A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
Glen, Katie E; Workman, Victoria L; Ahmed, Forhad; Ratcliffe, Elizabeth; Stacey, Adrian J; Thomas, Robert J
2013-09-01
Economic ex vivo manufacture of erythrocytes at 10(12) cell doses requires an efficiently controlled bio-process capable of extensive proliferation and high terminal density. High-resolution characterization of the process would identify production strategies for increased efficiency, monitoring and control. CD34(+) cord blood cells or equivalent cells that had been pre-expanded for 7 days with Delta1 Notch ligand were placed in erythroid expansion and differentiation conditions in a micro-scale ambr suspension bioreactor. Multiple culture parameters were varied, and phenotype markers and metabolites measured to identify conserved trends and robust monitoring markers. The cells exhibited a bi-modal erythroid differentiation pattern with an erythroid marker peak after 2 weeks and 3 weeks of culture; differentiation was comparatively weighted toward the second peak in Delta1 pre-expanded cells. Both differentiation events were strengthened by omission of stem cell factor and dexamethasone. The cumulative cell proliferation and death, or directly measured CD45 expression, enabled monitoring of proliferative rate of the cells. The metabolic activities of the cultures (glucose, glutamine and ammonia consumption or production) were highly variable but exhibited systematic change synchronized with the change in differentiation state. Erythroid differentiation chronology is partly determined by the heterogeneous CD34(+) progenitor compartment with implications for input control; Delta1 ligand-mediated progenitor culture can alter differentiation profile with control benefits for engineering production strategy. Differentiation correlated changes in cytokine response, markers and metabolic state will enable scientifically designed monitoring and timing of manufacturing process steps. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
In vivo dosimetric impact of breast tissue expanders on post-mastectomy radiotherapy
International Nuclear Information System (INIS)
Gee, Harriet E.; Bignell, Fiona; Odgers, David; Gill, Simran; Martin, Darren; Toohey, Joanne; Carroll, Susan
2016-01-01
Temporary tissue expanders with metallic ports for gradual saline injection are increasingly employed to facilitate breast reconstruction after post-mastectomy radiotherapy (PMRT). Treatment beams therefore pass through a high-density rare-earth magnet. Measurements ex vivo suggest attenuation of dose to the skin and chest wall at clinical risk of relapse. The purpose of the study was to quantify the resulting dose reduction in vivo, compared with treatment planning system (TPS). Sixteen patients receiving PMRT had in vivo dosimetry prospectively performed with ethics board approval. Port was located within the expanded chest wall using the planning CT scan. Strips of radiochromic film were laid on the skin surface underneath the bolus. To aid interpretation, ex vivo measurements were also performed, including comparison with TPS predictions. An average 7% reduction in dose to skin surface was measured in 15 of 16 patients. This was reproducibly located in the ‘shadow’ of the magnet, corresponding to each of the paths of the medial and lateral tangents. The average area was 1.07 cm2 (range 0.39 cm2 to 2.36 cm2). Ex vivo measurements confirmed attenuation of the beam in the shadow of the port. The surface area of the ‘cold-spot’ varied with angle of the beam relative to the metallic port. Dose attenuation in vivo differed from that predicted by the TPS. Dose is attenuated in the ‘shadow’ of the tissue expander port in patients receiving PMRT. This is likely to be clinically insignificant for most, but centres should undertake appropriate measurements before utilising TPS predictions.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
Gunetti, Monica; Noghero, Alessio; Molla, Fabiola; Staszewsky, Lidia Irene; de Angelis, Noeleen; Soldo, Annarita; Russo, Ilaria; Errichiello, Edoardo; Frasson, Chiara; Rustichelli, Deborah; Ferrero, Ivana; Gualandris, Anna; Berger, Massimo; Geuna, Massimo; Scacciatella, Paolo; Basso, Giuseppe; Marra, Sebastiano; Bussolino, Federico; Latini, Roberto; Fagioli, Franca
2011-10-01
Bone marrow (BM)-derived cells appear to be a promising therapeutic source for the treatment of acute myocardial infarction (AMI). However, the quantity and quality of the cells to be used, along with the appropriate time of administration, still need to be defined. We thus investigated the use of BM CD34(+)-derived cells as cells suitable for a cell therapy protocol (CTP) in the treatment of experimental AMI. The need for a large number of cells was satisfied by the use of a previously established protocol allowing the expansion of human CD34(+) cells isolated from neonatal and adult hematopoietic tissues. We evaluated gene expression, endothelial differentiation potential and cytokine release by BM-derived cells during in vitro culture. Basal and expanded CD34(+) cells were used as a delivery product in a murine AMI model consisting of a coronary artery ligation (CAL). Cardiac function recovery was evaluated after injecting basal or expanded cells. Gene expression analysis of in vitro-expanded cells revealed that endothelial markers were up-regulated during culture. Moreover, expanded cells generated a CD14(+) subpopulation able to differentiate efficiently into VE-cadherin-expressing cells. In vivo, we observed a cardiac function recovery in mice sequentially treated with basal and expanded cells injected 4 h and 7 days after CAL, respectively. Our data suggest that combining basal and expanded BM-derived CD34(+) cells in a specific temporal pattern of administration might represent a promising strategy for a successful cell-based therapy.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Directory of Open Access Journals (Sweden)
Okjae Lim
Full Text Available Ex vivo-expanded, allogeneic natural killer (NK cells can be used for the treatment of various types of cancer. In allogeneic NK cell therapy, NK cells from healthy donors must be expanded in order to obtain a sufficient number of highly purified, activated NK cells. In the present study, we established a simplified and efficient method for the large-scale expansion and activation of NK cells from healthy donors under good manufacturing practice (GMP conditions. After a single step of magnetic depletion of CD3(+ T cells, the depleted peripheral blood mononuclear cells (PBMCs were stimulated and expanded with irradiated autologous PBMCs in the presence of OKT3 and IL-2 for 14 days, resulting in a highly pure population of CD3(-CD16(+CD56(+ NK cells which is desired for allogeneic purpose. Compared with freshly isolated NK cells, these expanded NK cells showed robust cytokine production and potent cytolytic activity against various cancer cell lines. Of note, expanded NK cells selectively killed cancer cells without demonstrating cytotoxicity against allogeneic non-tumor cells in coculture assays. The anti-tumor activity of expanded human NK cells was examined in SCID mice injected with human lymphoma cells. In this model, expanded NK cells efficiently controlled lymphoma progression. In conclusion, allogeneic NK cells were efficiently expanded in a GMP-compliant facility and demonstrated potent anti-tumor activity both in vitro and in vivo.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Directory of Open Access Journals (Sweden)
Heiner Falkenberg
2013-01-01
Full Text Available Ex vivo expansion of haematopoetic cells by application of specific cytokines is one approach to overcome boundaries in cord blood transplantation due to limited numbers of haematopoetic stem cells. While many protocols describe an effective increase of total cell numbers and the amount of CD34-positive cells, it still remains unclear if and how the procedure actually affects the cells’ properties. In the presented publications, CD34-positive cells were isolated from cord blood and expanded for up to 7 days in media supplemented with stem cell factor (SCF, thrombopoietin (THPO, interleukin 6 (IL-6, and fms-related tyrosine kinase 3 ligand (FLT3lg. At days 3 and 7, expanded cells were harvested and analyzed by flow cytometry and quantitative proteomics. 2970 proteins were identified, whereof proteomic analysis showed 440 proteins significantly changed in abundance during ex vivo expansion. Despite the fact that haematopoetic cells still expressed CD34 on the surface after 3 days, major changes in regard to the protein profile were observed, while further expansion showed less effect on the proteome level. Enrichment analysis of biological processes clearly showed a proteomic change toward a protein biosynthesis phenotype already within the first three days of expression.
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
A novel orbital tissue expander (OTE): design, in vitro, and in vivo studies
Lee, Elizabete; Tse, David; Pinchuk, Leonard; Acosta, Ana C.; Martin, John B.; Davis, Stewart B.; Hernandez, Eleut; Yamamoto, Hideo; Denham, David B.; Dubovy, Sander; Parel, Jean-Marie
2006-02-01
Purpose: To assess the efficacy of a novel orbital tissue expander (OTE) in treating congenital anophthalmic and microphthalmic infants. Methods: The OTE implant is an inflatable (0.5 to >6cc) silicone rubber globe sliding on a titanium T-shaped bone plate secured to the temporal bone with 1mm titanium screws. In vitro testing was performed to assess injection volume versus diameter measurements to determine consistency between devices, flex fatigue for durability of the implants when compressed, weight change in isotonic saline at 37°C to mimic human body temperature, seal durability by puncturing the globe numerous times while inflating, capacity before rupture to determine the maximum amount of saline it is able to contain, and effective sterilization. Ex-vivo testing was performed for adjustments prior to in vivo study. An OTE was then implanted in five 2-week old kittens (OS only) and inflated in 0.5cc increments. Three control animals received enucleation alone. All 8 animals were followed for 18 weeks and underwent euthanasia for morphological and histopathological analysis. Results: In vitro testing confirmed a effects in the normal maturation, weight gain, and food intake of the cats. Light microscopy showed no signs of foreign body reaction. Pictures of the implants were obtained by using a shadow-photogrammetry system to compare the explanted OTE with the OD control eye. Conclusion: In vitro and in vivo studies show the implant's potential to safely treat anophthalmic and microphthalmic infants.
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
In Vitro Comparison of Self-Expanding Versus Balloon-Expandable Stents in a Human Ex Vivo Model
International Nuclear Information System (INIS)
Grenacher, Lars; Rohde, Stefan; Gaenger, Ellen; Deutsch, Jochen; Kauffmann, Guenter W.; Richter, Goetz M.
2006-01-01
The objective was to compare the radial strength and expansile precision of self-expanding stents and balloon-expandable stents in a human cadaver bifurcation model. Seven different self-expanding (LUMINEXX, JOSTENT SelfX, JOSTENT SelfX hrf, Sinus-Repo, Sinus SuperFlex, Easy Wallstent, SMART) and four different balloon-expandable stent models (Palmaz, Sinus Stent, SAXX Medium, JOSTENT peripheral), each type 10 stents (total n = 110 stents) were implanted into the common iliac arteries of human cadaver corpses. The maximum stent diameter was 10 mm for all models. After stent implantation, the specimens were filled with silicone caoutchouc. After 24 h, the vascular walls including the stents were removed from the hardened casts. Diameters were taken and the weight of the cast cylinders was measured in air and in purified water to calculate the volume of the bodies (according to Archimedes Law) as a relative but precise degree for the radial strength of the implanted stents. The cylindrical casts of the self-expanding stents showed lower mean diameters (8.2 ± 1.0 mm) and mean volumes (0.60 ± 0.14 ml/cm) than in the balloon-expandable stent group (10.1 ± 0.3 mm and 0.71 ± 0.04 ml/cm, respectively; p < 0.01). The nominal maximum diameter of 10 mm was not achieved in any of the self-expanding stents, but this was achieved in more than 70% (29/40) of the balloon-expandable stent specimens (p < 0.05). The variation between achieved volumes was significantly larger in self-expanding (range: 0.23-0.78 ml/cm) than in balloon-expandable stents (range: 0.66-0.81 ml/cm; p < 0.05). Self-expanding stents presented considerably lower radial expansion force and lower degree of precision than balloon-expandable stents
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Løvdal, Alexandra Liv Vest, E-mail: alvlo@nanotech.dtu.dk [Technical University of Denmark, Department of Micro- and Nanotechnology (Denmark); Calve, Sarah [Purdue University, Weldon School of Biomedical Engineering (United States); Yang, Shuo; Alstine, William Van [Cook Research Incorporated (United States); Binkert, Christoph A. [Institut für Radiologie, Kantonsspital Winterthur (Switzerland); Klausen, Kasper [William Cook Europe (Denmark)
2017-01-15
PurposeThis study was designed to evaluate performance and tissue response to a self-expandable bioabsorbable vein stent-base cut from a tube with enhanced stiffness and strength in vitro and in vivo.MethodsA diamond-shaped stent-base was cut from a sequential biaxially strained poly(l-lactide) (PLLA) tube for optimized performance. The performance of the stent-base was evaluated in a finite element analysis model, and validation was attempted in vitro through a cyclic flat-plate compression and radial force measurement. The performance of the stent-base was tested in vivo using 3 sheep with 2 implants each for 2 and 3½ weeks, respectively.ResultsIn vitro the stent-base showed an elliptical deformation but no fractures. In vivo the stent-base showed adequate radial force and no migration. All implanted stent-bases showed multiple fractures not only at the predicted stress zones but at all connecting points. Fragments of the caudal stent-base stayed in the vein wall indicating sufficient tissue coverage to avoid embolization of the fractured stent pieces, whereas fragments from the cranial device remaining were few. Neointima formation was confirmed histologically at 2 and 3½ weeks.ConclusionA bioabsorbable self-expandable stent-base made from PLLA for large veins seems feasible, but over time, the PLLA used in this study appears too stiff and lacks the sufficient flexibility to move with the vena cava, causing multiple fractures.
Løvdal, Alexandra Liv Vest; Calve, Sarah; Yang, Shuo; Van Alstine, William; Binkert, Christoph A; Klausen, Kasper
2017-01-01
This study was designed to evaluate performance and tissue response to a self-expandable bioabsorbable vein stent-base cut from a tube with enhanced stiffness and strength in vitro and in vivo. A diamond-shaped stent-base was cut from a sequential biaxially strained poly(L-lactide) (PLLA) tube for optimized performance. The performance of the stent-base was evaluated in a finite element analysis model, and validation was attempted in vitro through a cyclic flat-plate compression and radial force measurement. The performance of the stent-base was tested in vivo using 3 sheep with 2 implants each for 2 and 3½ weeks, respectively. In vitro the stent-base showed an elliptical deformation but no fractures. In vivo the stent-base showed adequate radial force and no migration. All implanted stent-bases showed multiple fractures not only at the predicted stress zones but at all connecting points. Fragments of the caudal stent-base stayed in the vein wall indicating sufficient tissue coverage to avoid embolization of the fractured stent pieces, whereas fragments from the cranial device remaining were few. Neointima formation was confirmed histologically at 2 and 3½ weeks. A bioabsorbable self-expandable stent-base made from PLLA for large veins seems feasible, but over time, the PLLA used in this study appears too stiff and lacks the sufficient flexibility to move with the vena cava, causing multiple fractures.
International Nuclear Information System (INIS)
Løvdal, Alexandra Liv Vest; Calve, Sarah; Yang, Shuo; Alstine, William Van; Binkert, Christoph A.; Klausen, Kasper
2017-01-01
PurposeThis study was designed to evaluate performance and tissue response to a self-expandable bioabsorbable vein stent-base cut from a tube with enhanced stiffness and strength in vitro and in vivo.MethodsA diamond-shaped stent-base was cut from a sequential biaxially strained poly(l-lactide) (PLLA) tube for optimized performance. The performance of the stent-base was evaluated in a finite element analysis model, and validation was attempted in vitro through a cyclic flat-plate compression and radial force measurement. The performance of the stent-base was tested in vivo using 3 sheep with 2 implants each for 2 and 3½ weeks, respectively.ResultsIn vitro the stent-base showed an elliptical deformation but no fractures. In vivo the stent-base showed adequate radial force and no migration. All implanted stent-bases showed multiple fractures not only at the predicted stress zones but at all connecting points. Fragments of the caudal stent-base stayed in the vein wall indicating sufficient tissue coverage to avoid embolization of the fractured stent pieces, whereas fragments from the cranial device remaining were few. Neointima formation was confirmed histologically at 2 and 3½ weeks.ConclusionA bioabsorbable self-expandable stent-base made from PLLA for large veins seems feasible, but over time, the PLLA used in this study appears too stiff and lacks the sufficient flexibility to move with the vena cava, causing multiple fractures.
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
Directory of Open Access Journals (Sweden)
MM Pleumeekers
2014-04-01
Full Text Available Cartilage has limited self-regenerative capacity. Tissue engineering can offer promising solutions for reconstruction of missing or damaged cartilage. A major challenge herein is to define an appropriate cell source that is capable of generating a stable and functional matrix. This study evaluated the performance of culture-expanded human chondrocytes from ear (EC, nose (NC and articular joint (AC, as well as bone-marrow-derived and adipose-tissue-derived mesenchymal stem cells both in vitro and in vivo. All cells (≥ 3 donors per source were culture-expanded, encapsulated in alginate and cultured for 5 weeks. Subsequently, constructs were implanted subcutaneously for 8 additional weeks. Before and after implantation, glycosaminoglycan (GAG and collagen content were measured using biochemical assays. Mechanical properties were determined using stress-strain-indentation tests. Hypertrophic differentiation was evaluated with qRT-PCR and subsequent endochondral ossification with histology. ACs had higher chondrogenic potential in vitro than the other cell sources, as assessed by gene expression and GAG content (p < 0.001. However, after implantation, ACs did not further increase their matrix. In contrast, ECs and NCs continued producing matrix in vivo leading to higher GAG content (p < 0.001 and elastic modulus. For NC-constructs, matrix-deposition was associated with the elastic modulus (R2 = 0.477, p = 0.039. Although all cells – except ACs – expressed markers for hypertrophic differentiation in vitro, there was no bone formed in vivo. Our work shows that cartilage formation and functionality depends on the cell source used. ACs possess the highest chondrogenic capacity in vitro, while ECs and NCs are most potent in vivo, making them attractive cell sources for cartilage repair.
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Directory of Open Access Journals (Sweden)
Yaw A Nyame
2017-01-01
Full Text Available Renal transplantation has profound improvements in mortality, morbidity, and overall quality of life compared to renal replacement therapy. This report aims to illustrate the use of ex-vivo partial nephrectomy in a patient with a renal angiomyolipoma prior to living donor transplantation. The surgical outcomes of the donor nephrectomy and recipient transplantation are reported with 2 years of follow-up. Both the donor and recipient are healthy and without any significant comorbidities. In conclusion, urologic techniques such as partial nephrectomy can be used to expand the living donor pool in carefully selected and well informed transplant recipients. Our experience demonstrated a safe and positive outcome for both the recipient and donor, and is consistent with other reported outcomes in the literature.
Directory of Open Access Journals (Sweden)
Manuel Wiesinger
2017-10-01
Full Text Available In recent years, the exploration of regulatory T cell (Treg-based cellular therapy has become an attractive strategy to ameliorate inflammation and autoimmunity in various clinical settings. The main obstacle to the clinical application of Treg in human is their low number circulating in peripheral blood. Therefore, ex vivo expansion is inevitable. Moreover, isolation of Treg bears the risk of concurrent isolation of unwanted effector cells, which may trigger or deteriorate inflammation upon adoptive Treg transfer. Here, we present a protocol for the GMP-compliant production, lot-release and validation of ex vivo expanded Tregs for treatment of patients with autoimmune and inflammatory disorders. In the presented production protocol, large numbers of Treg, previously enriched from a leukapheresis product by using the CliniMACS® system, are ex vivo expanded in the presence of anti-CD3/anti-CD28 expander beads, exogenous IL-2 and rapamycin during 21 days. The expanded Treg drug product passed predefined lot-release criteria. These criteria include (i sterility testing, (ii assessment of Treg phenotype, (iii assessment of non-Treg cellular impurities, (iv confirmation of successful anti-CD3/anti-CD28 expander bead removal after expansion, and (v confirmation of the biological function of the Treg product. Furthermore, the Treg drug product was shown to retain its stability and suppressive function for at least 1 year after freezing and thawing. Also, dilution of the Treg drug product in 0.9% physiological saline did not affect Treg phenotype and Treg function for up to 90 min. These data indicate that these cells are ready to use in a clinical setting in which a cell infusion time of up to 90 min can be expected. The presented production process has recently undergone on site GMP-conform evaluation and received GMP certification from the Bavarian authorities in Germany. This protocol can now be used for Treg-based therapy of various
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
Erythropoiesis in the aged mouse. I. Response to stimulation in vivo
International Nuclear Information System (INIS)
Udupa, K.B.; Lipschitz, D.A.
1984-01-01
Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Doulatov, Sergei; Vo, Linda T.; Chou, Stephanie S.; Kim, Peter G.; Arora, Natasha; Li, Hu; Hadland, Brandon K.; Bernstein, Irwin D.; Collins, James J.; Zon, Leonard I.; Daley, George Q.
2013-01-01
Summary Human pluripotent stem cells (hPSCs) represent a promising source of patient-specific cells for disease modeling, drug screens, and cellular therapies. However, the inability to derive engraftable human hematopoietic stem and progenitor (HSPCs) has limited their characterization to in vitro assays. We report a strategy to re-specify lineage-restricted CD34+CD45+ myeloid precursors derived from hPSCs into multilineage progenitors that can be expanded in vitro and engraft in vivo. HOXA9, ERG, and RORA conferred self-renewal and multilineage potential in vitro and maintained primitive CD34+CD38− cells. Screening cells via transplantation revealed that two additional factors, SOX4 and MYB, were required for engraftment. Progenitors specified with all five factors gave rise to reproducible short-term engraftment with myeloid and erythroid lineages. Erythroid precursors underwent hemoglobin switching in vivo, silencing embryonic and activating adult globin expression. Our combinatorial screening approach establishes a strategy for obtaining transcription factor-mediated engraftment of blood progenitors from human pluripotent cells. PMID:24094326
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
DEFF Research Database (Denmark)
Løvdal, Alexandra Liv Vest; Calve, Sarah; Yang, Shuo
2017-01-01
implants each for 2 and 3½ weeks, respectively. Results In vitro the stent-base showed an elliptical deformation but no fractures. In vivo the stent-base showed adequate radial force and no migration. All implanted stent-bases showed multiple fractures not only at the predicted stress zones but at all...... A bioabsorbable self-expandable stent-base made from PLLA for large veins seems feasible, but over time, the PLLA used in this study appears too stiff and lacks the sufficient flexibility to move with the vena cava, causing multiple fractures....
Swan, Marc C; Bucknall, David G; Czernuszka, Jan T; Pigott, David W; Goodacre, Timothy E E
2012-01-01
The advent of self-inflating hydrogel tissue expanders heralded a significant advance in the reconstructive potential of this technique. Their use, however, is limited by their uncontrolled isotropic (i.e., uniform in all directions) expansion. Anisotropy (i.e., directional dependence) was achieved by annealing a hydrogel copolymer of poly(methyl methacrylate-co-vinyl pyrrolidone) under a compressive load for a specified time period. The expansion ratio is dictated by the percentage of vinyl pyrrolidone content and the degree of compression. The expansion rate is modified by incorporating the polymer within a silicone membrane. The in vivo efficacy of differing prototype devices was investigated in juvenile pigs under United Kingdom Home Office Licence. The devices were implanted within a submucoperiosteal pocket in a total of six porcine palates; all were euthanized by 6 weeks after implantation. A longitudinal volumetric assessment of the expanded tissue was conducted, in addition to postmortem analysis of the bony and mucoperiosteal palatal elements. Uncoated devices caused excessive soft-tissue expansion that resulted in mucoperiosteal ulceration, thus necessitating animal euthanasia. The silicone-coated devices produced controlled soft-tissue expansion over the 6-week study period. There was a statistically significant increase in the volume of expanded soft tissue with no evidence of a significant acute inflammatory response to the implant, although peri-implant capsule formation was observed. Attenuation of the bony palatal shelf was noted. A unique anisotropic hydrogel device capable of controlled expansion has been developed that addresses a number of the shortcomings of the technology hitherto available.
Concise review: stem cell-derived erythrocytes as upcoming players in blood transfusion.
Zeuner, Ann; Martelli, Fabrizio; Vaglio, Stefania; Federici, Giulia; Whitsett, Carolyn; Migliaccio, Anna Rita
2012-08-01
Blood transfusions have become indispensable to treat the anemia associated with a variety of medical conditions ranging from genetic disorders and cancer to extensive surgical procedures. In developed countries, the blood supply is generally adequate. However, the projected decline in blood donor availability due to population ageing and the difficulty in finding rare blood types for alloimmunized patients indicate a need for alternative red blood cell (RBC) transfusion products. Increasing knowledge of processes that govern erythropoiesis has been translated into efficient procedures to produce RBC ex vivo using primary hematopoietic stem cells, embryonic stem cells, or induced pluripotent stem cells. Although in vitro-generated RBCs have recently entered clinical evaluation, several issues related to ex vivo RBC production are still under intense scrutiny: among those are the identification of stem cell sources more suitable for ex vivo RBC generation, the translation of RBC culture methods into clinical grade production processes, and the development of protocols to achieve maximal RBC quality, quantity, and maturation. Data on size, hemoglobin, and blood group antigen expression and phosphoproteomic profiling obtained on erythroid cells expanded ex vivo from a limited number of donors are presented as examples of the type of measurements that should be performed as part of the quality control to assess the suitability of these cells for transfusion. New technologies for ex vivo erythroid cell generation will hopefully provide alternative transfusion products to meet present and future clinical requirements. Copyright © 2012 AlphaMed Press.
Long-term in-vivo tumorigenic assessment of human culture-expanded adipose stromal/stem cells
Energy Technology Data Exchange (ETDEWEB)
MacIsaac, Zoe Marie, E-mail: zmm4a@virgina.edu [University of Virginia (United States); Shang, Hulan, E-mail: shanghulan@gmail.com [Department of Plastic Surgery, University of Virginia (United States); Agrawal, Hitesh, E-mail: hiteshdos@hotmail.com [Department of Plastic Surgery, University of Virginia (United States); Yang, Ning, E-mail: ny6u@virgina.edu [Department of Plastic Surgery, University of Virginia (United States); Parker, Anna, E-mail: amp4v@virginia.edu [Department of Surgery, University of Virginia (United States); Katz, Adam J., E-mail: ajk2f@virginia.edu [Department of Plastic Surgery, University of Virginia (United States)
2012-02-15
After more than a decade of extensive experimentation, the promise of stem cells to revolutionize the field of medicine has negotiated their entry into clinical trial. Adipose tissue specifically holds potential as an attainable and abundant source of stem cells. Currently undergoing investigation are adipose stem cell (ASC) therapies for diabetes and critical limb ischemia, among others. In the enthusiastic pursuit of regenerative therapies, however, questions remain regarding ASC persistence and migration, and, importantly, their safety and potential for neoplasia. To date, assays of in vivo ASC activity have been limited by early end points. We hypothesized that with time, ASCs injected subcutaneously undergo removal by normal tissue turnover and homeostasis, and by the host's immune system. In this study, a high dose of culture expanded ASCs was formulated and implanted as multicellular aggregates into immunocompromised mice, which were maintained for over one year. Animals were monitored for toxicity, and surviving cells quantified at study endpoint. No difference in growth/weight or lifespan was found between cell-treated and vehicle treated animals, and no malignancies were detected in treated animals. Moreover, real-time PCR for a human specific sequence, ERV-3, detected no persistent ASCs. With the advent of clinical application, clarification of currently enigmatic stem cell properties has become imperative. Our study represents the longest duration determination of stem cell activity in vivo, and contributes strong evidence in support of the safety of adipose derived stem cell applications. -- Highlights: Black-Right-Pointing-Pointer Adipose stem cells promise novel clinical therapies. Black-Right-Pointing-Pointer Before clinical translation, safety profiles must be further elucidated. Black-Right-Pointing-Pointer Subcutaneously injected non-autologous adipose stem cells do not form tumors. Black-Right-Pointing-Pointer Subcutaneously injected non
Long-term in-vivo tumorigenic assessment of human culture-expanded adipose stromal/stem cells
International Nuclear Information System (INIS)
MacIsaac, Zoe Marie; Shang, Hulan; Agrawal, Hitesh; Yang, Ning; Parker, Anna; Katz, Adam J.
2012-01-01
After more than a decade of extensive experimentation, the promise of stem cells to revolutionize the field of medicine has negotiated their entry into clinical trial. Adipose tissue specifically holds potential as an attainable and abundant source of stem cells. Currently undergoing investigation are adipose stem cell (ASC) therapies for diabetes and critical limb ischemia, among others. In the enthusiastic pursuit of regenerative therapies, however, questions remain regarding ASC persistence and migration, and, importantly, their safety and potential for neoplasia. To date, assays of in vivo ASC activity have been limited by early end points. We hypothesized that with time, ASCs injected subcutaneously undergo removal by normal tissue turnover and homeostasis, and by the host's immune system. In this study, a high dose of culture expanded ASCs was formulated and implanted as multicellular aggregates into immunocompromised mice, which were maintained for over one year. Animals were monitored for toxicity, and surviving cells quantified at study endpoint. No difference in growth/weight or lifespan was found between cell-treated and vehicle treated animals, and no malignancies were detected in treated animals. Moreover, real-time PCR for a human specific sequence, ERV-3, detected no persistent ASCs. With the advent of clinical application, clarification of currently enigmatic stem cell properties has become imperative. Our study represents the longest duration determination of stem cell activity in vivo, and contributes strong evidence in support of the safety of adipose derived stem cell applications. -- Highlights: ► Adipose stem cells promise novel clinical therapies. ► Before clinical translation, safety profiles must be further elucidated. ► Subcutaneously injected non-autologous adipose stem cells do not form tumors. ► Subcutaneously injected non-autologous adipose stem cells undergo complete removal by one year.
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Asai, Jun; Takenaka, Hideya; Ii, Masaaki; Asahi, Michio; Kishimoto, Saburo; Katoh, Norito; Losordo, Douglas W
2013-10-01
Impaired wound healing leading to skin ulceration is a serious complication of diabetes and may be caused by defective angiogenesis. Endothelial progenitor cells (EPCs) can augment neovascularisation in the ischaemic tissue. Experiments were performed to test the hypothesis that locally administered EPCs can promote wound healing in diabetes. Full-thickness skin wounds were created on the dorsum of diabetic mice. EPCs were obtained from bone marrow mononuclear cells (BMMNCs) and applied topically to the wound immediately after surgery. Vehicle and non-selective BMMNCs were used as controls. Wound size was measured on days 5, 10 and 14 after treatment, followed by resection, histological analysis and quantification of vascularity. Topical application of EPCs significantly promoted wound healing, as assessed by closure rate and wound vascularity. Immunostaining revealed that transplanted EPCs induced increased expression of vascular endothelial growth factor and basic fibroblast growth factor. Few EPCs were observed in the neovasculature based on in vivo staining of the functional vasculature. Ex vivo expanded EPCs promote wound healing in diabetic mice via mechanisms involving increased local cytokine expression and enhanced neovascularisation of the wound. This strategy exploiting the therapeutic capacity of autologously derived EPCs may be a novel approach to skin repair in diabetes. © 2012 The Authors. International Wound Journal © 2012 John Wiley & Sons Ltd and Medicalhelplines.com Inc.
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Gori, Jennifer L; Butler, Jason M; Kunar, Balvir; Poulos, Michael G; Ginsberg, Michael; Nolan, Daniel J; Norgaard, Zachary K; Adair, Jennifer E; Rafii, Shahin; Kiem, Hans-Peter
2017-03-01
Successful expansion of bone marrow (BM) hematopoietic stem and progenitor cells (HSPCs) would benefit many HSPC transplantation and gene therapy/editing applications. However, current expansion technologies have been limited by a loss of multipotency and self-renewal properties ex vivo. We hypothesized that an ex vivo vascular niche would provide prohematopoietic signals to expand HSPCs while maintaining multipotency and self-renewal. To test this hypothesis, BM autologous CD34 + cells were expanded in endothelial cell (EC) coculture and transplanted in nonhuman primates. CD34 + C38 - HSPCs cocultured with ECs expanded up to 17-fold, with a significant increase in hematopoietic colony-forming activity compared with cells cultured with cytokines alone (colony-forming unit-granulocyte-erythroid-macrophage-monocyte; p < .005). BM CD34 + cells that were transduced with green fluorescent protein lentivirus vector and expanded on ECs engrafted long term with multilineage polyclonal reconstitution. Gene marking was observed in granulocytes, lymphocytes, platelets, and erythrocytes. Whole transcriptome analysis indicated that EC coculture altered the expression profile of 75 genes in the BM CD34 + cells without impeding the long-term engraftment potential. These findings show that an ex vivo vascular niche is an effective platform for expansion of adult BM HSPCs. Stem Cells Translational Medicine 2017;6:864-876. © 2016 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
Drug discovery for Diamond-Blackfan anemia using reprogrammed hematopoietic progenitors
Doulatov, Sergei; Vo, Linda T.; Macari, Elizabeth R.; Wahlster, Lara; Kinney, Melissa A.; Taylor, Alison M.; Barragan, Jessica; Gupta, Manav; McGrath, Katherine; Lee, Hsiang-Ying; Humphries, Jessica M.; DeVine, Alex; Narla, Anupama; Alter, Blanche P.; Beggs, Alan H.; Agarwal, Suneet; Ebert, Benjamin L.; Gazda, Hanna T.; Lodish, Harvey F.; Sieff, Colin A.; Schlaeger, Thorsten M.; Zon, Leonard I.; Daley, George Q.
2017-01-01
Diamond-Blackfan anemia (DBA) is a congenital disorder characterized by the failure of erythroid progenitor differentiation, severely curtailing red blood cell production. Because many DBA patients fail to respond to corticosteroid therapy, there is considerable need for therapeutics for this disorder. Identifying therapeutics for DBA requires circumventing the paucity of primary patient blood stem and progenitor cells. To this end, we adopted a reprogramming strategy to generate expandable hematopoietic progenitor cells from induced pluripotent stem cells (iPSCs) from DBA patients. Reprogrammed DBA progenitors recapitulate defects in erythroid differentiation, which were rescued by gene complementation. Unbiased chemical screens identified SMER28, a small-molecule inducer of autophagy, which enhanced erythropoiesis in a range of in vitro and in vivo models of DBA. SMER28 acted through autophagy factor ATG5 to stimulate erythropoiesis and up-regulate expression of globin genes. These findings present an unbiased drug screen for hematological disease using iPSCs and identify autophagy as a therapeutic pathway in DBA. PMID:28179501
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
In vivo protein-DNA interactions at the β-globin gene locus
International Nuclear Information System (INIS)
Tohru Ikuta; Yuet Wai Kan
1991-01-01
The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Sadat Hashemi, Zahra; Forouzandeh Moghadam, Mahdi; Soleimani, Masoud
2013-10-01
Ex vivo expansion of hematopoitic stem cells is an alternative way to increase umbilical cord blood (UCB)-CD34+ cells for bone marrow transplantation. For this purpose demineralized bone matrix (DBM) and mineralized bone allograft (MBA) as two scaffolds based on bone matrix and stem cell niche, were simultaneously used to enhance the effect of human mesenchymal progenitor cells (MPCs) - unrestricted somatic stem cells (USSCs) - as a feeder layer. USSCs were isolated and characterized by morphological and immunological analysis then seeded on both scaffolds as a feeder layer. UCB-CD34(+) were isolated by MACS method and were co-culture expanded by USSC in 3D and 2D environments. After 3 weeks expansion, cells were counted and were assessed by karyotype, flow cytometry, clonogenic activity, and long-term culture-initiating cells (LTC-IC). Co-culture expansion in DBM and MBA was 29.22-fold and 27.77-fold, no significant differences in colony and LTC-IC were obtained. Maximum number of colonies belonged to the day 14 with the 73% CFU-GM (Colony Forming Unit- Granulocyte/Macrophage) in contrast to the day 0 which was BFU-E/CFU-E (Burst/Colony Forming Unit-Erythroid). Flow cytometry indicated that the percentage of CD34+ marker was decreased in USSC co-culture and the highest percentage was observed in simple 2D culture. Because of acid extraction in the DBM production process, mineral materials were removed and the protein background that was more flexible was presented. Therefore these results suggest that USSC-DBM can be a suitable ex vivo mimicry niche by intensifying of surface/volume ratio and supporting the stem cell differentiation and expansion.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
Petropoulos, Demetrios; Chan, Ka Wah
2009-11-01
Success of umbilical cord blood transplantation (UCBT) is mostly affected by the cell dose infused and its application is limited by the size of the recipient. For most adults and older children it is not possible to find a single UCB unit large enough for reliable engraftment. One strategy to increase the number of progenitor cells available is ex vivo expansion of the unit. The main challenge of ex vivo expansion systems is how not to deplete the self-renewing cell population by driving them into differentiation into committed progenitors. Copper modulates basic cell functions, such as survival, proliferation, and differentiation. Reduction of cellular copper in ex vivo culture conditions enabled preferential proliferation of early progenitors and increased engraftment capabilities. The result of a Phase I study of carlecortemcel-l, a product derived from ex vivo expansion of UCB progenitors in the presence of a copper chelator and early-acting cytokines, and the study design for the current pivotal study are presented. A literature review using PubMed and the investigator's brochure from the manufacturer. Early results suggest that carlecortemcel-l infusion is safe and may be associated with favorable non-relapse mortality rates. A pivotal global study is currently being conducted to evaluate safety and efficacy of this product from centralized manufacturing facilities.
CD1d(hi)CD5+ B cells expanded by GM-CSF in vivo suppress experimental autoimmune myasthenia gravis.
Sheng, Jian Rong; Quan, Songhua; Soliven, Betty
2014-09-15
IL-10-competent subset within CD1d(hi)CD5(+) B cells, also known as B10 cells, has been shown to regulate autoimmune diseases. Whether B10 cells can prevent or suppress the development of experimental autoimmune myasthenia gravis (EAMG) has not been studied. In this study, we investigated whether low-dose GM-CSF, which suppresses EAMG, can expand B10 cells in vivo, and whether adoptive transfer of CD1d(hi)CD5(+) B cells would prevent or suppress EAMG. We found that treatment of EAMG mice with low-dose GM-CSF increased the proportion of CD1d(hi)CD5(+) B cells and B10 cells. In vitro coculture studies revealed that CD1d(hi)CD5(+) B cells altered T cell cytokine profile but did not directly inhibit T cell proliferation. In contrast, CD1d(hi)CD5(+) B cells inhibited B cell proliferation and its autoantibody production in an IL-10-dependent manner. Adoptive transfer of CD1d(hi)CD5(+) B cells to mice could prevent disease, as well as suppress EAMG after disease onset. This was associated with downregulation of mature dendritic cell markers and expansion of regulatory T cells resulting in the suppression of acetylcholine receptor-specific T cell and B cell responses. Thus, our data have provided significant insight into the mechanisms underlying the tolerogenic effects of B10 cells in EAMG. These observations suggest that in vivo or in vitro expansion of CD1d(hi)CD5(+) B cells or B10 cells may represent an effective strategy in the treatment of human myasthenia gravis. Copyright © 2014 by The American Association of Immunologists, Inc.
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Cashman, J D; Clark-Lewis, I; Eaves, A C; Eaves, C J
1999-12-01
Nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice transplanted with human cord blood or adult marrow cells and injected 6 weeks posttransplant with 2 daily doses of transforming growth factor-beta(1) (TGF-beta(1)), monocyte chemoattractant protein-1 (MCP-1), or a nonaggregating form of macrophage inflammatory protein-1alpha (MIP-1alpha) showed unique patterns of inhibition of human progenitor proliferation 1 day later. TGF-beta(1) was active on long-term culture initiating cells (LTC-IC) and on primitive erythroid and granulopoietic colony-forming cells (HPP-CFC), but had no effect on mature CFC. MCP-1 inhibited the cycling of both types of HPP-CFC but not LTC-IC. MIP-1alpha did not inhibit either LTC-IC or granulopoietic HPP-CFC but was active on erythroid HPP-CFC and mature granulopoietic CFC. All of these responses were independent of the source of human cells transplanted. LTC-IC of either human cord blood or adult marrow origin continue to proliferate in NOD/SCID mice for many weeks, although the turnover of all types of human CFC in mice transplanted with adult human marrow (but not cord blood) is downregulated after 6 weeks. Interestingly, administration of either MIP-1beta, an antagonist of both MIP-1alpha and MCP-1 or MCP-1(9-76), an antagonist of MCP-1 (and MCP-2 and MCP-3), into mice in which human marrow-derived CFC had become quiescent, caused the rapid reactivation of these progenitors in vivo. These results provide the first definition of stage-specific inhibitors of human hematopoietic progenitor cell cycling in vivo. In addition they show that endogenous chemokines can contribute to late graft failure, which can be reversed by the administration of specific antagonists.
Directory of Open Access Journals (Sweden)
Chuan Jin
2014-01-01
Full Text Available Adoptive T-cell therapy of cancer is a treatment strategy where T cells are isolated, activated, in some cases engineered, and expanded ex vivo before being reinfused to the patient. The most commonly used T-cell expansion methods are either anti-CD3/CD28 antibody beads or the “rapid expansion protocol” (REP, which utilizes OKT-3, interleukin (IL-2, and irradiated allogeneic feeder cells. However, REP-expanded or bead-expanded T cells are sensitive to the harsh tumor microenvironment and often short-lived after reinfusion. Here, we demonstrate that when irradiated and preactivated allosensitized allogeneic lymphocytes (ASALs are used as helper cells to license OKT3-armed allogeneic mature dendritic cells (DCs, together they expand target T cells of high quality. The ASAL/DC combination yields an enriched Th1-polarizing cytokine environment (interferon (IFN-γ, IL-12, IL-2 and optimal costimulatory signals for T-cell stimulation. When genetically engineered antitumor T cells were expanded by this coculture system, they showed better survival and cytotoxic efficacy under oxidative stress and immunosuppressive environment, as well as superior proliferative response during tumor cell killing compared to the REP protocol. Our result suggests a robust ex vivo method to expand T cells with improved quality for adoptive cancer immunotherapy.
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Ex vivo expansion of hematopoietic stem cell by fusion protein TAT-Zfx
International Nuclear Information System (INIS)
Xu Chong; Zhang Yanbing; Jiang Hua
2009-01-01
The relative inability of hemopoietic stem cells (HSCs) to reproduce themselves (self-renew) ex vivo imposes substantial limitations on the current use of HSC transplantation. Recently, the transcription factor Zfx has been demonstrated that played an important in controlling the self-renewal of hematopoietic stem cells. Here, we reported that Zfx could enable high-level expansion of HSCs in vitro, by combination of protein transduction domain, TAT. Furthermore, we also demonstrated that expanded HSCs population retains their normal in vivo potential of pluripotency. It is thus that TAT-Zfx has the potential to expand HSCs significantly in vitro, and will have enormous clinical potentials.
Combined in vivo and ex vivo analysis of mesh mechanics in a porcine hernia model.
Kahan, Lindsey G; Lake, Spencer P; McAllister, Jared M; Tan, Wen Hui; Yu, Jennifer; Thompson, Dominic; Brunt, L Michael; Blatnik, Jeffrey A
2018-02-01
Hernia meshes exhibit variability in mechanical properties, and their mechanical match to tissue has not been comprehensively studied. We used an innovative imaging model of in vivo strain tracking and ex vivo mechanical analysis to assess effects of mesh properties on repaired abdominal walls in a porcine model. We hypothesized that meshes with dissimilar mechanical properties compared to native tissue would alter abdominal wall mechanics more than better-matched meshes. Seven mini-pigs underwent ventral hernia creation and subsequent open repair with one of two heavyweight polypropylene meshes. Following mesh implantation with attached radio-opaque beads, fluoroscopic images were taken at insufflation pressures from 5 to 30 mmHg on postoperative days 0, 7, and 28. At 28 days, animals were euthanized and ex vivo mechanical testing performed on full-thickness samples across repaired abdominal walls. Testing was conducted on 13 mini-pig controls, and on meshes separately. Stiffness and anisotropy (the ratio of stiffness in the transverse versus craniocaudal directions) were assessed. 3D reconstructions of repaired abdominal walls showed stretch patterns. As pressure increased, both meshes expanded, with no differences between groups. Over time, meshes contracted 17.65% (Mesh A) and 0.12% (Mesh B; p = 0.06). Mesh mechanics showed that Mesh A deviated from anisotropic native tissue more than Mesh B. Compared to native tissue, Mesh A was stiffer both transversely and craniocaudally. Explanted repaired abdominal walls of both treatment groups were stiffer than native tissue. Repaired tissue became less anisotropic over time, as mesh properties prevailed over native abdominal wall properties. This technique assessed 3D stretch at the mesh level in vivo in a porcine model. While the abdominal wall expanded, mesh-ingrown areas contracted, potentially indicating stresses at mesh edges. Ex vivo mechanics demonstrate that repaired tissue adopts mesh properties, suggesting
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
ExpandED Options: Learning beyond High School Walls
ExpandED Schools, 2014
2014-01-01
Through ExpandED Options by TASC, New York City high school students get academic credit for learning career-related skills that lead to paid summer jobs. Too many high school students--including those most likely to drop out--are bored or see classroom learning as irrelevant. ExpandED Options students live the connection between mastering new…
Hoch, Allison I; Duhr, Ralph; Di Maggio, Nunzia; Mehrkens, Arne; Jakob, Marcel; Wendt, David
2017-12-01
Bone marrow-derived mesenchymal stromal cells (BMSC), when expanded directly within 3D ceramic scaffolds in perfusion bioreactors, more reproducibly form bone when implanted in vivo as compared to conventional expansion on 2D polystyrene dishes/flasks. Since the bioreactor-based expansion on 3D ceramic scaffolds encompasses multiple aspects that are inherently different from expansion on 2D polystyrene, we aimed to decouple the effects of specific parameters among these two model systems. We assessed the effects of the: 1) 3D scaffold vs. 2D surface; 2) ceramic vs. polystyrene materials; and 3) BMSC niche established within the ceramic pores during in vitro culture, on subsequent in vivo bone formation. While BMSC expanded on 3D polystyrene scaffolds in the bioreactor could maintain their in vivo osteogenic potential, results were similar as BMSC expanded in monolayer on 2D polystyrene, suggesting little influence of the scaffold 3D environment. Bone formation was most reproducible when BMSC are expanded on 3D ceramic, highlighting the influence of the ceramic substrate. The presence of a pre-formed niche within the scaffold pores had negligible effects on the in vivo bone formation. The results of this study allow a greater understanding of the parameters required for perfusion bioreactor-based manufacturing of osteogenic grafts for clinical applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Vascular Endothelial Growth Factor Sequestration Enhances In Vivo Cartilage Formation
Directory of Open Access Journals (Sweden)
Carolina M. Medeiros Da Cunha
2017-11-01
Full Text Available Autologous chondrocyte transplantation for cartilage repair still has unsatisfactory clinical outcomes because of inter-donor variability and poor cartilage quality formation. Re-differentiation of monolayer-expanded human chondrocytes is not easy in the absence of potent morphogens. The Vascular Endothelial Growth Factor (VEGF plays a master role in angiogenesis and in negatively regulating cartilage growth by stimulating vascular invasion and ossification. Therefore, we hypothesized that its sole microenvironmental blockade by either VEGF sequestration by soluble VEGF receptor-2 (Flk-1 or by antiangiogenic hyperbranched peptides could improve chondrogenesis of expanded human nasal chondrocytes (NC freshly seeded on collagen scaffolds. Chondrogenesis of several NC donors was assessed either in vitro or ectopically in nude mice. VEGF blockade appeared not to affect NC in vitro differentiation, whereas it efficiently inhibited blood vessel ingrowth in vivo. After 8 weeks, in vivo glycosaminoglycan deposition was approximately two-fold higher when antiangiogenic approaches were used, as compared to the control group. Our data indicates that the inhibition of VEGF signaling, independently of the specific implementation mode, has profound effects on in vivo NC chondrogenesis, even in the absence of chondroinductive signals during prior culture or at the implantation site.
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Farahbakhshian, Elnaz; Verstegen, Monique M; Visser, Trudi P; Kheradmandkia, Sima; Geerts, Dirk; Arshad, Shazia; Riaz, Noveen; Grosveld, Frank; van Til, Niek P; Meijerink, Jules P P
2014-01-01
Allogeneic hematopoietic stem cell (HSC) transplantations from umbilical cord blood or autologous HSCs for gene therapy purposes are hampered by limited number of stem cells. To test the ability to expand HSCs in vitro prior to transplantation, two growth factor cocktails containing stem cell factor, thrombopoietin, fms-related tyrosine kinase-3 ligand (STF) or stem cell factor, thrombopoietin, insulin-like growth factor-2, fibroblast growth factor-1 (STIF) either with or without the addition of angiopoietin-like protein-3 (Angptl3) were used. Culturing HSCs in STF and STIF media for 7 days expanded long-term repopulating stem cells content in vivo by ∼6-fold and ∼10-fold compared to freshly isolated stem cells. Addition of Angptl3 resulted in increased expansion of these populations by ∼17-fold and ∼32-fold, respectively, and was further supported by enforced expression of Angptl3 in HSCs through lentiviral transduction that also promoted HSC expansion. As expansion of highly purified lineage-negative, Sca-1+, c-Kit+ HSCs was less efficient than less pure lineage-negative HSCs, Angptl3 may have a direct effect on HCS but also an indirect effect on accessory cells that support HSC expansion. No evidence for leukemia or toxicity was found during long-term follow up of mice transplanted with ex vivo expanded HSCs or manipulated HSC populations that expressed Angptl3. We conclude that the cytokine combinations used in this study to expand HSCs ex vivo enhances the engraftment in vivo. This has important implications for allogeneic umbilical cord-blood derived HSC transplantations and autologous HSC applications including gene therapy.
Single-shot spiral imaging enabled by an expanded encoding model: Demonstration in diffusion MRI.
Wilm, Bertram J; Barmet, Christoph; Gross, Simon; Kasper, Lars; Vannesjo, S Johanna; Haeberlin, Max; Dietrich, Benjamin E; Brunner, David O; Schmid, Thomas; Pruessmann, Klaas P
2017-01-01
The purpose of this work was to improve the quality of single-shot spiral MRI and demonstrate its application for diffusion-weighted imaging. Image formation is based on an expanded encoding model that accounts for dynamic magnetic fields up to third order in space, nonuniform static B 0 , and coil sensitivity encoding. The encoding model is determined by B 0 mapping, sensitivity mapping, and concurrent field monitoring. Reconstruction is performed by iterative inversion of the expanded signal equations. Diffusion-tensor imaging with single-shot spiral readouts is performed in a phantom and in vivo, using a clinical 3T instrument. Image quality is assessed in terms of artefact levels, image congruence, and the influence of the different encoding factors. Using the full encoding model, diffusion-weighted single-shot spiral imaging of high quality is accomplished both in vitro and in vivo. Accounting for actual field dynamics, including higher orders, is found to be critical to suppress blurring, aliasing, and distortion. Enhanced image congruence permitted data fusion and diffusion tensor analysis without coregistration. Use of an expanded signal model largely overcomes the traditional vulnerability of spiral imaging with long readouts. It renders single-shot spirals competitive with echo-planar readouts and thus deploys shorter echo times and superior readout efficiency for diffusion imaging and further prospective applications. Magn Reson Med 77:83-91, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.
DEFF Research Database (Denmark)
Lyngbaek, Stig; Ripa, Rasmus S; Haack-Sørensen, Mandana
2010-01-01
This pilot trial aimed to investigate the utilization of (111)In-labeling of mesenchymal stromal cells (MSC) for in vivo tracking after intramyocardial transplantation in a xenotransplantation model with gender mismatched cells. Human male MSC were expanded ex vivo and labeled with (111)In...
DEFF Research Database (Denmark)
Lyngbæk, Stig; Ripa, Rasmus Sejersten; Haack-Sørensen, Mandana
2009-01-01
This pilot trial aimed to investigate the utilization of (111)In-labeling of mesenchymal stromal cells (MSC) for in vivo tracking after intramyocardial transplantation in a xenotransplantation model with gender mismatched cells. Human male MSC were expanded ex vivo and labeled with (111)In...
In vivo NMR spectroscopy of the liver. Spectroscopie RMN du foie in vivo
Energy Technology Data Exchange (ETDEWEB)
Jehenson, P.; Cuenod, C.A.; Syrota, A. (CEA, 91 - Orsay (FR). Service Hospitalier Frederic Joliot)
1989-01-01
The application of in vivo MR spectroscopy to the study of the liver is currently an expanding field of research. Owing to technical difficulties, the results obtained thus far were mainly those of animal observations. Several nuclei have been considered: hydrogen, phosphorus, carbon or fluorine. This non-traumatic method allows following and quantifying the various metabolic pathways, especially during hepatic diseases. The major metabolic pathways, i.e. neoglycogenesis, glycogenolysis, Krebs' cycle, etc., are studied, as well as their alterations during diseases such as ischemia, diabetes or alcoholism. The development of this promising technique requires the cooperation of various clinical and fundamental disciplines.
Tissue expander infections in children: look beyond the expander pocket.
Mason, A C; Davison, S P; Manders, E K
1999-11-01
Infection of the expander pocket is the most common complication encountered with soft-tissue expansion. It is usually due to direct inoculation with skin flora either at the time of expander insertion or from extrusion of the device. The authors report two cases of infection of tissue expanders in which the children had concomitant infected sites distant from the prosthesis. Etiological bacteria of common pediatric infections like otitis media and pharyngitis were cultured from the infected expander pocket, raising suspicion that translocation of the organism to the expander had occurred. Aggressive antibiotic treatment, removal of the prosthesis, and flap advancement is advocated.
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
Bagnara, Davide; Ibatici, Adalberto; Corselli, Mirko; Sessarego, Nadia; Tenca, Claudya; De Santanna, Amleto; Mazzarello, Andrea; Daga, Antonio; Corvò, Renzo; De Rossi, Giulio; Frassoni, Francesco; Ciccone, Ermanno; Fais, Franco
2009-07-01
CD1d is a monomorphic antigen presentation molecule expressed in several hematologic malignancies. Alpha-galactosylceramide (alpha-GalCer) is a glycolipid that can be presented to cytotoxic CD1d-restricted T cells. These reagents represent a potentially powerful tool for cell mediated immunotherapy. We set up an experimental model to evaluate the use of adoptively transferred cytotoxic CD1d-restricted T cells and alpha-GalCer in the treatment of mice engrafted with CD1d(+) lymphoid neoplastic cells. To this end the C1R cell line was transfected with CD1c or CD1d molecules. In addition, upon retroviral infection firefly luciferase was expressed on C1R transfected cell lines allowing the evaluation of tumor growth in xenografted immunodeficient NOD/SCID mice. The C1R-CD1d cell line was highly susceptible to specific CD1d-restricted T cell cytotoxicity in the presence alpha-GalCer in vitro. After adoptive transfer of CD1d-restricted T cells and alpha-GalCer to mice engrafted with both C1R-CD1c and C1R-CD1d, a reduction in tumor growth was observed only in CD1d(+) masses. In addition, CD1d-restricted T-cell treatment plus alpha-GalCer eradicated small C1R-CD1d(+) nodules. Immunohistochemical analysis revealed that infiltrating NKT cells were mainly observed in CD1d nodules. Our results indicate that ex vivo expanded cytotoxic CD1d-restricted T cells and alpha-GalCer may represent a new immunotherapeutic tool for treatment of CD1d(+) hematologic malignancies.
Ex-vivo expansion of nonhuman primate CD34+ cells by stem cell factor Sall4B
Directory of Open Access Journals (Sweden)
Bin Shen
2016-10-01
Full Text Available Abstract Background Hematopoietic CD34+ stem cells are widely used in the clinical therapy of complicated blood diseases. Stem cell factor Sall4B is a zinc finger transcription factor that plays a vital role in hematopoietic stem cell expansion. The purpose of our current study is to further evaluate how Sall4B might affect the expansion of CD34+ cells derived from nonhuman primates. Methods Sall4B was overexpressed in nonhuman primate bone marrow-derived CD34+ cells via a lentiviral transduction system. The granulocyte–erythrocyte–macrophage–megakaryocyte colony-forming unit (CFU assay evaluated the differentiation potential of primate CD34+ cells that were expanded with Sall4B. Furthermore, an in-vivo murine system was employed to evaluate the hematopoietic potential of primate Sall4B-expanded CD34+ cells. Results Overexpression of Sall4B promoted ex-vivo nonhuman primate CD34+ cell expansion by 9.21 ± 1.94-fold on day 9, whereas lentiviral transduction without Sall4B expanded cells by only 2.95 ± 0.77-fold. Sall4B maintained a significant percentage of CD34+ cells as well. The CFU assay showed that the Sall4B-expanded CD34+ cells still possessed multilineage differentiation potential. A study using nonobese diabetic/severe combined immunodeficiency (NOD/SCID mice in vivo revealed that Sall4B led to an increase in the number of repopulating cells and the 9-day-old Sall4B-transduced CD34+ cells still possess self-renewal and multilineage differentiation capacity in vivo, which are similar stemness characteristics to those in freshly isolated primate bone marrow-derived CD34+ cells. Conclusions We investigated the expansion of nonhuman primate bone marrow-derived CD34+ cells using the Sall4B lentiviral overexpression approach; our findings provide a new perspective on mechanisms of rapid stem cell proliferation. The utilization of Sall4B to expand CD34+ cells on a large scale through use of suitable model systems would prove
Interleukin-3 greatly expands non-adherent endothelial forming cells with pro-angiogenic properties
Directory of Open Access Journals (Sweden)
Lachlan M. Moldenhauer
2015-05-01
Full Text Available Circulating endothelial progenitor cells (EPCs provide revascularisation for cardiovascular disease and the expansion of these cells opens up the possibility of their use as a cell therapy. Herein we show that interleukin-3 (IL3 strongly expands a population of human non-adherent endothelial forming cells (EXnaEFCs with low immunogenicity as well as pro-angiogenic capabilities in vivo, making their therapeutic utilisation a realistic option. Non-adherent CD133+ EFCs isolated from human umbilical cord blood and cultured under different conditions were maximally expanded by day 12 in the presence of IL3 at which time a 350-fold increase in cell number was obtained. Cell surface marker phenotyping confirmed expression of the hematopoietic progenitor cell markers CD133, CD117 and CD34, vascular cell markers VEGFR2 and CD31, dim expression of CD45 and absence of myeloid markers CD14 and CD11b. Functional experiments revealed that EXnaEFCs exhibited classical properties of endothelial cells (ECs, namely binding of Ulex europaeus lectin, up-take of acetylated-low density lipoprotein and contribution to EC tube formation in vitro. These EXnaEFCs demonstrated a pro-angiogenic phenotype within two independent in vivo rodent models. Firstly, a Matrigel plug assay showed increased vascularisation in mice. Secondly, a rat model of acute myocardial infarction demonstrated reduced heart damage as determined by lower levels of serum creatinine and a modest increase in heart functionality. Taken together, these studies show IL3 as a potent growth factor for human CD133+ cell expansion with clear pro-angiogenic properties (in vitro and in vivo and thus may provide clinical utility for humans in the future.
Nesbitt, J C; Carrasco, H
1996-05-01
Expandable metallic stents are effective in selected patients with malignant or benign airway stenoses. When used for malignant lesions, the primary purpose of the stent is to improve the quality of life; stents are usually chosen for palliation of symptoms in recognition of the low likelihood of success for other therapy. For patients with benign stenoses, the stents provide a permanent source of structural support to alleviate the narrowed segment. The advantages of the expandable metallic stents are as follows: (1) they can be inserted through an endotracheal tube or under local anesthesia with relative simplicity under fluoroscopic guidance; (2) they do not impair the drainage of sputum because ciliary movement is not interrupted; (3) over a period of a few weeks, the meshwork is gradually covered with mucosa as the stent becomes incorporated into the airway wall; (4) ventilation usually is not impaired if the metallic mesh stent covers another nonstenosed bronchus, because the interstices of the stent are nonobstructive; and (5) they are dynamic and continue to expand over time, particularly if concurrent treatment achieves an effect on the lesion that caused stenosis. Disadvantages of the expandable stent include (1) they often are only temporarily effective for tracheobronchial stenosis due to intraluminal tumor or granulation tissue, both of which can grow between the wires; (2) they are considered permanent stents because removal is difficult; and (3) they can be poorly positioned during placement or can become displaced by progressive migration after placement, and they cannot be repositioned. A relative contraindication to insertion is an inflammatory process or infection that can predispose to granulation formation, particularly at the points of maximal contact pressure of the stent to the airway mucosa. In the presence of inflammation, it may be better to use a silicone prosthesis until the inflammatory process subsides and fibrosis occurs. Granulation
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Marco Gabbianelli
2009-11-01
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Using exomarkers to assess mitochondrial reactive species in vivo.
Logan, Angela; Cochemé, Helena M; Li Pun, Pamela Boon; Apostolova, Nadezda; Smith, Robin A J; Larsen, Lesley; Larsen, David S; James, Andrew M; Fearnley, Ian M; Rogatti, Sebastian; Prime, Tracy A; Finichiu, Peter G; Dare, Anna; Chouchani, Edward T; Pell, Victoria R; Methner, Carmen; Quin, Caroline; McQuaker, Stephen J; Krieg, Thomas; Hartley, Richard C; Murphy, Michael P
2014-02-01
The ability to measure the concentrations of small damaging and signalling molecules such as reactive oxygen species (ROS) in vivo is essential to understanding their biological roles. While a range of methods can be applied to in vitro systems, measuring the levels and relative changes in reactive species in vivo is challenging. One approach towards achieving this goal is the use of exomarkers. In this, exogenous probe compounds are administered to the intact organism and are then transformed by the reactive molecules in vivo to produce a diagnostic exomarker. The exomarker and the precursor probe can be analysed ex vivo to infer the identity and amounts of the reactive species present in vivo. This is akin to the measurement of biomarkers produced by the interaction of reactive species with endogenous biomolecules. Our laboratories have developed mitochondria-targeted probes that generate exomarkers that can be analysed ex vivo by mass spectrometry to assess levels of reactive species within mitochondria in vivo. We have used one of these compounds, MitoB, to infer the levels of mitochondrial hydrogen peroxide within flies and mice. Here we describe the development of MitoB and expand on this example to discuss how better probes and exomarkers can be developed. This article is part of a Special Issue entitled Current methods to study reactive oxygen species - pros and cons and biophysics of membrane proteins. Guest Editor: Christine Winterbourn. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
What Expands in an Expanding Universe?
Pacheco, José A De Freitas
2015-01-01
In the present investigation, the possible effects of the expansion of the Universe on systems bonded either by gravitational or electromagnetic forces, are reconsidered. It will be shown that the acceleration (positive or negative) of the expanding background, is the determinant factor affecting planetary orbits and atomic sizes. In the presently accepted cosmology (ΛCDM) all bonded systems are expanding at a decreasing rate that tends to be zero as the universe enters in a de Sitter phase. It is worth mentioning that the estimated expansion rates are rather small and they can be neglected for all practical purposes.
What Expands in an Expanding Universe?
Directory of Open Access Journals (Sweden)
JOSÉ A. DE FREITAS PACHECO
2015-12-01
Full Text Available ABSTRACT In the present investigation, the possible effects of the expansion of the Universe on systems bonded either by gravitational or electromagnetic forces, are reconsidered. It will be shown that the acceleration (positive or negative of the expanding background, is the determinant factor affecting planetary orbits and atomic sizes. In the presently accepted cosmology (ΛCDM all bonded systems are expanding at a decreasing rate that tends to be zero as the universe enters in a de Sitter phase. It is worth mentioning that the estimated expansion rates are rather small and they can be neglected for all practical purposes.
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
DEFF Research Database (Denmark)
Lundgaard Andersen, Linda; Soldz, Stephen
2012-01-01
A major theme in recent psychoanalytic thinking concerns the use of therapist subjectivity, especially “countertransference,” in understanding patients. This thinking converges with and expands developments in qualitative research regarding the use of researcher subjectivity as a tool......-Saxon and continental traditions, this special issue provides examples of the use of researcher subjectivity, informed by psychoanalytic thinking, in expanding research understanding....
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo
Energy Technology Data Exchange (ETDEWEB)
Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)
2014-05-16
Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo.
Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M; Weissman, Jonathan S; Rouskin, Silvi
2017-01-01
Coupling of structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structure studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduce biases and necessitate population-average assessments of RNA structure. Here we present dimethyl sulfate (DMS) mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase. DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low-abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in noncanonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs with their mature isoforms. These applications illustrate DMS-MaPseq's capacity to dramatically expand in vivo analysis of RNA structure.
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
Serum-Free Media and the Immunoregulatory Properties of Mesenchymal Stem Cells In Vivo and In Vitro
Directory of Open Access Journals (Sweden)
Mei Wu
2014-02-01
Full Text Available Background: Mesenchymal stem cells are capable of self-renewal and multi-lineage differentiation. They are used extensively to treat several diseases. Traditionally, mesenchymal stem cells are cultured in serum-containing media, typically supplemented with fetal bovine serum (FBS. However, the variability of FBS is likely to skew experimental results. Although serum-free media used to expand mesenchymal stem cells has facilitated remarkable achievements, immunomodulation of these cells in under serum-free conditions is poorly understood. We hypothesized that mesenchymal stem cells expanded in serum-free media will retain powerful immunoregulatory functions in vitro and in vivo. Design and Methods: Immunosuppressive activity and the immunomodulatory cytokines produced by mesenchymal stem cells in serum-free media were characterized in vitro. Immunomodulation by serum-free mesenchymal stem cell expansion in monocrotaline-induced pulmonary hypertension was explored in vivo. Results: Similar to cells in serum-containing media, mesenchymal stem cells expanded in serum-free media inhibited proliferation and apoptosis of CD4+T cells. They also exhibited strong immunosuppressive activities and secreted high levels of immunomodulatory cytokines such as PGE2, IDO1, COX2, IL-6, and IL-1β, but not HGF. On the other hand, growth of mesenchymal stem cells in serum-free media attenuated pulmonary vascular remodeling and inhibited mRNA expression of proinflammatory cytokines TNF-α, IFN-γ, IL-6, IL-1β, and IL-18. Conclusions: Mesenchymal stem cells in serum-free media maintained powerful immunomodulatory function in vitro and in vivo; serum-free media may replace serum-containing media for basic research and clinical applications.
SMOC can act as both an antagonist and an expander of BMP signaling.
Thomas, J Terrig; Eric Dollins, D; Andrykovich, Kristin R; Chu, Tehyen; Stultz, Brian G; Hursh, Deborah A; Moos, Malcolm
2017-03-21
The matricellular protein SMOC (Secreted Modular Calcium binding protein) is conserved phylogenetically from vertebrates to arthropods. We showed previously that SMOC inhibits bone morphogenetic protein (BMP) signaling downstream of its receptor via activation of mitogen-activated protein kinase (MAPK) signaling. In contrast, the most prominent effect of the Drosophila orthologue, pentagone ( pent ), is expanding the range of BMP signaling during wing patterning. Using SMOC deletion constructs we found that SMOC-∆EC, lacking the extracellular calcium binding (EC) domain, inhibited BMP2 signaling, whereas SMOC-EC (EC domain only) enhanced BMP2 signaling. The SMOC-EC domain bound HSPGs with a similar affinity to BMP2 and could expand the range of BMP signaling in an in vitro assay by competition for HSPG-binding. Together with data from studies in vivo we propose a model to explain how these two activities contribute to the function of Pent in Drosophila wing development and SMOC in mammalian joint formation.
Bonk, Mario
2017-01-01
This monograph is devoted to the study of the dynamics of expanding Thurston maps under iteration. A Thurston map is a branched covering map on a two-dimensional topological sphere such that each critical point of the map has a finite orbit under iteration. It is called expanding if, roughly speaking, preimages of a fine open cover of the underlying sphere under iterates of the map become finer and finer as the order of the iterate increases. Every expanding Thurston map gives rise to a fractal space, called its visual sphere. Many dynamical properties of the map are encoded in the geometry of this visual sphere. For example, an expanding Thurston map is topologically conjugate to a rational map if and only if its visual sphere is quasisymmetrically equivalent to the Riemann sphere. This relation between dynamics and fractal geometry is the main focus for the investigations in this work.
Wolf, Dietlinde; Barreras, Henry; Bader, Cameron S; Copsel, Sabrina; Lightbourn, Casey O; Pfeiffer, Brent J; Altman, Norman H; Podack, Eckhard R; Komanduri, Krishna V; Levy, Robert B
2017-05-01
Regulatory T cells (Tregs) are critical for self-tolerance. Although adoptive transfer of expanded Tregs limits graft-versus-host disease (GVHD) after hematopoietic stem cell transplantation (HSCT), ex vivo generation of large numbers of functional Tregs remains difficult. Here, we demonstrate that in vivo targeting of the TNF superfamily receptor TNFRSF25 using the TL1A-Ig fusion protein, along with IL-2, resulted in transient but massive Treg expansion in donor mice, which peaked within days and was nontoxic. Tregs increased in multiple compartments, including blood, lymph nodes, spleen, and colon (GVHD target tissue). Tregs did not expand in bone marrow, a critical site for graft-versus-malignancy responses. Adoptive transfer of in vivo-expanded Tregs in the setting of MHC-mismatched or MHC-matched allogeneic HSCT significantly ameliorated GVHD. Critically, transplantation of Treg-expanded donor cells facilitated transplant tolerance without GVHD, with complete sparing of graft-versus-malignancy. This approach may prove valuable as a therapeutic strategy promoting transplantation tolerance. Copyright © 2017 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
Goreczny, Sebastian; Qureshi, Shakeel A; Rosenthal, Eric; Krasemann, Thomas; Nassar, Mohamed S; Anderson, David R; Morgan, Gareth J
2017-07-01
We aimed to compare the procedural and mid-term performance of a specifically designed self-expanding stent with balloon-expandable stents in patients undergoing hybrid palliation for hypoplastic left heart syndrome and its variants. The lack of specifically designed stents has led to off-label use of coronary, biliary, or peripheral stents in the neonatal ductus arteriosus. Recently, a self-expanding stent, specifically designed for use in hypoplastic left heart syndrome, has become available. We carried out a retrospective cohort comparison of 69 neonates who underwent hybrid ductal stenting with balloon-expandable and self-expanding stents from December, 2005 to July, 2014. In total, 43 balloon-expandable stents were implanted in 41 neonates and more recently 47 self-expanding stents in 28 neonates. In the balloon-expandable stents group, stent-related complications occurred in nine patients (22%), compared with one patient in the self-expanding stent group (4%). During follow-up, percutaneous re-intervention related to the ductal stent was performed in five patients (17%) in the balloon-expandable stent group and seven patients (28%) in self-expanding stents group. Hybrid ductal stenting with self-expanding stents produced favourable results when compared with the results obtained with balloon-expandable stents. Immediate additional interventions and follow-up re-interventions were similar in both groups with complications more common in those with balloon-expandable stents.
Prostaglandin E2 regulates hematopoietic stem cell
International Nuclear Information System (INIS)
Wang Yingying; Zhou Daohong; Meng Aimin
2013-01-01
Prostaglandin E2 (PGE2) is a bioactive lipid molecule produced by cyclooxygenase (COX), which plays an important role on hematopoiesis. While it can block differentiation of myeloid progenitors but enhance proliferation of erythroid progenitors. Recent research found that PGE2 have the effects on hematopoietic stem cell (HSC) function and these effects were independent from effects on progenitor cells. Exposure of HSC cells to PGE2 in vitro can increase homing efficiency of HSC to the murine bone marrow compartment and decrease HSC apoptosis, meanwhile increase long-term stem cell engraftment. In-vivo treatment with PGE2 expands short-term HSC and engraftment in murine bone marrow but not long-term HSC.In addition, PGE2 increases HSC survival after radiation injury and enhance hematopoietic recovery, resulting maintains hematopoietic homeostasis. PGE2 regulates HSC homeostasis by reactive oxygen species and Wnt pathway. Clinical beneficial of 16, 16-dimethyl-prostaglandin E2 treatment to enhance engraftment of umbilical cord blood suggest important improvements to therapeutic strategies. (authors)
Two Types of Expanding Lie Algebra and New Expanding Integrable Systems
International Nuclear Information System (INIS)
Dong Huanhe; Yang Jiming; Wang Hui
2010-01-01
From a new Lie algebra proposed by Zhang, two expanding Lie algebras and its corresponding loop algebras are obtained. Two expanding integrable systems are produced with the help of the generalized zero curvature equation. One of them has complex Hamiltion structure with the help of generalized Tu formula (GTM). (general)
Leukemogenic Ptpn11 allele causes defective erythropoiesis in mice.
Directory of Open Access Journals (Sweden)
Tatiana Usenko
Full Text Available Src homology 2 (SH2 domain-containing phosphatase 2 (SHP2, encoded by PTPN11, regulates signaling networks and cell fate in many tissues. Expression of oncogenic PTPN11 in the hematopoietic compartment causes myeloproliferative neoplasm (MPN in humans and mice. However, the stage-specific effect(s of mutant Ptpn11 on erythroid development have remained unknown. We found that expression of an activated, leukemogenic Ptpn11 allele, Ptpn11D61Y, specifically in the erythroid lineage causes dyserythropoiesis in mice. Ptpn11D61Y progenitors produce excess cKIT+ CD71+ Ter119- cells and aberrant numbers of cKITl° CD71+ erythroblasts. Mutant erythroblasts show elevated activation of ERK, AKT and STAT3 in response to EPO stimulation, and MEK inhibitor treatment blocks Ptpn11D61Y-evoked erythroid hyperproliferation in vitro. Thus, the expression of oncogenic Ptpn11 causes dyserythropoiesis in a cell-autonomous manner in vivo.
Directory of Open Access Journals (Sweden)
Jianguo Wen
2017-06-01
Full Text Available Abstract Background Sickle cell disease (SCD is a disorder of red blood cells (RBCs expressing abnormal hemoglobin-S (HbS due to genetic inheritance of homologous HbS gene. However, people with the sickle cell trait (SCT carry a single allele of HbS and do not usually suffer from SCD symptoms, thus providing a rationale to treat SCD. Methods To validate gene therapy potential, hematopoietic stem cells were isolated from the SCD patient blood and treated with CRISPR/Cas9 approach. To precisely dissect genome-editing effects, erythroid progenitor cells were cloned from single colonies of CRISPR-treated cells and then expanded for simultaneous gene, protein, and cellular function studies. Results Genotyping and sequencing analysis revealed that the genome-edited erythroid progenitor colonies were converted to SCT genotype from SCD genotype. HPLC protein assays confirmed reinstallation of normal hemoglobin at a similar level with HbS in the cloned genome-edited erythroid progenitor cells. For cell function evaluation, in vitro RBC differentiation of the cloned erythroid progenitor cells was induced. As expected, cell sickling assays indicated function reinstitution of the genome-edited offspring SCD RBCs, which became more resistant to sickling under hypoxia condition. Conclusions This study is an exploration of genome editing of SCD HSPCs.
International Nuclear Information System (INIS)
Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.
1987-01-01
To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)
Pessin, R.
1983-01-01
Tool locally expands small-diameter tubes. Tube expander locally expands and deforms tube: Compressive lateral stress induced in elastomeric sleeve by squeezing axially between two metal tool parts. Adaptable to situations in which tube must have small bulge for mechanical support or flow control.
The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.
Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A
2010-10-28
Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.
Energy Technology Data Exchange (ETDEWEB)
Moon, Yong Ju; Jeong, Yong Yeon; Kim, Jeong; Yim, Nam yeol; Kang, Heoung Keun [School of Medicine, Chonnam National Univ., Gwangju (Korea, Republic of); Kim, Eun Ha; Yoon, Kwon Ha [School of Medicine, Wonkwang Univ., Iksan (Korea, Republic of); Ko, Seog Wan [School of Medicine, Chonbuk National Univ., Jeonju (Korea, Republic of)
2004-12-01
The purpose of this study was to compare the shape and volume of the radio-frequency induced lesions produced by two commercially available radio-frequency ablation (RFA) systems, the expandable and cooled-tip needles, in clinical patients and an experimental model. A twelve-array anchor expandable needle electrode and a single cooled-tip needle electrode were used to treat hepatic tumors with a single session in 23 patients (20 hepatocellular carcinomas and 3 hepatic metastases) and fourteen patients (10 hepatocellular carcinomas and 4 hepatic metastases), respectively. Twenty RFA induced lesions were created with each system in 10 explanted bovine livers. The shape of the RFA induced lesions were divided into oval lesions along or perpendicular to the axis of the electrode and spherical lesions, and we then calculated the volumes of the RFA induced lesions. Fourteen (61%) lesions of the 23 patients treated with the expandable system were oval perpendicular to the axis of the electrode and nine (39%) of the lesions were spherical. All the lesions (100%) of the 14 patients treated with the cooled-tip needle were ovaI along the axis of the electrode. In the ex vivo bovine livers, the shape of the all RFA induced lesions was oval perpendicular to the axis of the electrode for the expandable needle, and oval along the axis of the electrode for the cooled-tip needle. The mean diameter and volume of the RFA induced lesions in the patients were 3.35{+-}0.56 cm and 19.9{+-}6.53 cm{sup 3}, respectively, for the expandable needle and 3.58{+-}0.78 cm and 23.19{+-}5.27 cm{sup 3}, respectively, for the cooled-tip needle. In the ex vivo model, the mean diameter and volume of RFA induced lesions were 3.41{+-}0.59 cm and 26.59{+-}8.02 cm{sup 3}, respectively, for the expandable needle, and 4.04{+-}0.65 cm and 33.82{+-}6.16 cm{sup 3}, respectively, for the cooled-tip needle (p <0.05). These results indicate that the shape of RFA induced lesions with the expandable needle were oval
Arnold, Patrick; Fischer, Martin S; Nyakatura, John A
2014-07-01
The reconstruction of a joint's maximum range of mobility (ROM) often is a first step when trying to understand the locomotion of fossil tetrapods. But previous studies suggest that the ROM of a joint is restricted by soft tissues surrounding the joint. To expand the limited informative value of ROM studies for the reconstruction of a fossil species' locomotor characteristics, it is moreover necessary to better understand the relationship of ex vivo ROM with the actual in vivo joint movement. To gain insight into the relationship between ex vivo mobility and in vivo movement, we systematically tested for the influence of soft tissues on joint ROM in the hip of the modern lizard Iguana iguana. Then, we compared the ex vivo mobility to in vivo kinematics of the hip joint in the same specimens using X-ray sequences of steady-state treadmill locomotion previously recorded. With stepwise removal of soft tissues and a repeated-measurement protocol, we show that soft tissues surrounding the hip joint considerably limit ROM, highlighting the problems when joint ROM is deduced from bare bones only. We found the integument to have the largest effect on the range of long-axis rotation, pro- and retraction. Importantly, during locomotion the iguana used only a fragment of the ROM that was measured in our least restrictive dissection situation (i.e. pelvis and femur only conjoined by ligaments), demonstrating the discrepancy between hip joint ROM and actual in vivo movement. Our study emphasizes the necessity for caution when attempting to reconstruct joint ROM or even locomotor kinematics from fossil bones only, as actual in vivo movement cannot be deduced directly from any condition of cadaver mobility in Iguana and likely in other tetrapods. © 2014 Anatomical Society.
Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie
2017-09-01
Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Microbial Biofilms and Breast Tissue Expanders
Directory of Open Access Journals (Sweden)
Melissa J. Karau
2013-01-01
Full Text Available We previously developed and validated a vortexing-sonication technique for detection of biofilm bacteria on the surface of explanted prosthetic joints. Herein, we evaluated this technique for diagnosis of infected breast tissue expanders and used it to assess colonization of breast tissue expanders. From April 2008 to December 2011, we studied 328 breast tissue expanders at Mayo Clinic, Rochester, MN, USA. Of seven clinically infected breast tissue expanders, six (85.7% had positive cultures, one of which grew Propionibacterium species. Fifty-two of 321 breast tissue expanders (16.2%, 95% CI, 12.3–20.7% without clinical evidence of infection also had positive cultures, 45 growing Propionibacterium species and ten coagulase-negative staphylococci. While vortexing-sonication can detect clinically infected breast tissue expanders, 16 percent of breast tissue expanders appear to be asymptomatically colonized with normal skin flora, most commonly, Propionibacterium species.
Analysis of antigen-specific B-cell memory directly ex vivo.
McHeyzer-Williams, Louise J; McHeyzer-Williams, Michael G
2004-01-01
Helper T-cell-regulated B-cell memory develops in response to initial antigen priming as a cellular product of the germinal center (GC) reaction. On antigen recall, memory response precursors expand rapidly with exaggerated differentiation into plasma cells to produce the high-titer, high-affinity antibody(Ab) that typifies the memory B-cell response in vivo. We have devised a high-resolution flow cytometric strategy to quantify the emergence and maintenance of antigen-specific memory B cells directly ex vivo. Extended cell surface phenotype establishes a level of cellular diversity not previously appreciated for the memory B-cell compartment. Using an "exclusion transfer" strategy, we ascertain the capacity of two distinct memory B-cell populations to transfer antigen-specific memory into naive adoptive hosts. Finally, we sequence expressed messenger ribonucleic acid (mRNA) from single cells within the population to estimate the level of somatic hypermutation as the best molecular indicator of B-cell memory. In this chapter, we describe the methods used in each of these four sections that serve to provide high-resolution quantification of antigen-specific B-cell memory responses directly ex vivo.
In vivo electrophysiological measurement of the rat ulnar nerve with axonal excitability testing
DEFF Research Database (Denmark)
Wild, Brandon M.; Morris, Renée; Moldovan, Mihai
2018-01-01
Electrophysiology enables the objective assessment of peripheral nerve function in vivo. Traditional nerve conduction measures such as amplitude and latency detect chronic axon loss and demyelination, respectively. Axonal excitability techniques "by threshold tracking" expand upon these measures...... by providing information regarding the activity of ion channels, pumps and exchangers that relate to acute function and may precede degenerative events. As such, the use of axonal excitability in animal models of neurological disorders may provide a useful in vivo measure to assess novel therapeutic...... interventions. Here we describe an experimental setup for multiple measures of motor axonal excitability techniques in the rat ulnar nerve. The animals are anesthetized with isoflurane and carefully monitored to ensure constant and adequate depth of anesthesia. Body temperature, respiration rate, heart rate...
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
In vivo body composition studies in malnourished patients
International Nuclear Information System (INIS)
Allen, B.J.; Blagojevic, N.
1987-01-01
The establishment of an in vivo TBN facility at Lucas Heights, together with measurement techniques for whole body and extracellular water, is leading to an expanded interest in the relationships between clinical status, body composition and dietary regimes. The ANSTO program provides the opportunity for the first quantitative assessments of these factors in Australia. Body composition studies provide a common link with other-wise unrelated physiological or psychological diseases, and a pool of normal data is being established. Substantial improvements in patient care and quality of life should result from this project, together with a deeper understanding of the importance of body composition in disease-induced malnutrition
In vivo body composition studies in malnourished patients
Energy Technology Data Exchange (ETDEWEB)
Allen, B J; Blagojevic, N
1987-09-01
The establishment of an in vivo TBN facility at Lucas Heights, together with measurement techniques for whole body and extracellular water, is leading to an expanded interest in the relationships between clinical status, body composition and dietary regimes. The ANSTO program provides the opportunity for the first quantitative assessments of these factors in Australia. Body composition studies provide a common link with other-wise unrelated physiological or psychological diseases, and a pool of normal data is being established. Substantial improvements in patient care and quality of life should result from this project, together with a deeper understanding of the importance of body composition in disease-induced malnutrition.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
International Nuclear Information System (INIS)
Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon
2010-01-01
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Silicon microfabricated beam expander
Othman, A.; Ibrahim, M. N.; Hamzah, I. H.; Sulaiman, A. A.; Ain, M. F.
2015-03-01
The feasibility design and development methods of silicon microfabricated beam expander are described. Silicon bulk micromachining fabrication technology is used in producing features of the structure. A high-precision complex 3-D shape of the expander can be formed by exploiting the predictable anisotropic wet etching characteristics of single-crystal silicon in aqueous Potassium-Hydroxide (KOH) solution. The beam-expander consist of two elements, a micromachined silicon reflector chamber and micro-Fresnel zone plate. The micro-Fresnel element is patterned using lithographic methods. The reflector chamber element has a depth of 40 µm, a diameter of 15 mm and gold-coated surfaces. The impact on the depth, diameter of the chamber and absorption for improved performance are discussed.
Bigelow Expandable Activity Module Project
National Aeronautics and Space Administration — The Bigelow Expandable Activity Module (BEAM) project is a NASA-industry partnership with Bigelow Aerospace (BA) that has developing the first human-rated expandable...
International Nuclear Information System (INIS)
Rieger, Johannes; Hautmann, Hubert; Linsenmaier, Ulrich; Weber, Cristoph; Treitl, Markus; Huber, R.M.; Pfeifer, Klaus-Juergen
2004-01-01
Over the last few years various types of metal wire stents have been increasingly employed in the treatment of both malignant and benign tracheobronchial obstruction. To date, however, few studies have investigated the in vivo properties of different stent types. We implanted 26 balloon-expandable tantalum Strecker stents (18 patients) and 18 self-expandable Wallstents (16 patients) into the tracheobronchial system of 30 patients with combined stenting in 4 patients. Mean age was 51 years (range: 0.5-79 years). Malignant disease was present in 23 patients, benign disease in seven patients. Both patients and individual stents were monitored clinically and radiographically. The probability of stents remaining within the tracheobronchial system, and of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for both stent types. Average stent follow-up time was 112 days until explantation and 115 days until patients' death or discharge. Kaplan-Meier analysis revealed a higher probability for the Wallstent to remain within the tracheobronchial system. Dislocation and compression occurred more rarely. Explantation, however, if desired, was more difficult compared to the Strecker stent. The Wallstent also led to the formation of granulation tissue, especially at the proximal stent end, frequently requiring reintervention. Both stent types proved to be effective therapeutic options in the management of obstructive tracheobronchial disease. The mechanical properties of the Strecker stent seem to be less favorable compared to the Wallstent but removal is easy. For benign disease, however, the Wallstent reveals limitations due to significant side effects
Helium turbo-expander with an alternator
International Nuclear Information System (INIS)
Akiyama, Yoshitane
1980-01-01
Study was made on a helium turbo-expander, the heart of helium refrigerator systems, in order to develop a system which satisfies the required conditions. A helium turbo-expander with externally pressurized helium gas bearings at the temperature of liquid nitrogen and an alternator as a brake have been employed. The essential difference between a helium turbo-expander and a nitrogen turbo-expander was clarified. The gas bearing lubricated with nitrogen at room temperature and the gas bearing lubricated with helium at low temperature were tested. The flow rate of helium in a helium refrigerator for a large superconducting magnet is comparatively small, therefore a helium turbine must be small, but the standard for large turbine design can be applied to such small turbine. Using the alternator as a brake, the turbo-expander was easily controllable electrically. The prototype turbo-expander was made, and the liquefaction test with it and MHD power generation test were carried out. (Kako, I.)
Kinesin expands and stabilizes the GDP-microtubule lattice
Peet, Daniel R.; Burroughs, Nigel J.; Cross, Robert A.
2018-05-01
Kinesin-1 is a nanoscale molecular motor that walks towards the fast-growing (plus) ends of microtubules, hauling molecular cargo to specific reaction sites in cells. Kinesin-driven transport is central to the self-organization of eukaryotic cells and shows great promise as a tool for nano-engineering1. Recent work hints that kinesin may also play a role in modulating the stability of its microtubule track, both in vitro2,3 and in vivo4, but the results are conflicting5-7 and the mechanisms are unclear. Here, we report a new dimension to the kinesin-microtubule interaction, whereby strong-binding state (adenosine triphosphate (ATP)-bound and apo) kinesin-1 motor domains inhibit the shrinkage of guanosine diphosphate (GDP) microtubules by up to two orders of magnitude and expand their lattice spacing by 1.6%. Our data reveal an unexpected mechanism by which the mechanochemical cycles of kinesin and tubulin interlock, and so allow motile kinesins to influence the structure, stability and mechanics of their microtubule track.
Silicon microfabricated beam expander
International Nuclear Information System (INIS)
Othman, A.; Ibrahim, M. N.; Hamzah, I. H.; Sulaiman, A. A.; Ain, M. F.
2015-01-01
The feasibility design and development methods of silicon microfabricated beam expander are described. Silicon bulk micromachining fabrication technology is used in producing features of the structure. A high-precision complex 3-D shape of the expander can be formed by exploiting the predictable anisotropic wet etching characteristics of single-crystal silicon in aqueous Potassium-Hydroxide (KOH) solution. The beam-expander consist of two elements, a micromachined silicon reflector chamber and micro-Fresnel zone plate. The micro-Fresnel element is patterned using lithographic methods. The reflector chamber element has a depth of 40 µm, a diameter of 15 mm and gold-coated surfaces. The impact on the depth, diameter of the chamber and absorption for improved performance are discussed
Silicon microfabricated beam expander
Energy Technology Data Exchange (ETDEWEB)
Othman, A., E-mail: aliman@ppinang.uitm.edu.my; Ibrahim, M. N.; Hamzah, I. H.; Sulaiman, A. A. [Faculty of Electrical Engineering, Universiti Teknologi MARA Malaysia, 40450, Shah Alam, Selangor (Malaysia); Ain, M. F. [School of Electrical and Electronic Engineering, Engineering Campus, Universiti Sains Malaysia, Seri Ampangan, 14300,Nibong Tebal, Pulau Pinang (Malaysia)
2015-03-30
The feasibility design and development methods of silicon microfabricated beam expander are described. Silicon bulk micromachining fabrication technology is used in producing features of the structure. A high-precision complex 3-D shape of the expander can be formed by exploiting the predictable anisotropic wet etching characteristics of single-crystal silicon in aqueous Potassium-Hydroxide (KOH) solution. The beam-expander consist of two elements, a micromachined silicon reflector chamber and micro-Fresnel zone plate. The micro-Fresnel element is patterned using lithographic methods. The reflector chamber element has a depth of 40 µm, a diameter of 15 mm and gold-coated surfaces. The impact on the depth, diameter of the chamber and absorption for improved performance are discussed.
Caceres, Gisela; McGraw, Kathy; Yip, Bon Ham; Pellagatti, Andrea; Johnson, Joseph; Zhang, Ling; Liu, Kenian; Zhang, Lan Min; Fulp, William J.; Lee, Ji-Hyun; Al Ali, Najla H.; Basiorka, Ashley; Smith, Larry J.; Daugherty, F. Joseph; Littleton, Neil; Wells, Richard A.; Sokol, Lubomir; Wei, Sheng; Komrokji, Rami S.; Boultwood, Jacqueline; List, Alan F.
2013-01-01
Stabilization of p53 in erythroid precursors in response to nucleosomal stress underlies the hypoplastic anemia in myelodysplastic syndromes (MDS) with chromosome 5q deletion [del(5q)]. We investigated whether cenersen, a clinically active 20-mer antisense oligonucleotide complementary to TP53 exon10, could suppress p53 expression and restore erythropoiesis in del(5q) MDS. Cenersen treatment of ribosomal protein S-14-deficient erythroblasts significantly reduced cellular p53 and p53-up-regulated modulator of apoptosis expression compared with controls, accompanied by a significant reduction in apoptosis and increased cell proliferation. In a two-stage erythroid differentiation assay, cenersen significantly suppressed nuclear p53 in bone marrow CD34+ cells isolated from patients with del(5q) MDS, whereas erythroid burst recovery increased proportionally to the magnitude of p53 suppression without evidence of del(5q) clonal suppression (r = −0.6; P = 0.005). To explore the effect of p53 suppression on erythropoiesis in vivo, dexamethasone, a glucocorticoid receptor-dependent p53 antagonist, was added to lenalidomide treatment in eight lower-risk, transfusion-dependent, del(5q) MDS patients with acquired drug resistance. Transfusion independence was restored in five patients accompanied by expansion of erythroid precursors and decreased cellular p53 expression. We conclude that targeted suppression of p53 could support effective erythropoiesis in lenalidomide-resistant del(5q) MDS. PMID:24043769
No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.
Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte
2017-07-20
Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.
Stenosis differentially affects subendocardial and subepicardial arterioles in vivo.
Merkus, D; Vergroesen, I; Hiramatsu, O; Tachibana, H; Nakamoto, H; Toyota, E; Goto, M; Ogasawara, Y; Spaan, J A; Kajiya, F
2001-04-01
The presence of a coronary stenosis results primarily in subendocardial ischemia. Apart from the decrease in coronary perfusion pressure, a stenosis also decreases coronary flow pulsations. Applying a coronary perfusion system, we compared the autoregulatory response of subendocardial (n = 10) and subepicardial (n = 12) arterioles (production with N(G)-monomethyl-L-arginine abrogated the effect of the stenosis on flow. We conclude that the decrease in pressure caused by a stenosis in vivo results in a larger decrease in diameter of the subendocardial arterioles than in the subepicardial arterioles, and furthermore stenosis selectively decreases the dilatory response of subendocardial arterioles. These two findings expand our understanding of subendocardial vulnerability to ischemia.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
Energy Technology Data Exchange (ETDEWEB)
Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)
2010-08-07
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A
2008-10-01
The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. Expander Codes - The Sipser–Spielman Construction. Priti Shankar. General Article Volume 10 ... Author Affiliations. Priti Shankar1. Department of Computer Science and Automation, Indian Institute of Science Bangalore 560 012, India.
The expanding universe: an introduction
Pössel, Markus
2017-01-01
An introduction to the physics and mathematics of the expanding universe, using no more than high-school level / undergraduate mathematics. Covered are the basics of scale factor expansion, the dynamics of the expanding universe, various distance concepts and the generalized redshift-luminosity relation, among other topics.
Jamadi, Mahsa; Shokrollahi, Parvin; Houshmand, Behzad; Joupari, Mortaza Daliri; Mashhadiabbas, Fatemeh; Khademhosseini, Ali; Annabi, Nasim
2017-08-01
Tissue expansion is used by plastic/reconstructive surgeons to grow additional skin/tissue for replacing or repairing lost or damaged soft tissues. Recently, hydrogels have been widely used for tissue expansion applications. Herein, a self-inflating tissue expander blend composition from three different molecular weights (2, 6, and 10 kDa) of poly (ethylene glycol) diacrylate (PEGDA) hydrogel with tunable mechanical and swelling properties is presented. The in vitro results demonstrate that, of the eight studied compositions, P6 (PEGDA 6 kDa:10 kDa (50:50)) and P8 (PEGDA 6 kDa:10 kDa (35:65)) formulations provide a balance of mechanical property and swelling capability suitable for tissue expansion. Furthermore, these expanders can be compressed up to 60% of their original height and can be loaded and unloaded cyclically at least ten times with no permanent deformation. The in vivo results indicate that these two engineered blend compositions are capable to generate a swelling pressure sufficient to dilate the surrounding tissue while retaining their original shape. The histological analyses reveal the formation of fibrous capsule at the interface between the implant and the subcutaneous tissue with no signs of inflammation. Ultimately, controlling the PEGDA chain length shows potential for the development of self-inflating tissue expanders with tunable mechanical and swelling properties. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F
2009-09-01
The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.
Directory of Open Access Journals (Sweden)
Hailian Wang
2018-01-01
Conclusion: Platelets can recover rapidly in vivo by means of expanded CD34+ cells with various cytokines. In our system, a group of TPO, SCF, FL, and IL-6 represents the best cytokine combination for expansion of Mk progenitor cells from CB CD34+ cells.
Directory of Open Access Journals (Sweden)
Séverine Bézie
2018-01-01
Full Text Available Both CD4+ and CD8+ Tregs play a critical role in the control of immune responses and immune tolerance; however, our understanding of CD8+ Tregs is limited while they are particularly promising for therapeutic application. We report here existence of highly suppressive human CD8+CD45RClow/− Tregs expressing Foxp3 and producing IFNγ, IL-10, IL-34, and TGFβ to mediate their suppressive activity. We demonstrate that total CD8+CD45RClow/− Tregs can be efficiently expanded in the presence of anti-CD3/28 mAbs, high-dose IL-2 and IL-15 and that such expanded Tregs efficiently delay GVHD and human skin transplantation rejection in immune humanized mice. Robustly expanded CD8+ Tregs displayed a specific gene signature, upregulated cytokines and expansion in the presence of rapamycin greatly improved proliferation and suppression. We show that CD8+CD45RClow/− Tregs are equivalent to canonical CD4+CD25highCD127low/− Tregs for suppression of allogeneic immune responses in vitro. Altogether, our results open new perspectives to tolerogenic strategies in human solid organ transplantation and GVHD.
A Rapidly Expanding Bose-Einstein Condensate: An Expanding Universe in the Lab
Eckel, S.; Kumar, A.; Jacobson, T.; Spielman, I. B.; Campbell, G. K.
2018-04-01
We study the dynamics of a supersonically expanding, ring-shaped Bose-Einstein condensate both experimentally and theoretically. The expansion redshifts long-wavelength excitations, as in an expanding universe. After expansion, energy in the radial mode leads to the production of bulk topological excitations—solitons and vortices—driving the production of a large number of azimuthal phonons and, at late times, causing stochastic persistent currents. These complex nonlinear dynamics, fueled by the energy stored coherently in one mode, are reminiscent of a type of "preheating" that may have taken place at the end of inflation.
Directory of Open Access Journals (Sweden)
Echoe M Bouta
Full Text Available Rheumatoid arthritis is a chronic inflammatory disease manifested by episodic flares in affected joints that are challenging to predict and treat. Longitudinal contrast enhanced-MRI (CE-MRI of inflammatory arthritis in tumor necrosis factor-transgenic (TNF-Tg mice has demonstrated that popliteal lymph nodes (PLN increase in volume and contrast enhancement during the pre-arthritic "expanding" phase of the disease, and then suddenly "collapse" during knee flare. Given the potential of this biomarker of arthritic flare, we aimed to develop a more cost-effective means of phenotyping PLN using ultrasound (US imaging. Initially we attempted to recapitulate CE-MRI of PLN with subcutaneous footpad injection of US microbubbles (DEFINITY®. While this approach allowed for phenotyping via quantification of lymphatic sinuses in PLN, which showed a dramatic decrease in collapsed PLN versus expanding or wild-type (WT PLN, electron microscopy demonstrated that DEFINITY® injection also resulted in destruction of the lymphatic vessels afferent to the PLN. In contrast, Power Doppler (PD US is innocuous to and efficiently quantifies blood flow within PLN of WT and TNF-Tg mice. PD-US demonstrated that expanding PLN have a significantly higher normalized PD volume (NPDV versus collapsed PLN (0.553 ± 0.007 vs. 0.008 ± 0.003; p0.030 and lower (<0.016 quartile NPDVs in this cohort of mice, which serve as conservative thresholds to phenotype PLN as expanding and collapsed, respectively. Interestingly, of the 12 PLN phenotyped by the two methods, there was disagreement in 4 cases in which they were determined to be expanding by CE-MRI and collapsed by PD-US. Since the adjacent knee had evidence of synovitis in all 4 cases, we concluded that the PD-US phenotyping was correct, and that this approach is currently the safest and most cost-effective in vivo approach to phenotype murine PLN as a biomarker of arthritic flare.
Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system.
Heppert, Jennifer K; Dickinson, Daniel J; Pani, Ariel M; Higgins, Christopher D; Steward, Annette; Ahringer, Julie; Kuhn, Jeffrey R; Goldstein, Bob
2016-11-07
Fluorescent protein tags are fundamental tools used to visualize gene products and analyze their dynamics in vivo. Recent advances in genome editing have expedited the precise insertion of fluorescent protein tags into the genomes of diverse organisms. These advances expand the potential of in vivo imaging experiments and facilitate experimentation with new, bright, photostable fluorescent proteins. Most quantitative comparisons of the brightness and photostability of different fluorescent proteins have been made in vitro, removed from biological variables that govern their performance in cells or organisms. To address the gap, we quantitatively assessed fluorescent protein properties in vivo in an animal model system. We generated transgenic Caenorhabditis elegans strains expressing green, yellow, or red fluorescent proteins in embryos and imaged embryos expressing different fluorescent proteins under the same conditions for direct comparison. We found that mNeonGreen was not as bright in vivo as predicted based on in vitro data but is a better tag than GFP for specific kinds of experiments, and we report on optimal red fluorescent proteins. These results identify ideal fluorescent proteins for imaging in vivo in C. elegans embryos and suggest good candidate fluorescent proteins to test in other animal model systems for in vivo imaging experiments. © 2016 Heppert et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Lee, Yu Bin; Kim, Se-Jeong; Kim, Eum Mi; Byun, Hayeon; Chang, Hyung-Kwan; Park, Jungyul; Choi, Yu Suk; Shin, Heungsoo
2017-10-01
Scaffold-free harvest of microtissue with a defined structure has received a great deal of interest in cell-based assay and regenerative medicine. In this study, we developed thermally expandable hydrogels with spatially controlled cell adhesive patterns for rapid harvest of geometrically controlled microtissue. We patterned polydopamine (PD) on to the hydrogel via microcontact printing (μCP), in linear shapes with widths of 50, 100 and 200μm. The hydrogels facilitated formation of spatially controlled strip-like microtissue of human dermal fibroblasts (HDFBs). It was possible to harvest and translocate microtissues with controlled widths of 61.4±14.7, 104.3±15.6, and 186.6±22.3μm from the hydrogel to glass substrates by conformal contact upon expansion of the hydrogel in response to a temperature change from 37 to 4°C, preserving high viability, extracellular matrix, and junction proteins. Microtissues were readily translocated in vivo to the subcutaneous tissue of mouse. The microtissues were further utilized as a simple assay model for monitoring of contraction in response to ROCK1 inhibitor. Collectively, micro-sized patterning of PD on the thermally expandable hydrogels via μCP holds promise for the development of microtissue harvesting systems that can be employed to ex vivo tissue assay and cell-based therapy. Harvest of artificial tissue with controlled cellular arrangement independently from external materials has been widely studied in cell-based assay and regenerative medicine. In this study, we developed scaffold-free harvest system of microtissues with anisotropic arrangement and controlled width by exploiting thermally expandable hydrogels with cell-adhesive patterns of polydopamine formed by simple microcontact printing. Cultured strips of human dermal fibroblasts on the hydrogels were rapidly delivered to various targets ranging from flat coverglass to mice subcutaneous tissue by thermal expansion of the hydrogel at 4°C for 10min. These
A Rapidly Expanding Bose-Einstein Condensate: An Expanding Universe in the Lab
Directory of Open Access Journals (Sweden)
S. Eckel
2018-04-01
Full Text Available We study the dynamics of a supersonically expanding, ring-shaped Bose-Einstein condensate both experimentally and theoretically. The expansion redshifts long-wavelength excitations, as in an expanding universe. After expansion, energy in the radial mode leads to the production of bulk topological excitations—solitons and vortices—driving the production of a large number of azimuthal phonons and, at late times, causing stochastic persistent currents. These complex nonlinear dynamics, fueled by the energy stored coherently in one mode, are reminiscent of a type of “preheating” that may have taken place at the end of inflation.
Xiao, Fang; Ma, Liang; Zhao, Min; Huang, Guocai; Mirenda, Vincenzo; Dorling, Anthony; Lechler, Robert; Lombardi, Giovanna
2014-01-01
Type 1 diabetes mellitus (T1DM) is an autoimmune disease caused by immune-mediated destruction of insulin-secreting β cells of the pancreas. Near complete dependence on exogenous insulin makes T1DM very difficult to control, with the result that patients are exposed to high blood glucose and risk of diabetic complications and/or intermittent low blood glucose that can cause unconsciousness, fits and even death. Allograft transplantation of pancreatic islets restores normoglycemia with a low risk of surgical complications. However, although successful immediately after transplantation, islets are progressively lost, with most of the patients requiring exogenous insulin within 2 years post-transplant. Therefore, there is an urgent requirement for the development of new strategies to prevent islet rejection. In this study, we explored the importance of human regulatory T cells in the control of islets allograft rejection. We developed a pre-clinical model of human islet transplantation by reconstituting NOD-scid IL2rγnull mice with cord blood-derived human CD34+ stem cells and demonstrated that although the engrafted human immune system mediated the rejection of human islets, their survival was significantly prolonged following adoptive transfer of ex vivo expanded human Tregs. Mechanistically, Tregs inhibited the infiltration of innate immune cells and CD4+ T cells into the graft by down-regulating the islet graft-derived monocyte chemoattractant protein-1. Our findings might contribute to the development of clinical strategies for Treg therapy to control human islet rejection. We also show for the first time that CD34+ cells-reconstituted NOD-scid IL2rγnull mouse model could be beneficial for investigating human innate immunity in vivo.
Xiao, Fang; Ma, Liang; Zhao, Min; Huang, Guocai; Mirenda, Vincenzo; Dorling, Anthony
2014-01-01
Type 1 diabetes mellitus (T1DM) is an autoimmune disease caused by immune-mediated destruction of insulin-secreting β cells of the pancreas. Near complete dependence on exogenous insulin makes T1DM very difficult to control, with the result that patients are exposed to high blood glucose and risk of diabetic complications and/or intermittent low blood glucose that can cause unconsciousness, fits and even death. Allograft transplantation of pancreatic islets restores normoglycemia with a low risk of surgical complications. However, although successful immediately after transplantation, islets are progressively lost, with most of the patients requiring exogenous insulin within 2 years post-transplant. Therefore, there is an urgent requirement for the development of new strategies to prevent islet rejection. In this study, we explored the importance of human regulatory T cells in the control of islets allograft rejection. We developed a pre-clinical model of human islet transplantation by reconstituting NOD-scid IL2rγnull mice with cord blood-derived human CD34+ stem cells and demonstrated that although the engrafted human immune system mediated the rejection of human islets, their survival was significantly prolonged following adoptive transfer of ex vivo expanded human Tregs. Mechanistically, Tregs inhibited the infiltration of innate immune cells and CD4+ T cells into the graft by down-regulating the islet graft-derived monocyte chemoattractant protein-1. Our findings might contribute to the development of clinical strategies for Treg therapy to control human islet rejection. We also show for the first time that CD34+ cells-reconstituted NOD-scid IL2rγnull mouse model could be beneficial for investigating human innate immunity in vivo. PMID:24594640
Directory of Open Access Journals (Sweden)
Fang Xiao
Full Text Available Type 1 diabetes mellitus (T1DM is an autoimmune disease caused by immune-mediated destruction of insulin-secreting β cells of the pancreas. Near complete dependence on exogenous insulin makes T1DM very difficult to control, with the result that patients are exposed to high blood glucose and risk of diabetic complications and/or intermittent low blood glucose that can cause unconsciousness, fits and even death. Allograft transplantation of pancreatic islets restores normoglycemia with a low risk of surgical complications. However, although successful immediately after transplantation, islets are progressively lost, with most of the patients requiring exogenous insulin within 2 years post-transplant. Therefore, there is an urgent requirement for the development of new strategies to prevent islet rejection. In this study, we explored the importance of human regulatory T cells in the control of islets allograft rejection. We developed a pre-clinical model of human islet transplantation by reconstituting NOD-scid IL2rγnull mice with cord blood-derived human CD34+ stem cells and demonstrated that although the engrafted human immune system mediated the rejection of human islets, their survival was significantly prolonged following adoptive transfer of ex vivo expanded human Tregs. Mechanistically, Tregs inhibited the infiltration of innate immune cells and CD4+ T cells into the graft by down-regulating the islet graft-derived monocyte chemoattractant protein-1. Our findings might contribute to the development of clinical strategies for Treg therapy to control human islet rejection. We also show for the first time that CD34+ cells-reconstituted NOD-scid IL2rγnull mouse model could be beneficial for investigating human innate immunity in vivo.
International Nuclear Information System (INIS)
Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir
2014-01-01
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway
Energy Technology Data Exchange (ETDEWEB)
Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)
2014-07-18
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.
The Expanding Universe: Dark Energy
Energy Technology Data Exchange (ETDEWEB)
Lincoln, Don [Fermilab; Nord, Brian [Fermilab
2014-09-01
In 1998, observations of distant supernovae led physicists that not only was the universe expanding, but the expansion was speeding up. In this article, we describe the evidence for an expanding universe and describe what physicists and cosmologists have learned in the intervening years. The target audience for this article is high school physics teachers and college physics professors at teaching institutions.
Screw expander for light duty diesel engines
1983-01-01
Preliminary selection and sizing of a positive displacement screw compressor-expander subsystem for a light-duty adiabatic diesel engine; development of a mathematical model to describe overall efficiencies for the screw compressor and expander; simulation of operation to establish overall efficiency for a range of design parameters and at given engine operating points; simulation to establish potential net power output at light-duty diesel operating points; analytical determination of mass moments of inertia for the rotors and inertia of the compressor-expander subsystem; and preparation of engineering layout drawings of the compressor and expander are discussed. As a result of this work, it was concluded that the screw compressor and expander designed for light-duty diesel engine applications are viable alternatives to turbo-compound systems, with acceptable efficiencies for both units, and only a moderate effect on the transient response.
Zhang, Hongjie; Abraham, Nessy; Khan, Liakot A; Hall, David H; Fleming, John T; Göbel, Verena
2011-09-18
Metazoan internal organs are assembled from polarized tubular epithelia that must set aside an apical membrane domain as a lumenal surface. In a global Caenorhabditis elegans tubulogenesis screen, interference with several distinct fatty-acid-biosynthetic enzymes transformed a contiguous central intestinal lumen into multiple ectopic lumens. We show that multiple-lumen formation is caused by apicobasal polarity conversion, and demonstrate that in situ modulation of lipid biosynthesis is sufficient to reversibly switch apical domain identities on growing membranes of single post-mitotic cells, shifting lumen positions. Follow-on targeted lipid-biosynthesis pathway screens and functional genetic assays were designed to identify a putative single causative lipid species. They demonstrate that fatty-acid biosynthesis affects polarity through sphingolipid synthesis, and reveal ceramide glucosyltransferases (CGTs) as end-point biosynthetic enzymes in this pathway. Our findings identify glycosphingolipids, CGT products and obligate membrane lipids, as critical determinants of in vivo polarity and indicate that they sort new components to the expanding apical membrane.
Directory of Open Access Journals (Sweden)
Weiting Du
Full Text Available Foxp3(+ regulatory T cells (Treg play a crucial role in regulating immune tolerance. The use of Treg to restore immune tolerance is considered an attractive novel approach to inhibit autoimmune disease, including type 1 diabetes (T1D, and to prevent rejection of organ transplants. In view of the goal of developing autologous Treg-based cell therapy for patients with long-term (>15 years T1D, it will be necessary to expand a sufficient amount of functional Treg in vitro in order to study and compare Treg from T1D patients and healthy subjects. Our results have demonstrated that there is a comparable frequency of Treg in the peripheral blood lymphocytes (PBLs of patients with long-term T1D relative to those in healthy subjects; however, Th1 cells, but not Th17 cells, were increased in the T1D patients. Further, more Treg in PBLs from T1D patients than from healthy subjects expressed the CD45RO(+ memory cell phenotype, suggesting they were antigen-experienced cells. After isolation, Treg from both T1D patients and healthy subjects were successfully expanded with high purity. Although there was no difference in Helios expression on Treg in PBLs, in vitro expansion led to fewer Helios-expressing Treg from T1D patients than healthy subjects. While more Th1-like Treg expressing IFN-γ or TNF-α were found in the PBLs of T1D patients than healthy controls, there was no such difference in the expanded Treg. Importantly, expanded Treg from both subject groups were able to suppress autologous or allogeneic CD8(+ effector T cells equally well. Our findings demonstrate that a large number of ex vivo expanded functional Treg can be obtained from long-term T1D patients, although fewer expanded Treg expressed a high level of Helios. Thus, based on the positive outcomes, these potent expanded Treg from diabetic human patients may be useful in treating T1D or preventing islet graft rejection.
A-coupled-expanding and distributional chaos
International Nuclear Information System (INIS)
Kim, Cholsan; Ju, Hyonhui; Chen, Minghao; Raith, Peter
2015-01-01
The concept of A-coupled-expanding maps is one of the more natural and useful ideas generalized from the horseshoe map which is commonly known as a criterion of chaos. It is well known that distributional chaos is one of the concepts which reflect strong chaotic behavior. In this paper, we focus on the relationship between A-coupled-expanding and distributional chaos. We prove two theorems which give sufficient conditions for a strictly A-coupled-expanding map to be distributionally chaotic in the senses of two kinds, where A is an m × m irreducible transition matrix
Directory of Open Access Journals (Sweden)
Holger A Russ
Full Text Available Expansion of beta cells from the limited number of adult human islet donors is an attractive prospect for increasing cell availability for cell therapy of diabetes. However, attempts at expanding human islet cells in tissue culture result in loss of beta-cell phenotype. Using a lineage-tracing approach we provided evidence for massive proliferation of beta-cell-derived (BCD cells within these cultures. Expansion involves dedifferentiation resembling epithelial-mesenchymal transition (EMT. Epigenetic analyses indicate that key beta-cell genes maintain open chromatin structure in expanded BCD cells, although they are not transcribed. Here we investigated whether BCD cells can be redifferentiated into beta-like cells.Redifferentiation conditions were screened by following activation of an insulin-DsRed2 reporter gene. Redifferentiated cells were characterized for gene expression, insulin content and secretion assays, and presence of secretory vesicles by electron microscopy. BCD cells were induced to redifferentiate by a combination of soluble factors. The redifferentiated cells expressed beta-cell genes, stored insulin in typical secretory vesicles, and released it in response to glucose. The redifferentiation process involved mesenchymal-epithelial transition, as judged by changes in gene expression. Moreover, inhibition of the EMT effector SLUG (SNAI2 using shRNA resulted in stimulation of redifferentiation. Lineage-traced cells also gave rise at a low rate to cells expressing other islet hormones, suggesting transition of BCD cells through an islet progenitor-like stage during redifferentiation.These findings demonstrate for the first time that expanded dedifferentiated beta cells can be induced to redifferentiate in culture. The findings suggest that ex-vivo expansion of adult human islet cells is a promising approach for generation of insulin-producing cells for transplantation, as well as basic research, toxicology studies, and drug
Stability of expanded plasma focus
International Nuclear Information System (INIS)
Soliman, H.M.
1994-01-01
In this study, the stabilization of the expanded plasma focus formed by 4.5 kJ plasma focus device of Mather type by magnetic field is presented. The experimental results of the induced axial magnetic field and electric probe measurements of the expanded plasma focus show that, the plasma consists of three plasmoids, electron temperature measurements off the plasmoids at a point close to the muzzle are 26 eV, 30 eV and 27 eV respectively and the electron densities are 6.6 x 10 14 , 6.1 x 10 14 / cm 3 respectively. The presence of external axial magnetic field (B 2 = 1.6 kg) at the mid distance between the breech and the muzzle has a less effect on the stability of expanded focus and it causes a restriction for the plasma motion. the electron temperature of the three plasmoids are found to increase in that case by 23%, 18.5% respectively. When this axial magnetic field is applied at the muzzle end, it leads to a more stable expanded plasma focus which consists mainly of one plasmoid with electron temperature of 39 eV and density of 3.4 x 10 14 / cm 3 . 5 figs
Expanding/Extending English: Interdisciplinarity and Internationalism.
Fleishman, Avrom
1994-01-01
Discusses the recent efforts to expand literary studies into numerous allied fields and the possible effects that such attempts toward interdisciplinarity and internationalism might have. Warns against possible negative consequences of interdisciplinary approaches. Calls for an expanded view of English as a field of study. (HB)
Geothermal ORC Systems Using Large Screw Expanders
Biederman, Tim R.; Brasz, Joost J.
2014-01-01
Geothermal ORC Systems using Large Screw Expanders Tim Biederman Cyrq Energy Abstract This paper describes a low-temperature Organic Rankine Cycle Power Recovery system with a screw expander a derivative of developed of Kaishan's line of screw compressors, as its power unit. The screw expander design is a modified version of its existing refrigeration compressor used on water-cooled chillers. Starting the ORC development program with existing refrigeration screw compre...
Ex-vivo expansion of red blood cells: how real for transfusion in humans?
Migliaccio, Anna Rita; Masselli, Elena; Varricchio, Lilian; Whitsett, Carolyn
2012-03-01
Blood transfusion is indispensable for modern medicine. In developed countries, the blood supply is adequate and safe but blood for alloimmunized patients is often unavailable. Concerns are increasing that donations may become inadequate in the future as the population ages prompting a search for alternative transfusion products. Improvements in culture conditions and proof-of-principle studies in animal models have suggested that ex-vivo expanded red cells may represent such a product. Compared to other cell therapies transfusion poses the unique challenge of requiring great cell doses (2.5×10(12) cells vs 10(7) cells). Although production of such cell numbers is theoretically possible, current technologies generate red cells in numbers sufficient only for safety studies. It is conceived that by the time these studies will be completed, technical barriers to mass cell production will have been eliminated making transfusion with ex-vivo generated red cells a reality. Copyright © 2011 Elsevier Ltd. All rights reserved.
Factors leading to tracheobronchial self-expandable metallic stent fracture.
Chung, Fu-Tsai; Lin, Shu-Min; Chen, Hao-Cheng; Chou, Chun-Liang; Yu, Chih-Teng; Liu, Chien-Ying; Wang, Chun-Hua; Lin, Horng-Chyuan; Huang, Chien-Da; Kuo, Han-Pin
2008-11-01
This retrospective study was to determine factors that contribute to self-expandable metallic stent fracture in patients with tracheobronchial disease. From 2001 to 2006, 139 patients (age, 62.1 +/- 15.4 years; range, 23-87 years) with benign (n = 62) and malignant (n = 77) tracheobronchial disease received 192 Ultraflex (Boston Scientific, Natick, Mass) self-expandable metallic stents (98 in patients with benign disease and 94 in patients with malignant disease). Seventeen fractured self-expandable metallic stents were found; the incidence was 12.2% (17/139 patients) among patients with tracheobronchial disease. Tortuous airway (odds ratio, 4.06; 95% confidence interval, 1.04-18.34; P = .04) independently predicted self-expandable metallic stent fracture. Most self-expandable metallic stent fractures (64.7%, 11/17) were detected 500 to 1000 days after self-expandable metallic stent implantation. Clinical presentations for patients with fractured self-expandable metallic stents included dyspnea exacerbation (70.6%, 12/17) and cough (23.5%, 4/17). Self-expandable metallic stent fracture is not uncommon in patients with tracheobronchial disease. Tortuous airway is an independent predictor for it. Although management of the fractured self-expandable metallic stent in our study was feasible and safe, self-expandable metallic stents should be restricted to a more select population.
Neutrinos in an expanding Universe
International Nuclear Information System (INIS)
Wigmans, Richard
2015-01-01
The Universe contains several billion neutrinos for each nucleon. In this paper, we follow the history of these relic neutrinos as the Universe expanded. At present, their typical velocity is a few hundred km/s and, therefore, their spectra are affected by gravitational forces. This may have led to a phenomenon that could explain two of todays great mysteries: The large-scale structure of the Universe and the increasing rate at which it expands. (paper)
Ha, Ae Wha; Kim, Woo Kyoung
2017-06-01
Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.
Lessons learned from vivo-morpholinos: How to avoid vivo-morpholino toxicity
Ferguson, David P.; Dangott, Lawrence J.; Lightfoot, J. Timothy
2014-01-01
Vivo-morpholinos are a promising tool for gene silencing. These oligonucleotide analogs transiently silence genes by blocking either translation or pre-mRNA splicing. Little to no toxicity has been reported for vivo-morpholino treatment. However, in a recent study conducted in our lab, treatment of mice with vivo-morpholinos resulted in high mortality rates. We hypothesized that the deaths were the result of oligonucleotide hybridization, causing an increased cationic charge associated with the dendrimer delivery moiety of the vivo-morpholino. The cationic charge increased blood clot formation in whole blood treated with vivo-morpholinos, suggesting that clotting could have caused cardiac arrest in the deceased mice. Therefore, we investigate the mechanism by which some vivo-morpholinos increase mortality rates and propose techniques to alleviate vivo-morpholino toxicity. PMID:24806225
International Nuclear Information System (INIS)
Nguyen-Neildez, T.M.A.; Vetillard, J.; Thierry, D.; Nenot, J.C.; Parmentier, C.
1996-01-01
After whole body overexposure, the key issue is the therapeutic decision, i.e. the choice between bone marrow transplantation and other strategies. The indications of bone marrow transplantation cover only a short range of doses, provided the exposure is distributed uniformly within the body; a rare event in accidental settings. The results of the clinical trials for Granulocyte-Colony Stimulating Factor: G-CSF, Granulocyte/Macrophage Colony Stimulating Factor: GM-CSF or Interleukin 3: IL-3, in vivo and in vitro radiobiology experiments suggest that growth factor therapy could be of use after most accidental overexposures to evidence and to stimulate the remaining haematopoietic stem cells in order to shorten the duration of aplasia, although questions have been raised about growth factor infusion real clinical efficiency. Ex vivo expansion of haematopoietic precursor, stem cells and differentiated cells is a new approach of growth factor therapy, which may be of interest for the treatment of patients with accidental radiation-induced aplasia. These studies aim to expand the pool of progenitors and stem cells for transplantation or to expand differentiated cells (mainly granulocytes but also megakaryocytes) for transfusion. This is made possible due to the development of techniques allowing the selection of a population of haematopoietic progenitors and stem cells from the blood (with stimulation by growth factors prior stem cell harvesting) or bone marrow using immature cell positive selection. The next step consisting in their culture with combination of growth factors or additional stroma cells is also under development. Autologous progenitor cells generated ex vivo has been recently used with some success for reconstitution of haematopoiesis after high-dose chemotherapy. (author)
Free-piston reciprocating cryogenic expander utilizing phase controller
Cha, Jeongmin; Park, Jiho; Kim, Kyungjoong; Jeong, Sangkwon
2017-02-01
In a free-piston expander which eliminates mechanical linkages, a prescribed behaviour of the free-piston movement is the key to an expander performance. In this paper, we have proposed an idea of reducing complexity of the free-piston expander. It is to replace both multiple solenoid valves and reservoirs that are indispensable in a previous machine with a combination of a single orifice-reservoir assembly. It functions as a phase controller like that of a pulse tube refrigerator so that it generates time-delay of pressure variation between the warm-end and the reservoir resulting in the intended expansion of the cold-end volume down to the pre-set reservoir pressure. The modeling of this unique free-piston reciprocating expander utilizing phase controller is developed to understand and predict the performance of the new-type expander. Additionally, the operating parameters are analysed at the specified conditions to enable one to develop a more efficient free-piston type cryogenic expander.
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo
Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-01-01
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping1 has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites2, viral barcodes3, and strategies based on transposons4 and CRISPR/Cas9 genome editing5; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system6,7. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs8–10. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure. PMID:28813413
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo.
Pei, Weike; Feyerabend, Thorsten B; Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-08-24
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites, viral barcodes, and strategies based on transposons and CRISPR-Cas9 genome editing; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure.
Cellular respiration: replicating in vivo systems biology for in ...
This editorial develops a philosophy for expanding the scope of Journal of Breath Research (JBR) into the realm of cellular level study, and links certain topics back to more traditional systemic research for understanding human health based on exhaled breath constituents. The express purpose is to provide a publication outlet for novel breath related research that includes in vitro studies, especially those that explore the biological origin and expression of compounds that may ultimately influence the constituents of exhaled breath. The new topics include all manner of methods and instrumentations for making in vivo and in vitro measurements, the use of different biological media (blood, urine saliva, swabs) including human and microbial cell-lines, in vitro kinetic studies of metabolism, and advances in ex vivo methods for maintaining metabolic competency and viability of biological samples. Traditionally, JBR has published articles on human breath analysis for diagnosing disease, tracking health state, assessing the dose and effect of exogenous chemicals, and contributions of malodorous compounds from the oral/nasal cavity. These have also included research describing novel sampling and analytical technologies, most notably those implementing mass spectrometry, chemical sensors and optical measurement instrumentation (Amann and Smith 2013). The journal’s original scope has also embraced animal models as surrogates for human sampling, new mathematical and
New generation expandable sand screens
Syltøy, Christer
2014-01-01
Master's thesis in Petroleum engineering This thesis aims to give a general insight into sand control and various sorts of sand control measures and applications of sand control tools. Special focus will be given to expandable sand screens – a technology which came about in the late 1990’s through the use of flexible, expandable tubulars as base pipe in sand screens. More specifically Darcy’s Hydraulic Endurance Screens, a compliant sand screen system using hydraulic activation, and the fu...
Rozov, F N; Grinenko, T S; Levit, G L; Krasnov, V P; Belyavsky, A V
2010-09-15
Efficient gene transfer into hematopoietic stem cells is vital for the success of gene therapy of hematopoietic and immune system disorders. An in vivo selection system based on a mutant form of the O(6)-methylguanine-DNA-methyltransferase gene (MGMTm) is considered one of the more promising strategies for expansion of hematopoietic cells transduced with viral vectors. Here we demonstrate that MGMTm-expressing cells can be efficiently selected using lysomustine, a nitrosourea derivative of lysine. K562 and murine bone marrow cells expressing MGMTm are protected from the cytotoxic action of lysomustine in vitro. We also show in a murine model that MGMTm-transduced hematopoietic cells can be expanded in vivo on transplantation into sublethally irradiated recipients followed by lysomustine treatment. These results indicate that lysomustine can be used as a potent novel chemoselection drug applicable for gene therapy of hematopoietic and immune system disorders. 2010 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Gavinsky, Dmitry; Pudlák, Pavel
2017-01-01
Roč. 60, č. 3 (2017), s. 378-395 ISSN 1432-4350 R&D Projects: GA ČR GBP202/12/G061 Institutional support: RVO:67985840 Keywords : expanders * pseudorandomness * communication complexity Subject RIV: BA - General Mathematics OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 0.645, year: 2016 http://link.springer.com/article/10.1007%2Fs00224-016-9738-5
Hematopoietic defects in response to reduced Arhgap21
Directory of Open Access Journals (Sweden)
Juliana Xavier-Ferrucio
2018-01-01
Full Text Available Arhgap21 is a member of the Rho GTPase activating protein (RhoGAP family, which function as negative regulators of Rho GTPases. Arhgap21 has been implicated in adhesion and migration of cancer cells. However, the role of Arhgap21 has never been investigated in hematopoietic cells. Herein, we evaluated functional aspects of hematopoietic stem and progenitor cells (HSPC using a haploinsufficient (Arhgap21+/− mouse. Our results show that Arhgap21+/− mice have an increased frequency of phenotypic HSC, impaired ability to form progenitor colonies in vitro and decreased hematopoietic engraftment in vivo, along with a decrease in LSK cell frequency during serial bone marrow transplantation. Arhgap21+/− hematopoietic progenitor cells have impaired adhesion and enhanced mobilization of immature LSK and myeloid progenitors. Arhgap21+/− mice also exhibit reduced erythroid commitment and differentiation, which was recapitulated in human primary cells, in which knockdown of ARHGAP21 in CMP and MEP resulted in decreased erythroid commitment. Finally, we observed enhanced RhoC activity in the bone marrow cells of Arhgap21+/− mice, indicating that Arhgap21 functions in hematopoiesis may be at least partially mediated by RhoC inactivation. Keywords: Arhgap21, Hematopoiesis, Erythroid cells, Hematopoietic stem and progenitor cells, Fate decision
Proteomic analysis reveals heat shock protein 70 has a key role in polycythemia Vera.
Gallardo, Miguel; Barrio, Santiago; Fernandez, Marisol; Paradela, Alberto; Arenas, Alicia; Toldos, Oscar; Ayala, Rosa; Albizua, Enriqueta; Jimenez, Ana; Redondo, Santiago; Garcia-Martin, Rosa Maria; Gilsanz, Florinda; Albar, Juan Pablo; Martinez-Lopez, Joaquin
2013-11-19
JAK-STAT signaling through the JAK2V617F mutation is central to the pathogenesis of myeloproliferative neoplasms (MPN). However, other events could precede the JAK2 mutation. The aim of this study is to analyze the phenotypic divergence between polycytemia vera (PV) and essential thrombocytemia (ET) to find novel therapeutics targets by a proteomic and functional approach to identify alternative routes to JAK2 activation. Through 2D-DIGE and mass spectrometry of granulocyte protein from 20 MPN samples, showed differential expression of HSP70 in PV and ET besides other 60 proteins. Immunohistochemistry of 46 MPN bone marrow samples confirmed HSP70 expression. The median of positive granulocytes was 80% in PV (SD 35%) vs. 23% in ET (SD 34.25%). In an ex vivo model KNK437 was used as an inhibition model assay of HSP70, showed dose-dependent inhibition of cell growth and burst formation unit erythroid (BFU-E) in PV and ET, increased apoptosis in the erythroid lineage, and decreased pJAK2 signaling, as well as a specific siRNA for HSP70. These data suggest a key role for HSP70 in proliferation and survival of the erythroid lineage in PV, and may represent a potential therapeutic target in MPN, especially in PV.
Flow boiling in expanding microchannels
Alam, Tamanna
2017-01-01
This Brief presents an up to date summary of details of the flow boiling heat transfer, pressure drop and instability characteristics; two phase flow patterns of expanding microchannels. Results obtained from the different expanding microscale geometries are presented for comparison and addition to that, comparison with literatures is also performed. Finally, parametric studies are performed and presented in the brief. The findings from this study could help in understanding the complex microscale flow boiling behavior and aid in the design and implementation of reliable compact heat sinks for practical applications.
International Nuclear Information System (INIS)
Schuhbaeck, Annika; Weingartner, Christina; Arnold, Martin; Schmid, Jasmin; Pflederer, Tobias; Marwan, Mohamed; Rixe, Johannes; Nef, Holger; Schneider, Christian; Lell, Michael; Uder, Michael; Ensminger, Stephan; Feyrer, Richard; Weyand, Michael; Achenbach, Stephan
2015-01-01
Highlights: • Post-implant geometry of catheter-based aortic valve prostheses is influenced by aortic valve calcification. • Balloon-expandable prostheses are more circular as compared to self-expanding prostheses. • The impact of post-implant geometry on valve function needs to be investigated. - Abstract: Introduction: The geometry of the aortic annulus and implanted transcatheter aortic valve prosthesis might influence valve function. We investigated the influence of valve type and aortic valve calcification on post-implant geometry of catheter-based aortic valve prostheses. Methods: Eighty consecutive patients with severe aortic valve stenosis (mean age 82 ± 6 years) underwent computed tomography before and after TAVI. Aortic annulus diameters were determined. Influence of prosthesis type and degree of aortic valve calcification on post-implant eccentricity were analysed. Results: Aortic annulus eccentricity was reduced in patients after TAVI (0.21 ± 0.06 vs. 0.08 ± 0.06, p < 0.0001). Post-TAVI eccentricity was significantly lower in 65 patients following implantation of a balloon-expandable prosthesis as compared to 15 patients who received a self-expanding prosthesis (0.06 ± 0.05 vs. 0.15 ± 0.07, p < 0.0001), even though the extent of aortic valve calcification was not different. After TAVI, patients with a higher calcium amount retained a significantly higher eccentricity compared to patients with lower amounts of calcium. Conclusions: Patients undergoing TAVI with a balloon-expandable prosthesis show a more circular shape of the implanted prosthesis as compared to patients with a self-expanding prosthesis. Eccentricity of the deployed prosthesis is affected by the extent of aortic valve calcification
Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M
2015-04-01
We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.
RISC RNA sequencing for context-specific identification of in vivo microRNA targets.
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2011-01-07
MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.
Hashemi, Zahra Sadat; Moghadam, Mehdi Forouzandeh; Soleimani, Masoud
2015-05-01
Bone marrow transplants (BMTs) are mainly limited by a low number of CD34(+) cells. The transforming growth factor-beta (TGF-β) pathway downregulation is a key factor that increases cell self-renewal. In nature, hematopoietic stem cells (HSCs) are in a microenvironment, surrounded by cells in a three-dimensional (3D) configuration. The aim of this study is to investigate the association between a 3D culture and the delivery ratio of downregulation. Demineralized bone matrix (DBM) and mineralized bone allograft (MBA) scaffolds were coated using unrestricted somatic stem cells (USSCs) as the feeder layer. Umbilical cord blood (UCB)-CD34(+) cells were then ex vivo expanded in them and transfected by small interfering RNA (siRNA) against TGFbR2, a type 2 receptor in the TGF-β pathway. Finally, quantitative real-time PCR, flow cytometry, and clonogenic assay were performed. In a global comparison, we observed that the highest expansion ratio, lowest expression level, and the highest CD34 marker belonged to the simple 2D culture transfected group. This suggests that TGFbR2 downregulation in a 2D culture can be done more effectively. The siRNA delivery system and the transfection ratio in an ex vivo environment, which mimicks in vivo conditions, have low efficiency. Genetic modification of the cells needs free 3D spaces to enable better transfection.
Entropy in an expanding universe
International Nuclear Information System (INIS)
Frautschi, S.
1982-01-01
The question of how the observed evolution of organized structures from initial chaos in the expanding universe can be reconciled with the laws of statistical mechanics is studied, with emphasis on effects of the expansion and gravity. Some major sources of entropy increase are listed. An expanding causal region is defined in which the entropy, though increasing, tends to fall further and further behind its maximum possible value, thus allowing for the development of order. The related questions of whether entropy will continue increasing without limit in the future, and whether such increase in the form of Hawking radiation or radiation from positronium might enable life to maintain itself permanently, are considered. Attempts to find a scheme for preserving life based on solid structures fail because events such as quantum tunneling recurrently disorganize matter on a very long but fixed time scale, whereas all energy sources slow down progressively in an expanding universe. However, there remains hope that other modes of life capable of maintaining themselves permanently can be found
Solid expandable systems put deepwater targets within reach
Energy Technology Data Exchange (ETDEWEB)
Perez-Roca, Eduardo [Enventure Global Technology L.L.C., Houston, TX (United States). Latin America; Fristch, Jerry [Enventure Global Technology L.L.C., Houston, TX (United States)
2008-07-01
Enabling technologies that take drilling operations to deeper objectives have made a significant impact on the practicality of many projects, especially deep water offshore targets. Increasing vertical depth and lateral reach requires adequate hole size to attain the desired objectives of the well bore. Solid expandable technology can maintain and retain hole size to address both the physical limitations and the economic feasibility of deep water operations. With each and every casing point, the potential for adequate hole size at total depth (TD) decreases. Solid expandable open hole liners and single-diameter systems reduce and eliminate, respectively, the well bore tapering that dictates hole size at TD and subsequent completion size. Successful mitigation of this tapering, whether through the entire well bore or through select zones, enables operators to gain access to previously unreachable reserves. Solid expandable systems have proven to be reliable and effective with over 1,000 installations in a myriad of conditions and environments worldwide. To date, over 115 of those applications have been in deep water environments. The current operating envelope for solid expandable systems include the deepest installation at {approx}28,750 ft (8,763 m) and the longest at 6,867 ft (2,083 m) in water depth over 3,150 ft (960 m). This record-length application consisted of an open hole liner installed and expanded in a single run. This paper will discuss the effectiveness of solid expandable systems in deep water operations and how the technology brings value to offshore projects especially when planned into the initial design. Case histories will be used to further illustrate the features, advantages, and benefits of expandable technology. In addition, this paper will examine the state of the solid expandable technology and its continuing evolution to provide even more drilling solutions. (author)
Expanded cellular clones carrying replication-competent HIV-1 persist, wax, and wane.
Wang, Zheng; Gurule, Evelyn E; Brennan, Timothy P; Gerold, Jeffrey M; Kwon, Kyungyoon J; Hosmane, Nina N; Kumar, Mithra R; Beg, Subul A; Capoferri, Adam A; Ray, Stuart C; Ho, Ya-Chi; Hill, Alison L; Siliciano, Janet D; Siliciano, Robert F
2018-03-13
The latent reservoir for HIV-1 in resting CD4 + T cells is a major barrier to cure. Several lines of evidence suggest that the latent reservoir is maintained through cellular proliferation. Analysis of this proliferative process is complicated by the fact that most infected cells carry defective proviruses. Additional complications are that stimuli that drive T cell proliferation can also induce virus production from latently infected cells and productively infected cells have a short in vivo half-life. In this ex vivo study, we show that latently infected cells containing replication-competent HIV-1 can proliferate in response to T cell receptor agonists or cytokines that are known to induce homeostatic proliferation and that this can occur without virus production. Some cells that have proliferated in response to these stimuli can survive for 7 d while retaining the ability to produce virus. This finding supports the hypothesis that both antigen-driven and cytokine-induced proliferation may contribute to the stability of the latent reservoir. Sequencing of replication-competent proviruses isolated from patients at different time points confirmed the presence of expanded clones and demonstrated that while some clones harboring replication-competent virus persist longitudinally on a scale of years, others wax and wane. A similar pattern is observed in longitudinal sampling of residual viremia in patients. The observed patterns are not consistent with a continuous, cell-autonomous, proliferative process related to the HIV-1 integration site. The fact that the latent reservoir can be maintained, in part, by cellular proliferation without viral reactivation poses challenges to cure.
FLAG-tagged CD19-specific CAR-T cells eliminate CD19-bearing solid tumor cells in vitro and in vivo.
Berahovich, Robert; Xu, Shirley; Zhou, Hua; Harto, Hizkia; Xu, Qumiao; Garcia, Andres; Liu, Fenyong; Golubovskaya, Vita M; Wu, Lijun
2017-06-01
Autologous T cells expressing chimeric antigen receptors (CARs) specific for CD19 have demonstrated remarkable efficacy as therapeutics for B cell malignancies. In the present study, we generated FLAG-tagged CD19-specific CAR-T cells (CD19-FLAG) and compared them to their non-tagged counterparts for their effects on solid and hematological cancer cells in vitro and in vivo . For solid tumors, we used HeLa cervical carcinoma cells engineered to overexpress CD19 (HeLa-CD19), and for hematological cancer we used Raji Burkitt's lymphoma cells, which endogenously express CD19. Like non-tagged CD19 CAR-T cells, CD19-FLAG CAR-T cells expanded in culture >100-fold and exhibited potent cytolytic activity against both HeLa-CD19 and Raji cells in vitro . CD19-FLAG CAR-T cells also secreted significantly more IFN-gamma and IL-2 than the control T cells. In vivo , CD19-FLAG CAR-T cells significantly blocked the growth of HeLa-CD19 solid tumors, increased tumor cleaved caspase-3 levels, and expanded systemically. CD19-FLAG CAR-T cells also significantly reduced Raji tumor burden and extended mouse survival. These results demonstrate the strong efficacy of FLAG-tagged CD19 CAR-T cells in solid and hematological cancer models.
Denecke, Bernd; Horsch, Liska D; Radtke, Stefan; Fischer, Johannes C; Horn, Peter A; Giebel, Bernd
2015-11-01
One of the major challenges in tissue engineering is to supply larger three-dimensional (3D) bioengineered tissue transplants with sufficient amounts of nutrients and oxygen and to allow metabolite removal. Consequently, artificial vascularization strategies of such transplants are desired. One strategy focuses on endothelial cells capable of initiating new vessel formation, which are settled on scaffolds commonly used in tissue engineering. A bottleneck in this strategy is to obtain sufficient amounts of endothelial cells, as they can be harvested only in small quantities directly from human tissues. Thus, protocols are required to expand appropriate cells in sufficient amounts without interfering with their capability to settle on scaffold materials and to initiate vessel formation. Here, we analysed whether umbilical cord blood (CB)-derived endothelial colony-forming cells (ECFCs) fulfil these requirements. In a first set of experiments, we showed that marginally expanded ECFCs settle and survive on different scaffold biomaterials. Next, we improved ECFC culture conditions and developed a protocol for ECFC expansion compatible with 'Good Manufacturing Practice' (GMP) standards. We replaced animal sera with human platelet lysates and used a novel type of tissue-culture ware. ECFCs cultured under the new conditions revealed significantly lower apoptosis and increased proliferation rates. Simultaneously, their viability was increased. Since extensively expanded ECFCs could still settle on scaffold biomaterials and were able to form tubular structures in Matrigel assays, we conclude that these ex vivo-expanded ECFCs are a novel, very potent cell source for scaffold-based tissue engineering. Copyright © 2013 John Wiley & Sons, Ltd.
Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina
2011-10-15
4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
Cheon, Young Koog; Lee, Tae Yoon; Sung, In Kyung; Shim, Chan Sup
2014-01-01
Most delivery devices used for esophageal stents for obstructing esophageal cancer have a diameter of 5-8 mm, a size that is too large to pass through the endoscopic working channel. The conventional esophageal stent requires multiple endoscopic procedures for implantation. The purpose of the present study was to evaluate the clinical feasibility of a newly developed fully covered, self-expanding, through-the-scope (TTS) esophageal stent in a porcine model. Eight mini pigs were used. Each animal underwent placement of a fully covered TTS stent (Hanarostent® Esophagus TTS) and the upper part of the stent was fixed by suturing with nylon. Fluoroscopy was carried out every week to assess migration of the stent. Follow-up endoscopy was done every month for 3 months to evaluate the status of the membrane, stent mesh, grade of tissue hyperplasia, and mucosal changes at both ends of the stent. All stents were successfully and easily deployed, and were placed without any distortion in the stent or without rupture of the membrane. In two cases, stent migration was observed after 8 weeks. No case of membrane disruption, stent mesh disruption or tissue hyperplasia at either end of the stent was found at the completion of the study. Our findings indicate that the new fully covered self-expanding TTS esophageal stent is easy and simple to implant, and no significant distortion of mesh or disruption of membrane was observed. © 2013 The Authors. Digestive Endoscopy © 2013 Japan Gastroenterological Endoscopy Society.
Novel power MOSFET-based expander for high frequency ultrasound systems.
Choi, Hojong; Shung, K Kirk
2014-01-01
The function of an expander is to obstruct the noise signal transmitted by the pulser so that it does not pass into the transducer or receive electronics, where it can produce undesirable ring-down in an ultrasound imaging application. The most common type is a diode-based expander, which is essentially a simple diode-pair, is widely used in pulse-echo measurements and imaging applications because of its simple architecture. However, diode-based expanders may degrade the performance of ultrasonic transducers and electronic components on the receiving and transmitting sides of the ultrasound systems, respectively. Since they are non-linear devices, they cause excessive signal attenuation and noise at higher frequencies and voltages. In this paper, a new type of expander that utilizes power MOSFET components, which we call a power MOSFET-based expander, is introduced and evaluated for use in high frequency ultrasound imaging systems. The performance of a power MOSFET-based expander was evaluated relative to a diode-based expander by comparing the noise figure (NF), insertion loss (IL), total harmonic distortion (THD), response time (RT), electrical impedance (EI) and dynamic power consumption (DPC). The results showed that the power MOSFET-based expander provided better NF (0.76 dB), IL (-0.3 dB) and THD (-62.9 dB), and faster RT (82 ns) than did the diode-based expander (NF (2.6 dB), IL (-1.4 dB), THD (-56.0 dB) and RT (119 ns)) at 70 MHz. The -6 dB bandwidth and the peak-to-peak voltage of the echo signal received by the transducer using the power MOSFET-based expander improved by 17.4% and 240% compared to the diode-based expander, respectively. The new power MOSFET-based expander was shown to yield lower NF, IL and THD, faster RT and lower ring down than the diode-based expander at the expense of higher dynamic power consumption. Copyright © 2013 Elsevier B.V. All rights reserved.
Expanding the Repertoire of Optogenetically Targeted Cells with an Enhanced Gene Expression System
Directory of Open Access Journals (Sweden)
Kenji F. Tanaka
2012-08-01
Full Text Available Optogenetics has been enthusiastically pursued in recent neuroscience research, and the causal relationship between neural activity and behavior is becoming ever more accessible. Here, we established knockin-mediated enhanced gene expression by improved tetracycline-controlled gene induction (KENGE-tet and succeeded in generating transgenic mice expressing a highly light-sensitive channelrhodopsin-2 mutant at levels sufficient to drive the activities of multiple cell types. This method requires two lines of mice: one that controls the pattern of expression and another that determines the protein to be produced. The generation of new lines of either type readily expands the repertoire to choose from. In addition to neurons, we were able to manipulate the activity of nonexcitable glial cells in vivo. This shows that our system is applicable not only to neuroscience but also to any biomedical study that requires understanding of how the activity of a selected population of cells propagates through the intricate organic systems.
Origin and dynamics of expanding neutral hydrogen supershells
International Nuclear Information System (INIS)
Kolesnik, I.G.; Silich, S.A.
1987-01-01
The evolutionary model of expanding supershells regulated by induced star formation is proposed. It is suggested that giant expanding shells are formed n superclouds at late evolutionary stage of star complexes. To understand the dynamics of the most huge supershells it is necessary to take into account that expanding shells can trigger star formation in cold dense pre-exosting cloudlets. Efficiency of induced star formation must be less than one percent to fit observational properties of supershells
Steinman, Joe; Koletar, Margaret; Stefanovic, Bojana; Sled, John G.
2016-03-01
This study evaluates 2-Photon fluorescence microscopy of in vivo and ex vivo cleared samples for visualizing cortical vasculature. Four mice brains were imaged with in vivo 2PFM. Mice were then perfused with a FITC gel and cleared in fructose. The same regions imaged in vivo were imaged ex vivo. Vessels were segmented automatically in both images using an in-house developed algorithm that accounts for the anisotropic and spatially varying PSF ex vivo. Through non-linear warping, the ex vivo image and tracing were aligned to the in vivo image. The corresponding vessels were identified through a local search algorithm. This enabled comparison of identical vessels in vivo/ex vivo. A similar process was conducted on the in vivo tracing to determine the percentage of vessels perfused. Of all the vessels identified over the four brains in vivo, 98% were present ex vivo. There was a trend towards reduced vessel diameter ex vivo by 12.7%, and the shrinkage varied between specimens (0% to 26%). Large diameter surface vessels, through a process termed 'shadowing', attenuated in vivo signal from deeper cortical vessels by 40% at 300 μm below the cortical surface, which does not occur ex vivo. In summary, though there is a mean diameter shrinkage ex vivo, ex vivo imaging has a reduced shadowing artifact. Additionally, since imaging depths are only limited by the working distance of the microscope objective, ex vivo imaging is more suitable for imaging large portions of the brain.
Kao, Yu-Chun; Bailey, Andy; Samminger, Bernhard; Tanimoto, Junji; Burnouf, Thierry
2016-07-01
Pooled human platelet lysate (HPL) is becoming the new gold standard as supplement for ex vivo cell culture for clinical protocols. However, the risk of pathogen contamination of HPL increases with the platelet pool size. We hypothesized that hollow fiber anion exchange membrane chromatography using QyuSpeed D (QSD) could remove resistant and untested bloodborne pathogens, such as parvoviruses and prions, from HPL-supplemented growth media without substantially affecting their capacity to support ex vivo cell expansion. Frozen or thawed platelet concentrates were serum-converted and centrifuged for obtaining HPL that was added to various growth media (ca. 100 mL), filtered through a 0.6-mL QSD membrane and characterized for proteins, growth factors and chemical composition. Capacity to expand Chinese hamster ovary, periodontal ligament, gingival fibroblast cells and Wharton's jelly mesenchymal stromal cells was studied. Removal of porcine parvovirus (PPV) and of the 263K prion strain of hamster-adapted scrapie was studied by spiking experiments following international guidelines. QSD had minimal impact on HPL-supplemented medium composition in proteins, growth factors and chemical content, nor capacity to expand and differentiate cells. In addition, QSD could remove ≥5.58 log10 [TCID50/mL] and ≥3.72 log10 of PPV and the 263K prion, respectively. QSD hollow fiber chromatography can be used to improve the virus and prion safety of HPL-supplemented media to safely expand cells for clinical protocols. These data bring new perspectives for increasingly safer use of pooled HPL in cell therapy and regenerative medicine applications. Copyright © 2016 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Faria, L.E.; Christopher, E.H.
1987-01-01
In an expander for use in a split Stirling cycle refrigeration system of the type wherein a displacer moves with reciprocating motion inside an expander housing, and wherein a plunger force and a regenerator force are formed on the displacer, the plunger force cyclically varying and having a time of minimum and maximum plunger force amplitude, and the regenerator force cyclically varying and having a time of minimum and maximum regenerator force amplitude, the improvement is described comprising: (a) means for maintaining displacer forces, such that the maximum plunger force amplitude is substantially equal to the maximum regenerator force amplitude; and (b) means for adjusting a time difference, the time difference being the time between the time of maximum plunger force and the time of maximum regenerator force such that a measure of the cooling power of the refrigeration system is maximized
Semiclassical expanding discrete space-times
International Nuclear Information System (INIS)
Cobb, W.K.; Smalley, L.L.
1981-01-01
Given the close ties between general relativity and geometry one might reasonably expect that quantum effects associated with gravitation might also be tied to the geometry of space-time, namely, to some sort of discreteness in space-time itself. In particular it is supposed that space-time consists of a discrete lattice of points rather than the usual continuum. Since astronomical evidence seems to suggest that the universe is expanding, the lattice must also expand. Some of the implications of such a model are that the proton should presently be stable, and the universe should be closed although the mechanism for closure is quantum mechanical. (author)
Variability of in vivo linear microcrack accumulation in the cortex of elderly human ribs
Directory of Open Access Journals (Sweden)
Amanda M. Agnew
2017-06-01
Full Text Available Excessive accumulation of microdamage in the skeleton in vivo is believed to contribute to fragility and risk of fracture, particularly in the elderly. Current knowledge of how much in vivo damage accrual varies between individuals, if at all, is lacking. In this study, paired sixth ribs from five male and five female elderly individuals (76–92 years, mean age = 84.7 years were examined using en bloc staining and fluorescent microcopy to quantify linear microcracks present at the time of death (i.e. in vivo microdamage. Crack number, crack length, crack density, and crack surface density were measured for each complete cross-section, with densities calculated using the variable of bone area (which accounts for the influence of porosity on the cortex, unlike the more frequently used cortical area, and analyzed using a two-way mixed model analysis of variance. Results indicate that while microcracks between individuals differ significantly, differences between the left and right corresponding pairs within individuals and the pleural and cutaneous cortices within each rib did not. These results suggest that systemic influences, such as differential metabolic activity, affect the accumulation of linear microcracks. Furthermore, variation in remodeling rates between individuals may be a major factor contributing to differential fracture risk in the elderly. Future work should expand to include a wider age range to examine differences in in vivo microdamage accumulation across the lifespan, as well as considering the influence of bisphosphonates on microdamage accumulation in the context of compromised remodeling rates in the elderly.
Refrigeration generation using expander-generator units
Klimenko, A. V.; Agababov, V. S.; Koryagin, A. V.; Baidakova, Yu. O.
2016-05-01
The problems of using the expander-generator unit (EGU) to generate refrigeration, along with electricity were considered. It is shown that, on the level of the temperatures of refrigeration flows using the EGU, one can provide the refrigeration supply of the different consumers: ventilation and air conditioning plants and industrial refrigerators and freezers. The analysis of influence of process parameters on the cooling power of the EGU, which depends on the parameters of the gas expansion process in the expander and temperatures of cooled environment, was carried out. The schematic diagram of refrigeration generation plant based on EGU is presented. The features and advantages of EGU to generate refrigeration compared with thermotransformer of steam compressive and absorption types were shown, namely: there is no need to use the energy generated by burning fuel to operate the EGU; beneficial use of the heat delivered to gas from the flow being cooled in equipment operating on gas; energy production along with refrigeration generation, which makes it possible to create, using EGU, the trigeneration plants without using the energy power equipment. It is shown that the level of the temperatures of refrigeration flows, which can be obtained by using the EGU on existing technological decompression stations of the transported gas, allows providing the refrigeration supply of various consumers. The information that the refrigeration capacity of an expander-generator unit not only depends on the parameters of the process of expansion of gas flowing in the expander (flow rate, temperatures and pressures at the inlet and outlet) but it is also determined by the temperature needed for a consumer and the initial temperature of the flow of the refrigeration-carrier being cooled. The conclusion was made that the expander-generator units can be used to create trigeneration plants both at major power plants and at small energy.
Second Generation Self-Inflating Tissue Expanders: A Two-Year Experience
Directory of Open Access Journals (Sweden)
Jamal Omran Al Madani
2014-01-01
Full Text Available Background. Tissue expansion is a well-established surgical technique that produces an additional amount of normal skin to cover a defect. This technique is appealing because the skin quality and color are from the patient’s own. The widely used injectable expanders are of great reliability but carry the disadvantage of being painful during injection and most of the time require multiple clinic visits. So the idea of self-inflation became attractive and hydrogel expanders were developed and became widely known for being painless during clinic visit and decrease number of visits. The first generation expanders were modified by adding an enclosing plastic shell to decrease the unopposed expansion that occurred in the first generation expanders, which lead to pressure necrosis of the skin flaps. This made it an attractive option for tissue expansion in children and some adult patients. Patients, Materials, and Methods. Charts of 17 patients were retrospectively reviewed, all of them had second generation self-inflating expanders implanted over a 2-year period for one of two purposes, the treatment of giant nevi or burn scars. Results. Fifteen patients were females and 2 were males. The indication was large burn scar in 14 cases (14/17, in which 47/55 expanders were implanted, and giant nevus in 3/17 cases in which 8/55 expanders were implanted. Extrusion of the expander occurred in 8/55 expanders (14.5%, which occurred in 6/14 patients. The highest percentage of extrusion occurred in the neck in which two out of three expanders extruded; otherwise this complication does not seem to be related to the indication, gender, nor age of the patients. It seems to be that it is technical in nature. The patients did not have to get any injections to fill the tissue expanders, which made the expansion process less painful and more convenient. Conclusion. This seems to be currently the largest published review in which second generation expanders were used
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Directory of Open Access Journals (Sweden)
Maxime DUCRET
2016-11-01
Full Text Available Mesenchymal stromal/stem cells (MSCs from human dental pulp (DP can be expanded in vitro for cell-based and regenerative dentistry therapeutic purposes. However, their heterogeneity may be a hurdle to the achievement of reproducible and predictable therapeutic outcomes. To get a better knowledge about this heterogeneity, we designed a flow cytometric strategy to analyze the phenotype of DP cells in vivo and upon in vitro expansion with stem cell markers. We focused on the CD31- cell population to exclude endothelial and leukocytic cells. Results showed that the in vivo CD31- DP cell population contained 1.4% of CD56+, 1.5% of CD146+, 2.4% of CD271+ and 6.3% of MSCA-1+ cells but very few Stro-1+ cells (≤1%. CD56+, CD146+, CD271+ and MSCA-1+ cell subpopulations expressed various levels of these markers. CD146+MSCA-1+, CD271+MSCA-1+ and CD146+CD271+ cells were the most abundant DP-MSC populations. Analysis of DP-MSCs expanded in vitro with a medicinal manufacturing approach showed that CD146 was expressed by about 50% of CD56+, CD271+, MSCA-1+ and Stro-1+ cells, and MSCA-1 by 15-30% of CD56+, CD146+, CD271+ and Stro-1+ cells. These ratios remained stable with passages. CD271 and Stro-1 were expressed by less than 1% of the expanded cell populations. Interestingly, the percentage of CD56+ cells strongly increased from P1 (25% to P4 (80% both in all sub-populations studied. CD146+CD56+, MSCA-1+CD56+ and CD146+MSCA-1+ cells were the most abundant DP-MSCs at the end of P4. These results established that DP-MSCs constitute a heterogeneous mixture of cells in pulp tissue in vivo and in culture, and that their phenotype is modified upon in vitro expansion. Further studies are needed to determine whether co-expression of specific MSC markers confers DP cells specific properties that could be used for the regeneration of human tissues, including the dental pulp, with standardized cell-based medicinal products.
Strength analysis of expandable tubulars for well applications
Energy Technology Data Exchange (ETDEWEB)
Aguiar, A.C.C. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil); Fonseca, C.E. [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil); Netto, T.A. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE)
2008-07-01
Solid expandable tube technology has many advantages when compared to conventional wells. The expansion of tubes in situ allows developing reserves in many of the challenging scenarios found in oil industry, as pre-salt layer, HPHT wells, deep reservoirs, or ultra-deep water. Besides, this procedure has good compatibility with directional and horizontal wells and facilitates side-tracks operations. Although the expansion of tubes is very attractive, a better understanding of its influence on the tube mechanical strength is necessary. In this work, experimental tests and numerical analyses were performed in order to determine the effect of parameters such as diameter-to-thickness ratio and expansion rate on the collapse resistance of expandable tubes. An experimental apparatus was designed and built to reproduce full-scale tube expansion. Three 2 meter long specimens were expanded 10% their original diameters and subjected to hydrostatic pressure inside a vessel until collapse. Three non-expanded tubes were also tested for comparison. At the same time, non-linear numerical models were developed using the finite element method. After calibration, they were used to further analyze the mechanical behavior of solid expandable tubes and the influence of expansion on its resistance against collapse. (author)
An Isothermal Steam Expander for an Industrial Steam Supplying System
Directory of Open Access Journals (Sweden)
Chen-Kuang Lin
2015-01-01
Full Text Available Steam is an essential medium used in the industrial process. To ensure steam quality, small and middle scale boilers are often adopted. However, because a higher steam pressure (compared to the necessary steam pressure is generated, the boiler’s steam pressure will be reduced via a pressure regulator before the steam is directed through the process. Unfortunately, pressure is somewhat wasted during the reducing process. Therefore, in order to promote energy efficiency, a pressure regulator is replaced by a steam expander. With this steam expander, the pressure will be transformed into mechanical energy and extracted during the expansion process. A new type of isothermal steam expander for an industrial steam supplying system will be presented in the paper. The isothermal steam expander will improve the energy efficiency of a traditional steam expander by replacing the isentropic process with an isothermal expansion process. With this, steam condensation will decrease, energy will increase, and steam quality will be improved. Moreover, the mathematical model of the isothermal steam expander will be established by using the Schmidt theory, the same principle used to analyze Stirling engines. Consequently, by verifying the correctness of the theoretical model for the isothermal steam expander using experimental data, a prototype of 100 c.c. isothermal steam expander is constructed.
In Vivo Assessment of Elasticity of Child Rib Cortical Bone Using Quantitative Computed Tomography
Directory of Open Access Journals (Sweden)
Y. Zhu
2017-01-01
Full Text Available Elasticity of the child rib cortical bone is poorly known due to the difficulties in obtaining specimens to perform conventional tests. It was shown on the femoral cortical bone that elasticity is strongly correlated with density for both children and adults through a unique relationship. Thus, it is assumed that the relationships between the elasticity and density of adult rib cortical bones could be expanded to include that of children. This study estimated in vivo the elasticity of the child rib cortical bone using quantitative computed tomography (QCT. Twenty-eight children (from 1 to 18 y.o. were considered. Calibrated QCT images were prescribed for various thoracic pathologies. The Hounsfield units were converted to bone mineral density (BMD. A relationship between the BMD and the elasticity of the rib cortical bone was applied to estimate the elasticity of children’s ribs in vivo. The estimated elasticity increases with growth (7.1 ± 2.5 GPa at 1 y.o. up to 11.6 ± 1.9 GPa at 18 y.o.. This data is in agreement with the few previous values obtained using direct measurements. This methodology paves the way for in vivo assessment of the elasticity of the child cortical bone based on calibrated QCT images.
Numerical modelling of multi-vane expander operating conditions in ORC system
Rak, Józef; Błasiak, Przemysław; Kolasiński, Piotr
2017-11-01
Multi-vane expanders are positive displacement volumetric machines which are nowadays considered for application in micro-power domestic ORC systems as promising alternative to micro turbines and other volumetric expanders. The multi-vane expander features very simple design, low gas flow capacity, low expansion ratios, an advantageous ratio of the power output to the external dimensions and are insensitive to the negative influence of the gas-liquid mixture expansion. Moreover, the multi-vane expander can be easily hermetically sealed, which is one of the key issues in the ORC system design. A literature review indicates that issues concerning the application of multi-vane expanders in such systems, especially related to operating of multi-vane expander with different low-boiling working fluids, are innovative, not fully scientifically described and have the potential for practical implementation. In this paper the results of numerical investigations on multi-vane expander operating conditions are presented. The analyses were performed on three-dimensional numerical model of the expander in ANSYS CFX software. The numerical model of the expander was validated using the data obtained from the experiment carried out on a lab test-stand. Then a series of computational analysis were performed using expanders' numerical model in order to determine its operating conditions under various flow conditions of different working fluids.
Expanded-bed chromatography in primary protein purification.
Anspach, F B; Curbelo, D; Hartmann, R; Garke, G; Deckwer, W D
1999-12-31
Chromatography in stable expanded beds enables proteins to be recovered directly from cultivations of microorganisms or cells and preparations of disrupted cells, without the need for prior removal of suspended solids. The general performance of an expanded bed is comparable to a packed bed owing to reduced mixing of the adsorbent particles in the column. However, optimal operating conditions are more restricted than in a packed bed due to the dependence of bed expansion on the size and density of the adsorbent particles as well as the viscosity and density of the feedstock. The feedstock composition may become the most limiting restriction owing to interactions of adsorbent particles with cell surfaces, DNA and other substances, leading to their aggregation and consequently to bed instabilities and channeling. Despite these difficulties, expanded-bed chromatography has found widespread applications in the large scale purification of proteins from mammalian cell and microbial feedstocks in industrial bioprocessing. The basics and implementation of expanded-bed chromatography, its advantages as well as problems encountered in the use of this technique for the direct extraction of proteins from unclarified feedstocks are addressed.
First order phase transition of expanding matter and its fragmentation
International Nuclear Information System (INIS)
Chikazumi, Shinpei; Iwamoto, Akira
2002-01-01
Using an expanding matter model with a Lennard-Jones potential, the instability of the expanding system is investigated. The pressure, the temperature, and the density fluctuations are calculated as functions of density during the time evolution of the expanding matter, which are compared to the coexistence curve calculated by the Gibbs ensemble. The expanding matter undergoes the first order phase transition in the limit of the quasistatic expansion. The resultant fragment mass distributions are also investigated. (author)
Directory of Open Access Journals (Sweden)
Anna Hammer
2017-12-01
Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.
Directory of Open Access Journals (Sweden)
Prasuna Paluru
2014-03-01
Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.
Grazing incidence beam expander
Energy Technology Data Exchange (ETDEWEB)
Akkapeddi, P.R.; Glenn, P.; Fuschetto, A.; Appert, Q.; Viswanathan, V.K.
1985-01-01
A Grazing Incidence Beam Expander (GIBE) telescope is being designed and fabricated to be used as an equivalent end mirror in a long laser resonator cavity. The design requirements for this GIBE flow down from a generic Free Electron Laser (FEL) resonator. The nature of the FEL gain volume (a thin, pencil-like, on-axis region) dictates that the output beam be very small. Such a thin beam with the high power levels characteristic of FELs would have to travel perhaps hundreds of meters or more before expanding enough to allow reflection from cooled mirrors. A GIBE, on the other hand, would allow placing these optics closer to the gain region and thus reduces the cavity lengths substantially. Results are presented relating to optical and mechanical design, alignment sensitivity analysis, radius of curvature analysis, laser cavity stability analysis of a linear stable concentric laser cavity with a GIBE. Fabrication details of the GIBE are also given.
The Expanded Large Scale Gap Test
1987-03-01
NSWC TR 86-32 DTIC THE EXPANDED LARGE SCALE GAP TEST BY T. P. LIDDIARD D. PRICE RESEARCH AND TECHNOLOGY DEPARTMENT ’ ~MARCH 1987 Ap~proved for public...arises, to reduce the spread in the LSGT 50% gap value.) The worst charges, such as those with the highest or lowest densities, the largest re-pressed...Arlington, VA 22217 PE 62314N INS3A 1 RJ14E31 7R4TBK 11 TITLE (Include Security CIlmsilficatiorn The Expanded Large Scale Gap Test . 12. PEIRSONAL AUTHOR() T
Numerical modelling of multi-vane expander operating conditions in ORC system
Directory of Open Access Journals (Sweden)
Rak Józef
2017-01-01
Full Text Available Multi-vane expanders are positive displacement volumetric machines which are nowadays considered for application in micro-power domestic ORC systems as promising alternative to micro turbines and other volumetric expanders. The multi-vane expander features very simple design, low gas flow capacity, low expansion ratios, an advantageous ratio of the power output to the external dimensions and are insensitive to the negative influence of the gas-liquid mixture expansion. Moreover, the multi-vane expander can be easily hermetically sealed, which is one of the key issues in the ORC system design. A literature review indicates that issues concerning the application of multi-vane expanders in such systems, especially related to operating of multi-vane expander with different low-boiling working fluids, are innovative, not fully scientifically described and have the potential for practical implementation. In this paper the results of numerical investigations on multi-vane expander operating conditions are presented. The analyses were performed on three-dimensional numerical model of the expander in ANSYS CFX software. The numerical model of the expander was validated using the data obtained from the experiment carried out on a lab test-stand. Then a series of computational analysis were performed using expanders' numerical model in order to determine its operating conditions under various flow conditions of different working fluids.
International Nuclear Information System (INIS)
Bigbee, W.L.; Jensen, R.H.; Veidebaum, T.
1997-01-01
The reactor accident at Chernobyl in 1986 necessitated a massive environmental cleanup that involved over 600,000 workers from all 15 Republics of the former Soviet Union. To determine whether the whole-body radiation received by workers in the course of these decontamination activities resulted in a detectable biological response, over 1,500 blood samples were obtained from cleanup workers sent from two Baltic countries, Estonia and Latvia. Here we report the results of studies of biodosimetry using the glycophorin A (GPA) locus in vivo somatic cell mutation assay applied to 734 blood samples from these workers, to 51 control samples from unexposed Baltic populations and to 94 samples from historical U.S. controls. The data reveal inconsistent evidence that the protracted radiation exposures received by these workers resulted in a significant dose-associated increase in GPA locus mutations compared with the controls. Taken together, these data suggest that the average radiation exposure to these workers does not greatly exceed 10 cGy, the minimum levels at which radiation effects might be detectable by the assay. Although the protracted nature of the exposure may have reduced the efficiency of induction of GPA locus mutations, it is likely that the estimated physical doses for these cleanup worker populations (median reported dose 9.5 cGy) were too low to result in radiation damage to erythroid stem cells that can be detected reliably by this method. 25 refs., 2 figs., 3 tabs
Evaluation of the in vivo and ex vivo optical properties in a mouse ear model
Energy Technology Data Exchange (ETDEWEB)
Salomatina, E; Yaroslavsky, A N [Wellman Center for Photomedicine, 40 Blossom Street, Boston, MA 02114 (United States)], E-mail: Yaroslav@helix.mgh.harvard.edu
2008-06-07
Determination of in vivo optical properties is a challenging problem. Absorption and scattering measured ex vivo are often used for in vivo applications. To investigate the validity of this approach, we have obtained and compared the optical properties of mouse ears in vivo and ex vivo in the spectral range from 370 to 1650 nm. Integrating sphere spectrophotometry in combination with the inverse Monte Carlo technique was employed to determine absorption coefficients, {mu}{sub a}, scattering coefficients, {mu}{sub s}, and anisotropy factors, g. Two groups of mice were used for the study. The first group was measured in vivo and ex vivo within 5-10 min post mortem. The second group was measured in vivo and ex vivo every 24 h for up to 72 h after sacrifice. Between the measurements the tissues were kept at 4 deg. C wrapped in a gauze moistened with saline solution. Then the specimens were frozen at -25 deg. C for 40 min, thawed and measured again. The results indicate that the absorption coefficients determined in vivo and ex vivo within 5-10 min post mortem differed considerably only in the spectral range dominated by hemoglobin. These changes can be attributed to rapid deoxygenation of tissue and blood post mortem. Absorption coefficients determined ex vivo up to 72 h post mortem decreased gradually with time in the spectral regions dominated by hemoglobin and water, which can be explained by the continuing loss of blood. Absorption properties of the frozen-thawed ex vivo tissues showed increase in oxygenation, which is likely caused by the release of hemoglobin from hemolyzed erythrocytes. Scattering of the ex vivo tissues decreased gradually with time in the entire spectral range due to the continuing loss of blood and partial cell damage. Anisotropy factors did not change considerably.
The effect of radiofrequency ablation on different organs: Ex vivo and in vivo comparative studies
Energy Technology Data Exchange (ETDEWEB)
Kim, Yoo Na [Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Ilwon-dong, Kangnam-Ku, Seoul 135-710 (Korea, Republic of); Rhim, Hyunchul, E-mail: rhimhc@skku.edu [Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Ilwon-dong, Kangnam-Ku, Seoul 135-710 (Korea, Republic of); Choi, Dongil; Kim, Young-sun; Lee, Min Woo; Chang, Ilsoo; Lee, Won Jae; Lim, Hyo K. [Department of Radiology and Center for Imaging Science, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Ilwon-dong, Kangnam-Ku, Seoul 135-710 (Korea, Republic of)
2011-11-15
Objective: The purposes of this study are to evaluate the ex vivo and in vivo efficacy of radiofrequency ablation (RFA) on different porcine tissues by the ablation of three different sites simultaneously. Materials and methods: A multichannel RFA system, enables three separate tumors to be ablated simultaneously, was used. RFA procedures were applied to normal porcine liver, kidney, and muscle together ex vivo (n = 12) and in vivo (n = 17). Pre-impedances, defined as baseline systemic impedances of tissues before beginning RFA, and the areas of ablation zones were measured and compared. Results: The areas of ablation zones among three organs had a significant difference in decreasing order as follows: liver, muscle, and kidney in the ex vivo study (p = 0.001); muscle, liver, and kidney in the in vivo study (p < 0.0001). The areas of ablation zones between ex vivo and in vivo had a significant difference in the liver and muscle (each p < 0.05). There was no significant correlation between the areas of ablation zones and pre-impedances in both studies. Conclusions: Renal RFA produced the smallest ablation zone in both in vivo and ex vivo studies. Muscular RFA demonstrated the largest ablation zone in the in vivo study, and hepatic RFA showed the largest ablation zone in the ex vivo study. This variability in the tissues should be considered for performing an optimized RFA for each organ site.
Directory of Open Access Journals (Sweden)
Johanna Maria Tauriainen
2015-04-01
Full Text Available T cells are pivotal in the immune defense against cancers and infectious agents. To mount an effector response against cancer cells, T cells need to migrate to the cancer-site, engage in contacts with cancer cells and perform their effector functions. Adoptive T cell therapy is an effective strategy as treatment of complications such as relapse or opportunistic infections after hematopoietic stem cell transplantations. This requires a sufficient amount of cells that are able to expand and respond to tumor or viral antigens. The cytokines interleukin (IL-2 and IL-7 drive T cell differentiation, proliferation and survival and are commonly used to expand T cells ex vivo. Here, we have used microchip-based live-cell imaging to follow the migration of individual T cells, their interactions with allogeneic monocytes, cell division and apoptosis for extended periods of time; something that cannot be achieved by commonly used methods. Our data indicate that cells grown in IL-7 + IL-2 had similar migration and contact dynamics as cells grown in IL-2 alone. However, the addition of IL-7 decreased cell death creating a more viable cell population, which should be beneficial when preparing cells for immunotherapy.
Verbeke, C S; Wenthe, U; Bergler, W F; Zentgraf, H
2000-01-01
Infectious mononucleosis (IM), a manifestation of primary infection with EBV, is characterized by a massive expansion of the T cell population. In this study we examined this expanded T cell population regarding its EBV status, its proliferative and apoptotic activity, and its expression of apoptosis-related genes. Whereas previous studies were performed on ex vivo cultures or on peripheral blood, our investigations included in vivo analysis of IM tonsillectomy specimens (14 cases) by in situ hybridization for viral RNA (EBERs) combined with immunohistochemistry (IHC; CD3, CD45RO, CD20, CD79a, Ki-67, Bcl-2, Bax, Fas, FasL) and the TUNEL method. Of the EBER+ cells 50–70% showed expression of the B cell markers CD20/CD79a. The remainder of the EBER+ cells expressed neither B nor T cell antigens. No co-expression of EBERs and T cell antigens was detected in any of the specimens. In accordance with a high rate of apoptosis (up to 2·37%) within the expanded T cell population, Bcl-2 expression was drastically reduced and FasL expression remarkably increased. The levels of Bax and Fas expression showed no or moderate up-regulation. In conclusion, the massive expansion of IM T cells is not caused by EBV infection of these cells but merely represents an intense immune reaction. Through altered expression of Bcl-2/Bax and Fas/FasL, the activated T cells are subject to enhanced apoptosis while residing within the lymphoid tissue, which eventually allows the efficient silencing of this potentially damaging T cell response. PMID:10792379
Conference Offers Girls Opportunity to Expand Career Horizons
Offers Girls Opportunity to Expand Career Horizons For more information contact: e:mail: Public Affairs Golden, Colo., Feb. 11, 1997 -- Expanding Your Horizons, a conference for girls grades 6 - 9 and Employed Women, Girls Incorporated of Metro Denver, King Soopers, McDonalds, the TCI Adult Program and the
Riding the Plane Wave: Considerations for In Vivo Study Designs Employing High Frame Rate Ultrasound
Directory of Open Access Journals (Sweden)
Jason S. Au
2018-02-01
Full Text Available Advancements in diagnostic ultrasound have allowed for a rapid expansion of the quantity and quality of non-invasive information that clinical researchers can acquire from cardiovascular physiology. The recent emergence of high frame rate ultrasound (HiFRUS is the next step in the quantification of complex blood flow behavior, offering angle-independent, high temporal resolution data in normal physiology and clinical cases. While there are various HiFRUS methods that have been tested and validated in simulations and in complex flow phantoms, there is a need to expand the field into more rigorous in vivo testing for clinical relevance. In this tutorial, we briefly outline the major advances in HiFRUS, and discuss practical considerations of participant preparation, experimental design, and human measurement, while also providing an example of how these frameworks can be immediately applied to in vivo research questions. The considerations put forward in this paper aim to set a realistic framework for research labs which use HiFRUS to commence the collection of human data for basic science, as well as for preliminary clinical research questions.
Development of cryogenic free-piston reciprocating expander utilizing phase controller
Energy Technology Data Exchange (ETDEWEB)
Cha, Jeong Min; Park, Ji Ho; Kim, Kyung Joong; Jeong, Sang Kwon [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of)
2016-06-15
A free-piston reciprocating expander is a device which operates without any mechanical linkage to a stationary part. Since the motion of the floating piston is only controlled by the pressure difference at two ends of the piston, this kind of expander may indispensably require a sophisticated active control system equipped with multiple valves and reservoirs. In this paper, we have suggested a novel design that can further reduce complexity of the previously developed cryogenic free-piston expander configuration. It is a simple replacement of both multiple valves and reservoirs by a combination of an orifice valve and a reservoir. The functional characteristic of the integrated orifice-reservoir configuration is similar to that of a phase controller applied in a pulse tube refrigerator so that we designate the one as a phase controller. Depending on the orifice valve size in the phase controller, the different PV work which affects the expander performance is generated. The numerical model of this unique free-piston reciprocating expander utilizing a phase controller is established to understand and analyze quantitatively the performance variation of the expander under different valve timing and orifice valve size. The room temperature experiments are carried out to examine the performance of this newly developed cryogenic expander.
Development of cryogenic free-piston reciprocating expander utilizing phase controller
International Nuclear Information System (INIS)
Cha, Jeong Min; Park, Ji Ho; Kim, Kyung Joong; Jeong, Sang Kwon
2016-01-01
A free-piston reciprocating expander is a device which operates without any mechanical linkage to a stationary part. Since the motion of the floating piston is only controlled by the pressure difference at two ends of the piston, this kind of expander may indispensably require a sophisticated active control system equipped with multiple valves and reservoirs. In this paper, we have suggested a novel design that can further reduce complexity of the previously developed cryogenic free-piston expander configuration. It is a simple replacement of both multiple valves and reservoirs by a combination of an orifice valve and a reservoir. The functional characteristic of the integrated orifice-reservoir configuration is similar to that of a phase controller applied in a pulse tube refrigerator so that we designate the one as a phase controller. Depending on the orifice valve size in the phase controller, the different PV work which affects the expander performance is generated. The numerical model of this unique free-piston reciprocating expander utilizing a phase controller is established to understand and analyze quantitatively the performance variation of the expander under different valve timing and orifice valve size. The room temperature experiments are carried out to examine the performance of this newly developed cryogenic expander
Directory of Open Access Journals (Sweden)
Kurlander Roger J
2010-10-01
Full Text Available Abstract Background The ability to expand virus- or tumor-specific T cells without damaging their functional capabilities is critical for success adoptive transfer immunotherapy of patients with opportunistic infection or tumor. Careful comparisons can help identify expansion methods better suited for particular clinical settings and identify recurrent deficiencies requiring new innovation. Methods We compared the efficacy of magnetic beads coated with anti-CD3 and anti-CD28 (anti-CD3/CD28 beads, and soluble anti-CD3 plus mixed mononuclear cells (designated a rapid expansion protocol or REP in expanding normal human T cells. Results Both anti-CD3/CD28 beads and soluble anti-CD3 promoted extensive expansion. Beads stimulated greater CD4 cell growth (geometric mean of 56- versus 27-fold (p Conclusions Anti-CD3/CD28 beads are highly effective for expanding CD4 cells, but soluble anti-CD3 has significant potential advantages for expanding CD8 T cells, particularly where preservation of phenotypically "young" CD8 cells would be desirable, or where the T cells of interest have been antigen-stimulated in vitro or in vivo in the recent past.
van den Akker, Emile; van Dijk, Thamar; Parren-van Amelsvoort, Martine; Grossmann, Katja S.; Schaeper, Ute; Toney-Earley, Kenya; Waltz, Susan E.; Löwenberg, Bob; von Lindern, Marieke
2004-01-01
Erythropoietin (EPO) is required for cell survival during differentiation and for progenitor expansion during stress erythropoiesis. Although signaling pathways may couple directly to docking sites on the EPO receptor (EpoR), additional docking molecules expand the signaling platform of the
Crystallization degree change of expanded graphite by milling and annealing
International Nuclear Information System (INIS)
Tang Qunwei; Wu Jihuai; Sun Hui; Fang Shijun
2009-01-01
Expanded graphite was ball milled with a planetary mill in air atmosphere, and subsequently thermal annealed. The samples were characterized by using X-ray diffraction spectroscopy (XRD), scanning electron microscopy (SEM) and thermal gravimetric analysis (TGA). It was found that in the milling initial stage (less than 12 h), the crystallization degree of the expanded graphite declined gradually, but after milling more than 16 h, a recrystallization of the expanded graphite toke place, and ordered nanoscale expanded graphite was formed gradually. In the annealing initial stage, the non-crystallization of the graphite occurred, but, beyond an annealing time, recrystallizations of the graphite arise. Higher annealing temperature supported the recrystallization. The milled and annealed expanded graphite still preserved the crystalline structure as raw material and hold high thermal stability.
Novel T cells with improved in vivo anti-tumor activity generated by RNA electroporation
Directory of Open Access Journals (Sweden)
Xiaojun Liu
2017-05-01
Full Text Available ABSTRACT The generation of T cells with maximal anti-tumor activities will significantly impact the field of T-cell-based adoptive immunotherapy. In this report, we found that OKT3/IL-2-stimulated T cells were phenotypically more heterogeneous, with enhanced anti-tumor activity in vitro and when locally administered in a solid tumor mouse model. To further improve the OKT3/IL-2-based T cell manufacturing procedure, we developed a novel T cell stimulation and expansion method in which peripheral blood mononuclear cells were electroporated with mRNA encoding a chimeric membrane protein consisting of a single-chain variable fragment against CD3 and the intracellular domains of CD28 and 4-1BB (OKT3-28BB. The expanded T cells were phenotypically and functionally similar to T cells expanded by OKT3/IL-2. Moreover, co-electroporation of CD86 and 4-1BBL could further change the phenotype and enhance the in vivo anti-tumor activity. Although T cells expanded by the co-electroporation of OKT3-28BB with CD86 and 4-1BBL showed an increased central memory phenotype, the T cells still maintained tumor lytic activities as potent as those of OKT3/IL-2 or OKT3-28BB-stimulated T cells. In different tumor mouse models, T cells expanded by OKT3-28BB RNA electroporation showed anti-tumor activities superior to those of OKT3/IL-2 T cells. Hence, T cells with both a less differentiated phenotype and potent tumor killing ability can be generated by RNA electroporation, and this T cell manufacturing procedure can be further optimized by simply co-delivering other splices of RNA, thus providing a simple and cost-effective method for generating high-quality T cells for adoptive immunotherapy.
New York: Expanding Time, Increasing Opportunities for Achievement
Miller, Tiffany D.
2014-01-01
New York is poised to take an important step to improve student achievement by expanding learning time for students attending high-poverty, low-performing schools. Recent district- and state-level investments in expanded learning time--a promising strategy to close achievement and opportunity gaps--will give students more time to learn core…
Institute of Scientific and Technical Information of China (English)
Martin Goetz; Beena Memadathil; Stefan Biesterfeld; Constantin Schneider; Sebastian Gregor; Peter R Galle; Markus F Neurath; Ralf Kiesslich
2007-01-01
AIM: To evaluate a newly developed hand-held confocal probe for in vivo microscopic imaging of the complete gastrointestinal tract in rodents.METHODS: A novel rigid confocal probe (diameter 7 mm) was designed with optical features similar to the flexible endomicroscopy system for use in humans using a 488 nm single line laser for fluorophore excitation.Light emission was detected at 505 to 750 nm. The field of view was 475 μm × 475 μm. Optical slice thickness was 7 μm with a lateral resolution of 0.7 μm. Subsurface serial images at different depths (surface to 250 μm)were generated in real time at 1024 × 1024 pixels (0.8 frames/s) by placing the probe onto the tissue in gentle,stable contact. Tissue specimens were sampled for histopathological correlation.RESULTS: The esophagus, stomach, small and large intestine and meso, liver, pancreas and gall bladder were visualised in vivo at high resolution in n = 48 mice.Real time microscopic imaging with the confocal minimicroscopy probe was easy to achieve. The different staining protocols (fluorescein, acriflavine, FITC-labelled dextran and L. esculentum lectin) each highlighted specific aspects of the tissue, and in vivo imaging correlated excellently with conventional histology. In vivo blood flow monitoring added a functional quality to morphologic imaging.CONCLUSION: Confocal microscopy is feasible in vivo allowing the visualisation of the complete GI tract at high resolution even of subsurface tissue structures.The new confocal probe design evaluated in this study is compatible with laparoscopy and significantly expands the field of possible applications to intra-abdominal organs. It allows immediate testing of new in vivo staining and application options and therefore permits rapid transfer from animal studies to clinical use in patients.
International Nuclear Information System (INIS)
Iglesias, A.; Favrat, D.
2014-01-01
Highlights: • Doing a new concept of small scale compressed air energy storage. • Presenting a new working process of scroll machinery. • Updating a thermodynamic model of scroll compressor that take into account water injection. • Updating a mathematical model of volumetric loses that take into account sealing effect of liquid water. • Encouraging results to investigate more deeply this new concept. - Abstract: The development of an efficient isothermal turbine and compressor is essential for the realization of a small-scale compressed air energy storage (CAES). This article presents the theoretical development of an oil-free co-rotating scroll air compressor and turbine working with water injection to make the operations of expansion and compression as isothermal as possible. First experimental results in expander mode are shown. The theoretical performance is predicted with the help of a mathematical model using the equations of energy and mass conservation and the equation of state. This model takes into account the effects of water injection and volumetric losses. The experimental prototype is an oil-free scroll air compressor with the distinctive feature of having two mobile involutes working in synchronized co-rotation one relative to another. The prime-mover is an electric motor driving the two scrolls with two synchronizing belts. Water injection in the housing intends to provide a quasi-isothermal compression. The same device is used as an isothermal expander by supplying high-pressure air with water when it rotates backwards in expander mode, the electric motor acting then as a generator. Expected improvements to a standard scroll compressor and expander are a better volumetric efficiency and a greater power density due to a higher rotational speed of the scrolls, thanks to their symmetrical masses. The isothermal processes increase also the overall performance
A Ratiometric Acoustogenic Probe for in Vivo Imaging of Endogenous Nitric Oxide.
Reinhardt, Christopher J; Zhou, Effie Y; Jorgensen, Michael D; Partipilo, Gina; Chan, Jefferson
2018-01-24
Photoacoustic (PA) imaging is an emerging imaging modality that utilizes optical excitation and acoustic detection to enable high resolution at centimeter depths. The development of activatable PA probes can expand the utility of this technology to allow for detection of specific stimuli within live-animal models. Herein, we report the design, development, and evaluation of a series of Acoustogenic Probe(s) for Nitric Oxide (APNO) for the ratiometric, analyte-specific detection of nitric oxide (NO) in vivo. The best probe in the series, APNO-5, rapidly responds to NO to form an N-nitroso product with a concomitant 91 nm hypsochromic shift. This property enables ratiometric PA imaging upon selective irradiation of APNO-5 and the corresponding product, tAPNO-5. Moreover, APNO-5 displays the requisite photophysical characteristics for in vivo PA imaging (e.g., high absorptivity, low quantum yield) as well as high biocompatibility, stability, and selectivity for NO over a variety of biologically relevant analytes. APNO-5 was successfully applied to the detection of endogenous NO in a murine lipopolysaccharide-induced inflammation model. Our studies show a 1.9-fold increase in PA signal at 680 nm and a 1.3-fold ratiometric turn-on relative to a saline control.
Expanding the Game Design Space
DEFF Research Database (Denmark)
Larsen, Lasse Juel; Majgaard, Gunver
2016-01-01
This article considers game design research in educational settings. Its focus is on how undergraduate students – particularly engineering students – learn computer game design. From observations conducted during our game design courses we have developed a model of expanded game design space...... layer establishes correspondence between formal elements of computer games and the structure of problem-based creativity. It addresses how game design challenges should be formulated and how creative solutions can be measured. The fourth and final layer demonstrates how clear framing can act....... It encapsulates the entire development process from the first ideas to the final game with emphasis on game design thinking. Our model of expanded game design space consists of four separate – yet interconnected – layers in the process of game development. The first layer addresses the importance of framing...
Self-expanding/shrinking structures by 4D printing
Bodaghi, M.; Damanpack, A. R.; Liao, W. H.
2016-10-01
The aim of this paper is to create adaptive structures capable of self-expanding and self-shrinking by means of four-dimensional printing technology. An actuator unit is designed and fabricated directly by printing fibers of shape memory polymers (SMPs) in flexible beams with different arrangements. Experiments are conducted to determine thermo-mechanical material properties of the fabricated part revealing that the printing process introduced a strong anisotropy into the printed parts. The feasibility of the actuator unit with self-expanding and self-shrinking features is demonstrated experimentally. A phenomenological constitutive model together with analytical closed-form solutions are developed to replicate thermo-mechanical behaviors of SMPs. Governing equations of equilibrium are developed for printed structures based on the non-linear Green-Lagrange strain tensor and solved implementing a finite element method along with an iterative incremental Newton-Raphson scheme. The material-structural model is then applied to digitally design and print SMP adaptive lattices in planar and tubular shapes comprising a periodic arrangement of SMP actuator units that expand and then recover their original shape automatically. Numerical and experimental results reveal that the proposed planar lattice as meta-materials can be employed for plane actuators with self-expanding/shrinking features or as structural switches providing two different dynamic characteristics. It is also shown that the proposed tubular lattice with a self-expanding/shrinking mechanism can serve as tubular stents and grippers for bio-medical or piping applications.
Analysis of a rotating spool expander for Organic Rankine Cycle applications
Krishna, Abhinav
Increasing interest in recovering or utilizing low-grade heat for power generation has prompted a search for ways in which the power conversion process may be enhanced. Amongst the conversion systems, the Organic Rankine Cycle (ORC) has generated an enormous amount of interest amongst researchers and system designers. Nevertheless, component level technologies need to be developed and match the range of potential applications. In particular, technical challenges associated with scaling expansion machines (turbines) from utility scale to commercial scale have prevented widespread adoption of the technology. In this regard, this work focuses on a novel rotating spool expansion machine at the heart of an Organic Rankine Cycle. A comprehensive, deterministic simulation model of the rotating spool expander is developed. The comprehensive model includes a detailed geometry model of the spool expander and the suction valve mechanism. Sub-models for mass flow, leakage, heat transfer and friction within the expander are also developed. Apart from providing the ability to characterize the expander in a particular system, the model provides a valuable tool to study the impact of various design variables on the performance of the machine. The investigative approach also involved an experimental program to assess the performance of a working prototype. In general, the experimental data showed that the expander performance was sub-par, largely due to the mismatch of prevailing operating conditions and the expander design criteria. Operating challenges during the shakedown tests and subsequent sub-optimal design changes also detracted from performance. Nevertheless, the results of the experimental program were sufficient for a proof-of-concept assessment of the expander and for model validation over a wide range of operating conditions. The results of the validated model reveal several interesting details concerning the expander design and performance. For example, the match
Rupture of an expander prosthesis mimics axillary cancer recurrence.
LENUS (Irish Health Repository)
Ismael, T
2005-10-01
Regional silicone gel migration from a ruptured breast implant has been reported at different locations including the upper extremity, chest wall muscles, axilla and back. We report a patient who presented with an axillary mass that mimicked a regional recurrence 5 years after breast cancer reconstruction with a latissimus dorsi musculocutaneous flap and silicon gel expander-prosthesis. Surgical exploration revealed that the mass contained silicone gel around the port of the breast expander that had ruptured. The mass was confluent with an intracapsular silicone leak through a tract along the tube of the expander port.
Verwilst, Peter; Kim, Hye-Ri; Seo, Jinho; Sohn, Nak-Won; Cha, Seung-Yun; Kim, Yeongmin; Maeng, Sungho; Shin, Jung-Won; Kwak, Jong Hwan; Kang, Chulhun; Kim, Jong Seung
2017-09-27
The elucidation of the cause of Alzheimer's disease remains one of the greatest questions in neurodegenerative research. The lack of highly reliable low-cost sensors to study the structural changes in key proteins during the progression of the disease is a contributing factor to this lack of insight. In the current work, we describe the rational design and synthesis of two fluorescent BODIPY-based probes, named Tau 1 and Tau 2. The probes were evaluated on the molecular surface formed by a fibril of the PHF6 ( 306 VQIVYK 311 ) tau fragment using molecular docking studies to provide a potential molecular model to rationalize the selectivity of the new probes as compared to a homologous Aβ-selective probe. The probes were synthesized in a few steps from commercially available starting products and could thus prove to be highly cost-effective. We demonstrated the excellent photophysical properties of the dyes, such as a large Stokes shift and emission in the near-infrared window of the electromagnetic spectrum. The probes demonstrated a high selectivity for self-assembled microtubule-associated protein tau (Tau protein), in both solution and cell-based experiments. Moreover, the administration to an acute murine model of tauopathy clearly revealed the staining of self-assembled hyperphosphorylated tau protein in pathologically relevant hippocampal brain regions. Tau 1 demonstrated efficient blood-brain barrier penetrability and demonstrated a clear selectivity for tau tangles over Aβ plaques, as well as the capacity for in vivo imaging in a transgenic mouse model. The current work could open up avenues for the cost-effective monitoring of the tau protein aggregation state in animal models as well as tissue staining. Furthermore, these fluorophores could serve as the basis for the development of clinically relevant sensors, for example based on PET imaging.
Mechanical properties of porcine brain tissue in vivo and ex vivo estimated by MR elastography.
Guertler, Charlotte A; Okamoto, Ruth J; Schmidt, John L; Badachhape, Andrew A; Johnson, Curtis L; Bayly, Philip V
2018-03-01
The mechanical properties of brain tissue in vivo determine the response of the brain to rapid skull acceleration. These properties are thus of great interest to the developers of mathematical models of traumatic brain injury (TBI) or neurosurgical simulations. Animal models provide valuable insight that can improve TBI modeling. In this study we compare estimates of mechanical properties of the Yucatan mini-pig brain in vivo and ex vivo using magnetic resonance elastography (MRE) at multiple frequencies. MRE allows estimations of properties in soft tissue, either in vivo or ex vivo, by imaging harmonic shear wave propagation. Most direct measurements of brain mechanical properties have been performed using samples of brain tissue ex vivo. It has been observed that direct estimates of brain mechanical properties depend on the frequency and amplitude of loading, as well as the time post-mortem and condition of the sample. Using MRE in the same animals at overlapping frequencies, we observe that porcine brain tissue in vivo appears stiffer than porcine brain tissue samples ex vivo at frequencies of 100 Hz and 125 Hz, but measurements show closer agreement at lower frequencies. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Campana Dario
2010-10-01
Full Text Available Abstract Background The possibility that autologous NK cells could serve as an effective treatment modality for solid tumors has long been considered. However, implementation is hampered by (i the small number of NK cells in peripheral blood, (ii the difficulties associated with large-scale production of GMP compliant cytolytic NK cells, (iii the need to activate the NK cells in order to induce NK cell mediated killing and (iv the constraints imposed by autologous inhibitory receptor-ligand interactions. To address these issues, we determined (i if large numbers of NK cells could be expanded from PBMC and GMP compliant cell fractions derived by elutriation, (ii their ability to kill allogeneic and autologous tumor targets by direct cytotoxitiy and by antibody-mediated cellular cytotoxicity and (iii defined NK cell specific receptor-ligand interactions that mediate tumor target cell killing. Methods Human NK cells were expanded during 14 days. Expansion efficiency, NK receptor repertoire before and after expansion, expression of NK specific ligands, cytolytic activity against allogeneic and autologous tumor targets, with and without the addition of chimeric EGFR monoclonal antibody, were investigated. Results Cell expansion shifted the NK cell receptor repertoire towards activation and resulted in cytotoxicity against various allogeneic tumor cell lines and autologous gastric cancer cells, while sparing normal PBMC. Blocking studies confirmed that autologous cytotoxicity is established through multiple activating receptor-ligand interactions. Importantly, expanded NK cells also mediated ADCC in an autologous and allogeneic setting by antibodies that are currently being used to treat patients with select solid tumors. Conclusion These data demonstrate that large numbers of cytolytic NK cells can be generated from PBMC and lymphocyte-enriched fractions obtained by GMP compliant counter current elutriation from PBMC, establishing the preclinical
Directory of Open Access Journals (Sweden)
Joe Steinman
Full Text Available Ex vivo 2-photon fluorescence microscopy (2PFM with optical clearing enables vascular imaging deep into tissue. However, optical clearing may also produce spherical aberrations if the objective lens is not index-matched to the clearing material, while the perfusion, clearing, and fixation procedure may alter vascular morphology. We compared in vivo and ex vivo 2PFM in mice, focusing on apparent differences in microvascular signal and morphology. Following in vivo imaging, the mice (four total were perfused with a fluorescent gel and their brains fructose-cleared. The brain regions imaged in vivo were imaged ex vivo. Vessels were segmented in both images using an automated tracing algorithm that accounts for the spatially varying PSF in the ex vivo images. This spatial variance is induced by spherical aberrations caused by imaging fructose-cleared tissue with a water-immersion objective. Alignment of the ex vivo image to the in vivo image through a non-linear warping algorithm enabled comparison of apparent vessel diameter, as well as differences in signal. Shrinkage varied as a function of diameter, with capillaries rendered smaller ex vivo by 13%, while penetrating vessels shrunk by 34%. The pial vasculature attenuated in vivo microvascular signal by 40% 300 μm below the tissue surface, but this effect was absent ex vivo. On the whole, ex vivo imaging was found to be valuable for studying deep cortical vasculature.
Guidry, Erin N; Farand, Julie; Soheili, Arash; Parish, Craig A; Kevin, Nancy J; Pipik, Brenda; Calati, Kathleen B; Ikemoto, Nori; Waldman, Jacob H; Latham, Andrew H; Howell, Bonnie J; Leone, Anthony; Garbaccio, Robert M; Barrett, Stephanie E; Parmar, Rubina Giare; Truong, Quang T; Mao, Bing; Davies, Ian W; Colletti, Steven L; Sepp-Lorenzino, Laura
2014-02-19
Polymer based carriers that aid in endosomal escape have proven to be efficacious siRNA delivery agents in vitro and in vivo; however, most suffer from cytotoxicity due in part to a lack of selectivity for endosomal versus cell membrane lysis. For polymer based carriers to move beyond the laboratory and into the clinic, it is critical to find carriers that are not only efficacious, but also have margins that are clinically relevant. In this paper we report three distinct categories of polymer conjugates that improve the selectivity of endosomal membrane lysis by relying on the change in pH associated with endosomal trafficking, including incorporation of low pKa heterocycles, acid cleavable amino side chains, or carboxylic acid pH sensitive charge switches. Additionally, we determine the therapeutic index of our polymer conjugates in vivo and demonstrate that the incorporation of pH responsive elements dramatically expands the therapeutic index to 10-15, beyond that of the therapeutic index (less than 3), for polymer conjugates previously reported.
Directory of Open Access Journals (Sweden)
Laszlo A. Marosi
2013-01-01
Full Text Available We present a new redshift (RS versus photon travel time ( test including 171 supernovae RS data points. We extended the Hubble diagram to a range of z = 0,0141–8.1 in the hope that at high RSs, the fitting of the calculated RS/ diagrams to the observed RS data would, as predicted by different cosmological models, set constraints on alternative cosmological models. The Lambda cold dark matter (ΛCDM, the static universe model, and the case for a slowly expanding flat universe (SEU are considered. We show that on the basis of the Hubble diagram test, the static and the slowly expanding models are favored.
Intermittency Statistics in the Expanding Solar Wind
Cuesta, M. E.; Parashar, T. N.; Matthaeus, W. H.
2017-12-01
The solar wind is observed to be turbulent. One of the open questions in solar wind research is how the turbulence evolves as the solar wind expands to great distances. Some studies have focused on evolution of the outer scale but not much has been done to understand how intermittency evolves in the expanding wind beyond 1 AU (see [1,2]). We use magnetic field data from Voyager I spacecraft from 1 to 10AU to study the evolution of statistics of magnetic discontinuities. We perform various statistical tests on these discontinuities and make connections to the physical processes occurring in the expanding wind.[1] Tsurutani, Bruce T., and Edward J. Smith. "Interplanetary discontinuities: Temporal variations and the radial gradient from 1 to 8.5 AU." Journal of Geophysical Research: Space Physics 84.A6 (1979): 2773-2787.[2] Greco, A., et al. "Evidence for nonlinear development of magnetohydrodynamic scale intermittency in the inner heliosphere." The Astrophysical Journal 749.2 (2012): 105.
Evaluation of the stiffness characteristics of rapid palatal expander screws
Directory of Open Access Journals (Sweden)
Luca Lombardo
2016-11-01
Full Text Available Abstract Background The aim of this study is to evaluate the mechanical properties of the screws used for rapid expansion of the upper jaw. Methods Ten types of expansion screw were assessed, seven with four arms: Lancer Philosophy 1, Dentaurum Hyrax Click Medium, Forestadent Anatomic Expander type “S”, Forestadent Anatomic Expander type “S” for narrow palates, Forestadent Memory, Leone A 2620-10 with telescopic guide, and Leone A 0630-10 with orthogonal arms; and three with two arms: Dentaurum Variety S.P., Target Baby REP Veltri, and Leone A 362113. A test expander with the mean dimensions taken from measurements on a sample of 100 expanders was constructed for each screw. The test expanders were connected to the supports of an Instron 4467 (Instron Corp., USA mechanical testing machine equipped with a 500 N load cell, and the compression force exerted after each activation was measured. The mean forces expressed by the two- and four-arm expanders were then compared. Results After five activations, the forces expressed by the two-arm devices were double than those expressed by the four-arm devices on average (224 ± 59.9 N vs. 103 ± 32.9 N, and such values remained high after subsequent activations. Conclusions The expanders tested demonstrated stiffness characteristics compatible with opening of the palatine sutures in pre-adolescent patients. The stiffness of such devices can be further increased during the construction phase.
DEFF Research Database (Denmark)
Sørensen, Brita Singers; Bassler, Niels; Nielsen, Steffen
2017-01-01
of the SOBP to behind the distal dose fall-off. Irradiations were performed with the same dose plan at all positions, corresponding to a dose of 31.25 Gy in the middle of the SOBP. Endpoint of the study was early skin damage of the foot, assessed by a mouse foot skin scoring system. RESULTS: The MDD50 values......, where LETd,z =1 was 3.3 keV/μm. CONCLUSIONS: Although there is a need to expand the current study to be able to calculate an exact enhancement ratio, an enhanced biological effect in vivo for early skin damage in the distal edge was demonstrated....
Esophagorespiratory fistula: treatment with self-expanding covered stent
International Nuclear Information System (INIS)
Zang Jian; Dou Yongchong; Wang Zheng; Kong Jian
2002-01-01
Objective: To evaluate self-expanding covered stent in the management of esophagorespiratory fistula. Methods: A self-expanding esophageal covered stent was implanted under fluoroscopic guidance in 13 patients with esophagorespiratory fistula. In this series patients aged 31-73 years (60.2 years in average). All patients had a pre-procedure fast of 6-41 days (17.3 days in average), in which 12 patients had pulmonary infection. Results: All fistulas were excluded and swallowing function was restored. No stend-related complication was observed. Pulmonary infection was managed in 10 patients out of 13. The mean survived time was 33.3 wks (1-178 wks) in follow-up. Conclusion: Covered self-expanding stent implantation is a safe and effective treatment of ERF
Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing
2016-08-01
Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.
Expanded tenses in the old English orosius a syntactic strengthening*
Directory of Open Access Journals (Sweden)
Frančiška Trobevšek Drobnak
1990-12-01
Full Text Available The present chapter reports the investigation into certain aspects of the periphrastic construction to be +present participle (e.g. NE: "he is teaching"; OE. "he is laerende" viewed as an example of a syntactic strengthening. The construc tion is usually referred to as "continuous tenses/form" or "progressive tenses/form", whereas Nickel (1966 uses "expanded form". Coming closest to this latter term, the "expanded tenses" employed here seems a convenient label for two reasons: a the use of expanded tenses is not restricted to the expression of verbal aspect (Aspekt or mode of verbal action (Aktionsart, which is implied by the use of either the term "continuous tenses/form" or the term "progressive tenses/form"; b the expanded tenses are integrated into the English tense system, in the sense that they can be substituted with the respective non-expanded tenses without any change in the syntax of the clause, e.g.
In vivo engineering of a functional tendon sheath in a hen model.
Xu, Liang; Cao, Dejun; Liu, Wei; Zhou, Guangdong; Zhang, Wen Jie; Cao, Yilin
2010-05-01
Repair of injured tendon sheath remains a major challenge and this study explored the possibility of in vivo reconstruction of a tendon sheath with tendon sheath derived cells and polyglycolic acid (PGA) fibers in a Leghorn hen model. Total 55 Leghorn hens with a 1cm tendon sheath defect created in the left middle toe of each animal were randomly assigned into: (1) experimental group (n=19) that received a cell-PGA construct; (2) scaffold control group (n=18) that received a cell-free PGA scaffold; (3) blank control group (n=18) with the defect untreated. Tendon sheath cells were isolated, in vitro expanded, and seeded onto PGA scaffolds. After in vitro culture for 7 days, the constructs were in vivo implanted to repair the sheath defects. Alcian blue staining confirmed the ability of cultured cells to produce specific matrices containing acidic carboxyl mucopolysaccharide (mainly hyaluronic acid). In addition, the engineered sheath formed a relatively mature structure at 12 weeks post-surgery, which was similar to that of native counterpart, including a smooth inner surface, a well-developed sheath histological structure with a clear space between the tendon and the engineered sheath. More importantly, Work of Flexion assay revealed that the tendons needed less power consumption to glide inside the engineered sheath when compared to the tendons which were surrounded by scar-repaired tissues, indicating that the engineered sheaths had gained the function to a certain extent of preventing tendon adhesion. Taken together, these results suggest that tendon sheaths that are functionally and structurally similar to native sheaths are possible to be engineered in vivo using tendon sheath cells and PGA scaffolds. Copyright 2010 Elsevier Ltd. All rights reserved.
Some design features of CO2 swing piston expander
International Nuclear Information System (INIS)
Guan Haiqing; Ma Yitai; Li Minxia
2006-01-01
CO 2 is a potential substitute for synthesized refrigerants with favorable environmental properties. To improve the coefficient of performance (COP) of CO 2 heat pump systems, a swing piston expander prototype has been developed for replacing the throttling valve based on the thermodynamic analysis of the operating conditions of a CO 2 transcritical cycle. The measures on reducing the loss of friction and leakage are paramount important to improve the efficiency of the expander. The performance of the CO 2 swing expander prototype was actually tested in a CO 2 transcritical cycle water-to-water heat pump test rig, and the test results illustrate that the isentropic efficiency of the prototype can be more than 28% when running steadily and up to a maximum of about 44%. Some operating characteristics of the swing piston expander are presented according to the analysis of the test results
Endovascular therapy of carotid stenosis with self-expandable stent
International Nuclear Information System (INIS)
Liu Jianmin; Huang Qinghai; Hong Bo; Xu Yi; Zhao Wenyuan; Zhang Yongwei; Zhang Long; Zhou Xiaoping
2002-01-01
Objective: To summarize the experience of endovascular treatment of carotid stenosis with expandable stents. Methods: Fifty-two patients with carotid stenosis who experienced repeated transient ischemic attacks or cerebral infarction were admitted to our hospital. The stenosis was pre-expanded with undetachable balloon, and self-expandable stents were implanted across the stenosis. A balloon catheter was used to further expand stents in 29 patients. Results: The stent was accurately implanted, and total disappearance of stenosis was obtained in 34 patients, the degree of stenosis reduced more than 90% in 16 patients, and more than 70% in 2 patients. The patients recovered well and no complications related to the procedure occurred. None experienced TIA or infarction postoperatively in 52 cases and follow-up imaging in 19 patients (6 - 12 months) demonstrated no restenosis. Conclusion: Endovascular stenting may be a safe and valid choice for the treatment of extracranial carotid stenosis
49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.
2010-10-01
... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
In vivo and ex vivo proton MR spectroscopy of primary and secondary melanoma
Energy Technology Data Exchange (ETDEWEB)
Bourne, Roger M.; Stanwell, Peter; Stretch, Jonathan R.; Scolyer, Richard A.; Thompson, John F.; Mountford, Carolyn E.; Lean, Cynthia L
2005-03-01
In vivo magnetic resonance (MR) spectroscopy at 1.5T was performed on a large polypoid cutaneous melanoma, and two enlarged lymph nodes containing metastatic melanoma, from three patients. Spectra were acquired in vivo from voxels wholly within the primary tumour or secondary lymph node and were thus uncontaminated by signals from adjacent tissue. Tissue biopsies taken after resection of primary tumours and secondary lymph nodes were examined by 8.5T magnetic resonance spectroscopy (MRS) and the results compared with the in vivo spectra, and with spectra from normal skin and a benign skin lesion. There was good agreement between the dominant features of 1.5T spectra acquired in vivo and 8.5T spectra acquired from resected tissue. However, less intense resonances observed at 8.5T in malignant biopsy tissue were not consistently observed at 1.5T in vivo. In vivo spectra from primary and metastatic melanoma showed high levels of choline metabolites. An intense lactate resonance was also present in the in vivo spectrum of primary melanoma. All 8.5T spectra of biopsies from primary and secondary melanoma showed high levels of choline metabolites and lactate, and additional resonances consistent with elevated levels of taurine, alanine, lysine, and glutamate/glutamine relative to normal and benign tissue. Elevated levels of choline, lactate, taurine, and amino acids appear to be clinically useful markers for identifying the pathology of primary and metastatic melanoma.
Operation of an organic Rankine cycle dependent on pumping flow rates and expander torques
International Nuclear Information System (INIS)
Yang, Xufei; Xu, Jinliang; Miao, Zheng; Zou, Jinghuang; Yu, Chao
2015-01-01
An ORC (organic Rankine cycle) was developed with R123 as the working fluid. The heat capacity is in ∼100 kW. The match between pump and expander is investigated. Lower pump frequencies (f 10 Hz) adapt low expander torques only, and cause unstable flow and pump cavitation for larger expander torques. Ultra-low expander torques generate sufficiently high vapor superheatings to decrease expander efficiencies. Ultra-high expander torques achieve saturation vapor at the expander inlet, causing liquid droplets induced shock wave to worsen expander performance. An optimal range of expander torques exists to have better expander performance. A liquid subcooling of 20 °C is necessary to avoid pump cavitation. Expander powers and efficiencies show parabola shapes versus expander torques, or vapor superheatings at the expander inlet. The optimal vapor superheating is 13 °C. The cavitation mechanisms and measures to avoid cavitation are analyzed. This paper notes the overestimation of ORC performance by equilibrium thermodynamic analysis. Assumptions should be dependent on experiments. Future studies are suggested on organic fluid flow, heat transfer and energy conversion in various components. - Highlights: • The match between pump and expander is investigated. • A liquid subcooling of 20 °C is needed at pump inlet. • A vapor superheating of 13 °C is necessary at expander inlet. • Cavitation in pumps and expanders are analyzed. • The equilibrium thermodynamics overestimate ORC performances.
Strauss, Mike; Schotte, Lise; Karunatilaka, Krishanthi S; Filman, David J; Hogle, James M
2017-02-01
By using cryo-electron microscopy, expanded 80S-like poliovirus virions (poliovirions) were visualized in complexes with four 80S-specific camelid VHHs (Nanobodies). In all four complexes, the VHHs bind to a site on the top surface of the capsid protein VP3, which is hidden in the native virus. Interestingly, although the four VHHs bind to the same site, the structures of the expanded virus differ in detail in each complex, suggesting that each of the Nanobodies has sampled a range of low-energy structures available to the expanded virion. By stabilizing unique structures of expanded virions, VHH binding permitted a more detailed view of the virus structure than was previously possible, leading to a better understanding of the expansion process that is a critical step in infection. It is now clear which polypeptide chains become disordered and which become rearranged. The higher resolution of these structures also revealed well-ordered conformations for the EF loop of VP2, the GH loop of VP3, and the N-terminal extensions of VP1 and VP2, which, in retrospect, were present in lower-resolution structures but not recognized. These structural observations help to explain preexisting mutational data and provide insights into several other stages of the poliovirus life cycle, including the mechanism of receptor-triggered virus expansion. When poliovirus infects a cell, it undergoes a change in its structure in order to pass RNA through its protein coat, but this altered state is short-lived and thus poorly understood. The structures of poliovirus bound to single-domain antibodies presented here capture the altered virus in what appear to be intermediate states. A careful analysis of these structures lets us better understand the molecular mechanism of infection and how these changes in the virus lead to productive-infection events. Copyright © 2017 American Society for Microbiology.
Tissue Expander Overfilling: Achieving New Dimensions of Customization in Breast Reconstruction.
Treiser, Matthew D; Lahair, Tracy; Carty, Matthew J
2016-02-01
Overfill of tissue expanders is a commonly used modality to achieve customized dimensions in breast reconstruction. Little formal study of the dynamics of hyperexpansion of these devices has been performed to date, however. Overfill trials were performed using both Natrelle 133 MV and Mentor 8200 tissue expanders of indicated capacities ranging from 250 to 800 mL. Each expander was initially filled to its indicated capacity with normal water and then injected in regular increments to 400% overfill. Measurements of each expander's width, height, and projection were made at indicated capacity and with each successive incremental overfill injection, and these results were then recorded, collated, and analyzed. Over the first 50% overfill, all expanders demonstrated a logarithmic increase in projection (mean increase, 143 ± 9%) while maintaining essentially stable base dimensions. Overfill levels in excess of 50% were accompanied by linear increases in height, width, and projection, during which projection approached, but never equaled, base dimensions. Stress versus strain analyses demonstrated nonlinear biomechanical dynamics during the first 50% overfill, followed by standard elastic dynamics up to 400% overfill. At no point during the study, did expander tensions outstrip elastic properties, thereby explaining the lack of device rupture. Through overfilling, tunable geometries of tissue expanders can be accessed that may provide for increasing customization of reconstructions, particularly at overfill volumes up to 50% over indicated capacity. This study should serve to guide tissue expander selection and fill volumes that surgeons may implement in obtaining ideal reconstructed breast shapes.
Flexural Behaviour Of Reinforced Concrete Beams Containing Expanded Glass As Lightweight Aggregates
Directory of Open Access Journals (Sweden)
Khatib Jamal
2015-12-01
Full Text Available The flexural properties of reinforced concrete beams containing expanded glass as a partial fine aggregate (sand replacement are investigated. Four concrete mixes were employed to conduct this study. The fine aggregate was replaced with 0%, 25%, 50% and 100% (by volume expanded glass. The results suggest that the incorporation of 50% expanded glass increased the workability of the concrete. The compressive strength was decreasing linearly with the increasing amount of expanded glass. The ductility of the concrete beam significantly improved with the incorporation of the expanded glass. However, the load-carrying capacity of the beam and load at which the first crack occurs was reduced. It was concluded that the inclusion of expanded glass in structural concrete applications is feasible.
Theoretical models for recombination in expanding gas
International Nuclear Information System (INIS)
Avron, Y.; Kahane, S.
1978-09-01
In laser isotope separation of atomic uranium, one is confronted with the theoretical problem of estimating the concentration of thermally ionized uranium atoms. To investigate this problem theoretical models for recombination in an expanding gas and in the absence of local thermal equilibrium have been constructed. The expansion of the gas is described by soluble models of the hydrodynamic equation, and the recombination by rate equations. General results for the freezing effect for the suitable ranges of the gas parameters are obtained. The impossibility of thermal equilibrium in expanding two-component systems is proven
International Nuclear Information System (INIS)
Harnek, Jan; Zoucas, Evita; Carlemalm, Erik; Cwikiel, Wojciech
1999-01-01
Purpose: To evaluate which of six different commonly available stents inserted into an artery without percutaneous transluminal angioplasty (PTA) causes the least endothelial damage. To compare the degree of endothelial injury after insertion of such a stent with injury caused by PTA. Methods: Twelve healthy pigs were used in the experiments. In the first part of the study six different types of stents were inserted into the common iliac arteries. In the second part of the study self-expanding stents with large spaces between the wires were used. PTA was performed in the contralateral iliac artery. The pigs were killed immediately after the procedure and resected specimens examined after fixation, using scanning electron microscopy. Results: All procedures but two were accomplished successfully. More endothelium was preserved after insertion of self-expanding stents with large spaces between the wires, compared with stents with small spaces and balloon-expanded stents. After insertion of self-expanding stents with large spaces, 50.1% ± 16.4% of the endothelium remained intact, compared with only 5.6% ± 7.7% after PTA. The difference was statistically significant (p < 0.001). Conclusion: Self-expanding stents with large spaces between the wires, inserted without PTA, cause less damage to the endothelium than other stents and significantly less damage than PTA
Study on paraffin/expanded graphite composite phase change thermal energy storage material
International Nuclear Information System (INIS)
Zhang Zhengguo; Fang Xiaoming
2006-01-01
A paraffin/expanded graphite composite phase change thermal energy storage material was prepared by absorbing the paraffin into an expanded graphite that has an excellent absorbability. In such a composite, the paraffin serves as a latent heat storage material and the expanded graphite acts as the supporting material, which prevents leakage of the melted paraffin from its porous structure due to the capillary and surface tension forces. The inherent structure of the expanded graphite did not change in the composite material. The solid-liquid phase change temperature of the composite PCM was the same as that of the paraffin, and the latent heat of the paraffin/expanded graphite composite material was equivalent to the calculated value based on the mass ratio of the paraffin in the composite. The heat transfer rate of the paraffin/expanded graphite composite was obviously higher than that of the paraffin due to the combination with the expanded graphite that had a high thermal conductivity. The prepared paraffin/expanded graphite composite phase change material had a large thermal storage capacity and improved thermal conductivity and did not experience liquid leakage during its solid-liquid phase change
Expanded function allied dental personnel and dental practice productivity and efficiency.
Beazoglou, Tryfon J; Chen, Lei; Lazar, Vickie F; Brown, L Jackson; Ray, Subhash C; Heffley, Dennis R; Berg, Rob; Bailit, Howard L
2012-08-01
This study examined the impact of expanded function allied dental personnel on the productivity and efficiency of general dental practices. Detailed practice financial and clinical data were obtained from a convenience sample of 154 general dental practices in Colorado. In this state, expanded function dental assistants can provide a wide range of reversible dental services/procedures, and dental hygienists can give local anesthesia. The survey identified practices that currently use expanded function allied dental personnel and the specific services/procedures delegated. Practice productivity was measured using patient visits, gross billings, and net income. Practice efficiency was assessed using a multivariate linear program, Data Envelopment Analysis. Sixty-four percent of the practices were found to use expanded function allied dental personnel, and on average they delegated 31.4 percent of delegatable services/procedures. Practices that used expanded function allied dental personnel treated more patients and had higher gross billings and net incomes than those practices that did not; the more services they delegated, the higher was the practice's productivity and efficiency. The effective use of expanded function allied dental personnel has the potential to substantially expand the capacity of general dental practices to treat more patients and to generate higher incomes for dental practices.
Expansion of microvascular networks in vivo by phthalimide neovascular factor 1 (PNF1).
Wieghaus, Kristen A; Nickerson, Meghan M; Petrie Aronin, Caren E; Sefcik, Lauren S; Price, Richard J; Paige, Mikell A; Brown, Milton L; Botchwey, Edward A
2008-12-01
Phthalimide neovascular factor (PNF1, formerly SC-3-149) is a potent stimulator of proangiogenic signaling pathways in endothelial cells. In this study, we evaluated the in vivo effects of sustained PNF1 release to promote ingrowth and expansion of microvascular networks surrounding biomaterial implants. The dorsal skinfold window chamber was used to evaluate the structural remodeling response of the local microvasculature. PNF1 was released from poly(lactic-co-glycolic acid) (PLAGA) films, and a transport model was utilized to predict PNF1 penetration into the surrounding tissue. PNF1 significantly expanded microvascular networks within a 2mm radius from implants after 3 and 7 days by increasing microvessel length density and lumenal diameter of local arterioles and venules. Staining of histological sections with CD11b showed enhanced recruitment of circulating white blood cells, including monocytes, which are critical for the process of vessel enlargement through arteriogenesis. As PNF1 has been shown to modulate MT1-MMP, a facilitator of CCL2 dependent leukocyte transmigration, aspects of window chamber experiments were repeated in CCR2(-/-) (CCL2 receptor) mouse chimeras to more fully explore the critical nature of monocyte recruitment on the therapeutic benefits of PNF1 function in vivo.
Correct integration of compressors and expanders in above ambient heat exchanger networks
International Nuclear Information System (INIS)
Fu, Chao; Gundersen, Truls
2016-01-01
The Appropriate Placement concept (also referred to as Correct Integration) is fundamental in Pinch Analysis. The placement of reactors, distillation columns, evaporators, heat pumps and heat engines in heat exchanger networks is well established. The placement of pressure changing equipment such as compressors and expanders is complex and less discussed in literature. A major difficulty is that both heat and work (not only heat) are involved. The integration of compressors and expanders separately into heat exchanger networks was recently investigated. A set of theorems were proposed for assisting the design. The problem is even more complex when both compressors and expanders are to be integrated. An important concern is about the sequence of integration with compressors and expanders, i.e. should compressors or expanders be implemented first. This problem is studied and a new theorem is formulated related to the Correct Integration of both compressors and expanders in above ambient heat exchanger networks. The objective is to minimize exergy consumption for the integrated processes. A graphical design methodology is developed for the integration of compressors and expanders into heat exchanger networks above ambient temperature. - Highlights: • The correct integration of compressors and expanders in heat exchanger networks is studied. • A theorem is proposed for heat integration between compressors and expanders. • The total exergy consumption is minimized.
Nitrogen expander cycles for large capacity liquefaction of natural gas
Energy Technology Data Exchange (ETDEWEB)
Chang, Ho-Myung; Park, Jae Hoon; Gwak, Kyung Hyun [Hong Ik University, Department of Mechanical Engineering, Seoul, 121-791 (Korea, Republic of); Choe, Kun Hyung [Korea Gas Corporation, Incheon, 406-130 (Korea, Republic of)
2014-01-29
Thermodynamic study is performed on nitrogen expander cycles for large capacity liquefaction of natural gas. In order to substantially increase the capacity, a Brayton refrigeration cycle with nitrogen expander was recently added to the cold end of the reputable propane pre-cooled mixed-refrigerant (C3-MR) process. Similar modifications with a nitrogen expander cycle are extensively investigated on a variety of cycle configurations. The existing and modified cycles are simulated with commercial process software (Aspen HYSYS) based on selected specifications. The results are compared in terms of thermodynamic efficiency, liquefaction capacity, and estimated size of heat exchangers. The combination of C3-MR with partial regeneration and pre-cooling of nitrogen expander cycle is recommended to have a great potential for high efficiency and large capacity.
Nitrogen expander cycles for large capacity liquefaction of natural gas
Chang, Ho-Myung; Park, Jae Hoon; Gwak, Kyung Hyun; Choe, Kun Hyung
2014-01-01
Thermodynamic study is performed on nitrogen expander cycles for large capacity liquefaction of natural gas. In order to substantially increase the capacity, a Brayton refrigeration cycle with nitrogen expander was recently added to the cold end of the reputable propane pre-cooled mixed-refrigerant (C3-MR) process. Similar modifications with a nitrogen expander cycle are extensively investigated on a variety of cycle configurations. The existing and modified cycles are simulated with commercial process software (Aspen HYSYS) based on selected specifications. The results are compared in terms of thermodynamic efficiency, liquefaction capacity, and estimated size of heat exchangers. The combination of C3-MR with partial regeneration and pre-cooling of nitrogen expander cycle is recommended to have a great potential for high efficiency and large capacity.
Nitrogen expander cycles for large capacity liquefaction of natural gas
International Nuclear Information System (INIS)
Chang, Ho-Myung; Park, Jae Hoon; Gwak, Kyung Hyun; Choe, Kun Hyung
2014-01-01
Thermodynamic study is performed on nitrogen expander cycles for large capacity liquefaction of natural gas. In order to substantially increase the capacity, a Brayton refrigeration cycle with nitrogen expander was recently added to the cold end of the reputable propane pre-cooled mixed-refrigerant (C3-MR) process. Similar modifications with a nitrogen expander cycle are extensively investigated on a variety of cycle configurations. The existing and modified cycles are simulated with commercial process software (Aspen HYSYS) based on selected specifications. The results are compared in terms of thermodynamic efficiency, liquefaction capacity, and estimated size of heat exchangers. The combination of C3-MR with partial regeneration and pre-cooling of nitrogen expander cycle is recommended to have a great potential for high efficiency and large capacity
Environmental assessment, expanded Ponnequin wind energy project, Weld County, Colorado
International Nuclear Information System (INIS)
1999-02-01
The US Department of Energy (DOE) has considered a proposal from the State of Colorado, Office of Energy Conservation (OEC), for funding construction of the Expanded Ponnequin Wind Project in Weld County, Colorado. OEC plans to enter into a contracting arrangement with Public Service Company of Colorado (PSCo) for the completion of these activities. PSCo, along with its subcontractors and business partners, are jointly developing the Expanded Ponnequin Wind Project. The purpose of this Final Environmental Assessment (EA) is to provide DOE and the public with information on potential environmental impacts associated with the Expanded Ponnequin Wind Energy Project. This EA, and public comments received on it, were used in DOE's deliberations on whether to release funding for the expanded project under the Commercialization Ventures Program
Environmental assessment, expanded Ponnequin wind energy project, Weld County, Colorado
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-02-01
The US Department of Energy (DOE) has considered a proposal from the State of Colorado, Office of Energy Conservation (OEC), for funding construction of the Expanded Ponnequin Wind Project in Weld County, Colorado. OEC plans to enter into a contracting arrangement with Public Service Company of Colorado (PSCo) for the completion of these activities. PSCo, along with its subcontractors and business partners, are jointly developing the Expanded Ponnequin Wind Project. The purpose of this Final Environmental Assessment (EA) is to provide DOE and the public with information on potential environmental impacts associated with the Expanded Ponnequin Wind Energy Project. This EA, and public comments received on it, were used in DOE`s deliberations on whether to release funding for the expanded project under the Commercialization Ventures Program.
Self-Expanding, Tough Biodegradable Elastomers for Wound Stasis
2015-08-06
the civilian setting, with no effective therapies available at point of injury. We previously reported that a self- expanding polyurethane foam...setting, with no effective therapies available at point of injury. We previously reported that a self-expanding polyurethane foam significantly...care in accor- dance with the Guide of the Care and Use of Laboratory Ani- mals (Health, 2011 #17). 2.2. Instrumentation and monitoring All swine (n
EFFECT OF INCORPORATING EXPANDED POLYSTYRENE ...
African Journals Online (AJOL)
2012-11-03
Nov 3, 2012 ... Incorporating expanded polystyrene granules in concrete matrix can produce lightweight polystyrene aggregate concrete of ... structure. [1] reported that the standard workability tests are not suitable for the polystyrene aggregate concrete since they are sensitive to the unit weight of concrete. [2] made ...
Expanding Greenland’s Glacial Record
DEFF Research Database (Denmark)
Bjørk, Anders Anker
. On order to expand the glacial history of Greenland, this thesis explores physical and geological archives for evidence of the glaciers’ past response to climatic variations. Using aerial photographs, the dynamic history of the Greenland Ice Sheet is extended back to 1900 C.E. Glacier changes covering...
Synthetic biology devices for in vitro and in vivo diagnostics.
Slomovic, Shimyn; Pardee, Keith; Collins, James J
2015-11-24
There is a growing need to enhance our capabilities in medical and environmental diagnostics. Synthetic biologists have begun to focus their biomolecular engineering approaches toward this goal, offering promising results that could lead to the development of new classes of inexpensive, rapidly deployable diagnostics. Many conventional diagnostics rely on antibody-based platforms that, although exquisitely sensitive, are slow and costly to generate and cannot readily confront rapidly emerging pathogens or be applied to orphan diseases. Synthetic biology, with its rational and short design-to-production cycles, has the potential to overcome many of these limitations. Synthetic biology devices, such as engineered gene circuits, bring new capabilities to molecular diagnostics, expanding the molecular detection palette, creating dynamic sensors, and untethering reactions from laboratory equipment. The field is also beginning to move toward in vivo diagnostics, which could provide near real-time surveillance of multiple pathological conditions. Here, we describe current efforts in synthetic biology, focusing on the translation of promising technologies into pragmatic diagnostic tools and platforms.
Expandable Total Humeral Replacement in a Child with Osteosarcoma
Directory of Open Access Journals (Sweden)
Eric R. Henderson
2015-01-01
Full Text Available Case. A right-handed 8-year-old female patient presented with a conventional, high-grade osteosarcoma involving her right humerus; through-shoulder amputation was recommended. After consultation, total humerus resection with expandable, total humeral endoprosthesis reconstruction was performed with a sleeve to encourage soft-tissue ingrowth. At three-year follow-up she has received one lengthening procedure and her functional scores are excellent. Conclusion. Total humeral resection and replacement in the pediatric population are rare and although early reports of expandable total humeral endoprosthesis outcomes demonstrate high failure rates, this patient’s success indicates that expandable total humeral replacement is a viable option.
Xu, Yang; Zhang, Ming; Ramos, Carlos A.; Durett, April; Liu, Enli; Dakhova, Olga; Liu, Hao; Creighton, Chad J.; Gee, Adrian P.; Heslop, Helen E.; Rooney, Cliona M.; Savoldo, Barbara
2014-01-01
Adoptive transfer of T lymphocytes expressing a CD19-specific chimeric antigen receptor (CAR.CD19) induces complete tumor regression in patients with lymphoid malignancies. Although in vivo persistence of CAR-T cells correlates with clinical responses, it remains unknown whether specific cell subsets within the CAR–T-cell product correlate with their subsequent in vivo expansion and persistence. We analyzed 14 patients with B-cell malignancies infused with autologous CAR.CD19-redirected T cells expanded ex vivo using IL-2, and found that their in vivo expansion only correlated with the frequency within the infused product of a CD8+CD45RA+CCR7+ subset, whose phenotype is closest to “T-memory stem cells.” Preclinical models showed that increasing the frequency of CD8+CD45RA+CCR7+ CAR-T cells in the infused line by culturing the cells with IL-7 and IL-15 produced greater antitumor activity of CAR-T cells mediated by increased resistance to cell death, following repetitive encounters with the antigen, while preserving their migration to secondary lymphoid organs. This trial was registered at www.clinicaltrials.gov as #NCT00586391 and #NCT00709033. PMID:24782509
Principles of the fifth order tuning of beam expanders
International Nuclear Information System (INIS)
Meot, F.; Aniel, T.
1995-01-01
An analytical treatment of the third and fifth order optics of beam expanders is described, which allows precise tuning of the optical elements of the beam line, and efficient optimization of the beam uniformizing at the extended target. An application to a two-dimensional expander is given as an illustration. (authors)
Survival of cord blood haematopoietic stem cells in a hyaluronan hydrogel for ex vivo biomimicry.
Demange, Elise; Kassim, Yusra; Petit, Cyrille; Buquet, Catherine; Dulong, Virginie; Cerf, Didier Le; Buchonnet, Gérard; Vannier, Jean-Pierre
2013-11-01
Haematopoietic stem cells (HSCs) and haematopoietic progenitor cells (HPCs) grow in a specified niche in close association with the microenvironment, the so-called 'haematopoietic niche'. Scaffolds have been introduced to overcome the liquid culture limitations, mimicking the presence of the extracellular matrix (ECM). In the present study the hyaluronic acid scaffold, already developed in the laboratory, has been used for the first time to maintain long-term cultures of CD34⁺ haematopoietic cells obtained from human cord blood. One parameter investigated was the impact on ex vivo survival of CD34⁺ cord blood cells (CBCs) on the hyaluronic acid surface, immobilized with peptides containing the RGD motif. This peptide was conjugated by coating the hyaluronan hydrogel and cultured in serum-free liquid phase complemented with stem cell factor (SCF), a commonly indispensable cytokine for haematopoiesis. Our work demonstrated that these hyaluronan hydrogels were superior to traditional liquid cultures by maintaining and expanding the HPCs without the need for additional cytokines, and a colonization of 280-fold increment in the hydrogel compared with liquid culture after 28 days of ex vivo expansion. Copyright © 2012 John Wiley & Sons, Ltd.
In Vitro and In Vivo Models for the Study of Human Polyomavirus Infection
Directory of Open Access Journals (Sweden)
Heidi Barth
2016-10-01
Full Text Available Developments of genome amplification techniques have rapidly expanded the family of human polyomaviruses (PyV. Following infection early in life, PyV persist in their hosts and are generally of no clinical consequence. High-level replication of PyV can occur in patients under immunosuppressive or immunomodulatory therapy and causes severe clinical entities, such as progressive multifocal leukoencephalopathy, polyomavirus-associated nephropathy or Merkel cell carcinoma. The characterization of known and newly-discovered human PyV, their relationship to human health, and the mechanisms underlying pathogenesis remain to be elucidated. Here, we summarize the most widely-used in vitro and in vivo models to study the PyV-host interaction, pathogenesis and anti-viral drug screening. We discuss the strengths and limitations of the different models and the lessons learned.
Theoretical investigation of flash vaporisation in a screw expander
Vasuthevan, Hanushan; Brümmer, Andreas
2017-08-01
In the present study flash vaporisation of liquid injection in a twin screw expander for a Trilateral Flash Cycle (TFC) is examined theoretically. The TFC process comprises a pressure increase in the working fluid, followed by heating the liquid close to boiling point. The hot liquid is injected into the working chamber of a screw expander. During this process the pressure of the liquid drops below the saturation pressure, while the temperature of the liquid remains virtually constant. Hence the liquid is superheated and in a metastable state. The liquid jet seeks to achieve a stable state in thermodynamic equilibrium and is therefore partially vaporised. This effect is referred to as flash vaporisation. Accordingly, a two-phase mixture, consisting of vapour and liquid, exists in the working chamber. Thermodynamic simulations were carried out using water as the working fluid for representative screw expander geometry. The simulations presented are performed from two different aspects during the filling process of a screw expander. The first case is the vaporisation of the injected liquid in a state of thermodynamic equilibrium, whereby the two-phase mixture is treated entirely as a compressible and homogeneous gas. The second case considers flashing efficiency. It describes the quantity of flashed vapour and consists of a liquid and vapour domain. Both models are compared and analysed with respect to the operational behaviour of a screw expander.
Expanding the HAWC Observatory
Energy Technology Data Exchange (ETDEWEB)
Mori, Johanna [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2016-08-17
The High Altitude Water Cherenkov Gamma-Ray Observatory is expanding its current array of 300 water tanks to include 350 outrigger tanks to increase sensitivity to gamma rays above 10 TeV. This involves creating and testing hardware with which to build the new tanks, including photomultiplier tubes, high voltage supply units, and flash analog to digital converters. My responsibilities this summer included preparing, testing and calibrating that equipment.
Expanding the Universe of Education.
Parsons, Elizabeth
1996-01-01
Definitions of "education" and "rural" are debunked and expanded. The three major tasks of rural education are educating people to understand their own needs, the unavoidable changes that will transform rural Australia within their lifetimes, and the range of technologies that can enhance their well-being. Presents a strategy…
Can microcarrier-expanded chondrocytes synthesize cartilaginous tissue in vitro?
Surrao, Denver C; Khan, Aasma A; McGregor, Aaron J; Amsden, Brian G; Waldman, Stephen D
2011-08-01
Tissue engineering is a promising approach for articular cartilage repair; however, it is challenging to produce adequate amounts of tissue in vitro from the limited number of cells that can be extracted from an individual. Relatively few cell expansion methods exist without the problems of de-differentiation and/or loss of potency. Recently, however, several studies have noted the benefits of three-dimensional (3D) over monolayer expansion, but the ability of 3D expanded chondrocytes to synthesize cartilaginous tissue constructs has not been demonstrated. Thus, the purpose of this study was to compare the properties of engineered cartilage constructs from expanded cells (monolayer and 3D microcarriers) to those developed from primary chondrocytes. Isolated bovine chondrocytes were grown for 3 weeks in either monolayer (T-Flasks) or 3D microcarrier (Cytodex 3) expansion culture. Expanded and isolated primary cells were then seeded in high density culture on Millicell™ filters for 4 weeks to evaluate the ability to synthesize cartilaginous tissue. While microcarrier expansion was twice as effective as monolayer expansion (microcarrier: 110-fold increase, monolayer: 52-fold increase), the expanded cells (monolayer and 3D microcarrier) were not effectively able to synthesize cartilaginous tissue in vitro. Tissues developed from primary cells were substantially thicker and accumulated significantly more extracellular matrix (proteoglycan content: 156%-292% increase; collagen content: 70%-191% increase). These results were attributed to phenotypic changes experienced during the expansion phase. Monolayer expanded chondrocytes lost their native morphology within 1 week, whereas microcarrier-expanded cells were spreading by 3 weeks of expansion. While the use of 3D microcarriers can lead to large cellular yields, preservation of chondrogenic phenotype during expansion is required in order to synthesize cartilaginous tissue.
Lew, Kristi
2011-01-01
People have always been fascinated with the stars above and the universe that contains them. Over the years, astronomers have developed numerous theories to explain how the universe began, how it works, and what its ultimate fate will be. But all of the scientists' questions are far from answered. The Expanding Universe goes beyond the creation of the universe to explain how scientists think the universe works, grows, and changes, including what great thinkers Isaac Newton and Albert Einstein had to say about its fate. Readers will also learn about how researchers are slowly shedding light on
DEFF Research Database (Denmark)
Bjarnsholt, Thomas; Alhede, Maria; Alhede, Morten
2013-01-01
Bacteria can grow and proliferate either as single, independent cells or organized in aggregates commonly referred to as biofilms. When bacteria succeed in forming a biofilm within the human host, the infection often becomes very resistant to treatment and can develop into a chronic state. Biofilms...... have been studied for decades using various in vitro models, but it remains debatable whether such in vitro biofilms actually resemble in vivo biofilms in chronic infections. In vivo biofilms share several structural characteristics that differ from most in vitro biofilms. Additionally, the in vivo...... experimental time span and presence of host defenses differ from chronic infections and the chemical microenvironment of both in vivo and in vitro biofilms is seldom taken into account. In this review, we discuss why the current in vitro models of biofilms might be limited for describing infectious biofilms...
Ecological and evolutionary processes at expanding range margins
Thomas, C.D.; Bodsworth, E.J.; Wilson, R.J.; Simmons, A.D.; Davies, Z.G.; Musche, M.; Conradt, L.
2001-01-01
Many animals are regarded as relatively sedentary and specialized in marginal parts of their geographical distributions. They are expected to be slow at colonizing new habitats. Despite this, the cool margins of many species' distributions have expanded\\ud rapidly in association with recent climate warming3±10. We examined four insect species that have expanded their geographical\\ud ranges in Britain over the past 20 years. Here we report that two butterfly species have increased the variety ...
Black holes in an expanding universe.
Gibbons, Gary W; Maeda, Kei-ichi
2010-04-02
An exact solution representing black holes in an expanding universe is found. The black holes are maximally charged and the universe is expanding with arbitrary equation of state (P = w rho with -1 < or = for all w < or = 1). It is an exact solution of the Einstein-scalar-Maxwell system, in which we have two Maxwell-type U(1) fields coupled to the scalar field. The potential of the scalar field is an exponential. We find a regular horizon, which depends on one parameter [the ratio of the energy density of U(1) fields to that of the scalar field]. The horizon is static because of the balance on the horizon between gravitational attractive force and U(1) repulsive force acting on the scalar field. We also calculate the black hole temperature.
Parameter estimation for an expanding universe
Directory of Open Access Journals (Sweden)
Jieci Wang
2015-03-01
Full Text Available We study the parameter estimation for excitations of Dirac fields in the expanding Robertson–Walker universe. We employ quantum metrology techniques to demonstrate the possibility for high precision estimation for the volume rate of the expanding universe. We show that the optimal precision of the estimation depends sensitively on the dimensionless mass m˜ and dimensionless momentum k˜ of the Dirac particles. The optimal precision for the ratio estimation peaks at some finite dimensionless mass m˜ and momentum k˜. We find that the precision of the estimation can be improved by choosing the probe state as an eigenvector of the hamiltonian. This occurs because the largest quantum Fisher information is obtained by performing projective measurements implemented by the projectors onto the eigenvectors of specific probe states.
Role of expanders in helium liquefaction cycles: Parametric studies using Collins cycle
International Nuclear Information System (INIS)
Thomas, Rijo Jacob; Ghosh, Parthasarathi; Chowdhury, Kanchan
2011-01-01
Large scale helium liquefaction/refrigeration plant is a key subsystem of fusion devices. Performance of these plants is dependent on a number of geometric and operating parameters of its constituting components such as compressors, heat exchangers, expanders, valves, etc. Expander has been chosen as the subject matter of analyses in the present study. As the sensible cold of helium vapor is lost in liquefiers, the expanders in liquefaction cycles have to provide more refrigeration than those in refrigeration cycles. The expander parameters such as rate of mass flow, operating pressure, inlet temperature, etc. are inter-dependent, and hence, it is difficult to predict the system behavior with variation of a particular parameter. This necessitates the use of process simulators. Parametric studies have been performed on Collins helium liquefaction cycle using Aspen HYSYS. Collins cycle has all the basic characteristics of a large-scale helium liquefier and the results of this study may be extrapolated to understand the behavior of large scale helium liquefiers. The study shows that the maximum liquid production is obtained when 80% of the compressor flow is diverted through the expanders and it is equally distributed between the two expanders. The relationships between the liquid production and the isentropic efficiency of expanders are almost linear and both the higher and lower temperature expanders exhibit similar trends.
Role of expanders in helium liquefaction cycles: Parametric studies using Collins cycle
Energy Technology Data Exchange (ETDEWEB)
Thomas, Rijo Jacob, E-mail: rijojthomas@gmail.com [Cryogenic Engineering Centre, Indian Institute of Technology, Kharagpur, West Bengal 721302 (India); Ghosh, Parthasarathi; Chowdhury, Kanchan [Cryogenic Engineering Centre, Indian Institute of Technology, Kharagpur, West Bengal 721302 (India)
2011-06-15
Large scale helium liquefaction/refrigeration plant is a key subsystem of fusion devices. Performance of these plants is dependent on a number of geometric and operating parameters of its constituting components such as compressors, heat exchangers, expanders, valves, etc. Expander has been chosen as the subject matter of analyses in the present study. As the sensible cold of helium vapor is lost in liquefiers, the expanders in liquefaction cycles have to provide more refrigeration than those in refrigeration cycles. The expander parameters such as rate of mass flow, operating pressure, inlet temperature, etc. are inter-dependent, and hence, it is difficult to predict the system behavior with variation of a particular parameter. This necessitates the use of process simulators. Parametric studies have been performed on Collins helium liquefaction cycle using Aspen HYSYS. Collins cycle has all the basic characteristics of a large-scale helium liquefier and the results of this study may be extrapolated to understand the behavior of large scale helium liquefiers. The study shows that the maximum liquid production is obtained when 80% of the compressor flow is diverted through the expanders and it is equally distributed between the two expanders. The relationships between the liquid production and the isentropic efficiency of expanders are almost linear and both the higher and lower temperature expanders exhibit similar trends.
Coupled-expanding maps and one-sided symbolic dynamical systems
International Nuclear Information System (INIS)
Shi Yuming; Ju, Hyonhui; Chen Guanrong
2009-01-01
This paper studies relationships between coupled-expanding maps and one-sided symbolic dynamical systems. The concept of coupled-expanding map is extended to a more general one: coupled-expansion for a transitive matrix. It is found that the subshift for a transitive matrix is strictly coupled-expanding for the matrix in certain disjoint compact subsets; the topological conjugacy of a continuous map in its compact invariant set of a metric space to a subshift for a transitive matrix has a close relationship with that the map is strictly coupled-expanding for the matrix in some disjoint compact subsets. A certain relationship between strictly coupled-expanding maps for a transitive matrix in disjoint bounded and closed subsets of a complete metric space and their topological conjugacy to the subshift for the matrix is also obtained. Dynamical behaviors of subshifts for irreducible matrices are then studied and several equivalent statements to chaos are obtained; especially, chaos in the sense of Li-Yorke is equivalent to chaos in the sense of Devaney for the subshift, and is also equivalent to that the domain of the subshift is infinite. Based on these results, several new criteria of chaos for maps are finally established via strict coupled-expansions for irreducible transitive matrices in compact subsets of metric spaces and in bounded and closed subsets of complete metric spaces, respectively, where their conditions are weaker than those existing in the literature.
In vitro and in vivo evaluation of capsaicin-loaded microemulsion for enhanced oral bioavailability.
Zhu, Yuan; Zhang, Jiajia; Zheng, Qianfeng; Wang, Miaomiao; Deng, Wenwen; Li, Qiang; Firempong, Caleb Kesse; Wang, Shengli; Tong, Shanshan; Xu, Ximing; Yu, Jiangnan
2015-10-01
Capsaicin, as a food additive, has attracted worldwide concern owing to its pungency and multiple pharmacological effects. However, poor water solubility and low bioavailability have limited its application. This study aims to develop a capsaicin-loaded microemulsion to enhance the oral bioavailability of the anti-neuropathic-pain component, capsaicin, which is poorly water soluble. In this study, the microemulsion consisting of Cremophor EL, ethanol, medium-chain triglycerides (oil phase) and water (external phase) was prepared and characterized (particle size, morphology, stability and encapsulation efficiency). The gastric mucosa irritation test of formulated capsaicin was performed in rats to evaluate its oral feasibility, followed by the pharmacokinetic study in vivo. Under these conditions, the encapsulated capsaicin revealed a faster capsaicin release in vitro coupled with a greater absorption in vivo when compared to the free capsaicin. The oral bioavailability of the formulated capsaicin-loaded microemulsions was 2.64-fold faster than that of free capsaicin. No significant irritation was observed on the mucosa from the pathological section of capsaicin-loaded microemulsion treated stomach. These results indicate that the developed microemulsion represents a safe and orally effective carrier for poorly soluble substances. The formulation could be used for clinical trials and expand the application of capsaicin. © 2014 Society of Chemical Industry.
International Nuclear Information System (INIS)
Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm
1989-01-01
The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)
Expanded-boundary approach to impurity control in tokamaks
International Nuclear Information System (INIS)
Ohyabu, N.
1981-01-01
It is proposed to expand the outermost flux surfaces in tokamaks to divert the heat flux emerging from the plasma core. The expanded flux surfaces provide a large volume for radiative cooling. The radiative power at the boundary is enhanced by the effects of plasma flow as well as by a volumetric factor, and the resultant edge cooling and reduced heat load on the limiter may significantly retard impurity generation. Furthermore, it seems to be compatible with reactor engineering requirements. (author)
Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.
Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P
1999-05-01
To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.
Influence Of Collapsing Matter On The Enveloping Expanding Universe
Choudhury, A. Latif
2005-01-01
Using a collapsing matter model at the center of an expanding universe as described by Weinberg we assume a special type of generated pressure. This pressure transmits into the surrounding expanding universe. Under certain restriction the ensuing hubble parameter is positive. The deacceleration parameter fluctuates with time, indicating that the universe accelerates for certain time and decelerates for other time intervals.
Analogue cosmological particle creation: Quantum correlations in expanding Bose-Einstein condensates
International Nuclear Information System (INIS)
Prain, Angus; Liberati, Stefano; Fagnocchi, Serena
2010-01-01
We investigate the structure of quantum correlations in an expanding Bose-Einstein condensate (BEC) through the analogue gravity framework. We consider both a 3+1 isotropically expanding BEC as well as the experimentally relevant case of an elongated, effectively 1+1 dimensional, expanding condensate. In this case we include the effects of inhomogeneities in the condensate, a feature rarely included in the analogue gravity literature. In both cases we link the BEC expansion to a simple model for an expanding spacetime and then study the correlation structure numerically and analytically (in suitable approximations). We also discuss the expected strength of such correlation patterns and experimentally feasible BEC systems in which these effects might be detected in the near future.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Directory of Open Access Journals (Sweden)
Yi Liu
2017-04-01
Full Text Available Summary: Natural genetic diversity offers an important yet largely untapped resource to decipher the molecular mechanisms regulating hematopoietic stem cell (HSC function. Latexin (Lxn is a negative stem cell regulatory gene identified on the basis of genetic diversity. By using an Lxn knockout mouse model, we found that Lxn inactivation in vivo led to the physiological expansion of the entire hematopoietic hierarchy. Loss of Lxn enhanced the competitive repopulation capacity and survival of HSCs in a cell-intrinsic manner. Gene profiling of Lxn-null HSCs showed altered expression of genes enriched in cell-matrix and cell-cell interactions. Thrombospondin 1 (Thbs1 was a potential downstream target with a dramatic downregulation in Lxn-null HSCs. Enforced expression of Thbs1 restored the Lxn inactivation-mediated HSC phenotypes. This study reveals that Lxn plays an important role in the maintenance of homeostatic hematopoiesis, and it may lead to development of safe and effective approaches to manipulate HSCs for clinical benefit. : In this article, Liang and colleagues show that loss of latexin in vivo expands the HSC population and increases their survival and engraftment. Latexin regulates HSC function and hematopoiesis via the Thbs1 signaling pathway. Keywords: latexin, hematopoietic stem cell, repopulating advantage, expansion, survival, thrombospondin 1
Chronic expanding hematoma in the retroperitoneal space: a case report
2013-01-01
Background Chronic expanding hematoma is a rare condition that develops after surgery, trauma, or injury. It can also develop at any location in the body in the absence of trauma. Clinical findings and various diagnostic imaging modalities can aid in the differential diagnosis of this condition. In general, hematomas are naturally reabsorbed and rarely cause serious problems. However, hematomas that develop slowly without a history of trauma, surgery, or bleeding disorders could be difficult to differentiate from soft tissue neoplasms. In the present case, we describe a patient, without any history or physical evidence of trauma, who exhibited a large chronic expanding hematoma in the retroperitoneal space that resulted in hydronephrosis because of the pressure exerted on the left ureter. Case presentation A 69-year-old man presented to our hospital with a swollen lesion in the left flank. A mass, 19 cm in diameter, was detected in the retroperitoneal space by computed tomography. We suspected the presence of a chronic expanding hematoma, soft tissue tumor, or left renal artery aneurysm. Surgical treatment was performed. However, postoperative histopathological examination indicated that the mass was a nonmalignant chronic expanding hematoma. No recurrence was observed during a 2-year follow-up period. Conclusion In patients without a history of trauma who present slowly growing masses, the differential diagnosis should include chronic expanding hematoma in addition to cysts and soft tissue tumors. Moreover, the use of magnetic resonance imaging and computed tomography is essential to differentiate between chronic expanding hematoma and soft tissue tumors. PMID:24237992
Differential effect of L3T4+ cells on recovery from total-body irradiation
International Nuclear Information System (INIS)
Pantel, K.; Nakeff, A.
1990-01-01
We have examined the importance of L3T4+ (murine equivalent to CD4+) cells for hematopoietic regulation in vivo in unperturbed mice and mice recovering from total-body irradiation (TBI) using a cytotoxic monoclonal antibody (MoAb) raised with the GK 1.5 hybridoma. Ablating L3T4+ cells in normal (unperturbed) B6D2F1 mice substantially decreased the S-phase fraction (determined by in vivo hydroxyurea suicide) of erythroid progenitor cells (erythroid colony-forming units, CFU-E) as compared to the pretreatment level (10% +/- 14.1% [day 3 following depletion] vs 79.8% +/- 15.9%, respectively) with a corresponding decrease in the marrow content of CFU-E at this time to approximately 1% of the pretreatment value. Although the S-phase fraction of CFU-GM was decreased to 2.2% +/- 3.1% 3 days after L3T4+ cell ablation from the 21.3% +/- 8.3% pretreatment value, CFU-GM cellularity showed little change over the 3 days following anti-L3T4 treatment. Anti-L3T4 MoAb treatment had little or no effect on either the S-phase fraction or the marrow content of hematopoietic stem cells (spleen colony-forming units, CFU-S) committed to myeloerythroid differentiation. Ablating L3T4+ cells prior to a single dose of 2 Gy TBI resulted in significantly reduced marrow contents of CFU-S on day 3 and granulocyte-macrophage colony-forming units (CFU-GM) on day 6 following TBI, with little or no effect on the corresponding recovery of CFU-E. The present findings provide the first in vivo evidence that L3T4+ cells are involved in: (1) maintaining the proliferative activity of CFU-E and CFU-GM in unperturbed mice and (2) supporting the restoration of CFU-S and CFU-GM following TBI-induced myelosuppression
Small Engines as Bottoming Cycle Steam Expanders for Internal Combustion Engines
Weerasinghe, Rohitha; Hounsham, Sandra
2017-01-01
Heat recovery bottoming cycles for internal combustion engines have opened new avenues for research into small steam expanders [1]. Dependable data for small steam expanders will allow us to predict on their suitability as bottoming cycle engines and the fuel economy achieved by using them as bottoming cycles. Wankel Engines, with its lower resistance properties at small scale provide excellent contenders for bottoming cycle expanders. Present paper is based on results of experiments carried ...
Feng, Lei; Jeon, Tina; Yu, Qiaowen; Ouyang, Minhui; Peng, Qinmu; Mishra, Virendra; Pletikos, Mihovil; Sestan, Nenad; Miller, Michael I; Mori, Susumu; Hsiao, Steven; Liu, Shuwei; Huang, Hao
2017-12-01
Animal models of the rhesus macaque (Macaca mulatta), the most widely used nonhuman primate, have been irreplaceable in neurobiological studies. However, a population-averaged macaque brain diffusion tensor imaging (DTI) atlas, including comprehensive gray and white matter labeling as well as bony and facial landmarks guiding invasive experimental procedures, is not available. The macaque white matter tract pathways and microstructures have been rarely recorded. Here, we established a population-averaged macaque brain atlas with high-resolution ex vivo DTI integrated into in vivo space incorporating bony and facial landmarks, and delineated microstructures and three-dimensional pathways of major white matter tracts in vivo MRI/DTI and ex vivo (postmortem) DTI of ten rhesus macaque brains were acquired. Single-subject macaque brain DTI template was obtained by transforming the postmortem high-resolution DTI data into in vivo space. Ex vivo DTI of ten macaque brains was then averaged in the in vivo single-subject template space to generate population-averaged macaque brain DTI atlas. The white matter tracts were traced with DTI-based tractography. One hundred and eighteen neural structures including all cortical gyri, white matter tracts and subcortical nuclei, were labeled manually on population-averaged DTI-derived maps. The in vivo microstructural metrics of fractional anisotropy, axial, radial and mean diffusivity of the traced white matter tracts were measured. Population-averaged digital atlas integrated into in vivo space can be used to label the experimental macaque brain automatically. Bony and facial landmarks will be available for guiding invasive procedures. The DTI metric measurements offer unique insights into heterogeneous microstructural profiles of different white matter tracts.
Experimental Investigation of the Performance of a Hermetic Screw-Expander Organic Rankine Cycle
Directory of Open Access Journals (Sweden)
Sung-Wei Hsu
2014-09-01
Full Text Available In this study, the authors experimentally investigate the performance of the organic Rankine cycle (ORC and screw expander under the influence of supply pressure and pressure ratio over the expander. Three tests were performed with expander pressure ratios of 2.4–3.5, 3.0–4.6, and 3.3–6.1, which cover the over-expansion and under-expansion operating modes. The test results show a maximum expander isentropic efficiency of 72.4% and a relative cycle efficiency of 10.5% at an evaporation temperature of 101 °C and condensation temperature of 45 °C. At a given pressure ratio over the expander, a higher supply pressure to the expander causes a higher expander isentropic efficiency and higher cycle efficiency in the over-expansion mode. However, in the under-expansion mode, the higher supply pressure results in a lower expander isentropic efficiency and adversely affects the cycle efficiency. The results also show that under the condition of operation at a given pressure ratio, a higher supply pressure yields a larger power output owing to the increased mass flow rate at the higher supply pressure. The study results demonstrate that a screw-expander ORC can be operated with a wide range of heat sources and heat sinks with satisfactory cycle efficiency.
Generating higher-order Lie algebras by expanding Maurer-Cartan forms
International Nuclear Information System (INIS)
Caroca, R.; Merino, N.; Salgado, P.; Perez, A.
2009-01-01
By means of a generalization of the Maurer-Cartan expansion method, we construct a procedure to obtain expanded higher-order Lie algebras. The expanded higher-order Maurer-Cartan equations for the case G=V 0 +V 1 are found. A dual formulation for the S-expansion multialgebra procedure is also considered. The expanded higher-order Maurer-Cartan equations are recovered from S-expansion formalism by choosing a special semigroup. This dual method could be useful in finding a generalization to the case of a generalized free differential algebra, which may be relevant for physical applications in, e.g., higher-spin gauge theories.
Dynamical 3-Space: Black Holes in an Expanding Universe
Directory of Open Access Journals (Sweden)
Rothall D. P.
2013-10-01
Full Text Available Black holes are usually studied without including effects of the expanding universe. However in some recent studies black holes have been embedded in an expanding universe, in order to determine the interplay, if any, of these two dynamical processes. Dynamical 3-space theory contains time independent solutions for black holes, which are spatial in-flows, and separately the time dependent Hubble expansion. This theory has explained numerous puzzles in observational astrophysics and contains 3 constants; G, - which from experimental data turns out to be the fine structure constant, and - which is a small but nonzero distance, possibly a Planck-type length. The Hubble expansion in the dynamical 3-space theory cannot be “switched o”, forcing the study, first, of isolated black holes coexisting with the expanding universe. It is shown that a time dependent black hole and expanding universe solution exists. The nature and implications of these solutions are discussed as they evolve over time. A dynamical network of black holes and induced linking cosmic filaments forming bubble structures is discussed, as a consequence of dynamical 3-space undergoing a dynamical breakdown of homogeneity and isotropy, even in the absence of baryonic matter.
'In situ' expanded graphite extinguishant
International Nuclear Information System (INIS)
Cao Qixin; Shou Yuemei; He Bangrong
1987-01-01
This report is concerning the development of the extinguishant for sodium fire and the investigation of its extinguishing property. The experiment result shows that 'in situ' expanded graphite developed by the authors is a kind of extinguishant which extinguishes sodium fire quickly and effectively and has no environment pollution during use and the amount of usage is little
Directory of Open Access Journals (Sweden)
Ming-Li Chou
Full Text Available Clinical-grade ex vivo expansion of corneal endothelial cells can increase the availability of corneal tissues for transplantation and treatment of corneal blindness. However, these cells have very limited proliferative capacity. Successful propagation has required so far to use very complex growth media supplemented with fetal bovine serum and other xenocomponents. We hypothesized that human platelet releasates rich in multiple growth factors, and in particular neurotrophins, could potentially be a useful supplement for ex vivo expansion of corneal endothelium cells due to their neural crest origin. Platelet releasates were prepared by calcium salt activation of apheresis platelet concentrates, subjected or not to complement inactivation by heat treatment at 56°C for 30 minutes. Platelet releasates were characterized for their content in proteins and were found to contain high amount of growth factors including platelet-derived growth factor-AB (30.56 to 39.08 ng/ml and brain-derived neurotrophic factor (30.57 to 37.11 ng/ml neurotrophins. We compared the growth and viability of corneal endothelium cells in DMEM-F12 medium supplemented with different combinations of components, including 2.5%∼10% of the platelet releasates. Corneal endothelium cells expanded in platelet releasates exhibited good adhesion and a typical hexagonal morphology. Their growth and viability were enhanced when using the complement-inactivated platelet releasate at a concentration of 10%. Immunostaining and Western blots showed that CECs maintained the expressions of four important membrane markers: Na-K ATPase α1, zona occludens-1, phospho-connexin 43 and N-cadherin. In conclusion, our study provides the first proof-of-concept that human platelet releasates can be used for ex vivo expansion of corneal endothelium cells. These findings open a new paradigm for ex vivo propagation protocols of corneal endothelium cells in compliance with good tissue culture practices
Galectin-9 activates and expands human T-helper 1 cells.
Directory of Open Access Journals (Sweden)
Marloes J M Gooden
Full Text Available Galectin-9 (Gal-9 is known for induction of apoptosis in IFN-γ and IL-17 producing T-cells and amelioration of autoimmunity in murine models. On the other hand, Gal-9 induced IFN-γ positive T-cells in a sarcoma mouse model and in food allergy, suggesting that Gal-9 can have diametric effects on T-cell immunity. Here, we aimed to delineate the immunomodulatory effect of Gal-9 on human resting and ex vivo activated peripheral blood lymphocytes. Treatment of resting lymphocytes with low concentrations of Gal-9 (5-30 nM induced apoptosis in ∼60% of T-cells after 1 day, but activated the surviving T-cells. These viable T-cells started to expand after 4 days with up to 6 cell divisions by day 7 and an associated shift from naïve towards central memory and IFN-γ producing phenotype. In the presence of T-cell activation signals (anti-CD3/IL-2 Gal-9 did not induce T-cell expansion, but shifted the CD4/CD8 balance towards a CD4-dominated T-cell response. Thus, Gal-9 activates resting T-cells in the absence of typical T-cell activating signals and promotes their transition to a TH1/C1 phenotype. In the presence of T-cell activating signals T-cell immunity is directed towards a CD4-driven response by Gal-9. Thus, Gal-9 may specifically enhance reactive immunological memory.
Ex vivo MR volumetry of human brain hemispheres.
Kotrotsou, Aikaterini; Bennett, David A; Schneider, Julie A; Dawe, Robert J; Golak, Tom; Leurgans, Sue E; Yu, Lei; Arfanakis, Konstantinos
2014-01-01
The aims of this work were to (a) develop an approach for ex vivo MR volumetry of human brain hemispheres that does not contaminate the results of histopathological examination, (b) longitudinally assess regional brain volumes postmortem, and (c) investigate the relationship between MR volumetric measurements performed in vivo and ex vivo. An approach for ex vivo MR volumetry of human brain hemispheres was developed. Five hemispheres from elderly subjects were imaged ex vivo longitudinally. All datasets were segmented. The longitudinal behavior of volumes measured ex vivo was assessed. The relationship between in vivo and ex vivo volumetric measurements was investigated in seven elderly subjects imaged both antemortem and postmortem. This approach for ex vivo MR volumetry did not contaminate the results of histopathological examination. For a period of 6 months postmortem, within-subject volume variation across time points was substantially smaller than intersubject volume variation. A close linear correspondence was detected between in vivo and ex vivo volumetric measurements. Regional brain volumes measured with this approach for ex vivo MR volumetry remain relatively unchanged for a period of 6 months postmortem. Furthermore, the linear relationship between in vivo and ex vivo MR volumetric measurements suggests that this approach captures information linked to antemortem macrostructural brain characteristics. Copyright © 2013 Wiley Periodicals, Inc.
OpenVIVO: Transparency in Scholarship
Directory of Open Access Journals (Sweden)
Violeta Ilik
2018-03-01
Full Text Available OpenVIVO is a free and open-hosted semantic web platform that anyone can join and that gathers and shares open data about scholarship in the world. OpenVIVO, based on the VIVO open-source platform, provides transparent access to data about the scholarly work of its participants. OpenVIVO demonstrates the use of persistent identifiers, the automatic real-time ingest of scholarly ecosystem metadata, the use of VIVO-ISF and related ontologies, the attribution of work, and the publication and reuse of data—all critical components of presenting, preserving, and tracking scholarship. The system was created by a cross-institutional team over the course of 3 months. The team created and used RDF models for research organizations in the world based on Digital Science GRID data, for academic journals based on data from CrossRef and the US National Library of Medicine, and created a new model for attribution of scholarly work. All models, data, and software are available in open repositories.
An Expanding Universe in the Classroom.
Chandler, David
1991-01-01
Two computer-generated star charts that can be used as overlay transparencies to show an expanding universe are presented. Directions on how to use the star charts to determine the Hubble constant and the age of the universe are provided. (KR)
Höfner, Thomas; Klein, Corinna; Eisen, Christian; Rigo-Watermeier, Teresa; Haferkamp, Axel; Sprick, Martin R
2016-04-01
The long-term propagation of basal prostate progenitor cells ex vivo has been very difficult in the past. The development of novel methods to expand prostate progenitor cells in vitro allows determining their cell surface phenotype in greater detail. Mouse (Lin(-)Sca-1(+) CD49f(+) Trop2(high)-phenotype) and human (Lin(-) CD49f(+) TROP2(high)) basal prostate progenitor cells were expanded in vitro. Human and mouse cells were screened using 242 anti-human or 176 antimouse monoclonal antibodies recognizing the cell surface protein profile. Quantitative expression was evaluated at the single-cell level using flow cytometry. Differentially expressed cell surface proteins were evaluated in conjunction with the known CD49f(+)/TROP2(high) phenotype of basal prostate progenitor cells and characterized by in vivo sandwich-transplantation experiments using nude mice. The phenotype of basal prostate progenitor cells was determined as CD9(+)/CD24(+)/CD29(+)/CD44(+)/CD47(+)/CD49f(+)/CD104(+)/CD147(+)/CD326(+)/Trop2(high) of mouse as well as human origin. Our analysis revealed several proteins, such as CD13, Syndecan-1 and stage-specific embryonal antigens (SSEAs), as being differentially expressed on murine and human CD49f(+) TROP2(+) basal prostate progenitor cells. Transplantation experiments suggest that CD49f(+) TROP2(high) SSEA-4(high) human prostate basal progenitor cells to be more potent to regenerate prostate tubules in vivo as compared with CD49f(+) TROP2(high) or CD49f(+) TROP2(high) SSEA-4(low) cells. Determination of the cell surface protein profile of functionally defined murine and human basal prostate progenitor cells reveals differentially expressed proteins that may change the potency and regenerative function of epithelial progenitor cells within the prostate. SSEA-4 is a candidate cell surface marker that putatively enables a more accurate identification of the basal PESC lineage. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by
Kaltenhauser, Kristin
2015-01-01
Expanding your horizons is a bi-annual “Science Day” for girls aged 11 to 14, held at the University of Geneva on 14 November. The girls had the opportunity to take part in hands-on workshops held by local professional women in the field of science, mathematics, engineering and technology. For the fourth time, CERN was part of this event, offering three workshops as well as a booth at the Discovery Fair, including Higgnite, an interactive visualization of the Higgs Field.
Production of durable expanded perlite microspheres in a Vertical Electrical Furnace
Panagiotis, M.; Angelopoulos, P.; Taxiarchou, M.; Paspaliaris, I.
2016-04-01
Expanded perlite constitutes one of the most competitive insulating materials that is widely used in construction and manufacturing industry due to its unique properties combination; it is white, natural, lightweight, chemically inert, and exhibits superior insulating properties (thermal and acoustic) and fire resistance. Conventionally, perlite expansion is performed in vertical gas-fired furnaces; the conventional perlite expansion process has certain disadvantages which affect expanded products quality, thus limiting their performance and range of applications. In order to overcome the drawbacks of the conventional expansion technique, a new perlite expansion process has been designed based on a vertical electrical furnace (VEF). In the current study, fine perlite samples (-150 μm) from Milos Island, Greece, were expansed in the novel VEF and a conventional gas-fired furnace with the aim to evaluate and compare the main physical properties of the expanded products. The novel expanded perlite particles were characterised by superior properties, namely increased compression strength, competitive water and oil absorption capability, size homogeneity, spherical shape and decreased surface porosity in comparison to conventionally expanded samples.
Ex-vivo MR Volumetry of Human Brain Hemispheres
Kotrotsou, Aikaterini; Bennett, David A.; Schneider, Julie A.; Dawe, Robert J.; Golak, Tom; Leurgans, Sue E.; Yu, Lei; Arfanakis, Konstantinos
2013-01-01
Purpose The aims of this work were to: a) develop an approach for ex-vivo MR volumetry of human brain hemispheres that does not contaminate the results of histopathological examination, b) longitudinally assess regional brain volumes postmortem, and c) investigate the relationship between MR volumetric measurements performed in-vivo and ex-vivo. Methods An approach for ex-vivo MR volumetry of human brain hemispheres was developed. Five hemispheres from elderly subjects were imaged ex-vivo longitudinally. All datasets were segmented. The longitudinal behavior of volumes measured ex-vivo was assessed. The relationship between in-vivo and ex-vivo volumetric measurements was investigated in seven elderly subjects imaged both ante-mortem and postmortem. Results The presented approach for ex-vivo MR volumetry did not contaminate the results of histopathological examination. For a period of 6 months postmortem, within-subject volume variation across time points was substantially smaller than inter-subject volume variation. A close linear correspondence was detected between in-vivo and ex-vivo volumetric measurements. Conclusion Regional brain volumes measured with the presented approach for ex-vivo MR volumetry remain relatively unchanged for a period of 6 months postmortem. Furthermore, the linear relationship between in-vivo and ex-vivo MR volumetric measurements suggests that the presented approach captures information linked to ante-mortem macrostructural brain characteristics. PMID:23440751
International Nuclear Information System (INIS)
Blomgren, H.; Jacobsson, H.
1974-01-01
Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay
Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D
2010-04-01
The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.
Functional Self-Expandable Metal Stents in Biliary Obstruction
Kwon, Chang-Il; Ko, Kwang Hyun; Hahm, Ki Baik
2013-01-01
Biliary stents are widely used not only for palliative treatment of malignant biliary obstruction but also for benign biliary diseases. Each plastic stent or self-expandable metal stent (SEMS) has its own advantages, and a proper stent should be selected carefully for individual condition. To compensate and overcome several drawbacks of SEMS, functional self-expandable metal stent (FSEMS) has been developed with much progress so far. This article looks into the outcomes and defects of each stent type for benign biliary stricture and describes newly introduced FSEMSs according to their functional categories. PMID:24143314
Expanding Your Horizons Conference in Geneva
Chromek-Burckhart, Doris
2011-01-01
CERN and its experiments participated in Expanding Your Horizons (EYH) in Science and Mathematics conference in Geneva on 12th November. EYH nurture girls' interest in science and math courses to encourage them to consider careers in science, technology, engineering, and math.
Expanding economic opportunities in protracted displacement
Miki Takahashi; Michael Moroz; Jonathan Peters; Jason Pronyk; Richard Barltrop
2018-01-01
Welcome progress has been made towards realising commitments made by international donors and host country governments to expand economic opportunities for Syrian refugees and host communities in neighbouring countries. However targets and commitments also bring new challenges, and evidence must underpin new policies.
Expanding Advanced Civilizations in the Universe
Gros, C.
The 1950 lunch-table remark by Enrico Fermi `Where is everybody' has started intensive scientific and philosophical discussions about what we call nowadays the `Fermi paradox': If there had been ever a single advanced civilization in the cosmological history of our galaxy, dedicated to expansion, it would have had plenty of time to colonize the entire galaxy via exponential growth. No evidence of present or past alien visits to earth are known to us, leading to the standard conclusion that no advanced expanding civilization has ever existed in the milky-way. This conclusion rest fundamentally on the ad-hoc assumption, that any alien civilizations dedicated to expansion at one time would remain dedicated to expansions forever. Considering our limited knowledge about alien civilizations we need however to relax this basic assumption. Here we show that a substantial and stable population of expanding advanced civilization might consequently exist in our galaxy.
Digital Radiography for Determination of Primary Tooth Length: In Vivo and Ex Vivo Studies
Directory of Open Access Journals (Sweden)
Maria D. Basso
2015-01-01
Full Text Available Background. Methods for determining the root canal length of the primary tooth should yield accurate and reproducible results. In vitro studies show some limitations, which do not allow their findings to be directly transferred to a clinical situation. Aim. To compare the accuracy of radiographic tooth length obtained from in vivo digital radiograph with that obtained from ex vivo digital radiograph. Method. Direct digital radiographs of 20 upper primary incisors were performed in teeth (2/3 radicular resorption that were radiographed by an intraoral sensor, according to the long-cone technique. Teeth were extracted, measured, and mounted in a resin block, and then radiographic template was used to standardise the sensor-target distance (30 cm. The apparent tooth length (APTL was obtained from the computer screen by means of an electronic ruler accompanying the digital radiography software (CDR 2.0, whereas the actual tooth length (ACTL was obtained by means of a digital calliper following extraction. Data were compared to the ACTL by variance analysis and Pearson’s correlation test. Results. The values for APTL obtained from in vivo radiography were slightly underestimated, whereas those values obtained from ex vivo were slightly overestimated. No significance was observed (P≤0.48 between APTL and ACTL. Conclusion. The length of primary teeth estimated by in vivo and ex vivo comparisons using digital radiography was found to be similar to the actual tooth length.
Electromagnetic tracking for CT-guided spine interventions: phantom, ex-vivo and in-vivo results
International Nuclear Information System (INIS)
Bruners, Philipp; Penzkofer, Tobias; Nagel, Markus; Elfring, Robert; Schmitz-Rode, Thomas; Gronloh, Nina; Guenther, Rolf W.; Mahnken, Andreas H.
2009-01-01
An electromagnetic-based tracking and navigation system was evaluated for interventional radiology. The electromagnetic tracking system (CAPPA IRAD EMT, CASinnovations, Erlangen, Germany) was used for real-time monitoring of punctures of the lumbar facet joints and intervertebral disks in a spine phantom, three pig cadavers and three anaesthesized pigs. Therefore, pre-interventional computed tomography (CT) datasets were transferred to the navigation system and puncture trajectories were planned. A coaxial needle was advanced along the trajectories while the position of the needle tip was monitored in real time. After puncture tracts were marked with pieces of wire another CT examination was performed and distances between wires and anatomical targets were measured. Performing punctures of the facet joints mean needle positioning errors were 0.4 ± 0.8 mm in the spine phantom, 2.8 ± 2.1 mm ex vivo and 3.0 ± 2.0 mm in vivo with mean length of the puncture tract of 54.0 ± 10.4 mm (phantom), 51.6 ± 12.6 mm (ex vivo) and 50.9 ± 17.6 mm (in vivo). At first attempt, intervertebral discs were successfully punctured in 15/15 in the phantom study, in 12/15 in the ex-vivo study and 14/15 in the in-vivo study, respectively. Immobilization of the patient and optimal positioning of the field generator are essential to achieve a high accuracy of needle placement in a clinical CT setting. (orig.)
Directory of Open Access Journals (Sweden)
Jiafei Xi
2013-01-01
Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.
Heme and erythropoieis: more than a structural role.
Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela
2014-06-01
Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.
Numerical simulation of a twin screw expander for performance prediction
Papes, Iva; Degroote, Joris; Vierendeels, Jan
2015-08-01
With the increasing use of twin screw expanders in waste heat recovery applications, the performance prediction of these machines plays an important role. This paper presents a mathematical model for calculating the performance of a twin screw expander. From the mass and energy conservation laws, differential equations are derived which are then solved together with the appropriate Equation of State in the instantaneous control volumes. Different flow processes that occur inside the screw expander such as filling (accompanied by a substantial pressure loss) and leakage flows through the clearances are accounted for in the model. The mathematical model employs all geometrical parameters such as chamber volume, suction and leakage areas. With R245fa as working fluid, the Aungier Redlich-Kwong Equation of State has been used in order to include real gas effects. To calculate the mass flow rates through the leakage paths formed inside the screw expander, flow coefficients are considered as constant and they are derived from 3D Computational Fluid Dynamic calculations at given working conditions and applied to all other working conditions. The outcome of the mathematical model is the P-V indicator diagram which is compared to CFD results of the same twin screw expander. Since CFD calculations require significant computational time, developed mathematical model can be used for the faster performance prediction.
Expanded austenite, crystallography and residual stress
DEFF Research Database (Denmark)
Christiansen, Thomas; Hummelshøj, Thomas Strabo; Somers, Marcel A. J.
2010-01-01
The identity of expanded austenite as developing during low temperature nitriding and/or carburising of austenitic stainless steel has been under debate since the very first observation of this phase. In the present article, recent results obtained with (a) homogeneous samples of various uniform ...
Expanded austenite; crystallography and residual stress
DEFF Research Database (Denmark)
Christiansen, Thomas; Hummelshøj, Thomas Strabo; Somers, Marcel A. J.
2009-01-01
The identity of expanded austenite as developing during low temperature nitriding and/or carburizing of austenitic stainless steel has been under debate since the very first observation of this phase. In the present article recent results obtained with i) homogeneous samples of various uniform co...
Coping with expanding nursing practice, knowledge, and technology.
Gaudinski, M A
1979-10-01
Nurses utilize transcultural, transactional, systems, primary, and interdisciplinary approaches to physiological and psychosocial components of patient care. Expanded roles, as well as advances in knowledge and technology have prepared nurses for critical, specialized, primary, aerospace, and independent nursing practice. Exciting as they are, nursing's expanded roles and practices frequently contribute to the burnout and distress phenomena increasingly observed in practicing health care professionals. Causes and symptoms of the burnout distress phenomena are many and varied. Selye, Shubin, Maslach, and others adeptly identified and wrote on the phenomena as it specifically relates to nurses and the many facets of nursing practice. Rather than utilizing crisis intervention coping techniques, preventive strategies and adaptations are suggested. This paper reviews and discusses: 1. Factors associated with burnout-distress phenomena identified in professional literature; 2. Identification of factors associated with expanded roles and practice which contribute to burnout stress; 3. Identification of factors in military and civilian air ambulance and aeromedical evacuation systems which contribute to burnout stress; 4. Recommendations for strategies to prevent and cope with burnout distress factors.
Dynamics of a radially expanding liquid sheet: Experiments
Majumdar, Nayanika; Tirumkudulu, Mahesh
2017-11-01
A recent theory predicts that sinuous waves generated at the center of a radially expanding liquid sheet grow spatially even in absence of a surrounding gas phase. Unlike flat liquid sheets, the thickness of a radially expanding liquid sheet varies inversely with distance from the center of the sheet. To test the predictions of the theory, experiments were carried out on a horizontal, radially expanding liquid sheet formed by collision of a single jet on a solid impactor. The latter was placed on a speaker-vibrator with controlled amplitude and frequency. The growth of sinuous waves was determined by measuring the wave surface inclination angle using reflected laser light under both atmospheric and sub-atmospheric pressure conditions. It is shown that the measured growth rate matches with the predictions of the theory over a large range of Weber numbers for both pressure conditions suggesting that the thinning of the liquid sheet plays a dominant role in setting the growth rate of sinuous waves with minimal influence of the surrounding gas phase on its dynamics. IIT Bombay.
Why has medicine expanded? The role of consumers.
Zheng, Hui
2015-07-01
In the past 50years, the field of medicine has expanded dramatically in many Western societies. Despite substantial improvements in objective health measures, there has not been a commensurate increase in assessments of subjective health. We hypothesize that medical expansion may lower people's subjective health perceptions, leading to an increase in health care utilization, and, in turn, fueling further medical expansion. We use OECD (Organization for Economic Co-operation and Development) Health Data, World Development Indicators, the World Values Survey, and the European Values Study to fit a difference-in-differences model that removes unobserved cross-national heterogeneity and any period trend that is shared across nations. We find that three dimensions of medical expansion at the societal level (medical investment, medical professionalization/specialization, and an expanded pharmaceutical industry) negatively affect individual subjective health. These findings are robust to different model specifications. We conclude by discussing possible explanations for the adverse effect of medical expansion on subjective health, and how this effect may be related to other mechanisms through which medicine expands. Copyright © 2015 Elsevier Inc. All rights reserved.
ASPS clinical practice guideline summary on breast reconstruction with expanders and implants.
Alderman, Amy; Gutowski, Karol; Ahuja, Amy; Gray, Diedra
2014-10-01
After reading this article, participants should be able to: 1. Understand the evidence regarding the timing of expander/implant breast reconstruction in the setting of radiation therapy. 2. Discuss the implications of a patient's risk factors for possible outcomes and complications of expander/implant breast reconstruction. 3. Implement proper prophylactic antibiotic protocols. 4. Use the guidelines to improve their own clinical outcomes and reduce complications. In March of 2013, the Executive Committee of the American Society of Plastic Surgeons approved an evidence-based guideline on breast reconstruction with expanders and implants, as developed by a guideline-specific work group commissioned by the society's Health Policy Committee. The guideline addresses ten clinical questions: patient education, immediate versus delayed reconstruction, risk factors, radiation therapy, chemotherapy, hormonal therapy, antibiotic prophylaxis, acellular dermal matrix, monitoring for cancer recurrence, and oncologic outcomes associated with implant-based reconstruction. The evidence indicates that patients undergoing mastectomy should be offered a preoperative referral to a plastic surgeon. Evidence varies regarding the association between postoperative complications and timing of postmastectomy expander/implant breast reconstruction. Evidence is limited regarding the optimal timing of expand/implant reconstruction in the setting of radiation therapy but suggests that irradiation to the expander or implant is associated with an increased risk of postoperative complications. Evidence also varies regarding the association between acellular dermal matrix and surgical complications in the setting of postmastectomy expander/implant reconstruction. Data support the use of an appropriate preoperative antibiotic, but antibiotics should be discontinued within 24 hours of the procedure, unless a surgical drain is present. Furthermore, postmastectomy expander/implant breast reconstruction
Directory of Open Access Journals (Sweden)
David Garrod
2010-01-01
Full Text Available The structure, function, and regulation of desmosomal adhesion in vivo are discussed. Most desmosomes in tissues exhibit calcium-independent adhesion, which is strongly adhesive or “hyperadhesive”. This is fundamental to tissue strength. Almost all studies in culture are done on weakly adhesive, calcium-dependent desmosomes, although hyperadhesion can be readily obtained in confluent cell culture. Calcium dependence is a default condition in vivo, found in wounds and embryonic development. Hyperadhesion appears to be associated with an ordered arrangement of the extracellular domains of the desmosomal cadherins, which gives rise to the intercellular midline identified in ultrastructural studies. This in turn probably depends on molecular order in the desmosomal plaque. Protein kinase C downregulates hyperadhesion and there is preliminary evidence that it may also be regulated by tyrosine kinases. Downregulation of desmosomes in vivo may occur by internalisation of whole desmosomes rather than disassembly. Hyperadhesion has implications for diseases such as pemphigus.
Granchi, Donatella; Ochoa, Gorka; Leonardi, Elisa; Devescovi, Valentina; Baglìo, Serena Rubina; Osaba, Lourdes; Baldini, Nicola; Ciapetti, Gabriela
2010-06-01
Bone marrow is commonly used as a source of adult multipotent mesenchymal stem cells (MSCs), defined for their ability to differentiate in vitro into multiple lineages. The ex vivo-expanded MSCs are currently being evaluated as a strategy for the restoration of function in damaged skeletal tissue, both in cell therapy and tissue engineering applications. The aim of this study was to define gene expression patterns underlying the differentiation of MSCs into mature osteoblasts during the expansion in vitro, and to explore a variety of cell functions that cannot be easily evaluated using morphological, cytochemical, and biochemical assays. Cell cultures were obtained from bone marrow samples of six individuals undergoing total hip replacement, and a large-scale transcriptome analysis, using Affymetrix HG-U133A Plus 2.0 array (Affymetrix((R)), Santa Clara, CA), was performed at the occurrence of specific events, including the appearance of MSC surface markers, formation of colonies, and deposition of mineral nodules. We focused our attention on 213 differentially upregulated genes, some belonging to well-known pathways and some having one or more Gene Ontology annotations related to bone cell biology, including angiogenesis, bone-related genes, cell communication, development and morphogenesis, transforming growth factor-beta signaling, and Wnt signaling. Twenty-nine genes, whose role in bone cell pathophysiology has not been described yet, were found. In conclusion, gene expression patterns that characterize the early, intermediate, and late phases of the osteogenic differentiation process of ex vivo-expanded MSCs were defined. These signatures represent a useful tool to monitor the osteogenic process, and to analyze a broad spectrum of functions of MSCs cultured on scaffolds, especially when the constructs are conceived for releasing growth factors or other signals to promote bone regeneration.
Expanding economic opportunities in protracted displacement
Directory of Open Access Journals (Sweden)
Miki Takahashi
2018-02-01
Full Text Available Welcome progress has been made towards realising commitments made by international donors and host country governments to expand economic opportunities for Syrian refugees and host communities in neighbouring countries. However targets and commitments also bring new challenges, and evidence must underpin new policies.
Magnetic fields in an expanding universe
International Nuclear Information System (INIS)
Kastor, David; Traschen, Jennie
2014-01-01
We find a solution to 4D Einstein–Maxwell theory coupled to a massless dilaton field, for all values of the dilaton coupling, describing a Melvin magnetic field in an expanding universe with ‘stiff matter’ equation of state parameter w = +1. As the universe expands, magnetic flux becomes more concentrated around the symmetry axis for dilaton coupling a<1/√3 and more dispersed for a>1/√3. An electric field circulates around the symmetry axis in the direction determined by Lenz's law. For a = 0 the magnetic flux through a disc of fixed comoving radius is proportional to the proper area of the disc. This result disagrees with the usual expectation based on a test magnetic field that this flux should be constant, and we show why this difference arises. We also find a Melvin solution in an accelerating universe with w = −7/9 for a dilaton field with a certain exponential potential. (paper)
Li, Tong; Chen, Hong; Khokhlova, Tatiana; Wang, Yak-Nam; Kreider, Wayne; He, Xuemei; Hwang, Joo Ha
2014-01-01
Pulsed high-intensity focused ultrasound (pHIFU) has been demonstrated to enhance vascular permeability, disrupt tumor barriers and enhance drug penetration into tumor tissue through acoustic cavitation. Monitoring of cavitation activity during pHIFU treatments and knowing the ultrasound pressure levels sufficient to reliably induce cavitation in a given tissue are therefore very important. Here, three metrics of cavitation activity induced by pHIFU and evaluated by confocal passive cavitation detection were introduced: cavitation probability, cavitation persistence and the level of the broadband acoustic emissions. These metrics were used to characterize cavitation activity in several ex vivo tissue types (bovine tongue and liver and porcine adipose tissue and kidney) and gel phantoms (polyacrylamide and agarose) at varying peak-rarefactional focal pressures (1–12 MPa) during the following pHIFU protocol: frequency 1.1 MHz, pulse duration 1 ms, pulse repetition frequency 1 Hz. To evaluate the relevance of the measurements in ex vivo tissue, cavitation metrics were also investigated and compared in the ex vivo and in vivo murine pancreatic tumors that develop spontaneously in transgenic KPC mice and closely recapitulate human disease in their morphology. The cavitation threshold, defined at 50 % cavitation probability, was found to vary broadly among the investigated tissues (within 2.5–10 MPa), depending mostly on the water-lipid ratio that characterizes the tissue composition. Cavitation persistence and the intensity of broadband emissions depended both on tissue structure and lipid concentration. Both the cavitation threshold and broadband noise emission level were similar between ex vivo and in vivo pancreatic tumor tissue. The largest difference between in vivo and ex vivo settings was found in the pattern of cavitation occurrence throughout pHIFU exposure: it was sporadic in vivo, but ex vivo it decreased rapidly and stopped over the first few pulses
Li, Tong; Chen, Hong; Khokhlova, Tatiana; Wang, Yak-Nam; Kreider, Wayne; He, Xuemei; Hwang, Joo Ha
2014-07-01
Pulsed high-intensity focused ultrasound (pHIFU) has been shown to enhance vascular permeability, disrupt tumor barriers and enhance drug penetration into tumor tissue through acoustic cavitation. Monitoring of cavitation activity during pHIFU treatments and knowing the ultrasound pressure levels sufficient to reliably induce cavitation in a given tissue are therefore very important. Here, three metrics of cavitation activity induced by pHIFU and evaluated by confocal passive cavitation detection were introduced: cavitation probability, cavitation persistence and the level of the broadband acoustic emissions. These metrics were used to characterize cavitation activity in several ex vivo tissue types (bovine tongue and liver and porcine adipose tissue and kidney) and gel phantoms (polyacrylamide and agarose) at varying peak-rare factional focal pressures (1-12 MPa) during the following pHIFU protocol: frequency 1.1 MHz, pulse duration 1 ms and pulse repetition frequency 1 Hz. To evaluate the relevance of the measurements in ex vivo tissue, cavitation metrics were also investigated and compared in the ex vivo and in vivo murine pancreatic tumors that develop spontaneously in transgenic KrasLSL.G12 D/+; p53 R172 H/+; PdxCretg/+ (KPC) mice and closely re-capitulate human disease in their morphology. The cavitation threshold, defined at 50% cavitation probability, was found to vary broadly among the investigated tissues (within 2.5-10 MPa), depending mostly on the water-lipid ratio that characterizes the tissue composition. Cavitation persistence and the intensity of broadband emissions depended both on tissue structure and lipid concentration. Both the cavitation threshold and broadband noise emission level were similar between ex vivo and in vivo pancreatic tumor tissue. The largest difference between in vivo and ex vivo settings was found in the pattern of cavitation occurrence throughout pHIFU exposure: it was sporadic in vivo, but it decreased rapidly and stopped
Esakky, Prabagaran; Hansen, Deborah A; Drury, Andrea M; Felder, Paul; Cusumano, Andrew; Moley, Kelle H
2018-01-01
Male exposure to cigarette smoke is associated with seminal defects and with congenital anomalies and childhood cancers in offspring. In mice, paternal exposure to cigarette smoke condensate (CSC) causes molecular defects in germ cells and phenotypic effects in their offspring. Here we used an ex vivo testicular explant model and in vivo exposure to determine the concentration at which CSC impairs spermatogenesis and offspring development. We explanted testis tissue at postnatal day (P)5.5 and cultured it until P11.5. Assessment of growth parameters by analyzing expression of cell-specific markers revealed that the explant system maintained structural and functional integrity. We exposed the P5.5 to -11.5 explants to various concentrations (40-160 µg/ml) of CSC and confirmed that nicotine in the CSC was metabolized to cotinine. We assessed various growth and differentiation parameters, as well as testosterone production, and observed that many spermatogenesis features were impaired at 160 µg/ml CSC. The same parameters were impaired by a similar CSC concentration in vivo Finally, females mated to males that were exposed to 160 µg/ml CSC neonatally had increased rates of pup resorption. We conclude that male exposure to CSC impairs offspring development and that the concentration at which CSC impairs spermatogenesis is similar in vivo and ex vivo. Given that the concentrations of CSC we used contained similar doses of nicotine as human smokers are exposed to, we argue that our model mimics human male reproductive effects of smoking.-Esakky, P., Hansen, D. A., Drury, A. M., Felder, P., Cusumano, A., Moley, K. H. Testicular cells exhibit similar molecular responses to cigarette smoke condensate ex vivo and in vivo . © FASEB.
DEFF Research Database (Denmark)
Chondrou, Vasiliki; Kolovos, Petros; Sgourou, Argyro
2017-01-01
from whole transcriptome analysis of erythroid cells, isolated from erythroid tissues at various developmental stages in an effort to identify distinct molecular signatures of each erythroid tissue. Results: From our in-depth data analysis, pathway analysis, and text mining, we opted to focus...
The Army’s Military Decision Making: Adequate or Update and Expand
2008-05-22
requires creative efforts by every Soldier and Marine.”63 Expanding the soldier base would allow for greater creativity in order to better deal with...military can overcome these deficiencies? I believe that to achieve the initial stage of success would be to create a segment of soldier telecommuters ...problems. By expanding the thinking base, the Army can expand the breadth and depth into areas currently unreachable. Telecommuting allows for several
International Nuclear Information System (INIS)
Tang, Hao; Wu, Huagen; Wang, Xiaolin; Xing, Ziwen
2015-01-01
The ORC (organic Rankine cycle) system is an effective technology to generate electricity from low temperature heat sources. The twin-screw expander is a key component that is commonly used in the small-to-medium capacity ORC system to convert thermal energy into work. In this paper, the performance of a twin-screw expander is theoretically and experimentally studied. A mathematical model is developed and subsequently validated using experimental data. The effect of several important factors including expander speed, suction pressure and inlet superheat on the expander performance is investigated. Results indicate that the expander speed and suction pressure have large influences on the expander performance, while the inlet superheat has relatively small effect. The isentropic efficiency of the expander decreases from 0.88 to 0.6 and the expander volumetric efficiency decreases from 0.88 to 0.7 as the expander rotational speed increases from 1250 to 6000 rpm. The results further show that the expander volumetric efficiency decreases from 0.91 to 0.85 as the expander suction pressure increases from 0.33 to 0.47 MPa. Furthermore, the energy conversion efficiency of the studied ORC system using the twin-screw expander is as high as 7.5% under the site conditions. - Highlights: • Performance of a twin-screw expander used in an ORC (organic Rankine cycle) system was studied. • A thermodynamic model was developed for this purpose and experimentally validated. • Effect of several key factors on the expander performance was investigated. • Suction pressure has a large influence on the expander performance. • Twin-screw expanders can be operated with a wide range of heat source temperatures.
Custom Ontologies for Expanded Network Analysis
2006-12-01
for Expanded Network Analysis. In Visualising Network Information (pp. 6-1 – 6-10). Meeting Proceedings RTO-MP-IST-063, Paper 6. Neuilly-sur-Seine...Even to this day, current research groups are working to develop an approach that involves taking all available text, video, imagery and audio and
International Nuclear Information System (INIS)
Yue Xueqing; Li Liang; Zhang Ruijun; Zhang Fucheng
2009-01-01
Two expanded graphites (EG), marked as EG-1 and EG-2, were prepared by rapid heating of expandable graphite to 600 and 1000 deg. C, respectively, and ball milled in a high-energy mill (planetary-type) under air atmosphere. The microstructure evolution of the ball-milled samples was characterized by X-ray diffraction (XRD) and high resolution transmission electron microscopy (HRTEM). XRD analysis shows that the evolution degree of the average crystallite thickness along the c-axis (L c ) of EG-2 is lower than that of EG-1 during the milling process. From the HRTEM images of the samples after 100 h ball-milling, slightly curved graphene planes can be frequently observed both in the two EGs, however, EG-1 and EG-2 exhibit sharply curved graphene planes and smoothly curved graphene planes with high bending angles, respectively.
Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin
2012-01-01
Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell prolifer...
Pignatti, Marco; Mantovani, Francesca; Bertelli, Luca; Barbieri, Andrea; Pacchioni, Lucrezia; Loschi, Pietro; De Santis, Giorgio
2013-08-01
Use of silicone expanders and implants is the most common breast reconstruction technique after mastectomy. Postmastectomy patients often need echocardiographic monitoring of potential cardiotoxicity induced by cancer chemotherapy. The impairment of the echocardiographic acoustic window caused by silicone implants for breast augmentation has been reported. This study investigates whether the echocardiographic image quality was impaired in women reconstructed with silicone expanders and implants. The records of 44 consecutive women who underwent echocardiographic follow-up after breast reconstruction with expanders and implants at the authors' institution from January of 2000 to August of 2012 were reviewed. The population was divided into a study group (left or bilateral breast expanders/implants, n=30) and a control group (right breast expanders/implants, n=14). The impact of breast expanders/implants on echocardiographic image quality was tested (analysis of covariance model). Patients with a breast expander/implant (left or bilateral and right breast expanders/implants) were included. The mean volume of the breast devices was 353.2±125.5 cc. The quality of the echocardiographic images was good or sufficient in the control group; in the study group, it was judged as adequate in only 50 percent of cases (15 patients) and inadequate in the remaining 15 patients (pimplants in postmastectomy left breast reconstruction considerably reduce the image quality of echocardiography. This may have important clinical implications, given the need for periodic echocardiographic surveillance before and during chemotherapy. Therapeutic, III.
Zonari, Erika; Desantis, Giacomo; Petrillo, Carolina; Boccalatte, Francesco E; Lidonnici, Maria Rosa; Kajaste-Rudnitski, Anna; Aiuti, Alessandro; Ferrari, Giuliana; Naldini, Luigi; Gentner, Bernhard
2017-04-11
Ex vivo gene therapy based on CD34 + hematopoietic stem cells (HSCs) has shown promising results in clinical trials, but genetic engineering to high levels and in large scale remains challenging. We devised a sorting strategy that captures more than 90% of HSC activity in less than 10% of mobilized peripheral blood (mPB) CD34 + cells, and modeled a transplantation protocol based on highly purified, genetically engineered HSCs co-infused with uncultured progenitor cells. Prostaglandin E 2 stimulation allowed near-complete transduction of HSCs with lentiviral vectors during a culture time of less than 38 hr, mitigating the negative impact of standard culture on progenitor cell function. Exploiting the pyrimidoindole derivative UM171, we show that transduced mPB CD34 + CD38 - cells with repopulating potential could be expanded ex vivo. Implementing these findings in clinical gene therapy protocols will improve the efficacy, safety, and sustainability of gene therapy and generate new opportunities in the field of gene editing. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Xiao, Huaqing; Wang, Shutao; Zhang, Shuo; Wang, Yihe; Xu, Qingfei; Hu, Wenjie; Zhou, Yan; Wang, Zhaojie; An, Changhua; Zhang, Jun
2017-01-01
Rational structural design for electrode materials is essential for fabricating high performance supercapacitors. In this work, we demonstrated a novel way to prepare incompact MoS_2 nanosheets assembled nanorods with the interlayer of MoS_2 nanosheets expanded to 0.89 nm, namely layer expanded MoS_2 nanorods (LE-MoS_2 NRs). The material was characterized by XRD, XPS and electron microscopes. The XRD data and HRTEM images confirmed the existence of expanded interlayer of MoS_2 nanosheets. N_2 adsorption-desorption isotherms of LE-MoS_2 NRs indicated high specific area up to 37.0 m"2 g"−"1. It was found that the expanded interlayer spacing can benefit the ion transportation within the MoS_2 interlayers. The as-prepared electrode material showed capacitance up to 231 F g"−"1 at 1 A g"−"1 charge-discharge current and cycling stability test indicated high capacitance of 177 F g"−"1 was retained after 1000 cycles. - Highlights: • High performance electrochemical supercapacitor electrode material. • Interlayer expanded MoS_2 to achieve enhanced capacitance. • Facile hydrothermal synthesis of interlayer expanded MoS_2. • MoS_2 nanosheets assembled incompact nanorods.
Industrial implementation of plasma deposition using the expanding thermal plasma technique
Sanden, van de M.C.M.; Oever, van den P.J.; Creatore, M.; Schaepkens, M.; Miebach, T.; Iacovangelo, C.D.; Bosch, R.C.M.; Bijker, M.D.; Evers, M.F.J.; Schram, D.C.; Kessels, W.M.M.
2004-01-01
Two successful industrial implementations of the expanding thermal plasma setup, a novel plasma source, obtaining high deposition rate are discussed. The Ar/O2/hexamethyldisiloxane and Ar/O2/octamethyl-cyclosiloxane-fed expanding thermal plasma setup is used to deposit scratch resistant silicone
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
DISRUPTIVE TECHNOLOGIES: AN EXPANDED VIEW
JAMES M. UTTERBACK; HAPPY J. ACEE
2005-01-01
The term "disruptive technology" as coined by Christensen (1997, The Innovator's Dilemma; How New Technologies Cause Great Firms to Fail. Harvard Business School Press) refers to a new technology having lower cost and performance measured by traditional criteria, but having higher ancillary performance. Christensen finds that disruptive technologies may enter and expand emerging market niches, improving with time and ultimately attacking established products in their traditional markets. This...
In vitro and in vivo Development of Cloned Ovine Embryos using in vitro and in vivo Matured Oocytes
DEFF Research Database (Denmark)
Holm, P; Nagashima, H; Sun, F-J
1995-01-01
Cloning of sheep embryos by nucleus transplantation can be achieved by using in vivo matured (oviductal) oocytes and in vivo culture. However, these steps involve cumbersome procedures. Therefore, the effects of in vivo vs. the equivalent in vitro procedures on the pre-implantation development of...
An ex vivo approach to botanical-drug interactions: a proof of concept study.
Wang, Xinwen; Zhu, Hao-Jie; Munoz, Juliana; Gurley, Bill J; Markowitz, John S
2015-04-02
Botanical medicines are frequently used in combination with therapeutic drugs, imposing a risk for harmful botanical-drug interactions (BDIs). Among the existing BDI evaluation methods, clinical studies are the most desirable, but due to their expense and protracted time-line for completion, conventional in vitro methodologies remain the most frequently used BDI assessment tools. However, many predictions generated from in vitro studies are inconsistent with clinical findings. Accordingly, the present study aimed to develop a novel ex vivo approach for BDI assessment and expand the safety evaluation methodology in applied ethnopharmacological research. This approach differs from conventional in vitro methods in that rather than botanical extracts or individual phytochemicals being prepared in artificial buffers, human plasma/serum collected from a limited number of subjects administered botanical supplements was utilized to assess BDIs. To validate the methodology, human plasma/serum samples collected from healthy subjects administered either milk thistle or goldenseal extracts were utilized in incubation studies to determine their potential inhibitory effects on CYP2C9 and CYP3A4/5, respectively. Silybin A and B, two principal milk thistle phytochemicals, and hydrastine and berberine, the purported active constituents in goldenseal, were evaluated in both phosphate buffer and human plasma based in vitro incubation systems. Ex vivo study results were consistent with formal clinical study findings for the effect of milk thistle on the disposition of tolbutamide, a CYP2C9 substrate, and for goldenseal׳s influence on the pharmacokinetics of midazolam, a widely accepted CYP3A4/5 substrate. Compared to conventional in vitro BDI methodologies of assessment, the introduction of human plasma into the in vitro study model changed the observed inhibitory effect of silybin A, silybin B and hydrastine and berberine on CYP2C9 and CYP3A4/5, respectively, results which more
Women Engineering Faculty: Expanding the Pipeline
Greni, Nadene Deiterman
2006-01-01
The purpose for this case study was to explore the features of undergraduate engineering departmental and college support that influenced the persistence of women students. Women engineering faculty members were among the participants at three Land Grant universities in the Midwest. The data revealed the theme, Expanding the Pipeline, and…
Porous expandable device for attachment to bone tissue
Rybicki, Edmund F.; Wheeler, Kenneth Ray; Hulbert, Lewis E.; Karagianes, Manuel Tom; Hassler, Craig R.
1977-01-01
A device for attaching to substantially solid living bone tissue, comprising a body member having an outer surface shaped to fit approximately into an empty space in the tissue and having pores into which the tissue can grow to strengthen the bond between the device and the tissue, and adjustable means for expanding the body member against the tissue to an extent such as to provide a compressive stress capable of maintaining a snug and stable fit and of enhancing the growth of the tissue into the pores in the body member. The expanding means is adjustable to provide a stress between the tissue and the body member in the range of about 150 to 750 psi, typically 150 to 350 psi. Typically the body member comprises an expandable cylindrical portion having at least one radial slit extending longitudinally from a first end to the vicinity of the opposite (second) end thereof, at least one radial slit extending longitudinally from the second end to the vicinity of the first end thereof, and a tapered cylindrical hole extending coaxially from a wider circular opening in the first end to a narrower circular opening communicating with the second end.
Prospects for expanded utilization of biogas in Germany
International Nuclear Information System (INIS)
Poeschl, Martina; Ward, Shane; Owende, Philip
2010-01-01
The prospects for expanded utilization of biogas systems in German was analysed, by identifying the operational and policy factors affecting the complete chain of processes from implementation process for biogas plants, through to biogas production and utilization. It was found that the Renewable Energies Act (EEG) and energy tax reliefs provide bases for the support of expanded utilization. Upgrading of biogas to natural gas quality for utilization in the transportation sector was arguably the most promising technology that could support rapid utilization expansion. Sustainable deployment of biogas systems in light of the unstable feedstock prices and availability, and the need for subsidy-free operation in the long term requires; enhancement of feedstock flexibility and quality characteristics to maximise gas yield, and optimisation of the anaerobic digestion process management. Assessment of energy balance and potential environmental impacts of the integrated process chain provides a holistic assessment of sustainability. The results also support the development and foster of policies and framework for development of biogas as environmentally friendly energy resource, among a mix of renewable energy sources, hence, compete favourably with fossil fuels to enhance the prospects for expanded utilization. (author)
In vivo dosimetry in radiation therapy in Sweden; In vivo-dosimetri inom straalbehandling i Sverige
Energy Technology Data Exchange (ETDEWEB)
Eriksson, Jacob; Blomquist, Michael (Norrlands universitetssjukhus, Umeaa (Sweden))
2010-07-15
A prerequisite for achieving high radiation safety for patients receiving external beam radiation therapy is that the hospitals have a quality assurance program. The program should include include monitoring of the radiation dose given to the patient. Control measurements are performed both at the system level and at the individual level. Control measurement is normally performed using in vivo dosimetry, e.g. a method to measure the radiation dose at the individual level during the actual radiation treatment time. In vivo dosimetry has proven to be an important tool to detect and prevent serious errors in patient treatment. The purpose of this research project was to identify the extent to which vivo dosimetry is used and the methods available for this at Swedish radiation therapy clinics. The authority also wanted to get an overall picture of how hospitals manage results of in vivo dosimetry, and how clinics control radiation dose when using modern treatment techniques. The report reflects the situation in Swedish radiotherapy clinics 2007. The report shows that all hospitals use some form of in vivo dosimetry. The instruments used are mainly diodes and termoluminiscence dosimeters
Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol
2018-02-26
Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.
In Vivo Imaging of Molecularly Targeted Phage
Directory of Open Access Journals (Sweden)
Kimberly A. Kelly
2006-12-01
Full Text Available Rapid identification of in vivo affinity ligands would have far-reaching applications for imaging specific molecular targets, in vivo systems imaging, and medical use. We have developed a high-throughput method for identifying and optimizing ligands to map and image biologic targets of interest in vivo. We directly labeled viable phage clones with far-red fluorochromes and comparatively imaged them in vivo by multichannel fluorescence ratio imaging. Using Secreted Protein Acidic and Rich in Cysteine (osteonectin and vascular cell adhesion molecule-1 as model targets, we show that: 1 fluorescently labeled phage retains target specificity on labeling; 2 in vivo distribution can be quantitated (detection thresholds of ~ 300 phage/mm3 tissue throughout the entire depth of the tumor using fluorescent tomographic imaging; and 3 fluorescently labeled phage itself can serve as a replenishable molecular imaging agent. The described method should find widespread application in the rapid in vivo discovery and validation of affinity ligands and, importantly, in the use of fluorochrome-labeled phage clones as in vivo imaging agents.
MLL-ENL cooperates with SCF to transform primary avian multipotent cells.
Schulte, Cathleen E; von Lindern, Marieke; Steinlein, Peter; Beug, Hartmut; Wiedemann, Leanne M
2002-08-15
The MLL gene is targeted by chromosomal translocations, which give rise to heterologous MLL fusion proteins and are associated with distinct types of acute lymphoid and myeloid leukaemia. To determine how MLL fusion proteins alter the proliferation and/or differentiation of primary haematopoietic progenitors, we introduced the MLL-AF9 and MLL-ENL fusion proteins into primary chicken bone marrow cells. Both fusion proteins caused the sustained outgrowth of immature haematopoietic cells, which was strictly dependent on stem cell factor (SCF). The renewing cells have a long in vitro lifespan exceeding the Hayflick limit of avian cells. Analysis of clonal cultures identified the renewing cells as immature, multipotent progenitors, expressing erythroid, myeloid, lymphoid and stem cell surface markers. Employing a two-step commitment/differentiation protocol involving the controlled withdrawal of SCF, the MLL-ENL-transformed progenitors could be induced to terminal erythroid or myeloid differentiation. Finally, in cooperation with the weakly leukaemogenic receptor tyrosine kinase v-Sea, the MLL-ENL fusion protein gave rise to multilineage leukaemia in chicks, suggesting that other activated, receptor tyrosine kinases can substitute for ligand-activated c-Kit in vivo.
Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata
2016-09-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.
Expanding CTE Opportunities through Blended Learning
McKinstry, Elizabeth
2012-01-01
The global economy, 21st century skills, knowledge society, college and career readiness, digital and project-based learning are all common terms to educators who are expanding their learning environments beyond the classroom to meet the needs of all students. It is common knowledge that the rapid technological advances of this century have…
Quark and gluon production from a boost-invariantly expanding color electric field
Taya, Hidetoshi
2017-07-01
Particle production from an expanding classical color electromagnetic field is extensively studied, motivated by the early stage dynamics of ultrarelativistic heavy ion collisions. We develop a formalism at one-loop order to compute the particle spectra by canonically quantizing quark, gluon, and ghost fluctuations under the presence of such an expanding classical color background field; the canonical quantization is done in the τ -η coordinates in order to take into account manifestly the expanding geometry. As a demonstration, we model the expanding classical color background field by a boost-invariantly expanding homogeneous color electric field with lifetime T , for which we obtain analytically the quark and gluon production spectra by solving the equations of motion of QCD nonperturbatively with respect to the color electric field. In this paper we study (i) the finite lifetime effect, which is found to modify significantly the particle spectra from those expected from the Schwinger formula; (ii) the difference between the quark and gluon production; and (iii) the quark mass dependence of the production spectra. Implications of these results to ultrarelativistic heavy ion collisions are also discussed.
On the Propagation of Light in an Expanding Universe
Directory of Open Access Journals (Sweden)
Yuri Heymann
2013-07-01
Full Text Available The equation of the propagation of light in an expanding Universe is derived based on the definition of comoving distances. A numerical method is proposed to solve this equation jointly with the Friedmann equation. As the equation of the propagation of light in an expanding Universe defines a horizon of the visible Universe, this puts a constraint on cosmological models in order to be consistent with an upper limit for redshifts observed from galaxies. This puzzle is challenging current expansionist cosmological models.
Astori, Giuseppe; Amati, Eliana; Bambi, Franco; Bernardi, Martina; Chieregato, Katia; Schäfer, Richard; Sella, Sabrina; Rodeghiero, Francesco
2016-07-13
The use of fetal bovine serum (FBS) as a cell culture supplement is discouraged by regulatory authorities to limit the risk of zoonoses and xenogeneic immune reactions in the transplanted host. Additionally, FBS production came under scrutiny due to animal welfare concerns. Platelet derivatives have been proposed as FBS substitutes for the ex-vivo expansion of mesenchymal stem/stromal cells (MSCs) since platelet-derived growth factors can promote MSC ex-vivo expansion. Platelet-derived growth factors are present in platelet lysate (PL) obtained after repeated freezing-thawing cycles of the platelet-rich plasma or by applying physiological stimuli such as thrombin or CaCl2.PL-expanded MSCs have been used already in the clinic, taking advantage of their faster proliferation compared with FBS-expanded preparations. Should PL be applied to other biopharmaceutical products, its demand is likely to increase dramatically. The use of fresh platelet units for the production of PL raises concerns due to limited availability of platelet donors. Expired units might represent an alternative, but further data are needed to define safety, including pathogen reduction, and functionality of the obtained PL. In addition, relevant questions concerning the definition of PL release criteria, including concentration ranges of specific growth factors in PL batches for various clinical indications, also need to be addressed. We are still far from a common definition of PL and standardized PL manufacture due to our limited knowledge of the mechanisms that mediate PL-promoting cell growth. Here, we concisely discuss aspects of PL as MSC culture supplement as a preliminary step towards an agreed definition of the required characteristics of PL for the requirements of manufacturers and users.
Energy Technology Data Exchange (ETDEWEB)
Xiao, Huaqing; Wang, Shutao; Zhang, Shuo; Wang, Yihe; Xu, Qingfei; Hu, Wenjie [College of Science, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China); Zhou, Yan, E-mail: yanzhou@upc.edu.cn [College of Science, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China); State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China); Wang, Zhaojie [College of Science, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China); An, Changhua [College of Science, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China); College of Chemistry and Chemical Engineering, Tianjin University of Technology, Tianjin, 300384 (China); Zhang, Jun, E-mail: zhangj@upc.edu.cn [State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), 66 Changjiang West Road, Qingdao Economic Development Zone, Qingdao, Shandong, 266580 (China)
2017-05-01
Rational structural design for electrode materials is essential for fabricating high performance supercapacitors. In this work, we demonstrated a novel way to prepare incompact MoS{sub 2} nanosheets assembled nanorods with the interlayer of MoS{sub 2} nanosheets expanded to 0.89 nm, namely layer expanded MoS{sub 2} nanorods (LE-MoS{sub 2} NRs). The material was characterized by XRD, XPS and electron microscopes. The XRD data and HRTEM images confirmed the existence of expanded interlayer of MoS{sub 2} nanosheets. N{sub 2} adsorption-desorption isotherms of LE-MoS{sub 2} NRs indicated high specific area up to 37.0 m{sup 2} g{sup −1}. It was found that the expanded interlayer spacing can benefit the ion transportation within the MoS{sub 2} interlayers. The as-prepared electrode material showed capacitance up to 231 F g{sup −1} at 1 A g{sup −1} charge-discharge current and cycling stability test indicated high capacitance of 177 F g{sup −1} was retained after 1000 cycles. - Highlights: • High performance electrochemical supercapacitor electrode material. • Interlayer expanded MoS{sub 2} to achieve enhanced capacitance. • Facile hydrothermal synthesis of interlayer expanded MoS{sub 2}. • MoS{sub 2} nanosheets assembled incompact nanorods.
Han, Yanmei; Jiang, Zhengping; Chen, Zhubo; Gu, Yan; Liu, Yanfang; Zhang, Xiang; Cao, Xuetao
2015-04-01
Natural killer T cells (NKT cells) are effector cells, but also regulator of immune response, which either promote or suppress immune response through production of different cytokines. However, the subsets of NKT cells with definite phenotype and regulatory function need to be further identified. Furthermore, the mechanisms for NKT cells to regulate immune response remain to be fully elucidated. Here we identified CD11b(+) invariant NKT (CD11b(+) iNKT) cells as a new subset of regulatory NKT cells in mouse models with infection. αGalCer:CD1d complex(+)TCRβ(+)NK1.1(+) NKT cells could be categorized to CD11b(+) and CD11b(-) subsets. NKT cells are enriched in liver. During Listeria monocytogenes infection, hepatic CD11b(+) iNKT cells were significantly induced and expanded, with peak expansion on day 8. CD11b(+) iNKT cells were also expanded significantly in spleen and mesenteric lymph nodes. As compared to CD11b(-) iNKT cells, CD11b(+) iNKT cells expressed higher levels of CD27, FasL, B7H1, CD69, and particularly higher level of membrane-bound TGF-β1 (mTGF-β1), but produced less IFN-γ, IL-4, IL-10 and TGF-β1. Hepatic CD11b(+) iNKT cells suppressed antigen-nonspecific and OVA-specific CD4 and CD8 T cell proliferation through mTGF-β1 both in vitro and in vivo, meanwhile, they did not interfere with activation of CD4 T cells and cytotoxicity of the activated CD8 T cells. Thus, we have identified a new subset of pathogen-expanded CD11b(+) invariant NKT cells which can feedback inhibit T cell response through cell-to-cell contact via cell surface (membrane-bound) TGF-β1, especially at the late stage of immune response against infection. CD11b(+) regulatory iNKT cells may contribute to protect host from pathological injure by preventing immune overactivation. Copyright © 2015 Elsevier Ltd. All rights reserved.
13 CFR 120.835 - Application to expand an Area of Operations.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Application to expand an Area of Operations. 120.835 Section 120.835 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS... program responsibilities in the proposed area. (b) Local Economic Area Expansion. A CDC seeking to expand...
In vitro and in vivo Development of Cloned Ovine Embryos using in vitro and in vivo Matured Oocytes
DEFF Research Database (Denmark)
Holm, P; Nagashima, H; Sun, F-J
1995-01-01
Cloning of sheep embryos by nucleus transplantation can be achieved by using in vivo matured (oviductal) oocytes and in vivo culture. However, these steps involve cumbersome procedures. Therefore, the effects of in vivo vs. the equivalent in vitro procedures on the pre-implantation development...... matured oocytes were enucleated and fused with inserted blastomeres from donor embryos. In vitro matured oocytes were enucleated and allowed to age prior to blastomere insertion and electrofusion. Fused embryos were cultured for approximately 132 h either in vivo in ligated sheep oviducts or in vitro...
Absolute calibration in vivo measurement systems
International Nuclear Information System (INIS)
Kruchten, D.A.; Hickman, D.P.
1991-02-01
Lawrence Livermore National Laboratory (LLNL) is currently investigating a new method for obtaining absolute calibration factors for radiation measurement systems used to measure internally deposited radionuclides in vivo. Absolute calibration of in vivo measurement systems will eliminate the need to generate a series of human surrogate structures (i.e., phantoms) for calibrating in vivo measurement systems. The absolute calibration of in vivo measurement systems utilizes magnetic resonance imaging (MRI) to define physiological structure, size, and composition. The MRI image provides a digitized representation of the physiological structure, which allows for any mathematical distribution of radionuclides within the body. Using Monte Carlo transport codes, the emission spectrum from the body is predicted. The in vivo measurement equipment is calibrated using the Monte Carlo code and adjusting for the intrinsic properties of the detection system. The calibration factors are verified using measurements of existing phantoms and previously obtained measurements of human volunteers. 8 refs
In vivo studies of opiate receptors
International Nuclear Information System (INIS)
Frost, J.J.; Dannals, R.F.; Duelfer, T.; Burns, H.D.; Ravert, H.T.; Langstroem, B.; Balasubramanian, V.; Wagner, H.N. Jr.
1984-01-01
To study opiate receptors noninvasively in vivo using positron emission tomography, techniques for preferentially labeling opiate receptors in vivo can be used. The rate at which receptor-bound ligand clears from the brain in vivo can be predicted by measuring the equilibrium dissociation constant (KD) at 37 degrees C in the presence of 100 mM sodium chloride and 100 microM guanyl-5'-imidodiphosphate, the drug distribution coefficient, and the molecular weight. A suitable ligand for labeling opiate receptors in vivo is diprenorphine, which binds to mu, delta, and kappa receptors with approximately equal affinity in vitro. However, in vivo diprenorphine may bind predominantly to one opiate receptor subtype, possibly the mu receptor. To predict the affinity for binding to the opiate receptor, a Hansch correlation was determined between the 50% inhibitory concentration for a series of halogen-substituted fentanyl analogs and electronic, lipophilic, and steric parameters. Radiochemical methods for the synthesis of carbon-11-labeled diprenorphine and lofentanil are presented
In vivo studies of opiate receptors
Energy Technology Data Exchange (ETDEWEB)
Frost, J.J.; Dannals, R.F.; Duelfer, T.; Burns, H.D.; Ravert, H.T.; Langstroem, B.; Balasubramanian, V.; Wagner, H.N. Jr.
1984-01-01
To study opiate receptors noninvasively in vivo using positron emission tomography, techniques for preferentially labeling opiate receptors in vivo can be used. The rate at which receptor-bound ligand clears from the brain in vivo can be predicted by measuring the equilibrium dissociation constant (KD) at 37 degrees C in the presence of 100 mM sodium chloride and 100 microM guanyl-5'-imidodiphosphate, the drug distribution coefficient, and the molecular weight. A suitable ligand for labeling opiate receptors in vivo is diprenorphine, which binds to mu, delta, and kappa receptors with approximately equal affinity in vitro. However, in vivo diprenorphine may bind predominantly to one opiate receptor subtype, possibly the mu receptor. To predict the affinity for binding to the opiate receptor, a Hansch correlation was determined between the 50% inhibitory concentration for a series of halogen-substituted fentanyl analogs and electronic, lipophilic, and steric parameters. Radiochemical methods for the synthesis of carbon-11-labeled diprenorphine and lofentanil are presented.
Covered Balloon-Expanding Stents in Airway Stenosis.
Majid, Adnan; Kheir, Fayez; Chung, Jey; Alape, Daniel; Husta, Bryan; Oh, Scott; Folch, Erik
2017-04-01
The balloon-expanding stents are widely available but rarely described for use within the tracheobronchial tree. This report describes our experience with these stents in airway stenosis particularly as a lobar salvage therapy. This was a retrospective review of all records in which the balloon-expanding stents were used at a tertiary medical center. Ages, sex, location of stenosis, etiology of stenosis, stent size, duration of stent placement and associated interventions for airway stenosis were recorded. Patient's self-reported respiratory symptoms, dyspnea scale, and radiographic imaging at baseline and after stent placement were also reported. Twenty-one Atrium iCAST stents were inserted in 18 patients with malignant and benign airway disease. The median age was 69.5 years (interquartile range, 53.5 to 74). Most stents (n=20, 95%) were deployed in the lobar airways. There was a significant improvement in the modified Medical Research Council dyspnea scale from median of 3 to 2 (Pstent placement was achieved in 15 patients (83%). No deaths were related to airway stenting complications. Adverse events related to stents included migration (n=2, 9.5%), granulation tissue formation (n=2, 9.5%) and mucus plugging (n=1, 4.8%). Lobar stenting with balloon-expanding metallic stents appears feasible, safe and improves symptoms as well as radiographic atelectasis in patients with lobar airway stenosis in this small case series. Larger studies are needed to confirm this observation and to address long-term safety.
CFD simulations of compressed air two stage rotary Wankel expander – Parametric analysis
International Nuclear Information System (INIS)
Sadiq, Ghada A.; Tozer, Gavin; Al-Dadah, Raya; Mahmoud, Saad
2017-01-01
Highlights: • CFD ANSYS-Fluent 3D simulation of Wankel expander is developed. • Single and two-stage expander’s performance is compared. • Inlet and outlet ports shape and configurations are investigated. • Isentropic efficiency of two stage Wankel expander of 91% is achieved. - Abstract: A small scale volumetric Wankel expander is a powerful device for small-scale power generation in compressed air energy storage (CAES) systems and Organic Rankine cycles powered by different heat sources such as, biomass, low temperature geothermal, solar and waste heat leading to significant reduction in CO_2 emissions. Wankel expanders outperform other types of expander due to their ability to produce two power pulses per revolution per chamber additional to higher compactness, lower noise and vibration and lower cost. In this paper, a computational fluid dynamics (CFD) model was developed using ANSYS 16.2 to simulate the flow dynamics for a single and two stage Wankel expanders and to investigate the effect of port configurations, including size and spacing, on the expander’s power output and isentropic efficiency. Also, single-stage and two-stage expanders were analysed with different operating conditions. Single-stage 3D CFD results were compared to published work showing close agreement. The CFD modelling was used to investigate the performance of the rotary device using air as an ideal gas with various port diameters ranging from 15 mm to 50 mm; port spacing varying from 28 mm to 66 mm; different Wankel expander sizes (r = 48, e = 6.6, b = 32) mm and (r = 58, e = 8, b = 40) mm both as single-stage and as two-stage expanders with different configurations and various operating conditions. Results showed that the best Wankel expander design for a single-stage was (r = 48, e = 6.6, b = 32) mm, with the port diameters 20 mm and port spacing equal to 50 mm. Moreover, combining two Wankel expanders horizontally, with a larger one at front, produced 8.52 kW compared
Historical Notes on the Expanding Universe
Way, Michael J.; Belenkyi, Ari; Nussbaumer, Harry; Peacock, John
2014-01-01
The article Measuring the Hubble constant by Mario Livio and Adam Riess (Physics Today, October 2013, page 41) reviewed studies of the expanding universe from the 1920s to the present. Although the history of the subject underwent considerable compression to fit the length of a magazine article, we think it may leave a misleading impression of some of the key steps to our current understanding. We therefore offer the following clarifications. Most significantly, papers by Arthur Eddington and by Willem de Sitter in 1930, who successfully promoted Georges Lematres 1927 article for the Scientific Society of Brussels, effected a paradigm shift in interpretation of extragalactic redshifts in 1930. Before then, the astronomical community was generally unaware of the existence of nonstatic cosmological solutions and did not broadly appreciate that redshifts could be thought of locally as Doppler shifts in an expanding matter distribution. Certainly, in 1929 Edwin Hubble referred only to the de Sitter solution of 1917. At the time, the relation between distance and redshift predicted in that model was generally seen purely as a manifestation of static spacetime curvature.
Determination of the concentration dependent diffusion coefficient of nitrogen in expanded austenite
DEFF Research Database (Denmark)
Christiansen, Thomas; Somers, Marcel A. J.
2008-01-01
The concentration dependent diffusion coefficient of nitrogen in expanded austenite was determined from of the rate of retracting nitrogen from thin initially N-saturated coupons. Nitrogen saturated homogeneous foils of expanded austenite were obtained by nitriding AISI 304 and AISI 316 in pure...... in the composition range where nitrogen can be extracted by hydrogen gas at the diffusion temperature. Numerical simulation of the denitriding experiments shows that the thus determined concentration dependent diffusion coefficients are an accurate approximation of the actual diffusivity of nitrogen in expanded...... ammonia at 693 K and 718 K. Denitriding experiments were performed by equilibrating the foils with a successively lower nitrogen activity, as imposed by a gas mixture of ammonia and hydrogen. The concentration dependent diffusion coefficient of nitrogen in expanded austenite was approximated...
Expanding the Education Universe: A Fifty-State Strategy for Course Choice
Brickman, Michael
2014-01-01
After twenty years of expanding school-choice options, state leaders, educators, and families have a new tool: course choice, a strategy for students to learn from unconventional providers that might range from top-tier universities or innovative community colleges to local employers, labs, or hospitals. In "Expanding the Education Universe:…
Reciprocating Expander for an Exhaust Heat Recovery Rankine Cycle for a Passenger Car Application
Directory of Open Access Journals (Sweden)
Osoko Shonda
2012-06-01
Full Text Available Nowadays, on average, two thirds of the fuel energy consumed by an engine is wasted through the exhaust gases and the cooling liquid. The recovery of this energy would enable a substantial reduction in fuel consumption. One solution is to integrate a heat recovery system based on a steam Rankine cycle. The key component in such a system is the expander, which has a strong impact on the system’s performance. A survey of different expander technologies leads us to select the reciprocating expander as the most promising one for an automotive application. This paper therefore proposes a steady-state semi-empirical model of the expander device developed under the Engineering Equation Solver (EES environment. The ambient and mechanical losses as well as internal leakage were taken into account by the model. By exploiting the expander manufacturer’s data, all the parameters of the expander model were identified. The model computes the mass flow rate, the power output delivered and the exhaust enthalpy of the steam. The maximum deviation between predictions and measurement data is 4.7%. A performance study of the expander is carried out and shows that the isentropic efficiency is quite high and increases with the expander rotary speed. The mechanical efficiency depends on mechanical losses which are quite high, approximately 90%. The volumetric efficiency was also evaluated.
The motion of an isolated gas group in expanding universe
International Nuclear Information System (INIS)
Zhang Banggu
1993-01-01
The contraction of an isolated gas group in the expanding universe has been discussed. It is found that in addition to the contracted conditions of the static isolated gas group, the initial gas group is straticulate statistical uniform and the initial radius is larger than a critical value D γ -1 , the contracted conditions of expanding case also include that the Hubble constant H is smaller than a constant D t
Intelligent Flexible Materials for Space Structures: Expandable Habitat Engineering Development Unit
Hinkle, Jon; Sharpe, George; Lin, John; Wiley, Cliff; Timmers, Richard
2010-01-01
Expandable habitable elements are an enabling technology for human exploration in space and on planetary surfaces. Large geometries can be deployed from a small launch volume, allowing greater mission capability while reducing mass and improving robustness over traditional rigid shells. This report describes research performed by ILC Dover under the Intelligent Flexible Materials for Space Structures program on the design and manufacture of softgoods for LaRC's Expandable Habitat Engineering Development Unit (EDU). The EDU is a full-scale structural test article of an expandable hybrid habitat, integrating an expandable softgoods center section with two rigid end caps. The design of the bladder, restraint layer and a mock-up Thermal Micrometeoroid Cover is detailed together with the design of the interface hardware used to attach them to the end caps. The integration and design of two windows and a floor are also covered. Analysis was performed to study the effects of the open weave design, and to determine the correct webbing and fabric configuration. Stress analyses were also carried out on the interfaces between the softgoods and the end caps and windows. Testing experimentally determined the strength of the fabric and straps, and component testing was used to proof several critical parts of the design. This program established new manufacturing and design techniques that can be applied to future applications in expandable structures.
Measuring the Plasma Density of a Ferroelectric Plasma Source in an Expanding Plasma
International Nuclear Information System (INIS)
Dunaevsky, A.; Fisch, N.J.
2003-01-01
The initial density and electron temperature at the surface of a ferroelectric plasma source were deduced from floating probe measurements in an expanding plasma. The method exploits negative charging of the floating probe capacitance by fast flows before the expanding plasma reaches the probe. The temporal profiles of the plasma density can be obtained from the voltage traces of the discharge of the charged probe capacitance by the ion current from the expanding plasma. The temporal profiles of the plasma density, at two different distances from the surface of the ferroelectric plasma source, could be further fitted by using the density profiles for the expanding plasma. This gives the initial values of the plasma density and electron temperature at the surface. The method could be useful for any pulsed discharge, which is accompanied by considerable electromagnetic noise, if the initial plasma parameters might be deduced from measurements in expanding plasma
Peng, Tiefeng; Liu, Bin; Gao, Xuechao; Luo, Liqun; Sun, Hongjuan
2018-06-01
Expandable graphite is widely used as a new functional carbon material, especially as fire-retardant; however, its practical application is limited due to the high expansion temperature. In this work, preparation process of low temperature and highly expandable graphite was studied, using natural flake graphite as raw material and KMnO4/HClO4/NH4NO3 as oxidative intercalations. The structure, morphology, functional groups and thermal properties were characterized during expanding process by Fourier transform infrared spectroscopy (FTIR), Raman spectra, thermo-gravimetry differential scanning calorimetry (TG-DSC), X-ray diffraction (XRD), and scanning electron microscope (SEM). The analysis showed that by oxidation intercalation, some oxygen-containing groups were grafted on the edge and within the graphite layer. The intercalation reagent entered the graphite layer to increase the interlayer spacing. After expansion, the original flaky expandable graphite was completely transformed into worm-like expanded graphite. The order of graphite intercalation compounds (GICs) was proposed and determined to be 3 for the prepared expandable graphite, based on quantitative XRD peak analysis. Meanwhile, the detailed intercalation mechanisms were also proposed. The comprehensive investigation paved a benchmark for the industrial application of such sulfur-free expanded graphite.
Tunneling in expanding Universe: Euclidean and Hamiltonian approaches
International Nuclear Information System (INIS)
Goncharov, A.S.; Linde, A.D.
1986-01-01
The theory of the false vacuum decay in de Sitter space and in the inflationary Universe, and also the theory of the Universe creation ''from nothing'' are discussed. This explained why tunneling in the inflationary Universe differs from that in de Sitter space and cannot be exactly homogeneous. It is shown that in several important cases the Euclidean approach should be considerably modified or is absolutely inapplicable for the description of tunneling in the expanding Universe and of the process of the quantum creation of the Universe. The Hamiltonian approach to the theory of tunneling in expanding Universe is developed. The results obtained by this method are compared with the results obtained by the Euclidean approach
Thinking of a Blockchain for VIVO
garcia, alexander; Lopez, Federico; Conlon, Michael
2017-01-01
VIVO is an example of a decentralized system; institutions publish VIVO data just by adhering to a simple data structure in the form of an ontology. Similar to a distributed ledger, VIVO is a decentralized database that is used to maintain a continuously growing list of records. These records aim to include a comprehensive list of scholarly outputs. Although outputs are often described in a single narrative, the published reviewed paper, the research has generat...
In vivo and ex vivo inflammatory markers of common metabolic phenotypes in humans
DEFF Research Database (Denmark)
Mærkedahl, Rasmus Baadsgaard; Frøkiær, Hanne; Stenbæk, Marie Grøntved
2018-01-01
fasting serum markers of LGSI and leukocyte counts associated best with measures of MS-associated LGSI, whereas ex vivo cytokine production was only associated with prevailing glycemia and dyslipidemia. Taken together, this indicates that the relationship between in vivo and ex vivo inflammatory markers...
Infrastructure Requirements for an Expanded Fuel Ethanol Industry
Energy Technology Data Exchange (ETDEWEB)
Reynolds, Robert E. [Downstream Alternatives, Inc., South Bend, IN (United States)
2002-01-15
This report provides technical information specifically related to ethanol transportation, distribution, and marketing issues. This report required analysis of the infrastructure requirements for an expanded ethanol industry.
Waste Heat-to-Power Using Scroll Expander for Organic Rankine Bottoming Cycle
Energy Technology Data Exchange (ETDEWEB)
Dieckmann, John [TIAX LLC, Lexington, MA (United States); Smutzer, Chad [TIAX LLC, Lexington, MA (United States); Sinha, Jayanti [TIAX LLC, Lexington, MA (United States)
2017-05-30
The objective of this program was to develop a novel, scalable scroll expander for conversion of waste heat to power; this was accomplished and demonstrated in both a bench-scale system as well as a full-scale system. The expander is a key component in Organic Rankine Cycle (ORC) waste heat recovery systems which are used to convert medium-grade waste heat to electric power in a wide range of industries. These types of waste heat recovery systems allow for the capture of energy that would otherwise just be exhausted to the atmosphere. A scroll expander has the benefit over other technologies of having high efficiency over a broad range of operating conditions. The speed range of the TIAX expander (1,200 to 3,600 RPM) enables the shaft power output to directly drive an electric generator and produce 60 Hz electric power without incurring the equipment costs or losses of electronic power conversion. This greatly simplifies integration with the plant electric infrastructure. The TIAX scroll expander will reduce the size, cost, and complexity of a small-scale waste heat recovery system, while increasing the system efficiency compared to the prevailing ORC technologies at similar scale. During this project, TIAX demonstrated the scroll expander in a bench-scale test setup to have isentropic efficiency of 70-75% and operated it successfully for ~200 hours with minimal wear. This same expander was then installed in a complete ORC system driven by a medium grade waste heat source to generate 5-7 kW of electrical power. Due to funding constraints, TIAX was unable to complete this phase of testing, although the initial results were promising and demonstrated the potential of the technology.
Shatilova, Ksenia; Aloian, Georgii; Karabut, Maria; Ryabova, Valentina; Yaroslavsky, Ilya V.; Altshuler, Gregory
2018-02-01
In this work, we present the first histological in vivo and ex vivo study of effects of fractional Er fiber laser (wavelength 1550 nm, peak power 25 W) on keratinized gum and alveolar mucosa for gum regeneration. Biopsy with subsequent NBTC staining was used as primary evaluation technique. Ex vivo, porcine tissue model was used. Effects of pulse energy, beam diameter, and beam divergence were investigated in detail. It has been demonstrated that under optimal conditions columns up to 800 μm in depth could be reliably produced with 130 mJ pulses. Clinically, 2 subjects were treated and 4 punch biopsies were collected. The results were compared with ex vivo data. Both ex vivo and in vivo datasets suggest feasibility of a dental fractional system intended for gum regeneration.
The impact of [corrected] expanded nursing practice on professional identify in Denmark.
Piil, Karin; Kolbæk, Raymond; Ottmann, Goetz; Rasmussen, Bodil
2012-01-01
This article explores the concept of professional identity of Danish nurses working in an expanded practice. The case study explores the experiences of a small group of Danish nurses with a new professional category that reaches into a domain that customarily belonged to physicians. The aim of this case study was to explore the impact of "nurse consultations," representing an expanded nursing role, of 5 nurses focusing on their perception of autonomy, self-esteem, and confidence. The case study used semistructured interviews with 5 participants triangulated and validated with participant observations, a focus group interview, and theoretically derived insights. This study indicates that nurses working within a new expanded professional practice see themselves as still engaged in nursing and not as substitute physicians. The study also suggests that the involved nurses gained a higher sense of autonomy, self-esteem, and confidence in their practice. These elements have a positive impact on their professional identity. The research demonstrates that for the nurses involved in expanded professional practice, the boundaries of professional practice have shifted significantly. The research indicates that an expanded practice generates a new domain within the professional identity of nurses.
Alkali-silica reactivity of expanded glass granules in structure of lightweight concrete
International Nuclear Information System (INIS)
Bumanis, G; Bajare, D; Korjakins, A; Locs, J
2013-01-01
Main component in the lightweight concrete, which provides its properties, is aggregate. A lot of investigations on alkali silica reaction (ASR) between cement and lightweight aggregates have been done with their results published in the academic literature. Whereas expanded glass granules, which is relatively new product in the market of building materials, has not been a frequent research object. Therefore lightweight granules made from waste glass and eight types of cement with different chemical and mineralogical composition were examined in this research. Expanded glass granules used in this research is commercially available material produced by Penostek. Lightweight concrete mixtures were prepared by using commercial chemical additives to improve workability of concrete. The aim of the study is to identify effect of cement composition to the ASR reaction which occurs between expanded glass granules and binder. Expanded glass granules mechanical and physical properties were determined. In addition, properties of fresh and hardened concrete were determined. The ASR test was processed according to RILEM AAR-2 testing recommendation. Tests with scanning electron microscope and microstructural investigations were performed for expanded glass granules and hardened concrete specimens before and after exposing them in alkali solution
Automated Segmentation of in Vivo and Ex Vivo Mouse Brain Magnetic Resonance Images
Directory of Open Access Journals (Sweden)
Alize E.H. Scheenstra
2009-01-01
Full Text Available Segmentation of magnetic resonance imaging (MRI data is required for many applications, such as the comparison of different structures or time points, and for annotation purposes. Currently, the gold standard for automated image segmentation is nonlinear atlas-based segmentation. However, these methods are either not sufficient or highly time consuming for mouse brains, owing to the low signal to noise ratio and low contrast between structures compared with other applications. We present a novel generic approach to reduce processing time for segmentation of various structures of mouse brains, in vivo and ex vivo. The segmentation consists of a rough affine registration to a template followed by a clustering approach to refine the rough segmentation near the edges. Compared with manual segmentations, the presented segmentation method has an average kappa index of 0.7 for 7 of 12 structures in in vivo MRI and 11 of 12 structures in ex vivo MRI. Furthermore, we found that these results were equal to the performance of a nonlinear segmentation method, but with the advantage of being 8 times faster. The presented automatic segmentation method is quick and intuitive and can be used for image registration, volume quantification of structures, and annotation.
Directory of Open Access Journals (Sweden)
Abhishek Kothari
2012-01-01
Full Text Available Optical coherence tomography (OCT has transformed macular disease practices. This report describes the use of conventional OCT systems for peripheral retinal imaging. Thirty-six eyes with peripheral retinal pathology underwent imaging with conventional OCT systems. In vivo sectional imaging of lattice degeneration, snail-track degeneration, and paving-stone degeneration was performed. Differences were noted between phenotypes of lattice degeneration. Several findings previously unreported in histopathology studies were encountered. Certain anatomic features were seen that could conceivably explain clinical and intraoperative behavior of peripheral lesions. Peripheral OCT imaging helped elucidate clinically ambiguous situations such as retinal breaks, subclinical retinal detachment, retinoschisis, choroidal nevus, and metastasis. Limitations of such scanning included end-gaze nystagmus and far peripheral lesions. This first of its kind study demonstrates the feasibility of peripheral retinal OCT imaging and expands the spectrum of indications for which OCT scanning may be clinically useful.
Kothari, Abhishek; Narendran, V; Saravanan, V R
2012-01-01
Optical coherence tomography (OCT) has transformed macular disease practices. This report describes the use of conventional OCT systems for peripheral retinal imaging. Thirty-six eyes with peripheral retinal pathology underwent imaging with conventional OCT systems. In vivo sectional imaging of lattice degeneration, snail-track degeneration, and paving-stone degeneration was performed. Differences were noted between phenotypes of lattice degeneration. Several findings previously unreported in histopathology studies were encountered. Certain anatomic features were seen that could conceivably explain clinical and intraoperative behavior of peripheral lesions. Peripheral OCT imaging helped elucidate clinically ambiguous situations such as retinal breaks, subclinical retinal detachment, retinoschisis, choroidal nevus, and metastasis. Limitations of such scanning included end-gaze nystagmus and far peripheral lesions. This first of its kind study demonstrates the feasibility of peripheral retinal OCT imaging and expands the spectrum of indications for which OCT scanning may be clinically useful.
Influence of Surgical Staples on Radiofrequency Ablation Using Multitined Expandable Electrodes
International Nuclear Information System (INIS)
Sakuhara, Yusuke; Shimizu, Tadashi; Abo, Daisuke; Hasegawa, Yu; Kato, Fumi; Kodama, Yoshihisa; Shirato, Hiroki
2007-01-01
Purpose. During radiofrequency ablation (RFA), there is a risk that the multitined expandable electrode will come into contact with one of the surgical staples used to treat local recurrence after surgical operations. Our objective was to evaluate whether a surgical staple would influence the RFA of egg white using a multitined expandable electrode. Methods. Multitined expandable electrodes, LeVeen needles (expandable diameter 3.0 cm), were sunk into an egg white bath with (a) no surgical staple, (b) a surgical staple touching one of the tines, or (c) a surgical staple touching two of the tines simultaneously. By connecting the LeVeen needle and copper plate at the bottom of the bath, RFA was then performed on the egg whites as a substitute for human tissue. Ten egg white baths were ablated under each of conditions (a), (b), and (c), for a total of 30 sets of coagulated egg white. Results. There was no significant difference in the time from the power-on to the roll-off (i.e., the completion and shutting off of the electric circuit) or in the maximum diameter of the thermal lesion between conditions (a) and (b) or (a) and (c). However, the minimum diameter of the thermal lesion was significantly smaller in (c) compared with (a) (p < 0.01). Conclusions. Surgical staples have the capacity to interfere with the electromagnetic field and decrease the minimum diameter of the thermal lesion in the event that a staple touches two of the tines of a multitined expandable electrode during RFA. Although the difference might be small enough to be neglected under many clinical circumstances, we recommend that, if possible, the tines not be expanded near metallic material
Focusing of geodesic congruences in an accelerated expanding Universe
International Nuclear Information System (INIS)
Albareti, F.D.; Cembranos, J.A.R.; Cruz-Dombriz, A. de la
2012-01-01
We study the accelerated expansion of the Universe through its consequences on a congruence of geodesics. We make use of the Raychaudhuri equation which describes the evolution of the expansion rate for a congruence of timelike or null geodesics. In particular, we focus on the space-time geometry contribution to this equation. By straightforward calculation from the metric of a Robertson-Walker cosmological model, it follows that in an accelerated expanding Universe the space-time contribution to the Raychaudhuri equation is positive for the fundamental congruence, favoring a non-focusing of the congruence of geodesics. However, the accelerated expansion of the present Universe does not imply a tendency of the fundamental congruence to diverge. It is shown that this is in fact the case for certain congruences of timelike geodesics without vorticity. Therefore, the focusing of geodesics remains feasible in an accelerated expanding Universe. Furthermore, a negative contribution to the Raychaudhuri equation from space-time geometry which is usually interpreted as the manifestation of the attractive character of gravity is restored in an accelerated expanding Robertson-Walker space-time at high speeds
Focusing of geodesic congruences in an accelerated expanding Universe
Energy Technology Data Exchange (ETDEWEB)
Albareti, F.D.; Cembranos, J.A.R. [Departamento de Física Teórica I, Universidad Complutense de Madrid, Ciudad Universitaria, E-28040 Madrid (Spain); Cruz-Dombriz, A. de la, E-mail: fdalbareti@estumail.ucm.es, E-mail: cembra@fis.ucm.es, E-mail: alvaro.delacruz-dombriz@uct.ac.za [Astrophysics, Cosmology and Gravity Centre (ACGC), University of Cape Town, 7701 Rondebosch, Cape Town (South Africa)
2012-12-01
We study the accelerated expansion of the Universe through its consequences on a congruence of geodesics. We make use of the Raychaudhuri equation which describes the evolution of the expansion rate for a congruence of timelike or null geodesics. In particular, we focus on the space-time geometry contribution to this equation. By straightforward calculation from the metric of a Robertson-Walker cosmological model, it follows that in an accelerated expanding Universe the space-time contribution to the Raychaudhuri equation is positive for the fundamental congruence, favoring a non-focusing of the congruence of geodesics. However, the accelerated expansion of the present Universe does not imply a tendency of the fundamental congruence to diverge. It is shown that this is in fact the case for certain congruences of timelike geodesics without vorticity. Therefore, the focusing of geodesics remains feasible in an accelerated expanding Universe. Furthermore, a negative contribution to the Raychaudhuri equation from space-time geometry which is usually interpreted as the manifestation of the attractive character of gravity is restored in an accelerated expanding Robertson-Walker space-time at high speeds.
Expandable metallic stents for tracheobronchial stenoses in esophageal cancer.
Takamori, S; Fujita, H; Hayashi, A; Tayama, K; Mitsuoka, M; Ohtsuka, S; Shirouzu, K
1996-09-01
Tracheobronchial stenosis in patients with esophageal cancer can be life threatening. Few reports have discussed use of expandable metallic stents for central airway stenoses in patients with esophageal cancer. Twelve patients with esophageal cancer underwent placement of expandable metallic stents for respiratory distress caused by tracheobronchial stricture. Single or double metallic stents were placed in the stenotic airways under fluoroscopic guidance. Improvement in respiratory symptoms and clinical outcome were assessed. Most stenoses were located in the trachea or the left main bronchus. From one to four expandable metallic stents were placed in each stricture site, with immediate relief of respiratory symptoms in 8 patients. One patient with tracheomalacia in alive 3 years after stent placement and another is alive 6 months after stent insertion. The other 10 patients lived from 10 to 70 days (mean; survival, 35 days) after stent placement. Death was due to progression of disease. Although metallic stents are useful for relieving respiratory distress in patients with advanced esophageal cancer, additional therapies should be considered.
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Ugo Testa
2009-06-01
Full Text Available
In humans the switch from fetal to adult hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Photon beam dose distributions for patients with implanted temporary tissue expanders
Asena, A.; Kairn, T.; Crowe, S. B.; Trapp, J. V.
2015-01-01
This study examines the effects of temporary tissue expanders (TTEs) on the dose distributions of photon beams in breast cancer radiotherapy treatments. EBT2 radiochromic film and ion chamber measurements were taken to quantify the attenuation and backscatter effects of the inhomogeneity. Results illustrate that the internal magnetic port present in a tissue expander causes a dose reduction of approximately 25% in photon tangent fields immediately downstream of the implant. It was also shown that the silicone elastomer shell of the tissue expander reduced the dose to the target volume by as much as 8%. This work demonstrates the importance for an accurately modelled high-density implant in the treatment planning system for post-mastectomy breast cancer patients.
Esophageal carcinoma treatment with self-expanding covered stent implanted in esophagus
International Nuclear Information System (INIS)
Liu Mingguo; Ji Yan; He Nengwei
2006-01-01
Objective: To investigate the clinical significance of the treatment to esophageal cancer by self- expanding covered stent implanted into esophagus. Methods: Under fluoroscopic guidance and with guidance wire , 20 self-expanding covered stents were implanted into stenotic part of esophagus to recanalize the esophagus, then follow up to observe the clinical symptom improved. Results: Technical success was obtained 20 cases without any complication. Clinical symptom were improved in shot time. Conclusions: self-expanding covered stent is implanted in stenotic part of esophageal carcinoma to treat esophageal stenosis and enable to improved clinical symptom in shot time, if combined with transcatheter arterial infusion and embolization, Radiotherapy, Chinese medical treatment, it enable to lengthen life time remarkably. (authors)
Structural and magnetic properties of {open_quotes}expanded{close_quotes} Mn
Energy Technology Data Exchange (ETDEWEB)
Grigorov, I.L.; Walker, J.C. [Department of Physics and Astronomy, The Johns Hopkins University, Baltimore, Maryland21218 (United States); Hawley, M.E.; Brown, G.W. [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States); Luett, M.; Fitzsimmons, M.R. [Manuel Lujan Jr. Neutron Scattering Center, Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States)
1998-06-01
Structural and magnetic properties of {open_quotes}expanded{close_quotes} Mn deposited on (111) oriented fcc noble metals were studied with single-crystal x-ray diffraction and exchange bias measurements. A single peak corresponding to this phase was found at momentum transfer q=2.86{Angstrom}{sup {minus}1} along six equivalent [11{bar 2}] directions of the noble metal substrate. Magnetic hysteresis of the field cooled Fe/Mn bilayers exhibited a characteristic shift along the field axis, indicating antiferromagnetic order in the expanded Mn with T{sub N}{ge}20K. The magnetic and structural data are consistent with understanding the expanded phase as trigonally distorted {alpha}-Mn. {copyright} {ital 1998 American Institute of Physics.}
Gravitational instability in a multicomponent expanding medium
International Nuclear Information System (INIS)
Solov'eva, L.V.; Nurgaliev, I.S.
1985-01-01
In the Newtonian approximation we consider the gravitational instability of a two- or N-component medium in an expanding universe. The system of density-perturbation equations is solved in the short- and long-wave limits. For small values of the wave vector k, a result obtained for the stationary case continues to hold true: at most there can exist only one unstable mode. If k is kept fixed, the introduction of a perturbation component delta/sub i/ will speed the growth of fluctuations delta/sub j/, provided the adiabatic indices γ/sub i/>γ/sub j/. In the large-k limit, ordinary acoustic waves result. Other components will begin to manifest themselves in the first-order terms when the oscillation amplitude is expanded in powers of k -1 : provided γ/sub j/>γ/sub i/> or =4/3, the ith-component amplitude will decay more slowly than otherwise
Directory of Open Access Journals (Sweden)
Driver Ashley M
2012-03-01
Full Text Available Abstract Background A valuable tool for both research and industry, in vitro fertilization (IVF has applications range from gamete selection and preservation of traits to cloning. Although IVF has achieved worldwide use, with approximately 339,685 bovine embryos transferred in 2010 alone, there are still continuing difficulties with efficiency. It is rare to have more than 40% of fertilized in vitro cattle oocytes reach blastocyst stage by day 8 of culture, and pregnancy rates are reported as less than 45% for in vitro produced embryos. To investigate potential influences in-vitro fertilization (IVF has on embryonic development, this study compares in vivo- and in vitro-derived bovine blastocysts at a similar stage and quality grade (expanded, excellent quality to determine the degree of transcriptomic variation beyond morphology using RNA-Seq. Results A total of 26,906,451 and 38,184,547 fragments were sequenced for in vitro and in vivo embryo pools, respectively. We detected expression for a total of 17,634 genes, with 793 genes showing differential expression between the two embryo populations with false discovery rate (FDR Conclusions Thus, our results support that IVF may influence at the transcriptomic level and that morphology is limited in full characterization of bovine preimplantation embryos.
Veronesi, Francesca; Maglio, Melania; Tschon, Matilde; Aldini, Nicolò Nicoli; Fini, Milena
2014-07-01
Several therapeutic approaches have been developed to address hyaline cartilage regeneration, but to date, there is no universal procedure to promote the restoration of mechanical and functional properties of native cartilage, which is one of the most important challenges in orthopedic surgery. For cartilage tissue engineering, adult mesenchymal stem cells (MSCs) are considered as an alternative cell source to chondrocytes. Since little is known about adipose-derived mesenchymal stem cell (ADSC) cartilage regeneration potential, the aim of this review was to give an overview of in vivo studies about the chondrogenic potential and regeneration ability of culture-expanded ADSCs when implanted in heterotopic sites or in osteoarthritic and osteochondral defects. The review compares the different studies in terms of number of implanted cells and animals, cell harvesting sites, in vitro expansion and chondrogenic induction conditions, length of experimental time, defect dimensions, used scaffolds and post-explant analyses of the cartilage regeneration. Despite variability of the in vivo protocols, it seems that good cartilage formation and regeneration were obtained with chondrogenically predifferentiated ADSCs (1 × 10(7) cells for heterotopic cartilage formation and 1 × 10(6) cells/scaffold for cartilage defect regeneration) and polymeric scaffolds, even if many other aspects need to be clarified in future studies. © 2013 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Cai, W.; Harris, G.; Holalkere, N.; Sahani, D.; Yoshida, H. [Massachusetts General Hospital and Harvard Medical School (United States)
2007-06-15
Measurement of kidney volume by computed tomography (CT), called renal volumetry, is indispensable for diagnosis and treatment of kidney-related diseases. Computer-aided volumetry (CAV) of kidney relies on an efficient and accurate segmentation method of the kidney. The purpose of this study is to assess the accuracy of our CAV of kidney scheme using dynamic-threshold (DT) level set method, based on in-vivo and ex-vivo reference standards. Eight Yorkshire breed anesthetized pigs were scanned on a 64-slice multi-detector CT scanner (Sensation 64, Siemens) after an injection of iodinated (300 mgl/ml) contrast agent through an IV cannula. The kidneys of the pigs were then surgically resected and scanned on CT in the same manner. Both in-vivo and ex-vivo CT images were subjected to our volumetry scheme. The resulting volumes of the kidneys were compared with the in-vivo and ex-vivo reference standards: the former was established by manual contouring of the kidneys on the CT images by an experienced radiologist, and the latter was established as the water displacement volume of the resected kidney. Our CAV of kidney scheme demonstrated accurate in-vivo and ex-vivo measurement of kidney volume, despite a large difference between the two reference standards. (orig.)
International Nuclear Information System (INIS)
Cai, W.; Harris, G.; Holalkere, N.; Sahani, D.; Yoshida, H.
2007-01-01
Measurement of kidney volume by computed tomography (CT), called renal volumetry, is indispensable for diagnosis and treatment of kidney-related diseases. Computer-aided volumetry (CAV) of kidney relies on an efficient and accurate segmentation method of the kidney. The purpose of this study is to assess the accuracy of our CAV of kidney scheme using dynamic-threshold (DT) level set method, based on in-vivo and ex-vivo reference standards. Eight Yorkshire breed anesthetized pigs were scanned on a 64-slice multi-detector CT scanner (Sensation 64, Siemens) after an injection of iodinated (300 mgl/ml) contrast agent through an IV cannula. The kidneys of the pigs were then surgically resected and scanned on CT in the same manner. Both in-vivo and ex-vivo CT images were subjected to our volumetry scheme. The resulting volumes of the kidneys were compared with the in-vivo and ex-vivo reference standards: the former was established by manual contouring of the kidneys on the CT images by an experienced radiologist, and the latter was established as the water displacement volume of the resected kidney. Our CAV of kidney scheme demonstrated accurate in-vivo and ex-vivo measurement of kidney volume, despite a large difference between the two reference standards. (orig.)
Long-term implications of observing an expanding cosmological civilization
Olson, S. Jay
2018-01-01
Suppose that advanced civilizations, separated by a cosmological distance and time, wish to maximize their access to cosmic resources by rapidly expanding into the universe. How does the presence of one limit the expansionistic ambitions of another, and what sort of boundary forms between their expanding domains? We describe a general scenario for any expansion speed, separation distance and time. We then specialize to a question of particular interest: What are the future prospects for a young and ambitious civilization if they can observe the presence of another at a cosmological distance? We treat cases involving the observation of one or two expanding domains. In the single-observation case, we find that almost any plausible detection will limit one's future cosmic expansion to some extent. Also, practical technological limits to expansion speed (well below the speed of light) play an interesting role. If a domain is visible at the time one embarks on cosmic expansion, higher practical limits to expansion speed are beneficial only up to a certain point. Beyond this point, a higher speed limit means that gains in the ability to expand are more than offset by the first-mover advantage of the observed domain. In the case of two visible domains, it is possible to be `trapped' by them if the practical speed limit is high enough and their angular separation in the sky is large enough, i.e. one's expansion in any direction will terminate at a boundary with the two visible civilizations. Detection at an extreme cosmological distance has surprisingly little mitigating effect on our conclusions.
Successful range-expanding plants experience less above-ground and below-ground enemy impact.
Engelkes, Tim; Morriën, Elly; Verhoeven, Koen J F; Bezemer, T Martijn; Biere, Arjen; Harvey, Jeffrey A; McIntyre, Lauren M; Tamis, Wil L M; van der Putten, Wim H
2008-12-18
Many species are currently moving to higher latitudes and altitudes. However, little is known about the factors that influence the future performance of range-expanding species in their new habitats. Here we show that range-expanding plant species from a riverine area were better defended against shoot and root enemies than were related native plant species growing in the same area. We grew fifteen plant species with and without non-coevolved polyphagous locusts and cosmopolitan, polyphagous aphids. Contrary to our expectations, the locusts performed more poorly on the range-expanding plant species than on the congeneric native plant species, whereas the aphids showed no difference. The shoot herbivores reduced the biomass of the native plants more than they did that of the congeneric range expanders. Also, the range-expanding plants developed fewer pathogenic effects in their root-zone soil than did the related native species. Current predictions forecast biodiversity loss due to limitations in the ability of species to adjust to climate warming conditions in their range. Our results strongly suggest that the plants that shift ranges towards higher latitudes and altitudes may include potential invaders, as the successful range expanders may experience less control by above-ground or below-ground enemies than the natives.
Lattice expansion of carbon-stabilized expanded austenite
DEFF Research Database (Denmark)
Hummelshøj, Thomas Strabo; Christiansen, Thomas; Somers, Marcel A. J.
2010-01-01
The lattice parameter of expanded austenite was determined as a function of the content of interstitially dissolved carbon in homogeneous, carburized thin stainless steel foils. For the first time this expansion of the face-centered cubic lattice is determined on unstrained austenite. It is found...
Technical Note: Effect of Incorporating Expanded Polystyrene ...
African Journals Online (AJOL)
Incorporating expanded polystyrene granules in concrete matrix can produce lightweight polystyrene aggregate concrete of various densities. Workability which is an important property of concrete, aects the rate of placement and the degree of compaction of concrete. Inadequate compaction leads to reduction in both ...
Expanding Sex-Role Definitions by Self-Discovery.
Kahn, Sharon E.; Greenberg, Leslie S.
1980-01-01
Counselors who stimulate client self-discovery may help these clients experience undeveloped parts of themselves and expand their definitions of themselves and their sex-role possibilities. Stimulation methods actively involve clients in the exploration of sex-role concerns to change restrictive self-concepts. (Author)
Expanding CEP290 mutational spectrum in ciliopathies
Travaglini, Lorena; Brancati, Francesco; Attie-Bitach, Tania; Audollent, Sophie; Bertini, Enrico; Kaplan, Josseline; Perrault, Isabelle; Iannicelli, Miriam; Mancuso, Brunella; Rigoli, Luciana; Rozet, Jean-Michel; Swistun, Dominika; Tolentino, Jerlyn; Dallapiccola, Bruno; Gleeson, Joseph G.; Valente, Enza Maria; Zankl, A.; Leventer, R.; Grattan-Smith, P.; Janecke, A.; D'Hooghe, M.; Sznajer, Y.; van Coster, R.; Demerleir, L.; Dias, K.; Moco, C.; Moreira, A.; Kim, C. Ae; Maegawa, G.; Petkovic, D.; Abdel-Salam, G. M. H.; Abdel-Aleem, A.; Zaki, M. S.; Marti, I.; Quijano-Roy, S.; Sigaudy, S.; de Lonlay, P.; Romano, S.; Touraine, R.; Koenig, M.; Lagier-Tourenne, C.; Messer, J.; Collignon, P.; Wolf, N.; Philippi, H.; Kitsiou Tzeli, S.; Halldorsson, S.; Johannsdottir, J.; Ludvigsson, P.; Phadke, S. R.; Udani, V.; Stuart, B.; Magee, A.; Lev, D.; Michelson, M.; Ben-Zeev, B.; Fischetto, R.; Benedicenti, F.; Stanzial, F.; Borgatti, R.; Accorsi, P.; Battaglia, S.; Fazzi, E.; Giordano, L.; Pinelli, L.; Boccone, L.; Bigoni, S.; Ferlini, A.; Donati, M. A.; Caridi, G.; Divizia, M. T.; Faravelli, F.; Ghiggeri, G.; Pessagno, A.; Briguglio, M.; Briuglia, S.; Salpietro, C. D.; Tortorella, G.; Adami, A.; Castorina, P.; Lalatta, F.; Marra, G.; Riva, D.; Scelsa, B.; Spaccini, L.; Uziel, G.; del Giudice, E.; Laverda, A. M.; Ludwig, K.; Permunian, A.; Suppiej, A.; Signorini, S.; Uggetti, C.; Battini, R.; Di Giacomo, M.; Cilio, M. R.; Di Sabato, M. L.; Leuzzi, V.; Parisi, P.; Pollazzon, M.; Silengo, M.; de Vescovi, R.; Greco, D.; Romano, C.; Cazzagon, M.; Simonati, A.; Al-Tawari, A. A.; Bastaki, L.; Mégarbané, A.; Sabolic Avramovska, V.; de Jong, M. M.; Stromme, P.; Koul, R.; Rajab, A.; Azam, M.; Barbot, C.; Martorell Sampol, L.; Rodriguez, B.; Pascual-Castroviejo, I.; Teber, S.; Anlar, B.; Comu, S.; Karaca, E.; Kayserili, H.; Yüksel, A.; Akcakus, M.; Al Gazali, L.; Sztriha, L.; Nicholl, D.; Woods, C. G.; Bennett, C.; Hurst, J.; Sheridan, E.; Barnicoat, A.; Hennekam, R.; Lees, M.; Blair, E.; Bernes, S.; Sanchez, H.; Clark, A. E.; DeMarco, E.; Donahue, C.; Sherr, E.; Hahn, J.; Sanger, T. D.; Gallager, T. E.; Dobyns, W. B.; Daugherty, C.; Krishnamoorthy, K. S.; Sarco, D.; Walsh, C. A.; McKanna, T.; Milisa, J.; Chung, W. K.; de Vivo, D. C.; Raynes, H.; Schubert, R.; Seward, A.; Brooks, D. G.; Goldstein, A.; Caldwell, J.; Finsecke, E.; Maria, B. L.; Holden, K.; Cruse, R. P.; Swoboda, K. J.; Viskochil, D.
2009-01-01
Ciliopathies are an expanding group of rare conditions characterized by multiorgan involvement, that are caused by mutations in genes encoding for proteins of the primary cilium or its apparatus. Among these genes, CEP290 bears an intriguing allelic spectrum, being commonly mutated in Joubert
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Fiber-optic coupling based on nonimaging expanded-beam optics.
Moslehi, B; Ng, J; Kasimoff, I; Jannson, T
1989-12-01
We have fabricated and experimentally tested low-cost and mass-producible multimode fiber-optic couplers and connectors based on nonimaging beam-expanding optics and Liouville's theorem. Analysis indicates that a pair coupling loss of -0.25 dB can be achieved. Experimentally, we measured insertion losses as low as -0.38 dB. The beam expanders can be mass produced owing to the use of plastic injection-molding fabrication techniques and packaged in standard connector housings. This design is compatible with the fiber geometry and can yield highly stable coupling owing to its high tolerance for misalignments.
Scalar-Tensor Black Holes Embedded in an Expanding Universe
Tretyakova, Daria; Latosh, Boris
2018-02-01
In this review we focus our attention on scalar-tensor gravity models and their empirical verification in terms of black hole and wormhole physics. We focus on a black hole, embedded in an expanding universe, describing both cosmological and astrophysical scales. We show that in scalar-tensor gravity it is quite common that the local geometry is isolated from the cosmological expansion, so that it does not backreact on the black hole metric. We try to extract common features of scalar-tensor black holes in an expanding universe and point out the gaps that must be filled.
Scalar-Tensor Black Holes Embedded in an Expanding Universe
Directory of Open Access Journals (Sweden)
Daria Tretyakova
2018-02-01
Full Text Available In this review, we focus our attention on scalar-tensor gravity models and their empirical verification in terms of black hole and wormhole physics. We focus on black holes, embedded in an expanding universe, describing both cosmological and astrophysical scales. We show that in scalar-tensor gravity it is quite common that the local geometry is isolated from the cosmological expansion, so that it does not backreact on the black hole metric. We try to extract common features of scalar-tensor black holes in an expanding universe and point out the issues that are not fully investigated.
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Anitua, Eduardo; Pelacho, Beatriz; Prado, Roberto; Aguirre, José Javier; Sánchez, Mikel; Padilla, Sabino; Aranguren, Xabier L; Abizanda, Gloria; Collantes, María; Hernandez, Milagros; Perez-Ruiz, Ana; Peñuelas, Ivan; Orive, Gorka; Prosper, Felipe
2015-03-28
PRGF is a platelet concentrate within a plasma suspension that forms an in situ-generated fibrin-matrix delivery system, releasing multiple growth factors and other bioactive molecules that play key roles in tissue regeneration. This study was aimed at exploring the angiogenic and myogenic effects of PRGF on in vitro endothelial cells (HUVEC) and skeletal myoblasts (hSkMb) as well as on in vivo mouse subcutaneously implanted matrigel and on limb muscles after a severe ischemia. Human PRGF was prepared and characterized. Both proliferative and anti-apoptotic responses to PRGF were assessed in vitro in HUVEC and hSkMb. In vivo murine matrigel plug assay was conducted to determine the angiogenic capacity of PRGF, whereas in vivo ischemic hind limb model was carried out to demonstrate PRGF-driven vascular and myogenic regeneration. Primary HUVEC and hSkMb incubated with PRGF showed a dose dependent proliferative and anti-apoptotic effect and the PRGF matrigel plugs triggered an early and significant sustained angiogenesis compared with the control group. Moreover, mice treated with PRGF intramuscular infiltrations displayed a substantial reperfusion enhancement at day 28 associated with a fibrotic tissue reduction. These findings suggest that PRGF-induced angiogenesis is functionally effective at expanding the perfusion capacity of the new vasculature and attenuating the endogenous tissue fibrosis after a severe-induced skeletal muscle ischemia. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jyoti Kode
2017-01-01
Interpretation & conclusions: Cocktail of cytokines and SDF1 showed good potential to successfully expand HSPC which exhibited enhanced ability to generate multilineage cells in short-term and long-term repopulation assay. This cocktail-mediated stem cell expansion has potential to obviate the need for longer and large volume apheresis procedure making it convenient for donors.
Expanding Agricultural and Rural Extension Roles for Sustainable ...
African Journals Online (AJOL)
Expanding Agricultural and Rural Extension Roles for Sustainable Extension ... privatization of the public sector of national economies of developing nations has ... include marketing extension, non-farm rural micro enterprise development, ...
Evaluation of external heat loss from a small-scale expander used in organic Rankine cycle
International Nuclear Information System (INIS)
Li Jing; Pei Gang; Li Yunzhu; Ji Jie
2011-01-01
With the scaling down of the Organic Rankine Cycle (ORC), the engine shaft power is not only determined by the enthalpy drop in the expansion process but also the external heat loss from the expander. Theoretical and experimental support in evaluating small-scale expander heat loss is rare. This paper presents a quantitative study on the convection, radiation, and conduction heat transfer from a kW-scale expander. A mathematical model is built and validated. The results show that the external radiative or convective heat loss coefficient was about 3.2 or 7.0 W/K.m 2 when the ORC operated around 100 o C. Radiative and convective heat loss coefficients increased as the expander operation temperature increased. Conductive heat loss due to the connection between the expander and the support accounted for a large proportion of the total heat loss. The fitting relationships between heat loss and mean temperature difference were established. It is suggested that low conductivity material be embodied in the support of expander. Mattress insulation for compact expander could be eliminated when the operation temperature is around 100 o C. - Highlights: → A close examination of external heat loss from a small expander is presented. → Theoretical analysis and experimental test were conducted. → The established formulas can be applied to other small ORC expanders. → The results are useful in further research of small-scale ORC.
Celet Ozden, Burcu; Guven, Erdem; Aslay, Isik; Kemikler, Gonul; Olgac, Vakur; Soluk Tekkesin, Merva; Serarslan, Bengul; Tumerdem Ulug, Burcak; Bilgin Karabulut, Aylin; Arinci, Atilla; Emekli, Ufuk
2012-02-20
The optimum protocol for expander volume adjustment with respect to the timing and application of radiotherapy remains controversial. Eighteen New Zealand rabbits were divided into three groups. Metallic port integrated anatomic breast expanders of 250 cc were implanted on the back of each animal and controlled expansion was performed. Group I underwent radiotherapy with full expanders while in Group II, expanders were partially deflated immediately prior to radiotherapy. Control group did not receive radiotherapy.The changes in blood flow at different volume adjustments were investigated in Group II by laser Doppler flowmetry. Variations in the histopathologic properties of the irradiated tissues including the skin, capsule and the pocket floor, were compared in the biopsy specimens taken from different locations in each group. A significant increase in skin blood flow was detected in Group II with partial expander deflation. Overall, histopathologic exam revealed aggravated findings of chronic radiodermatitis (epidermal atrophy, dermal inflammation and fibrosis, neovascularisation and vascular changes as well as increased capsule thickness) especially around the lower expander pole, in Group II. Expander deflation immediately prior to radiotherapy, may augment the adverse effects, especially in the lower expander pole, possibly via enhanced radiosensitization due to a relative increase in the blood flow and tissue oxygenation.
Directory of Open Access Journals (Sweden)
Celet Ozden Burcu
2012-02-01
Full Text Available Abstract Background The optimum protocol for expander volume adjustment with respect to the timing and application of radiotherapy remains controversial. Methods Eighteen New Zealand rabbits were divided into three groups. Metallic port integrated anatomic breast expanders of 250 cc were implanted on the back of each animal and controlled expansion was performed. Group I underwent radiotherapy with full expanders while in Group II, expanders were partially deflated immediately prior to radiotherapy. Control group did not receive radiotherapy. The changes in blood flow at different volume adjustments were investigated in Group II by laser Doppler flowmetry. Variations in the histopathologic properties of the irradiated tissues including the skin, capsule and the pocket floor, were compared in the biopsy specimens taken from different locations in each group. Results A significant increase in skin blood flow was detected in Group II with partial expander deflation. Overall, histopathologic exam revealed aggravated findings of chronic radiodermatitis (epidermal atrophy, dermal inflammation and fibrosis, neovascularisation and vascular changes as well as increased capsule thickness especially around the lower expander pole, in Group II. Conclusions Expander deflation immediately prior to radiotherapy, may augment the adverse effects, especially in the lower expander pole, possibly via enhanced radiosensitization due to a relative increase in the blood flow and tissue oxygenation.
Hybrid Scenarios, Transmedia Storytelling, Expanded Ethnography
Directory of Open Access Journals (Sweden)
Daniel Domínguez Figaredo
2012-10-01
Full Text Available The transformation of social scenarios due to the impact of digital technologies, introduces new possibilities for ethnographic research. Once the initial approaches focused on the dichotomy of “physical-virtual spaces” have been overcame, it comes a stage of maturity that allows the ethnographers to open new avenues for conceptual and analytical methodology applied in techno-social scenarios. This article discusses the evolution of some key dimensions of ethnography according to the new social and epistemological framework. The discussion is based on the analysis of expanded practices that take place in the new techno-social spaces, defined as hybrid environments, where technologies are embedded in the physical life of the subjects. On the one hand, we consider the production of actions based on the assembly of ideas, meanings and objects through digital mediation devices. It is also analysed the transmedia component of the narratives that make sense to allow the experiments. Underlying the analysis, some elements are introduced for discussion on the scope of expanded ethnographic research, the influence of transmedia phenomenon in the notion of “field” and the methods for determining the significance through digital storytelling.
Bank Directors’ Perceptions of Expanded Auditor's Reports
DEFF Research Database (Denmark)
Boolaky, Pran Krishansing; Quick, Reiner
2016-01-01
Subsequent to the financial crisis, standard setters developed suggestions for enhancing the audit function, in order to increase financial stability. One related idea is to expand the audit report disclosed to the public, to ensure that it is fit for purpose. This study investigates the impact o...
Wegner, Alexander; Benson, Sven; Rebernik, Laura; Spreitzer, Ingo; Jäger, Marcus; Schedlowski, Manfred; Elsenbruch, Sigrid; Engler, Harald
2017-07-01
Clinical data indicate that inflammatory responses differ across sexes, but the mechanisms remain elusive. Herein, we assessed in vivo and ex vivo cytokine responses to bacterial endotoxin in healthy men and women to elucidate the role of systemic and cellular factors underlying sex differences in inflammatory responses. Participants received an i.v. injection of low-dose endotoxin (0.4 ng/kg body mass), and plasma TNF-α and IL-6 responses were analyzed over a period of 6 h. In parallel, ex vivo cytokine production was measured in endotoxin-stimulated blood samples obtained immediately before in vivo endotoxin administration. As glucocorticoids (GCs) play an important role in the negative feedback regulation of the inflammatory response, we additionally analyzed plasma cortisol concentrations and ex vivo GC sensitivity of cytokine production. Results revealed greater in vivo pro-inflammatory responses in women compared with men, with significantly higher increases in plasma TNF-α and IL-6 concentrations. In addition, the endotoxin-induced rise in plasma cortisol was more pronounced in women. In contrast, no sex differences in ex vivo cytokine production and GC sensitivity were observed. Together, these findings demonstrate major differences in in vivo and ex vivo responses to endotoxin and underscore the importance of systemic factors underlying sex differences in the inflammatory response.
Parameter Sensitivity Study for Typical Expander-Based Transcritical CO2 Refrigeration Cycles
Directory of Open Access Journals (Sweden)
Bo Zhang
2018-05-01
Full Text Available A sensitivity study was conducted for three typical expander-based transcritical CO2 cycles with the developed simulation model, and the sensitivities of the maximum coefficient of performance (COP to the key operating parameters, including the inlet pressure of gas cooler, the temperatures at evaporator inlet and gas cooler outlet, the inter-stage pressure and the isentropic efficiency of expander, were obtained. The results showed that the sensitivity to the gas cooler inlet pressure differs greatly before and after the optimal gas cooler inlet pressure. The sensitivity to the intercooler outlet temperature in the two-stage cycles increases sharply to near zero and then keeps almost constant at intercooler outlet temperature of higher than 45 °C. However, the sensitivity stabilizes near zero when the evaporator inlet temperature is very low of −26.1 °C. In two-stage compression with an intercooler and an expander assisting in driving the first-stage compressor (TEADFC cycle, an abrupt change in the sensitivity of maximum COP to the inter-stage pressure was observed, but disappeared after intercooler outlet temperature exceeds 50 °C. The sensitivity of maximum COP to the expander isentropic efficiency increases almost linearly with the expander isentropic efficiency.
In vivo multiphoton-microscopy of picosecond-laser-induced optical breakdown in human skin.
Balu, Mihaela; Lentsch, Griffin; Korta, Dorota Z; König, Karsten; Kelly, Kristen M; Tromberg, Bruce J; Zachary, Christopher B
2017-08-01
Improvements in skin appearance resulting from treatment with fractionated picosecond-lasers have been noted, but optimizing the treatment efficacy depends on a thorough understanding of the specific skin response. The development of non-invasive laser imaging techniques in conjunction with laser therapy can potentially provide feedback for guidance and optimizing clinical outcome. The purpose of this study was to demonstrate the capability of multiphoton microscopy (MPM), a high-resolution, label-free imaging technique, to characterize in vivo the skin response to a fractionated non-ablative picosecond-laser treatment. Two areas on the arm of a volunteer were treated with a fractionated picosecond laser at the Dermatology Clinic, UC Irvine. The skin response to treatment was imaged in vivo with a clinical MPM-based tomograph at 3 hours and 24 hours after treatment and seven additional time points over a 4-week period. MPM revealed micro-injuries present in the epidermis. Pigmented cells were particularly damaged in the process, suggesting that melanin is likely the main absorber for laser induced optical breakdown. Damaged individual cells were distinguished as early as 3 hours post pico-laser treatment with the 532 nm wavelength, and 24 hours post-treatment with both 532 and 1064 nm wavelengths. At later time points, clusters of cellular necrotic debris were imaged across the treated epidermis. After 24 hours of treatment, inflammatory cells were imaged in the proximity of epidermal micro-injuries. The epidermal injuries were exfoliated over a 4-week period. This observational and descriptive pilot study demonstrates that in vivo MPM imaging can be used non-invasively to provide label-free contrast for describing changes in human skin following a fractionated non-ablative laser treatment. The results presented in this study represent the groundwork for future longitudinal investigations on an expanded number of subjects to understand the response to treatment
GWDC Expands High-End Market Share
Institute of Scientific and Technical Information of China (English)
无
2008-01-01
@@ It is a decision of great significance for GWDC to expand high-end market share in order to realize its transformation of development strategy and improve its development quality. As an important step of GWDC to explore high-end market, Oman PDO Project marks the first time that the Chinese petroleum engineering service team cooperates with the transnational petroleum corporations ranking first three in the world.
Expanding the Visibility of Women's Work: Policy Implications.
Messias, DeAnne K. Hilfinger; Regev, Hanna; Im, Eun-Ok; Spiers, Judith A.; Van, Paulina; Meleis, Afaf Ibrahim
1997-01-01
Social conceptualization and media images of women's work affect health and social policy formation. Nurses can expand the visibility of women's work and promote gender-sensitive policies within and outside the profession. (SK)
International Nuclear Information System (INIS)
Sanden, M.C.M. van den.
1991-01-01
This thesis concerns the fundamental aspects of an argon plasma expanding from a cascaded arc. This type of plasma is not only used for fundamental research but also for technologically orientated research on plasma deposition and plasma sources. The important characteristics of the plasma are a strong supersonic expansion in which the neutral particle and ion densities decrease three orders of magnitude, followed by a stationary shock front. After the shock front the plasma expands further subsonically. A part of this thesis is devoted to the discussion of a newly constructed combined Thomson-Rayleigh scattering set up. With this set up the electron density, the electron temperature and the neutral particle density are measured locally in the plasma for different conditions. In the analysis of the measured spectra weak coherent effects and the measured apparatus profile are included. The inaccuracies are small, ranging from 1 to 4 percent for the electron density and 2 to 6 percent for the electron temperature, depending on the plasma conditions. The inaccuracy of the neutral particle density determination is larger and ranges from 10 to 50 percent. The detection limits for the electron and neutral particle density are 7.10 17 m -3 and 1.10 20 m -3 respectively. A side path in this thesis is the derivation of the Saha equation for a two-temperature plasma. The reason for this derivation was the dispute in the literature about the correct form of this equation. In this thesis it is shown, from the correct extension of the second law of thermodynamics and from the non-equilibrium formalism of Zubarev, That in the limit of m e /m h ->0 the generalized Saha equation depends on the electron temperature only. (author). 221 refs.; 54 figs.; 13 tabs
International Nuclear Information System (INIS)
Bleeker, W.K.; Feitsma, R.I.J.; Pauwels, E.K.J.; Plas, J. van der; Agterberg, J.; Rigter, G.; Bakker, J.C.
1989-01-01
The present investigation compares the suitability of two radiolabeling techniques for hemoglobin. 125 I labeling of hemoglobin with Iodogen as iodinating agent caused major changes in the chromatographic behaviour and an accelerated plasma clearance of the labeled hemoglobin in rats. A recently developed two-step procedure for 99m Tc labeling gave better results. The label had only minimal influence on the chromatographic behaviour of hemoglobin. In vivo, no free label occurred in the circulation and no transfer of the label to other plasma proteins took place. The plasma clearance of 99m Tc-labeled hemoglobin in rats was slowed. However, this could be explained entirely by diminishing glomerular filtration, probably by inhibition of the dissociation of the hemoglobin molecule into dimers. The plasma clearance of hemoglobin modified by intramolecular cross-linking, which prevents dissociation of the molecule into dimers and thus excretion by the kidney, was not influenced by the label. We conclude that the 99m Tc labeling procedure is suitable for in vivo distribution studies of hemoglobin when it is taken into account that the urinary excretion is underestimated. For cross-linked hemoglobin, which is more promising as plasma expander, no such restriction exists. (author)
Circle diffeomorphisms forced by expanding circle maps
Homburg, A.J.
2012-01-01
We discuss the dynamics of skew product maps defined by circle diffeomorphisms forced by expanding circle maps. We construct an open class of such systems that are robustly topologically mixing and for which almost all points in the same fiber converge under iteration. This property follows from the
Quantifying the impact of expanded age group campaigns for polio eradication.
Wagner, Bradley G; Behrend, Matthew R; Klein, Daniel J; Upfill-Brown, Alexander M; Eckhoff, Philip A; Hu, Hao
2014-01-01
A priority of the Global Polio Eradication Initiative (GPEI) 2013-2018 strategic plan is to evaluate the potential impact on polio eradication resulting from expanding one or more Supplementary Immunization Activities (SIAs) to children beyond age five-years in polio endemic countries. It has been hypothesized that such expanded age group (EAG) campaigns could accelerate polio eradication by eliminating immunity gaps in older children that may have resulted from past periods of low vaccination coverage. Using an individual-based mathematical model, we quantified the impact of EAG campaigns in terms of probability of elimination, reduction in polio transmission and age stratified immunity levels. The model was specifically calibrated to seroprevalence data from a polio-endemic region: Zaria, Nigeria. We compared the impact of EAG campaigns, which depend only on age, to more targeted interventions which focus on reaching missed populations. We found that EAG campaigns would not significantly improve prospects for polio eradication; the probability of elimination increased by 8% (from 24% at baseline to 32%) when expanding three annual SIAs to 5-14 year old children and by 18% when expanding all six annual SIAs. In contrast, expanding only two of the annual SIAs to target hard-to-reach populations at modest vaccination coverage-representing less than one tenth of additional vaccinations required for the six SIA EAG scenario-increased the probability of elimination by 55%. Implementation of EAG campaigns in polio endemic regions would not improve prospects for eradication. In endemic areas, vaccination campaigns which do not target missed populations will not benefit polio eradication efforts.
Subclinical leaflet thickening and stent frame geometry in self-expanding transcatheter heart valves
DEFF Research Database (Denmark)
Fuchs, Andreas; De Backer, Ole; Brooks, Matthew
2017-01-01
AIMS: This study aimed to assess the potential relationship between subclinical leaflet thickening and stent frame geometry in patients who underwent aortic valve replacement with a self-expanding transcatheter heart valve (THV). METHODS AND RESULTS: Seventy-five patients with a self-expanding THV....... CONCLUSIONS: Regional THV stent frame underexpansion is associated with an increased risk of leaflet thickening. Post-dilatation of self-expanding THV as well as a supra-annular valve position seem to reduce the occurrence of this phenomenon....
In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences
Energy Technology Data Exchange (ETDEWEB)
Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.
2006-02-01
The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.
Esophagojejunal anastomotic leak managed with self expandable metallic stent
Directory of Open Access Journals (Sweden)
Arvind Madurandagam Annapillai
2013-01-01
Full Text Available Esophagealjejunal anastomotic leak after gastrectomy is a serious surgical emergency with high mortality. This report describes a 57-year-old male with esophagojejunal anastomotic leak following total gastrectomy for gastric cancer and was managed successfully with self-expandable metallic stent. To our knowledge this is the first such report from India. This case report highlights the need of interdisciplinary coordination in managing this difficult clinical situation. Endotherapy with self-expandable metallic stent (SEM provided twin benefits of improving respiratory embarrassment and the joy of eating. Therapy of such difficult cases must be individualized; however, and SEM stent usage is a viable option
Dissipation and fluctuation of quantum fields in expanding universes
International Nuclear Information System (INIS)
Morikawa, M.
1990-01-01
A stochastic dynamics of a long-wavelength part of a scalar field in an expanding universe is derived by using the influence functional method. Dissipation as well as fluctuation are derived for general parameters: a mass, a coupling to the scalar curvature, and a cutoff scale parameter. A dissipation-fluctuation relation is found with a temperature which is proportional to the Hawking temperature, but system dependent. The method is further applied to an expanding universe with a power law and yields the dispersion which agrees with that obtained by the regularization method. The back reaction to the background de Sitter space itself is also obtained
Expanding Business Opportunities for African Youth in Agricultural ...
International Development Research Centre (IDRC) Digital Library (Canada)
Expanding Business Opportunities for African Youth in Agricultural Value ... sector actors who can help commercialize them and achieve large-scale impacts. ... CultiAF supports research to achieve long-term food security in Eastern and ...
Overview of the APT high-energy beam transport and beam expanders
International Nuclear Information System (INIS)
Shafer, R.E.; Blind, B.; Gray, E.R.
1997-01-01
The APT high energy beam transport (HEBT) and beam expanders convey the 1700-MeV, 100-mA cw proton beam from the linac to the tritium target/blanket assembly, or a tuning beam stop. The HEBT includes extensive beam diagnostics, collimators, and beam jitter correction, to monitor and control the 170-MW beam prior to expansion. A zero-degree beamline conveys the beam to the beam stop, and an achromatic bend conveys the beam to the tritium production target. Nonlinear beam expanders make use of higher-order multipole magnets and dithering dipoles to expand the beam to a uniform-density, 16-cm wide by 160-cm high rectangular profile on the tritium-production target. The overall optics design will be reviewed, and beam simulations will be presented
Impaired heat shock response in cells expressing full-length polyglutamine-expanded huntingtin.
Directory of Open Access Journals (Sweden)
Sidhartha M Chafekar
Full Text Available The molecular mechanisms by which polyglutamine (polyQ-expanded huntingtin (Htt causes neurodegeneration in Huntington's disease (HD remain unclear. The malfunction of cellular proteostasis has been suggested as central in HD pathogenesis and also as a target of therapeutic interventions for the treatment of HD. We present results that offer a previously unexplored perspective regarding impaired proteostasis in HD. We find that, under non-stress conditions, the proteostatic capacity of cells expressing full length polyQ-expanded Htt is adequate. Yet, under stress conditions, the presence of polyQ-expanded Htt impairs the heat shock response, a key component of cellular proteostasis. This impaired heat shock response results in a reduced capacity to withstand the damage caused by cellular stress. We demonstrate that in cells expressing polyQ-expanded Htt the levels of heat shock transcription factor 1 (HSF1 are reduced, and, as a consequence, these cells have an impaired a heat shock response. Also, we found reduced HSF1 and HSP70 levels in the striata of HD knock-in mice when compared to wild-type mice. Our results suggests that full length, non-aggregated polyQ-expanded Htt blocks the effective induction of the heat shock response under stress conditions and may thus trigger the accumulation of cellular damage during the course of HD pathogenesis.
AR42J-B-13 cell: An expandable progenitor to generate an unlimited supply of functional hepatocytes
International Nuclear Information System (INIS)
Wallace, Karen; Fairhall, Emma A.; Charlton, Keith A.; Wright, Matthew C.
2010-01-01
Hepatocytes are the preparation of choice for Toxicological research in vitro. However, despite the fact that hepatocytes proliferate in vivo during liver regeneration, they are resistant to proliferation in vitro, do not tolerate sub-culture and tend to enter a de-differentiation program that results in a loss of hepatic function. These limitations have resulted in the search for expandable rodent and human cells capable of being directed to differentiate into functional hepatocytes. Research with stem cells suggests that it may be possible to provide the research community with hepatocytes in vitro although to date, significant challenges remain, notably generating a sufficiently pure population of hepatocytes with a quantitative functionality comparable with hepatocytes. This paper reviews work with the AR42J-B-13 (B-13) cell line. The B-13 cell was cloned from the rodent AR42J pancreatic cell line, express genes associated with pancreatic acinar cells and readily proliferates in simple culture media. When exposed to glucocorticoid, 75-85% of the cells trans-differentiate into hepatocyte-like (B-13/H) cells functioning at a level quantitatively similar to freshly isolated rat hepatocytes (with the remaining cells retaining the B-13 phenotype). Trans-differentiation of pancreatic acinar cells also appears to occur in vivo in rats treated with glucocorticoid; in mice with elevated circulating glucocorticoid and in humans treated for long periods with glucocorticoid. The B-13 response to glucocorticoid therefore appears to be related to a real pathophysiological response of a pancreatic cell to glucocorticoid. An understanding of how this process occurs and if it can be generated or engineered in human cells would result in a cell line with the ability to generate an unlimited supply of functional human hepatocytes in a cost effective manner.
Directory of Open Access Journals (Sweden)
Marie S Hasemann
Full Text Available BACKGROUND: Transcription factors play a key role in lineage commitment and differentiation of stem cells into distinct mature cells. In hematopoiesis, they regulate lineage-specific gene expression in a stage-specific manner through various physical and functional interactions with regulatory proteins that are simultanously recruited and activated to ensure timely gene expression. The transcription factor CCAAT/enhancer binding protein α (C/EBPα is such a factor and is essential for the development of granulocytic/monocytic cells. The activity of C/EBPα is regulated on several levels including gene expression, alternative translation, protein interactions and posttranslational modifications, such as phosphorylation. In particular, the phosphorylation of serine 248 of the transactivation domain has been shown to be of crucial importance for granulocytic differentiation of 32Dcl3 cells in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we use mouse genetics to investigate the significance of C/EBPα serine 248 in vivo through the construction and analysis of Cebpa(S248A/S248A knock-in mice. Surprisingly, 8-week old Cebpa(S248A/S248A mice display normal steady-state hematopoiesis including unaltered development of mature myeloid cells. However, over time some of the animals develop a hematopoietic disorder with accumulation of multipotent, megakaryocytic and erythroid progenitor cells and a mild impairment of differentiation along the granulocytic-monocytic lineage. Furthermore, BM cells from Cebpa(S248A/S248A animals display a competitive advantage compared to wild type cells in a transplantation assay. CONCLUSIONS/SIGNIFICANCE: Taken together, our data shows that the substitution of C/EBPα serine 248 to alanine favors the selection of the megakaryocytic/erythroid lineage over the monocytic/granulocytic compartment in old mice and suggests that S248 phosphorylation may be required to maintain proper hematopoietic homeostasis in response to
Hasemann, Marie S; Schuster, Mikkel B; Frank, Anne-Katrine; Theilgaard-Mönch, Kim; Pedersen, Thomas Å; Nerlov, Claus; Porse, Bo T
2012-01-01
Transcription factors play a key role in lineage commitment and differentiation of stem cells into distinct mature cells. In hematopoiesis, they regulate lineage-specific gene expression in a stage-specific manner through various physical and functional interactions with regulatory proteins that are simultanously recruited and activated to ensure timely gene expression. The transcription factor CCAAT/enhancer binding protein α (C/EBPα) is such a factor and is essential for the development of granulocytic/monocytic cells. The activity of C/EBPα is regulated on several levels including gene expression, alternative translation, protein interactions and posttranslational modifications, such as phosphorylation. In particular, the phosphorylation of serine 248 of the transactivation domain has been shown to be of crucial importance for granulocytic differentiation of 32Dcl3 cells in vitro. Here, we use mouse genetics to investigate the significance of C/EBPα serine 248 in vivo through the construction and analysis of Cebpa(S248A/S248A) knock-in mice. Surprisingly, 8-week old Cebpa(S248A/S248A) mice display normal steady-state hematopoiesis including unaltered development of mature myeloid cells. However, over time some of the animals develop a hematopoietic disorder with accumulation of multipotent, megakaryocytic and erythroid progenitor cells and a mild impairment of differentiation along the granulocytic-monocytic lineage. Furthermore, BM cells from Cebpa(S248A/S248A) animals display a competitive advantage compared to wild type cells in a transplantation assay. Taken together, our data shows that the substitution of C/EBPα serine 248 to alanine favors the selection of the megakaryocytic/erythroid lineage over the monocytic/granulocytic compartment in old mice and suggests that S248 phosphorylation may be required to maintain proper hematopoietic homeostasis in response to changes in the wiring of cellular signalling networks. More broadly, the marked differences
Lymphotoxin prevention of diethylnitrosamine carcinogenesis in vivo
International Nuclear Information System (INIS)
Ransom, J.H.; Evans, C.H.; DiPaolo, J.A.
1982-01-01
Development of intervention measures to control cancer would be facilitated by being able to monitor in vivo carcinogenesis by in vitro quantitation of early indices of neoplastic transformation to assess the in vivo effectiveness of preventive-therapeutic measures. Pregnant Syrian golden hamsters were used in an in vivo-in vitro transplacental model of carcinogenesis to determine the extent that in vivo administration of immunologic hormone preparations along with chemical carcinogen would prevent morphologic transformation assessed in vitro. Pregnant hamsters at 10-11 days of gestation were given injections ip of 3 mg diethylnitrosamine (DENA)/100 g body weight and were killed 2 days later when fetal cells were seeded for colony formation. The frequency of morphologically transformed colonies was assessed after 7 days of growth. Cloning efficiency and mean transformation frequency after DENA exposure were 3.6% and 1 X 10(-4) per cell seeded, respectively. The ip injection of an immunologic hormone preparation reduced the transformation frequency by 46%. The hormone preparation, containing 10,000 U of lymphotoxin but no detectable interferon, was the ultrafiltered lymphokines (greater than 10,000 mol wt) from phytohemagglutinin-stimulated hamster peritoneal leukocytes. The effect of lymphotoxin on cocarcinogenic exposure of fetal cells to DENA in vivo followed by X-irradiation in vitro was also determined. Cells exposed to 250 rad in vitro had a cloning efficiency of 0.5% and a transformation frequency of 0.4 X 10(-4) per cell seeded. After DENA injection and X-irradiation, the transformation frequency increased to 1 X 10(-4) and was inhibited 64% by lymphotoxin in vivo. Thus immunologic hormones (e.g., lymphotoxin) can prevent carcinogenesis in vivo. Furthermore, in vitro quantitation of transformation is a rapid means for evaluating therapeutic and autochthonous effector mechanisms for their ability to prevent or otherwise modulate carcinogenesis in vivo
Hilar Renal Artery Aneurysm - Ex-vivo Reconstruction and Autotransplantation.
Pinto Sousa, Pedro; Veiga, Carlos; Matos, Arlindo; Sá Pinto, Pedro; Almeida, Rui
2017-01-01
Renal artery aneurysm (RAA) is a rare clinical entity with an estimated prevalence of 0.15% to 0.1%in the general population. The majority of patients present asymptomatically and the diagnosis is made incidentally during a hypertension study test, and more rarely, fortuitously after backache. Indications to treat have been subject of intense debate, nevertheless there seems to be some consensus that RAAs greater than 2 cm in diameter, expanding RAA, with thrombus or in pregnant women should be treated. Treatment options vary between surgical or endovascular approach. The complex (hilar) RAA constitute a subset of RAA that present a therapeutic dilemma because of their anatomic location and may require extracorporeal arterial reconstruction and auto-transplantation. We describe a 71-year-old woman with a personal history of hypertension for more than twenty years but normal renal function. Following the study for an abdominal discomfort a complex RAA was incidentally diagnosed. Computed tomographic angiography with three-dimensional reconstruction revealed a 13mm, saccular aneurysm located at the right renal hilum. We performed hand-assisted laparoscopic nephrectomy with ex vivo repair of the RAA. The aneurysm was resected and a polar renal artery was implanted over the resected area with a latero-terminal anastomosis. Complementarily, the renal vein was augmented with a spiral great saphenous vein graft and finally the kidney was implanted into the right iliac fossa. The intervention and postoperative course were uneventful and the patient submitted to ultrasound evaluation on the day after procedure. It revealed normal renal perfusion with normal flow indices. In the last follow-up realized, two months after surgery the patient was alive with a well-functioning auto-transplant. RAA may be nowadays more frequently diagnosed due to the increasing use of imaging techniques. While renal artery trunk aneurysms are most often treated using an endovascular procedure it