attention in the study of complex network. In this paper, based on notion of voltage drops and discrete potential theory, a simple and fast semisupervised community detection algorithm is proposed. The label propagation through discrete potential transmission is accomplished by using voltage drops. The complexity of the proposal is OV+E for the sparse network with V vertices and E edges. The obtained voltage value of a vertex can be reflected clearly in the relationship between the vertex and community. The experimental results on four real networks and three benchmarks indicate that the proposed algorithm is effective and flexible. Furthermore, this algorithm is easily applied to graph-based machine learning methods.

  5. Photonic surfaces for designable nonlinear power shaping

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Roshni, E-mail: rbiswas@usc.edu; Povinelli, Michelle L. [Ming Hsieh Department of Electrical Engineering, University of Southern California, Los Angeles, California 90089 (United States)

    2015-02-09

    We propose a method for designing nonlinear input-output power response based on absorptive resonances of nanostructured surfaces. We show that various power transmission trends can be obtained by placing a photonic resonance mode at the appropriate detuning from the laser wavelength. We demonstrate our results in a silicon photonic crystal slab at a laser wavelength of 808 nm. We quantify the overall spectral red shift as a function of laser power. The shift results from absorptive heating and the thermo-optic effect. We then demonstrate devices with increasing, decreasing, and non-monotonic transmission as a function of laser power. The transmission changes are up to 7.5 times larger than in unpatterned silicon. The strong nonlinear transmission is due to a combination of resonantly enhanced absorption, reduced thermal conductivity, and the resonant transmission lineshape. Our results illustrate the possibility of designing different nonlinear power trends within a single materials platform at a given wavelength of interest.

  6. Photonic surfaces for designable nonlinear power shaping

    International Nuclear Information System (INIS)

    Biswas, Roshni; Povinelli, Michelle L.

    2015-01-01

    We propose a method for designing nonlinear input-output power response based on absorptive resonances of nanostructured surfaces. We show that various power transmission trends can be obtained by placing a photonic resonance mode at the appropriate detuning from the laser wavelength. We demonstrate our results in a silicon photonic crystal slab at a laser wavelength of 808 nm. We quantify the overall spectral red shift as a function of laser power. The shift results from absorptive heating and the thermo-optic effect. We then demonstrate devices with increasing, decreasing, and non-monotonic transmission as a function of laser power. The transmission changes are up to 7.5 times larger than in unpatterned silicon. The strong nonlinear transmission is due to a combination of resonantly enhanced absorption, reduced thermal conductivity, and the resonant transmission lineshape. Our results illustrate the possibility of designing different nonlinear power trends within a single materials platform at a given wavelength of interest

  7. High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC

    Science.gov (United States)

    Lizcano, M.

    2017-01-01

    High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.

  8. Nonlinear systems

    National Research Council Canada - National Science Library

    Drazin, P. G

    1992-01-01

    This book is an introduction to the theories of bifurcation and chaos. It treats the solution of nonlinear equations, especially difference and ordinary differential equations, as a parameter varies...

  9. Nonlinear analysis

    CERN Document Server

    Gasinski, Leszek

    2005-01-01

    Hausdorff Measures and Capacity. Lebesgue-Bochner and Sobolev Spaces. Nonlinear Operators and Young Measures. Smooth and Nonsmooth Analysis and Variational Principles. Critical Point Theory. Eigenvalue Problems and Maximum Principles. Fixed Point Theory.

  10. Direct harmonic voltage control strategy for shunt active power filter

    DEFF Research Database (Denmark)

    Munir, Hafiz Mudassir; Zou, JianXiao; Xie, Chuan

    2017-01-01

    generation system (DPGS) where the nonlinear loads are highly dispersed. Local harmonic voltage detection based Resistive-APF (R-APF) seems more suitable to be applied in the DPGS, however, R-APF suffers from poor compensation performance and difficulty of parameter tuning. In this paper, a direct harmonic...... voltage control strategy for the S-APF is proposed with local point of common coupling (PCC) voltage detection only. The control strategy design procedure is given in detail. Simulation is conducted in Matlab/Simulink to compare the performance between the R-APF and the proposed method. The results...

  11. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  12. 76 FR 79206 - Commercial Renewable Energy Transmission on the Outer Continental Shelf (OCS) Offshore Mid...

    Science.gov (United States)

    2011-12-21

    ...-circuit, high-voltage direct current (HVDC) transmission line that would collect power generated by wind...-voltage alternating current into HVDC using voltage sourced converters. Each offshore converter platform... transmission grid at up to seven locations where AWC terrestrial converter stations would convert the HVDC...

  13. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  14. Method for conducting nonlinear electrochemical impedance spectroscopy

    Science.gov (United States)

    Adler, Stuart B.; Wilson, Jamie R.; Huff, Shawn L.; Schwartz, Daniel T.

    2015-06-02

    A method for conducting nonlinear electrochemical impedance spectroscopy. The method includes quantifying the nonlinear response of an electrochemical system by measuring higher-order current or voltage harmonics generated by moderate-amplitude sinusoidal current or voltage perturbations. The method involves acquisition of the response signal followed by time apodization and fast Fourier transformation of the data into the frequency domain, where the magnitude and phase of each harmonic signal can be readily quantified. The method can be implemented on a computer as a software program.

  15. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  16. Effect of localized states on the current-voltage characteristics of metal-semiconductor contacts with thin interfacial layer

    Science.gov (United States)

    Chattopadhyay, P.

    1994-10-01

    The role of discrete localized states on the current-voltage characteristics of metal-semiconductor contact is examined. It is seen that, because of these localized states, the logarithmic current vs voltage characteristics become nonlinear. Such nonlinearity is found sensitive to the temperature, and the energy and density of the localized states. The predicted temperature dependence of barrier height and the current-voltage characteristics are in agreement with the experimental results of Aboelfotoh [ Phys. Rev. B39, 5070 (1989)].

  17. LED-Based High-Voltage Lines Warning System

    Directory of Open Access Journals (Sweden)

    Eldar MUSA

    2013-04-01

    Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

  18. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  19. Topology optimization of nonlinear optical devices

    DEFF Research Database (Denmark)

    Jensen, Jakob Søndergaard

    2011-01-01

    This paper considers the design of nonlinear photonic devices. The nonlinearity stems from a nonlinear material model with a permittivity that depends on the local time-averaged intensity of the electric field. A finite element model is developed for time-harmonic wave propagation and an incremen......This paper considers the design of nonlinear photonic devices. The nonlinearity stems from a nonlinear material model with a permittivity that depends on the local time-averaged intensity of the electric field. A finite element model is developed for time-harmonic wave propagation...... limiter. Here, air, a linear and a nonlinear material are distributed so that the wave transmission displays a strong sensitivity to the amplitude of the incoming wave....

  20. A comprehensive analysis and hardware implementation of control strategies for high output voltage DC-DC boost power converter

    OpenAIRE

    Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel

    2017-01-01

    Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...

  1. Public participation in planning procedures for the expansion of extra-high voltage transmission systems under the Energy Economy Law and the Law for Accelerated Network Expansion for Transmission Systems; Buergerbeteiligung in den Planungsverfahren zum Hoechstspannungsnetzausbau nach EnWG und NABEG

    Energy Technology Data Exchange (ETDEWEB)

    Weingarten, Elke; Peters, Wolfgang [Bosch and Partner GmbH, Berlin (Germany); Mueller-Pfannenstiel, Klaus [Bosch and Partner GmbH, Herne (Germany)

    2013-05-15

    The energy turnaround necessitates an expansion of the existing power transmission grid on a large scale and within a very short time frame. These measures will in all probability not be realisable without incurring conflicts with citizens affected by them. The topic of public participation should therefore be given very high priority from the very beginning of grid construction planning by systematically providing opportunities for citizens as representatives of the public at large to participate in decision making processes.

  2. Regional transmission subsystem planning

    Energy Technology Data Exchange (ETDEWEB)

    Costa Bortoni, Edson da [Quadrante Softwares Especializados Ltda., Itajuba, MG (Brazil); Bajay, Sergio Valdir; Barros Correia, Paulo de [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Santos, Afonso Henriques Moreira; Haddad, Jamil [Escola Federal de Engenharia de Itajuba, MG (Brazil)

    1994-12-31

    This work presents an approach for the planning of transmission systems by employing mixed--integer linear programming to obtain a cost and operating characteristics optimized system. The voltage loop equations are written in a modified form, so that, at the end of the analysis, the model behaves as a DC power flow, with the help of the two Kirchhoff`s laws, exempting the need of interaction with an external power flow program for analysis of the line loading. The model considers the occurrence of contingencies, so that the final result is a network robust to the most severe contingencies. This whole technique is adapted to the regional electric power transmission subsystems. (author) 9 refs., 4 figs.

  3. Current-voltage model of LED light sources

    DEFF Research Database (Denmark)

    Beczkowski, Szymon; Munk-Nielsen, Stig

    2012-01-01

    Amplitude modulation is rarely used for dimming light-emitting diodes in polychromatic luminaires due to big color shifts caused by varying magnitude of LED driving current and nonlinear relationship between intensity of a diode and driving current. Current-voltage empirical model of light...

  4. Transmission issues

    International Nuclear Information System (INIS)

    Bradford, J.; Wilson, L.; Thon, S.; Millar, N.

    2005-01-01

    This session on transmission issues focused on the role that transmission plays in electricity markets and the importance of getting the market structure right in terms of generation divestiture with buy back contracts, demand side responsive programs, transmission upgrades and long term contracts. The difficulties of distinguishing between market power and scarcity were examined along with some of the complications that ensue if transmission experiences congestion, as exemplified by the August 2003 blackout in eastern North America. The presentations described the best ways to handle transmission issues, and debated whether transmission should be deregulated or follow market forces. Issues of interconnections and reliability of connections were also debated along with the attempt to integrate renewables into the grid. Some presentations identified what new transmission must be built and what must be done to ensure that transmission gets built. The challenges and business opportunities for transmission in Alberta were discussed with reference to plans to invest in new infrastructure, where it is going outside of the province and how it works with other jurisdictions. Manitoba's Conawapa Hydro Project and its 2000 MW tie line to Ontario was also discussed. Some examples of non-optimal use of interconnections in Europe were also discussed in an effort to learn from these mistakes and avoid them in Canada. tabs., figs

  5. Coiled transmission line pulse generators

    Science.gov (United States)

    McDonald, Kenneth Fox

    2010-11-09

    Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

  6. Nonlinear optimization

    CERN Document Server

    Ruszczynski, Andrzej

    2011-01-01

    Optimization is one of the most important areas of modern applied mathematics, with applications in fields from engineering and economics to finance, statistics, management science, and medicine. While many books have addressed its various aspects, Nonlinear Optimization is the first comprehensive treatment that will allow graduate students and researchers to understand its modern ideas, principles, and methods within a reasonable time, but without sacrificing mathematical precision. Andrzej Ruszczynski, a leading expert in the optimization of nonlinear stochastic systems, integrates the theory and the methods of nonlinear optimization in a unified, clear, and mathematically rigorous fashion, with detailed and easy-to-follow proofs illustrated by numerous examples and figures. The book covers convex analysis, the theory of optimality conditions, duality theory, and numerical methods for solving unconstrained and constrained optimization problems. It addresses not only classical material but also modern top...

  7. Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

    DEFF Research Database (Denmark)

    Micallef, A.; Apap, M.; Spitero-Stanies, C.

    2012-01-01

    This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

  8. Non-linear thermal fluctuations in a diode

    NARCIS (Netherlands)

    Kampen, N.G. van

    As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being

  9. A model for voltage collapse study considering load characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, L B [Companhia de Energia Eletrica da Bahia (COELBA), Salvador, BA (Brazil)

    1994-12-31

    This paper presents a model for analysis of voltage collapse and instability problem considering the load characteristics. The model considers fundamentally the transmission lines represented by exact from through the generalized constants A, B, C, D and the loads as function of the voltage, emphasizing the cases of constant power, constant current and constant impedance. the study treats of the system behavior on steady state and presents illustrative graphics about the problem. (author) 12 refs., 4 figs.

  10. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  11. Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity

    Directory of Open Access Journals (Sweden)

    John H. Miller Jr.

    2011-04-01

    Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.

  12. Nonlinear dynamics of capacitive charging and desalination by porous electrodes

    Science.gov (United States)

    Biesheuvel, P. M.; Bazant, M. Z.

    2010-03-01

    The rapid and efficient exchange of ions between porous electrodes and aqueous solutions is important in many applications, such as electrical energy storage by supercapacitors, water desalination and purification by capacitive deionization, and capacitive extraction of renewable energy from a salinity difference. Here, we present a unified mean-field theory for capacitive charging and desalination by ideally polarizable porous electrodes (without Faradaic reactions or specific adsorption of ions) valid in the limit of thin double layers (compared to typical pore dimensions). We illustrate the theory for the case of a dilute, symmetric, binary electrolyte using the Gouy-Chapman-Stern (GCS) model of the double layer, for which simple formulae are available for salt adsorption and capacitive charging of the diffuse part of the double layer. We solve the full GCS mean-field theory numerically for realistic parameters in capacitive deionization, and we derive reduced models for two limiting regimes with different time scales: (i) in the “supercapacitor regime” of small voltages and/or early times, the porous electrode acts like a transmission line, governed by a linear diffusion equation for the electrostatic potential, scaled to the RC time of a single pore, and (ii) in the “desalination regime” of large voltages and long times, the porous electrode slowly absorbs counterions, governed by coupled, nonlinear diffusion equations for the pore-averaged potential and salt concentration.

  13. Planning aspects of ac extra high voltage lines

    Energy Technology Data Exchange (ETDEWEB)

    Engelhardt, H

    1964-01-01

    The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

  14. Mitigation of Flicker using STATCOM with Three-Level 12-pulse Voltage Source Inverter

    OpenAIRE

    Ali Z a'fari

    2011-01-01

    Voltage flicker is a disturbance in electrical power systems. The reason for this disturbance is mainly the large nonlinear loads such as electric arc furnaces. Synchronous static compensator (STATCOM) is considered as a proper technique to mitigate the voltage flicker. Application of more suitable and precise power electronic converter leads to a more precise performance of the compensator. In this paper a three-level 12-pulse voltage source inverter (VSI) with a 12-term...

  15. Giant, Voltage-Actuated Deformation of a Dielectric Elastomer under Dead Load

    OpenAIRE

    Huang, Jiangshui; Li, Tiefeng; Foo, Choon Chiang; Clarke, David R.; Zhu, Jian; Suo, Zhigang

    2012-01-01

    Far greater voltage-actuated deformation is achievable for a dielectric elastomer under equal-biaxial dead load than under rigid constraint usually employed. Areal strains of 488% are demonstrated. The dead load suppresses electric breakdown, enabling the elastomer to survive the snap-through electromechanical instability. The breakdown voltage is found to increase with the voltage ramp rate. A nonlinear model for viscoelastic dielectric elastomers is developed and shown to be consistent with...

  16. Transmission Line Series Compensation for Wind Energy Transmission

    International Nuclear Information System (INIS)

    Palanichamy, C; Wong, Y C

    2015-01-01

    Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)

  17. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  18. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  19. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  20. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  1. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  2. Local Dynamic Reactive Power for Correction of System Voltage Problems

    Energy Technology Data Exchange (ETDEWEB)

    Kueck, John D [ORNL; Rizy, D Tom [ORNL; Li, Fangxing [ORNL; Xu, Yan [ORNL; Li, Huijuan [University of Tennessee, Knoxville (UTK); Adhikari, Sarina [ORNL; Irminger, Philip [ORNL

    2008-12-01

    Distribution systems are experiencing outages due to a phenomenon known as local voltage collapse. Local voltage collapse is occurring in part because modern air conditioner compressor motors are much more susceptible to stalling during a voltage dip than older motors. These motors can stall in less than 3 cycles (.05s) when a fault, such as on the sub-transmission system, causes voltage to sag to 70 to 60%. The reasons for this susceptibility are discussed in the report. During the local voltage collapse, voltages are depressed for a period of perhaps one or two minutes. There is a concern that these local events are interacting together over larger areas and may present a challenge to system reliability. An effective method of preventing local voltage collapse is the use of voltage regulation from Distributed Energy Resources (DER) that can supply or absorb reactive power. DER, when properly controlled, can provide a rapid correction to voltage dips and prevent motor stall. This report discusses the phenomenon and causes of local voltage collapse as well as the control methodology we have developed to counter voltage sag. The problem is growing because of the use of low inertia, high efficiency air conditioner (A/C) compressor motors and because the use of electric A/C is growing in use and becoming a larger percentage of system load. A method for local dynamic voltage regulation is discussed which uses reactive power injection or absorption from local DER. This method is independent, rapid, and will not interfere with conventional utility system voltage control. The results of simulations of this method are provided. The method has also been tested at the ORNL s Distributed Energy Communications and Control (DECC) Laboratory using our research inverter and synchronous condenser. These systems at the DECC Lab are interconnected to an actual distribution system, the ORNL distribution system, which is fed from TVA s 161kV sub-transmission backbone. The test results

  3. Quantifying Transmission.

    Science.gov (United States)

    Woolhouse, Mark

    2017-07-01

    Transmissibility is the defining characteristic of infectious diseases. Quantifying transmission matters for understanding infectious disease epidemiology and designing evidence-based disease control programs. Tracing individual transmission events can be achieved by epidemiological investigation coupled with pathogen typing or genome sequencing. Individual infectiousness can be estimated by measuring pathogen loads, but few studies have directly estimated the ability of infected hosts to transmit to uninfected hosts. Individuals' opportunities to transmit infection are dependent on behavioral and other risk factors relevant given the transmission route of the pathogen concerned. Transmission at the population level can be quantified through knowledge of risk factors in the population or phylogeographic analysis of pathogen sequence data. Mathematical model-based approaches require estimation of the per capita transmission rate and basic reproduction number, obtained by fitting models to case data and/or analysis of pathogen sequence data. Heterogeneities in infectiousness, contact behavior, and susceptibility can have substantial effects on the epidemiology of an infectious disease, so estimates of only mean values may be insufficient. For some pathogens, super-shedders (infected individuals who are highly infectious) and super-spreaders (individuals with more opportunities to transmit infection) may be important. Future work on quantifying transmission should involve integrated analyses of multiple data sources.

  4. 75 FR 63826 - Transmission Infrastructure Program-TransWest Express Transmission Project Capacity

    Science.gov (United States)

    2010-10-18

    ... Administration (Western), a Federal power marketing administration of the United States Department of Energy (DOE... operates an integrated 17,000 circuit mile, high-voltage transmission system across 15 western states... transmission lines and related facilities with at least one terminus in Western's marketing area, that deliver...

  5. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  6. High-voltage direct-current circuit breakers

    International Nuclear Information System (INIS)

    Yoshioka, Y.; Hirasawa, K.

    1991-01-01

    This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system

  7. Force transmissibility versus displacement transmissibility

    Science.gov (United States)

    Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

    2014-10-01

    It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

  8. Improving the Energy Market: Algorithms, Market Implications, and Transmission Switching

    Science.gov (United States)

    Lipka, Paula Ann

    corresponding to the accuracy and AC-feasiblity of the solution. This linearization was tested on the IEEE and Polish systems, which range from 14 to 3375 buses and 20 to 4161 transmission lines. It had an accuracy of 0.5% or less for all but the 30-bus system. It also solved in linear time with CPLEX, while the non-linear version solved in O(n1.11) to O(n1.39). The sequential linearization is slower than the nonlinear formulation for smaller problems, but faster for larger problems, and its linear computational time means it would continue solving faster for larger problems. A major consideration to implementing algorithms to solve the optimal generator dispatch is ensuring that the resulting prices from the algorithm will support the market. Since the sequential linearization is linear, it is convex, its marginal values are well-defined, and there is no duality gap. The prices and settlements obtained from the sequential linearization therefore can be used to run a market. This market will include extra prices and settlements for reactive power and voltage, compared to the present-day market, which is based on real power. An advantage of this is that there is a very clear pool that can be used for reactive power/voltage support payments, while presently there is not a clear pool to take them out of. This method also reveals how valuable reactive power and voltage are at different locations, which can enable better planning of reactive resource construction. Transmission switching increases the feasible region of the generator dispatch, which means there may be a better solution than without transmission switching. Power flows on transmission lines are not directly controllable; rather, the power flows according to how it is injected and the physical characteristics of the lines. Changing the network topology changes the physical characteristics, which changes the flows. This means that sets of generator dispatch that may have previously been infeasible due to the flow

  9. Data transmission

    National Research Council Canada - National Science Library

    Tugal, Dogan A; Tugal, Osman

    1989-01-01

    This updated second edition provides working answers to today's critical questions about designing and managing all types of data transmission systems and features a new chapter on local area networks (LANs...

  10. Atlas transmission line breakdown analysis

    CERN Document Server

    Nielsen, K E; Ballard, E O; Elizondo, J M; Gribble, R F; McCuistian, B T; Parsons, W M

    1999-01-01

    The Atlas facility will use 24 radially converging, vertically oriented and tapered, oil insulated, triplate transmission lines between the Marx generators and the central load region. Among the requirements of the transmission lines are low inductance and high reliability. The inter-conductor gap is nominally 2 cm and the lines taper from a height of 1.75 m at the Marx end to 0.32 m at the output end. The aluminum conductors, held together by 20 insulating spacers, are assembled and inserted as a unit into radial oil-filled steel tanks. The negative, high-voltage, center conductor is 2.54-cm thick and the outer ground conductors are 1.59-cm thick. All 24 triplate transmission lines connect to a transition section at near 1 m radius that couples the transmission lines to a disk/conical solid- dielectric-insulated power flow channel transmission line terminating at the load. Peak operating voltage on the lines can be as high as 240 kV with an effective stress time of 0.8 mu s. Testing of small sections of the ...

  11. Nonlinear behaviour of cantilevered carbon nanotube resonators based on a new nonlinear electrostatic load model

    Science.gov (United States)

    Farokhi, Hamed; Païdoussis, Michael P.; Misra, Arun K.

    2018-04-01

    The present study examines the nonlinear behaviour of a cantilevered carbon nanotube (CNT) resonator and its mass detection sensitivity, employing a new nonlinear electrostatic load model. More specifically, a 3D finite element model is developed in order to obtain the electrostatic load distribution on cantilevered CNT resonators. A new nonlinear electrostatic load model is then proposed accounting for the end effects due to finite length. Additionally, a new nonlinear size-dependent continuum model is developed for the cantilevered CNT resonator, employing the modified couple stress theory (to account for size-effects) together with the Kelvin-Voigt model (to account for nonlinear damping); the size-dependent model takes into account all sources of nonlinearity, i.e. geometrical and inertial nonlinearities as well as nonlinearities associated with damping, small-scale, and electrostatic load. The nonlinear equation of motion of the cantilevered CNT resonator is obtained based on the new models developed for the CNT resonator and the electrostatic load. The Galerkin method is then applied to the nonlinear equation of motion, resulting in a set of nonlinear ordinary differential equations, consisting of geometrical, inertial, electrical, damping, and size-dependent nonlinear terms. This high-dimensional nonlinear discretized model is solved numerically utilizing the pseudo-arclength continuation technique. The nonlinear static and dynamic responses of the system are examined for various cases, investigating the effect of DC and AC voltages, length-scale parameter, nonlinear damping, and electrostatic load. Moreover, the mass detection sensitivity of the system is examined for possible application of the CNT resonator as a nanosensor.

  12. Dual design resistor for high voltage conditioning and transmission lines

    Science.gov (United States)

    Siggins, Timothy Lynn [Newport News, VA; Murray, Charles W [Hayes, VA; Walker, Richard L [Norfolk, VA

    2007-01-23

    A dual resistor for eliminating the requirement for two different value resistors. The dual resistor includes a conditioning resistor at a high resistance value and a run resistor at a low resistance value. The run resistor can travel inside the conditioning resistor. The run resistor is capable of being advanced by a drive assembly until an electrical path is completed through the run resistor thereby shorting out the conditioning resistor and allowing the lower resistance run resistor to take over as the current carrier.

  13. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  14. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  15. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  16. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  17. Advanced nonlinear control of three phase series active power filter

    Directory of Open Access Journals (Sweden)

    Abouelmahjoub Y.

    2014-01-01

    Full Text Available The problem of controlling three-phase series active power filter (TPSAPF is addressed in this paper in presence of the perturbations in the voltages of the electrical supply network. The control objective of the TPSAPF is twofold: (i compensation of all voltage perturbations (voltage harmonics, voltage unbalance and voltage sags, (ii regulation of the DC bus voltage of the inverter. A controller formed by two nonlinear regulators is designed, using the Backstepping technique, to provide the above compensation. The regulation of the DC bus voltage of the inverter is ensured by the use of a diode bridge rectifier which its output is in parallel with the DC bus capacitor. The Analysis of controller performances is illustrated by numerical simulation in Matlab/Simulink environment.

  18. Experiences in simulating and testing coordinated voltage control provided by multiple wind power plants

    Energy Technology Data Exchange (ETDEWEB)

    Arlaban, T.; Alonso, O.; Ortiz, D. [Acciona Windpower S.A. (Spain); Peiro, J.; Rivas, R. [Red Electrica de Espana SAU (Spain); Quinonez-Varela, G.; Lorenzo, P. [Acciona Energia S.A. (Spain)

    2011-07-01

    This document presents some field tests performed in a transmission system node in order to check the adequacy of voltage control performance by multiple wind power plants, with an overall capacity of 395 MW. It briefly explains the Spanish TSO motivation towards new voltage control requirements and the necessity of performing such tests in order to set the most convenient voltage control parameters and to verify the stable operation. It presents how different the voltage control capability between modern wind turbines (DFIG) and older ones (SCIG) specifically retrofitted for voltage control is. (orig.)

  19. Voltage-carrying states in superconducting microstrips

    International Nuclear Information System (INIS)

    Stuivinga, M.E.C.

    1983-01-01

    When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

  20. Artificial intelligence techniques for voltage control

    Energy Technology Data Exchange (ETDEWEB)

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  1. Nonlinear Elliptic Differential Equations with Multivalued Nonlinearities

    Indian Academy of Sciences (India)

    In this paper we study nonlinear elliptic boundary value problems with monotone and nonmonotone multivalued nonlinearities. First we consider the case of monotone nonlinearities. In the first result we assume that the multivalued nonlinearity is defined on all R R . Assuming the existence of an upper and of a lower ...

  2. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  3. High voltage superconducting switch for power application

    International Nuclear Information System (INIS)

    Mawardi, O.; Ferendeci, A.; Gattozzi, A.

    1983-01-01

    This paper reports the development of a novel interrupter which meets the requirements of a high voltage direct current (HVDC) power switch and at the same time doubles as a current limiter. The basic concept of the interrupter makes use of a fast superconducting, high capacity (SHIC) switch that carries the full load current while in the superconducting state and reverts to the normal resistive state when triggered. Typical design parameters are examined for the case of a HVDC transmission line handling 2.5KA at 150KVDC. The result is a power switch with superior performance and smaller size than the ones reported to date

  4. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  5. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  6. The role of facts and HVDC in the future pan-European transmission system development

    NARCIS (Netherlands)

    L'Abbate, A.; Migliavacca, G.; Hager, U.; Rehtanz, C.; Ruberg, S.; Lopes Ferreira, H.M.; Fulli, G.; Purvins, A.

    2010-01-01

    The present paper focuses on FACTS (Flexible Alternating Current Transmission System) and HVDC (High Voltage Direct Current) transmission technologies. Particular attention is paid to different specific technical, economic and environmental features of these power electronics-based devices. Final

  7. Flexible AC transmission systems modelling and control

    CERN Document Server

    Zhang, Xiao-Ping; Pal, Bikash

    2012-01-01

    The extended and revised second edition of this successful monograph presents advanced modeling, analysis and control techniques of Flexible AC Transmission Systems (FACTS). The book covers comprehensively a range of power-system control problems: from steady-state voltage and power flow control, to voltage and reactive power control, to voltage stability control, to small signal stability control using FACTS controllers. In the six years since the first edition of the book has been published research on the FACTS has continued to flourish while renewable energy has developed into a mature and

  8. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  9. Phasor Alternatives to Friis’ Transmission Equation

    DEFF Research Database (Denmark)

    Franek, Ondrej

    2018-01-01

    Two alternatives to Friis’ transmission equation in terms of phasor voltage waves are presented. In one formulation antennas are characterized by the complex effective length vectors. An additional form introducing field gain, that serves effectively as a phasor counterpart to the power gain......, is proposed. Both forms show the same degree of symmetry and modularity as the original Friis’ equation, but thanks to using phasors instead of power quantities they allow for superposition of fields or voltages. Although the new transmission equations are formulated in frequency domain, they also constitute...

  10. Nonlinear estimation and control of automotive drivetrains

    CERN Document Server

    Chen, Hong

    2014-01-01

    Nonlinear Estimation and Control of Automotive Drivetrains discusses the control problems involved in automotive drivetrains, particularly in hydraulic Automatic Transmission (AT), Dual Clutch Transmission (DCT) and Automated Manual Transmission (AMT). Challenging estimation and control problems, such as driveline torque estimation and gear shift control, are addressed by applying the latest nonlinear control theories, including constructive nonlinear control (Backstepping, Input-to-State Stable) and Model Predictive Control (MPC). The estimation and control performance is improved while the calibration effort is reduced significantly. The book presents many detailed examples of design processes and thus enables the readers to understand how to successfully combine purely theoretical methodologies with actual applications in vehicles. The book is intended for researchers, PhD students, control engineers and automotive engineers. Hong Chen is a professor at the State Key Laboratory of Automotive Simulation and...

  11. High-voltage pulsed generator for dynamic fragmentation of rocks.

    Science.gov (United States)

    Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  12. High-voltage pulsed generator for dynamic fragmentation of rocks

    Science.gov (United States)

    Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  13. Voltage regulator placement in radial distribution system using plant ...

    African Journals Online (AJOL)

    user

    location and number along with tap setting of the voltage regulators that ... can be fixed or switched type; they are considered integer multiple of a capacitor unit ..... By simulating the growth process of plant phototropism, a probability model ..... He is referee for IEE Proceedings - Generation Transmission and Distribution and ...

  14. Single-step emulation of nonlinear fiber-optic link with gaussian mixture model

    DEFF Research Database (Denmark)

    Borkowski, Robert; Doberstein, Andy; Haisch, Hansjörg

    2015-01-01

    We use a fast and low-complexity statistical signal processing method to emulate nonlinear noise in fiber links. The proposed emulation technique stands in good agreement with the numerical NLSE simulation for 32 Gbaud DP-16QAM nonlinear transmission.......We use a fast and low-complexity statistical signal processing method to emulate nonlinear noise in fiber links. The proposed emulation technique stands in good agreement with the numerical NLSE simulation for 32 Gbaud DP-16QAM nonlinear transmission....

  15. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  16. Buck supplies output voltage ripple reduction using fuzzy control

    Directory of Open Access Journals (Sweden)

    Nicu BIZON

    2007-12-01

    Full Text Available Using the PWM control for switching power supplies the peaks EMI noise appear at the switching frequency and its harmonics. Using randomize or chaotic PWM control techniques in these systems the power spectrum is spread out in all frequencies band spectral emissions, but with a bigger ripple in the output voltage. The proposed nonlinear feedback control method, which induces chaos, is based by fuzzy rules that minimize the output voltage ripple. The feasibility and effectiveness of this relative simple method is shown by simulation. A comparison with the previous control method is included, too.

  17. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  18. Nonlinear charge transport in bipolar semiconductors due to electron heating

    International Nuclear Information System (INIS)

    Molina-Valdovinos, S.; Gurevich, Yu.G.

    2016-01-01

    It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

  19. Nonlinear charge transport in bipolar semiconductors due to electron heating

    Energy Technology Data Exchange (ETDEWEB)

    Molina-Valdovinos, S., E-mail: sergiom@fisica.uaz.edu.mx [Universidad Autónoma de Zacatecas, Unidad Académica de Física, Calzada Solidaridad esq. Paseo, La Bufa s/n, CP 98060, Zacatecas, Zac, México (Mexico); Gurevich, Yu.G. [Centro de Investigación y de Estudios Avanzados del IPN, Departamento de Física, Av. IPN 2508, México D.F., CP 07360, México (Mexico)

    2016-05-27

    It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

  20. First 735 kV transmission, Manicouagan, Montreal

    Energy Technology Data Exchange (ETDEWEB)

    Cahill, L

    1964-11-01

    The 735 kV transmission network of Hydro Quebec is described giving reasons for choice of voltage, stability factors level of insulation, disposition of conductors, insulators, equipment used and state of readiness of the project.

  1. Guinea_WADC00320_ADBG_Guinea_Electricity_Transmission_Network

    Data.gov (United States)

    United Nations Cartographic Section — Data for medium and high voltage transmission lines were compiled for the AICD study led by the World Bank. A variety of sources were consulted, including regional...

  2. Performance Evaluation of Three Different Inverter Configurations of DVR for Mitigation of Voltage Events

    Directory of Open Access Journals (Sweden)

    Miska Prasad

    2016-12-01

    Full Text Available The voltage events namely voltage sags and voltage swells represent the most common, frequent and important power quality events in today’s power system. Dynamic voltage restorer (DVR is one of the key components used to mitigate the supply voltage quality disturbances in terms of voltage sags and swells in the distribution system. It consists of an energy storage unit, a voltage source inverter, a filter, a coupling transformer and the control system. This paper presents three different inverter configurations of dynamic voltage restorer (DVR for mitigation of voltage events such as voltage sags and swells with sudden addition or removal of the nonlinear load. These three configurations are voltage source inverter based DVR (VSI-DVR, current source inverter based DVR (CSI-DVR and impedance or Z-source inverter based DVR (ZSI-DVR. The d-q control technique is used to control the operation of the DVR. The response of ZSI-DVR for mitigation of voltage sags and swells are investigated and compared with VSI-DVR and CSI-DVR using MATLAB/SIMULINK environment.

  3. Dynamic voltage-current characteristics for a water jet plasma arc

    International Nuclear Information System (INIS)

    Yang Jiaxiang; Lan Sheng; Xu Zuoming

    2008-01-01

    A virtual instrument technology is used to measure arc current, arc voltage, dynamic V-I characteristics, and nonlinear conductance for a cone-shaped water jet plasma arc under ac voltage. Experimental results show that ac arc discharge mainly happens in water vapor evaporated from water when heated. However, due to water's cooling effect and its conductance, arc conductance, reignition voltage, extinguish voltage, and current zero time are very different from those for ac arc discharge in gas work fluid. These can be valuable to further studies on mechanism and characteristics of plasma ac discharge in water, and even in gas work fluid

  4. Performance Improvement of Sensorless Vector Control for Induction Motor Drives Fed by Matrix Converter Using Nonlinear Model and Disturbance Observer

    DEFF Research Database (Denmark)

    Lee, Kyo-Beum; Blaabjerg, Frede

    2004-01-01

    This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with a non-linearity compensation and disturbance observer. The nonlinear voltage distortion that is caused by communication delay and on-state voltage drop in switching...

  5. Reduced Order Extended Luenberger Observer Based Sensorless Vector Control Fed by Matrix Converter with Non-linearity Modeling

    DEFF Research Database (Denmark)

    Lee, Kyo-Beum; Blaabjerg, Frede

    2004-01-01

    This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with non-linearity compensation. The nonlinear voltage distortion that is caused by commutation delay and on-state voltage drop in switching device is corrected by a new...

  6. Nonlinear Photonic Crystal Fibers

    DEFF Research Database (Denmark)

    Hansen, Kim Per

    2004-01-01

    Despite the general recession in the global economy and the collapse of the optical telecommunication market, research within specialty fibers is thriving. This is, more than anything else, due to the technology transition from standard all-glass fibers to photonic crystal fibers, which, instead....... The freedom to design the dispersion profile of the fibers is much larger and it is possible to create fibers, which support only a single spatial mode, regardless of wavelength. In comparison, the standard dispersion-shifted fibers are limited by a much lower index-contrast between the core and the cladding...... in 1996, and are today on their way to become the dominating technology within the specialty fiber field. Whether they will replace the standard fiber in the more traditional areas like telecommunication transmission, is not yet clear, but the nonlinear photonic crystal fibers are here to stay....

  7. Voltage Flicker Mitigation in Electric Arc Furnace using D-STATCOM

    OpenAIRE

    Deepthisree Madathil; Ilango Karuppasamy; Kirthika Devi V S; Manjula G Nair

    2014-01-01

    The major power quality issue of voltage flicker has resulted as a serious concern for the customers and heavy power companies. Voltage flicker is an impression of unsteadiness of visual sensation induced by a light source whose luminance fluctuates with time. This phenomenon is experienced when an Electric Arc Furnace (EAF) as load is connected to the power system. Flexible AC transmission devices (FACTS) devices were gradually utilized for voltage flicker reduction. In this paper the FACTS ...

  8. Control voltage and power fluctuations when connecting wind farms

    Science.gov (United States)

    Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

    2015-12-01

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

  9. Control voltage and power fluctuations when connecting wind farms

    International Nuclear Information System (INIS)

    Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana

    2015-01-01

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve

  10. Control voltage and power fluctuations when connecting wind farms

    Energy Technology Data Exchange (ETDEWEB)

    Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

    2015-12-23

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

  11. Large third-order optical nonlinearity in vertically oriented mesoporous silica thin films embedded with Ag nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Min; Liu, Qiming, E-mail: qmliu@whu.edu.cn [Wuhan University, Key Laboratory of Artificial Micro- and Nano-structures of Ministry of Education, School of Physics and Technology (China)

    2016-12-15

    Taking advantage of the channel confinement of mesoporous films to prevent the agglomeration of Ag nanoparticles to achieve large third-order optical nonlinearity in amorphous materials, Ag-loaded composite mesoporous silica film was prepared by the electrochemical deposition method on ITO substrate. Ag ions were firstly transported into the channels of mesoporous film by the diffusion and binding force of channels, which were reduced to nanoparticles by applying suitable voltage. The existence and uniform distribution of Ag nanoparticles ranging in 1–10 nm in the mesoporous silica thin films were exhibited by UV spectrophotometer, X-ray powder diffraction (XRD), transmission electron microscopy (TEM), and X-ray photoelectron spectroscopy (XPS) measurements. The third-order optical nonlinearity induced by Ag nanoparticles was studied by the Z-scan technique. Due to the local field surface plasmon resonance, the maximum third-order nonlinear optical susceptibility of Ag-loaded composite mesoporous silica film is 1.53×10{sup −10} esu, which is 1000 times larger than that of the Ag-contained chalcogenide glasses which showed large nonlinearity in amorphous materials.

  12. A nonlinear analysis of the terahertz serpentine waveguide traveling-wave amplifier

    International Nuclear Information System (INIS)

    Li, Ke; Cao, Miaomiao; Liu, Wenxin; Wang, Yong

    2015-01-01

    A nonlinear model for the numerical simulation of terahertz serpentine waveguide traveling-wave tube (SW-TWT) is described. In this model, the electromagnetic wave transmission in the SW is represented as an infinite set of space harmonics to interact with an electron beam. Analytical expressions for axial electric fields in axisymmetric interaction gaps of SW-TWTs are derived and compared with the results from CST simulation. The continuous beam is treated as discrete macro-particles with different initial phases. The beam-tunnel field equations, space-charge field equations, and motion equations are combined to solve the beam-wave interaction. The influence of backward wave and relativistic effect is also considered in the series of equations. The nonlinear model is used to design a 340 GHz SW-TWT. Several favorable comparisons of model predictions with results from a 3-D Particle-in-cell simulation code CHIPIC are presented, in which the output power versus beam voltage and interaction periods are illustrated. The relative error of the predicted output power is less than 15% in the 3 dB bandwidth and the relative error of the saturated length is less than 8%.The results show that the 1-D nonlinear analysis model is appropriate to solve the terahertz SW-TWT operation characteristics

  13. Wireless data transmission from inside electromagnetic fields.

    Science.gov (United States)

    Huertas, José Ignacio; Barraza, Roberto; Echeverry, Julian Mauricio

    2010-01-01

    This paper describes analytical and experimental work developed to evaluate the effects of the electromagnetic fields produced by high-voltage lines (400 kV) on wireless data transmission at the 900MHz band. In this work the source of the data transmission is located inside the electromagnetic field and the reception station is located at different distances from the power lines. Different atmospheric conditions are considered.

  14. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  15. Nonlinear Elasticity

    Science.gov (United States)

    Fu, Y. B.; Ogden, R. W.

    2001-05-01

    This collection of papers by leading researchers in the field of finite, nonlinear elasticity concerns itself with the behavior of objects that deform when external forces or temperature gradients are applied. This process is extremely important in many industrial settings, such as aerospace and rubber industries. This book covers the various aspects of the subject comprehensively with careful explanations of the basic theories and individual chapters each covering a different research direction. The authors discuss the use of symbolic manipulation software as well as computer algorithm issues. The emphasis is placed firmly on covering modern, recent developments, rather than the very theoretical approach often found. The book will be an excellent reference for both beginners and specialists in engineering, applied mathematics and physics.

  16. Nonlinear resonances

    CERN Document Server

    Rajasekar, Shanmuganathan

    2016-01-01

    This introductory text presents the basic aspects and most important features of various types of resonances and anti-resonances in dynamical systems. In particular, for each resonance, it covers the theoretical concepts, illustrates them with case studies, and reviews the available information on mechanisms, characterization, numerical simulations, experimental realizations, possible quantum analogues, applications and significant advances made over the years. Resonances are one of the most fundamental phenomena exhibited by nonlinear systems and refer to specific realizations of maximum response of a system due to the ability of that system to store and transfer energy received from an external forcing source. Resonances are of particular importance in physical, engineering and biological systems - they can prove to be advantageous in many applications, while leading to instability and even disasters in others. The book is self-contained, providing the details of mathematical derivations and techniques invo...

  17. Nonlinear Control Structure of Grid Connected Modular Multilevel Converters

    DEFF Research Database (Denmark)

    Hajizadeh, Amin; Norum, Lars; Ahadpour Shal, Alireza

    2017-01-01

    in the prediction step in order to preserve the stochastic characteristics of a nonlinear system. In order to design adaptive robust control strategy and nonlinear observer, mathematical model of MMC using rotating d-q theory has been used. Digital time-domain simulation studies are carried out in the Matlab......This paper implements nonlinear control structure based on Adaptive Fuzzy Sliding Mode (AFSM) Current Control and Unscented Kalman Filter (UKF) to estimate the capacitor voltages from the measurement of arm currents of Modular Multilevel Converter (MMC). UKF use nonlinear unscented transforms....../Simulink environment to verify the performance of the overall proposed control structure during different case studies....

  18. Unidirectional reflection and invisibility in nonlinear media with an incoherent nonlinearity

    Science.gov (United States)

    Mostafazadeh, Ali; Oflaz, Neslihan

    2017-11-01

    We give explicit criteria for the reflectionlessness, transparency, and invisibility of a finite-range potential in the presence of an incoherent (intensity-dependent) nonlinearity that is confined to the range of the potential. This allows us to conduct a systematic study of the effects of such a nonlinearity on a locally periodic class of finite-range potentials that display perturbative unidirectional invisibility. We use our general results to examine the effects of a weak Kerr nonlinearity on the behavior of these potentials and show that the presence of nonlinearity destroys the unidirectional invisibility of these potentials. If the strength of the Kerr nonlinearity is so weak that the first-order perturbation theory is reliable, the presence of nonlinearity does not affect the unidirectional reflectionlessness and transmission reciprocity of the potential. We show that the expected violation of the latter is a second order perturbative effect.

  19. Grain boundary effect of ZnO voltage sensitive ceramic

    International Nuclear Information System (INIS)

    Zhu Ziying; Lei Deming; Li Jingde

    1991-01-01

    Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary

  20. Statistical characteristics of transient enclosure voltage in ultra-high-voltage gas-insulated switchgear

    Science.gov (United States)

    Cai, Yuanji; Guan, Yonggang; Liu, Weidong

    2017-06-01

    Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.

  1. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  2. The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.

    Science.gov (United States)

    Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge

    2017-11-17

    The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.

  3. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  4. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  5. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  6. The possibility of applying spectral redundancy in DWDM systems on existing long-distance FOCLs for increasing the data transmission rate and decreasing nonlinear effects and double Rayleigh scattering without changes in the communication channel

    Science.gov (United States)

    Nekuchaev, A. O.; Shuteev, S. A.

    2014-04-01

    A new method of data transmission in DWDM systems along existing long-distance fiber-optic communication lines is proposed. The existing method, e.g., uses 32 wavelengths in the NRZ code with an average power of 16 conventional units (16 units and 16 zeros on the average) and transmission of 32 bits/cycle. In the new method, one of 124 wavelengths with a duration of one cycle each (at any time instant, no more than 16 obligatory different wavelengths) and capacity of 4 bits with an average power of 15 conventional units and rate of 64 bits/cycle is transmitted at every instant of a 1/16 cycle. The cross modulation and double Rayleigh scattering are significantly decreased owing to uniform distribution of power over time at different wavelengths. The time redundancy (forward error correction (FEC)) is about 7% and allows one to achieve a coding enhancement of about 6 dB by detecting and removing deletions and errors simultaneously.

  7. The eGo grid model: An open source approach towards a model of German high and extra-high voltage power grids

    Science.gov (United States)

    Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen

    2018-02-01

    There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.

  8. Insulation co-ordination in high-voltage electric power systems

    CERN Document Server

    Diesendorf, W

    2015-01-01

    Insulation Co-ordination in High-Voltage Electric Power Systems deals with the methods of insulation needed in different circumstances. The book covers topics such as overvoltages and lightning surges; disruptive discharge and withstand voltages; self-restoring and non-self-restoring insulation; lightning overvoltages on transmission lines; and the attenuation and distortion of lightning surges. Also covered in the book are topics such as the switching surge designs of transmission lines, as well as the insulation coordination of high-voltage stations. The text is recommended for electrical en

  9. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  10. [Nonlinear magnetohydrodynamics

    International Nuclear Information System (INIS)

    1994-01-01

    Resistive MHD equilibrium, even for small resistivity, differs greatly from ideal equilibrium, as do the dynamical consequences of its instabilities. The requirement, imposed by Faraday's law, that time independent magnetic fields imply curl-free electric fields, greatly restricts the electric fields allowed inside a finite-resistivity plasma. If there is no flow and the implications of the Ohm's law are taken into account (and they need not be, for ideal equilibria), the electric field must equal the resistivity times the current density. The vanishing of the divergence of the current density then provides a partial differential equation which, together with boundary conditions, uniquely determines the scalar potential, the electric field, and the current density, for any given resistivity profile. The situation parallels closely that of driven shear flows in hydrodynamics, in that while dissipative steady states are somewhat more complex than ideal ones, there are vastly fewer of them to consider. Seen in this light, the vast majority of ideal MHD equilibria are just irrelevant, incapable of being set up in the first place. The steady state whose stability thresholds and nonlinear behavior needs to be investigated ceases to be an arbitrary ad hoc exercise dependent upon the whim of the investigator, but is determined by boundary conditions and choice of resistivity profile

  11. Percolation-enhanced nonlinear scattering from semicontinuous metal films

    Science.gov (United States)

    Breit, M.; von Plessen, G.; Feldmann, J.; Podolskiy, V. A.; Sarychev, A. K.; Shalaev, V. M.; Gresillon, S.; Rivoal, J. C.; Gadenne, P.

    2001-03-01

    Strongly enhanced second-harmonic generation (SHG), which is characterized by nearly isotropic distribution, is observed for gold-glass films near the percolation threshold. The diffuse-like SHG scattering, which can be thought of as nonlinear critical opalescence, is in sharp contrast with highly collimated linear reflection and transmission from these nanostructured semicontinuous metal films. Our observations, which can be explained by giant fluctuations of local nonlinear sources for SHG, verify recent predictions of percolation-enhanced nonlinear scattering.

  12. Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation

    Directory of Open Access Journals (Sweden)

    N Hatefi Kargan

    2013-09-01

    Full Text Available  In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.

  13. Index-based reactive power compensation scheme for voltage regulation

    Science.gov (United States)

    Dike, Damian Obioma

    2008-10-01

    Increasing demand for electrical power arising from deregulation and the restrictions posed to the construction of new transmission lines by environment, socioeconomic, and political issues had led to higher grid loading. Consequently, voltage instability has become a major concern, and reactive power support is vital to enhance transmission grid performance. Improved reactive power support to distressed grid is possible through the application of relatively unfamiliar emerging technologies of "Flexible AC Transmission Systems (FACTS)" devices and "Distributed Energy Resources (DERS)." In addition to these infrastructure issues, a lack of situational awareness by system operators can cause major power outages as evidenced by the August 14, 2003 widespread North American blackout. This and many other recent major outages have highlighted the inadequacies of existing power system indexes. In this work, a novel "Index-based reactive compensation scheme" appropriate for both on-line and off-line computation of grid status has been developed. A new voltage stability index (Ls-index) suitable for long transmission lines was developed, simulated, and compared to the existing two-machine modeled L-index. This showed the effect of long distance power wheeling amongst regional transmission organizations. The dissertation further provided models for index modulated voltage source converters (VSC) and index-based load flow analysis of both FACTS and microgrid interconnected power systems using the Newton-Raphson's load flow model incorporated with multi-FACTS devices. The developed package has been made user-friendly through the embodiment of interactive graphical user interface and implemented on the IEEE 14, 30, and 300 bus systems. The results showed reactive compensation has system wide-effect, provided readily accessible system status indicators, ensured seamless DERs interconnection through new islanding modes and enhanced VSC utilization. These outcomes may contribute

  14. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  15. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  16. Modeling generalized interline power-flow controller (GIPFC using 48-pulse voltage source converters

    Directory of Open Access Journals (Sweden)

    Amir Ghorbani

    2018-05-01

    Full Text Available Generalized interline power-flow controller (GIPFC is one of the voltage-source controller (VSC-based flexible AC transmission system (FACTS controllers that can independently regulate the power-flow over each transmission line of a multiline system. This paper presents the modeling and performance analysis of GIPFC based on 48-pulsed voltage-source converters. This paper deals with a cascaded multilevel converter model, which is a 48-pulse (three levels voltage source converter. The voltage source converter described in this paper is a harmonic neutralized, 48-pulse GTO converter. The GIPFC controller is based on d-q orthogonal coordinates. The algorithm is verified using simulations in MATLAB/Simulink environment. Comparisons between unified power flow controller (UPFC and GIPFC are also included. Keywords: Generalized interline power-flow controller (GIPFC, Voltage source converter (VCS, 48-pulse GTO converter

  17. Application of Multipoint DC Voltage Control in VSC-MTDC System

    Directory of Open Access Journals (Sweden)

    Yang Xi

    2013-01-01

    Full Text Available The voltage-source-converter- (VSC- based multiterminal VSC-HVDC power transmission system (VSC-MTDC is an ideal approach to connect wind farm with power grid. Analyzing the characteristics of doubly fed induction generators as well as the basic principle and the control strategy of VSC-MTDC, a multiterminal DC voltage control strategy suitable for wind farm connected with VSC-MTDC is proposed. By use of PSCAD/EMTDC, the proposed control strategy is simulated, and simulation results show that using the proposed control strategy the conversion between constant power control mode and constant DC voltage control mode can be automatically implemented; thus the DC voltage stability control and reliable power output of wind farm can be ensured after the fault-caused outage of converter station controlled by constant DC voltage and under other faults. The simulation result shows that the model can fulfill multiterminal power transmission and fast response control.

  18. Nonlinear Deadbeat Current Control of a Switched Reluctance Motor

    OpenAIRE

    Rudolph, Benjamin

    2009-01-01

    High performance current control is critical to the success of the switched reluctance motor (SRM). Yet high motor phase nonlinearities in the SRM place extra burden on the current controller, rendering it the weakest link in SRM control. In contrast to linear motor control techniques that respond to current error, the deadbeat controller calculates the control voltage by the current command, phase current, rotor position and applied phase voltage. The deadbeat controller has demonstrated sup...

  19. Distance Protection of Cross-Bonded Transmission Cable-Systems

    DEFF Research Database (Denmark)

    Bak, Claus Leth; F. Jensen, Christian

    2014-01-01

    In this paper the problems of protecting a cross-bonded cable system using distance protection are analysed. The combination of the desire to expand the high voltage transmission grid and the public's opinion towards new installations of overhead lines (OHL), more and more transmission cable syst...

  20. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  1. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  2. A support vector machine (SVM) based voltage stability classifier

    Energy Technology Data Exchange (ETDEWEB)

    Dosano, R.D.; Song, H. [Kunsan National Univ., Kunsan, Jeonbuk (Korea, Republic of); Lee, B. [Korea Univ., Seoul (Korea, Republic of)

    2007-07-01

    Power system stability has become even more complex and critical with the advent of deregulated energy markets and the growing desire to completely employ existing transmission and infrastructure. The economic pressure on electricity markets forces the operation of power systems and components to their limit of capacity and performance. System conditions can be more exposed to instability due to greater uncertainty in day to day system operations and increase in the number of potential components for system disturbances potentially resulting in voltage stability. This paper proposed a support vector machine (SVM) based power system voltage stability classifier using local measurements of voltage and active power of load. It described the procedure for fast classification of long-term voltage stability using the SVM algorithm. The application of the SVM based voltage stability classifier was presented with reference to the choice of input parameters; input data preconditioning; moving window for feature vector; determination of learning samples; and other considerations in SVM applications. The paper presented a case study with numerical examples of an 11-bus test system. The test results for the feasibility study demonstrated that the classifier could offer an excellent performance in classification with time-series measurements in terms of long-term voltage stability. 9 refs., 14 figs.

  3. A programmable nonlinear acoustic metamaterial

    Directory of Open Access Journals (Sweden)

    Tianzhi Yang

    2017-09-01

    Full Text Available Acoustic metamaterials with specifically designed lattices can manipulate acoustic/elastic waves in unprecedented ways. Whereas there are many studies that focus on passive linear lattice, with non-reconfigurable structures. In this letter, we present the design, theory and experimental demonstration of an active nonlinear acoustic metamaterial, the dynamic properties of which can be modified instantaneously with reversibility. By incorporating active and nonlinear elements in a single unit cell, a real-time tunability and switchability of the band gap is achieved. In addition, we demonstrate a dynamic “editing” capability for shaping transmission spectra, which can be used to create the desired band gap and resonance. This feature is impossible to achieve in passive metamaterials. These advantages demonstrate the versatility of the proposed device, paving the way toward smart acoustic devices, such as logic elements, diode and transistor.

  4. Nonlinear beam mechanics

    NARCIS (Netherlands)

    Westra, H.J.R.

    2012-01-01

    In this Thesis, nonlinear dynamics and nonlinear interactions are studied from a micromechanical point of view. Single and doubly clamped beams are used as model systems where nonlinearity plays an important role. The nonlinearity also gives rise to rich dynamic behavior with phenomena like

  5. Transcending Transmission

    DEFF Research Database (Denmark)

    Schoeneborn, Dennis; Trittin, Hannah

    2013-01-01

    Purpose – Extant research on corporate social responsibility (CSR) communication primarily relies on a transmission model of communication that treats organizations and communication as distinct phenomena. This approach has been criticized for neglecting the formative role of communication...... in the emergence of organizations. This paper seeks to propose to reconceptualize CSR communication by drawing on the “communication constitutes organizations” (CCO) perspective. Design/methodology/approach – This is a conceptual paper that explores the implications of switching from an instrumental...... to a constitutive notion of communication. Findings – The study brings forth four main findings: from the CCO view, organizations are constituted by several, partly dissonant, and potentially contradictory communicative practices. From that viewpoint, the potential impact of CSR communication becomes a matter...

  6. Modulation linearization of a frequency-modulated voltage controlled oscillator, part 3

    Science.gov (United States)

    Honnell, M. A.

    1975-01-01

    An analysis is presented for the voltage versus frequency characteristics of a varactor modulated VHF voltage controlled oscillator in which the frequency deviation is linearized by using the nonlinear characteristics of a field effect transistor as a signal amplifier. The equations developed are used to calculate the oscillator output frequency in terms of pertinent circuit parameters. It is shown that the nonlinearity exponent of the FET has a pronounced influence on frequency deviation linearity, whereas the junction exponent of the varactor controls total frequency deviation for a given input signal. A design example for a 250 MHz frequency modulated oscillator is presented.

  7. Electromagnetic pulses at the boundary of a nonlinear plasma

    International Nuclear Information System (INIS)

    Satorius, E.H.

    1975-01-01

    An investigation was made of the behavior of strong electromagnetic pulses at the boundary of a nonlinear, cold, collisionless, and uniform plasma. The nonlinearity considered here is due to the nonlinear terms in the fluid equation which is used to describe the plasma. Two cases are studied. First, the case where there is a voltage pulse applied across the plane boundary of a semi-infinite, nonlinear plasma. Two different voltage pulses are considered, i.e., a delta function pulse and a suddenly turned-on sinusoidal pulse. The resulting electromagnetic fields propagating in the nonlinear plasma are found in this case. In the second case, the reflection of incident E-polarized and H-polarized, electromagnetic pulses at various angles of incidence from a nonlinear, semi-infinite plasma are considered. Again, two forms of incident pulses are considered: a delta function pulse and a suddenly turned-on sinusoidal pulse. In case two, the reflected electromagnetic fields are found. In both cases, the method used for finding the fields is to first solve the fluid equation (which describes the plasma) for the nonlinear conduction current in terms of the electric field using a perturbation method (since the nonlinear effects are assumed to be small). Next, this current is substituted into Maxwell's equations, and finally the electromagnetic fields which satisfy the boundary conditions are found. (U.S.)

  8. HVDC transmission preferred to 750 kV ac

    Energy Technology Data Exchange (ETDEWEB)

    1965-06-25

    It is unlikely that there will be a need in Britain for ac transmission voltages above 400 kV. But with the growing load density in the large conurbations with no possibility of local generation, high voltage dc transmission is likely to be most useful. It was concluded that by 1971 the 400 kV supergrid would be nation-wide and 6,200 circuit miles should be in service. With the expansion to accommodate the large new generating stations, the 400 kV supergrid would become an extremely high power distribution network rather than a transmission system. A higher voltage for transmission is outside the rational limit of speculation for a country the size of Britain.

  9. STUDY ON PERFORMANCE OF 21M 132kV TRANSMISSION TOWER WITH MEDIUM WIND INTENSITY

    OpenAIRE

    V. LAKSHMI; A. RAJAGOPALA RAO

    2012-01-01

    Electric Power is today playing an increasingly important role in the life of the community. In the electric power system the production and transmission of power are two predominant factors. For the purpose of transmission of electricity towers are the main medium with some wires at required distances and altitudes. The remotehydroelectric power plants have given rise to the need for extra high voltage. Prior to 1950, 150 kV electric transmission lines were considered and still higher voltag...

  10. Site Selection Strategy of Single-Frequency Tuned R-APF for Background Harmonic Voltage Damping in Power Systems

    DEFF Research Database (Denmark)

    Sun, Xiaofeng; Zeng, Jian; Chen, Zhe

    2013-01-01

    , and analyze the harmonic voltage propagation caused by the background harmonic voltage in power systems. Then, a new strategy is proposed for the site selection of resistive active power filter to damp the background harmonic voltage in power systems. Experiments have been performed to verify the theoretical......Series resonance between capacitance and line inductance may magnify background harmonic voltage and worsen the harmonic voltage distortion in power systems. To solve this problem, in this paper, the transmission line theory is used to set up the distributed parameter model of power system feeders...

  11. Nonlinear effects in propagation of long-range surface plasmon polaritons in gold strip waveguides

    DEFF Research Database (Denmark)

    Lysenko, Oleg; Bache, Morten; Malureanu, Radu

    2016-01-01

    cladding. The optical characterization was performed using a high power picosecond laser at 1064 nm. The experiments reveal two nonlinear optical effects: nonlinear power transmission and spectral broadening of the LRSPP mode in the waveguides. Both nonlinear optical effects depend on the gold layer...

  12. Harmonics in transmission power systems

    DEFF Research Database (Denmark)

    Wiechowski, Wojciech Tomasz

    . The comparison shows that results obtained used both types of the cores are the same, so it is concluded that both cores can be used for harmonic measurements. Low-inductance resistors are introduced in the secondary circuits, in series with the metering and protective relaying. On those resistors, the harmonic......Some time ago, Energinet.dk, the Transmission System Operator of the 150 kV and 400 kV transmission network in Denmark, had experienced operational malfunctions of some of the measuring and protection equipment. Also an overloading of a harmonic filter has been reported, and therefore, a need...... end only so the ground is not used as a return path. A way to reduce the capacitive coupling is to provide shielding. Harmonic currents are measured using the conventional inductive voltage transformers. Both protective and metering cores were compared if they could be used for harmonic measurements...

  13. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  14. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  15. An impact analysis of the fault impedance on voltage sags

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Alessandro Candido Lopes [CELG - Companhia Energetica de Goias, Goiania, GO (Brazil). Generation and Transmission. System' s Operation Center], E-mail: alessandro.clr@celg.com.br; Batista, Adalberto Jose [Federal University of Goias (UFG), Goiania, GO (Brazil)], E-mail: batista@eee.ufg.br; Leborgne, Roberto Chouhy [Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil)], E-mail: rcl@ece.ufrgs.br; Emiliano, Pedro Henrique Mota, E-mail: ph@phph.com.br

    2009-07-01

    This paper presents an impact analysis of the fault impedance, in terms of its module and angle, on voltage sags caused by faults. Symmetrical and asymmetrical faults are simulated, at transmission and distribution lines, by using a frequency-domain fault simulation software called ANAFAS. Voltage sags are monitored at buses where sensitive end-users are connected. In order to overcome some intrinsic limitations of this software concerning its automatic execution for several cases, a computational tool was developed in Java programming language. This solution allows the automatic simulation of cases including the effect of the fault position, the fault type, and the proper fault impedance. The main conclusion is that the module and angle of the fault impedance can have a significant influence on voltage sag depending on the fault characteristics. (author)

  16. Investigation of nonlinear I–V behavior of CNTs filled polymer composites

    International Nuclear Information System (INIS)

    Wang, Jian; Yu, Shuhui; Luo, Suibin; Chu, Baojin; Sun, Rong; Wong, Ching-Ping

    2016-01-01

    Graphical abstract: - Highlights: • Mechanism of nonlinear behavior of the CNT composites was systematically investigated. • There are one linear region (I) and two nonlinear regions (II and III) in the I–V curves. • This phenomenon was analyzed based on hopping, tunneling and Joule heating effects. - Abstract: Nonlinear current–voltage (I–V) behavior is a typical feature of polymeric composites containing conductor or semiconductor fillers, which are desired to handle the transient voltage and electrostatic discharge (ESD) of microelectronic devices. In this paper, the mechanism of nonlinear behavior of carbon nanotubes (CNTs) filled polymer composites in the applied electric field was explored. The I–V curves of the composites exhibited three regions. The variation of current at low voltages (region I) is linear. Under relatively higher voltages (region II), the variation is nonlinear and grows rapidly with voltage. As the voltage is further increased, the I–V curve is still non-linear (region III), but the growth rate is significantly slowed down. The I–V characteristics in the above three regions were analyzed systematically based on the calculation of the electrons hopping from the conduction band of CNTs to epoxy, the induced current under electric field, as well as Joule-heating and tunneling effect.

  17. Analysis of operating conditions of the voltage transformer

    Directory of Open Access Journals (Sweden)

    Fastiy G. P.

    2017-12-01

    Full Text Available In electrical networks, constant monitoring of the electrical equipment operation is necessary. To accomplish this task, current transformers and voltage transformers (VT are used, on which the accuracy of electrical measurements, electricity metering, and the reliability of the emergency control system depend. The results of the analysis of the conditions for forming the magnetization of a voltage transformer in the mode with unilateral connection of overhead transmission lines, as well as variants of violations in the 110 kV network that may exist for a relatively long time have been presented. It should be noted that the considered network has its own peculiarities: the overhead transmission lines connected in series have a significant length and a low level of load, which may be a condition for the appearance of a transmission lines capacitive effect (the Ferranti effect, the latter can cause overvoltage. Overvoltage occurs when the operating modes are temporary in terms of operation, adverse combinations of network parameters take place, and can continue until the circuit and network modes change. Most often they appear in asymmetric modes, with short circuits to ground, etc. Asymmetric modes caused by incomplete-phase commutations and wire breaks on the overhead line, as well as wire breaks with subsequent disconnection of power transformers that can affect the voltage level on the VT have been considered. The possibility of VT magnetizing with a prolonged voltage rise in symmetric modes, namely, the manifestation of the Ferranti effect with various loads at substations up to complete switching-off and power transformers switching off has been investigated. The analysis of the measuring voltage transformer operating conditions has been based on materials provided by the "Kolenergo" services.

  18. Improvement of Voltage Stability in Electrical Network by Using a STATCOM

    Directory of Open Access Journals (Sweden)

    Kamel MERINI

    2014-02-01

    Full Text Available This paper aims to clarify power flow without and with static synchronous compensator (STATCOM and searching the best location of STATCOM to improve voltage in the Algerian network. In daily operation where there are all kinds of disturbances such as voltage fluctuations, voltage sags, swells, voltage unbalances and harmonics. STATCOM is modeled as a controllable voltage source. To validate the effectiveness of the Newton-Raphson method algorithm was implemented to solve power flow equations in presence of STATCOM. Case studies are carried out on 59-bus Algerian network test to demonstrate the performance of proposed models. Simulation results show the effectiveness and capability of STATCOM in improving voltage regulation in transmission systems; moreover the power solution using the Newton-Raphson algorithm developed. The STATCOM and the detailed simulation are performed using Matlab program.

  19. Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units

    DEFF Research Database (Denmark)

    Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede

    2018-01-01

    -area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...

  20. Measurement of magnetically insulated line voltage using a Thomson Parabola Charged Particle Analyser

    International Nuclear Information System (INIS)

    Stanley, T.D.; Stinnett, R.W.

    1981-01-01

    The absence of direct measurements of magnetically insulated line voltage necessitated reliance on inferred voltages based on theoretical calculation and current measurements. This paper presents some of the first direct measurements of magnetically insulated transmission line peak voltages. These measurements were made on the Sandia National Laboratories HydraMITE facility. The peak voltage is measured by observing the energy of negative ions produced at the line cathode and accelerated through the line voltage. The ion energy and the charge-to-mass ratio are measured using the Thomson Parabola mass spectrometry technique. This technique uses parallel E and B fields to deflect the ions. The deflected ions are detected using a microchannel plate coupled to a phosphor screen and photographic film. The Thomson Parabola results are compared to Faraday Cup measurements and to calculated voltages based on current measurements. In addition, the significance of observed positive ions is discussed

  1. High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

    1993-01-01

    During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

  2. Advanced High Voltage Power Device Concepts

    CERN Document Server

    Baliga, B Jayant

    2012-01-01

    Advanced High Voltage Power Device Concepts describes devices utilized in power transmission and distribution equipment, and for very high power motor control in electric trains and steel-mills. Since these devices must be capable of supporting more than 5000-volts in the blocking mode, this books covers operation of devices rated at 5,000-V, 10,000-V and 20,000-V. Advanced concepts (the MCT, the BRT, and the EST) that enable MOS-gated control of power thyristor structures are described and analyzed in detail. In addition, detailed analyses of the silicon IGBT, as well as the silicon carbide MOSFET and IGBT, are provided for comparison purposes. Throughout the book, analytical models are generated to give a better understanding of the physics of operation for all the structures. This book provides readers with: The first comprehensive treatment of high voltage (over 5000-volts) power devices suitable for the power distribution, traction, and motor-control markets;  Analytical formulations for all the device ...

  3. Topologically protected loop flows in high voltage AC power grids

    International Nuclear Information System (INIS)

    Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I

    2016-01-01

    Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)

  4. Power Quality Assessment in Real Shipboard Microgrid Systems under Unbalanced and Harmonic AC Bus Voltage

    DEFF Research Database (Denmark)

    Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz

    2018-01-01

    were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....

  5. LIMIT SOLUTIONS OF EQUATIONS OF A DC HIGH-VOLTAGE CASCADE GENERATOR

    Directory of Open Access Journals (Sweden)

    V. O. Brzhezitsky

    2015-04-01

    Full Text Available In the paper the issue of calculating the high voltage cascade mode oscillator with a nonlinear load using the analytical method under different conditions of selection values of its components is presented. The peculiarity of the method of the study is that during multivariate calculations output parameters load generator remain unchanged. For high-voltage cascade direct current power found conditions under which can be significantly reduced high capacity capacitors cascade generator. The calculations show that acceptable for practical applications of high-voltage characteristics of cascade generators can be achieved with substantial reduction of the volume of their constituents, and thus substantial decline in their value.

  6. Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

    Directory of Open Access Journals (Sweden)

    Josef Burian

    2012-12-01

    Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

  7. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  8. Low-Frequency MEMS Electrostatic Vibration Energy Harvester With Corona-Charged Vertical Electrets and Nonlinear Stoppers

    Science.gov (United States)

    Lu, Y.; Cottone, F.; Boisseau, S.; Galayko, D.; Marty, F.; Basset, P.

    2015-12-01

    This paper reports for the first time a MEMS electrostatic vibration energy harvester (e-VEH) with corona-charged vertical electrets on its electrodes. The bandwidth of the 1-cm2 device is extended in low and high frequencies by nonlinear elastic stoppers. With a bias voltage of 46 V (electret@21 V + DC external source@25 V) between the electrodes, the RMS power of the device reaches 0.89 μW at 33 Hz and 6.6 μW at 428 Hz. The -3dB frequency band including the hysteresis is 223∼432 Hz, the one excluding the hysteresis 88∼166 Hz. We also demonstrate the charging of a 47 μF capacitor used for powering a wireless and autonomous temperature sensor node with a data transmission beyond 10 m at 868 MHz.

  9. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  10. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  11. Transmission analysis in WDM networks

    DEFF Research Database (Denmark)

    Rasmussen, Christian Jørgen

    1999-01-01

    This thesis describes the development of a computer-based simulator for transmission analysis in optical wavelength division multiplexing networks. A great part of the work concerns fundamental optical network simulator issues. Among these issues are identification of the versatility and user...... the different component models are invoked during the simulation of a system. A simple set of rules which makes it possible to simulate any network architectures is laid down. The modelling of the nonlinear fibre and the optical receiver is also treated. The work on the fibre concerns the numerical solution...

  12. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  13. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  14. Possibilities for Advanced Encoding Techniques at Signal Transmission in the Optical Transmission Medium

    Directory of Open Access Journals (Sweden)

    Filip Čertík

    2016-01-01

    Full Text Available This paper presents a possible simulation of negative effects in the optical transmission medium and an analysis for the utilization of different signal processing techniques at the optical signal transmission. An attention is focused on the high data rate signal transmission in the optical fiber influenced by linear and nonlinear environmental effects presented by the prepared simulation model. The analysis includes possible utilization of OOK, BPSK, DBPSK, BFSK, QPSK, DQPSK, 8PSK, and 16QAM modulation techniques together with RS, BCH, and LDPC encoding techniques for the signal transmission in the optical fiber. Moreover, the prepared simulation model is compared with real optical transmission systems. In the final part, a comparison of the selected modulation techniques with different encoding techniques and their implementation in real transmission systems is shown.

  15. Effect of Circuit Breaker Shunt Resistance on Chaotic Ferroresonance in Voltage Transformer

    Directory of Open Access Journals (Sweden)

    RADMANESH, H.

    2010-08-01

    Full Text Available Ferroresonance or nonlinear resonance is a complex electrical phenomenon, which may cause over voltages and over currents in the electrical power system which endangers the system reliability and continuous safe operating. This paper studies the effect of circuit breaker shunt resistance on the control of chaotic ferroresonance in a voltage transformer. It is expected that this resistance generally can cause ferroresonance dropout. For confirmation this aspect Simulation has been done on a one phase voltage transformer rated 100VA, 275kV. The magnetization characteristic of the transformer is modeled by a single-value two-term polynomial with q=7. The simulation results reveal that considering the shunt resistance on the circuit breaker, exhibits a great mitigating effect on ferroresonance over voltages. Significant effect on the onset of chaos, the range of parameter values that may lead to chaos along with ferroresonance voltages has been obtained and presented.

  16. Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

    Science.gov (United States)

    Agarwal, Ruchi; Singh, Sanjeev

    2017-12-01

    The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

  17. Analysis of the public debate on health hazards due to high-voltage transmission lines. Recommendations for the radiation protection related communication with respect of grid extension; Analyse des oeffentlichen Diskurses zu gesundheitlichen Auswirkungen von Hochspannungsleitungen. Handlungsempfehlungen fuer die strahlenschutzbezogene Kommunikation beim Stromnetzausbau

    Energy Technology Data Exchange (ETDEWEB)

    Weber, Florian; Kuehne, Olaf; Jenal, Corinna; Sanio, Tina [Hochschule Weihenstephan-Triesdorf, Freising (Germany). Lehrgebiet Laendliche Entwicklung/Regionalmanagement; Langer, Kerstin [Hochschule Weihenstephan-Triesdorf, Freising (Germany). Lehrgebiet Kommunikation und Partizipation in der Landschaftsarchitektur; Igel, Michael [Hochschule fuer Technik und Wirtschaft des Saarlandes, Saarbruecken (Germany). Lehrgebiet Elektrische Energieversorgung und Gebaeudesystemtechnik

    2016-05-15

    With its phase-out of nuclear power generation and the expansion of renewably sourced energy, the German energy turnaround ('Energiewende') has radically changed existing power supply structures, with wide geographical repercussions. One aspect of this is changes to the national power grid. Existing networks are to be upgraded and new long-distance north-south power-lines built. This creates resistance and conflict. Commissioned by the Federal Office for Radiation Protection, and the Federal Ministry of the Environment, Nature Conservation, Building and Nuclear Safety, the research project entitled Analysis of public discourse on the health impacts of high-voltage power lines - recommendations for action in radiation-protection discourse related to the extension of the power grid starts precisely at the point of conflict. It first investigates from a discourse theory perspective how power grid extensions and possible health-related consequences are communicatively constructed, and what argumentation patterns dominate the discussion. From this it derives recommendations for action, with a focus on health politics information and discourse. Behind the research project stands a socio-constructivist discourse theory that sees 'social reality' not as a given but as a socially evolved entity, and its meanings, therefore, not as stable but as subject to change. The central mechanism for the communication of an objectivized social world is language. The analyses undertaken here of power grid extension are based on a methodological mix of quantitative and qualitative elements that facilitates both the differentiation of central issues and detailed examination of individual aspects. Analysis focuses on the discussion of health issues not only in the relevant literature and on civic initiative websites, but also in the first 50 Google hits, in articles from the Sueddeutsche Zeitung (SZ) and Focus, and in talk shows. The resultant discourse analysis

  18. Non-linear time variant model intended for polypyrrole-based actuators

    Science.gov (United States)

    Farajollahi, Meisam; Madden, John D. W.; Sassani, Farrokh

    2014-03-01

    Polypyrrole-based actuators are of interest due to their biocompatibility, low operation voltage and relatively high strain and force. Modeling and simulation are very important to predict the behaviour of each actuator. To develop an accurate model, we need to know the electro-chemo-mechanical specifications of the Polypyrrole. In this paper, the non-linear time-variant model of Polypyrrole film is derived and proposed using a combination of an RC transmission line model and a state space representation. The model incorporates the potential dependent ionic conductivity. A function of ionic conductivity of Polypyrrole vs. local charge is proposed and implemented in the non-linear model. Matching of the measured and simulated electrical response suggests that ionic conductivity of Polypyrrole decreases significantly at negative potential vs. silver/silver chloride and leads to reduced current in the cyclic voltammetry (CV) tests. The next stage is to relate the distributed charging of the polymer to actuation via the strain to charge ratio. Further work is also needed to identify ionic and electronic conductivities as well as capacitance as a function of oxidation state so that a fully predictive model can be created.

  19. Wave propagation in elastic medium with heterogeneous quadratic nonlinearity

    International Nuclear Information System (INIS)

    Tang Guangxin; Jacobs, Laurence J.; Qu Jianmin

    2011-01-01

    This paper studies the one-dimensional wave propagation in an elastic medium with spatially non-uniform quadratic nonlinearity. Two problems are solved analytically. One is for a time-harmonic wave propagating in a half-space where the displacement is prescribed on the surface of the half-space. It is found that spatial non-uniformity of the material nonlinearity causes backscattering of the second order harmonic, which when combined with the forward propagating waves generates a standing wave in steady-state wave motion. The second problem solved is the reflection from and transmission through a layer of finite thickness embedded in an otherwise linearly elastic medium of infinite extent, where it is assumed that the layer has a spatially non-uniform quadratic nonlinearity. The results show that the transmission coefficient for the second order harmonic is proportional to the spatial average of the nonlinearity across the thickness of the layer, independent of the spatial distribution of the nonlinearity. On the other hand, the coefficient of reflection is proportional to a weighted average of the nonlinearity across the layer thickness. The weight function in this weighted average is related to the propagating phase, thus making the coefficient of reflection dependent on the spatial distribution of the nonlinearity. Finally, the paper concludes with some discussions on how to use the reflected and transmitted second harmonic waves to evaluate the variance and autocorrelation length of nonlinear parameter β when the nonlinearity distribution in the layer is a stochastic process.

  20. On Poisson Nonlinear Transformations

    Directory of Open Access Journals (Sweden)

    Nasir Ganikhodjaev

    2014-01-01

    Full Text Available We construct the family of Poisson nonlinear transformations defined on the countable sample space of nonnegative integers and investigate their trajectory behavior. We have proved that these nonlinear transformations are regular.

  1. Nonlinear control of permanent magnet synchronous motor driving a ...

    African Journals Online (AJOL)

    This paper presents a non-linear control of permanent magnet synchronous motor (PMSM) fed by a PWM voltage source inverter. To improve the performance of this control technique, the input-output linearization technique is proposed for a system driving a mechanical load with two masses. In order to ensure a steady ...

  2. Electrostatic potential profile and nonlinear current in an interacting ...

    Indian Academy of Sciences (India)

    Unknown

    Since the Poisson distribution crucially depends on charge densities ... formedon a large number of systems using semi-empirical to first-principles ... known by now that the current in these systems is a nonlinear function of the voltage and ..... the middle of the molecule and the potential drop is smaller near the interfaces.

  3. Scheduling and Voltage Scaling for Energy/Reliability Trade-offs in Fault-Tolerant Time-Triggered Embedded Systems

    DEFF Research Database (Denmark)

    Pop, Paul; Poulsen, Kåre Harbo; Izosimov, Viacheslav

    2007-01-01

    -execution and dynamic voltage scaling-based low-power techniques are competing for the slack in the schedules. Our approach decides the voltage levels and start times of processes and the transmission times of messages, such that the transient faults are tolerated, the timing constraints of the application...

  4. Why transmission is still the critical link

    Energy Technology Data Exchange (ETDEWEB)

    Flynn, V. [ESBI Alberta Ltd., Calgary, AB (Canada)

    2002-07-01

    This paper describes the important role that transmission plays in the competitive electric power industry in North America and around the world. In the past several years the transmission sector has experienced a lack of investment, congestion on transmission networks, merchant transmission development, and the creation of Regional Transmission Organizations (RTOs). The transmission grid is central to the reliability of the entire electricity system. It also plays a vital role in promoting efficient markets in electricity. The author discusses the consequences of inadequate investment to this critical link within the power industry. He also discusses how much investment is needed, and the challenges and solutions to building an infrastructure. The integrated electric system and the electricity industry in Alberta is very different from those in the United Sates, but the issues facing the industry are the same. The challenge is the sharp increase in the number of system access requests by new generators combined with the difficulties in siting new transmission lines. There are 17,000 km of transmission lines in Alberta, at voltages ranging from 69 kV to 500 kV. There are also connections between neighbouring provinces. The transmission lines have a value of C$1.5 billion. Since there have been no major additions to the transmission grid since the mid-1980s, significant investments in the coming years will have a disproportionate impact on the cost of transmission. Two merchant transmission projects have been proposed. The first will enhance transfer of electricity between Alberta and Saskatchewan by 150 MW, and the second is proposed to be a 1,500 MW, 500 kV DC line from the Fort McMurray area to the Pacific Northwest. 5 figs.

  5. E-beam high voltage switching power supply

    Science.gov (United States)

    Shimer, Daniel W.; Lange, Arnold C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

  6. E-beam high voltage switching power supply

    International Nuclear Information System (INIS)

    Shimer, D.W.; Lange, A.C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

  7. Spin-current emission governed by nonlinear spin dynamics.

    Science.gov (United States)

    Tashiro, Takaharu; Matsuura, Saki; Nomura, Akiyo; Watanabe, Shun; Kang, Keehoon; Sirringhaus, Henning; Ando, Kazuya

    2015-10-16

    Coupling between conduction electrons and localized magnetization is responsible for a variety of phenomena in spintronic devices. This coupling enables to generate spin currents from dynamical magnetization. Due to the nonlinearity of magnetization dynamics, the spin-current emission through the dynamical spin-exchange coupling offers a route for nonlinear generation of spin currents. Here, we demonstrate spin-current emission governed by nonlinear magnetization dynamics in a metal/magnetic insulator bilayer. The spin-current emission from the magnetic insulator is probed by the inverse spin Hall effect, which demonstrates nontrivial temperature and excitation power dependences of the voltage generation. The experimental results reveal that nonlinear magnetization dynamics and enhanced spin-current emission due to magnon scatterings are triggered by decreasing temperature. This result illustrates the crucial role of the nonlinear magnon interactions in the spin-current emission driven by dynamical magnetization, or nonequilibrium magnons, from magnetic insulators.

  8. Non-linear dielectric monitoring of biological suspensions

    International Nuclear Information System (INIS)

    Treo, E F; Felice, C J

    2007-01-01

    Non-linear dielectric spectroscopy as a tool for in situ monitoring of enzyme assumes a non-linear behavior of the sample when a sinusoidal voltage is applied to it. Even many attempts have been made to improve the original experiments, all of them had limited success. In this paper we present upgrades made to a non-linear dielectric spectrometer developed and the results obtained when using different cells. We emphasized on the electrode surface, characterizing the grinding and polishing procedure. We found that the biological medium does not behave as expected, and the non-linear response is generated in the electrode-electrolyte interface. The electrochemistry of this interface can bias unpredictably the measured non-linear response

  9. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  10. Advances in nonlinear optics

    CERN Document Server

    Chen, Xianfeng; Zeng, Heping; Guo, Qi; She, Weilong

    2015-01-01

    This book presents an overview of the state of the art of nonlinear optics from weak light nonlinear optics, ultrafast nonlinear optics to electro-optical theory and applications. Topics range from the fundamental studies of the interaction between matter and radiation to the development of devices, components, and systems of tremendous commercial interest for widespread applications in optical telecommunications, medicine, and biotechnology.

  11. Nonlinear behavior of three-terminal graphene junctions at room temperature

    International Nuclear Information System (INIS)

    Kim, Wonjae; Riikonen, Juha; Lipsanen, Harri; Pasanen, Pirjo

    2012-01-01

    We demonstrate nonlinear behavior in three-terminal T-branch graphene devices at room temperature. A rectified nonlinear output at the center branch is observed when the device is biased by a push–pull configuration. Nonlinearity is assumed to arise from a difference in charge transfer through the metal–graphene contact barrier between two contacts. The sign of the rectification can be altered by changing the carrier type using the back-gate voltage. (paper)

  12. Energy reduction through voltage scaling and lightweight checking

    Science.gov (United States)

    Kadric, Edin

    As the semiconductor roadmap reaches smaller feature sizes and the end of Dennard Scaling, design goals change, and managing the power envelope often dominates delay minimization. Voltage scaling remains a powerful tool to reduce energy. We find that it results in about 60% geomean energy reduction on top of other common low-energy optimizations with 22nm CMOS technology. However, when voltage is reduced, it becomes easier for noise and particle strikes to upset a node, potentially causing Silent Data Corruption (SDC). The 60% energy reduction, therefore, comes with a significant drop in reliability. Duplication with checking and triple-modular redundancy are traditional approaches used to combat transient errors, but spending 2--3x the energy for redundant computation can diminish or reverse the benefits of voltage scaling. As an alternative, we explore the opportunity to use checking operations that are cheaper than the base computation they are guarding. We devise a classification system for applications and their lightweight checking characteristics. In particular, we identify and evaluate the effectiveness of lightweight checks in a broad set of common tasks in scientific computing and signal processing. We find that the lightweight checks cost only a fraction of the base computation (0-25%) and allow us to recover the reliability losses from voltage scaling. Overall, we show about 50% net energy reduction without compromising reliability compared to operation at the nominal voltage. We use FPGAs (Field-Programmable Gate Arrays) in our work, although the same ideas can be applied to different systems. On top of voltage scaling, we explore other common low-energy techniques for FPGAs: transmission gates, gate boosting, power gating, low-leakage (high-Vth) processes, and dual-V dd architectures. We do not scale voltage for memories, so lower voltages help us reduce logic and interconnect energy, but not memory energy. At lower voltages, memories become dominant

  13. Intelligent distributed voltage control system for smart grid application

    Energy Technology Data Exchange (ETDEWEB)

    Sajadi, Amirhossein [Warsaw Univ. of Technology (Poland); Ariatabar, Mitra [RWTH Aachen Univ. (Germany)

    2012-07-01

    Increasing penetration of the renewable energy source (RES) units in distribution networks particularly due to nonlinear and unpredictable nature of renewable units brings up new challenges in different aspects of electricity network, which leads to more complex power systems. Multi-agent system is consisting of agents which are capable to perceive environment that they are located in and to reacts with each other by communication infrastructure in order to achieve overall goals. In this paper an approach to control the voltage based on in the power distribution system is proposed and discussed. Therefore, a multi-agent system has been integrated with artificial intelligence to come up with fuzzy multi-agent based system. The proposed control scheme is deployed to a smart distribution system consisting distribution generation units, modelled in MATLAB/Simulink, to evaluate its effectiveness. The simulation results show how proposed system can regulate voltage in smart distribution feeders. (orig.)

  14. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  15. Transmission Line Adapted Analytical Power Charts Solution

    Science.gov (United States)

    Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu

    2017-08-01

    The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

  16. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  17. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  18. Homotopy analysis approach for nonlinear piezoelectric vibration energy harvesting

    Directory of Open Access Journals (Sweden)

    Shahlaei-Far Shahram

    2016-01-01

    Full Text Available Piezoelectric energy harvesting from a vertical geometrically nonlinear cantilever beam with a tip mass subject to transverse harmonic base excitations is analyzed. One piezoelectric patch is placed on the slender beam to convert the tension and compression into electrical voltage. Applying the homotopy analysis method to the coupled electromechanical governing equations, we derive analytical solutions for the horizontal displacement of the tip mass and consequently the output voltage from the piezoelectric patch. Analytical approximation for the frequency response and phase of the geometrically forced nonlinear vibration system are also obtained. The research aims at a rigorous analytical perspective on a nonlinear problem which has previously been solely investigated by numerical and experimental methods.

  19. Quantum Nonlinear Optics

    CERN Document Server

    Hanamura, Eiichi; Yamanaka, Akio

    2007-01-01

    This graduate-level textbook gives an introductory overview of the fundamentals of quantum nonlinear optics. Based on the quantum theory of radiation, Quantum Nonlinear Optics incorporates the exciting developments in novel nonlinear responses of materials (plus laser oscillation and superradiance) developed over the past decade. It deals with the organization of radiation field, interaction between electronic system and radiation field, statistics of light, mutual manipulation of light and matter, laser oscillation, dynamics of light, nonlinear optical response, and nonlinear spectroscopy, as well as ultrashort and ultrastrong laser pulse. Also considered are Q-switching, mode locking and pulse compression. Experimental and theoretical aspects are intertwined throughout.

  20. Nonlinear dynamics and complexity

    CERN Document Server

    Luo, Albert; Fu, Xilin

    2014-01-01

    This important collection presents recent advances in nonlinear dynamics including analytical solutions, chaos in Hamiltonian systems, time-delay, uncertainty, and bio-network dynamics. Nonlinear Dynamics and Complexity equips readers to appreciate this increasingly main-stream approach to understanding complex phenomena in nonlinear systems as they are examined in a broad array of disciplines. The book facilitates a better understanding of the mechanisms and phenomena in nonlinear dynamics and develops the corresponding mathematical theory to apply nonlinear design to practical engineering.

  1. Engineering aspect of the microwave ionosphere nonlinear interaction experiment (MINIX) with a sounding rocket

    Science.gov (United States)

    Nagatomo, Makoto; Kaya, Nobuyuki; Matsumoto, Hiroshi

    The Microwave Ionosphere Nonlinear Interaction Experiment (MINIX) is a sounding rocket experiment to study possible effects of strong microwave fields in case it is used for energy transmission from the Solar Power Satellite (SPS) upon the Earth's atmosphere. Its secondary objective is to develop high power microwave technology for space use. Two rocket-borne magnetrons were used to emit 2.45 GHz microwave in order to make a simulated condition of power transmission from an SPS to a ground station. Sounding of the environment radiated by microwave was conducted by the diagnostic package onboard the daughter unit which was separated slowly from the mother unit. The main design drivers of this experiment were to build such high power equipments in a standard type of sounding rocket, to keep the cost within the budget and to perform a series of experiments without complete loss of the mission. The key technology for this experiment is a rocket-borne magnetron and high voltage converter. Location of position of the daughter unit relative to the mother unit was a difficult requirement for a spin-stabilized rocket. These problems were solved by application of such a low cost commercial products as a magnetron for microwave oven and a video tape recorder and camera.

  2. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  3. New trends in the development of high voltage technology

    Energy Technology Data Exchange (ETDEWEB)

    Aleksandrov, G N

    1964-07-01

    The question is raised as to what type of transmission should be developed to transfer power over long distances from the eastern to the western part of Russia, and what principles should be utilized to combine power transmission into single power system in the USSR. Aleksandrov indicates the need for higher voltage power transmission, and stresses that ac is more economical than dc. The author compares +-750 kV dc with 1000 kV ac. The economic comparison is conducted for the same level of insulation, and it is stated that it will result in the same amount of power transmitted. New insulation materials are mentioned, and wider use of fiberglass and other plastics is predicted.

  4. Lightning-induced overvoltages in low-voltage systems

    Energy Technology Data Exchange (ETDEWEB)

    Hoeidalen, Hans Kristian

    1997-12-31

    Lightning-induced overvoltages (LIOs) are a main source of failures in low-voltage overhead line systems. This thesis deals mainly with calculations of LIOs aiming to enable the design of a proper voltage protection. Models for calculation of LIOs are adapted from the literature or developed based on measurements. The models used are believed to be fairly accurate for the first few microseconds, which is usually sufficient for predicting the maximum induced voltage in the system. The lightning channel is modelled by the Modified Transmission Line (MTL) model with the Transmission Line (TL) model as a special case. The coupling between the electrical fields from a lightning channel and an overhead line is modelled by Agrawal`s model. The attenuation of electrical fields over a lossy ground is modelled by Norton`s- or the Surface Impedance methods. The validity of all the applied models is analysed. In addition, measurements have been performed in order to develop models of distribution transformers and low-voltage power installation (LVPI) networks. Simple models of typical transformers and LVPIs are developed for calculations when specific data are unavailable. The practical range of values and its influence on the LIOs in a system is investigated. The main frequency range of interest related to LIOs is 10 kHz - 1 MHz in which all the models are accurate. The adapted or developed models are used to calculate LIOs in low-voltage systems. The influence of various key parameters in the system is investigated. Most important are the return stroke amplitude and rise time, the overhead line height and location, the termination of overhead line segments, neutral grounding, and the ground conductivity. 135 refs., 136 figs., 12 tabs.

  5. Reactive power management and voltage control in deregulated power markets

    Science.gov (United States)

    Spangler, Robert G.

    The research that is the subject of this dissertation is about the management of reactive power and voltage support in the wholesale open access power markets in the United States (US). The purpose of this research is to place decisions about open access market structures, as they relate to reactive power and voltage control, on a logical and consistent economic basis, given the engineering needs of a commercial electric power system. An examination of the electricity markets operating in the US today reveals that current approaches to reactive power management and voltage support are extensions of those based on historical, regulated monopoly electric service. A case for change is built by first looking at the subject of reactive power from an engineering viewpoint and then from an economic perspective. Ultimately, a set of market rules for managing reactive power and voltage support is proposed. The proposal suggests that cost recovery for static and dynamic VARs is appropriately accomplished through the regulated transmission cost of service. Static VAR cost recovery should follow traditional rate recovery methodologies. In the case of dynamic VARs, this work provides a methodology based on the microeconomic theory of the firm for determining such cost. It further suggests that an operational strategy that reduces and limits the use of dynamic VARs, during normal operations, is appropriate. This latter point leads to an increase in the fixed cost of the transmission network but prevents price spikes and short supply situations from affecting, or being affected by, the reactive capability limitations associated with dynamic VARs supplied from synchronous generators. The rules are consistent with a market structure that includes competitive generation and their application will result in the communication of a clear understanding of the responsibilities, related to voltage control, of each type of market entity. In this sense, their application will contribute to

  6. Mitigation of voltage dip and power system oscillations damping using dual STATCOM for grid connected DFIG

    OpenAIRE

    D.V.N. Ananth; G.V. Nagesh Kumar

    2017-01-01

    During grid fault, transmission lines reach its thermal limit and lose its capability to transfer. If this fault current enters generator terminals, it will lead to dip in stator voltage and consequently produces torque and real power oscillations. This further affects in the form of internal heat in rotor windings and finally damages the generator. A new control strategy is proposed to limit fault current using dual STATCOM, which will damp power oscillations and mitigate the voltage dip due...

  7. Nonlinear effects in varactor-tuned resonators.

    Science.gov (United States)

    Everard, Jeremy; Zhou, Liang

    2006-05-01

    This paper describes the effects of RF power level on the performance of varactor-tuned resonator circuits. A variety of topologies are considered, including series and parallel resonators operating in both unbalanced and balanced modes. As these resonators were designed to produce oscillators with minimum phase noise, the initial small signal insertion loss was set to 6 dB and, hence, QL/Q0 = 1/2. To enable accurate analysis and simulation, S parameter and PSPICE models for the varactors were optimized and developed. It is shown that these resonators start to demonstrate nonlinear operation at very low power levels demonstrating saturation and lowering of the resonant frequency. On occasion squegging is observed for modified bias conditions. The nonlinear effects are dependent on the unloaded Q (Q0), the ratio of loaded to unloaded Q (QL/Q0), the bias voltage, and circuit configurations with typical nonlinear effects occurring at -8 dBm in a circuit with a loaded Q of 63 and a varactor bias voltage of 3 V. Analysis, simulation, and measurements that show close correlation are presented.

  8. The Characteristics of Vibration Isolation System with Damping and Stiffness Geometrically Nonlinear

    Science.gov (United States)

    Lu, Ze-Qi; Chen, Li-Qun; Brennan, Michael J.; Li, Jue-Ming; Ding, Hu

    2016-09-01

    The paper concerns an investigation into the use of both stiffness and damping nonlinearity in the vibration isolator to improve its effectiveness. The nonlinear damping and nonlinear stiffness are both achieved by horizontal damping and stiffness as the way of the geometrical nonlinearity. The harmonic balance method is used to analyze the force transmissibility of such vibration isolation system. It is found that as the horizontal damping increasing, the height of the force transmissibility peak is decreased and the high-frequency force transmissibility is almost the same. The results are also validated by some numerical method. Then the RMS of transmissibility under Gaussian white noise is calculated numerically, the results demonstrate that the beneficial effects of the damping nonlinearity can be achieved under random excitation.

  9. Selective virtual capacitive impedance loop for harmonics voltage compensation in islanded microgrids

    DEFF Research Database (Denmark)

    Micallef, Alexander; Apap, Maurice; Spiteri-Staines, Cyril

    2013-01-01

    Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead of in...... resistance for selective harmonic compensation in islanded microgrids. Simulation results were given to show the suitability of the proposed algorithms in reducing the voltage harmonics at the PCC.......Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead...... of introducing additional active or passive filters into the system that could compromise the stability of the microgrid. However, the performance of these compensation loops becomes degraded when a virtual resistance is introduced with the aim to improve the overall stability of the parallel inverters...

  10. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  11. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  12. Distributed nonlinear optical response

    DEFF Research Database (Denmark)

    Nikolov, Nikola Ivanov

    2005-01-01

    of bound states of out of phase bright solitons and dark solitons. Also, the newly introduced analogy between the nonlocal cubic nonlinear and the quadratic nonlinear media, presented in paper B and Chapter 3 is discussed. In particular it supplies intuitive physical meaning of the formation of solitons...... in quadratic nonlinear media. In the second part of the report (Chapter 4), the possibility to obtain light with ultrabroad spectrum due to the interplay of many nonlinear effects based on cubic nonlinearity is investigated thoroughly. The contribution of stimulated Raman scattering, a delayed nonlinear...... a modified nonlinear Schroedinger model equation. Chapter 4 and papers D and E are dedicated to this part of the research....

  13. Current-voltage characteristics of carbon nanotubes with substitutional nitrogen

    DEFF Research Database (Denmark)

    Kaun, C.C.; Larade, B.; Mehrez, H.

    2002-01-01

    unit cell generates a metallic transport behavior. Nonlinear I-V characteristics set in at high bias and a negative differential resistance region is observed for the doped tubes. These behaviors can be well understood from the alignment/mis-alignment of the current carrying bands in the nanotube leads......We report ab initio analysis of current-voltage (I-V) characteristics of carbon nanotubes with nitrogen substitution doping. For zigzag semiconducting tubes, doping with a single N impurity increases current flow and, for small radii tubes, narrows the current gap. Doping a N impurity per nanotube...

  14. Thyristor voltage converter in induction electric drives with microprocessor control

    Energy Technology Data Exchange (ETDEWEB)

    Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)

    1997-12-31

    The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.

  15. Metering error quantification under voltage and current waveform distortion

    Science.gov (United States)

    Wang, Tao; Wang, Jia; Xie, Zhi; Zhang, Ran

    2017-09-01

    With integration of more and more renewable energies and distortion loads into power grid, the voltage and current waveform distortion results in metering error in the smart meters. Because of the negative effects on the metering accuracy and fairness, it is an important subject to study energy metering combined error. In this paper, after the comparing between metering theoretical value and real recorded value under different meter modes for linear and nonlinear loads, a quantification method of metering mode error is proposed under waveform distortion. Based on the metering and time-division multiplier principles, a quantification method of metering accuracy error is proposed also. Analyzing the mode error and accuracy error, a comprehensive error analysis method is presented which is suitable for new energy and nonlinear loads. The proposed method has been proved by simulation.

  16. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  17. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  18. Survey of Transmission Cost Allocation Methodologies for Regional Transmission Organizations

    Energy Technology Data Exchange (ETDEWEB)

    Fink, S.; Porter, K.; Mudd, C.; Rogers, J.

    2011-02-01

    The report presents transmission cost allocation methodologies for reliability transmission projects, generation interconnection, and economic transmission projects for all Regional Transmission Organizations.

  19. Grounding modelling for transient overvoltage simulation in electric power transmission

    International Nuclear Information System (INIS)

    Moreno O, German; Valencia V, Jaime A; Villada, Fernando

    1992-01-01

    Grounding plays an important role in transmission line outages and consequently on electric energy transmission quality indexes. Fundamentals of an accurate modelling for transient behaviour analysis, particularly for the response of transmission lines to lightning, are presented. Also, a method to take into account the electromagnetic propagation guided by the grounding electrodes and finally to assess the grounding impedance in order to simulate the transmission line behaviour under lightning is presented. Analysis of impedance behaviour for diverse configurations and simulation results of over voltages on a real 220 kV line are presented to illustrate the capabilities of the method and of the computational program developed

  20. An Estimation Method of System Voltage Sag Profile using Recorded Sag Data

    Science.gov (United States)

    Tanaka, Kazuyuki; Sakashita, Tadashi

    The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.

  1. Current-voltage curves of atomic-sized transition metal contacts: An explanation of why Au is ohmic and Pt is not

    DEFF Research Database (Denmark)

    Nielsen, S.K.; Brandbyge, Mads; Hansen, K.

    2002-01-01

    We present an experimental study of current-voltage (I-V) curves on atomic-sized Au and Pt contacts formed under cryogenic vacuum (4.2 K). Whereas I-V curves for Au are almost Ohmic, the conductance G=I/V for Pt decreases with increasing voltage, resulting in distinct nonlinear I-V behavior...

  2. Nontrivial transition of transmission in a highly open quantum point contact in the quantum Hall regime

    Science.gov (United States)

    Hong, Changki; Park, Jinhong; Chung, Yunchul; Choi, Hyungkook; Umansky, Vladimir

    2017-11-01

    Transmission through a quantum point contact (QPC) in the quantum Hall regime usually exhibits multiple resonances as a function of gate voltage and high nonlinearity in bias. Such behavior is unpredictable and changes sample by sample. Here, we report the observation of a sharp transition of the transmission through an open QPC at finite bias, which was observed consistently for all the tested QPCs. It is found that the bias dependence of the transition can be fitted to the Fermi-Dirac distribution function through universal scaling. The fitted temperature matches quite nicely to the electron temperature measured via shot-noise thermometry. While the origin of the transition is unclear, we propose a phenomenological model based on our experimental results that may help to understand such a sharp transition. Similar transitions are observed in the fractional quantum Hall regime, and it is found that the temperature of the system can be measured by rescaling the quasiparticle energy with the effective charge (e*=e /3 ). We believe that the observed phenomena can be exploited as a tool for measuring the electron temperature of the system and for studying the quasiparticle charges of the fractional quantum Hall states.

  3. Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x

    International Nuclear Information System (INIS)

    Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O

    2006-01-01

    We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results

  4. Metamaterial-Enhanced Nonlinear Terahertz Spectroscopy

    Directory of Open Access Journals (Sweden)

    Zhang X.

    2013-03-01

    Full Text Available We demonstrate large nonlinear terahertz responses in the gaps of metamaterial split ring resonators in several materials and use nonlinear THz transmission and THz-pump/THz-probe spectroscopy to study the nonlinear responses and dynamics. We use the field enhancement in the SRR gaps to initiate high-field phenomena at lower incident fields. In vanadium dioxide, we drive the insulator-to-metal phase transition with high-field THz radiation. The film conductivity increases by over two orders of magnitude and the phase transition occurs on a several picosecond timescale. In gallium arsenide, we observe high-field transport phenomena, including mobility saturation and impact ionization. The carrier density increases by up to ten orders of magnitude at high fields. At the highest fields, we demonstrate THz-induced damage in both vanadium dioxide and gallium arsenide.

  5. An FFT-accelerated time-domain multiconductor transmission line simulator

    KAUST Repository

    Bagci, Hakan

    2010-02-01

    A fast time-domain multiconductor transmission line (MTL) simulator for analyzing general MTL networks is presented. The simulator models the networks as homogeneous MTLs that are excited by external fields and driven/terminated/ connected by potentially nonlinear lumped circuitry. It hybridizes an MTL solver derived from time-domain integral equations (TDIEs) in unknown wave coefficients for each MTL with a circuit solver rooted in modified nodal analysis equations in unknown node voltages and voltage-source currents for each circuit. These two solvers are rigorously interfaced at MTL and circuit terminals, and the resulting coupled system of equations is solved simultaneously for all MTL and circuit unknowns at each time step. The proposed simulator is amenable to hybridization, is fast Fourier transform (FFT)-accelerated, and is highly accurate: 1) It can easily be hybridized with TDIE-based field solvers (in a fully rigorous mathematical framework) for performing electromagnetic interference and compatibility analysis on electrically large and complex structures loaded with MTL networks. 2) It is accelerated by an FFT algorithm that calculates temporal convolutions of time-domain MTL Green functions in only O(Ntlog2 N t) rather than O(Ntt2) operations, where N t is the number of time steps of simulation. Moreover, the algorithm, which operates on temporal samples of MTL Green functions, is indifferent to the method used to obtain them. 3) It approximates MTL voltages, currents, and wave coefficients, using high-order temporal basis functions. Various numerical examples, including the crosstalk analysis of a (twisted) unshielded twisted-pair (UTP)-CAT5 cable and the analysis of field coupling into UTP-CAT5 and RG-58 cables located on an airplane, are presented to demonstrate the accuracy, efficiency, and versatility of the proposed simulator. © 2010 IEEE.

  6. Reactive Power Compensation of a 24 MW Wind Farm using a 12-Pulse Voltage Source Converter

    DEFF Research Database (Denmark)

    Pedersen, Knud Ole Helgesen; Pedersen, Jørgen Kaas

    1998-01-01

    Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop and investig......Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop...... and investigate the use of a STATCOM by modelling and field testing an 8 MVar unit in a 24 MW wind farm....

  7. Reconnection of the islanded portion of the CIGRE low voltage distribution network

    DEFF Research Database (Denmark)

    Bhutto, G.M.; Bak, Claus Leth; Somro, Duur M.

    2016-01-01

    Islanding is phenomena in which a part of the distribution grid is electrically disconnected from the main transmission system. Islanded operation is encouraged in order to operate the electrical power networks in reliable manners. However, the reliability of the small networks operating is island...... is less as compared to that of the grid connected system. The islanded portion of the distribution network can be reconnected to the transmission grid if the voltage magnitudes, voltage phase angles and the frequencies of the two systems are synchronized. The main objective of this paper is to facilitate...

  8. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  9. High voltage power network construction

    CERN Document Server

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  10. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  11. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  12. 40 Gb/s optical transmission systems

    DEFF Research Database (Denmark)

    Buxens Azcoaga, Alvaro Juan; Nielsen, Steen Krogh

    2003-01-01

    ; chromatic dispersion, Polarization Mode Dispersion (PMD), Self Phase Modulation (SPM) and linear or non-linear crosstalk among others. Regarding chromatic dispersion, sufficient evidence is presented for the need in 40 Gb/s systems of either modulation formats that allow for higher tolerance than....... Using a 9 ps pulsed RZ Tx, transmission is achieved over a 400 km link consisting of 5 spans of 80 km standard-SMF with a Quality (Q) factor of 17.7 dB, while for NRZ it is reduced to 15 dB. In another experimental verification over 40 km spans of standard-SMF, we could achieve transmission over 6 spans...

  13. Voltage linear transformation circuit design

    Science.gov (United States)

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  14. Nonlinear Dirac Equations

    Directory of Open Access Journals (Sweden)

    Wei Khim Ng

    2009-02-01

    Full Text Available We construct nonlinear extensions of Dirac's relativistic electron equation that preserve its other desirable properties such as locality, separability, conservation of probability and Poincaré invariance. We determine the constraints that the nonlinear term must obey and classify the resultant non-polynomial nonlinearities in a double expansion in the degree of nonlinearity and number of derivatives. We give explicit examples of such nonlinear equations, studying their discrete symmetries and other properties. Motivated by some previously suggested applications we then consider nonlinear terms that simultaneously violate Lorentz covariance and again study various explicit examples. We contrast our equations and construction procedure with others in the literature and also show that our equations are not gauge equivalent to the linear Dirac equation. Finally we outline various physical applications for these equations.

  15. Nonlinear graphene plasmonics

    Science.gov (United States)

    Ooi, Kelvin J. A.; Tan, Dawn T. H.

    2017-10-01

    The rapid development of graphene has opened up exciting new fields in graphene plasmonics and nonlinear optics. Graphene's unique two-dimensional band structure provides extraordinary linear and nonlinear optical properties, which have led to extreme optical confinement in graphene plasmonics and ultrahigh nonlinear optical coefficients, respectively. The synergy between graphene's linear and nonlinear optical properties gave rise to nonlinear graphene plasmonics, which greatly augments graphene-based nonlinear device performance beyond a billion-fold. This nascent field of research will eventually find far-reaching revolutionary technological applications that require device miniaturization, low power consumption and a broad range of operating wavelengths approaching the far-infrared, such as optical computing, medical instrumentation and security applications.

  16. Quantum dynamics of a Josephson junction driven cavity mode system in the presence of voltage bias noise

    Science.gov (United States)

    Wang, Hui; Blencowe, M. P.; Armour, A. D.; Rimberg, A. J.

    2017-09-01

    We give a semiclassical analysis of the average photon number as well as photon number variance (Fano factor F ) for a Josephson junction (JJ) embedded microwave cavity system, where the JJ is subject to a fluctuating (i.e., noisy) bias voltage with finite dc average. Through the ac Josephson effect, the dc voltage bias drives the effectively nonlinear microwave cavity mode into an amplitude squeezed state (F Armour et al., Phys. Rev. Lett. 111, 247001 (2013), 10.1103/PhysRevLett.111.247001], but bias noise acts to degrade this squeezing. We find that the sensitivity of the Fano factor to bias voltage noise depends qualitatively on which stable fixed point regime the system is in for the corresponding classical nonlinear steady-state dynamics. Furthermore, we show that the impact of voltage bias noise is most significant when the cavity is excited to states with large average photon number.

  17. Stationary nonlinear Airy beams

    International Nuclear Information System (INIS)

    Lotti, A.; Faccio, D.; Couairon, A.; Papazoglou, D. G.; Panagiotopoulos, P.; Tzortzakis, S.; Abdollahpour, D.

    2011-01-01

    We demonstrate the existence of an additional class of stationary accelerating Airy wave forms that exist in the presence of third-order (Kerr) nonlinearity and nonlinear losses. Numerical simulations and experiments, in agreement with the analytical model, highlight how these stationary solutions sustain the nonlinear evolution of Airy beams. The generic nature of the Airy solution allows extension of these results to other settings, and a variety of applications are suggested.

  18. Generalized Nonlinear Yule Models

    OpenAIRE

    Lansky, Petr; Polito, Federico; Sacerdote, Laura

    2016-01-01

    With the aim of considering models with persistent memory we propose a fractional nonlinear modification of the classical Yule model often studied in the context of macrovolution. Here the model is analyzed and interpreted in the framework of the development of networks such as the World Wide Web. Nonlinearity is introduced by replacing the linear birth process governing the growth of the in-links of each specific webpage with a fractional nonlinear birth process with completely general birth...

  19. The super high-voltage as examined from the ecological viewpoint, particularly considering the risk of biological damages and public rights

    International Nuclear Information System (INIS)

    Ubisch, H. von.

    1980-06-01

    The power-transmission lines utilizing system voltages of 800 kV, are justified by the long distances of transmission. The lines interfere in the landscape and may also affect human beings. The voltage is put in relation to alternative ways of energy transmission and thereafter to lower voltages and other electrical phenomena which have similar biological effects in the society. Possible causal connections are examined and available protective measures are pointed out. The general picture will simplify the appraisement of the biological observations and the relevance and validity of the postulates of environmental damage. The position taken to the question by all parties will thus be facilitated. (GB)

  20. Transmission Lines Loading Enhancement Using ADPSO Approach

    OpenAIRE

    M. Mahdavi; H. Monsef; A. Bagheri

    2010-01-01

    Discrete particle swarm optimization (DPSO) is a powerful stochastic evolutionary algorithm that is used to solve the large-scale, discrete and nonlinear optimization problems. However, it has been observed that standard DPSO algorithm has premature convergence when solving a complex optimization problem like transmission expansion planning (TEP). To resolve this problem an advanced discrete particle swarm optimization (ADPSO) is proposed in this paper. The simulation res...

  1. Nonlinear evolution equations

    CERN Document Server

    Uraltseva, N N

    1995-01-01

    This collection focuses on nonlinear problems in partial differential equations. Most of the papers are based on lectures presented at the seminar on partial differential equations and mathematical physics at St. Petersburg University. Among the topics explored are the existence and properties of solutions of various classes of nonlinear evolution equations, nonlinear imbedding theorems, bifurcations of solutions, and equations of mathematical physics (Navier-Stokes type equations and the nonlinear Schrödinger equation). The book will be useful to researchers and graduate students working in p

  2. Nonlinear Physics of Plasmas

    CERN Document Server

    Kono, Mitsuo

    2010-01-01

    A nonlinearity is one of the most important notions in modern physics. A plasma is rich in nonlinearities and provides a variety of behaviors inherent to instabilities, coherent wave structures and turbulence. The book covers the basic concepts and mathematical methods, necessary to comprehend nonlinear problems widely encountered in contemporary plasmas, but also in other fields of physics and current research on self-organized structures and magnetized plasma turbulence. The analyses make use of strongly nonlinear models solved by analytical techniques backed by extensive simulations and available experiments. The text is written for senior undergraduates, graduate students, lecturers and researchers in laboratory, space and fusion plasmas.

  3. Nonlinear optics at interfaces

    International Nuclear Information System (INIS)

    Chen, C.K.

    1980-12-01

    Two aspects of surface nonlinear optics are explored in this thesis. The first part is a theoretical and experimental study of nonlinear intraction of surface plasmons and bulk photons at metal-dielectric interfaces. The second part is a demonstration and study of surface enhanced second harmonic generation at rough metal surfaces. A general formulation for nonlinear interaction of surface plasmons at metal-dielectric interfaces is presented and applied to both second and third order nonlinear processes. Experimental results for coherent second and third harmonic generation by surface plasmons and surface coherent antiStokes Raman spectroscopy (CARS) are shown to be in good agreement with the theory

  4. Nonlinear drift tearing mode

    International Nuclear Information System (INIS)

    Zelenyj, L.M.; Kuznetsova, M.M.

    1989-01-01

    Nonlinear study of magnetic perturbation development under single-mode conditions in collision-free plasma in configurations with the magnetic field shear is investigated. Results are obtained with regard of transverse component of electrical field and its effect on ion dynamics within wide range of ion Larmor radius value and values of magnetic field shear. Increments of nonlinear drift tearing mode are obtained and it is shown that excitation drastic conditions of even linearly stable modes are possible. Mechanism of instability nonlinear stabilization is considered and the value of magnetic island at the saturation threshold is estimeted. Energy of nonlinear drift tearing mode is discussed

  5. Nanoplasmonic solution for nonlinear optics

    DEFF Research Database (Denmark)

    Bache, Morten; Lavrinenko, Andrei; Lysenko, Oleg

    2014-01-01

    for the silicon dioxide cladding. The blue, cyan and magenta curves correspond to the transmission spectra for the gold waveguides with the width of 10 μm and length of 2, 3, and 4 mm.The polarization of laser beam was tuned to match the transverse magnetic mode of surface plasmonpolaritons in the gold waveguides...... and is being under investigation in recent years [3].The purpose of our research is to study nonlinear optical properties of gold waveguides embedded intodielectric medium (silicon dioxide) using picosecond laser spectroscopy. The work includes modeling ofoptical properties of gold waveguides, fabrication...... of prototype samples, and optical characterization ofsamples using a picosecond laser source.The prototype samples of gold waveguides embedded into silicon dioxide were fabricated at DTUDanchip. A silicon wafer with pre-made 6.5 μm layer of silicon dioxide was used as a substrate and goldwaveguides (films...

  6. Magnetically insulated transmission line oscillator

    Science.gov (United States)

    Bacon, L.D.; Ballard, W.P.; Clark, M.C.; Marder, B.M.

    1987-05-19

    A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields are produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap. 11 figs.

  7. The prediction and prevention of voltage collapse in the Finnish power system

    Energy Technology Data Exchange (ETDEWEB)

    Bastman, J; Lakervi, E [Tampere Univ. of Tech. (Finland); Hirvonen, R; Kuronen, P; Hagman, E [IVO Group (Finland)

    1994-12-31

    The Finnish power system is a part of the Nordic power system (NORDEL), which includes Finland, Sweden, Norway and the eastern part of Denmark. In NORDEL the transmission distances are long, which implies that the power transmission capacities are determined by stability criteria . The methods to prevent and predict the voltage collapse during severe disturbances are studied using advances simulation program. Results are presented. (author) 10 figs., 1 tab.

  8. Atypical Exit Wound in High-Voltage Electrocution.

    Science.gov (United States)

    Parakkattil, Jamshid; Kandasamy, Shanmugam; Das, Siddhartha; Devnath, Gerard Pradeep; Chaudhari, Vinod Ashok; Shaha, Kusa Kumar

    2017-12-01

    Electrocution fatality cases are difficult to investigate. High-voltage electrocution burns resemble burns caused by other sources, especially if the person survives for few days. In that case, circumstantial evidence if correlated with the autopsy findings helps in determining the cause and manner of death. In addition, the crime scene findings also help to explain the pattern of injuries observed at autopsy. A farmer came in contact with a high-voltage transmission wire and sustained superficial to deep burns over his body. A charred and deeply scorched area was seen over the face, which was suggestive of the electric entry wound. The exit wound was present over both feet and lower leg and was atypical in the form of a burnt area of peeled blistered skin, charring, and deep scorching. The injuries were correlated with crime scene findings, and the circumstances that lead to his electrocution are discussed here.

  9. DESIGN AND IMPLEMENTATION OF POTENTIOMETER-BASED NONLINEAR TRANSDUCER EMULATOR

    Directory of Open Access Journals (Sweden)

    Sheroz Khan

    2011-05-01

    Full Text Available This work attempts to design and implement in hardware a transducer with a nonlinear response using potentiometer. Potentiometer is regarded as a linear transducer, while a the response of a nonlinear transducer can be treated as a concatenation of linear segments made out of the response curve of an actual nonlinear transducer at the points of inflections being exhibited by the nonlinear curve. Each straight line segment is characterized by its slope and a constant, called the y-intercept, which is ultimately realized by a corresponding electronic circuit. The complete circuit diagram is made of three stages: (i the input stage for range selection, (ii a digital logic to make appropriate selection, (iii a conditioning circuit for realizing a given straight-line segment identified by its relevant slope and reference voltage. The simulation of the circuit is carried using MULTISIM, and the designed circuit is afterward tested to verify that variations of the input voltage give us an output voltage very close to the response pattern envisaged in the analytical stage of the design. The utility of this work lies in its applications in emulating purpose built transducers that could be used to nicely emulate a transducer in a real world system that is to be controlled by a programmable digital system.

  10. Polarization Nonlinear Optics of Quadratically Nonlinear Azopolymers

    International Nuclear Information System (INIS)

    Konorov, S.O.; Akimov, D.A.; Ivanov, A.A.; Petrov, A.N.; Alfimov, M.V.; Yakimanskii, A.V.; Smirnov, N.N.; Ivanova, V.N.; Kudryavtsev, V.V.; Podshivalov, A.A.; Sokolova, I.M.; Zheltikov, A.M.

    2005-01-01

    The polarization properties of second harmonic and sum-frequency signals generated by femtosecond laser pulses in films of polymers containing covalent groups of an azobenzothiazole chromophore polarized by an external electric field are investigated. It is shown that the methods of polarization nonlinear optics make it possible to determine the structure of oriented molecular dipoles and reveal important properties of the motion of collectivized πelectrons in organic molecules with strong optical nonlinearities. The polarization measurements show that the tensor of quadratic nonlinear optical susceptibility of chromophore fragments oriented by an external field in macromolecules of the noted azopolymers has a degenerate form. This is indicative of a predominantly one-dimensional character of motion of collectivized π electrons along an extended group of atoms in such molecules

  11. ANALYSIS AND SIMULATION OF MAIN MAGNET TRANSMISSION LINE EFFECT

    Energy Technology Data Exchange (ETDEWEB)

    ZHANG,W.; MARNERIS, I.; SANDBERG, J.

    2007-06-25

    A main magnet chain forms a pair of transmission lines. Pulse-reflection-caused voltage and current differentiation throughout the magnet chain can have adverse effect on main magnet field quality. This effect is associated with magnet system configuration, coupling efficiency, and parasitic parameters. A better understanding of this phenomenon will help us in new design and existing system upgrade. In this paper, we exam the transmission line effect due to different input functions as well as configuration, coupling, and other parameters.

  12. Offshore VSC-HVDC Networks : Impact on Transient Stability of AC Transmission Systems

    NARCIS (Netherlands)

    van der Meer, A.A.

    2017-01-01

    The transition towards a sustainable society calls for the massive deployment of renewable energy sources such as large wind parks located far offshore. High-voltage direct current transmission based on voltage sourced converter technology (VSC-HVDC) offers a wide range of technological benefits

  13. Nanopore Current Oscillations: Nonlinear Dynamics on the Nanoscale.

    Science.gov (United States)

    Hyland, Brittany; Siwy, Zuzanna S; Martens, Craig C

    2015-05-21

    In this Letter, we describe theoretical modeling of an experimentally realized nanoscale system that exhibits the general universal behavior of a nonlinear dynamical system. In particular, we consider the description of voltage-induced current fluctuations through a single nanopore from the perspective of nonlinear dynamics. We briefly review the experimental system and its behavior observed and then present a simple phenomenological nonlinear model that reproduces the qualitative behavior of the experimental data. The model consists of a two-dimensional deterministic nonlinear bistable oscillator experiencing both dissipation and random noise. The multidimensionality of the model and the interplay between deterministic and stochastic forces are both required to obtain a qualitatively accurate description of the physical system.

  14. Analyzing randomly occurring voltage breakdowns

    International Nuclear Information System (INIS)

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  15. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  16. High-voltage CMOS detectors

    International Nuclear Information System (INIS)

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  17. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  18. High-voltage CMOS detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  19. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  20. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)