In vitro culture of various species of microsporidia causing keratitis: Evaluation of three immortalized cell lines

Directory of Open Access Journals (Sweden)

Joseph J

2009-01-01

Full Text Available Being intracellular parasites, microsporidia can only be propagated in cell culture systems. This study evaluated three cell lines to determine the most suitable host-parasite In vitro system. Confluent monolayers of vero, SIRC, and HeLa cell lines, grown in 24-well tissue culture plates, were inoculated with varying concentrations (1 x 10 4 to 1 x 10 8 spores/mL of Vittaforma corneae, Encephalitozoon hellem, Encephalitozoon cuniculi, and Encephalitozoon intestinalis spores. Growth was compared quantitatively at weekly intervals. Encephalitozoon species showed the highest amount of growth when cultured in vero cell line, while there was no significant difference in their growth in SIRC and HeLa cell lines. In comparison, V. corneae showed the highest growth in SIRC cells, followed by vero cells. The analytical sensitivity was found to be 1 x 10 4 spores/mL for vero cell line compared to 1 x 10 5 spores/mL for SIRC cell line and 1 x 10 7 spores/mL for HeLa cell line. HeLa cells also showed rapid disruption of cells, and the spores could not be easily distinguished from cell debris. This is the first report of the comparison of vero, SIRC, and HeLa for the propagation of microsporidial spores. Vero cell line was found to be more sensitive than SIRC and HeLa cells, and we believe that the inclusion of vero cell line in the routine culture protocols of ocular parasitology laboratories would result in a significant increase in the diagnostic yield.

In vitro culture of human osteosarcoma cell lines: a comparison of functional characteristics for cell lines cultured in medium without and with fetal calf serum.

Science.gov (United States)

Bruserud, Oystein; Tronstad, Karl Johan; Berge, Rolf

2005-06-01

Experimental in vitro models including well-characterised cell lines can be used to identify possible new therapeutic targets for the treatment of osteosarcoma. Culture media including inactivated serum is often recommended for in vitro culture of osteosarcoma cells, but the serum component then represents a nonstandardised parameter including a wide range of unidentified mediators. To improve the standardisation we have investigated whether serum-free culture media can be used in experimental in vitro studies of osteosarcoma cell lines. The seven osteosarcoma cell lines Cal72, SJSA-1, Saos-2, SK-ES-1, U2OS, 143.98.2, and KHOS-32IH were cultured in vitro in various serum-free media and media supplemented with 10% heat-inactivated fetal calf serum (FCS). Although proliferation often was relatively low in serum-free media (X-vivo 10, X-vivo 15, X-vivo 20, Stem Span SFEM), some cell lines (Cal72, KHOS-32IH, Saos-2) showed proliferation comparable with the recommended FCS-containing media even when using serum-free conditions. The optimal serum-free medium then varied between cell lines. We also compared 6 different FCS-containing media (including Stem Span with 10% FCS) and the optimal FCS-containing medium varied between cell lines. However, all cell lines proliferated well in Stem Span with FCS, and this medium was regarded as optimal for four of the lines. FCS could not be replaced by fatty acids or low density lipoprotein when testing the Stem Span medium. The release of a wide range of soluble mediators showed only minor differences when using serum-free and FCS-containing media (including Stem Span with and without FCS), and serum-free Stem Span could also be used for in vitro studies of mitogen-stimulated T cell activation in the presence of accessory osteosarcoma cells. The use of Stem Span with 10% FCS allowed the release of a wide range of chemokines by osteosarcoma cell lines (Cal72, SJSA-1), and the chemokine release profile was very similar to the

Co-culture of chondrocytes and bone marrow mesenchymal stem cells in vitro enhances the expression of cartilaginous extracellular matrix components

Directory of Open Access Journals (Sweden)

Chang Qing

2011-04-01

Full Text Available Chondrocytes and bone marrow mesenchymal stem cells (BMSCs are frequently used as seed cells in cartilage tissue engineering. In the present study, we determined if the co-culture of rabbit articular chondrocytes and BMSCs in vitro promotes the expression of cartilaginous extracellular matrix and, if so, what is the optimal ratio of the two cell types. Cultures of rabbit articular chondrocytes and BMSCs were expanded in vitro and then cultured individually or at a chondrocyte:BMSC ratio of 4:1, 2:1, 1:1, 1:2, 1:4 for 21 days and cultured in DMEM/F12. BMSCs were cultured in chondrogenic induction medium. Quantitative real-time RT-PCR and Western blot were used to evaluate gene expression. In the co-cultures, type II collagen and aggrecan expression increased on days 14 and 21. At the mRNA level, the expression of type II collagen and aggrecan on day 21 was much higher in the 4:1, 2:1, and 1:1 groups than in either the articular chondrocyte group or the induced BMSC group, and the best ratio of co-culture groups seems to be 2:1. Also on day 21, the expression of type II collagen and aggrecan proteins in the 2:1 group was much higher than in all other groups. The results demonstrate that the co-culture of rabbit chondrocytes and rabbit BMSCs at defined ratios can promote the expression of cartilaginous extracellular matrix. The optimal cell ratio appears to be 2:1 (chondrocytes:BMSCs. This approach has potential applications in cartilage tissue engineering since it provides a protocol for maintaining and promoting seed-cell differentiation and function.

Co-culture of chondrocytes and bone marrow mesenchymal stem cells in vitro enhances the expression of cartilaginous extracellular matrix components.

Science.gov (United States)

Qing, Chang; Wei-ding, Cui; Wei-min, Fan

2011-04-01

Chondrocytes and bone marrow mesenchymal stem cells (BMSCs) are frequently used as seed cells in cartilage tissue engineering. In the present study, we determined if the co-culture of rabbit articular chondrocytes and BMSCs in vitro promotes the expression of cartilaginous extracellular matrix and, if so, what is the optimal ratio of the two cell types. Cultures of rabbit articular chondrocytes and BMSCs were expanded in vitro and then cultured individually or at a chondrocyte:BMSC ratio of 4:1, 2:1, 1:1, 1:2, 1:4 for 21 days and cultured in DMEM/F12. BMSCs were cultured in chondrogenic induction medium. Quantitative real-time RT-PCR and Western blot were used to evaluate gene expression. In the co-cultures, type II collagen and aggrecan expression increased on days 14 and 21. At the mRNA level, the expression of type II collagen and aggrecan on day 21 was much higher in the 4:1, 2:1, and 1:1 groups than in either the articular chondrocyte group or the induced BMSC group, and the best ratio of co-culture groups seems to be 2:1. Also on day 21, the expression of type II collagen and aggrecan proteins in the 2:1 group was much higher than in all other groups. The results demonstrate that the co-culture of rabbit chondrocytes and rabbit BMSCs at defined ratios can promote the expression of cartilaginous extracellular matrix. The optimal cell ratio appears to be 2:1 (chondrocytes:BMSCs). This approach has potential applications in cartilage tissue engineering since it provides a protocol for maintaining and promoting seed-cell differentiation and function.

Brain Aggregates: An Effective In Vitro Cell Culture System Modeling Neurodegenerative Diseases.

Science.gov (United States)

Ahn, Misol; Kalume, Franck; Pitstick, Rose; Oehler, Abby; Carlson, George; DeArmond, Stephen J

2016-03-01

Drug discovery for neurodegenerative diseases is particularly challenging because of the discrepancies in drug effects between in vitro and in vivo studies. These discrepancies occur in part because current cell culture systems used for drug screening have many limitations. First, few cell culture systems accurately model human aging or neurodegenerative diseases. Second, drug efficacy may differ between dividing and stationary cells, the latter resembling nondividing neurons in the CNS. Brain aggregates (BrnAggs) derived from embryonic day 15 gestation mouse embryos may represent neuropathogenic processes in prion disease and reflect in vivo drug efficacy. Here, we report a new method for the production of BrnAggs suitable for drug screening and suggest that BrnAggs can model additional neurological diseases such as tauopathies. We also report a functional assay with BrnAggs by measuring electrophysiological activities. Our data suggest that BrnAggs could serve as an effective in vitro cell culture system for drug discovery for neurodegenerative diseases. © 2016 American Association of Neuropathologists, Inc. All rights reserved.

Gamma-ray mutagenesis of cultured mammalian cells in vitro and in vivo

International Nuclear Information System (INIS)

Suzuki, Norio; Okada, Shigefumi

1977-01-01

The in vitro assay system used to study the reversion of L5178Y-Ala32 cells from an alanine requiring state to a non-requiring state, has been modified in order to be of use in selected in vivo systems. Gamma-ray induced mutations were compared between cells cultured in vitro and those grown in vivo in the intraperitoneal cavity of mice. The expression time was chosen to be 2 days for cells grown in vitro and 5 days for those grown in vivo. The dose-response curve can be described as cumulative for cells grown in vitro and linear for those grown in vivo. A doserate effect was observed in both systems. The cells grown in vivo were less sensitive to γ-rays with respect to both mutation rate per rad and cell killing as compared to cells grown in vitro. The delayed expression and reduced sensitivity of cells in vivo with respect to induced mutation may be due to factors such as hypoxia and/or reduced availability of essential nutrients. Sensitization in vitro by BUdR was detectable at a concentration as low as 10 -6 M, using an exposure time of 15 h. Under these conditions, BUdR alone did not induce any observable mutations

Quantitative HRMAS proton total correlation spectroscopy applied to cultured melanoma cells treated by chloroethyl nitrosourea: demonstration of phospholipid metabolism alterations.

Science.gov (United States)

Morvan, Daniel; Demidem, Aicha; Papon, Janine; Madelmont, Jean Claude

2003-02-01

Recent NMR spectroscopy developments, such as high-resolution magic angle spinning (HRMAS) probes and correlation-enhanced 2D sequences, now allow improved investigations of phospholipid (Plp) metabolism. Using these modalities we previously demonstrated that a mouse-bearing melanoma tumor responded to chloroethyl nitrosourea (CENU) treatment in vivo by altering its Plp metabolism. The aims of the present study were to investigate whether HRMAS proton total correlation spectroscopy (TOCSY) could be used as a quantitative technique to probe Plp metabolism, and to determine the Plp metabolism response of cultured B16 melanoma cells to CENU treatment in vitro. The exploited TOCSY signals of Plp derivatives arose from scalar coupling among the protons of neighbor methylene groups within base headgroups (choline and ethanolamine). For strongly expressed Plp derivatives, TOCSY signals were compared to saturation recovery signals and demonstrated a linear relationship. HRMAS proton TOCSY was thus used to provide concentrations of Plp derivatives during long-term follow-up of CENU-treated cell cultures. Strong Plp metabolism alteration was observed in treated cultured cells in vitro involving a down-regulation of phosphocholine, and a dramatic and irreversible increase of phosphoethanolamine. These findings are discussed in relation to previous in vivo data, and to Plp metabolism enzymatic involvement. Copyright 2003 Wiley-Liss, Inc.

Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

International Nuclear Information System (INIS)

Mori, K.J.; Izumi, Hiroko; Seto, Akira

1981-01-01

A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

In vitro development of cloned bovine embryos produced by handmade cloning using somatic cells from distinct levels of cell culture confluence.

Science.gov (United States)

Gerger, R P C; Ribeiro, E S; Forell, F; Bertolini, L R; Rodrigues, J L; Ambrósio, C E; Miglino, M A; Mezzalira, A; Bertolini, M

2010-02-18

The relationship between the level of cell confluence near the plateau phase of growth and blastocyst yield following somatic cell cloning is not well understood. We examined the effect of distinct cell culture confluence levels on in vitro development of cloned bovine embryos. In vitro-matured bovine oocytes were manually bisected and selected by DNA staining. One or two enucleated hemi-cytoplasts were paired and fused with an adult skin somatic cell. Cultured skin cells from an adult Nellore cow harvested at three distinct culture confluence levels (70-80, 80-90, and >95%) were used for construction of embryos and hemi-embryos. After activation, structures were cultured in vitro as one embryo (1 x 100%) or as aggregates of two hemi-embryos (2 x 50%) per microwell. Fusion, cleavage and blastocyst rates were compared using the chi(2) test. The fusion rate for hemi-embryos (51.4%) was lower than for embryos (67.6%), with no influence of degree of cell confluence. However, blastocyst rates improved linearly (7.0, 17.5, and 29.4%) with increases in cell confluence. We conclude that degree of cell culture confluence significantly influences subsequent embryo development; use of a cell population in high confluence (>90%) for nuclear transfer significantly improved blastocyst yield after cloning.

In vitro oocyte culture and somatic cell nuclear transfer used to produce a live-born cloned goat.

Science.gov (United States)

Ohkoshi, Katsuhiro; Takahashi, Seiya; Koyama, Shin-Ichiro; Akagi, Satoshi; Adachi, Noritaka; Furusawa, Tadashi; Fujimoto, Jun-Ichiro; Takeda, Kumiko; Kubo, Masanori; Izaike, Yoshiaki; Tokunaga, Tomoyuki

2003-01-01

The use of an in vitro culture system was examined for production of somatic cells suitable for nuclear transfer in the goat. Goat cumulus-oocyte complexes were incubated in tissue culture medium TCM-199 supplemented with 10% fetal bovine serum (FBS) for 20 h. In vitro matured (IVM) oocytes were enucleated and used as karyoplast recipients. Donor cells obtained from the anterior pituitary of an adult male were introduced into the perivitelline space of enucleated IVM oocytes and fused by an electrical pulse. Reconstituted oocytes were cultured in chemically defined medium for 9 days. Two hundred and twenty-eight oocytes (70%) were fused with donor cells. After in vitro culture, seven somatic cell nuclear transfer (SCNT) oocytes (3%) developed to the blastocyst stage. SCNT embryos were transferred to the oviducts of recipient females (four 8-cell embryos per female) or uterine horn (two blastocysts per female). One male clone (NT1) was produced at day 153 from an SCNT blastocyst and died 16 days after birth. This study demonstrates that nuclear transferred goat oocytes produced using an in vitro culture system could develop to term and that donor anterior pituitary cells have the developmental potential to produce term offspring. In this study, it suggested that the artificial control of endocrine system in domestic animal might become possible by the genetic modification to anterior pituitary cells.

Digital holographic microscopy for toxicity testing and cell culture quality control

Science.gov (United States)

Kemper, Björn

2018-02-01

For the example of digital holographic microscopy (DHM), it is illustrated how label-free biophysical parameter sets can be extracted from quantitative phase images of adherent and suspended cells, and how the retrieved data can be applied for in-vitro toxicity testing and cell culture quality assessment. This includes results from the quantification of the reactions of cells to toxic substances as well as data from sophisticated monitoring of cell alterations that are related to changes of cell culture conditions.

A cell culture technique for human epiretinal membranes to describe cell behavior and membrane contraction in vitro.

Science.gov (United States)

Wertheimer, Christian; Eibl-Lindner, Kirsten H; Compera, Denise; Kueres, Alexander; Wolf, Armin; Docheva, Denitsa; Priglinger, Siegfried G; Priglinger, Claudia; Schumann, Ricarda G

2017-11-01

To introduce a human cell culture technique for investigating in-vitro behavior of primary epiretinal cells and membrane contraction of fibrocellular tissue surgically removed from eyes with idiopathic macular pucker. Human epiretinal membranes were harvested from ten eyes with idiopathic macular pucker during standard vitrectomy. Specimens were fixed on cell culture plastic using small entomological pins to apply horizontal stress to the tissue, and then transferred to standard cell culture conditions. Cell behavior of 400 epiretinal cells from 10 epiretinal membranes was observed in time-lapse microscopy and analyzed in terms of cell migration, cell velocity, and membrane contraction. Immunocytochemistry was performed for cell type-specific antigens. Cell specific differences in migration behavior were observed comprising two phenotypes: (PT1) epiretinal cells moving fast, less directly, with small round phenotype and (PT2) epiretinal cells moving slowly, directly, with elongated large phenotype. No mitosis, no outgrowth and no migration onto the plastic were seen. Horizontal contraction measurements showed variation between specimens. Masses of epiretinal cells with a myofibroblast-like phenotype expressed cytoplasmatic α-SMA stress fibers and correlated with cell behavior characteristics (PT2). Fast moving epiretinal cells (PT1) were identified as microglia by immunostaining. This in-vitro technique using traction application allows for culturing surgically removed epiretinal membranes from eyes with idiopathic macular pucker, demonstrating cell behavior and membrane contraction of primary human epiretinal cells. Our findings emphasize the abundance of myofibroblasts, the presence of microglia and specific differences of cell behavior in these membranes. This technique has the potential to improve the understanding of pathologies at the vitreomacular interface and might be helpful in establishing anti-fibrotic treatment strategies.

Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells in irradiated bone marrow cell culture in vitro

International Nuclear Information System (INIS)

Fujitake, Hideki; Okamoto, Yuruko; Okubo, Hiroshi; Miyanomae, Takeshi; Kumagai, Keiko; Mori, K.J.

1981-01-01

Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 10 7 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 10 6 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 10 7 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)

Towards a quantitative understanding of oxygen tension and cell density evolution in fibrin hydrogels.

Science.gov (United States)

Demol, Jan; Lambrechts, Dennis; Geris, Liesbet; Schrooten, Jan; Van Oosterwyck, Hans

2011-01-01

The in vitro culture of hydrogel-based constructs above a critical size is accompanied by problems of unequal cell distribution when diffusion is the primary mode of oxygen transfer. In this study, an experimentally-informed mathematical model was developed to relate cell proliferation and death inside fibrin hydrogels to the local oxygen tension in a quantitative manner. The predictive capacity of the resulting model was tested by comparing its outcomes to the density, distribution and viability of human periosteum derived cells (hPDCs) that were cultured inside fibrin hydrogels in vitro. The model was able to reproduce important experimental findings, such as the formation of a multilayered cell sheet at the hydrogel periphery and the occurrence of a cell density gradient throughout the hydrogel. In addition, the model demonstrated that cell culture in fibrin hydrogels can lead to complete anoxia in the centre of the hydrogel for realistic values of oxygen diffusion and consumption. A sensitivity analysis also identified these two parameters, together with the proliferation parameters of the encapsulated cells, as the governing parameters for the occurrence of anoxia. In conclusion, this study indicates that mathematical models can help to better understand oxygen transport limitations and its influence on cell behaviour during the in vitro culture of cell-seeded hydrogels. Copyright © 2010 Elsevier Ltd. All rights reserved.

Dynamic 3D culture promotes spontaneous embryonic stem cell differentiation in vitro.

Science.gov (United States)

Gerlach, Jörg C; Hout, Mariah; Edsbagge, Josefina; Björquist, Petter; Lübberstedt, Marc; Miki, Toshio; Stachelscheid, Harald; Schmelzer, Eva; Schatten, Gerald; Zeilinger, Katrin

2010-02-01

Spontaneous in vitro differentiation of mouse embryonic stem cells (mESC) is promoted by a dynamic, three-dimensional (3D), tissue-density perfusion technique with continuous medium perfusion and exchange in a novel four-compartment, interwoven capillary bioreactor. We compared ectodermal, endodermal, and mesodermal immunoreactive tissue structures formed by mESC at culture day 10 with mouse fetal tissue development at gestational day E9.5. The results show that the bioreactor cultures more closely resemble mouse fetal tissue development at gestational day E9.5 than control mESC cultured in Petri dishes.

In vitro interactions of lymphocytes and cultured cells from beagles with plutonium-induced bone tumors

International Nuclear Information System (INIS)

Frazier, M.E.; Lund, J.E.; Busch, R.H.

1976-01-01

Cell cultures have been prepared from lung and bone tumors arising in beagle dogs following exposure to inhaled plutonium. Evaluation of the cultured cells by commonly applied criteria (i.e., cell morphology, lack of contact inhibitory mechanisms, cloning efficiency, growth in soft agar, and tumor production in vivo) indicated that tumor cells were being grown in culture. Blood leukocytes and peripheral lymphocytes from beagle dogs were tested for cytotoxic effects against several cell cultures. Lymphocytes from normal dogs or dogs with unrelated tumors would not kill the bone tumor cells unless monocytes (macrophage) were present, in which case the leukocyte preparation was capable of mounting de novo cytotoxic immune reactions after 3 to 5 days in culture. In contrast, the dogs with plutonium-induced bone tumors had circulating lymphocytes that appeared to have undergone presensitization to bone-tumor-distinctive antigens in vivo. Consequently these lymphocytes interacted with cultured cells promptly after encounter in vitro

The in vitro biokinetics of chlorpromazine and diazepam in aggregating rat brain cell cultures after repeated exposure

NARCIS (Netherlands)

Broeders, Jessica J W; Hermens, Joop L M; Blaauboer, Bas J; Zurich, Marie-Gabrielle

2015-01-01

Neurotoxic effects of compounds can be tested in vitro using cell systems. One example is aggregating rat brain cell cultures. For the extrapolation of in vitro data to the in vivo situation, it is important to take the biokinetics of the test compound into account. In addition, the exposure in vivo

Tick-borne relapsing fever imported from West Africa: diagnosis by quantitative buffy coat analysis and in vitro culture of Borrelia crocidurae.

Science.gov (United States)

van Dam, A P; van Gool, T; Wetsteyn, J C; Dankert, J

1999-06-01

West African tick-borne relapsing fever (TBRF) is difficult to diagnose due to the low number of spirochetes in the bloodstream of patients. Previously, the causative microorganism, Borrelia crocidurae, had never been cultured in vitro. TBRF was rapidly diagnosed for two patients returning from western Africa with fever of unknown origin by quantitative buffy coat (QBC) analysis. Diagnosis was confirmed by intraperitoneal inoculation of blood specimens from patients into laboratory mice. In vitro experiments showed that QBC analysis may be as much as 100-fold more sensitive than thick smear. Spirochetes were also cultured from blood samples from both patients in modified Kelly's medium and were identified as B. crocidurae by partial sequencing of the PCR-amplified rrs gene.

In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

International Nuclear Information System (INIS)

Ananthaswamy, H.N.; Kripke, M.L.

1981-01-01

Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

Changes of heterogeneous cell populations in the Ishikawa cell line during long-term culture: Proposal for an in vitro clonal evolution model of tumor cells.

Science.gov (United States)

Kasai, Fumio; Hirayama, Noriko; Ozawa, Midori; Iemura, Masashi; Kohara, Arihiro

2016-06-01

Genomic changes in tumor cell lines can occur during culture, leading to differences between cell lines carrying the same name. In this study, genome profiles between low and high passages were investigated in the Ishikawa 3-H-12 cell line (JCRB1505). Cells contained between 43 and 46 chromosomes and the modal number changed from 46 to 45 during culture. Cytogenetic analysis revealed that a translocation t(9;14), observed in all metaphases, is a robust marker for this cell line. Single-nucleotide polymorphism microarrays showed a heterogeneous copy number in the early passages and distinct profiles at late passages. These results demonstrate that cell culture can lead to elimination of ancestral clones by sequential selection, resulting in extensive replacement with a novel clone. Our observations on Ishikawa cells in vitro are different from the in vivo heterogeneity in which ancestral clones are often retained during tumor evolution and suggest a model for in vitro clonal evolution. Copyright © 2016 Elsevier Inc. All rights reserved.

Morphological characterization of pre- and peri-implantation in vitro cultured, somatic cell nuclear transfer and in vivo derived ovine embryos

DEFF Research Database (Denmark)

Tveden-Nyborg, Pernille Yde; Peura, T.T.; Hartwich, K.M.

2005-01-01

The processes of cellular differentiation were studied in somatic cell nuvlear transfer (SCNT), in vitro cultured (IVC) and in vivo developed (in vivo) ovine embryos on days 7, 9, 11, 13, 17 and 19. SCNT embryos were constructed from in vitro matured oocytes and granulosa cells, and IVC embryos...... were produced by in vitro culture of in vivo fertilized zygotes. Most SCNT and IVC embryos were transferred to recipients on day 6 while some remained in culture for day 7 processing. In vivo embryos were collected as zygotes, transferred to intermediate recipients and retransferred to final recipients...

In vitro culture and characterization of human umbilical cord blood-derived plasmacytoid dendritic cell subsets

Directory of Open Access Journals (Sweden)

PENG Jianping

2015-11-01

Full Text Available ObjectiveTo establish a method for in vitro culture of plasmacytoid dendritic cell (pDC. MethodsUmbilical cord blood (40 ml was collected from healthy parturients in the First Affiliated Hospital of Hunan University of Chinese Medicine, and cord blood mononuclear cell (CBMC were isolated. The CBMC were cultured for 7 days with RPMI 1640 complete medium containing rh Flt3-ligand (Flt3-L (100 ng/ml and rh interleukin (IL-3 (10 ng/ml, and the medium was half changed every 2 days. On the eighth day, CpG ODN (2 μg/ml was added to the cells, and the attached cells and supernatant were collected 24 h later for flow cytometry and interferon (IFNα measurement, respectively. On days 1, 3, 5, 7, and 8 of cell culture, the morphological changes of pDC were observed. Results After 2 h of culture, the CBMC showed circular, flat morphology. Twenty-four hours later, the cells began to adhere to the wall, with extended cytoplasm and increased volumes, and they became round and translucent, with scattered small colonies. On days 3-4 of culture, the cell volume continued increasing; most cells were round, and some had small protrusions; few cells were spindle-, tadpole-, star- or irregularly shaped; the number and volumes of colonies increased substantially. On days 5-8 of culture, the number of colonies and the number of cells in colonies gradually decreased, and suspended cells that were round or had small protrusions gradually increased in the medium. The cells expressing CD123, BDCA-2, and BDCA-4, which were considered pDC, were detected by flow cytometry. Flow cytometry revealed that the proportion of pDC in CBMC increased during the culture: increasing from 1.08% at the beginning of culture to 5.32% on day 4, and finally reaching a peak of 19.8% on day 8. On day 8, the level of IFNα in pDC culture supernatant was(11 302.61±1745.31 pg/ml. ConclusionpDC can be successfully induced in vitro by rh Flt3-L combined with IL-3 from human umbilical CBMC.

Short-term spheroid culture of primary colorectal cancer cells as an in vitro model for personalizing cancer medicine

DEFF Research Database (Denmark)

Jeppesen, Maria; Hagel, Grith; Glenthoj, Anders

2017-01-01

Chemotherapy treatment of cancer remains a challenge due to the molecular and functional heterogeneity displayed by tumours originating from the same cell type. The pronounced heterogeneity makes it difficult for oncologists to devise an effective therapeutic strategy for the patient. One approac...... and combinations most commonly used for treatment of colorectal cancer. In summary, short-term spheroid culture of primary colorectal adenocarcinoma cells represents a promising in vitro model for use in personalized medicine....... for increasing treatment efficacy is to test the chemosensitivity of cancer cells obtained from the patient's tumour. 3D culture represents a promising method for modelling patient tumours in vitro. The aim of this study was therefore to evaluate how closely short-term spheroid cultures of primary colorectal...... cancer cells resemble the original tumour. Colorectal cancer cells were isolated from human tumour tissue and cultured as spheroids. Spheroid cultures were established with a high success rate and remained viable for at least 10 days. The spheroids exhibited significant growth over a period of 7 days...

3D cell culture to determine in vitro biocompatibility of bioactive glass in association with chitosan.

Science.gov (United States)

Bédouin, Y; Pellen Mussi, P; Tricot-Doleux, S; Chauvel-Lebret, D; Auroy, P; Ravalec, X; Oudadesse, H; Perez, F

2015-01-01

This study reports the in vitro biocompatibility of a composite biomaterial composed of 46S6 bioactive glass in association with chitosan (CH) by using 3D osteoblast culture of SaOS2. The 46S6 and CH composite (46S6-CH) forms small hydroxyapatite crystals on its surface after only three days immersion in the simulated body fluid. For 2D osteoblast culture, a significant increase in cell proliferation was observed after three days of contact with 46S6 or 46S6-CH-immersed media. After six days, 46S6-CH led to a significant increase in cell proliferation (128%) compared with pure 46S6 (113%) and pure CH (122%). For 3D osteoblast culture, after six days of culture, there was an increase in gene expression of markers of the early osteoblastic differentiation (RUNX2, ALP, COL1A1). Geometric structures corresponding to small apatite clusters were observed by SEM on the surface of the spheroids cultivated with 46S6 or 46S6-CH-immersed media. We showed different cellular responses depending on the 2D and 3D cell culture model. The induction of osteoblast differentiation in the 3D cell culture explained the differences of cell proliferation in contact with 46S6, CH or 46S6-CH-immersed media. This study confirmed that the 3D cell culture model is a very promising tool for in vitro biological evaluation of bone substitutes' properties.

Deciphering defective amelogenesis using in vitro culture systems.

Science.gov (United States)

Arinawati, Dian Yosi; Miyoshi, Keiko; Tanimura, Ayako; Horiguchi, Taigo; Hagita, Hiroko; Noma, Takafumi

2018-04-01

The conventional two-dimensional (2D) in vitro culture system is frequently used to analyze the gene expression with or without extracellular signals. However, the cells derived from primary culture and cell lines frequently deviate the gene expression profile compared to the corresponding in vivo samples, which sometimes misleads the actual gene regulation in vivo. To overcome this gap, we developed the comparative 2D and 3D in vitro culture systems and applied them to the genetic study of amelogenesis imperfecta (AI) as a model. Recently, we found specificity protein 6 (Sp6) mutation in an autosomal-recessive AI rat that was previously named AMI. We constructed 3D structure of ARE-B30 cells (AMI-derived rat dental epithelial cells) or G5 (control wild type cells) combined with RPC-C2A cells (rat pulp cell line) separated by the collagen membrane, while in 2D structure, ARE-B30 or G5 was cultured with or without the collagen membrane. Comparative analysis of amelogenesis-related gene expression in ARE-B30 and G5 using our 2D and 3D in vitro systems revealed distinct expression profiles, showing the causative outcomes. Bone morphogenetic protein 2 and follistatin were reciprocally expressed in G5, but not in ARE-B30 cells. All-or-none expression of amelotin, kallikrein-related peptidase 4, and nerve growth factor receptor was observed in both cell types. In conclusion, our in vitro culture systems detected the phenotypical differences in the expression of the stage-specific amelogenesis-related genes. Parallel analysis with 2D and 3D culture systems may provide a platform to understand the molecular basis for defective amelogenesis caused by Sp6 mutation. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Highly Efficient In Vitro Reparative Behaviour of Dental Pulp Stem Cells Cultured with Standardised Platelet Lysate Supplementation

Directory of Open Access Journals (Sweden)

Pasquale Marrazzo

2016-01-01

Full Text Available Dental pulp is an accessible source of multipotent mesenchymal stromal cells (MSCs. The perspective role of dental pulp stem cells (DPSCs in regenerative medicine demands an in vitro expansion and in vivo delivery which must deal with the safety issues about animal serum, usually required in cell culture practice. Human platelet lysate (PL contains autologous growth factors and has been considered as valuable alternative to fetal bovine serum (FBS in cell cultures. The optimum concentration to be added of such supplement is highly dependent on its preparation whose variability limits comparability of results. By in vitro experiments, we aimed to evaluate a standardised formulation of pooled PL. A low selected concentration of PL (1% was able to support the growth and maintain the viability of the DPSCs. The use of PL in cell cultures did not impair cell surface signature typically expressed by MSCs and even upregulated the transcription of Sox2. Interestingly, DPSCs cultured in presence of PL exhibited a higher healing rate after injury and are less susceptible to toxicity mediated by exogenous H2O2 than those cultured with FBS. Moreover, PL addition was shown as a suitable option for protocols promoting osteogenic and chondrogenic differentiation of DPSCs. Taken together, our results indicated that PL is a valid substitute of FBS to culture and differentiate DPSCs for clinical-grade use.

Highly Efficient In Vitro Reparative Behaviour of Dental Pulp Stem Cells Cultured with Standardised Platelet Lysate Supplementation.

Science.gov (United States)

Marrazzo, Pasquale; Paduano, Francesco; Palmieri, Francesca; Marrelli, Massimo; Tatullo, Marco

2016-01-01

Dental pulp is an accessible source of multipotent mesenchymal stromal cells (MSCs). The perspective role of dental pulp stem cells (DPSCs) in regenerative medicine demands an in vitro expansion and in vivo delivery which must deal with the safety issues about animal serum, usually required in cell culture practice. Human platelet lysate (PL) contains autologous growth factors and has been considered as valuable alternative to fetal bovine serum (FBS) in cell cultures. The optimum concentration to be added of such supplement is highly dependent on its preparation whose variability limits comparability of results. By in vitro experiments, we aimed to evaluate a standardised formulation of pooled PL. A low selected concentration of PL (1%) was able to support the growth and maintain the viability of the DPSCs. The use of PL in cell cultures did not impair cell surface signature typically expressed by MSCs and even upregulated the transcription of Sox2. Interestingly, DPSCs cultured in presence of PL exhibited a higher healing rate after injury and are less susceptible to toxicity mediated by exogenous H 2 O 2 than those cultured with FBS. Moreover, PL addition was shown as a suitable option for protocols promoting osteogenic and chondrogenic differentiation of DPSCs. Taken together, our results indicated that PL is a valid substitute of FBS to culture and differentiate DPSCs for clinical-grade use.

Triple co-culture cell model as an in vitro model for oral particulate vaccine systems

DEFF Research Database (Denmark)

Nielsen, Line Hagner; De Rossi, C.; Lehr, C-M.

; this was not observed with ovalbumin and blank solution. An example of the results is shown in Figure 2 for IL-17A. An established co-culture of Caco-2, THP-1 and MUTZ-3 cells showed promise as an in vitro model for testing of oral vaccine formulations. Mobility of co-culture immune cells as well as cytokine production......A triple co-culture cell model of Caco-2 cells, dendritic cells and macrophages (Figure 1) has previously been developed for studying intestinal permeability in a state of inflammation [1],[2]. The aim of this study was to investigate the applicability of this cell model for testing...... the model antigen ovalbumin was spray dried to obtain a particulate vaccine model system for testing in the cell model. The precursors were shown to form cubosomes when dispersed in aqueous medium, and was therefore used as the vaccine formulation for testing on the co-cultures. After 11 days, the TEER...

Functionalized Thick Film Impedance Sensors for Use in In Vitro Cell Culture.

Science.gov (United States)

Bartsch, Heike; Baca, Martin; Fernekorn, Uta; Müller, Jens; Schober, Andreas; Witte, Hartmut

2018-04-05

Multi-electrode arrays find application in electrophysiological recordings. The quality of the captured signals depends on the interfacial contact between electrogenic cells and the electronic system. Therefore, it requires reliable low-impedance electrodes. Low-temperature cofired ceramic technology offers a suitable platform for rapid prototyping of biological reactors and can provide both stable fluid supply and integrated bio-hardware interfaces for recordings in electrogenic cell cultures. The 3D assembly of thick film gold electrodes in in vitro bio-reactors has been demonstrated for neuronal recordings. However, especially when dimensions become small, their performance varies strongly. This work investigates the influence of different coatings on thick film gold electrodes with regard to their influence on impedance behavior. PSS layer, titanium oxynitride and laminin coatings are deposited on LTCC gold electrodes using different 2D and 3D MEA chip designs. Their impedance characteristics are compared and discussed. Titanium oxynitride layers emerged as suitable functionalization. Small 86-µm-electrodes have a serial resistance R s of 32 kOhm and serial capacitance C s of 4.1 pF at 1 kHz. Thick film gold electrodes with such coatings are thus qualified for signal recording in 3-dimensional in vitro cell cultures.

Functionalized Thick Film Impedance Sensors for Use in In Vitro Cell Culture

Directory of Open Access Journals (Sweden)

Heike Bartsch

2018-04-01

Full Text Available Multi-electrode arrays find application in electrophysiological recordings. The quality of the captured signals depends on the interfacial contact between electrogenic cells and the electronic system. Therefore, it requires reliable low-impedance electrodes. Low-temperature cofired ceramic technology offers a suitable platform for rapid prototyping of biological reactors and can provide both stable fluid supply and integrated bio-hardware interfaces for recordings in electrogenic cell cultures. The 3D assembly of thick film gold electrodes in in vitro bio-reactors has been demonstrated for neuronal recordings. However, especially when dimensions become small, their performance varies strongly. This work investigates the influence of different coatings on thick film gold electrodes with regard to their influence on impedance behavior. PEDOT:PSS layer, titanium oxynitride and laminin coatings are deposited on LTCC gold electrodes using different 2D and 3D MEA chip designs. Their impedance characteristics are compared and discussed. Titanium oxynitride layers emerged as suitable functionalization. Small 86-µm-electrodes have a serial resistance Rs of 32 kOhm and serial capacitance Cs of 4.1 pF at 1 kHz. Thick film gold electrodes with such coatings are thus qualified for signal recording in 3-dimensional in vitro cell cultures.

Functional properties of hepatocytes in vitro are correlated with cell polarity maintenance.

Science.gov (United States)

Zeigerer, Anja; Wuttke, Anne; Marsico, Giovanni; Seifert, Sarah; Kalaidzidis, Yannis; Zerial, Marino

2017-01-01

Exploring the cell biology of hepatocytes in vitro could be a powerful strategy to dissect the molecular mechanisms underlying the structure and function of the liver in vivo. However, this approach relies on appropriate in vitro cell culture systems that can recapitulate the cell biological and metabolic features of the hepatocytes in the liver whilst being accessible to experimental manipulations. Here, we adapted protocols for high-resolution fluorescence microscopy and quantitative image analysis to compare two primary hepatocyte culture systems, monolayer and collagen sandwich, with respect to the distribution of two distinct populations of early endosomes (APPL1 and EEA1-positive), endocytic capacity, metabolic and signaling activities. In addition to the re-acquisition of hepatocellular polarity, primary hepatocytes grown in collagen sandwich but not in monolayer culture recapitulated the apico-basal distribution of EEA1 endosomes observed in liver tissue. We found that such distribution correlated with the organization of the actin cytoskeleton in vitro and, surprisingly, was dependent on the nutritional state in vivo. Hepatocytes in collagen sandwich also exhibited faster kinetics of low-density lipoprotein (LDL) and epidermal growth factor (EGF) internalization, showed improved insulin sensitivity and preserved their ability for glucose production, compared to hepatocytes in monolayer cultures. Although no in vitro culture system can reproduce the exquisite structural features of liver tissue, our data nevertheless highlight the ability of the collagen sandwich system to recapitulate key structural and functional properties of the hepatocytes in the liver and, therefore, support the usage of this system to study aspects of hepatocellular biology in vitro. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Restored in vivo-like membrane lipidomics positively influence in vitro features of cultured mesenchymal stromal/stem cells derived from human placenta.

Science.gov (United States)

Chatgilialoglu, Alexandros; Rossi, Martina; Alviano, Francesco; Poggi, Paola; Zannini, Chiara; Marchionni, Cosetta; Ricci, Francesca; Tazzari, Pier Luigi; Taglioli, Valentina; Calder, Philip C; Bonsi, Laura

2017-02-07

The study of lipid metabolism in stem cell physiology has recently raised great interest. The role of lipids goes beyond the mere structural involvement in assembling extra- and intra-cellular compartments. Nevertheless, we are still far from understanding the impact of membrane lipidomics in stemness maintenance and differentiation patterns. In the last years, it has been reported how in vitro cell culturing can modify membrane lipidomics. The aim of the present work was to study the membrane fatty acid profile of mesenchymal stromal cells (MSCs) derived from human fetal membranes (hFM-MSCs) and to correlate this to specific biological properties by using chemically defined tailored lipid supplements (Refeed®). Freshly isolated hFM-MSCs were characterized for their membrane fatty acid composition. hFM-MSCs were cultivated in vitro following a classical protocol and their membrane fatty acid profile at different passages was compared to the profile in vivo. A tailored Refeed® lipid supplement was developed with the aim of reducing the differences created by the in vitro cultivation and was tested on cultured hFM-MSCs. Cell morphology, viability, proliferation, angiogenic differentiation, and immunomodulatory properties after in vitro exposure to the tailored Refeed® lipid supplement were investigated. A significant modification of hFM-MSC membrane fatty acid composition occurred during in vitro culture. Using a tailored lipid supplement, the fatty acid composition of cultured cells remained more similar to their in vivo counterparts, being characterized by a higher polyunsaturated and omega-6 fatty acid content. These changes in membrane composition had no effect on cell morphology and viability, but were linked with increased cell proliferation rate, angiogenic differentiation, and immunomodulatory properties. In particular, Refeed®-supplemented hFM-MSCs showed greater ability to express fully functional cell membrane molecules. Culturing hFM-MSCs alters their

The in vitro viability and growth of fibroblasts cultured in the presence of different bone grafting materials (NanoBone and Straumann Bone Ceramic).

Science.gov (United States)

Kauschke, E; Rumpel, E; Fanghänel, J; Bayerlein, T; Gedrange, T; Proff, P

2006-02-01

Different clinical applications, including dentistry, are making increasing demands on bone grafting material. In the present study we have analysed the viability, proliferation and growth characteristics of fibroblasts cultured in vitro together with two different bone grafting materials, NanoBone and Straumann Bone Ceramic, over a period of 24 and 28 days respectively. Viability was measured at least every 72 hours by using the alamarBlue assay, a test that measures quantitatively cell proliferation and viability but does not require cell fixation or extraction. After one week of culture fibroblast viability was as high as in controls for both grafting materials and remained high (> 90%) for the duration of the experiment. Cell growth was evaluated microscopically. Scanning electron microscopy revealed a dense fibroblast growth at the surface of both bone grafting materials after three weeks of in vitro culture. Generally, our in vitro analyses contribute to further insights into cell - scaffold interactions.

Effect of Zebularine loaded MePEG-PCL nanoparticles on viability, attachment of in vitro cultured lens epithelial cells

Directory of Open Access Journals (Sweden)

Si-Wei Liu

2015-01-01

Full Text Available AIM: To investigate the effect of zebularine(Zebloaded Poly(ethylene glycol-block-poly(ε-caprolactonemethyl ether(MePEG-PCLnanoparticles(NPson the viability, attachment, and apoptosis of in vitro cultured lens epithelial cells(LECs. METHODS: In vitro cultured infant human lens tissue HLE B-3 immortalized cells were distributed randomly divided into six groups. Each group was administered with free Zeb 50μmol/L(ZebF1 group, 100μmol/L(ZebF2 group, Zeb -loaded MePEG-PCL NPs 50μmol/L(ZebNP1 group, Zeb -loaded MePEG-PCL NPs 100μmol/L(ZebNP2 group, MePEG-PCL empty NPs(NPs groupor blank medium(group Crespectively. A tetrazolium dye assay(MTTtest and modified MTT test were performed to determine cell viability and cell attachment. DNA ladder was used to detect the cell apoptosis. RESULTS: Determined by MTT colorimetric method: Cell proliferation rate of LECs were suppressed by all Zeb administration groups in a concentration-time dependent manner(PPP ZebNP1>ZebF2(PCONCLUSION: Zeb loaded MePEG-PCL NPs had better effect on suppressing the viability and attachment of in vitro cultured LECs than the free Zeb groups, as well as enhancing the apoptosis.

Human breast cancer histoid: an in vitro 3-dimensional co-culture model that mimics breast cancer tissue.

Science.gov (United States)

Kaur, Pavinder; Ward, Brenda; Saha, Baisakhi; Young, Lillian; Groshen, Susan; Techy, Geza; Lu, Yani; Atkinson, Roscoe; Taylor, Clive R; Ingram, Marylou; Imam, S Ashraf

2011-12-01

Progress in our understanding of heterotypic cellular interaction in the tumor microenvironment, which is recognized to play major roles in cancer progression, has been hampered due to unavailability of an appropriate in vitro co-culture model. The aim of this study was to generate an in vitro 3-dimensional human breast cancer model, which consists of cancer cells and fibroblasts. Breast cancer cells (UACC-893) and fibroblasts at various densities were co-cultured in a rotating suspension culture system to establish co-culture parameters. Subsequently, UACC-893, BT.20, or MDA.MB.453 were co-cultured with fibroblasts for 9 days. Co-cultures resulted in the generation of breast cancer histoid (BCH) with cancer cells showing the invasion of fibroblast spheroids, which were visualized by immunohistochemical (IHC) staining of sections (4 µm thick) of BCH. A reproducible quantitative expression of C-erbB.2 was detected in UACC-893 cancer cells in BCH sections by IHC staining and the Automated Cellular Imaging System. BCH sections also consistently exhibited qualitative expression of pancytokeratins, p53, Ki-67, or E-cadherin in cancer cells and that of vimentin or GSTPi in fibroblasts, fibronectin in the basement membrane and collagen IV in the extracellular matrix. The expression of the protein analytes and cellular architecture of BCH were markedly similar to those of breast cancer tissue.

Effects of different feeder layers on culture of bovine embryonic stem cell-like cells in vitro.

Science.gov (United States)

Cong, Shan; Cao, Guifang; Liu, Dongjun

2014-12-01

To find a suitable feeder layer is important for successful culture conditions of bovine embryonic stem cell-like cells. In this study, expression of pluripotency-related genes OCT4, SOX2 and NANOG in bovine embryonic stem cell-like cells on mouse embryonic fibroblast feeder layers at 1-5 passages were monitored in order to identify the possible reason that bovine embryonic stem cell-like cells could not continue growth and passage. Here, we developed two novel feeder layers, mixed embryonic fibroblast feeder layers of mouse and bovine embryonic fibroblast at different ratios and sources including mouse fibroblast cell lines. The bovine embryonic stem cell-like cells generated in our study displayed typical stem cell morphology and expressed specific markers such as OCT4, stage-specific embryonic antigen 1 and 4, alkaline phosphatase, SOX2, and NANOG mRNA levels. When feeder layers and cell growth factors were removed, the bovine embryonic stem cell-like cells formed embryoid bodies in a suspension culture. Furthermore, we compared the expression of the pluripotent markers during bovine embryonic stem cell-like cell in culture on mixed embryonic fibroblast feeder layers, including mouse fibroblast cell lines feeder layers and mouse embryonic fibroblast feeder layers by real-time quantitative polymerase chain reaction. Results suggested that mixed embryonic fibroblast and sources including mouse fibroblast cell lines feeder layers were more suitable for long-term culture and growth of bovine embryonic stem cell-like cells than mouse embryonic fibroblast feeder layers. The findings may provide useful experimental data for the establishment of an appropriate culture system for bovine embryonic stem cell lines.

In-vitro analysis of early calcification in aortic valvular interstitial cells using Laser-Induced Breakdown Spectroscopy (LIBS).

Science.gov (United States)

Davari, Seyyed Ali; Masjedi, Shirin; Ferdous, Zannatul; Mukherjee, Dibyendu

2018-01-01

Calcific aortic valve disease (CAVD) is a major cardiovascular disorder caused by osteogenic differentiation of valvular interstitial cells (VICs) within aortic valves. Conventional methods like colorimetric assays and histology fail to detect small calcium depositions during in-vitro VIC cultures. Laser-induced breakdown spectroscopy (LIBS) is a robust analytical tool used for inorganic materials characterizations, but relatively new to biomedical applications. We employ LIBS, for the first time, for quantitative in-vitro detection of calcium depositions in VICs at various osteogenic differentiation stages. VICs isolated from porcine aortic valves were cultured in osteogenic media over various days. Colorimetric calcium assays based on arsenazo dye and Von Kossa staining measured the calcium depositions within VICs. Simultaneously, LIBS signatures for Ca I (422.67 nm) atomic emission lines were collected for estimating calcium depositions in lyophilized VIC samples. Our results indicate excellent linear correlation between the calcium assay and our LIBS measurements. Furthermore, unlike the assay results, the LIBS results could resolve calcium signals from cell samples with as early as 2 days of osteogenic culture. Quantitatively, the LIBS measurements establish the limit of detection for calcium content in VICs to be ∼0.17±0.04 μg which indicates a 5-fold improvement over calcium assay. Picture: Quantitative LIBS enables in-vitro analysis for early stage detection of calcium deposition within aortic valvular interstitial cells (VICs). © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Follicle stimulating hormone increases spermatogonial stem cell colonization during in vitro co - culture

Directory of Open Access Journals (Sweden)

Reza Narenji Sani

2013-03-01

Full Text Available The complex process of spermatogenesis is regulated by various factors. Studies onspermatogonial stem cells(SCCshave provided very important tool to improve herd geneticand different field. 0.2 to 0.3 percent of total cells of seminiferous tubules is consist ofspermatogonial stem cells. To investigate and biomanipulation of these cells, proliferationand viability rate of cells should be increasedin vitro, at first. Follicle stimulating hormone(FSH has been suggested to play a determinant role in the survival of germ cells in additionto increasing spermatogonial proliferation. In this study, thein vitroeffects ofFSHonspermatogonial cell colony formation were investigated. Sertoli and spermatogonial cellswere isolated from 3-5 months old calves. The identity of theSertoli cells and spermatogonialstem cells were confirmed through immunocytochemistry and colony morphology,respectively. Co-cultured Sertoli and spermatogonial cells were treatedwithFSHin differentdose of10, 20 and 40 IU mL-1FSH, before colony assay.Results indicated that,FSHincreasedin vitrocolonization of spermatogonial cells in comparison with control group. In conclusion,usingFSHprovided proper bovine spermatogonial stem cell culture medium forin vitrostudy of these cells.

Uniform, stable supply of medium for in vitro cell culture using a robust chamber

Science.gov (United States)

Wei, Juan; Liu, Chong; Jiang, Yang; Liu, Tao; Chen, Li; Liu, Bo; Li, Jingmin

2018-06-01

A uniform, stable supply of medium is important for in vitro cell culture. In this paper, a microfluidic device is presented for culturing cells inside a robust chamber with continuous perfusion of medium. The device consists of a main channel, two bifurcated channels and a culture chamber. The culture chamber connects to the bifurcated channels via multiple paths, and distributes symmetrically on the main channel, to improve the efficiency of medium exchange. Furthermore, regular polygonal chambers with various numbers of edges have been designed, to study the effects of chamber shape on flow fields. The finite element method has been employed to predict the effects of multiple paths on the uniformity and stability of flow fields in the culture chamber. Particle tracking technology has been used to evaluate the flow fields in the chambers, and PC-12 cells have been cultured using the microfluidic device, to test its validity. The results of simulation and experiment indicate that the microfluidic design could provide a continuous interstitial-like flow microenvironment, with a relatively stable and uniform supply of medium.

Stimulation of the proliferation of hemopoietic stem cells in irradiated bone marrow cell culture

International Nuclear Information System (INIS)

Mori, K.J.; Izumi, H.; Seto, A.

1981-01-01

Long-term hemopoiesis was established in bone marrow cell culture in vitro. This culture was shown to support the recovery proliferation of hemopoietic stem cells completely in vitro after irradiation. Hemopoietic stem cells were stimulated into proliferation in culture when normal bone marrow cells were overlayed on top of the irradiated adherent cell colonies. These results indicate that proliferation and differentiation of hemopoietic stem cells in vitro are also supported by stromahemopoietic cell interactions

Spatial organization of mesenchymal stem cells in vitro--results from a new individual cell-based model with podia.

Directory of Open Access Journals (Sweden)

Martin Hoffmann

Full Text Available Therapeutic application of mesenchymal stem cells (MSC requires their extensive in vitro expansion. MSC in culture typically grow to confluence within a few weeks. They show spindle-shaped fibroblastoid morphology and align to each other in characteristic spatial patterns at high cell density. We present an individual cell-based model (IBM that is able to quantitatively describe the spatio-temporal organization of MSC in culture. Our model substantially improves on previous models by explicitly representing cell podia and their dynamics. It employs podia-generated forces for cell movement and adjusts cell behavior in response to cell density. At the same time, it is simple enough to simulate thousands of cells with reasonable computational effort. Experimental sheep MSC cultures were monitored under standard conditions. Automated image analysis was used to determine the location and orientation of individual cells. Our simulations quantitatively reproduced the observed growth dynamics and cell-cell alignment assuming cell density-dependent proliferation, migration, and morphology. In addition to cell growth on plain substrates our model captured cell alignment on micro-structured surfaces. We propose a specific surface micro-structure that according to our simulations can substantially enlarge cell culture harvest. The 'tool box' of cell migratory behavior newly introduced in this study significantly enhances the bandwidth of IBM. Our approach is capable of accommodating individual cell behavior and collective cell dynamics of a variety of cell types and tissues in computational systems biology.

Screening and selection of high carotenoid producing in vitro tomato cell culture lines for [13C]-carotenoid production.

Science.gov (United States)

Engelmann, Nancy J; Campbell, Jessica K; Rogers, Randy B; Rupassara, S Indumathie; Garlick, Peter J; Lila, Mary Ann; Erdman, John W

2010-09-22

Isotopically labeled tomato carotenoids, phytoene, phytofluene, and lycopene, are needed for mammalian bioavailability and metabolism research but are currently commercially unavailable. The goals of this work were to establish and screen multiple in vitro tomato cell lines for carotenoid production, test the best producers with or without the bleaching herbicides, norflurazon and 2-(4-chlorophenyl-thio)triethylamine (CPTA), and to use the greatest carotenoid accumulator for in vitro 13C-labeling. Different Solanum lycopersicum allelic variants for high lycopene and varying herbicide treatments were compared for carotenoid accumulation in callus and suspension culture, and cell suspension cultures of the hp-1 line were chosen for isotopic labeling. When grown with [U]-13C-glucose and treated with CPTA, hp-1 suspensions yielded highly enriched 13C-lycopene with 45% of lycopene in the M+40 form and 88% in the M+35 to M+40 isotopomer range. To the authors' knowledge this is the first report of highly enriched 13C-carotenoid production from in vitro plant cell culture.

Culture of Dendritic Cells in vitro and Its Anti-tumor Immonotherapy

Directory of Open Access Journals (Sweden)

Yanwen ZHOU

2010-05-01

Full Text Available Background and objective Immunocompromised patients with malignant tumor always lack of strong anti-tumor immune response, because the antigenicity of tumor cells is weak, and antigen-presenting cell function is low, so that can not be effectively presenting tumor antigens to the lymphocytes. Therefore, how to effectively induce anti-tumor immune response is the key issue. Through the study on establishing a method to culture dendritic cells (DC in vitro and to observe the anti-lung cancer immunological effect induced by DC, we provided definite experiment basis for the clinic application of vaccine based on DC. Methods Through the experiment we get the soluble antigen polypeptide from lung cancer cells GLC-82 by 3 mol/L potassium chloride. DCs are cultured and obtained from peripheral blood mononuclear cell by GM-CSF, IL-4 and TNF-a. DCs are identified by flow cytometer (FCM and immunostaining. DCs modified by lung cancer tumor soluble antigen (TSA and staphylococcal enterotox in A (SEA, DCs modified by TSA or DCs modified by SEA or DCs modified by nothing were cultivated together with T lymphocyte, and the obtained cells are named TSA-SEA-DCL or TSA-DCL or SEA-DCL or DCL as effector cells. The anti-tumor activity of every effector cells against target cells was assayed with MTT method. Shape of DCs and effector cells, and the process of killing target cells were observed in microscope. Results Induced DCs expressed more CD1a, CD80 and HLA-DR, which had typical cell traits such as tree branch. The killing ratio of the TSA-SEA-DCL in vitro to GLC-82 is larger than TSA-DCL, SEA-DCL and DCL, also larger than to K562. When the effector cells cultivate with target cells, we can observe the CTL approach and gather to the cancer cell, induce it necrosis and apoptosis. Conclusion Ripe DCs that have typical characteristic and phenotype could be induced successfully. High potency and relatively specific antilung caner effect can be prepared in virtue of

AlgiMatrix™-Based 3D Cell Culture System as an In Vitro Tumor Model: An Important Tool in Cancer Research.

Science.gov (United States)

Godugu, Chandraiah; Singh, Mandip

2016-01-01

Routinely used two-dimensional cell culture-based models often fail while translating the observations into in vivo models. This setback is more common in cancer research, due to several reasons. The extracellular matrix and cell-to-cell interactions are not present in two-dimensional (2D) cell culture models. Diffusion of drug molecules into cancer cells is hindered by barriers of extracellular components in in vivo conditions, these barriers are absent in 2D cell culture models. To better mimic or simulate the in vivo conditions present in tumors, the current study used the alginate based three-dimensional cell culture (AlgiMatrix™) model, which resembles close to the in vivo tumor models. The current study explains the detailed protocols involved in AlgiMatrix™ based in vitro non-small-cell lung cancer (NSCLC) models. The suitability of this model was studied by evaluating, cytotoxicity, apoptosis, and penetration of nanoparticles into the in vitro tumor spheroids. This study also demonstrated the effect of EphA2 receptor targeted docetaxel-loaded nanoparticles on MDA-MB-468 TNBC cell lines. The methods section is subdivided into three subsections such as (1) preparation of AlgiMatrix™-based 3D in vitro tumor models and cytotoxicity assays, (2) free drug and nanoparticle uptake into spheroid studies, and (3) western blot, IHC, and RT-PCR studies.

Exposing primary rat retina cell cultures to γ-rays: An in vitro model for evaluating radiation responses.

Science.gov (United States)

Gaddini, Lucia; Balduzzi, Maria; Campa, Alessandro; Esposito, Giuseppe; Malchiodi-Albedi, Fiorella; Patrono, Clarice; Matteucci, Andrea

2018-01-01

Retinal tissue can receive incidental γ-rays exposure during radiotherapy either of tumors of the eye and optic nerve or of head-and-neck tumors, and during medical diagnostic procedures. Healthy retina is therefore at risk of suffering radiation-related side effects and the knowledge of pathophysiological response of retinal cells to ionizing radiations could be useful to design possible strategies of prevention and management of radiotoxicity. In this study, we have exploited an in vitro model (primary rat retinal cell culture) to study an array of biological effects induced on retinal neurons by γ-rays. Most of the different cell types present in retinal tissue - either of the neuronal or glial lineages - are preserved in primary rat retinal cultures. Similar to the retina in situ, neuronal cells undergo in vitro a maturational development shown by the formation of polarized neuritic trees and operating synapses. Since 2 Gy is the incidental dose received by the healthy retina per fraction when the standard treatment is delivered to the brain, retina cell cultures have been exposed to 1 or 2 Gy of γ-rays at different level of neuronal differentiation in vitro: days in vitro (DIV)2 or DIV8. At DIV9, retinal cultures were analyzed in terms of viability, apoptosis and characterized by immunocytochemistry to identify alterations in neuronal differentiation. After irradiation at DIV2, MTT assay revealed an evident loss of cell viability and βIII-tubulin immunostaining highlighted a marked neuritic damage, indicating that survived neurons showed an impaired differentiation. Differentiated cultures (DIV8) appeared to be more resistant with respect to undifferentiated, DIV2 cultures, both in terms of cell viability and differentiation. Apoptosis evaluated with TUNEL assay showed that irradiation at both DIV2 and DIV8 induced a significant increase in the apoptotic rate. To further investigate the effects of γ-rays on retinal neurons, we evaluated the

Post-thaw non-cultured and post-thaw cultured equine cord blood mesenchymal stromal cells equally suppress lymphocyte proliferation in vitro.

Directory of Open Access Journals (Sweden)

Lynn B Williams

Full Text Available Multipotent mesenchymal stromal cells (MSC are receiving increased attention for their non-progenitor immunomodulatory potential. Cryopreservation is commonly used for long-term storage of MSC. Post-thaw MSC proliferation is associated with a lag-phase in vitro. How this lag-phase affect MSC immunomodulatory properties is unknown. We hypothesized that in vitro there is no difference in lymphocyte suppression potential between quick-thawed cryopreserved equine cord blood (CB MSC immediately included in mixed lymphocyte reaction (MLR and same MSC allowed post-thaw culture time prior to inclusion in MLR. Cryopreserved CB-MSC from five unrelated foals were compared using two-way MLR. For each of the five unrelated MSC cultures, paired MLR assays of MSC allowed five days of post-thaw culture and MSC included in MLR assay immediately post-thawing were evaluated. We report no difference in the suppression of lymphocyte proliferation by CB-MSC that had undergone post-thaw culture and MSC not cultured post-thaw (p<0.0001. Also, there was no inter-donor variability between the lymphocyte suppressive properties of MSC harvested from the five different donors (p = 0.13. These findings suggest that cryopreserved CB-MSC may have clinical utility immediately upon thawing. One implication hereof is the possibility of using cryopreserved CB-MSC at third party locations without the need for cell culture equipment or competencies.

Early bovine embryos regulate oviduct epithelial cell gene expression during in vitro co-culture.

Science.gov (United States)

Schmaltz-Panneau, Barbara; Cordova, Amanda; Dhorne-Pollet, Sophie; Hennequet-Antier, Christelle; Uzbekova, Sveltlana; Martinot, Emmanuelle; Doret, Sarah; Martin, Patrice; Mermillod, Pascal; Locatelli, Yann

2014-10-01

In mammals, the oviduct may participate to the regulation of early embryo development. In vitro co-culture of early bovine embryos with bovine oviduct epithelial cells (BOEC) has been largely used to mimic the maternal environment. However, the mechanisms of BOEC action have not been clearly elucidated yet. The aim of this study was to determine the response of BOEC cultures to the presence of developing bovine embryos. A 21,581-element bovine oligonucleotide array was used compare the gene expression profiles of confluent BOEC cultured for 8 days with or without embryos. This study revealed 34 differentially expressed genes (DEG). Of these 34 genes, IFI6, ISG15, MX1, IFI27, IFI44, RSAD2, IFITM1, EPSTI1, USP18, IFIT5, and STAT1 expression increased to the greatest extent due to the presence of embryos with a major impact on antiviral and immune response. Among the mRNAs at least 25 are already described as induced by interferons. In addition, transcript levels of new candidate genes involved in the regulation of transcription, modulation of the maternal immune system and endometrial remodeling were found to be increased. We selected 7 genes and confirmed their differential expression by quantitative RT-PCR. The immunofluorescence imaging of cellular localization of STAT1 protein in BOEC showed a nuclear translocation in the presence of embryos, suggesting the activation of interferon signaling pathway. This first systematic study of BOEC transcriptome changes in response to the presence of embryos in cattle provides some evidences that these cells are able to adapt their transcriptomic profile in response to embryo signaling. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of patient related factors on number of mesenchymal stromal cells reached after in vitro culture expansion for clinical treatment

DEFF Research Database (Denmark)

Qayyum, Abbas Ali; Kaur, Kamal Preet; Mathiasen, Anders Bruun

2017-01-01

of autologous stromal cells reached after in vitro culture expansion for clinical therapy. METHODS: Culture expansion data from 111 patients with IHD treated with autologous stromal cells in three clinical trials were used. We correlated the final cell count after two passages of cultivation with different...... correlation between left ventricular ejection fraction and number of MSCs was found (r = -0.287, p = .017). CONCLUSIONS: Patient related factors such as BMI, hypertension and gender may influence the number of MSCs reached after in vitro culture expansion....... patient factors. RESULTS: There was a significant relation between body mass index (BMI) and the number of adipose derived stromal cells (ASCs) reached after culture expansion and for all patients included into the three studies (r = 0.375, p = .019 and r = 0.200, p = .036, respectively). Moreover...

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

Science.gov (United States)

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

Patterns of proliferation and differentiation of irradiated haemopoietic stem cells cultured on normal 'stromal' cell colonies in vitro

International Nuclear Information System (INIS)

Mori, K.J.

1981-01-01

Experiments were designed to elucidate whether or not the irradiated bone marrow cells receive any stimulation for the self-replication and differentiation from normal 'stromal' cell colonies in the bone marrow cell culture in vitro. When irradiated or unirradiated bone marrow cells were overlaid on the normal adherent cell colonies, the proliferation of haemopoietic stem cells was supported, the degree of the stimulation depending on the starting cellular concentration. There was, however, no significant changes in the concentration of either CFUs or CFUc regardless of the dose of irradiation on the bone marrow cells overlaid. This was a great contrast to the dose-dependent decrease of CFUs or CFUc within the culture in which both the stem cells and stromal cells were simultaneously irradiated. These results suggest that the balance of self-replication and differentiation of the haemopoietic stem cells is affected only when haemopoietic microenvironment is perturbed. (author)

Optimization of human corneal endothelial cell culture: density dependency of successful cultures in vitro.

Science.gov (United States)

Peh, Gary S L; Toh, Kah-Peng; Ang, Heng-Pei; Seah, Xin-Yi; George, Benjamin L; Mehta, Jodhbir S

2013-05-03

Global shortage of donor corneas greatly restricts the numbers of corneal transplantations performed yearly. Limited ex vivo expansion of primary human corneal endothelial cells is possible, and a considerable clinical interest exists for development of tissue-engineered constructs using cultivated corneal endothelial cells. The objective of this study was to investigate the density-dependent growth of human corneal endothelial cells isolated from paired donor corneas and to elucidate an optimal seeding density for their extended expansion in vitro whilst maintaining their unique cellular morphology. Established primary human corneal endothelial cells were propagated to the second passage (P2) before they were utilized for this study. Confluent P2 cells were dissociated and seeded at four seeding densities: 2,500 cells per cm2 ('LOW'); 5,000 cells per cm2 ('MID'); 10,000 cells per cm2 ('HIGH'); and 20,000 cells per cm2 ('HIGH(×2)'), and subsequently analyzed for their propensity to proliferate. They were also subjected to morphometric analyses comparing cell sizes, coefficient of variance, as well as cell circularity when each culture became confluent. At the two lower densities, proliferation rates were higher than cells seeded at higher densities, though not statistically significant. However, corneal endothelial cells seeded at lower densities were significantly larger in size, heterogeneous in shape and less circular (fibroblastic-like), and remained hypertrophic after one month in culture. Comparatively, cells seeded at higher densities were significantly homogeneous, compact and circular at confluence. Potentially, at an optimal seeding density of 10,000 cells per cm2, it is possible to obtain between 10 million to 25 million cells at the third passage. More importantly, these expanded human corneal endothelial cells retained their unique cellular morphology. Our results demonstrated a density dependency in the culture of primary human corneal endothelial

Primary culture of glial cells from mouse sympathetic cervical ganglion: a valuable tool for studying glial cell biology.

Science.gov (United States)

de Almeida-Leite, Camila Megale; Arantes, Rosa Maria Esteves

2010-12-15

Central nervous system glial cells as astrocytes and microglia have been investigated in vitro and many intracellular pathways have been clarified upon various stimuli. Peripheral glial cells, however, are not as deeply investigated in vitro despite its importance role in inflammatory and neurodegenerative diseases. Based on our previous experience of culturing neuronal cells, our objective was to standardize and morphologically characterize a primary culture of mouse superior cervical ganglion glial cells in order to obtain a useful tool to study peripheral glial cell biology. Superior cervical ganglia from neonatal C57BL6 mice were enzymatically and mechanically dissociated and cells were plated on diluted Matrigel coated wells in a final concentration of 10,000cells/well. Five to 8 days post plating, glial cell cultures were fixed for morphological and immunocytochemical characterization. Glial cells showed a flat and irregular shape, two or three long cytoplasm processes, and round, oval or long shaped nuclei, with regular outline. Cell proliferation and mitosis were detected both qualitative and quantitatively. Glial cells were able to maintain their phenotype in our culture model including immunoreactivity against glial cell marker GFAP. This is the first description of immunocytochemical characterization of mouse sympathetic cervical ganglion glial cells in primary culture. This work discusses the uses and limitations of our model as a tool to study many aspects of peripheral glial cell biology. Copyright © 2010 Elsevier B.V. All rights reserved.

The role of changes in the oxygen concentration in modification of reproductive death of cells in vitro

International Nuclear Information System (INIS)

Korystov, Yu.N.

1983-01-01

In this report the data are discussed and summarized concerning cell oxygenation in culture. Formulae are proposed for calculation of the oxygen concentration in suspension, monolayer and spheroid, as well as numerical parameters are submitted determining the oxygenation of cells in vitro. This permits to estimate quantitatively the oxygen concentration at the cell surface upon irradiation in different experimental conditions

Quantitation of DNA repair in brain cell cultures: implications for autoradiographic analysis of mixed cell populations

International Nuclear Information System (INIS)

Dambergs, R.; Kidson, C.

1979-01-01

Quantitation of DNA repair in the mixed cell population of mouse embryo brain cultures has been assessed by autoradiographic analysis of unscheduled DNA synthesis following UV-irradiation. The proportion of labelled neurons and the grain density over neuronal nuclei were both less than the corresponding values for glial cells. The nuclear geometries of these two classes of cell are very different. Partial correction for the different geometries by relating grain density to nuclear area brought estimates of neuronal and glial DNA repair synthesis more closely in line. These findings have general implications for autoradiographic measurement of DNA repair in mixed cell populations and in differentiated versus dividing cells. (author)

mRNA Fragments in In-Vitro Culture Media are Associated with Bovine Preimplantation Embryonic Development

Directory of Open Access Journals (Sweden)

Jenna eKropp

2015-08-01

Full Text Available In vitro production (IVP systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerated conditioned media. Differential expression was confirmed by quantitative real-time PCR for

Quantitation of specific myeloid cells in rat bone marrow measured by in vitro /sup 35/S-sulphate incorporation

Energy Technology Data Exchange (ETDEWEB)

Wright, A F; Rose, M S

1984-08-01

A biochemical measurement which can be used for quantitation of specific early myeloid cells in rat bone marrow has been developed. This measurement consists of a rapid, simple assay for the in vitro quantitation of /sup 35/S-sulfate incorporation into rat bone marrow cells. Incubation of bone marrow cells with /sup 35/S-sulfate led to a time-dependent increase in radioactivity obtained in perchloric acid insoluble fractions of bone marrow cell suspensions. This incorporation was inhibited by cyanide and puromycin. Autoradiography has demonstrated the radiolabel to be specifically associated with immature cells of the myeloid series. The cells most active in this respect were eosinophils. When rats were treated with endotoxin, the rate of /sup 35/S-sulfate incorporation was increased. Cell number measurements, using conventional histopathology and a Coulter Counter, demonstrated that endotoxin caused an initial release of mature granulocytes from the bone marrow. The regeneration of this mature population in the marrow was rapid, and was characterized by an increase in the number of immature cells and a concomitant increase in the rate of /sup 35/S-sulfate incorporation measured in preparations of bone marrow cells in vitro. Furthermore, this response to endotoxin has demonstrated that Coulter Counting techniques can be used to distinguish specific populations of cells (e.g. mature granulocytes) within the bone marrow.

Tumor infiltrating lymphocytes in melanoma comprise high numbers of T-cell clonotypes that are lost during in vitro culture

DEFF Research Database (Denmark)

thor Straten, P; Kirkin, A F; Siim, E

2000-01-01

-associated peptide epitopes. Cultured TIL have been studied in order to unveil characteristics of TIL and the interactions of TIL and melanoma cells. Whether in vitro cultured TIL mirrors the in situ situation has, however, been questioned. In the present study we have taken advantage of T-cell receptor clonotype...

BK virus has tropism for human salivary gland cells in vitro: Implications for transmission

International Nuclear Information System (INIS)

Jeffers, Liesl K.; Madden, Vicki; Webster-Cyriaque, Jennifer

2009-01-01

Background: In this study, it was determined that BKV is shed in saliva and an in vitro model system was developed whereby BKV can productively infect both submandibular (HSG) and parotid (HSY) salivary gland cell lines. Results: BKV was detected in oral fluids using quantitative real-time PCR (QRTPCR). BKV infection was determined using quantitative RT-PCR, immunofluorescence and immunoblotting assays. The infectivity of BKV was inhibited by pre-incubation of the virus with gangliosides that saturated the major capsid protein, VP1, halting receptor mediated BKV entry into salivary gland cells. Examination of infected cultures by transmission electron microscopy revealed 45-50 nm BK virions clearly visible within the cells. Subsequent to infection, encapsidated BK virus was detected in the supernatant. Conclusion: We thus demonstrated that BKV was detected in oral fluids and that BK infection and replication occur in vitro in salivary gland cells. These data collectively suggest the potential for BKV oral route of transmission and oral pathogenesis.

Characterization of a plasminogen activator from human melanoma cells cultured in vitro

International Nuclear Information System (INIS)

Heussen, C.

1982-08-01

This thesis describes the work that have been done on the isolation and characterization of a plasminogen activator, Mel-PA, that is released by human melanoma cells cultured in vitro. This enzyme was compared to the urinary plasminogen activator, urokinase. The human melanoma cell line released large amounts of Mel-PA into the surrounding medium when cultured under serum-free conditions. These cells released only one type of plasminogen activator. A technique was developed in which plasminogen activators were seperated electrophoretically and detected in polyacrylamide gel slabs. Mel-PA was concentrated and partially purified by affinity chromatography on benzamidine-sepharose. A study of the distribution of plasminogen activators in tissues and body fluids showed that all mammals examined had two immunochemically distinct plasminogen activators that corresponded, in their distribution, to the urokinase-like and Mel-PA like enzymes of man. A comparitive study of the kinetic behaviour of Mel-PA and urokinase showed numerous differences between the catalytic activities of these two enzymes

Proliferating fibroblasts and HeLa cells co-cultured in vitro reciprocally influence growth patterns, protein expression, chromatin features and cell survival.

Science.gov (United States)

Delinasios, John G; Angeli, Flora; Koumakis, George; Kumar, Shant; Kang, Wen-Hui; Sica, Gigliola; Iacopino, Fortunata; Lama, Gina; Lamprecht, Sergio; Sigal-Batikoff, Ina; Tsangaris, George T; Farfarelos, Christos D; Farfarelos, Maria C; Vairaktaris, Eleftherios; Vassiliou, Stavros; Delinasios, George J

2015-04-01

to identify biological interactions between proliferating fibroblasts and HeLa cells in vitro. Fibroblasts were isolated from both normal and tumour human tissues. Coverslip co-cultures of HeLa and fibroblasts in various ratios with medium replacement every 48 h were studied using fixed cell staining with dyes such as Giemsa and silver staining, with immunochemistry for Ki-67 and E-cadherin, with dihydrofolate reductase (DHFR) enzyme reaction, as well as live cell staining for non-specific esterases and lipids. Other techniques included carmine cell labeling, autoradiography and apoptosis assessment. Under conditions of feeding and cell: cell ratios allowing parallel growth of human fibroblasts and HeLa cells, co-cultured for up to 20 days, a series of phenomena occur consecutively: profound affinity between the two cell types and exchange of small molecules; encircling of the HeLa colonies by the fibroblasts and enhanced growth of both cell types at their contact areas; expression of carbonic anhydrase in both cell types and high expression of non-specific esterases and cytoplasmic argyrophilia in the surrounding fibroblasts; intense production and secretion of lipid droplets by the surrounding fibroblasts; development of a complex net of argyrophilic projections of the fibroblasts; E-cadherin expression in the HeLa cells; from the 10th day onwards, an increasing detachment of batches of HeLa cells at the peripheries of colonies and appearance of areas with many multi-nucleated and apoptotic HeLa cells, and small HeLa fragments; from the 17th day, appearance of fibroblasts blocked at the G2-M phase. Co-cultures at approximately 17-20 days display a cell-cell fight with foci of (a) sparse growth of both cell types, (b) overgrowth of the fibroblasts and (c) regrowth of HeLa in small colonies. These results indicate that during their interaction with HeLa cells in vitro, proliferating fibroblasts can be activated against HeLa. This type of activation is not observed

Individual fates of mesenchymal stem cells in vitro

Directory of Open Access Journals (Sweden)

Drasdo Dirk

2010-05-01

Full Text Available Abstract Background In vitro cultivated stem cell populations are in general heterogeneous with respect to their expression of differentiation markers. In hematopoietic progenitor populations, this heterogeneity has been shown to regenerate within days from isolated subpopulations defined by high or low marker expression. This kind of plasticity has been suggested to be a fundamental feature of mesenchymal stem cells (MSCs as well. Here, we study MSC plasticity on the level of individual cells applying a multi-scale computer model that is based on the concept of noise-driven stem cell differentiation. Results By simulation studies, we provide detailed insight into the kinetics of MSC organisation. Monitoring the fates of individual cells in high and low oxygen culture, we calculated the average transition times of individual cells into stem cell and differentiated states. We predict that at low oxygen the heterogeneity of a MSC population with respect to differentiation regenerates from any selected subpopulation in about two days. At high oxygen, regeneration becomes substantially slowed down. Simulation results on the composition of the functional stem cell pool of MSC populations suggest that most of the cells that constitute this pool originate from more differentiated cells. Conclusions Individual cell-based models are well-suited to provide quantitative predictions on essential features of the spatio-temporal organisation of MSC in vitro. Our predictions on MSC plasticity and its dependence on the environment motivate a number of in vitro experiments for validation. They may contribute to a better understanding of MSC organisation in vitro, including features of clonal expansion, environmental adaptation and stem cell ageing.

Effect of amniotic fluid on the in vitro culture of human corneal endothelial cells.

Science.gov (United States)

Feizi, Sepehr; Soheili, Zahra-Soheila; Bagheri, Abouzar; Balagholi, Sahar; Mohammadian, Azam; Rezaei-Kanavi, Mozhgan; Ahmadieh, Hamid; Samiei, Shahram; Negahban, Kambiz

2014-05-01

The present study was designed to evaluate the effects of human amniotic fluid (HAF) on the growth of human corneal endothelial cells (HCECs) and to establish an in vitro method for expanding HCECs. HCECs were cultured in DMEM-F12 supplemented with 20% fetal bovine serum (FBS). Confluent monolayer cultures were trypsinized and passaged using either FBS- or HAF-containing media. Cell proliferation and cell death ELISA assays were performed to determine the effect of HAF on cell growth and viability. The identity of the cells cultured in 20% HAF was determined using immunocytochemistry (ICC) and real-time reverse transcription polymerase chain reaction (RT-PCR) techniques to evaluate the expression of factors that are characteristic of HCECs, including Ki-67, Vimentin, Na+/K+-ATPase and ZO-1. HCEC primary cultures were successfully established using 20% HAF-containing medium, and these cultures demonstrated rapid cell proliferation according to the cell proliferation and death ELISA assay results. The ICC and real time RT-PCR results indicated that there was a higher expression of Na+/K+-ATPase and ZO-1 in the 20% HAF cell cultures compared with the control (20% FBS) (P < 0.05). The 20% HAF-containing medium exhibited a greater stimulatory effect on HCEC growth and could represent a potential enriched supplement for HCEC regeneration studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Comparison of STIM and particle backscattering spectrometry mass determination for quantitative microanalysis of cultured cells

International Nuclear Information System (INIS)

Deves, G.; Ortega, R.

2001-01-01

In biological sample microanalysis, a mass-normalisation method is commonly used as a quantitative index of elemental concentrations determined by particle-induced X-ray emission (PIXE). The organic mass can either be determined using particle backscattering spectrometry (BS) or scanning transmission ion microscopy (STIM). However, the accuracy of quantitative microanalysis in samples such as cultured cells is affected by beam-induced loss of organic mass during analysis. The aim of this paper is to compare mass measurements determined by particle BS or by STIM. In order to calibrate STIM and BS analyses, we measured by both techniques the thickness of standard foils of polycarbonate (3 and 6 μm), Mylar[reg] (4 μm), Kapton[reg] (7.5 μm) and Nylon[reg] (15 μm), as well as biological samples of mono-layered cultured cells. Non-damaging STIM analysis of samples before PIXE irradiation is certainly one of the most accurate ways to determine the sample mass, however, this requires strong experimental handling. On the other hand, BS performed simultaneously to PIXE is the simplest method to determine the local mass in polymer foils, but appears less accurate in the case of cultured cells

In vitro repopulation of haemopoietic stem cells after irradiation

International Nuclear Information System (INIS)

Mori, K.J.; Kumagai, Keiko; Seto, Akira; Ito, Yohei

1981-01-01

A culture system was designed in which proliferation of the haemopoietic stem cells was supported by adherent 'stromal' cell colonies. Application of the culture system to studies on kinetic behaviour of the haemopoietic stem cells after irradiation revealed; i) bone marrow stromal cells were radiosensitive with D 0 = 95R, when measured as the capability to proliferate and form adherent cell colonies in vitro, ii) radiosensitivity of the pluripotent stem cells (CFUs) in vitro was within the range of the in vivo sensitivity, iii) irradiated bone marrow cells under in vitro condition could repopulate at the same rate as those under in vivo condition, thereby suggesting that the function related to the support of haemopoiesis was radioresistant, iv) concentrations of both CFUs and granulocyte-macrophage precursor cells (CFUc) were higher in the irradiated cultures than those in unirradiated control culture at 3 weeks after irradiation. (author)

Morphological analysis of human umbilical vein endothelial cells co-cultured with ovarian cancer cells in 3D: An oncogenic angiogenesis assay.

Directory of Open Access Journals (Sweden)

Xiao Wan

Full Text Available Antiangiogenic therapy for cancer is a strategy targeted at tumour vasculature, often in combination with conventional cytotoxicity treatments. Animal testing is still the most common method used for evaluating the efficacy of new drugs but tissue-engineered in vitro models are becoming more acceptable for replacing and reducing the use of animals in anti-cancer drug screening. In this study, a 3D co-culture model of human endothelial cells and ovarian cancer cells was developed. This model has the potential to mimic the interactions between endothelial cells and ovarian cancer cells. The feasibility of applying this model in drug testing was explored here. The complex morphology of the co-culture system, which features development of both endothelial tubule-like structures and tumour structures, was analysed quantitatively by an image analysis method. The co-culture morphology integrity was maintained for 10 days and the potential of the model for anti-cancer drug testing was evaluated using Paclitaxel and Cisplatin, two common anti-tumour drugs with different mechanisms of action. Both traditional cell viability assays and quantitative morphological analyses were applied in the drug testing. Cisplatin proved a good example showing the advantages of morphological analysis of the co-culture model when compared with mono-culture of endothelial cells, which did not reveal an inhibitory effect of Cisplatin on the tubule-like endothelial structures. Thus, the tubule areas of the co-culture reflected the anti-angiogenesis potential of Cisplatin. In summary, in vitro cancer models can be developed using a tissue engineering approach to more closely mimic the characteristics of tumours in vivo. Combined with the image analysis technique, this developed 3D co-culture angiogenesis model will provide more reproducible and reliably quantified results and reveal further information of the drug's effects on both tumour cell growth and tumour angiogenesis.

In vitro cell culture lethal dose submitted to gamma radiation

Energy Technology Data Exchange (ETDEWEB)

Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: carolina_sm@hotmail.com; Ikeda, Tamiko I.; Cruz, Aurea S. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil)

2009-07-01

The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that {sup 60}Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

In vitro cell culture lethal dose submitted to gamma radiation

International Nuclear Information System (INIS)

Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto; Ikeda, Tamiko I.; Cruz, Aurea S.

2009-01-01

The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that 60 Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

Quercetin inhibits adipogenesis of muscle progenitor cells in vitro

Directory of Open Access Journals (Sweden)

Tomoko Funakoshi

2018-03-01

Full Text Available Muscle satellite cells are committed myogenic progenitors capable of contributing to myogenesis to maintain adult muscle mass and function. Several experiments have demonstrated that muscle satellite cells can differentiate into adipocytes in vitro, supporting the mesenchymal differentiation potential of these cells. Moreover, muscle satellite cells may be a source of ectopic muscle adipocytes, explaining the lipid accumulation often observed in aged skeletal muscle (sarcopenia and in muscles of patients` with diabetes. Quercetin, a polyphenol, is one of the most abundant flavonoids distributed in edible plants, such as onions and apples, and possesses antioxidant, anticancer, and anti-inflammatory properties. In this study, we examined whether quercetin inhibited the adipogenesis of muscle satellite cells in vitro with primary cells from rat limbs by culture in the presence of quercetin under adipogenic conditions. Morphological observations, Oil Red-O staining results, triglyceride content analysis, and quantitative reverse transcription polymerase chain reaction revealed that quercetin was capable of inhibiting the adipogenic induction of muscle satellite cells into adipocytes in a dose-dependent manner by suppressing the transcript levels of adipogenic markers, such as peroxisome proliferator-activated receptor-γ and fatty acid binding protein 4. Our results suggested that quercetin inhibited the adipogenesis of muscle satellite cells in vitro by suppressing the transcription of adipogenic markers. Keywords: Quercetin, Muscle satellite cell, Differentiation, Intramuscular lipid

Quantitative Analysis of Rat Dorsal Root Ganglion Neurons Cultured on Microelectrode Arrays Based on Fluorescence Microscopy Image Processing.

Science.gov (United States)

Mari, João Fernando; Saito, José Hiroki; Neves, Amanda Ferreira; Lotufo, Celina Monteiro da Cruz; Destro-Filho, João-Batista; Nicoletti, Maria do Carmo

2015-12-01

Microelectrode Arrays (MEA) are devices for long term electrophysiological recording of extracellular spontaneous or evocated activities on in vitro neuron culture. This work proposes and develops a framework for quantitative and morphological analysis of neuron cultures on MEAs, by processing their corresponding images, acquired by fluorescence microscopy. The neurons are segmented from the fluorescence channel images using a combination of segmentation by thresholding, watershed transform, and object classification. The positioning of microelectrodes is obtained from the transmitted light channel images using the circular Hough transform. The proposed method was applied to images of dissociated culture of rat dorsal root ganglion (DRG) neuronal cells. The morphological and topological quantitative analysis carried out produced information regarding the state of culture, such as population count, neuron-to-neuron and neuron-to-microelectrode distances, soma morphologies, neuron sizes, neuron and microelectrode spatial distributions. Most of the analysis of microscopy images taken from neuronal cultures on MEA only consider simple qualitative analysis. Also, the proposed framework aims to standardize the image processing and to compute quantitative useful measures for integrated image-signal studies and further computational simulations. As results show, the implemented microelectrode identification method is robust and so are the implemented neuron segmentation and classification one (with a correct segmentation rate up to 84%). The quantitative information retrieved by the method is highly relevant to assist the integrated signal-image study of recorded electrophysiological signals as well as the physical aspects of the neuron culture on MEA. Although the experiments deal with DRG cell images, cortical and hippocampal cell images could also be processed with small adjustments in the image processing parameter estimation.

Application of cell co-culture system to study fat and muscle cells.

Science.gov (United States)

Pandurangan, Muthuraman; Hwang, Inho

2014-09-01

Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.

Tick-Borne Relapsing Fever Imported from West Africa: Diagnosis by Quantitative Buffy Coat Analysis and In Vitro Culture of Borrelia crocidurae

OpenAIRE

van Dam, Alje P.; van Gool, Tom; Wetsteyn, José C. F. M.; Dankert, Jacob

1999-01-01

West African tick-borne relapsing fever (TBRF) is difficult to diagnose due to the low number of spirochetes in the bloodstream of patients. Previously, the causative microorganism, Borrelia crocidurae, had never been cultured in vitro. TBRF was rapidly diagnosed for two patients returning from western Africa with fever of unknown origin by quantitative buffy coat (QBC) analysis. Diagnosis was confirmed by intraperitoneal inoculation of blood specimens from patients into laboratory mice. In v...

Serum-free keloid fibroblast cell culture: an in vitro model for the study of aberrant wound healing.

Science.gov (United States)

Koch, R J; Goode, R L; Simpson, G T

1997-04-01

The purpose of this study was to develop an in vitro serum-free keloid fibroblast model. Keloid formation remains a problem for every surgeon. Prior evaluations of fibroblast characteristics in vitro, especially those of growth factor measurement, have been confounded by the presence of serum-containing tissue culture media. The serum itself contains growth factors, yet has been a "necessary evil" to sustain cell growth. The design of this study is laboratory-based and uses keloid fibroblasts obtained from five patients undergoing facial (ear lobule) keloid removal in a university-affiliated clinic. Keloid fibroblasts were established in primary cell culture and then propagated in a serum-free environment. The main outcome measures included sustained keloid fibroblast growth and viability, which was comparable to serum-based models. The keloid fibroblast cell cultures exhibited logarithmic growth, sustained a high cellular viability, maintained a monolayer, and displayed contact inhibition. Demonstrating model consistency, there was no statistically significant difference between the mean cell counts of the five keloid fibroblast cell lines at each experimental time point. The in vitro growth of keloid fibroblasts in a serum-free model has not been done previous to this study. The results of this study indicate that the proliferative characteristics described are comparable to those of serum-based models. The described model will facilitate the evaluation of potential wound healing modulators, and cellular effects and collagen modifications of laser resurfacing techniques, and may serve as a harvest source for contaminant-free fibroblast autoimplants. Perhaps its greatest utility will be in the evaluation of endogenous and exogenous growth factors.

In vitro culture and characterization of a mammary epithelial cell line from Chinese Holstein dairy cow.

Directory of Open Access Journals (Sweden)

Han Hu

Full Text Available BACKGROUND: The objective of this study was to establish a culture system and elucidate the unique characteristics of a bovine mammary epithelial cell line in vitro. METHODOLOGY: Mammary tissue from a three year old lactating dairy cow (ca. 100 d relative to parturition was used as a source of the epithelial cell line, which was cultured in collagen-coated tissue culture dishes. Fibroblasts and epithelial cells successively grew and extended from the culturing mammary tissue at the third day. Pure epithelial cells were obtained by passages culture. PRINCIPAL FINDINGS: The strong positive immunostaining to cytokeratin 18 suggested that the resulting cell line exhibited the specific character of epithelial cells. Epithelial cells cultured in the presence of 10% FBS, supraphysiologic concentrations of insulin, and hydrocortisone maintained a normal diploid chromosome modal number of 2n=60. Furthermore, they were capable of synthesizing beta-casein (CSN2, acetyl-CoA carboxylase-alpha (ACACA and butyrophilin (BTN1A1. An important finding was that frozen preservation in a mixture of 90% FBS and 10% DMSO did not influence the growth characteristics, chromosome number, or protein secretion of the isolated epithelial cell line. CONCLUSIONS: The obtained mammary epithelial cell line had normal morphology, growth characteristics, cytogenetic and secretory characteristics, thus, it might represent an useful tool for studying the function of Chinese Holstein dairy cows mammary epithelial cell (CMECs.

Triple co-culture cell model as an in vitro model for oral particulate vaccine systems

DEFF Research Database (Denmark)

Nielsen, Line Hagner; De Rossi, C.; Lehr, C.-M.

the immunostimulatory ability of particulate vaccine formulations designed for oral delivery. Levels of cytokine production in response to vaccine administration were measured following particulate vaccine administration, as an indication of dendritic cell and macrophage activation. Precursors of cubosomes containing......; this was not observed with ovalbumin and blank solution. An example of the results is shown in Figure 2 for IL-17A. An established co-culture of Caco-2, THP-1 and MUTZ-3 cells showed promise as an in vitro model for testing of oral vaccine formulations. Mobility of co-culture immune cells as well as cytokine production...... with particle formulations. This was not the case when incubating with ovalbumin solution or blank. The ELISA screening assay showed production of a wide range of cytokines following culture incubation with cubosomes (with and without ovalbumin) and LPS solutions, indicative of a stimulatory effect...

Evaluation of Antigen-Specific IgM and IgG Production during an In Vitro Peripheral Blood Mononuclear Cell Culture Assay

Directory of Open Access Journals (Sweden)

Yoshiko Matsuda

2017-07-01

Full Text Available The recent attention given to diseases associated with memory B-cell (mBC-produced antibodies (Abs suggests the need for a similar in vitro assay to evaluate the functions of mBCs. Here, we cultured peripheral blood mononuclear cells (PBMCs with the intent to collect mBC-derived Abs in vitro and maintain their cell–cell contact-dependent interactions with helper T-cells. PBMCs were cultured with interleukin (IL-21, CpG-oligodeoxynucleotides (ODN, phorbol myristate acetate (PMA, and phytohemagglutinin/leucoagglutinin (PHA-L in 24-well flat-bottom plates (5 × 105 cells/well. A culture supernatant analysis of PBMCs from healthy donors (n = 10 indicated that antigen-specific IgM Ab levels in a PBMC culture supernatant might be better able to demonstrate the antigen sensitization status in a smaller peripheral blood sample, compared to IgG because Epstein–Barr virus-specific IgM mBCs circulate peripherally at a significantly higher frequency once antiviral humoral immunity has stabilized. Thus, our in vitro assay demonstrated the potential significance of antigen-specific IgM Ab production in the culture supernatants. Furthermore, an analysis of cultured PBMCs from allograft kidney recipients (n = 16 sensitized with de novo donor-specific human leukocyte antigen (HLA-specific Abs (DSAs showed that IgM-type HLA-specific Abs were detected mainly from the culture supernatants from PBMCs of patients with stable graft function, whereas IgG isotype HLA Abs were detectable only from patients with biopsy-proven antibody-mediated rejection. In other words, these IgG isotype Abs also represented an activated humoral immune response in vivo. Additionally, IgM- and IgG-expressing mBCs from healthy donors (n = 5 were cultured with IL-21, CpG-ODN, and a supernatant produced by stimulating CD19+ B-cell-depleted PBMCs with PHA-L and PMA in 24-well flat-bottom plates (1 × 105 cells/well, and the resulting in vitro analysis provided some

A PDMS Device Coupled with Culture Dish for In Vitro Cell Migration Assay.

Science.gov (United States)

Lv, Xiaoqing; Geng, Zhaoxin; Fan, Zhiyuan; Wang, Shicai; Pei, WeiHua; Chen, Hongda

2018-04-30

Cell migration and invasion are important factors during tumor progression and metastasis. Wound-healing assay and the Boyden chamber assay are efficient tools to investigate tumor development because both of them could be applied to measure cell migration rate. Therefore, a simple and integrated polydimethylsiloxane (PDMS) device was developed for cell migration assay, which could perform quantitative evaluation of cell migration behaviors, especially for the wound-healing assay. The integrated device was composed of three units, which included cell culture dish, PDMS chamber, and wound generation mold. The PDMS chamber was integrated with cell culture chamber and could perform six experiments under different conditions of stimuli simultaneously. To verify the function of this device, it was utilized to explore the tumor cell migration behaviors under different concentrations of fetal bovine serum (FBS) and transforming growth factor (TGF-β) at different time points. This device has the unique capability to create the "wound" area in parallel during cell migration assay and provides a simple and efficient platform for investigating cell migration assay in biomedical application.

Suppression of in vitro primary immune response by L1210 cells and their culture supernatant: evidence for cytotoxic effects

International Nuclear Information System (INIS)

Huget, R.P.; Flad, H.D.; Opitz, H.G.

1977-01-01

L1210 cells and their culture supernatants were found to inhibit the generation of PFC in the in vitro primary immune response of spleen cells to SRBC. As few as 1 percent of L1210 cells and 1 percent of culture fluid were inhibitory. Inhibition of DNA or protein synthesis of L1210 cells did not abolish their immunosuppressive activity, excluding exhaustion of culture medium as a possible mechanism of inhibition of PFC. Heating of the supernatant completely abrogated the suppressive effect and resulted in a marked increase of PFC. Daily evaluation of cell viability in the cultures revealed that, in the presence of L1210 and supernatants, the fraction of surviving cells is markedly reduced. We conclude that a direct cytotoxic effect on splenic lymphocytes and macrophages is the predominant immunosuppressive mechanism of L1210 cells and their culture supernatants

AlgiMatrix™ based 3D cell culture system as an in-vitro tumor model for anticancer studies.

Directory of Open Access Journals (Sweden)

Chandraiah Godugu

Full Text Available Three-dimensional (3D in-vitro cultures are recognized for recapitulating the physiological microenvironment and exhibiting high concordance with in-vivo conditions. Taking the advantages of 3D culture, we have developed the in-vitro tumor model for anticancer drug screening.Cancer cells grown in 6 and 96 well AlgiMatrix™ scaffolds resulted in the formation of multicellular spheroids in the size range of 100-300 µm. Spheroids were grown in two weeks in cultures without compromising the growth characteristics. Different marketed anticancer drugs were screened by incubating them for 24 h at 7, 9 and 11 days in 3D cultures and cytotoxicity was measured by AlamarBlue® assay. Effectiveness of anticancer drug treatments were measured based on spheroid number and size distribution. Evaluation of apoptotic and anti-apoptotic markers was done by immunohistochemistry and RT-PCR. The 3D results were compared with the conventional 2D monolayer cultures. Cellular uptake studies for drug (Doxorubicin and nanoparticle (NLC were done using spheroids.IC(50 values for anticancer drugs were significantly higher in AlgiMatrix™ systems compared to 2D culture models. The cleaved caspase-3 expression was significantly decreased (2.09 and 2.47 folds respectively for 5-Fluorouracil and Camptothecin in H460 spheroid cultures compared to 2D culture system. The cytotoxicity, spheroid size distribution, immunohistochemistry, RT-PCR and nanoparticle penetration data suggested that in vitro tumor models show higher resistance to anticancer drugs and supporting the fact that 3D culture is a better model for the cytotoxic evaluation of anticancer drugs in vitro.The results from our studies are useful to develop a high throughput in vitro tumor model to study the effect of various anticancer agents and various molecular pathways affected by the anticancer drugs and formulations.

Quantitative volumetric Raman imaging of three dimensional cell cultures

KAUST Repository

Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

2017-01-01

in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies

Dynamic quantitative analysis of adherent cell cultures by means of lens-free video microscopy

Science.gov (United States)

Allier, C.; Vincent, R.; Navarro, F.; Menneteau, M.; Ghenim, L.; Gidrol, X.; Bordy, T.; Hervé, L.; Cioni, O.; Bardin, S.; Bornens, M.; Usson, Y.; Morales, S.

2018-02-01

We present our implementation of lens-free video microscopy setup for the monitoring of adherent cell cultures. We use a multi-wavelength LED illumination together with a dedicated holographic reconstruction algorithm that allows for an efficient removal of twin images from the reconstructed phase image for densities up to those of confluent cell cultures (>500 cells/mm2). We thereby demonstrate that lens-free video microscopy, with a large field of view ( 30 mm2) can enable us to capture the images of thousands of cells simultaneously and directly inside the incubator. It is then possible to trace and quantify single cells along several cell cycles. We thus prove that lens-free microscopy is a quantitative phase imaging technique enabling estimation of several metrics at the single cell level as a function of time, for example the area, dry mass, maximum thickness, major axis length and aspect ratio of each cell. Combined with cell tracking, it is then possible to extract important parameters such as the initial cell dry mass (just after cell division), the final cell dry mass (just before cell division), the average cell growth rate, and the cell cycle duration. As an example, we discuss the monitoring of a HeLa cell cultures which provided us with a data-set featuring more than 10 000 cell cycle tracks and more than 2x106 cell morphological measurements in a single time-lapse.

Tuning differentiation signals for efficient propagation and in vitro validation of rat embryonic stem cell cultures.

Science.gov (United States)

Meek, Stephen; Sutherland, Linda; Burdon, Tom

2015-01-01

The rat is one of the most commonly used laboratory animals in biomedical research and the recent isolation of genuine pluripotent rat embryonic stem (ES) cell lines has provided new opportunities for applying contemporary genetic engineering techniques to the rat and enhancing the use of this rodent in scientific research. Technical refinements that improve the stability of the rat ES cell cultures will undoubtedly further strengthen and broaden the use of these stem cells in biomedical research. Here, we describe a relatively simple and robust protocol that supports the propagation of germ line competent rat ES cells, and outline how tuning stem cell signaling using small molecule inhibitors can be used to both stabilize self-renewal of rat ES cell cultures and aid evaluation of their differentiation potential in vitro.

In vitro culture and characterization of enteric neural precursor cells from human gut biopsy specimens using polymer scaffold.

Science.gov (United States)

Krishnamohan, Janardhanam; Senthilnathan, Venugopal S; Vaikundaraman, Tirunelveli Muthiah; Srinivasan, Thangavelu; Balamurugan, Madasamy; Iwasaki, Masaru; Preethy, Senthilkumar; Abraham, Samuel Jk

2013-08-01

In vitro expansion and characterization of neural precursor cells from human gut biopsy specimens with or without Hirschsprung's disease using a novel thermoreversible gelation polymer (TGP) is reported aiming at a possible future treatment. Gut biopsy samples were obtained from five patients undergoing gut resection for Hirschsprung's disease (n = 1) or gastrointestinal disorders (n = 4). Cells isolated from the smooth muscle layer and the myenteric plexus were cultured in two groups for 18 to 28 days; Group I: conventional culture as earlier reported and Group II: using TGP scaffold. Neurosphere like bodies (NLBs) were observed in the cultures between 8th to 12th day and H & E staining was positive for neural cells in both groups including aganglionic gut portion from the Hirschsprung's disease patient. Immunohistochemistry using S-100 and neuron specific enolase (NSE) was positive in both groups but the TGP group (Group II) showed more number of cells with intense cytoplasmic granular positivity for both NSE and S-100 compared to Group I. TGP supports the in vitro expansion of human gut derived neuronal cells with seemingly better quality NLBs. Animal Studies can be tried to validate their functional outcome by transplanting the NLBs with TGP scaffolds to see whether this can enhance the outcome of cell based therapies for Hirschsprung's disease.

Propagation of human spermatogonial stem cells in vitro.

Science.gov (United States)

Sadri-Ardekani, Hooman; Mizrak, Sefika C; van Daalen, Saskia K M; Korver, Cindy M; Roepers-Gajadien, Hermien L; Koruji, Morteza; Hovingh, Suzanne; de Reijke, Theo M; de la Rosette, Jean J M C H; van der Veen, Fulco; de Rooij, Dirk G; Repping, Sjoerd; van Pelt, Ans M M

2009-11-18

Young boys treated with high-dose chemotherapy are often confronted with infertility once they reach adulthood. Cryopreserving testicular tissue before chemotherapy and autotransplantation of spermatogonial stem cells at a later stage could theoretically allow for restoration of fertility. To establish in vitro propagation of human spermatogonial stem cells from small testicular biopsies to obtain an adequate number of cells for successful transplantation. Study performed from April 2007 to July 2009 using testis material donated by 6 adult men who underwent orchidectomy as part of prostate cancer treatment. Testicular cells were isolated and cultured in supplemented StemPro medium; germline stem cell clusters that arose were subcultured on human placental laminin-coated dishes in the same medium. Presence of spermatogonia was determined by reverse transcriptase polymerase chain reaction and immunofluorescence for spermatogonial markers. To test for the presence of functional spermatogonial stem cells in culture, xenotransplantation to testes of immunodeficient mice was performed, and migrated human spermatogonial stem cells after transplantation were detected by COT-1 fluorescence in situ hybridization. The number of colonized spermatogonial stem cells transplanted at early and later points during culture were counted to determine propagation. Propagation of spermatogonial stem cells over time. Testicular cells could be cultured and propagated up to 15 weeks. Germline stem cell clusters arose in the testicular cell cultures from all 6 men and could be subcultured and propagated up to 28 weeks. Expression of spermatogonial markers on both the RNA and protein level was maintained throughout the entire culture period. In 4 of 6 men, xenotransplantation to mice demonstrated the presence of functional spermatogonial stem cells, even after prolonged in vitro culture. Spermatogonial stem cell numbers increased 53-fold within 19 days in the testicular cell culture and

Modeling long-term host cell-Giardia lamblia interactions in an in vitro co-culture system.

Directory of Open Access Journals (Sweden)

Bridget S Fisher

Full Text Available Globally, there are greater than 700,000 deaths per year associated with diarrheal disease. The flagellated intestinal parasite, Giardia lamblia, is one of the most common intestinal pathogens in both humans and animals throughout the world. While attached to the gastrointestinal epithelium, Giardia induces epithelial cell apoptosis, disrupts tight junctions, and increases intestinal permeability. The underlying cellular and molecular mechanisms of giardiasis, including the role lamina propria immune cells, such as macrophages, play in parasite control or clearance are poorly understood. Thus far, one of the major obstacles in ascertaining the mechanisms of Giardia pathology is the lack of a functionally relevant model for the long-term study of the parasite in vitro. Here we report on the development of an in vitro co-culture model which maintains the basolateral-apical architecture of the small intestine and allows for long-term survival of the parasite. Using transwell inserts, Caco-2 intestinal epithelial cells and IC-21 macrophages are co-cultured in the presence of Giardia trophozoites. Using the developed model, we show that Giardia trophozoites survive over 21 days and proliferate in a combination media of Caco-2 cell and Giardia medium. Giardia induces apoptosis of epithelial cells through caspase-3 activation and macrophages do not abrogate this response. Additionally, macrophages induce Caco-2 cells to secrete the pro-inflammatory cytokines, GRO and IL-8, a response abolished by Giardia indicating parasite induced suppression of the host immune response. The co-culture model provides additional complexity and information when compared to a single-cell model. This model will be a valuable tool for answering long-standing questions on host-parasite biology that may lead to discovery of new therapeutic interventions.

Photo irradiation Systems for In-Vitro Cultured Cells Phototherapy and Photobiology Experiments

International Nuclear Information System (INIS)

Serrano Navarro, Joel; Morales Lopez, Orestes M.; Hernandez Quintanas, Luis F.; Lopez Silva, Y.; Fabila Bustos, Diego A.; De la Rosa Vazquez, Jose M.; Valor Reed, Alma; Stolik Isakina, Suren; Brodin, Patrik N.; Guha, Chandan; Tome, Wolfgang A.

2016-01-01

The increase in research and application of various phototherapy methods, especially photodynamic therapy (PDT) has created the need to study in depth the mechanisms of interaction of light with biological tissue using a photosensitizing drug in order to increase the therapeutic effectiveness. In this issue, two systems for controlled irradiation of in-vitro cell culture and temperature monitoring of the culture are presented. The first system was designed to irradiate 24 wells in a 96-well microplate. The second one was constructed for the irradiation and control of a 24-well microplate using larger volumes of cultured cells. Both systems can independently irradiate and control the temperature of each well. The systems include a module for contactless measurement of the temperature in each well. Light sources are located in an interchangeable module, so that it can be replaced to irradiate with different wavelengths. These prototypes count with various operation modes, controlled by a computer, which permits establishing specific settings in accordance with the desired experiment. The systems allow the automated experiment execution with precise control of dosimetry, irradiation and temperature, which reduces the sample-handling while, saves time. (Author)

In vitro expansion and differentiation of rat pancreatic duct-derived stem cells into insulin secreting cells using a dynamicthree-dimensional cell culture system.

Science.gov (United States)

Chen, X C; Liu, H; Li, H; Cheng, Y; Yang, L; Liu, Y F

2016-06-27

In this study, a dynamic three-dimensional cell culture technology was used to expand and differentiate rat pancreatic duct-derived stem cells (PDSCs) into islet-like cell clusters that can secrete insulin. PDSCs were isolated from rat pancreatic tissues by in situ collagenase digestion and density gradient centrifugation. Using a dynamic three-dimensional culture technique, the cells were expanded and differentiated into functional islet-like cell clusters, which were characterized by morphological and phenotype analyses. After maintaining 1 x 108 isolated rat PDSCs in a dynamic three-dimensional cell culture for 7 days, 1.5 x 109 cells could be harvested. Passaged PDSCs expressed markers of pancreatic endocrine progenitors, including CD29 (86.17%), CD73 (90.73%), CD90 (84.13%), CD105 (78.28%), and Pdx-1. Following 14 additional days of culture in serum-free medium with nicotinamide, keratinocyte growth factor (KGF), and b fibroblast growth factor (FGF), the cells were differentiated into islet-like cell clusters (ICCs). The ICC morphology reflected that of fused cell clusters. During the late stage of differentiation, representative clusters were non-adherent and expressed insulin indicated by dithizone (DTZ)-positive staining. Insulin was detected in the extracellular fluid and cytoplasm of ICCs after 14 days of differentiation. Additionally, insulin levels were significantly higher at this time compared with the levels exhibited by PDSCs before differentiation (P cell culture system, PDSCs can be expanded in vitro and can differentiate into functional islet-like cell clusters.

A novel approach for in vitro studies applying electrical fields to cell cultures by transformer-like coupling.

Science.gov (United States)

Hess, R; Neubert, H; Seifert, A; Bierbaum, S; Hart, D A; Scharnweber, D

2012-12-01

The purpose of this study was to develop a new apparatus for in vitro studies applying low frequency electrical fields to cells without interfering side effects like biochemical reactions or magnetic fields which occur in currently available systems. We developed a non-invasive method by means of the principle of transformer-like coupling where the magnetic field is concentrated in a toroid and, therefore, does not affect the cell culture. Next to an extensive characterization of the electrical field parameters, initial cell culture studies have focused on examining the response of bone marrow-derived human mesenchymal stem cells (MSCs) to pulsed electrical fields. While no significant differences in the proliferation of human MSCs could be detected, significant increases in ALP activity as well as in gene expression of other osteogenic markers were observed. The results indicate that transformer-like coupled electrical fields can be used to influence osteogenic differentiation of human MSCs in vitro and can pose a useful tool in understanding the influence of electrical fields on the cellular and molecular level.

Bio-EdIP: An automatic approach for in vitro cell confluence images quantification.

Science.gov (United States)

Cardona, Andrés; Ariza-Jiménez, Leandro; Uribe, Diego; Arroyave, Johanna C; Galeano, July; Cortés-Mancera, Fabian M

2017-07-01

Cell imaging is a widely-employed technique to analyze multiple biological processes. Therefore, simple, accurate and quantitative tools are needed to understand cellular events. For this purpose, Bio-EdIP was developed as a user-friendly tool to quantify confluence levels using cell culture images. The proposed algorithm combines a pre-processing step with subsequent stages that involve local processing techniques and a morphological reconstruction-based segmentation algorithm. Segmentation performance was assessed in three constructed image sets, comparing F-measure scores and AUC values (ROC analysis) for Bio-EdIP, its previous version and TScratch. Furthermore, segmentation results were compared with published algorithms using eight public benchmarks. Bio-EdIP automatically segmented cell-free regions from images of in vitro cell culture. Based on mean F-measure scores and ROC analysis, Bio-EdIP conserved a high performance regardless of image characteristics of the constructed dataset, when compared with its previous version and TScratch. Although acquisition quality of the public dataset affected Bio-EdIP segmentation, performance was better in two out of eight public sets. Bio-EdIP is a user-friendly interface, which is useful for the automatic analysis of confluence levels and cell growth processes using in vitro cell culture images. Here, we also presented new manually annotated data for algorithms evaluation. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of Somatic Cell Types and Culture Medium on in vitro Maturation, Fertilization and Early Development Capability of Buffalo Oocytes

Directory of Open Access Journals (Sweden)

H. Jamil*, H. A. Samad, N. Rehman, Z. I. Qureshi and L. A. Lodhi

2011-04-01

Full Text Available This study was designed to evaluate the efficacy of different somatic cell types and media in supporting in vitro maturation (IVM, in vitro fertilization (IVF and early embryonic development competence of buffalo follicular oocytes. Cumulus oocyte complexes were collected for maturation from follicles (>6mm of buffalo ovaries collected at the local abattoir. Oocytes were co-cultured in tissue culture medium (TCM-199 with either granulosa cells, cumulus cells, or buffalo oviductal epithelial cells (BOEC @ 3x106 cells/ml or in TCM-199 without helper cells (control at 39°C and 5%CO2 in humidified air. Fresh semen was prepared in modified Ca++ free Tyrode medium. Fertilization was carried out in four types of media: i Tyrode lactate albumin pyruvate (TALP, ii TALP+BOEC, iii modified Ca++ free Tyrode and iv modified Ca++ free Tyrode+BOEC. Fertilized oocytes were cultured for early embryonic development in TCM-199 with and without BOEC. Higher maturation rates were observed in the granulosa (84.24% and cumulus cells (83.44% than BOEC co culture system (73.37%. Highest fertilization rate was obtained in modified Ca++ free Tyrode with BOEC co culture (70.42%, followed by modified Ca++ free Tyrode alone (63.77%, TALP with BOEC (36.92% and TALP alone (10.94%. Development of early embryos (8-cell stage improved in TCM-199 with BOEC co culture than TCM-199 alone. From the results of this study, it can be concluded that addition of somatic cells (granulosa cells, cumulus cells results in higher maturation rates of buffalo follicular oocytes than BOEC co culture system, while fertilization rate improved in modified Ca++ free Tyrode with and without BOEC. Addition of BOEC to TCM-199 improved the developmental capacity of early embryo.

PCL-coated hydroxyapatite scaffold derived from cuttlefish bone: In vitro cell culture studies

International Nuclear Information System (INIS)

Milovac, Dajana; Gamboa-Martínez, Tatiana C.; Ivankovic, Marica; Gallego Ferrer, Gloria; Ivankovic, Hrvoje

2014-01-01

In the present study, we examined the potential of using highly porous poly(ε-caprolactone) (PCL)-coated hydroxyapatite (HAp) scaffold derived from cuttlefish bone for bone tissue engineering applications. The cell culture studies were performed in vitro with preosteoblastic MC3T3-E1 cells in static culture conditions. Comparisons were made with uncoated HAp scaffold. The attachment and spreading of preosteoblasts on scaffolds were observed by Live/Dead staining Kit. The cells grown on the HAp/PCL composite scaffold exhibited greater spreading than cells grown on the HAp scaffold. DNA quantification and scanning electron microscopy (SEM) confirmed a good proliferation of cells on the scaffolds. DNA content on the HAp/PCL scaffold was significantly higher compared to porous HAp scaffolds. The amount of collagen synthesis was determined using a hydroxyproline assay. The osteoblastic differentiation of the cells was evaluated by determining alkaline phosphatase (ALP) activity and collagen type I secretion. Furthermore, cell spreading and cell proliferation within scaffolds were observed using a fluorescence microscope. - Highlights: • Hydroxyapatite/poly(ε-caprolactone) scaffold with interconnected pores was prepared • Cytotoxicity test showed that the scaffold was not cytotoxic towards MC3T3-E1 cells • The scaffold supported the attachment, proliferation and differentiation of cells • A 3D cell colonization was confirmed using the fluorescence microscopy • The scaffold might be a promising candidate for bone tissue engineering

Physiology of in vitro culture

Directory of Open Access Journals (Sweden)

Maria Jesús Cañal

2001-01-01

Full Text Available The culture procedures described up to the eighties, did not made any mention to the environmental control of in vitro plant development. However, growth rate, development and many of the physiologic-morphologic features of the in vitro grown plants are influenced by the culture vessel. The increasing knowledge about the environmental control of culture vessels under sterile conditions, is helping to change micorpropagation procedures. The in vitro environment with lower rate ventilation, brings about low flow rates of matter and energy, with minimum variations of temperature, high relative humidity and large daily changes of the concentration of CO2 inside the culture vessel. The type of culture vessel (size, shape, fabric and closing system can influence the evolution of the atmosphere along the time of culture. Although submitted to different stresses factors plant can be grown in vitro, but plants can be faulty in their anatomy, morphology and physiology. As a consequence, these plants shown a phenotype unable to survive to ex vitro conditions. Different strategies can be used to control the atmosphere along the different phases of micropropagation, in heterotrophic, mixotrophic or autotrophic cultures. The election of the best strategy will be based on different factors as species, number of transplantes required, or quality-price relationship. enviromental control, tissue culture, micropropagation Keywords: in vitro enviromental, characteristic physiology,

Claudin-11 and occludin are major contributors to Sertoli cell tight junction function, in vitro

Directory of Open Access Journals (Sweden)

Mark J McCabe

2016-01-01

Full Text Available The Sertoli cell tight junction (TJ is the key component of the blood-testis barrier, where it sequesters developing germ cells undergoing spermatogenesis within the seminiferous tubules. Hormonally regulated claudin-11 is a critical transmembrane protein involved in barrier function and its murine knockout results in infertility. We aimed to assess quantitatively the significance of the contribution of claudin-11 to TJ function, in vitro, using siRNA-mediated gene silencing. We also conducted an analysis of the contribution of occludin, another intrinsic transmembrane protein of the TJ. Silencing of claudin-11 and/or occludin was conducted using siRNA in an immature rat Sertoli cell culture model. Transepithelial electrical resistance was used to assess quantitatively TJ function throughout the culture. Two days after siRNA treatment, cells were fixed for immunocytochemical localization of junction proteins or lyzed for RT-PCR assessment of mRNA expression. Silencing of claudin-11, occludin, or both resulted in significant decreases in TJ function of 55% (P < 0.01, 51% (P < 0.01, and 62% (P < 0.01, respectively. Data were concomitant with significant decreases in mRNA expression and marked reductions in the localization of targeted proteins to the Sertoli cell TJ. We provide quantitative evidence that claudin-11 contributes significantly (P < 0.01 to Sertoli cell TJ function in vitro. Interestingly, occludin, which is hormonally regulated but not implicated in infertility until late adulthood, is also a significant (P < 0.01 contributor to barrier function. Our data are consistent with in vivo studies that clearly demonstrate a role for these proteins in maintaining normal TJ barrier structure and function.

Quantitative morphological analysis of proliferating and nonproliferating subpopulations of IMR-90 fibroblasts during aging in vitro

International Nuclear Information System (INIS)

Pool, T.B.; Heitman, T.O.; Buck, M.A.

1982-01-01

Early-, mid- and late-passage cultures (population doubling levels 12, 35, and 51, respectively) of IMR-90 fibroblasts were exposed to 3 H-thymidine for 48 h prior to fixation in situ for morphometric analysis in order to determine quantitatively what ultrastructural changes accompany the loss of proliferative capacity during aging in vitro. Analysis of autoradiographs, both at the light and electron microscopic levels, with an image analyzer followed by ANOVA statistical scrutiny demonstrated that a significant increase in relative cell area, an indicator of cell size, was characteristic of cells unable to incorporate 3 H-TdR at both mid- and late-passage, but not at early-passage levels. Nuclear size also increased significantly with progressive passage level but was not related to proliferative capacity. No significant difference in the area fraction of nucleoli per unit area of nucleus or of mitochondria, Golgi, or lysosomes was seen in either subpopulation at any passage level. Dilated cisternae of rough endoplasmic reticulum in early-passage cells were seen if cells were harvested with trypsin and fixed either before or after centrifugation, but were not seen in labeled or unlabeled cells from any passage level when cultures were fixed in situ. We conclude that a significant increase in cell size is the only significant morphological change associated with the loss of proliferative capacity of IRM-90 fibroblasts. Furthermore, our data indicate that there is no accumulation of secondary lysosomes in human diploid fibroblasts during aging in vitro; we therefore cannot support any hypothesis of aging or proliferative decline that is based mechanistically upon this phenomenon

Establishment of a new model for culturing rabbit osteoblasts in vitro

International Nuclear Information System (INIS)

Cao Xianying; Yin Meizhen; Zhang Lina; Li Shipu; Cao Yang

2006-01-01

To establish an experimental model for culturing rabbit osteoblasts in vitro, the osteoblasts were isolated from the calvarial bone of a 15-day old rabbit using a method of culturing the bone pieces in a medium after they had been digested by an enzyme for 15 min. The acquired cells were assayed by cell morphology, alkaline phosphatase activity and production of a mineralized matrix. The results showed that the cells had the morphologic characteristics and some biological behaviours of osteoblasts. Based on the primary isolation of osteoblasts from bone and combining digestion with explants, a novel model for culturing rabbit osteoblasts in vitro was established, which is easy, efficient and effective. This model can be used in many studies of osteogenesis mechanisms and bone replacement materials. (communication)

In vitro differentiation of neural cells from human adipose tissue derived stromal cells.

Science.gov (United States)

Dave, Shruti D; Patel, Chetan N; Vanikar, Aruna V; Trivedi, Hargovind L

2018-01-01

Stem cells, including neural stem cells (NSCs), are endowed with self-renewal capability and hence hold great opportunity for the institution of replacement/protective therapy. We propose a method for in vitro generation of stromal cells from human adipose tissue and their differentiation into neural cells. Ten grams of donor adipose tissue was surgically resected from the abdominal wall of the human donor after the participants' informed consents. The resected adipose tissue was minced and incubated for 1 hour in the presence of an enzyme (collagenase-type I) at 37 0 C followed by its centrifugation. After centrifugation, the supernatant and pellets were separated and cultured in a medium for proliferation at 37 0 C with 5% CO2 for 9-10 days in separate tissue culture dishes for generation of mesenchymal stromal cells (MSC). At the end of the culture, MSC were harvested and analyzed. The harvested MSC were subjected for further culture for their differentiation into neural cells for 5-7 days using differentiation medium mainly comprising of neurobasal medium. At the end of the procedure, culture cells were isolated and studied for expression of transcriptional factor proteins: orthodenticle homolog-2 (OTX-2), beta-III-tubulin (β3-Tubulin), glial-fibrillary acid protein (GFAP) and synaptophysin-β2. In total, 50 neural cells-lines were generated. In vitro generated MSC differentiated neural cells' mean quantum was 5.4 ± 6.9 ml with the mean cell count being, 5.27 ± 2.65 × 10 3/ μl. All of them showed the presence of OTX-2, β3-Tubulin, GFAP, synaptophysin-β2. Neural cells can be differentiated in vitro from MSC safely and effectively. In vitro generated neural cells represent a potential therapy for recovery from spinal cord injuries and neurodegenerative disease.

Porous PEOT/PBT scaffolds for bone tissue engineering: preparation, characterization, and in vitro bone marrow cell culturing

NARCIS (Netherlands)

Claase, M.B.; Grijpma, Dirk W.; Mendes, S.C.; Mendes, Sandra C.; de Bruijn, Joost Dick; Feijen, Jan

2003-01-01

The preparation, characterization, and in vitro bone marrow cell culturing on porous PEOT/PBT copolymer scaffolds are described. These scaffolds are meant for use in bone tissue engineering. Previous research has shown that PEOT/PBT copolymers showed in vivo degradation, calcification, and bone

Pigment Cell Differentiation in Sea Urchin Blastula-Derived Primary Cell Cultures

Science.gov (United States)

Ageenko, Natalya V.; Kiselev, Konstantin V.; Dmitrenok, Pavel S.; Odintsova, Nelly A.

2014-01-01

The quinone pigments of sea urchins, specifically echinochrome and spinochromes, are known for their effective antioxidant, antibacterial, antifungal, and antitumor activities. We developed in vitro technology for inducing pigment differentiation in cell culture. The intensification of the pigment differentiation was accompanied by a simultaneous decrease in cell proliferation. The number of pigment cells was two-fold higher in the cells cultivated in the coelomic fluids of injured sea urchins than in those intact. The possible roles of the specific components of the coelomic fluids in the pigment differentiation process and the quantitative measurement of the production of naphthoquinone pigments during cultivation were examined by MALDI and electrospray ionization mass spectrometry. Echinochrome A and spinochrome E were produced by the cultivated cells of the sand dollar Scaphechinus mirabilis in all tested media, while only spinochromes were found in the cultivated cells of another sea urchin, Strongylocentrotus intermedius. The expression of genes associated with the induction of pigment differentiation was increased in cells cultivated in the presence of shikimic acid, a precursor of naphthoquinone pigments. Our results should contribute to the development of new techniques in marine biotechnology, including the generation of cell cultures producing complex bioactive compounds with therapeutic potential. PMID:24979272

In vitro biology of fibropapilloma-associated turtle herpesvirus and host cells in Hawaiian green turtles (Chelonia mydas)

Science.gov (United States)

Work, Thierry M.; Dagenais, Julie; Balazs, George H.; Schumacher, Joanne; Lewis, Teresa D.; Leong, Jo-Ann C.; Casey, Rufina N.; Casey, James W.

2009-01-01

Fibropapillomatosis (FP) of green turtles has a global distribution and causes debilitating tumours of the skin and internal organs in several species of marine turtles. FP is associated with a presently non-cultivable alphaherpesvirus Chelonid fibropapilloma-associated herpesvirus (CFPHV). Our aims were to employ quantitative PCR targeted to pol DNA of CFPHV to determine (i) if DNA sequesters by tumour size and/or cell type, (ii) whether subculturing of cells is a viable strategy for isolating CFPHV and (iii) whether CFPHV can be induced to a lytic growth cycle in vitro using chemical modulators of replication (CMRs), temperature variation or co-cultivation. Additional objectives included determining whether non-tumour and tumour cells behave differently in vitro and confirming the phenotype of cultured cells using cell-type-specific antigens. CFPHV pol DNA was preferentially concentrated in dermal fibroblasts of skin tumours and the amount of viral DNA per cell was independent of tumour size. Copy number of CFPHV pol DNA per cell rapidly decreased with cell doubling of tumour-derived fibroblasts in culture. Attempts to induce viral replication in known CFPHV-DNA-positive cells using temperature or CMR failed. No significant differences were seen in in vitro morphology or growth characteristics of fibroblasts from tumour cells and paired normal skin, nor from CFPHV pol-DNA-positive intestinal tumour cells. Tumour cells were confirmed as fibroblasts or keratinocytes by positive staining with anti-vimentin and anti-pancytokeratin antibodies, respectively. CFPHV continues to be refractory to in vitro cultivation.

DNA double-strand breaks in human induced pluripotent stem cell reprogramming and long-term in vitro culturing.

Science.gov (United States)

Simara, Pavel; Tesarova, Lenka; Rehakova, Daniela; Matula, Pavel; Stejskal, Stanislav; Hampl, Ales; Koutna, Irena

2017-03-21

Human induced pluripotent stem cells (hiPSCs) play roles in both disease modelling and regenerative medicine. It is critical that the genomic integrity of the cells remains intact and that the DNA repair systems are fully functional. In this article, we focused on the detection of DNA double-strand breaks (DSBs) by phosphorylated histone H2AX (known as γH2AX) and p53-binding protein 1 (53BP1) in three distinct lines of hiPSCs, their source cells, and one line of human embryonic stem cells (hESCs). We measured spontaneously occurring DSBs throughout the process of fibroblast reprogramming and during long-term in vitro culturing. To assess the variations in the functionality of the DNA repair system among the samples, the number of DSBs induced by γ-irradiation and the decrease over time was analysed. The foci number was detected by fluorescence microscopy separately for the G1 and S/G2 cell cycle phases. We demonstrated that fibroblasts contained a low number of non-replication-related DSBs, while this number increased after reprogramming into hiPSCs and then decreased again after long-term in vitro passaging. The artificial induction of DSBs revealed that the repair mechanisms function well in the source cells and hiPSCs at low passages, but fail to recognize a substantial proportion of DSBs at high passages. Our observations suggest that cellular reprogramming increases the DSB number but that the repair mechanism functions well. However, after prolonged in vitro culturing of hiPSCs, the repair capacity decreases.

In vitro differentiation of rat spermatogonia into round spermatids in tissue culture.

Science.gov (United States)

Reda, A; Hou, M; Winton, T R; Chapin, R E; Söder, O; Stukenborg, J-B

2016-09-01

Do the organ culture conditions, previously defined for in vitro murine male germ cell differentiation, also result in differentiation of rat spermatogonia into post-meiotic germ cells exhibiting specific markers for haploid germ cells? We demonstrated the differentiation of rat spermatogonia into post-meiotic cells in vitro, with emphasis on exhibiting, protein markers described for round spermatids. Full spermatogenesis in vitro from immature germ cells using an organ culture technique in mice was first reported 5 years ago. However, no studies reporting the differentiation of rat spermatogonia into post-meiotic germ cells exhibiting the characteristic protein expression profile or into functional sperm have been reported. Organ culture of testicular fragments of 5 days postpartum (dpp) neonatal rats was performed for up to 52 days. Evaluation of microscopic morphology, testosterone levels, mRNA and protein expression as measured by RT-qPCR and immunostaining were conducted to monitor germ cell differentiation in vitro. Potential effects of melatonin, Glutamax® medium, retinoic acid and the presence of epidydimal fat tissue on the spermatogenic process were evaluated. A minimum of three biological replicates were performed for all experiments presented in this study. One-way ANOVA, ANOVA on ranks and student's t-test were applied to perform the statistical analysis. Male germ cells, present in testicular tissue pieces grown from 5 dpp rats, exhibited positive protein expression for Acrosin and Crem (cAMP (cyclic adenosine mono phosphate) response element modulator) after 52 days of culture in vitro. Intra-testicular testosterone production could be observed after 3 days of culture, while when epididymal fat tissue was added, spontaneous contractility of cultured seminiferous tubules could be observed after 21 days. However, no supportive effect of the supplementation with any factor or the co-culturing with epididymal fat tissue on germ cell differentiation in

Radiosensitivity of normal human epidermal cells in culture

International Nuclear Information System (INIS)

Dover, R.; Potten, C.S.

1983-01-01

Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

The in vitro and in vivo capacity of culture-expanded human cells from several sources encapsulated in alginate to form cartilage

Directory of Open Access Journals (Sweden)

MM Pleumeekers

2014-04-01

Full Text Available Cartilage has limited self-regenerative capacity. Tissue engineering can offer promising solutions for reconstruction of missing or damaged cartilage. A major challenge herein is to define an appropriate cell source that is capable of generating a stable and functional matrix. This study evaluated the performance of culture-expanded human chondrocytes from ear (EC, nose (NC and articular joint (AC, as well as bone-marrow-derived and adipose-tissue-derived mesenchymal stem cells both in vitro and in vivo. All cells (≥ 3 donors per source were culture-expanded, encapsulated in alginate and cultured for 5 weeks. Subsequently, constructs were implanted subcutaneously for 8 additional weeks. Before and after implantation, glycosaminoglycan (GAG and collagen content were measured using biochemical assays. Mechanical properties were determined using stress-strain-indentation tests. Hypertrophic differentiation was evaluated with qRT-PCR and subsequent endochondral ossification with histology. ACs had higher chondrogenic potential in vitro than the other cell sources, as assessed by gene expression and GAG content (p < 0.001. However, after implantation, ACs did not further increase their matrix. In contrast, ECs and NCs continued producing matrix in vivo leading to higher GAG content (p < 0.001 and elastic modulus. For NC-constructs, matrix-deposition was associated with the elastic modulus (R2 = 0.477, p = 0.039. Although all cells – except ACs – expressed markers for hypertrophic differentiation in vitro, there was no bone formed in vivo. Our work shows that cartilage formation and functionality depends on the cell source used. ACs possess the highest chondrogenic capacity in vitro, while ECs and NCs are most potent in vivo, making them attractive cell sources for cartilage repair.

Glial cell line-derived neurotrophic factor in combination with insulin-like growth factor 1 and basic fibroblast growth factor promote in vitro culture of goat spermatogonial stem cells.

Science.gov (United States)

Bahadorani, M; Hosseini, S M; Abedi, P; Abbasi, H; Nasr-Esfahani, M H

2015-01-01

Growth factors are increasingly considered as important regulators of spermatogonial stem cells (SSCs). This study investigated the effects of various growth factors (GDNF, IGF1, bFGF, EGF and GFRalpha-1) on purification and colonization of undifferentiated goat SSCs under in vitro and in vivo conditions. Irrespective of the culture condition used, the first signs of developing colonies were observed from day 4 of culture onwards. The number of colonies developed in GDNF + IGF1 + bFGF culture condition was significantly higher than the other groups (p culture condition was significantly higher than the other groups (p cells (vimentin, alpha-inhibin and α-SMA) and spermatogonial cells (PLZF, THY 1, VASA, alpha-1 integrin, bet-1 integrin and DBA) revealed that both cell types existed in developing colonies, irrespective of the culture condition used. Even though, the relative abundance of VASA, FGFR3, OCT4, PLZF, BCL6B and THY1 transcription factors in GDNF + IGF1 + bFGF treatment group was significantly higher than the other groups (p culture condition could colonize within the seminiferous tubules of the germ-cell depleted recipient mice following xenotransplantation. Obtained results demonstrated that combination of GDNF with IGF1 and bFGF promote in vitro culture of goat SSCs while precludes uncontrolled proliferation of somatic cells.

Cell and molecular biology of the spiny dogfish Squalus acanthias and little skate Leucoraja erinacea: insights from in vitro cultured cells.

Science.gov (United States)

Barnes, D W

2012-04-01

Two of the most commonly used elasmobranch experimental model species are the spiny dogfish Squalus acanthias and the little skate Leucoraja erinacea. Comparative biology and genomics with these species have provided useful information in physiology, pharmacology, toxicology, immunology, evolutionary developmental biology and genetics. A wealth of information has been obtained using in vitro approaches to study isolated cells and tissues from these organisms under circumstances in which the extracellular environment can be controlled. In addition to classical work with primary cell cultures, continuously proliferating cell lines have been derived recently, representing the first cell lines from cartilaginous fishes. These lines have proved to be valuable tools with which to explore functional genomic and biological questions and to test hypotheses at the molecular level. In genomic experiments, complementary (c)DNA libraries have been constructed, and c. 8000 unique transcripts identified, with over 3000 representing previously unknown gene sequences. A sub-set of messenger (m)RNAs has been detected for which the 3' untranslated regions show elements that are remarkably well conserved evolutionarily, representing novel, potentially regulatory gene sequences. The cell culture systems provide physiologically valid tools to study functional roles of these sequences and other aspects of elasmobranch molecular cell biology and physiology. Information derived from the use of in vitro cell cultures is valuable in revealing gene diversity and information for genomic sequence assembly, as well as for identification of new genes and molecular markers, construction of gene-array probes and acquisition of full-length cDNA sequences. © 2012 The Author. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.

LFA-1 and ICAM-1 expression induced during melanoma-endothelial cell co-culture favors the transendothelial migration of melanoma cell lines in vitro

International Nuclear Information System (INIS)

Ghislin, Stephanie; Obino, Dorian; Middendorp, Sandrine; Boggetto, Nicole; Alcaide-Loridan, Catherine; Deshayes, Frederique

2012-01-01

Patients with metastatic melanoma have a poor median rate of survival. It is therefore necessary to increase our knowledge about melanoma cell dissemination which includes extravasation, where cancer cells cross the endothelial barrier. Extravasation is well understood during travelling of white blood cells, and involves integrins such as LFA-1 (composed of two chains, CD11a and CD18) expressed by T cells, while ICAM-1 is induced during inflammation by endothelial cells. Although melanoma cell lines cross endothelial cell barriers, they do not express LFA-1. We therefore hypothesized that melanoma-endothelial cell co-culture might induce the LFA-1/ICAM ligand/receptor couple during melanoma transmigration. A transwell approach has been used as well as blocking antibodies against CD11a, CD18 and ICAM-1. Data were analyzed with an epifluorescence microscope. Fluorescence intensity was quantified with the ImageJ software. We show here that HUVEC-conditioned medium induce cell-surface expression of LFA-1 on melanoma cell lines. Similarly melanoma-conditioned medium activates ICAM-1 expression in endothelial cells. Accordingly blocking antibodies of ICAM-1, CD11a or CD18 strongly decrease melanoma transmigration. We therefore demonstrate that melanoma cells can cross endothelial monolayers in vitro due to the induction of ICAM-1 and LFA-1 occurring during the co-culture of melanoma and endothelial cells. Our data further suggest a role of LFA-1 and ICAM-1 in the formation of melanoma cell clumps enhancing tumor cell transmigration. Melanoma-endothelial cell co-culture induces LFA-1 and ICAM-1 expression, thereby favoring in vitro melanoma trans-migration

LFA-1 and ICAM-1 expression induced during melanoma-endothelial cell co-culture favors the transendothelial migration of melanoma cell lines in vitro

Directory of Open Access Journals (Sweden)

Ghislin Stephanie

2012-10-01

Full Text Available Abstract Background Patients with metastatic melanoma have a poor median rate of survival. It is therefore necessary to increase our knowledge about melanoma cell dissemination which includes extravasation, where cancer cells cross the endothelial barrier. Extravasation is well understood during travelling of white blood cells, and involves integrins such as LFA-1 (composed of two chains, CD11a and CD18 expressed by T cells, while ICAM-1 is induced during inflammation by endothelial cells. Although melanoma cell lines cross endothelial cell barriers, they do not express LFA-1. We therefore hypothesized that melanoma-endothelial cell co-culture might induce the LFA-1/ICAM ligand/receptor couple during melanoma transmigration. Methods A transwell approach has been used as well as blocking antibodies against CD11a, CD18 and ICAM-1. Data were analyzed with an epifluorescence microscope. Fluorescence intensity was quantified with the ImageJ software. Results We show here that HUVEC-conditioned medium induce cell-surface expression of LFA-1 on melanoma cell lines. Similarly melanoma-conditioned medium activates ICAM-1 expression in endothelial cells. Accordingly blocking antibodies of ICAM-1, CD11a or CD18 strongly decrease melanoma transmigration. We therefore demonstrate that melanoma cells can cross endothelial monolayers in vitro due to the induction of ICAM-1 and LFA-1 occurring during the co-culture of melanoma and endothelial cells. Our data further suggest a role of LFA-1 and ICAM-1 in the formation of melanoma cell clumps enhancing tumor cell transmigration. Conclusion Melanoma-endothelial cell co-culture induces LFA-1 and ICAM-1 expression, thereby favoring in vitro melanoma trans-migration.

Quantitative imaging of epithelial cell scattering identifies specific inhibitors of cell motility and cell-cell dissociation

NARCIS (Netherlands)

Loerke, D.; le Duc, Q.; Blonk, I.; Kerstens, A.; Spanjaard, E.; Machacek, M.; Danuser, G.; de Rooij, J.

2012-01-01

The scattering of cultured epithelial cells in response to hepatocyte growth factor (HGF) is a model system that recapitulates key features of metastatic cell behavior in vitro, including disruption of cell-cell adhesions and induction of cell migration. We have developed image analysis tools that

Vascular smooth muscle cells exhibit a progressive loss of rigidity with serial culture passaging.

Science.gov (United States)

Dinardo, Carla Luana; Venturini, Gabriela; Omae, Samantha Vieira; Zhou, Enhua H; da Motta-Leal-Filho, Joaquim Maurício; Dariolli, Rafael; Krieger, José Eduardo; Alencar, Adriano Mesquita; Costa Pereira, Alexandre

2012-01-01

One drawback of in vitro cell culturing is the dedifferentiation process that cells experience. Smooth muscle cells (SMC) also change molecularly and morphologically with long term culture. The main objective of this study was to evaluate if culture passages interfere in vascular SMC mechanical behavior. SMC were obtained from five different porcine arterial beds. Optical magnetic twisting cytometry (OMTC) was used to characterize mechanically vascular SMC from different cultures in distinct passages and confocal microscopy/western blotting, to evaluate cytoskeleton and extracellular matrix proteins. We found that vascular SMC rigidity or viscoelastic complex modulus (G) decreases with progression of passages. A statistically significant negative correlation between G and passage was found in four of our five cultures studied. Phalloidin-stained SMC from higher passages exhibited lower mean signal intensity per cell (confocal microscopy) and quantitative western blotting analysis showed a decrease in collagen I content throughout passages. We concluded that vascular SMC progressively lose their stiffness with serial culture passaging. Thus, limiting the number of passages is essential for any experiment measuring viscoelastic properties of SMC in culture.

mRNA fragments in in vitro culture media are associated with bovine preimplantation embryonic development.

Science.gov (United States)

Kropp, Jenna; Khatib, Hasan

2015-01-01

In vitro production (IVP) systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage) embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerate conditioned media. Differential expression was confirmed by quantitative real-time PCR for fragments of mRNA POSTN and VSNL-1, in four additional biological replicates of media. To better understand the mechanisms of mRNA secretion into the media, the expression of a predicted RNA binding protein of POSTN, PUM2, was knocked down using an antisense oligonucleotide gapmer. Supplementation of a PUM2 gapmer significantly reduced blastocyst development and decreased secretion of POSTN mRNA into the media. Overall, differential mRNA expression in the media was repeatable and sets the framework for future study of mRNA biomarkers in in vitro culture media to improve predictability of reproductive performance.

The blood-brain barrier in vitro using primary culture

DEFF Research Database (Denmark)

Larsen, Annette Burkhart

The brain is protected from the entry of unwanted substances by means of the blood-brain barrier (BBB) formed by the brain microvasculature. This BBB is composed of non-fenestrated brain capillary endothelial cells (BCECs) with their intermingling tight junctions. The presence of the BBB is a huge...... obstacle for the treatment of central nervous system (CNS) diseases, as many potentially CNS active drugs are unable to reach their site of action within the brain. In vitro BBB models are, therefore, being developed to investigate the BBB permeability of a drug early in its development. The first part...... of the thesis involves the establishment and characterization of an in vitro BBB models based on primary cells isolated from the rat brain. Co-culture and triple culture models with astrocytes and pericytes were found to be the superior to mono cultured BCECs with respect to many important BBB characteristics...

Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Rassing, Margrethe Rømer

2002-01-01

The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...

Drug adsorption to plastic containers and retention of drugs in cultured cells under in vitro conditions.

Science.gov (United States)

Palmgrén, Joni J; Mönkkönen, Jukka; Korjamo, Timo; Hassinen, Anssi; Auriola, Seppo

2006-11-01

Loss of drug content during cell culture transport experiment can lead to misinterpretations in permeability analysis. This study analyses drug adsorption to various plastic containers and drug retention in cultured cells under in vitro conditions. The loss of various drugs to polystyrene tubes and well plates was compared to polypropylene and glass tubes both in deionised water and buffer solution. In cellular uptake experiments, administered drugs were obtained from cultured cells by liquid extraction. Samples were collected at various time points and drug concentrations were measured by a new HPLC-MS/MS method. Acidic drugs (hydrochlorothiazide, naproxen, probenicid, and indomethacin) showed little if any sorption to all tested materials in either water or buffer. In the case of basic drugs, substantial loss to polystyrene tubes and well plates was observed. After 4.5 h, the relative amount remaining in aqueous test solution stored in polystyrene tubes was 64.7 +/- 6.8%, 38.4 +/- 9.1%, 31.9 +/- 6.7%, and 23.5 +/- 6.1% for metoprolol, medetomidine, propranolol, and midazolam, respectively. Interestingly, there was no significant loss of drugs dissolved in buffer to any of the tested materials indicating that buffer reduced surficial interaction. The effect of drug concentration to sorption was also tested. Results indicated that the higher the concentration in the test solution the lower the proportional drug loss, suggesting that the polystyrene contained a limited amount of binding sites. Cellular uptake studies showed considerable retention of drugs in cultured cells. The amounts of absorbed drugs in cellular structures were 0.45%, 4.88%, 13.15%, 43.80%, 23.57% and 11.22% for atenolol, metoprolol, medetomidine, propranolol, midazolam, and diazepam, respectively. Overall, these findings will benefit development and validation of further in vitro drug permeation experiments.

Assessment of Culture Condition and In Vitro Colonization Ability of Human Spermatogonial Stem Cells: A Review Article

Directory of Open Access Journals (Sweden)

Maryam Mahal Dashtian

2013-06-01

Full Text Available Spermatogenesis is a highly complex and regulated process in which germ stem cells differentiate into spermatozoa. These stem cells, called spermatogonial stem cells (SSCs, are in the base of seminiferous tubules and have the ability of self-renewal and differentiation into functional germ cells. Due to this ability, SSCs can restore spermatogenesis after testicular damage caused by cytotoxic materials or following transplantation into an infertile recipient. Therefore, self-renewal of these cells is critical for the preservation of SSC populations and restoration of fertility. While previous studies have shown that the SSCs of mice and other species can survive and proliferate for long periods of time, little information is available about suitable culture media for the growth of human SSCs. Identification of SSC markers allows for the isolation of these populations of cells. The isolated cell can be expanded in culture and transplanted into infertile recipients. Consequently, the recognition of markers and the establishment of long-term culture systems for human SSCs will be essential for using the potential of these cells in a clinical setting. In this article, we focus on the markers that have been identified for human SSCs and in vitro culture techniques used for human SSCs proliferation.

Differentiation of Human Pluripotent Stem Cells into Functional Endothelial Cells in Scalable Suspension Culture

Directory of Open Access Journals (Sweden)

Ruth Olmer

2018-05-01

Full Text Available Summary: Endothelial cells (ECs are involved in a variety of cellular responses. As multifunctional components of vascular structures, endothelial (progenitor cells have been utilized in cellular therapies and are required as an important cellular component of engineered tissue constructs and in vitro disease models. Although primary ECs from different sources are readily isolated and expanded, cell quantity and quality in terms of functionality and karyotype stability is limited. ECs derived from human induced pluripotent stem cells (hiPSCs represent an alternative and potentially superior cell source, but traditional culture approaches and 2D differentiation protocols hardly allow for production of large cell numbers. Aiming at the production of ECs, we have developed a robust approach for efficient endothelial differentiation of hiPSCs in scalable suspension culture. The established protocol results in relevant numbers of ECs for regenerative approaches and industrial applications that show in vitro proliferation capacity and a high degree of chromosomal stability. : In this article, U. Martin and colleagues show the generation of hiPSC endothelial cells in scalable cultures in up to 100 mL culture volume. The generated ECs show in vitro proliferation capacity and a high degree of chromosomal stability after in vitro expansion. The established protocol allows to generate hiPSC-derived ECs in relevant numbers for regenerative approaches. Keywords: hiPSC differentiation, endothelial cells, scalable culture

Effect of in vitro irradiation and cell cycle-inhibitory drugs on the spontaneous human IgE synthesis in vitro

International Nuclear Information System (INIS)

Del Prete, G.F.; Vercelli, D.; Tiri, A.; Maggi, E.; Rossi, O.; Romagnani, S.; Ricci, M.

1987-01-01

The in vitro effects of radiation, diterpine forskolin (FK), and hydrocortisone (HC) on the in vitro spontaneous IgE synthesis by peripheral blood B-lymphocytes from atopic patients were investigated. Without affecting cell viability, in vitro irradiation inhibited in a dose-dependent fashion de novo IgE synthesis in vitro by B cells from all patients examined with a mean 40% reduction of in vitro IgE product after treatment with 100 rads. In contrast, the in vitro IgE production by the U266 myeloma cell line was unaffected, even by irradiation with 1600 rads. The addition to B cell cultures from atopic patients of FK consistently resulted in a dose-dependent inhibition of the spontaneous IgE production in vitro. The addition to cultures of 10(-5) and 10(-6) molar concentrations of HC was also usually inhibitory, whereas lower HC concentrations were uneffective or even enhanced the spontaneous in vitro IgE synthesis. When 10(-6) molar concentrations of both HC and FK were combined in culture, a summation inhibitory effect on the spontaneous IgE synthesis was observed. In contrast, neither FK nor HC had inhibitory effect on the in vitro spontaneous IgE synthesis by the U266 myeloma cell line. The spontaneous in vitro IgE synthesis by B cells from patients with Hodgkin's disease, demonstrating high levels of serum IgE, was strongly reduced or virtually abolished after patients underwent total nodal irradiation to prevent the spread of the disease. In addition, the in vitro spontaneous IgE synthesis by B cells from atopic patients was markedly decreased or abolished by in vivo administration of betamethasone

Trends in the development of microfluidic cell biochips for in vitro hepatotoxicity.

Science.gov (United States)

Baudoin, Régis; Corlu, Anne; Griscom, Laurent; Legallais, Cécile; Leclerc, Eric

2007-06-01

Current developments in the technological fields of liver tissue engineering, bioengineering, biomechanics, microfabrication and microfluidics have lead to highly complex and pertinent new tools called "cell biochips" for in vitro toxicology. The purpose of "cell biochips" is to mimic organ tissues in vitro in order to partially reduce the amount of in vivo testing. These "cell biochips" consist of microchambers containing engineered tissue and living cell cultures interconnected by a microfluidic network, which allows the control of microfluidic flows for dynamic cultures, by continuous feeding of nutrients to cultured cells and waste removal. Cell biochips also allow the control of physiological contact times of diluted molecules with the tissues and cells, for rapid testing of sample preparations or specific addressing. Cell biochips can be situated between in vitro and in vivo testing. These types of systems can enhance functionality of cells by mimicking the tissue architecture complexities when compared to in vitro analysis but at the same time present a more rapid and simple process when compared to in vivo testing procedures. In this paper, we first introduce the concepts of microfluidic and biochip systems based on recent progress in microfabrication techniques used to mimic liver tissue in vitro. This includes progress and understanding in biomaterials science (cell culture substrate), biomechanics (dynamic cultures conditions) and biology (tissue engineering). The development of new "cell biochips" for chronic toxicology analysis of engineered tissues can be achieved through the combination of these research domains. Combining these advanced research domains, we then present "cell biochips" that allow liver chronic toxicity analysis in vitro on engineered tissues. An extension of the "cell biochip" idea has also allowed "organ interactions on chip", which can be considered as a first step towards the replacement of animal testing using a combined liver

Development of integrated in vivo/in vitro system for the study of carcinogenic effects of energy-related by-products. Progress report No. 2, November 1, 1978-October 31, 1979

International Nuclear Information System (INIS)

Yuhas, J.M.

1979-01-01

Progress is reported in the following areas of research: development of a means of isolating type II cells from the mouse lung in a reproductively intact condition; growth of these cells in monolayer culture; serial propagation of these cells; production of transformants in vitro by the addition of carcinogens to the cultures; induction of transformation in vivo followed by assay in vitro; verification of the tumorgenic potential of the transformants by analysis of their quantitative and qualitative characteristics; quantitation of the in vivo and in vitro transformation process; and comparison of the quantitative aspects of the two systems with each other and with in vivo tumor yield patterns. Research in the first four areas was extended during the past year to include human lung cells, and on a limited scale, to include in vitro analysis of 131 I radiation carcinogenesis in thyroid cultures

Behaviour of moderately differentiated osteoblast-like cells cultured in contact with bioactive glasses

Directory of Open Access Journals (Sweden)

Hattar S.

2002-12-01

Full Text Available Bioactive glasses have been shown to stimulate osteogenesis both in vivo and in vitro. However, the molecular mechanisms underlying this process are still poorly understood. In this study, we have investigated the behaviour of osteoblast-like cells (MG63, cultured in the presence of bioglass particles. Three types of granules were used: 45S5registered bioactive glass, 45S5registered granules preincubated in tris buffer and 60S non-reactive glass, used as control. Phase contrast microscopy permitted step-by-step visualization of cell cultures in contact with the particles. Ultrastructural observations of undecalcified sections revealed direct contacts of the cells and an electron-dense layer located at the periphery of the material. Protein synthesis was evaluated biochemically and showed a gradual increase throughout the culture time in the three types of cultures. Alkaline phosphatase was detected in situ, in clusters of packed cells either in contact with the material or in the background cell layer. Semi-quantitative RT-PCR analysis of the main osteoblastic markers showed that gene expression was maintained in all three cultures. The fact that osteocalcin was not detected, supports the fact that the MG63 cell line is composed of less differentiated osteogenic cells rather than mature osteoblasts. We also demonstrated for the first time in this cell line, the expression of Msx-2, Dlx-3 and Dlx-7 homeogenes, known to regulate in vivo foetal skeletogenesis as well as adult skeletal regeneration. However, no significant differences could be recognised in the expression pattern of bone markers between the three types of cultures. Yet these preliminary results indicate that bioactive glasses provided a suitable environment for the growth and proliferation of osteoblasts in vitro, since no drastic changes in phenotype expression of pre-osteoblasts was noted.

Development of cell-based quantitative evaluation method for cell cycle-arrest type cancer drugs for apoptosis by high precision surface plasmon resonance sensor

Science.gov (United States)

Ona, Toshihiro; Nishijima, Hiroshi; Kosaihira, Atsushi; Shibata, Junko

2008-04-01

In vitro rapid and quantitative cell-based assay is demanded to verify the efficacy prediction of cancer drugs since a cancer patient may have unconventional aspects of tumor development. Here, we show the rapid and non-label quantitative verifying method and instrumentation of apoptosis for cell cycle-arrest type cancer drugs (Roscovitine and D-allose) by reaction analysis of living liver cancer cells cultured on a sensor chip with a newly developed high precision (50 ndeg s -1 average fluctuation) surface plasmon resonance (SPR) sensor. The time-course cell reaction as the SPR angle change rate for 10 min from 30 min cell culture with a drug was significantly related to cell viability. By the simultaneous detection of differential SPR angle change and fluorescence by specific probes using the new instrument, the SPR angle was related to the nano-order potential decrease in inner mitochondrial membrane potential. The results obtained are universally valid for the cell cycle-arrest type cancer drugs, which mediate apoptosis through different cell-signaling pathways, by a liver cancer cell line of Hep G2 (P<0.001). This system towards the application to evaluate personal therapeutic potentials of drugs using cancer cells from patients in clinical use.

Paracrine interactions between LNCaP prostate cancer cells and bioengineered bone in 3D in vitro culture reflect molecular changes during bone metastasis.

Science.gov (United States)

Sieh, Shirly; Taubenberger, Anna V; Lehman, Melanie L; Clements, Judith A; Nelson, Colleen C; Hutmacher, Dietmar W

2014-06-01

As microenvironmental factors such as three-dimensionality and cell-matrix interactions are increasingly being acknowledged by cancer biologists, more complex 3D in vitro models are being developed to study tumorigenesis and cancer progression. To better understand the pathophysiology of bone metastasis, we have established and validated a 3D indirect co-culture model to investigate the paracrine interactions between prostate cancer (PCa) cells and human osteoblasts. Co-culture of the human PCa, LNCaP cells embedded within polyethylene glycol hydrogels with human osteoblasts in the form of a tissue engineered bone construct (TEB), resulted in reduced proliferation of LNCaP cells. LNCaP cells in both monoculture and co-culture were responsive to the androgen analog, R1881, as indicated by an increase in the expression (mRNA and/or protein induction) of androgen-regulated genes including prostate specific antigen and fatty acid synthase. Microarray gene expression analysis further revealed an up-regulation of bone markers and other genes associated with skeletal and vasculature development and a significant activation of transforming growth factor β1 downstream genes in LNCaP cells after co-culture with TEB. LNCaP cells co-cultured with TEB also unexpectedly showed similar changes in classical androgen-responsive genes under androgen-deprived conditions not seen in LNCaP monocultures. The molecular changes of LNCaP cells after co-culturing with TEBs suggest that osteoblasts exert a paracrine effect that may promote osteomimicry and modulate the expression of androgen-responsive genes in LNCaP cells. Taken together, we have presented a novel 3D in vitro model that allows the study of cellular and molecular changes occurring in PCa cells and osteoblasts that are relevant to metastatic colonization of bone. This unique in vitro model could also facilitate cancer biologists to dissect specific biological hypotheses via extensive genomic or proteomic assessments to

Optimization of in vitro culture and transfection condition of bovine ...

African Journals Online (AJOL)

The present study aimed to optimize the in vitro culture and transfection efficiency of bovine primary spermatogonial stem cells (SSCs). To this end, SSCs were obtained from newborn Holstein bull calves by two-step enzymatic digestion. After enrichment and culture, SSCs were characterized by using alkaline phosphatase ...

21 CFR 864.2280 - Cultured animal and human cells.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...

Apoptosis related genes expressed in cultured Fallopian tube epithelial cells infected in vitro with Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

PAZ A REYES

2007-01-01

Full Text Available Background: Infection of the Fallopian tubes (FT by Neisseria gonorrhoeae (Ngo can lead to acute salpingitis, an inflammatory condition resulting in damage primarily to the ciliated cells, with loss of ciliary activity and sloughing of the cells from the epithelium. Recently, we have shown that Ngo infection induced apoptosis in FT epithelium cells by a TNF-alpha dependent mechanism that could contribute to the cell and tissue damage observed in gonococcal salpingitis. Aim: To investigate the apoptosis-related genes expressed during apoptosis induction in cultured FT epithelial cells infected in vitro by Ngo. Materials and Methods: In the current study, we used cDNA macroarrays and real time PCR to identify and determine the expression levels of apoptosis related genes during the in vitro gonococci infection of FT epithelial cells. Results: Significant apoptosis was induced following infection with Ngo. Macroarray analysis identified the expression of multiple genes of the TNF receptor family (TNFRSF1B, -4, -6, -10A, -10B and -10D and the Bcl-2 family (BAK1, BAX, BLK, HRK and MCL-1 without differences between controls and infected cells. This lack of difference was confirmed by RT-PCR of BAX, Bcl-2, TNFRS1A (TNFR-I and TNFRSF1B (TNFR-II. Conclusion: Several genes related to apoptosis are expressed in primary cultures of epithelial cells of the human Fallopian tube. Infection with Ngo induces apoptosis without changes in the pattern of gene expression of several apoptosis-related genes. Results strongly suggest that Ngo regulates apoptosis in the FT by post-transcriptional mechanisms that need to be further addressed

Precursors (pre-CFCmulti) of multilineage hemopoietic colony-forming cells quantitated in vitro. Uniqueness of IL-1 requirement, partial separation from pluripotential colony-forming cells, and correlation with long term reconstituting cells in vivo

International Nuclear Information System (INIS)

Iscove, N.N.; Yan, X.Q.

1990-01-01

Pluripotential colony-forming cells (CFCmulti) from mouse marrow can expand significantly in number during 4 days of suspension culture with IL-1 and IL-3. In this study, the cells (pre-CFCmulti) which originate this response are characterized in terms of their frequency, progeny number, factor requirements, buoyant density, and extent of restoration following marrow transplantation. Parallel measurements of both CFCmulti and cells providing long term marrow reconstitution in vivo allowed direct comparisons to be made with pre-CFCmulti. The proliferative response of pre-CFCmulti was found to depend uniquely on the combination of IL-1 and IL-3, and neither of these regulators was replaceable by any of IL-4, IL-6, IL-7, GM-CSF, G-CSF, M-CSF or LIF. After separation on density gradients, pre-CFCmulti were recovered in fractions of lower density than most of the CFCmulti, but in the same fractions that contained most of the in vivo reconstituting cells. After irradiation and marrow transplantation, marrow CFCmulti were restored to near normal levels, while both pre-CFCmulti as well as reconstituting stem cells remained profoundly depressed. These results show pre-CFCmulti to be distinct from most CFCmulti and to represent the closest approach to quantitative detection of reconstituting stem cells so far achieved in vitro

In vitro culture and characterization of putative porcine embryonic germ cells derived from domestic breeds and yucatan mini pig embryos at days 20-24 of gestation

DEFF Research Database (Denmark)

Petkov, Stoyan Gueorguiev; Marks, Hendrik; Klein, Tino

2011-01-01

Embryonic germ cells (EGC) are cultured pluripotent cells derived from primordial germ cells (PGC). This study explored the possibility of establishing porcine EGC from domestic breeds and Yucatan mini pigs using embryos at Days 17-24 of gestation. In vitro culture of PGC from both pooled...

The impact of cell culture equipment on energy loss.

Science.gov (United States)

Davies, Lleucu B; Kiernan, Michael N; Bishop, Joanna C; Thornton, Catherine A; Morgan, Gareth

2014-01-01

Light energy of discrete wavelengths supplied via lasers and broadband intense pulsed light have been used therapeutically for many years. In vitro models complement clinical studies, especially for the elucidation of underlying mechanisms of action. Clarification that light energy reaches the cells is necessary when developing protocols for the treatment of cells using in vitro models. Few studies report on energy loss in cell culture equipment. The ability of energy from light with therapeutic potential to reach cells in culture needs to be determined; this includes determining the proportion of light energy lost within standard cell culture media and cell culture vessels. The energy absorption of cell culture media, with/without the pH indicator dye phenol red, and the loss of energy within different plastics and glassware used typically for in vitro cell culture were investigated using intense pulsed light and a yellow pulsed dye laser. Media containing phenol red have a distinctive absorption peak (560 nm) absent in phenol red-free media and restored by the addition of phenol red. For both light sources, energy loss was lowest in standard polystyrene tissue culture flasks or multi-well plates and highest in polypropylene vessels or glass tubes. The effects of phenol red-free media on the absorption of energy varied with the light source used. Phenol red-free media are the media of choice; polystyrene vessels with flat surfaces such as culture flasks or multi-well plates should be used in preference to polypropylene or glass vessels.

In vitro cartilage construct generation from silk fibroin- chitosan porous scaffold and umbilical cord blood derived human mesenchymal stem cells in dynamic culture condition.

Science.gov (United States)

Agrawal, Parinita; Pramanik, Krishna; Biswas, Amit; Ku Patra, Ranjan

2018-02-01

Cartilage construct generation includes a scaffold with appropriate composition to mimic matrix of the damaged tissue on which the stem cells grow and differentiate. In this study, umbilical cord blood (UCB) derived human mesenchymal stem cells (hMSCs) were seeded on freeze dried porous silk-fibroin (SF)/chitosan (CS) scaffolds. Influence of static and dynamic (spinner flask bioreactor) culture conditions on the developing cartilage construct were studied by in-vitro characterization for viability, proliferation, distribution, and chondrogenic differentiation of hMSCs over the scaffold. Constructs developed in spinner flask consisted of 62% live cells, and exhibited 543% more cell density at the core than constructs cultured in static system. Quantification of DNA and glycosaminoglycans accumulation after 21 days showed the progression of chondrogenic differentiation of hMSCs was higher in dynamic culture compared to static one. In constructs generated under dynamic condition, histology staining for proteoglycan matrix, and fluorescence staining for collagen-II and aggrecan showed positive correlation between early and late stage chondrogenic markers, which was further confirmed by quantitative PCR analysis, showing low collagen-I expression and highly expressed Sox9, collagen-II and aggrecan. The present study demonstrated that construct generated by combining 3D SF/CS scaffold with UCB-hMSCs under dynamic condition using spinner flask bioreactor can be used for cartilage tissue regeneration for future medical treatments. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 397-407, 2018. © 2017 Wiley Periodicals, Inc.

An in vitro prototype of a porcine biomimetic testis-like cell culture system: a novel tool for the study of reassembled Sertoli and Leydig cells

Directory of Open Access Journals (Sweden)

Iva Arato

2018-01-01

Full Text Available At present, there is no reliable in vitro assembled prepubertal testis-like biomimetic organ culture system designed to assess the functional effects of human gonadotropins on Sertoli and Leydig cells. Spermatogenesis is regulated by endocrine, paracrine, and juxtacrine factors (testicular cross-talk, mainly orchestrated by gonadotropins such as luteinizing hormone (LH and follicle-stimulating hormone (FSH that play a pivotal role by stimulating Leydig and Sertoli cells, respectively. The aim of our study was to set up an in vitro prepubertal porcine bioengineered construct as a new model for experimental studies on reassembled Sertoli and Leydig cells. We have evaluated Sertoli and Leydig cells obtained from 15- to 20-day-old neonatal pig testes in terms of purity and function. Subsequently, purified Sertoli and enriched Leydig cells were subjected to coincubation to obtain an in vitro prepubertal porcine testis-like culture system. We performed enzyme-linked immunosorbent assay (ELISA for anti-Müllerian hormone (AMH, inhibin B, and testosterone secretion in the medium, and Real-Time PCR analysis of AMH, inhibin B, FSH-r, aromatase, LHr, and 3β-HSD mRNA expression levels. This in vitro testis-like system was highly responsive to the effects of human gonadotropins and testosterone. AMH mRNA expression and secretion declined, and inhibin-B increased, while FSH-receptor expression was downregulated upon FSH/LH exposure/treatment. Finally, the production of testosterone was increased selectively upon LH treatment. In summary, our proposed model could help to better determine the action of human gonadotropins on Sertoli and Leydig cells. The potential usefulness of the system for shedding light into male infertility-related issues is evident.

Identification of differences in gene expression in primary cell cultures of human endometrial epithelial cells and trophoblast cells following their interaction

DEFF Research Database (Denmark)

Høgh, Mette; Islin, Henrik; Møller, Charlotte

2006-01-01

The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...

A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function

Science.gov (United States)

Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.

2018-01-01

Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488

Immunophenotypic characterisation and cytogenetic analysis of mesenchymal stem cells from equine bone marrow and foal umbilical cords during in vitro culture

Directory of Open Access Journals (Sweden)

Mazurkevych Anatoliy

2016-09-01

Full Text Available Introduction: The objective of the study was immunophenotypic and cytogenetic analysis of mesenchymal stem cells from equine bone marrow and foal umbilical cords during in vitro culture.

In vitro formation of osteoclasts from long-term cultures of bone marrow mononuclear phagocytes

International Nuclear Information System (INIS)

Burger, E.H.; Van der Meer, J.W.; van de Gevel, J.S.; Gribnau, J.C.; Thesingh, G.W.; van Furth, R.

1982-01-01

The origin of osteoclasts was studied in an in vitro model using organ cultures of periosteum-free embryonic mouse long-bone primordia, which were co-cultured with various cell populations. The bone rudiments were freed of their periosteum-perichondrium by collagenase treatment in a stage before cartilage erosion and osteoclast formation, and co-cultured for 7 d with either embryonic liver or mononuclear phagocytes from various sources. Light and electron microscopic examination of the cultures showed that mineralized matrix-resorbing osteoclasts developed only in bones co-cultured with embryonic liver or with cultured bone marrow mononuclear phagocytes but not when co-cultured with blood monocytes or resident or exudate peritoneal macrophages. Osteoclasts developed from the weakly adherent, but not from the strongly adherent cells of bone marrow cultures, whereas 1,000 rad irradiation destroyed the capacity of such cultures to form osteoclasts. In bone cultures to which no other cells were added, osteoclasts were virtually absent. Bone-resorbing activity of in vitro formed osteoclasts was demonstrated by 45 Ca release studies. These studies demonstrate that osteoclasts develop from cells present in cultures of proliferating mononuclear phagocytes and that, at least in our system, monocytes and macrophages are unable to form osteoclasts. The most likely candidates for osteoclast precursor cells seem to be monoblasts and promonocytes

Quantitative stain-free and continuous multimodal monitoring of wound healing in vitro with digital holographic microscopy.

Directory of Open Access Journals (Sweden)

Dominik Bettenworth

Full Text Available Impaired epithelial wound healing has significant pathophysiological implications in several conditions including gastrointestinal ulcers, anastomotic leakage and venous or diabetic skin ulcers. Promising drug candidates for accelerating wound closure are commonly evaluated in in vitro wound assays. However, staining procedures and discontinuous monitoring are major drawbacks hampering accurate assessment of wound assays. We therefore investigated digital holographic microscopy (DHM to appropriately monitor wound healing in vitro and secondly, to provide multimodal quantitative information on morphological and functional cell alterations as well as on motility changes upon cytokine stimulation. Wound closure as reflected by proliferation and migration of Caco-2 cells in wound healing assays was studied and assessed in time-lapse series for 40 h in the presence of stimulating epidermal growth factor (EGF and inhibiting mitomycin c. Therefore, digital holograms were recorded continuously every thirty minutes. Morphological changes including cell thickness, dry mass and tissue density were analyzed by data from quantitative digital holographic phase microscopy. Stimulation of Caco-2 cells with EGF or mitomycin c resulted in significant morphological changes during wound healing compared to control cells. In conclusion, DHM allows accurate, stain-free and continuous multimodal quantitative monitoring of wound healing in vitro and could be a promising new technique for assessment of wound healing.

An improved in vitro blood-brain barrier model: rat brain endothelial cells co-cultured with astrocytes.

Science.gov (United States)

Abbott, N Joan; Dolman, Diana E M; Drndarski, Svetlana; Fredriksson, Sarah M

2012-01-01

In vitro blood-brain barrier (BBB) models using primary cultured brain endothelial cells are important for establishing cellular and molecular mechanisms of BBB function. Co-culturing with BBB-associated cells especially astrocytes to mimic more closely the in vivo condition leads to upregulation of the BBB phenotype in the brain endothelial cells. Rat brain endothelial cells (RBECs) are a valuable tool allowing ready comparison with in vivo studies in rodents; however, it has been difficult to obtain pure brain endothelial cells, and few models achieve a transendothelial electrical resistance (TEER, measure of tight junction efficacy) of >200 Ω cm(2), i.e. the models are still relatively leaky. Here, we describe methods for preparing high purity RBECs and neonatal rat astrocytes, and a co-culture method that generates a robust, stable BBB model that can achieve TEER >600 Ω cm(2). The method is based on >20 years experience with RBEC culture, together with recent improvements to kill contaminating cells and encourage BBB differentiation.Astrocytes are isolated by mechanical dissection and cell straining and are frozen for later co-culture. RBECs are isolated from 3-month-old rat cortices. The brains are cleaned of meninges and white matter and enzymatically and mechanically dissociated. Thereafter, the tissue homogenate is centrifuged in bovine serum albumin to separate vessel fragments from other cells that stick to the myelin plug. The vessel fragments undergo a second enzyme digestion to separate pericytes from vessels and break down vessels into shorter segments, after which a Percoll gradient is used to separate capillaries from venules, arterioles, and single cells. To kill remaining contaminating cells such as pericytes, the capillary fragments are plated in puromycin-containing medium and RBECs grown to 50-60% confluence. They are then passaged onto filters for co-culture with astrocytes grown in the bottom of the wells. The whole procedure takes ∼2

Evaluation of peroxidative stress of cancer cells in vitro by real-time quantification of volatile aldehydes in culture headspace.

Science.gov (United States)

Shestivska, Violetta; Rutter, Abigail V; Sulé-Suso, Josep; Smith, David; Španěl, Patrik

2017-08-30

Peroxidation of lipids in cellular membranes results in the release of volatile organic compounds (VOCs), including saturated aldehydes. The real-time quantification of trace VOCs produced by cancer cells during peroxidative stress presents a new challenge to non-invasive clinical diagnostics, which as described here, we have met with some success. A combination of selected ion flow tube mass spectrometry (SIFT-MS), a technique that allows rapid, reliable quantification of VOCs in humid air and liquid headspace, and electrochemistry to generate reactive oxygen species (ROS) in vitro has been used. Thus, VOCs present in the headspace of CALU-1 cancer cell line cultures exposed to ROS have been monitored and quantified in real time using SIFT-MS. The CALU-1 lung cancer cells were cultured in 3D collagen to mimic in vivo tissue. Real-time SIFT-MS analyses focused on the volatile aldehydes: propanal, butanal, pentanal, hexanal, heptanal and malondialdehyde (propanedial), that are expected to be products of cellular membrane peroxidation. All six aldehydes were identified in the culture headspace, each reaching peak concentrations during the time of exposure to ROS and eventually reducing as the reactants were depleted in the culture. Pentanal and hexanal were the most abundant, reaching concentrations of a few hundred parts-per-billion by volume, ppbv, in the culture headspace. The results of these experiments demonstrate that peroxidation of cancer cells in vitro can be monitored and evaluated by direct real-time analysis of the volatile aldehydes produced. The combination of adopted methodology potentially has value for the study of other types of VOCs that may be produced by cellular damage. Copyright © 2017 John Wiley & Sons, Ltd.

Three-dimensional neuroepithelial culture from human embryonic stem cells and its use for quantitative conversion to retinal pigment epithelium.

Directory of Open Access Journals (Sweden)

Yu Zhu

Full Text Available A goal in human embryonic stem cell (hESC research is the faithful differentiation to given cell types such as neural lineages. During embryonic development, a basement membrane surrounds the neural plate that forms a tight, apico-basolaterally polarized epithelium before closing to form a neural tube with a single lumen. Here we show that the three-dimensional epithelial cyst culture of hESCs in Matrigel combined with neural induction results in a quantitative conversion into neuroepithelial cysts containing a single lumen. Cells attain a defined neuroepithelial identity by 5 days. The neuroepithelial cysts naturally generate retinal epithelium, in part due to IGF-1/insulin signaling. We demonstrate the utility of this epithelial culture approach by achieving a quantitative production of retinal pigment epithelial (RPE cells from hESCs within 30 days. Direct transplantation of this RPE into a rat model of retinal degeneration without any selection or expansion of the cells results in the formation of a donor-derived RPE monolayer that rescues photoreceptor cells. The cyst method for neuroepithelial differentiation of pluripotent stem cells is not only of importance for RPE generation but will also be relevant to the production of other neuronal cell types and for reconstituting complex patterning events from three-dimensional neuroepithelia.

Effect of embryo density on in vitro development and gene expression in bovine in vitro-fertilized embryos cultured in a microwell system.

Science.gov (United States)

Sugimura, Satoshi; Akai, Tomonori; Hashiyada, Yutaka; Aikawa, Yoshio; Ohtake, Masaki; Matsuda, Hideo; Kobayashi, Shuji; Kobayashi, Eiji; Konishi, Kazuyuki; Imai, Kei

2013-01-01

To identify embryos individually during in vitro development, we previously developed the well-of-the-well (WOW) dish, which contains 25 microwells. Here we investigated the effect of embryo density (the number of embryos per volume of medium) on in vitro development and gene expression of bovine in vitro-fertilized embryos cultured in WOW dishes. Using both conventional droplet and WOW culture formats, 5, 15, and 25 bovine embryos were cultured in 125 μl medium for 168 h. The blastocysts at Day 7 were analyzed for number of cells and expression of ten genes (CDX2, IFN-tau, PLAC8, NANOG, OCT4, SOX2, AKR1B1, ATP5A1, GLUT1 and IGF2R). In droplet culture, the rates of formation of >4-cell cleavage embryos and blastocysts were significantly lower in embryos cultured at 5 embryos per droplet than in those cultured at 15 or 25 embryos per droplet, but not in WOW culture. In both droplet and WOW culture, developmental kinetics and blastocyst cell numbers did not differ among any groups. IFN-tau expression in embryos cultured at 25 embryos per droplet was significantly higher than in those cultured at 15 embryos per droplet and in artificial insemination (AI)-derived blastocysts. Moreover, IGF2R expression was significantly lower in the 25-embryo group than in the 5-embryo group and in AI-derived blastocysts. In WOW culture, these expressions were not affected by embryo density and were similar to those in AI-derived blastocysts. These results suggest that, as compared with conventional droplet culture, in vitro development and expression of IFN-tau and IGF2R in the microwell system may be insensitive to embryo density.

[The investigation of genomes of some species of the genus Gentiana in nature and in vitro cell culture].

Science.gov (United States)

Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

2002-01-01

The comparative study of the genomes of intact plants-representatives of some species of the genus Gentiana L. as well as cultured cells of G. lutea and G. punctata was performed using restriction analysis. Species specificity of restriction fragment patterns for studied representatives of this genus was revealed. The differences between electrophoretic patterns of digested DNA purified from rhizome and leaves of G. lutea and G. punctata were found. The changes in genomes of G. lutea and G. punctata cells cultured in vitro compared with the genomes of intact plants were detected. The data obtained evidence that some of them may be of nonrandom character.

Regeneration of the Barley Zygote in In Vitro Cultured Ovules

DEFF Research Database (Denmark)

Holme, Inger B; Brinch-Pedersen, Henrik; Lange, Mette

2010-01-01

In vitro cultures of zygotes and small embryos carry a lot of potential for studying plant embryogenesis and are also highly relevant for plant biotechnology. Several years ago we established an in vitro ovule culture technique for barley that allows the regeneration of plants from zygotes (Holm et...... culture ability in immature embryo culture i.e. Femina, Salome and Corniche. Barley spikes were emasculated and hand pollinated 3 days after emasculation. In barley, fertilization takes place one hour after pollination and ovules with fertilized egg cells could therefore be isolated one hour after...... pollination. Ovules were grown for 3 weeks on a culture medium where after embryos could be isolated and transferred to regeneration medium. An average of 1.2 green plantlets per ovule could be regenerated from 50 % of the isolated ovules. No genotypic differences were found on embryo induction...

Alginate based 3D hydrogels as an in vitro co-culture model platform for the toxicity screening of new chemical entities

International Nuclear Information System (INIS)

Lan, Shih-Feng; Starly, Binil

2011-01-01

Prediction of human response to potential therapeutic drugs is through conventional methods of in vitro cell culture assays and expensive in vivo animal testing. Alternatives to animal testing require sophisticated in vitro model systems that must replicate in vivo like function for reliable testing applications. Advancements in biomaterials have enabled the development of three-dimensional (3D) cell encapsulated hydrogels as in vitro drug screening tissue model systems. In this study, we have developed an in vitro platform to enable high density 3D culture of liver cells combined with a monolayer growth of target breast cancer cell line (MCF-7) in a static environment as a representative example of screening drug compounds for hepatotoxicity and drug efficacy. Alginate hydrogels encapsulated with serial cell densities of HepG2 cells (10 5 -10 8 cells/ml) are supported by a porous poly-carbonate disc platform and co-cultured with MCF-7 cells within standard cell culture plates during a 3 day study period. The clearance rates of drug transformation by HepG2 cells are measured using a coumarin based pro-drug. The platform was used to test for HepG2 cytotoxicity 50% (CT 50 ) using commercially available drugs which further correlated well with published in vivo LD 50 values. The developed test platform allowed us to evaluate drug dose concentrations to predict hepatotoxicity and its effect on the target cells. The in vitro 3D co-culture platform provides a scalable and flexible approach to test multiple-cell types in a hybrid setting within standard cell culture plates which may open up novel 3D in vitro culture techniques to screen new chemical entity compounds. - Graphical abstract: Display Omitted Highlights: → A porous support disc design to support the culture of desired cells in 3D hydrogels. → Demonstrated the co-culture of two cell types within standard cell-culture plates. → A scalable, low cost approach to toxicity screening involving multiple cell

Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth

OpenAIRE

Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, J?rn

2017-01-01

Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell...

Development of a microfluidic perfusion 3D cell culture system

Science.gov (United States)

Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

2018-04-01

Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

Cytotoxicity of extracts of spices to cultured cells.

Science.gov (United States)

Unnikrishnan, M C; Kuttan, R

1988-01-01

The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

Decreased proliferative, migrative and neuro-differentiative potential of postnatal rat enteric neural crest-derived cells during culture in vitro

International Nuclear Information System (INIS)

Yu, Hui; Pan, Wei-Kang; Zheng, Bai-Jun; Wang, Huai-Jie; Chen, Xin-Lin; Liu, Yong; Gao, Ya

2016-01-01

A growing body of evidence supports the potential use of enteric neural crest-derived cells (ENCCs) as a cell replacement therapy for Hirschsprung's disease. Based on previous observations of robust propagation of primary ENCCs, as opposed to their progeny, it is suggested that their therapeutic potential after in vitro expansion may be restricted. We therefore examined the growth and differentiation activities and phenotypic characteristics of continuous ENCC cultures. ENCCs were isolated from the intestines of postnatal rats and were identified using an immunocytochemical approach. During continuous ENCC culture expansion, proliferation, migration, apoptosis, and differentiation potentials were monitored. The Cell Counting Kit-8 was used for assessment of ENCC vitality, Transwell inserts for cell migration, immunocytochemistry for cell counts and identification, and flow cytometry for apoptosis. Over six continuous generations, ENCC proliferation potency was reduced and with prolonged culture, the ratio of migratory ENCCs was decreased. The percentage of apoptosis showed an upward trend with prolonged intragenerational culture, but showed a downward trend with prolonged culture of combined generations. Furthermore, the percentage of peripherin"+ cells decreased whilst the percentage of GFAP"+ cells increased with age. The results demonstrated that alterations in ENCC growth characteristics occur with increased culture time, which may partially account for the poor results of proposed cell therapies. - Highlights: • Differences were identified between primary and daughter ENCCs. • Daughter ENCCs had reduced proliferation, migration and differentiation. • Daughter ENCCs also had increased apoptosis. • These altered characteristics warrant further investigation.

Decreased proliferative, migrative and neuro-differentiative potential of postnatal rat enteric neural crest-derived cells during culture in vitro

Energy Technology Data Exchange (ETDEWEB)

Yu, Hui [Department of Pediatric Surgery, the Second Affiliated Hospital, Xi’an Jiaotong University, No 157, Xi Wu Road, Xi’an 710004, Shaanxi (China); Institute of Neurobiology, Environment and Genes Related to Diseases Key Laboratory of Chinese Ministry of Education, Xi’an Jiaotong University, No 96, Yan Ta Xi Road, Xi’an 710061, Shaanxi (China); Pan, Wei-Kang; Zheng, Bai-Jun; Wang, Huai-Jie [Department of Pediatric Surgery, the Second Affiliated Hospital, Xi’an Jiaotong University, No 157, Xi Wu Road, Xi’an 710004, Shaanxi (China); Chen, Xin-Lin; Liu, Yong [Institute of Neurobiology, Environment and Genes Related to Diseases Key Laboratory of Chinese Ministry of Education, Xi’an Jiaotong University, No 96, Yan Ta Xi Road, Xi’an 710061, Shaanxi (China); Gao, Ya, E-mail: ygao@mail.xjtu.edu.cn [Department of Pediatric Surgery, the Second Affiliated Hospital, Xi’an Jiaotong University, No 157, Xi Wu Road, Xi’an 710004, Shaanxi (China)

2016-05-01

A growing body of evidence supports the potential use of enteric neural crest-derived cells (ENCCs) as a cell replacement therapy for Hirschsprung's disease. Based on previous observations of robust propagation of primary ENCCs, as opposed to their progeny, it is suggested that their therapeutic potential after in vitro expansion may be restricted. We therefore examined the growth and differentiation activities and phenotypic characteristics of continuous ENCC cultures. ENCCs were isolated from the intestines of postnatal rats and were identified using an immunocytochemical approach. During continuous ENCC culture expansion, proliferation, migration, apoptosis, and differentiation potentials were monitored. The Cell Counting Kit-8 was used for assessment of ENCC vitality, Transwell inserts for cell migration, immunocytochemistry for cell counts and identification, and flow cytometry for apoptosis. Over six continuous generations, ENCC proliferation potency was reduced and with prolonged culture, the ratio of migratory ENCCs was decreased. The percentage of apoptosis showed an upward trend with prolonged intragenerational culture, but showed a downward trend with prolonged culture of combined generations. Furthermore, the percentage of peripherin{sup +} cells decreased whilst the percentage of GFAP{sup +} cells increased with age. The results demonstrated that alterations in ENCC growth characteristics occur with increased culture time, which may partially account for the poor results of proposed cell therapies. - Highlights: • Differences were identified between primary and daughter ENCCs. • Daughter ENCCs had reduced proliferation, migration and differentiation. • Daughter ENCCs also had increased apoptosis. • These altered characteristics warrant further investigation.

Characterization of primary human mammary epithelial cells isolated and propagated by conditional reprogrammed cell culture.

Science.gov (United States)

Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang

2018-02-20

Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.

Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC) Applied to Quantitative Proteomics of Bacillus subtilis

DEFF Research Database (Denmark)

Soufi, Boumediene; Kumar, C.; Gnad, F.

2010-01-01

We applied stable isotope labeling by amino acids in cell culture (SILAC) to large-scale quantitative proteomics analyses of the model bacterium Bacillus subtilis in two physiological conditions: growth on succinate and growth under phosphate starvation. Using a B. subtilis strain auxotrophic...... of the most comprehensive quantitative proteomics studies in bacteria, covering more than 75% of the B. subtilis genes expressed in the log phase of growth. Furthermore, we detect and quantify dynamics of 35 Ser/Thr/Tyr phosphorylation sites under growth on succinate, and 10 phosphorylation sites under...

Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

DEFF Research Database (Denmark)

Claesson, Mogens Helweg; Ropke, C

1990-01-01

We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu......We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level...

In vitro culture and characterization of human lung cancer circulating tumor cells isolated by size exclusion from an orthotopic nude-mouse model expressing fluorescent protein.

Science.gov (United States)

Kolostova, Katarina; Zhang, Yong; Hoffman, Robert M; Bobek, Vladimir

2014-09-01

In the present study, we demonstrate an animal model and recently introduced size-based exclusion method for circulating tumor cells (CTCs) isolation. The methodology enables subsequent in vitro CTC-culture and characterization. Human lung cancer cell line H460, expressing red fluorescent protein (H460-RFP), was orthotopically implanted in nude mice. CTCs were isolated by a size-based filtration method and successfully cultured in vitro on the separating membrane (MetaCell®), analyzed by means of time-lapse imaging. The cultured CTCs were heterogeneous in size and morphology even though they originated from a single tumor. The outer CTC-membranes were blebbing in general. Abnormal mitosis resulting in three daughter cells was frequently observed. The expression of RFP ensured that the CTCs originated from lung tumor. These readily isolatable, identifiable and cultivable CTCs can be used to characterize individual patient cancers and for screening of more effective treatment.

Agent-Based Computational Modeling of Cell Culture ...

Science.gov (United States)

Quantitative characterization of cellular dose in vitro is needed for alignment of doses in vitro and in vivo. We used the agent-based software, CompuCell3D (CC3D), to provide a stochastic description of cell growth in culture. The model was configured so that isolated cells assumed a “fried egg shape” but became increasingly cuboidal with increasing confluency. The surface area presented by each cell to the overlying medium varies from cell-to-cell and is a determinant of diffusional flux of toxicant from the medium into the cell. Thus, dose varies among cells for a given concentration of toxicant in the medium. Computer code describing diffusion of H2O2 from medium into each cell and clearance of H2O2 was calibrated against H2O2 time-course data (25, 50, or 75 uM H2O2 for 60 min) obtained with the Amplex Red assay for the medium and the H2O2-sensitive fluorescent reporter, HyPer, for cytosol. Cellular H2O2 concentrations peaked at about 5 min and were near baseline by 10 min. The model predicted a skewed distribution of surface areas, with between cell variation usually 2 fold or less. Predicted variability in cellular dose was in rough agreement with the variation in the HyPer data. These results are preliminary, as the model was not calibrated to the morphology of a specific cell type. Future work will involve morphology model calibration against human bronchial epithelial (BEAS-2B) cells. Our results show, however, the potential of agent-based modeling

Filtration assay for quantitation of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) specific binding to whole cells in culture

International Nuclear Information System (INIS)

Dold, K.M.; Greenlee, W.F.

1990-01-01

A rapid and sensitive filtration assay for quantitating the specific binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) to whole cells in culture is described. Cell monolayers are incubated with [3H]TCDD in the presence or absence of excess unlabeled ligand, detached from the culture dish with trypsin, filtered, and washed with cold (-78 degrees C) acetone to separate free and nonspecifically bound TCDD from specifically bound TCDD. TCDD receptor binding parameters were characterized in the murine hepatoma cell line Hepa1c1c7. The lower limit of detection of TCDD specific binding was in a sample equivalent to 10 micrograms of total cell protein. The equilibrium dissociation constant and stereospecificity for binding to the TCDD receptor were the same as those previously reported with other TCDD receptor assays on broken cell preparations. Analysis of binding in the murine hepatoma TCDD receptor variants TAO-c1BPrc1 and BPrc1 indicated that this assay will detect receptor number or affinity variants, but will not detect nuclear transfer deficient variants. The major advantage of the whole cell binding assay is that it provides the means to rapidly and reproducibly quantitate TCDD specific binding in small samples of whole cells in culture. In addition, this method eliminates loss or degradation of the receptor protein during the fractionation of cells required in previously reported methods. This method should prove useful in screening clonal cell populations for TCDD receptor number and affinity variants, and in screening for TCDD receptor binding activity in complementation studies of receptor deficient cells

In vitro androgenetic cultures of Hyoscyamus niger L., H. albus L. and alkaloid content assay

Directory of Open Access Journals (Sweden)

Maria Wesołwska

2014-01-01

Full Text Available In vitro cultures of Hyoscyamus niger L. and H. albus L. anthers were initiated which resulted in obtaining androgenectic plants and callus cultures. The leaves of these pants and the callus cultures were subjected to analysis (TLC, GC for the presence of alkaloids, derivatives of tropane. In the studied material, alkaloids of different qualitative and quantitative composition from that of ground-grown plants were found.

In vitro differentiation and maturation of mouse embryonic stem cells into hepatocytes

International Nuclear Information System (INIS)

Ishii, Takamichi; Yasuchika, Kentaro; Fujii, Hideaki; Hoppo, Toshitaka; Baba, Shinji; Naito, Masato; Machimoto, Takafumi; Kamo, Naoko; Suemori, Hirofumi; Nakatsuji, Norio; Ikai, Iwao

2005-01-01

It is difficult to induce the maturation of embryonic stem (ES) cells into hepatocytes in vitro. We previously reported that Thy1-positive mesenchymal cells derived from the mouse fetal liver promote the maturation of hepatic progenitor cells. Here, we isolated alpha-fetoprotein (AFP)-producing cells from mouse ES cells for subsequent differentiation into hepatocytes in vitro by coculture with Thy1-positive cells. ES cells expressing green fluorescent protein (GFP) under the control of an AFP promoter were cultured under serum- and feeder layer-free culture conditions. The proportion of GFP-positive cells plateaued at 41.6 ± 12.2% (means ± SD) by day 7. GFP-positive cells, isolated by flow cytometry, were cultured in the presence or absence of Thy1-positive cells as a feeder layer. Isolated GFP-positive cells were stained for AFP, Foxa2, and albumin. The expression of mRNAs encoding tyrosine amino transferase, tryptophan 2,3-dioxygenase, and glucose-6-phosphatase were only detected following coculture with Thy1-positive cells. Following coculture with Thy1-positive cells, the isolated cells produced and stored glycogen. Ammonia clearance activity was also enhanced following coculture. Electron microscopic analysis indicated that the cocultured cells exhibited the morphologic features of mature hepatocytes. In conclusion, coculture with Thy1-positive cells in vitro induced the maturation of AFP-producing cells isolated from ES cell cultures into hepatocytes

The Next Frontier: Quantitative Biochemistry in Living Cells.

Science.gov (United States)

Honigmann, Alf; Nadler, André

2018-01-09

Researchers striving to convert biology into an exact science foremost rely on structural biology and biochemical reconstitution approaches to obtain quantitative data. However, cell biological research is moving at an ever-accelerating speed into areas where these approaches lose much of their edge. Intrinsically unstructured proteins and biochemical interaction networks composed of interchangeable, multivalent, and unspecific interactions pose unique challenges to quantitative biology, as do processes that occur in discrete cellular microenvironments. Here we argue that a conceptual change in our way of conducting biochemical experiments is required to take on these new challenges. We propose that reconstitution of cellular processes in vitro should be much more focused on mimicking the cellular environment in vivo, an approach that requires detailed knowledge of the material properties of cellular compartments, essentially requiring a material science of the cell. In a similar vein, we suggest that quantitative biochemical experiments in vitro should be accompanied by corresponding experiments in vivo, as many newly relevant cellular processes are highly context-dependent. In essence, this constitutes a call for chemical biologists to convert their discipline from a proof-of-principle science to an area that could rightfully be called quantitative biochemistry in living cells. In this essay, we discuss novel techniques and experimental strategies with regard to their potential to fulfill such ambitious aims.

Multi-development-HPTLC method for quantitation of hyoscyamine, scopolamine and their biosynthetic precursors in selected solanaceae plants grown in natural conditions and as in vitro cultures.

Science.gov (United States)

Jaremicz, Zbigniew; Luczkiewicz, Maria; Kisiel, Mariusz; Zárate, Rafael; El Jaber-Vazdekis, Nabil; Migas, Piotr

2014-01-01

Hyoscyamine and scopolamine, anti-cholinergic agents widely used in medicine, are typically obtained from plants grown under natural conditions. Since field cultivation entails certain difficulties (changeable weather, pests, etc.), attempts have been made to develop a plant in vitro culture system as an alternative source for the production of these compounds. During experiments to locate the limiting steps in the biotechnological procedure, it is important to monitor not only the levels of the final products but also the changes in the concentration of their precursors. To develop a HPTLC method for the separation and quantitation of the main tropane alkaloids hyoscyamine and scopolamine, their respective direct precursors littorine and anisodamine, and cuscohygrine, a product of a parallel biosynthetic pathway that shares a common precursor (N-methyl-∆(1) -pyrrolium cation) with tropane alkaloids. Using alkaloid extracts from Atropa baetica hairy roots, different TLC chromatographic systems and developing procedures were investigated. Full separation of all compounds was obtained on HPTLC Si60 F254 plates preconditioned with mobile phase vapours (chloroform:methanol:acetone:25% ammonia ratios of 75:15:10:1.8, v/v/v/v). The chromatograms were developed twice (at distances of 4.0 and 3.0 cm) in a Camag twin trough chamber and visualised with Dragendorff's reagent. Densitometric detection (λ = 190 and 520 nm) was used for quantitative analyses of the different plant samples. This method can be recommended for quantitation of hyoscyamine, scopolamine, anisodamine, littorine and cuscohygrine in different plant material (field grown vs. in vitro cultures). Copyright © 2013 John Wiley & Sons, Ltd.

Quantitative and informatics tools for studying the effect of low dose radiation on tissue and cell culture

International Nuclear Information System (INIS)

Parvin, B.; Yang, Q.; Fontenay, G.; Barcellos-Hoff, M.H.

2003-01-01

Full text: The challenge of the post-genomic era is functional genomics, i.e., understanding how the genome is expressed to produce myriad cell phenotypes. To use genomic information to understand the biology of complex organisms, one must understand the dynamics of phenotype generation and maintenance. A phenotype is the result of selective expression of the genome. In order to define cell 'phenomes,' one would track the kinetics and quantities of multiple constituent proteins, their cellular context and morphological features in large populations. Our aim is to extend the development of the BioSig imaging bioinformatics system for understanding how ionizing radiation alters tissue homeostasis and responses in cell culture experiments. Given several thousand antibodies and reagents for differentiating cell-specific protein components, biological heterogeneity, and other variables that affect cellular responses, there is a clear requirements for managing images and information about these images. Our focus is on the development of (1) quantitative methods for protein expression either in tissue or cell culture studies, (2) a adequate data model that couples quantitative results with the experimental variables, and (3) browsing and visualization tools that enable exploration of large scale image data in feature space in the context of biological heterogeneity. The framework provides the basis for studying the effect of low-dose radiation on the cellular microenvironment, inter-cell communication, and the underlying mechanisms. In turn, this information can then be used to more accurately predict more complex multicellular biological responses following exposure to different types of inhibitors. The BioSig informatics approach to microscopy and quantitative image analysis has been used to build a more detailed picture of the signaling that occurs between cells, as a result of an exogenous stimulus such as radiation, or as a consequence of endogenous programs leading

The Evolution of Polystyrene as a Cell Culture Material.

Science.gov (United States)

Lerman, Max J; Lembong, Josephine; Muramoto, Shin; Gillen, Greg; Fisher, John P

2018-04-10

Polystyrene (PS) has brought in vitro cell culture from its humble beginnings to the modern era, propelling dozens of research fields along the way. This review discusses the development of the material, fabrication, and treatment approaches to create the culture material. However, native PS surfaces poorly facilitate cell adhesion and growthin vitro. To overcome this, liquid surface deposition, energetic plasma activation, and emerging functionalization methods transform the surface chemistry. This review seeks to highlight the many potential applications of the first widely accepted polymer growth surface. Although the majority of in vitro research occurs on 2D surfaces, the importance of 3D culture models cannot be overlooked. Here the methods to transition PS to specialized 3D culture surfaces are also reviewed. Specifically, casting, electrospinning, 3D printing, and microcarrier approaches to shift PS to a 3D culture surface are highlighted. The breadth of applications of the material makes it impossible to highlight every use, but the aim remains to demonstrate the versatility and potential as both a general and custom cell culture surface. The review concludes with emerging scaffolding approaches and, based on the findings, presents our insights on the future steps for PS as a tissue culture platform.

Quantitative assessment of cancer cell morphology and motility using telecentric digital holographic microscopy and machine learning.

Science.gov (United States)

Lam, Van K; Nguyen, Thanh C; Chung, Byung M; Nehmetallah, George; Raub, Christopher B

2018-03-01

The noninvasive, fast acquisition of quantitative phase maps using digital holographic microscopy (DHM) allows tracking of rapid cellular motility on transparent substrates. On two-dimensional surfaces in vitro, MDA-MB-231 cancer cells assume several morphologies related to the mode of migration and substrate stiffness, relevant to mechanisms of cancer invasiveness in vivo. The quantitative phase information from DHM may accurately classify adhesive cancer cell subpopulations with clinical relevance. To test this, cells from the invasive breast cancer MDA-MB-231 cell line were cultured on glass, tissue-culture treated polystyrene, and collagen hydrogels, and imaged with DHM followed by epifluorescence microscopy after staining F-actin and nuclei. Trends in cell phase parameters were tracked on the different substrates, during cell division, and during matrix adhesion, relating them to F-actin features. Support vector machine learning algorithms were trained and tested using parameters from holographic phase reconstructions and cell geometric features from conventional phase images, and used to distinguish between elongated and rounded cell morphologies. DHM was able to distinguish between elongated and rounded morphologies of MDA-MB-231 cells with 94% accuracy, compared to 83% accuracy using cell geometric features from conventional brightfield microscopy. This finding indicates the potential of DHM to detect and monitor cancer cell morphologies relevant to cell cycle phase status, substrate adhesion, and motility. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

Radiation effects on human glia and glioma cells in vitro

International Nuclear Information System (INIS)

Nilsson, S.

1983-01-01

The radiosensitivity of human glia and glioma cells has been studied in vitro, and a new cloning method has been developed to overcome the difficulties due to the very low cloning efficiency of these cells. The cells were confined to small palladium areas surrounded by agarose, which increased the cell density, but kept the clones separated. Using this method, the glia cells were found to be very sensitive to gamma irradiation (D 0 =1.0-1.5 Gy and n=1) in comparision with the glioma cells (D 0 =1.5-2.5 Gy and n=3.5). The induction and repair of DNA strand breaks were studied with two DNA unwinding techniques. No differences between the two cell-lines were detected when induction and fast repair were studied with the single-labelling method, while the glioma cells showed less unrepaired DNA strand breaks than the glia cells after 1, 2 and 3 hours, when the double-labelling method was used. Detachment, attachment and growth kinetics were studied using the palladium-agarose cloning method. All of the glioma cell-lines studied, detached and attached themselves at rates higher than the normal diploid glia cell-lines. All of the cell-lines contained clones with different properties. Some clones were rapidly growing, others maintained a nearly constant number of cells or even decreased. The effects of chronic hypoxia were tested in a few experiments. Low oxygen tension in the culture medium reduced the rate of growth and the DNA synthesis of the glioma cells. The present study indicates that cultured human glioma cells are less radiosensitive than cultured glia cells. The palladium-agarose technique, enable studying growth kinetics detachment, attachment and radiosensitivity in a quantitative manner for cells with low cloning efficiency. (author)

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

Science.gov (United States)

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Effects of anti-inflammatory compounds on sulfur mustard injured cells: Recommendations and caveats suggested by in vitro cell culture models.

Science.gov (United States)

Menacher, Georg; Steinritz, Dirk; Schmidt, Annette; Popp, Tanja; Worek, Franz; Gudermann, Thomas; Thiermann, Horst; Balszuweit, Frank

2018-09-01

Sulfur mustard (SM) is a vesicant agent who had its first military use 100 years ago, in Ypres. Since then it has been used in several conflicts like the Iran-Iraq war in the 1980s. The use of SM in Syria 2015 indicated the still existing threat. Despite decades of research no causal antidote against SM intoxication is available, so far. A SM intoxication is accompanied by necrosis, apoptosis and inflammation. To counteract the SM-induced inflammation, glucocorticoids and non-steroidal anti-inflammatory compounds (NSAIDs) are recommended. Aim of this study was to evaluate the efficacy of the anti-inflammatory compounds dexamethasone, ibuprofen and diclofenac in vitro. For that purpose, two different cell culture models were used. Firstly, a monoculture of keratinocytes (HaCaT) and secondly, an established co-culture of keratinocytes (HaCaT) and immunocompetent cells (THP-1) to identify the role of immune cells in the process and to mimic the dermal physiology more closely. Both models were challenged with different SM concentrations (100, 200 and 300μM) and treated with different anti-inflammatory compounds one hour after the SM exposure. Analytical analysis of necrosis (ToxiLight), apoptosis (CDDE) and inflammation (IL-6 and -8 ELISAs) followed 24h thereafter. Dexamethasone provided small but consistent protective effects in the monoculture. For the reduction of apoptosis, 3μM dexamethasone was sufficient. The most effective reduction regarding interleukin (IL) production was found with 6μM dexamethasone. Protective effects were less pronounced in co-culture, which implies, that the protective effects of dexamethasone are rather generic and not due to a modulation of the immune cells. Against our expectations, ibuprofen strongly amplified apoptosis and necrosis in SM exposed cells in the monoculture as well as the co-culture. Therefore, use of ibuprofen for treatment of SM intoxication should at least be considered most critically, if not even regarded as

Stochastic modeling of oligodendrocyte generation in cell culture: model validation with time-lapse data

Directory of Open Access Journals (Sweden)

Noble Mark

2006-05-01

Full Text Available Abstract Background The purpose of this paper is two-fold. The first objective is to validate the assumptions behind a stochastic model developed earlier by these authors to describe oligodendrocyte generation in cell culture. The second is to generate time-lapse data that may help biomathematicians to build stochastic models of cell proliferation and differentiation under other experimental scenarios. Results Using time-lapse video recording it is possible to follow the individual evolutions of different cells within each clone. This experimental technique is very laborious and cannot replace model-based quantitative inference from clonal data. However, it is unrivalled in validating the structure of a stochastic model intended to describe cell proliferation and differentiation at the clonal level. In this paper, such data are reported and analyzed for oligodendrocyte precursor cells cultured in vitro. Conclusion The results strongly support the validity of the most basic assumptions underpinning the previously proposed model of oligodendrocyte development in cell culture. However, there are some discrepancies; the most important is that the contribution of progenitor cell death to cell kinetics in this experimental system has been underestimated.

Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

Directory of Open Access Journals (Sweden)

Sandra Pritzkow

Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

Effects of cortisol on the primary response of mouse spleen cell cultures to heterologous erythrocytes

International Nuclear Information System (INIS)

Dracott, B.N.

1974-01-01

Cell viability and the production of direct PFC were studied in mouse spleen cell cultures after cortisol treatment in vivo or in vitro at various times relative to primary stimulation with SRBC in vitro. Cortisol treatment in vivo reduced spleen cell numbers by 88 percent after 48 hr, but cultures of the remaining cells produced as many PFC in vitro as did cultures of equal numbers of normal spleen cells. In normal spleen cell cultures incubated with cortisol for 4 hr prior to the addition of antigen, peak responses of PFC/culture and PFC/10 6 cells occurred 24 hr later than in controls and averaged, respectively, 27 and 141 percent of control values. Minimum viable cell numbers were observed in cortisol-treated cultures after 3 days; thereafter cell numbers gradually increased. These results were not significantly altered when cultures were treated simultaneously with cortisol and antigen. The response was not suppressed if the addition of antigen preceded that of cortisol by more than 4 hr. Suppression was also considerably reduced if fetal calf serum was used when preparing cells for culture

Bacterial Cellulose Shifts Transcriptome and Proteome of Cultured Endothelial Cells Towards Native Differentiation.

Science.gov (United States)

Feil, Gerhard; Horres, Ralf; Schulte, Julia; Mack, Andreas F; Petzoldt, Svenja; Arnold, Caroline; Meng, Chen; Jost, Lukas; Boxleitner, Jochen; Kiessling-Wolf, Nicole; Serbest, Ender; Helm, Dominic; Kuster, Bernhard; Hartmann, Isabel; Korff, Thomas; Hahne, Hannes

2017-09-01

Preserving the native phenotype of primary cells in vitro is a complex challenge. Recently, hydrogel-based cellular matrices have evolved as alternatives to conventional cell culture techniques. We developed a bacterial cellulose-based aqueous gel-like biomaterial, dubbed Xellulin, which mimics a cellular microenvironment and seems to maintain the native phenotype of cultured and primary cells. When applied to human umbilical vein endothelial cells (HUVEC), it allowed the continuous cultivation of cell monolayers for more than one year without degradation or dedifferentiation. To investigate the impact of Xellulin on the endothelial cell phenotype in detail, we applied quantitative transcriptomics and proteomics and compared the molecular makeup of native HUVEC, HUVEC on collagen-coated Xellulin and collagen-coated cell culture plastic (polystyrene).Statistical analysis of 12,475 transcripts and 7831 proteins unveiled massive quantitative differences of the compared transcriptomes and proteomes. K -means clustering followed by network analysis showed that HUVEC on plastic upregulate transcripts and proteins controlling proliferation, cell cycle and protein biosynthesis. In contrast, HUVEC on Xellulin maintained, by and large, the expression levels of genes supporting their native biological functions and signaling networks such as integrin, receptor tyrosine kinase MAP/ERK and PI3K signaling pathways, while decreasing the expression of proliferation associated proteins. Moreover, CD34-an endothelial cell differentiation marker usually lost early during cell culture - was re-expressed within 2 weeks on Xellulin but not on plastic. And HUVEC on Xellulin showed a significantly stronger functional responsiveness to a prototypic pro-inflammatory stimulus than HUVEC on plastic.Taken together, this is one of the most comprehensive transcriptomic and proteomic studies of native and propagated HUVEC, which underscores the importance of the morphology of the cellular

X-ray sensitivity of human tumor cells in vitro

International Nuclear Information System (INIS)

Weichselbaum, R.R.; Nove, J.; Little, J.B.

1980-01-01

Clonally-derived cells from ten human malignant tumors considered radiocurable (breast, neuroblastoma, medulloblastoma) or non-radiocurable (osteosarcoma, hypernephroma, glioblastoma, melanoma) were studied in cell culture and their in vitro x-ray survival curve parameters determined (anti n, D 0 ). There were no significant differences among the tumor cell lines suggesting that survival parameters in vitro do not explain differences in clinical radiocurability. Preliminary investigation with density inhibited human tumor cells indicate that such an approach may yield information regarding inherent cellular differences in radiocurability

Induction of specific suppressor T cells in vitro

International Nuclear Information System (INIS)

Eardley, D.D.; Gershon, R.K.

1976-01-01

We describe conditions for generating sheep red blood cell-specific suppressor T cells in Mishell-Dutton cultures. The production of specific suppressor cells is favored by increasing antigen dose in the initial culture but can be produced by transferring more cells when lower doses of antigen are used. Transfer of small numbers of cells cultured with low doses of antigen leads to a specific helper effect. Transfer of large numbers of educated cells leads to nonspecific suppression. Suppression can be effected by the effluent cells from nylon wool columns which do not make detectable PFC. A fraction of these cells become resistant to treatment with anti-T cell sera and complement after culture. The suppressor cells are radiation sensitive and must be able to synthesize protein to suppress. They take 2 to 3 days of education to reach maximum suppressive efficiency and will not suppress cultures if added 2 to 3 days after culture initiation. Their production is favored by the absence of mercaptoethanol, suggesting that the observed suppression is not ''too much help.'' The ability to generate specific suppressor cells in vitro should be of great benefit in determining the factors that regulate their appearance in vivo

Extracellular mass transport considerations for space flight research concerning suspended and adherent in vitro cell cultures.

Science.gov (United States)

Klaus, David M; Benoit, Michael R; Nelson, Emily S; Hammond, Timmothy G

2004-03-01

Conducting biological research in space requires consideration be given to isolating appropriate control parameters. For in vitro cell cultures, numerous environmental factors can adversely affect data interpretation. A biological response attributed to microgravity can, in theory, be explicitly correlated to a specific lack of weight or gravity-driven motion occurring to, within or around a cell. Weight can be broken down to include the formation of hydrostatic gradients, structural load (stress) or physical deformation (strain). Gravitationally induced motion within or near individual cells in a fluid includes sedimentation (or buoyancy) of the cell and associated shear forces, displacement of cytoskeleton or organelles, and factors associated with intra- or extracellular mass transport. Finally, and of particular importance for cell culture experiments, the collective effects of gravity must be considered for the overall system consisting of the cells, their environment and the device in which they are contained. This does not, however, rule out other confounding variables such as launch acceleration, on orbit vibration, transient acceleration impulses or radiation, which can be isolated using onboard centrifuges or vibration isolation techniques. A framework is offered for characterizing specific cause-and-effect relationships for gravity-dependent responses as a function of the above parameters.

Human adipose-derived stromal/stem cell isolation, culture, and osteogenic differentiation.

Science.gov (United States)

Qureshi, Ammar T; Chen, Cong; Shah, Forum; Thomas-Porch, Caasy; Gimble, Jeffrey M; Hayes, Daniel J

2014-01-01

Annually, more than 200,000 elective liposuction procedures are performed in the United States and over a million worldwide. The ease of harvest and abundance make human adipose-derived stromal/stem cells (hASCs) isolated from lipoaspirates an attractive, readily available source of adult stem cells that have become increasingly popular for use in many studies. Here, we describe common methods for hASC culture, preservation, and osteogenic differentiation. We introduce methods of ceramic, polymer, and composite scaffold synthesis with a description of morphological, chemical, and mechanical characterization techniques. Techniques for scaffold loading are compared, and methods for determining cell loading efficiency and proliferation are described. Finally, we provide both qualitative and quantitative techniques for in vitro assessment of hASC osteogenic differentiation. © 2014 Elsevier Inc. All rights reserved.

The gene expression profiles of canine mammary cancer cells grown with carcinoma-associated fibroblasts (CAFs as a co-culture in vitro

Directory of Open Access Journals (Sweden)

Król Magdalena

2012-03-01

Full Text Available Abstract Background It is supposed that fibroblasts present in tumour microenvironment increase cancer invasiveness and its ability to metastasize but the mechanisms have not been clearly defined yet. Thus, the current study was designed to assess changes in gene expression in five various cancer cell lines grown as a co-culture with the carcinoma-associated fibroblasts (CAFs in vitro. Results A carcinoma-associated fibroblast cell line was isolated from a canine mammary cancer. Then, a co-culture of cancer cells with the CAFs was established and maintained for 72 hrs. Having sorted the cells, a global gene expression in cancer cells using DNA microarrays was examined. The analysis revealed an up-regulation of 100 genes and a down-regulation of 106 genes in the cancer cells grown as a co-culture with the CAFs in comparison to control conditions. The PANTHER binomial statistics tool was applied to determine statistically over-manifested pathways (p Conclusion The results of the current study showed that the co-culturing of cancer cells and the CAFs caused significant changes to the cancer gene expression. The presence of the CAFs in a microenvironment of cancer cells promotes adhesion, angiogenesis and EMT.

Long-Term Storage of Cryptosporidium parvum for In Vitro Culture

NARCIS (Netherlands)

Paziewska-Harris, A.; Schoone, G.; Schallig, H. D. F. H.

2018-01-01

The long-term storage of Cryptosporidium life-cycle stages is a prerequisite for in vitro culture of the parasite. Cryptosporidium parvum oocysts, sporozoites, and intracellular forms inside infected host cells were stored for 6-12 mo in liquid nitrogen utilizing different cryoprotectants (dimethyl

Seed coat removal improves Fe bioavailability in cooked lentils: studies using an in vitro digestion/Caco-2 cell culture model

Science.gov (United States)

This study examined the range of Fe concentration and relative Fe bioavailability of 24 varieties of cooked lentils, as well as the impact of seed coat removal on lentil Fe nutritional quality. Relative Fe bioavailability was assessed by the in vitro/Caco-2 cell culture method. While Fe concentrat...

Response-predictive gene expression profiling of glioma progenitor cells in vitro.

Directory of Open Access Journals (Sweden)

Sylvia Moeckel

Full Text Available High-grade gliomas are amongst the most deadly human tumors. Treatment results are disappointing. Still, in several trials around 20% of patients respond to therapy. To date, diagnostic strategies to identify patients that will profit from a specific therapy do not exist.In this study, we used serum-free short-term treated in vitro cell cultures to predict treatment response in vitro. This approach allowed us (a to enrich specimens for brain tumor initiating cells and (b to confront cells with a therapeutic agent before expression profiling.As a proof of principle we analyzed gene expression in 18 short-term serum-free cultures of high-grade gliomas enhanced for brain tumor initiating cells (BTIC before and after in vitro treatment with the tyrosine kinase inhibitor Sunitinib. Profiles from treated progenitor cells allowed to predict therapy-induced impairment of proliferation in vitro.For the tyrosine kinase inhibitor Sunitinib used in this dataset, the approach revealed additional predictive information in comparison to the evaluation of classical signaling analysis.

Polyurethane acrylates as effective substrates for sustained in vitro culture of human myotubes.

Science.gov (United States)

Andriani, Yosephine; Chua, Jason Min-Wen; Chua, Benjamin Yan-Jiang; Phang, In Yee; Shyh-Chang, Ng; Tan, Wui Siew

2017-07-15

Muscular disease has debilitating effects with severe damage leading to death. Our knowledge of muscle biology, disease and treatment is largely derived from non-human cell models, even though non-human cells are known to differ from human cells in their biochemical responses. Attempts to develop highly sought after in vitro human cell models have been plagued by early cell delamination and difficulties in achieving human myotube culture in vitro. In this work, we developed polyurethane acrylate (PUA) materials to support long-term in vitro culture of human skeletal muscle tissue. Using a constant base with modulated crosslink density we were able to vary the material modulus while keeping surface chemistry and roughness constant. While previous studies have focused on materials that mimic soft muscle tissue with stiffness ca. 12kPa, we investigated materials with tendon-like surface moduli in the higher 150MPa to 2.4GPa range, which has remained unexplored. We found that PUA of an optimal modulus within this range can support human myoblast proliferation, terminal differentiation and sustenance beyond 35days, without use of any extracellular protein coating. Results show that PUA materials can serve as effective substrates for successful development of human skeletal muscle cell models and are suitable for long-term in vitro studies. We developed polyurethane acrylates (PUA) to modulate the human skeletal muscle cell growth and maturation in vitro by controlling surface chemistry, morphology and tuning material's stiffness. PUA was able to maintain muscle cell viability for over a month without any detectable signs of material degradation. The best performing PUA prevented premature cell detachment from the substrate which often hampered long-term muscle cell studies. It also supported muscle cell maturation up to the late stages of differentiation. The significance of these findings lies in the possibility to advance studies on muscle cell biology, disease and

Isolation and culture of porcine neural progenitor cells from embryos and pluripotent stem cells

DEFF Research Database (Denmark)

Rasmussen, Mikkel Aabech; Hall, Vanessa Jane; Hyttel, Poul

2013-01-01

from porcine embryos or induced pluripotent stem cells is presented. The neural induction is performed in coculture and the isolation of rosette structures is carried out manually to ensure a homogenous population of NPCs. Using this method, multipotent NPCs can be obtained in approximately 1 month......The isolation and culture of neural progenitor cells (NPCs) from pluripotent stem cells has facilitated in vitro mechanistic studies of diseases related to the nervous system, as well as discovery of new medicine. In addition, NPCs are envisioned to play a crucial role in future cell replacement...... therapy. The pig has become recognized as an important large animal model and establishment of in vitro-derived porcine NPCs would allow for preclinical safety testing by transplantation in a porcine biomedical model. In this chapter, a detailed method for isolation and in vitro culture of porcine NPCs...

Internalisation of engineered nanoparticles into mammalian cells in vitro: influence of cell type and particle properties

International Nuclear Information System (INIS)

Busch, Wibke; Bastian, Susanne; Trahorsch, Ulrike; Iwe, Maria; Kühnel, Dana; Meißner, Tobias; Springer, Armin; Gelinsky, Michael; Richter, Volkmar; Ikonomidou, Chrysanthy; Potthoff, Annegret; Lehmann, Irina; Schirmer, Kristin

2011-01-01

Cellular internalisation of industrial engineered nanoparticles is undesired and a reason for concern. Here we investigated and compared the ability of seven different mammalian cell cultures in vitro to incorporate six kinds of engineered nanoparticles, focussing on the role of cell type and particle properties in particle uptake. Uptake was examined using light and electron microscopy coupled with energy dispersive X-ray spectroscopy (EDX) for particle element identification. Flow cytometry was applied for semi-quantitative analyses of particle uptake and for exploring the influence on uptake by the phagocytosis inhibitor Cytochalasin D (CytoD). All particles studied were found to enter each kind of cultured cells. Yet, particles were never found within cell nuclei. The presence of the respective particles within the cells was confirmed by EDX. Live-cell imaging revealed the time-dependent process of internalisation of technical nanoparticles, which was exemplified by tungsten carbide particle uptake into the human skin cells, HaCaT. Particles were found to co-localise with lysosomal structures within the cells. The incorporated nanoparticles changed the cellular granularity, as measured by flow cytometry, already after 3 h of exposure in a particle specific manner. By correlating particle properties with flow cytometry data, only the primary particle size was found to be a weakly influential property for particle uptake. CytoD, an inhibitor of actin filaments and therewith of phagocytosis, significantly inhibited the internalisation of particle uptake in only two of the seven investigated cell cultures. Our study, therefore, supports the notion that nanoparticles can enter mammalian cells quickly and easily, irrespective of the phagocytic ability of the cells.

Effect of oviduct epithelial cells on the fertilization and development of sheep oocytes in vitro

DEFF Research Database (Denmark)

Holm, Peter; Irvine, Brendon J.; Armstrong, David T.

1994-01-01

The study examined whether co-culture with oviductal epithelial cells was of benefit to ovine in vitro fertilization ( IVF) and embryo culture procedures utilizing ·a well charac- terized culture system based on a synthetic oviductal fluid medium (SOFM) supple- mented with serum in a 90% N2, 5% 0 2......, 5% C02, atmosphere at 38.6°C. Two experiments were carried out. In Experiment 1, comparison was made between the frequency of fertil- ization and development of in vitro matured ( IVM) oocytes cultured in the absence (Group 1) or presence of oviductal cells for a 24 h (Group 2), 48 h (Group 3) or 96...... h (Group 4) period post insemination. In Experiment 2, comparison was made between the develop- ment of IVM oocytes fertilized and cultured in vitro for 7. 5 days in the absence or presence of oviductal cells with IVM oocytes which had been fertilized in vitro for 20 h in the pres- ence of oviductal...

Quantitative Multilevel Analysis of Central Metabolism in Developing Oilseeds of Oilseed Rape During In Vitro Culture

Energy Technology Data Exchange (ETDEWEB)

Schwender, Jorg [Brookhaven National Lab. (BNL), Upton, NY (United States); Hebbelmann, Inga [Brookhaven National Lab. (BNL), Upton, NY (United States); Heinzel, Nicholas [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany); Hildebrandt, Tatjana [Univ. of Hannover (Germany); Rogers, Alistair [Brookhaven National Lab. (BNL), Upton, NY (United States); Naik, Dhiraj [Brookhaven National Lab. (BNL), Upton, NY (United States); Indian Inst. of Advanced Research Koba, Gujarat (India); Klapperstuck, Matthias [Monash Univ., Melbourne, VIC (Australia); Braun, Hans -Peter [Univ. of Hannover (Germany); Schreiber, Falk [Monash Univ., Melbourne, VIC (Australia); Univ. Halle-Wittenberg, Melbourne (Australia); Denolf, Peter [Bayer CropScience (Belgium); Borisjuk, Ljudmilla [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany); Rolletschek, Hardy [Leibniz Inst. of Plant Genetics and Crop Plant Research, Gatersleben (Germany)

2015-07-01

Seeds provide the basis for many food, feed, and fuel products. Continued increases in seed yield, composition, and quality require an improved understanding of how the developing seed converts carbon and nitrogen supplies into storage. Current knowledge of this process is often based on the premise that transcriptional regulation directly translates via enzyme concentration into flux. In an attempt to highlight metabolic control, we explore genotypic differences in carbon partitioning for in vitro cultured developing embryos of oilseed rape (Brassica napus). We determined biomass composition as well as 79 net fluxes, the levels of 77 metabolites, and 26 enzyme activities with specific focus on central metabolism in nine selected germplasm accessions. We observed a tradeoff between the biomass component fractions of lipid and starch. With increasing lipid content over the spectrum of genotypes, plastidic fatty acid synthesis and glycolytic flux increased concomitantly, while glycolytic intermediates decreased. The lipid/starch tradeoff was not reflected at the proteome level, pointing to the significance of (posttranslational) metabolic control. Enzyme activity/flux and metabolite/flux correlations suggest that plastidic pyruvate kinase exerts flux control and that the lipid/starch tradeoff is most likely mediated by allosteric feedback regulation of phosphofructokinase and ADP-glucose pyrophosphorylase. Also, quantitative data were used to calculate in vivo mass action ratios, reaction equilibria, and metabolite turnover times. Compounds like cyclic 3',5'-AMP and sucrose-6-phosphate were identified to potentially be involved in so far unknown mechanisms of metabolic control. This study provides a rich source of quantitative data for those studying central metabolism..

The use of embryonic stem cell derived bioactive material as a new protein supplement for the in vitro culture of bovine embryos.

Science.gov (United States)

Kim, Eun Young; Lee, Jun Beom; Park, Hyo Young; Jeong, Chang Jin; Riu, Key Zung; Park, Se Pill

2011-06-01

Embryonic stem (ES) cells are expanded versions of the inner cell mass cells that compose the early mammalian blastocyst. Components derived from ES cells may contain various bioactive materials (BM) helpful for early preimplantation embryo growth. In this study, we examined the effect of human ES cell derived BM (hES-BM) on in vitro culture of bovine embryos. When bovine parthenogenetic day 2 embryos were cultured in 10% hES-BM, a significantly higher embryo development rate (44.3%) and increased cell numbers were observed relative to control medium containing 3 mg/ml BSA (19.5%; Pculture environment to support the growth of bovine embryos in vitro (P<0.05). Little difference was observed between 10% hES-BM and 10% FBS treatment in the examined parthenogenetic or in vitro fertilized embryos, although the hES-BM group developed at a slightly better rate. However, the ICM cell numbers were significantly higher in the hES-BM group in irrespective of embryo origin (P<0.05). In addition, the relative levels of pluripotency (Oct4, × 1.8 fold; Nanog. × 3.3 fold), embryogenesis (Stat3, × 2.8 fold; FGF4, × 18.8 fold; E-cad, × 2.0 fold) and growth (Glut5, × 2.6 fold) genes were significantly higher in the 10% hES-BM group than in the 10% FBS group (P<0.05), while the levels of other genes (Bax, Bcl2, MnSOD and Connexin43) were not different. This is the first report examining the positive effects of hES-BM on bovine embryo development in vitro. Based on our results, we conclude that hES-BM can be used as a new protein supplement for bovine preimplantation embryo development.

Three-dimensional printing of Hela cells for cervical tumor model in vitro

International Nuclear Information System (INIS)

Zhao, Yu; Yao, Rui; Ouyang, Liliang; Ding, Hongxu; Zhang, Ting; Sun, Wei; Zhang, Kaitai; Cheng, Shujun

2014-01-01

Advances in three-dimensional (3D) printing have enabled the direct assembly of cells and extracellular matrix materials to form in vitro cellular models for 3D biology, the study of disease pathogenesis and new drug discovery. In this study, we report a method of 3D printing for Hela cells and gelatin/alginate/fibrinogen hydrogels to construct in vitro cervical tumor models. Cell proliferation, matrix metalloproteinase (MMP) protein expression and chemoresistance were measured in the printed 3D cervical tumor models and compared with conventional 2D planar culture models. Over 90% cell viability was observed using the defined printing process. Comparisons of 3D and 2D results revealed that Hela cells showed a higher proliferation rate in the printed 3D environment and tended to form cellular spheroids, but formed monolayer cell sheets in 2D culture. Hela cells in 3D printed models also showed higher MMP protein expression and higher chemoresistance than those in 2D culture. These new biological characteristics from the printed 3D tumor models in vitro as well as the novel 3D cell printing technology may help the evolution of 3D cancer study. (paper)

Buffalo (Bubalus bubalis in vitro embryo production in two different defined culture media

Directory of Open Access Journals (Sweden)

B. Gasparrini

2011-03-01

Full Text Available In vitro embryo production (IVEP is largely applied world wide to animal breeding. One of the principal steps of the IVEP is represented by embryo culture (Khurana and Niemann., 2000. In the past, embryos were grown in co-culture systems with other cells such as oviductal epithelial cells, cumulus cells, Buffalo rat liver (BRL and VERO cells (Duszewska et al., 2000. These cells are able to supply the nutrients for embryo development by their replication and metabolism. Nevertheless, the metabolic activity of these cells is also responsible of an early lowering of pH in the culture medium: that needs to be changed every two days. Furthermore, with this culture system it is impossible to standardize all the procedure: in fact the result is dependent from several variables, as the quality of the cells and their concentration in co-culture. The use of defined culture media is necessary to acquire a better comprehension of metabolism and biochemical requirements for IVEP........

Characterizing parameters of Jatropha curcas cell cultures for microgravity studies

Science.gov (United States)

Vendrame, Wagner A.; Pinares, Ania

2013-06-01

Jatropha (Jatropha curcas) is a tropical perennial species identified as a potential biofuel crop. The oil is of excellent quality and it has been successfully tested as biodiesel and in jet fuel mixes. However, studies on breeding and genetic improvement of jatropha are limited. Space offers a unique environment for experiments aiming at the assessment of mutations and differential gene expression of crops and in vitro cultures of plants are convenient for studies of genetic variation as affected by microgravity. However, before microgravity studies can be successfully performed, pre-flight experiments are necessary to characterize plant material and validate flight hardware environmental conditions. Such preliminary studies set the ground for subsequent spaceflight experiments. The objectives of this study were to compare the in vitro growth of cultures from three explant sources (cotyledon, leaf, and stem sections) of three jatropha accessions (Brazil, India, and Tanzania) outside and inside the petriGAP, a modified group activation pack (GAP) flight hardware to fit petri dishes. In vitro jatropha cell cultures were established in petri dishes containing a modified MS medium and maintained in a plant growth chamber at 25 ± 2 °C in the dark. Parameters evaluated were surface area of the explant tissue (A), fresh weight (FW), and dry weight (DW) for a period of 12 weeks. Growth was observed for cultures from all accessions at week 12, including subsequent plantlet regeneration. For all accessions differences in A, FW and DW were observed for inside vs. outside the PetriGAPs. Growth parameters were affected by accession (genotype), explant type, and environment. The type of explant influenced the type of cell growth and subsequent plantlet regeneration capacity. However, overall cell growth showed no abnormalities. The present study demonstrated that jatropha in vitro cell cultures are suitable for growth inside PetriGAPs for a period of 12 weeks. The parameters

A simple, specific high-throughput enzyme-linked immunosorbent assay (ELISA) for quantitative determination of melatonin in cell culture medium.

Science.gov (United States)

Li, Ye; Cassone, Vincent M

2015-09-01

A simple, specific, high-throughput enzyme-linked immunosorbent assay (ELISA) for quantitative determination of melatonin was developed for directly measuring melatonin in cell culture medium with 10% FBS. This assay adopts a commercial monoclonal melatonin antibody and melatonin-HRP conjugate, so it can be applied in multiple labs rapidly with low cost compared with commercial RIA and ELISA kits. In addition, the procedure is much simpler with only four steps: 1) sample/conjugate incubation, 2) plate washing, 3) TMB color reaction and 4) reading of results. The standards of the assay cover a wide working range from 100 pg/mL to 10 ng/mL. The sensitivity was 68 pg/mL in cell culture medium with 10% FBS and 26 pg/mL in PBS with as little as 25 μL sample volume. The recovery of melatonin from cell culture medium was 101.0%. The principal cross-reacting compound was 5-methoxytryptophol (0.1%). The variation coefficients of the assay, within and between runs, ranged between 6.68% and 15.76% in cell culture medium. The mean linearity of a series diluted cell culture medium sample was 105% (CV=5%), ranging between 98% and 111%, y=5.5263x+0.0646, R(2)=0.99. The assay enables small research and teaching labs to reliably measure this important neurohormone. Copyright © 2015 Elsevier B.V. All rights reserved.

Radioimmunoassay to quantitatively measure cell surface immunoglobulins

International Nuclear Information System (INIS)

Krishman, E.C.; Jewell, W.R.

1975-01-01

A radioimmunoassay techniques developed to quantitatively measure the presence of immunoglobulins on the surface of cells, is described. The amount of immunoglobulins found on different tumor cells varied from 200 to 1140 ng/10 6 cells. Determination of immunoglobulins on the peripheral lymphocytes obtained from different cancer patients varied between 340 to 1040 ng/10 6 cells. Cultured tumor cells, on the other hand, were found to contain negligible quantities of human IgG [pt

Quantitative Ultrasound Characterization of Cancer Radiotherapy Effects In Vitro

International Nuclear Information System (INIS)

Vlad, Roxana M.; Alajez, Nehad M.; Giles, Anoja B.Sc.; Kolios, Michael C.; Czarnota, Gregory J.

2008-01-01

Purpose: Currently, no routinely used imaging modality is available to assess tumor responses to cancer treatment within hours to days after radiotherapy. In this study, we demonstrate the preclinical application of quantitative ultrasound methods to characterize the cellular responses to cancer radiotherapy in vitro. Methods and Materials: Three different cell lines were exposed to radiation doses of 2-8 Gy. Data were collected with an ultrasound scanner using frequencies of 10-30 MHz. As indicators of response, ultrasound integrated backscatter and spectral slope were determined from the cell samples. These parameters were corrected for ultrasonic attenuation by measuring the attenuation coefficient. Results: A significant increase in the ultrasound integrated backscatter of 4-7 dB (p < 0.001) was found for radiation-treated cells compared with viable cells at all radiation doses. The spectral slopes decreased in the cell samples that predominantly underwent mitotic arrest/catastrophe after radiotherapy, consistent with an increase in cell size. In contrast, the spectral slopes did not change significantly in the cell samples that underwent a mix of cell death (apoptosis and mitotic arrest), with no significant change in average cell size. Conclusion: The changes in ultrasound integrated backscatter and spectral slope were direct consequences of cell and nuclear morphologic changes associated with cell death. The results indicate that this combination of quantitative ultrasonic parameters has the potential to assess the cell responses to radiation, differentiate between different types of cell death, and provide a preclinical framework to monitor tumor responses in vivo

Bridging the gap between cell culture and live tissue

Directory of Open Access Journals (Sweden)

Stefan Przyborski

2017-11-01

Full Text Available Traditional in vitro two-dimensional (2-D culture systems only partly imitate the physiological and biochemical features of cells in their original tissue. In vivo, in organs and tissues, cells are surrounded by a three-dimensional (3-D organization of supporting matrix and neighbouring cells, and a gradient of chemical and mechanical signals. Furthermore, the presence of blood flow and mechanical movement provides a dynamic environment (Jong et al., 2011. In contrast, traditional in vitro culture, carried out on 2-D plastic or glass substrates, typically provides a static environment, which, however is the base of the present understanding of many biological processes, tissue homeostasis as well as disease. It is clear that this is not an exact representation of what is happening in vivo and the microenvironment provided by in vitro cell culture models are significantly different and can cause deviations in cell response and behaviour from those distinctive of in vivo tissues. In order to translate the present basic knowledge in cell control, cell repair and regeneration from the laboratory bench to the clinical application, we need a better understanding of the cell and tissue interactions. This implies a detailed comprehension of the natural tissue environment, with its organization and local signals, in order to more closely mimic what happens in vivo, developing more physiological models for efficient in vitro systems. In particular, it is imperative to understand the role of the environmental cues which can be mainly divided into those of a chemical and mechanical nature.

In vitro formation of the Merkel cell-neurite complex in embryonic mouse whiskers using organotypic co-cultures.

Science.gov (United States)

Ishida, Kentaro; Saito, Tetsuichiro; Mitsui, Toshiyuki

2018-06-01

A Merkel cell-neurite complex is a touch receptor composed of specialized epithelial cells named Merkel cells and peripheral sensory nerves in the skin. Merkel cells are found in touch-sensitive skin components including whisker follicles. The nerve fibers that innervate Merkel cells of a whisker follicle extend from the maxillary branch of the trigeminal ganglion. Whiskers as a sensory organ attribute to the complicated architecture of the Merkel cell-neurite complex, and therefore it is intriguing how the structure is formed. However, observing the dynamic process of the formation of a Merkel cell-neurite complex in whiskers during embryonic development is still difficult. In this study, we tried to develop an organotypic co-culture method of a whisker pad and a trigeminal ganglion explant to form the Merkel cell-neurite complex in vitro. We initially developed two distinct culture methods of a single whisker row and a trigeminal ganglion explant, and then combined them. By dissecting and cultivating a single row from a whisker pad, the morphogenesis of whisker follicles could be observed under a microscope. After the co-cultivation of the whisker row with a trigeminal ganglion explant, a Merkel cell-neurite complex composed of Merkel cells, which were positive for both cytokeratin 8 and SOX2, Neurofilament-H-positive trigeminal nerve fibers and Schwann cells expressing Nestin, SOX2 and SOX10 was observed via immunohistochemical analyses. These results suggest that the process for the formation of a Merkel cell-neurite complex can be observed under a microscope using our organotypic co-culture method. © 2018 Japanese Society of Developmental Biologists.

Radiosensitivity of stromal cells responsible for in vitro maintenance of hemopoietic stem cells in continuous, long-term marrow culture. [/sup 137/Cs; Mice

Energy Technology Data Exchange (ETDEWEB)

Tavassoli, M

1982-05-01

Marrow stromal cells are generally thought to be radioresistant. However, when the marrow was irradiated in vivo or in vitro before its use for the continuous longterm marrow culture, doses of radiation as low as 500 rad interfered with the establishment of the adherent stromal layer. Moreover, when the stromal layer was permitted to establish, similar doses of radiation interfered with its potential to support the proliferation and maintenance of the hemopoietic stem cell. Thus, marrow stromal cells appear to be more radiosensitive than hitherto thought. The type of damage may vary, however, according to the dose of radiation. Small doses may interfere with such functions as adhesion or cell division while larger doses may completely destroy the cell.

Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

Science.gov (United States)

Bonazza, Camila; Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Batista, Fabrício Pereira; Paredes-Gamero, Edgar J; Girão, Manoel J B C; Oliva, Maria Luiza V; Castro, Rodrigo Aquino

2016-01-01

Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2) and progesterone (P4) effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation). These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

Cell cultures in uterine leiomyomas: rapid disappearance of cells carrying MED12 mutations.

Science.gov (United States)

Nadine Markowski, Dominique; Tadayyon, Mahboobeh; Bartnitzke, Sabine; Belge, Gazanfer; Maria Helmke, Burkhard; Bullerdiek, Jörn

2014-04-01

Uterine leiomyomas (UL) are the most frequent symptomatic human tumors. Nevertheless, their molecular pathogenesis is not yet fully understood. To learn more about the biology of these common neoplasms and their response to treatment, cell cultures derived from UL are a frequently used model system, but until recently appropriate genetic markers confirming their origin from the tumor cell population were lacking for most UL, i.e., those not displaying karyotypic abnormalities. The identification of MED12 mutations in the majority of UL makes it possible to trace the tumor cell population during in vitro passaging in the absence of cytogenetic abnormalities. The present study is addressing the in vitro survival of cells carrying MED12 mutations and its association with karyotypic alterations. The results challenge numerous in vitro studies into the biology and behavior of leiomyomas. Cells of one genetic subtype of UL, i.e., those with rearrangements of the high mobility AT-hook 2 protein gene (HMGA2), seem to be able to proliferate in vitro for many passages whereas tumor cells from the much more frequent MED12-mutated lesions barely survive even the first passages. Apparently, for the most frequent type of human UL no good in vitro model seems to exist because cells do not survive culturing. On the other hand, this inability may point to an Achilles' heel of this type of UL. Copyright © 2014 Wiley Periodicals, Inc.

Cellular automata model for human articular chondrocytes migration, proliferation and cell death: An in vitro validation.

Science.gov (United States)

Vaca-González, J J; Gutiérrez, M L; Guevara, J M; Garzón-Alvarado, D A

2017-01-01

Articular cartilage is characterized by low cell density of only one cell type, chondrocytes, and has limited self-healing properties. When articular cartilage is affected by traumatic injuries, a therapeutic strategy such as autologous chondrocyte implantation is usually proposed for its treatment. This approach requires in vitro chondrocyte expansion to yield high cell number for cell transplantation. To improve the efficiency of this procedure, it is necessary to assess cell dynamics such as migration, proliferation and cell death during culture. Computational models such as cellular automata can be used to simulate cell dynamics in order to enhance the result of cell culture procedures. This methodology has been implemented for several cell types; however, an experimental validation is required for each one. For this reason, in this research a cellular automata model, based on random-walk theory, was devised in order to predict articular chondrocyte behavior in monolayer culture during cell expansion. Results demonstrated that the cellular automata model corresponded to cell dynamics and computed-accurate quantitative results. Moreover, it was possible to observe that cell dynamics depend on weighted probabilities derived from experimental data and cell behavior varies according to the cell culture period. Thus, depending on whether cells were just seeded or proliferated exponentially, culture time probabilities differed in percentages in the CA model. Furthermore, in the experimental assessment a decreased chondrocyte proliferation was observed along with increased passage number. This approach is expected to having other uses as in enhancing articular cartilage therapies based on tissue engineering and regenerative medicine.

In vitro propagation of male germline stem cells from piglets.

Science.gov (United States)

Zheng, Yi; Tian, Xiue; Zhang, Yaqing; Qin, Jinzhou; An, Junhui; Zeng, Wenxian

2013-07-01

To study the effects of serum and growth factors on propagation of porcine male germline stem cells (MGSCs) in vitro and develop a culture system for these stem cells. Fresh testicular cells from neonatal piglets were obtained by mechanical dissociation and collagenase-trypsin digestion. After differential plating, non-adhering cells were cultured in media supplemented with different concentrations of serum (0, 1 %, 2 %, 5 %, 10 %). After 10 days of primary culture, the cells were maintained in media supplemented with different concentrations of growth factors (basic fibroblast growth factor and epidermal growth factor at 1, 5, 10 ng/ml). The number of MGSC-derived colonies with different sizes was determined in each treatment to assess the effects of serum concentrations and growth factors. The number of MGSC-derived colonies was significantly higher in the presence of 1 % rather than 10 % fetal bovine serum (FBS). Basic fibroblast growth factor (bFGF) at 1, 5 ng/ml and epidermal growth factor (EGF) at 5, 10 ng/ml significantly promoted colony formation. Immunocytochemistry, reverse transcriptase-polymerase chain reaction (RT-PCR) and xenotransplantation assays demonstrated the presence of functional stem cells in cultured cell population. In vitro propagation of porcine MGSCs could be maintained in the presence of 1 % FBS and supplementation of growth factors for 1 month.

Osteogenic Differentiation of Three-Dimensional Bioprinted Constructs Consisting of Human Adipose-Derived Stem Cells In Vitro and In Vivo.

Directory of Open Access Journals (Sweden)

Xiao-Fei Wang

Full Text Available Here, we aimed to investigate osteogenic differentiation of human adipose-derived stem cells (hASCs in three-dimensional (3D bioprinted tissue constructs in vitro and in vivo. A 3D Bio-plotter dispensing system was used for building 3D constructs. Cell viability was determined using live/dead cell staining. After 7 and 14 days of culture, real-time quantitative polymerase chain reaction (PCR was performed to analyze the expression of osteogenesis-related genes (RUNX2, OSX, and OCN. Western blotting for RUNX2 and immunofluorescent staining for OCN and RUNX2 were also performed. At 8 weeks after surgery, osteoids secreted by osteogenically differentiated cells were assessed by hematoxylin-eosin (H&E staining, Masson trichrome staining, and OCN immunohistochemical staining. Results from live/dead cell staining showed that most of the cells remained alive, with a cell viability of 89%, on day 1 after printing. In vitro osteogenic induction of the 3D construct showed that the expression levels of RUNX2, OSX, and OCN were significantly increased on days 7 and 14 after printing in cells cultured in osteogenic medium (OM compared with that in normal proliferation medium (PM. Fluorescence microscopy and western blotting showed that the expression of osteogenesis-related proteins was significantly higher in cells cultured in OM than in cells cultured in PM. In vivo studies demonstrated obvious bone matrix formation in the 3D bioprinted constructs. These results indicated that 3D bioprinted constructs consisting of hASCs had the ability to promote mineralized matrix formation and that hASCs could be used in 3D bioprinted constructs for the repair of large bone tissue defects.

A comparison of three-dimensional culture systems to evaluate in vitro chondrogenesis of equine bone marrow-derived mesenchymal stem cells.

Science.gov (United States)

Watts, Ashlee E; Ackerman-Yost, Jeremy C; Nixon, Alan J

2013-10-01

To compare in vitro three-dimensional (3D) culture systems that model chondrogenesis of bone marrow-derived mesenchymal stem cells (MSCs). MSCs from five horses 2-3 years of age were consolidated in fibrin 0.3% alginate, 1.2% alginate, 2.5×10(5) cell pellets, 5×10(5) cell pellets, and 2% agarose, and maintained in chondrogenic medium with supplemental TGF-β1 for 4 weeks. Pellets and media were tested at days 1, 14, and 28 for gene expression of markers of chondrogenic maturation and hypertrophy (ACAN, COL2B, COL10, SOX9, 18S), and evaluated by histology (hematoxylin and eosin, Toluidine Blue) and immunohistochemistry (collagen type II and X). alginate, fibrin alginate (FA), and both pellet culture systems resulted in chondrogenic transformation. Adequate RNA was not obtained from agarose cultures at any time point. There was increased COL2B, ACAN, and SOX9 expression on day 14 from both pellet culture systems. On day 28, increased expression of COL2B was maintained in 5×10(5) cell pellets and there was no difference in ACAN and SOX9 between FA and both pellet cultures. COL10 expression was significantly lower in FA cultures on day 28. Collagen type II was abundantly formed in all culture systems except alginate and collagen type X was least in FA hydrogels. equine MSCs respond to 3D culture in FA blended hydrogel and both pellet culture systems with chondrogenic induction. For prevention of terminal differentiation and hypertrophy, FA culture may be superior to pellet culture systems.

The allogeneic umbilical cord mesenchymal stem cells regulate the function of T helper 17 cells from patients with rheumatoid arthritis in an in vitro co-culture system

Directory of Open Access Journals (Sweden)

Wang Qin

2012-12-01

Full Text Available Abstract Background Previous in vivo studies have shown that mesenchymal stem cell (MSC transplantation significantly improves the condition of a number of autoimmune diseases including autoimmune cerebrospinal meningitis, multiple sclerosis, glomerulonephritis and systemic lupus erythematosus. Methods To investigate the immunoregulatory effect of stem cell transplantation, human umbilical cord MSCs were co-cultured with peripheral blood mononuclear cells (PBMCs from patients with rheumatoid arthritis (RA. Orphan nuclear receptor gamma (ROR-γ mRNA and protein expression was detected with real-time PCR and Western blotting. Interleukin (IL-17, IL-6 and tumor necrosis factor (TNF-α in the cell culture supernatant were measured using a flow cytometric bead capture method. Results After 72 hours of co-culture, the mRNA and protein expression levels of ROR-γ in co-cultured PBMCs were decreased compared with that in PBMC of RA patients cultured alone (p  Conclusions In vitro co-culture with MSCs down-regulated the inflammatory response of PBMCs from RA patients with severe disease activity, but had no significant effect on PBMCs from healthy controls or patients with mild disease activity, suggesting that the immunoregulatory role of MSCs may associate with the occurrence of inflammatory mediators.

Tackling bioactive glass excessive in vitro bioreactivity: Preconditioning approaches for cell culture tests.

Science.gov (United States)

Ciraldo, Francesca E; Boccardi, Elena; Melli, Virginia; Westhauser, Fabian; Boccaccini, Aldo R

2018-05-21

Bioactive glasses (BGs) are being increasingly considered for biomedical applications in bone and soft tissue replacement approaches thanks to their ability to form strong bonding with tissues. However, due to their high reactivity once in contact with water-based solutions BGs rapidly exchange ions with the surrounding environment leading in most cases to an undesired increase of the pH under static in vitro conditions (due to alkaline ion "burst release"), making difficult or even impossible to perform cell culture studies. Several pre-conditioning treatments have been therefore proposed in laboratories worldwide to limit this problem. This paper presents an overview of the different strategies that have been put forward to pre-treat BG samples to tackle the pH raise issue in order to enable cell biology studies. The paper also discusses the relevant criteria that determine the selection of the optimal pre-treatment depending on the BG composition and morphology (e.g. particles, scaffolds). Bioactive glasses (BGs), since their discovery in 1971 by L.L Hench, have been widely used for bone replacement and repair, and, more recently, they are becoming highly attractive for bone and soft tissue engineering applications. BGs have in fact the ability to form a strong bond with both hard and soft tissues once in contact with biological fluid. The enhanced interaction of BGs with the biological environment is based on their significant surface bioreactivity. This surface effect of BGs is, on the other hand, problematic for cell biology studies by standard (static) cell culture methods: an excessive bioreactivity leads in most cases to a rapid and dramatic increase of the pH of the surrounding medium, which results in cell death and makes cell culture tests on BG samples impossible. The BG research community has been aware of this for many years and numerous pre-treatments have been proposed by different groups worldwide to limit this problem. For the first time, we have

In vitro culture of higher plants as a tool in the propagation of horticultural crops.

NARCIS (Netherlands)

Pierik, R.L.M.

1988-01-01

In vitro culture of higher plants is the culture, under sterile conditions, of plants, seeds, embryos, organs, explants, tissues, cells and protoplasts on nutrient media. This type of culture has shown spectacular development since 1975, resulting in the production and regeneration of viable

Apple derived cellulose scaffolds for 3D mammalian cell culture.

Directory of Open Access Journals (Sweden)

Daniel J Modulevsky

Full Text Available There are numerous approaches for producing natural and synthetic 3D scaffolds that support the proliferation of mammalian cells. 3D scaffolds better represent the natural cellular microenvironment and have many potential applications in vitro and in vivo. Here, we demonstrate that 3D cellulose scaffolds produced by decellularizing apple hypanthium tissue can be employed for in vitro 3D culture of NIH3T3 fibroblasts, mouse C2C12 muscle myoblasts and human HeLa epithelial cells. We show that these cells can adhere, invade and proliferate in the cellulose scaffolds. In addition, biochemical functionalization or chemical cross-linking can be employed to control the surface biochemistry and/or mechanical properties of the scaffold. The cells retain high viability even after 12 continuous weeks of culture and can achieve cell densities comparable with other natural and synthetic scaffold materials. Apple derived cellulose scaffolds are easily produced, inexpensive and originate from a renewable source. Taken together, these results demonstrate that naturally derived cellulose scaffolds offer a complementary approach to existing techniques for the in vitro culture of mammalian cells in a 3D environment.

In vitro models of the blood–brain barrier: An overview of commonly used brain endothelial cell culture models and guidelines for their use

Science.gov (United States)

Helms, Hans C; Abbott, N Joan; Burek, Malgorzata; Cecchelli, Romeo; Couraud, Pierre-Olivier; Deli, Maria A; Förster, Carola; Galla, Hans J; Romero, Ignacio A; Shusta, Eric V; Stebbins, Matthew J; Vandenhaute, Elodie; Weksler, Babette

2016-01-01

The endothelial cells lining the brain capillaries separate the blood from the brain parenchyma. The endothelial monolayer of the brain capillaries serves both as a crucial interface for exchange of nutrients, gases, and metabolites between blood and brain, and as a barrier for neurotoxic components of plasma and xenobiotics. This “blood-brain barrier” function is a major hindrance for drug uptake into the brain parenchyma. Cell culture models, based on either primary cells or immortalized brain endothelial cell lines, have been developed, in order to facilitate in vitro studies of drug transport to the brain and studies of endothelial cell biology and pathophysiology. In this review, we aim to give an overview of established in vitro blood–brain barrier models with a focus on their validation regarding a set of well-established blood–brain barrier characteristics. As an ideal cell culture model of the blood–brain barrier is yet to be developed, we also aim to give an overview of the advantages and drawbacks of the different models described. PMID:26868179

In vitro cultures of Salvia officinalis L. as a source of antioxidant compounds

Directory of Open Access Journals (Sweden)

Izabela Grzegorczyk

2011-01-01

Full Text Available The concentrations of carnosic acid, carnosol and rosmarinic acid in different materials from differentiated (multiple shoot cultures and regenerated plants and undifferentiated (callus and cell suspension in vitro cultures of Salvia officinalis were determined by HPLC. The results suggested that diterpenoid (carnosic acid and carnosol production is closely related to shoot differentiation. The highest diterpenoid yield (11.4 mg g-1 for carnosic acid and 1.1 mg g-1 for carnosol was achieved in shoots of 10-week-old micropropagated plants. The levels were comparable to those found in shoots of naturally growing plants. Undifferentiated callus and cell suspension cultures produced only very low amounts of carnosol (ca. 0.05 mg g-1 of dry weight. In contrast, content of rosmarinic acid in callus and suspension cultures as well as shoots growing in vitro and in vivo was similar and ranged between 11.2 and 18.6 mg g-1 of dry weight.

Quantitative evaluation of endothelial cell attachment to vascular graft materials using In-111 Oxine label

Energy Technology Data Exchange (ETDEWEB)

Park, H.M.; Kesler, K.A.; Stinson, J.; Mock, B.; Arnold, M.

1985-05-01

Human umbilical vein endothelial cells were harvested, cultured and labeled with In-111 oxine using a modification of the technique described by Sharefkin et al. Average cell labeling efficiency was 42%. Two graft materials, polytetrafluoroethylene (Gortex) and polyester elastomer (Hytrel), with and without pretreatment with human fibronectin (FN) were incubated with the labeled cells. Quantitation of In-111 activity was done 3 times: at inoculation, after incubation (attachment) and after 1 hr of in vitro perfusion (retention). The average attachment ranged from 53% to 99.5%. The In-111 activity attached ranged from 10 to 20 ..mu..Ci per graft. A gamma camera with medium energy collimator and two pulse height analyzers for 173 and 247 keV photons with 20% window and an on-line computer was used. Images were obtained in 1.5 zoom mode. The count rate response to a In-111 point source up to 150 ..mu..Ci was linear. The results indicate Hytrel permits better endothelial cell attachment than Gortex and FN coating enhances the strength of attachment to both graft materials. The authors conclude that In-111 Oxine labeling is a reliable method for quantitatively evaluating endothelial cell attachment to vascular graft materials.

Effect of Excess Gravitational Force on Cultured Myotubes in Vitro

Directory of Open Access Journals (Sweden)

Shigehiro Hashimoto

2013-06-01

Full Text Available An effect of an excess gravitational force on cultured myoblasts has been studied in an experimental system with centrifugal force in vitro. Mouse myoblasts (C2C12 were seeded on a culture dish of 35 mm diameter, and cultured in the Dulbecco's Modified Eagle's Medium until the sub-confluent condition. To apply the excess gravitational force on the cultured cells, the dish was set in a conventional centrifugal machine. Constant gravitational force was applied to the cultured cells for three hours. Variations were made on the gravitational force (6 G, 10 G, 100 G, 500 G, and 800 G with control of the rotational speed of the rotator in the centrifugal machine. Morphology of the cells was observed with a phasecontrast microscope for eight days. The experimental results show that the myotube thickens day by day after the exposure to the excess gravitational force field. The results also show that the higher excess gravitational force thickens myotubes. The microscopic study shows that myotubes thicken with fusion each other.

Examination of tetrachlorosalicylanilide (TCSA) photoallergy using in vitro photohapten-modified Langerhans cell-enriched epidermal cells

International Nuclear Information System (INIS)

Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.

1991-01-01

Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent

Sildenafil Effect on Nitric Oxide Secretion by Normal Human Endometrial Epithelial Cells Cultured In vitro

Directory of Open Access Journals (Sweden)

Farzaneh Chobsaz

2011-01-01

Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.

Feeder Cell Type Affects the Growth of In Vitro Cultured Bovine Trophoblast Cells

Directory of Open Access Journals (Sweden)

Islam M. Saadeldin

2017-01-01

Full Text Available Trophectoderm cells are the foremost embryonic cells to differentiate with prospective stem-cell properties. In the current study, we aimed at improving the current approach for trophoblast culture by using granulosa cells as feeders. Porcine granulosa cells (PGCs compared to the conventional mouse embryonic fibroblasts (MEFs were used to grow trophectoderm cells from hatched bovine blastocysts. Isolated trophectoderm cells were monitored and displayed characteristic epithelial/cuboidal morphology. The isolated trophectoderm cells expressed mRNA of homeobox protein (CDX2, cytokeratin-8 (KRT8, and interferon tau (IFNT. The expression level was higher on PGCs compared to MEFs throughout the study. In addition, primary trophectoderm cell colonies grew faster on PGCs, with a doubling time of approximately 48 hrs, compared to MEFs. PGCs feeders produced a fair amount of 17β-estradiol and progesterone. We speculated that the supplementation of sex steroids and still-unknown factors during the trophoblasts coculture on PGCs have helped to have better trophectoderm cell’s growth than on MEFs. This is the first time to use PGCs as feeders to culture trophectoderm cells and it proved superior to MEFs. We propose PGCs as alternative feeders for long-term culture of bovine trophectoderm cells. This model will potentially benefit studies on the early trophoblast and embryonic development in bovines.

Extracellular matrix components and culture regimen selectively regulate cartilage formation by self-assembling human mesenchymal stem cells in vitro and in vivo.

Science.gov (United States)

Ng, Johnathan; Wei, Yiyong; Zhou, Bin; Burapachaisri, Aonnicha; Guo, Edward; Vunjak-Novakovic, Gordana

2016-12-09

Cartilage formation from self-assembling mesenchymal stem cells (MSCs) in vitro recapitulate important cellular events during mesenchymal condensation that precedes native cartilage development. The goal of this study was to investigate the effects of cartilaginous extracellular matrix (ECM) components and culture regimen on cartilage formation by self-assembling human MSCs in vitro and in vivo. Human bone marrow-derived MSCs (hMSCs) were seeded and compacted in 6.5-mm-diameter transwell inserts with coated (type I, type II collagen) or uncoated (vehicle) membranes, at different densities (0.5 × 10 6 , 1.0 × 10 6 , 1.5 × 10 6 per insert). Pellets were formed by aggregating hMSCs (0.25 × 10 6 ) in round-bottomed wells. All tissues were cultured for up to 6 weeks for in vitro analyses. Discs (cultured for 6, 8 or 10 weeks) and pellets (cultured for 10 weeks) were implanted subcutaneously in immunocompromised mice to evaluate the cartilage stability in vivo. Type I and type II collagen coatings enabled cartilage disc formation from self-assembling hMSCs. Without ECM coating, hMSCs formed dome-shaped tissues resembling the pellets. Type I collagen, expressed in the prechondrogenic mesenchyme, improved early chondrogenesis versus type II collagen. High seeding density improved cartilage tissue properties but resulted in a lower yield of disc formation. Discs and pellets exhibited compositional and organizational differences in vitro and in vivo. Prolonged chondrogenic induction of the discs in vitro expedited endochondral ossification in vivo. The outcomes of cartilage tissues formed from self-assembling MSCs in vitro and in vivo can be modulated by the control of culture parameters. These insights could motivate new directions for engineering cartilage and bone via a cartilage template from self-assembling MSCs.

Biological Dosimetry of In Vitro Irradiation with Radionuclides : Comparison of Whole Blood, Lymphocyte and Buffy Coat Culture

International Nuclear Information System (INIS)

Kim, Jong Ho; Lee, Dong Soo; Choi, Chang Woon; Chung, June Key; Lee, Myung Chul; Koh, Chang Soon; Kim, Chong Soon; Kim, Hee Geun; Kang, Duck Won; Song, Myung Jae

1995-01-01

The purpose of this study was to establish mononuclear cell cultures such as lymphocytes or buffy coat for the biological dosimetry of in vitro irradiation of the radionuclide Tc-99m in order to exclude the effect of residual doses seen in the cultures of whole blood. Biological dosimetry of Tc-99m on cultured mononuclear cells at doses ranging from 0.05 to 6.00 Gy, by scoring unstable chromosomal aberrations(Ydr) observed in cultured lymphocytes, were performed using peripheral venous blood of healthy normal person. The results showed that; (1) In vitro irradiation of radioisotope in separated lymphocyte or buffy coat showed trace amount af residual doses of isotope after washing. Residual doses of isotopes are increased in proportion tn exposed time and irradiated dose without difference between I-131 anct Tc-99m. (2) We obtained these linear-quadratic dose response equations in lymphocyte and buffy coat culture after in vitro irradiation of Tc-99m, respectively (Ydr = 0,001949 D 2 +0,006279D+ 0.000185; Ydr= 0.002531 D 2 -0.003274 D+0.003488). In conclusion, the linear quadrstic dose response equation from in vitro irradiation of Tc-99m with lymphocyte and buffy coat culture was thought to be useful for assessing Tc-99m indueed biological effects. And mononuclear cell cultures seem to be the most appropriate experimental model for the assessment of biological dosimetry of internal irradiation of radionuclides.

Study on the cytotoxicity of natural killer cells induced by endothelial cells in vitro in the model of xenotransplantation

International Nuclear Information System (INIS)

Huang Haoyue; Shen Zhenya; Liu Hongcheng; Meng Zili; Teng Xiaomei

2004-01-01

Objective: To explore the change of the cytotoxicity of natural killer cells induced by vascular endothelial cells in vitro and the relationship between this change and the variety of cytokine level. Methods: After fixed by paraformaldehyde, vascular endothelial cells from pigs were co-cultured in vitro with natural killer cells from Chinese monkeys at different ratios. The change of the cytotoxicity of natural killer cells occurring after this contact and the content of IFN-γ and TNF-α in the supernatants were detected. Results: The cytotoxicity of natural killer cells improved gradually in accordance with the co-culture ratio after co-cultured with fixed vascular endothelial cells. The secretion of INF-γ and TNF-α also improved gradually. Conclusion: After contact with xeno-target cells, the cytotoxicity of natural killer cells and the secretion of cytokines are related to the ratio of effective cells and target cells

Investigation of in vitro bone cell adhesion and proliferation on Ti using direct current stimulation

International Nuclear Information System (INIS)

Bodhak, Subhadip; Bose, Susmita; Kinsel, William C.; Bandyopadhyay, Amit

2012-01-01

Our objective was to establish an in vitro cell culture protocol to improve bone cell attachment and proliferation on Ti substrate using direct current stimulation. For this purpose, a custom made electrical stimulator was developed and a varying range of direct currents, from 5 to 25 μA, was used to study the current stimulation effect on bone cells cultured on conducting Ti samples in vitro. Cell–material interaction was studied for a maximum of 5 days by culturing with human fetal osteoblast cells (hFOB). The direct current was applied in every 8 h time interval and the duration of electrical stimulation was kept constant at 15 min for all cases. In vitro results showed that direct current stimulation significantly favored bone cell attachment and proliferation in comparison to nonstimulated Ti surface. Immunochemistry and confocal microscopy results confirmed that the cell adhesion was most pronounced on 25 μA direct current stimulated Ti surfaces as hFOB cells expressed higher vinculin protein with increasing amount of direct current. Furthermore, MTT assay results established that cells grew 30% higher in number under 25 μA electrical stimulation as compared to nonstimulated Ti surface after 5 days of culture period. In this work we have successfully established a simple and cost effective in vitro protocol offering easy and rapid analysis of bone cell–material interaction which can be used in promotion of bone cell attachment and growth on Ti substrate using direct current electrical stimulation in an in vitro model. - Highlights: ► D.C. stimulation was used to enhance in vitro bone cell adhesion and proliferation. ► Cells cultured on Ti were stimulated by using a custom made electrical stimulator. ► Optimization was performed by using a varying range of direct currents ∼ 5 to 25 μA. ► 25 μA stimulation was found most beneficial for promotion of cell adhesion/growth.

An In Vitro Study of Differentiation of Hematopoietic Cells to Endothelial Cells

Directory of Open Access Journals (Sweden)

Qi Ru Wang

2011-01-01

medium (ECCM. BM-EPCs were characterized in terms of phenotype, lineage potential, and their functional properties. Endothelial cell colonies derived from BM-EPC were cultured with ECCM for 3 months. Cultured EPC colony cells expressed endothelial cell markers and formed the capillary-like network in vitro. EPC colony cells expressed differential proliferative capacity; some of the colonies exhibited a high proliferative potential (HPP capacity up to 20 population doublings. More importantly, these HPP-EPCs expressed hematopoietic marker CD45, exhibited endocytic activities, and preserved some of the myeloid cell activity. In addition, the HPP-EPCs secrete various growth factors including VEGF and GM-CSF into the culture medium. The results demonstrate that these EPCs were primarily derived from hematopoietic origin of early precursor cells and maintained high proliferative potential capacity, a feature with a significant potential in the application of cell therapy in ischemic diseases.

Influence of cell culture medium composition on in vitro dissolution behavior of a fluoride-containing bioactive glass.

Science.gov (United States)

Shah, Furqan A; Brauer, Delia S; Wilson, Rory M; Hill, Robert G; Hing, Karin A

2014-03-01

Bioactive glasses are used clinically for bone regeneration, and their bioactivity and cell compatibility are often characterized in vitro, using physiologically relevant test solutions. The aim of this study was to show the influence of varying medium characteristics (pH, composition, presence of proteins) on glass dissolution and apatite formation. The dissolution behavior of a fluoride-containing bioactive glass (BG) was investigated over a period of one week in Eagle's Minimal Essential Medium with Earle's Salts (MEM), supplemented with either, (a) acetate buffer, (b) 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer, (c) HEPES + carbonate, or (d) HEPES + carbonate + fetal bovine serum. Results show pronounced differences in pH, ion release, and apatite formation over 1 week: Despite its acidic pH (pH 5.8 after BG immersion, as compared to pH 7.4-8.3 for HEPES-containing media), apatite formation was fastest in acetate buffered (HEPES-free) MEM. Presence of carbonate resulted in formation of calcite (calcium carbonate). Presence of serum proteins, on the other hand, delayed apatite formation significantly. These results confirm that the composition and properties of a tissue culture medium are important factors during in vitro experiments and need to be taken into consideration when interpreting results from dissolution or cell culture studies. Copyright © 2013 Wiley Periodicals, Inc.

A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

Science.gov (United States)

Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

2018-02-01

Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

Directory of Open Access Journals (Sweden)

Camila Bonazza

Full Text Available Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2 and progesterone (P4 effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation. These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

Cultures and co-cultures of human blood mononuclear cells and endothelial cells for the biocompatibility assessment of surface modified AISI 316L austenitic stainless steel

Energy Technology Data Exchange (ETDEWEB)

Stio, Maria; Martinesi, Maria; Treves, Cristina [Dipartimento di Scienze Biomediche, Sperimentali e Cliniche ‘Mario Serio’, Sezione di Scienze Biochimiche, Università di Firenze, viale Morgagni 50, 50134 Firenze (Italy); Borgioli, Francesca, E-mail: francesca.borgioli@unifi.it [Dipartimento di Ingegneria Industriale (DIEF), Università di Firenze, via S. Marta 3, 50139 Firenze (Italy)

2016-12-01

Samples of AISI 316L austenitic stainless steel were subjected either to grinding and polishing procedure, or to grinding and then low temperature glow-discharge nitriding treatment, or to grinding, nitriding and subsequently coating with collagen-I. Nitrided samples, even if only ground, show a higher corrosion resistance in PBS solution, in comparison with ground and polished AISI 316L. Biocompatibility was evaluated in vitro by incubating the samples with either peripheral blood mononuclear cells (PBMC) or human umbilical vein endothelial cells (HUVEC), tested separately or in co-culture. HUVEC-PBMC co-culture and co-incubation of HUVEC with PBMC culture medium, after the previous incubation of PBMC with metallic samples, allowed to determine whether the incubation of PBMC with the different samples might affect HUVEC behaviour. Many biological parameters were considered: cell proliferation, release of cytokines, matrix metalloproteinases (MMPs) and sICAM-1, gelatinolytic activity of MMPs, and ICAM-1 protein expression. Nitriding treatment, with or without collagen coating of the samples, is able to ameliorate some of the biological parameters taken into account. The obtained results point out that biocompatibility may be successfully tested in vitro, using cultures of normal human cells, as blood and endothelial cells, but more than one cell line should be used, separately or in co-culture, and different parameters should be determined, in particular those correlated with inflammatory phenomena. - Highlights: • Nitriding improves corrosion resistance and biocompatibility of ground AISI 316L. • The metallic samples differently affect different human cell cultures. • PBMC and HUVEC are a suitable model to test in vitro biocompatibility. • Co-cultures show that HUVEC are affected by pre-incubation of PBMC with the samples. • Inflammation parameters must be taken into account for assessing biocompatibility.

Cultures and co-cultures of human blood mononuclear cells and endothelial cells for the biocompatibility assessment of surface modified AISI 316L austenitic stainless steel

International Nuclear Information System (INIS)

Stio, Maria; Martinesi, Maria; Treves, Cristina; Borgioli, Francesca

2016-01-01

Samples of AISI 316L austenitic stainless steel were subjected either to grinding and polishing procedure, or to grinding and then low temperature glow-discharge nitriding treatment, or to grinding, nitriding and subsequently coating with collagen-I. Nitrided samples, even if only ground, show a higher corrosion resistance in PBS solution, in comparison with ground and polished AISI 316L. Biocompatibility was evaluated in vitro by incubating the samples with either peripheral blood mononuclear cells (PBMC) or human umbilical vein endothelial cells (HUVEC), tested separately or in co-culture. HUVEC-PBMC co-culture and co-incubation of HUVEC with PBMC culture medium, after the previous incubation of PBMC with metallic samples, allowed to determine whether the incubation of PBMC with the different samples might affect HUVEC behaviour. Many biological parameters were considered: cell proliferation, release of cytokines, matrix metalloproteinases (MMPs) and sICAM-1, gelatinolytic activity of MMPs, and ICAM-1 protein expression. Nitriding treatment, with or without collagen coating of the samples, is able to ameliorate some of the biological parameters taken into account. The obtained results point out that biocompatibility may be successfully tested in vitro, using cultures of normal human cells, as blood and endothelial cells, but more than one cell line should be used, separately or in co-culture, and different parameters should be determined, in particular those correlated with inflammatory phenomena. - Highlights: • Nitriding improves corrosion resistance and biocompatibility of ground AISI 316L. • The metallic samples differently affect different human cell cultures. • PBMC and HUVEC are a suitable model to test in vitro biocompatibility. • Co-cultures show that HUVEC are affected by pre-incubation of PBMC with the samples. • Inflammation parameters must be taken into account for assessing biocompatibility.

In vitro proliferation of adult human beta-cells.

Directory of Open Access Journals (Sweden)

Sabine Rutti

Full Text Available A decrease in functional beta-cell mass is a key feature of type 2 diabetes. Glucagon-like peptide 1 (GLP-1 analogues induce proliferation of rodent beta-cells. However, the proliferative capacity of human beta-cells and its modulation by GLP-1 analogues remain to be fully investigated. We therefore sought to quantify adult human beta-cell proliferation in vitro and whether this is affected by the GLP-1 analogue liraglutide.Human islets from 7 adult cadaveric organ donors were dispersed into single cells. Beta-cells were purified by FACS. Non-sorted cells and the beta-cell enriched ("beta-cells" population were plated on extracellular matrix from rat (804G and human bladder carcinoma cells (HTB9 or bovine corneal endothelial ECM (BCEC. Cells were maintained in culture+/-liraglutide for 4 days in the presence of BrdU.Rare human beta-cell proliferation could be observed either in the purified beta-cell population (0.051±0.020%; 22 beta-cells proliferating out of 84'283 beta-cells counted or in the non-sorted cell population (0.055±0.011%; 104 proliferating beta-cells out of 232'826 beta-cells counted, independently of the matrix or the culture conditions. Liraglutide increased human beta-cell proliferation on BCEC in the non-sorted cell population (0.082±0.034% proliferating beta-cells vs. 0.017±0.008% in control, p<0.05.These results indicate that adult human beta-cell proliferation can occur in vitro but remains an extremely rare event with these donors and particular culture conditions. Liraglutide increases beta-cell proliferation only in the non-sorted cell population and only on BCEC. However, it cannot be excluded that human beta-cells may proliferate to a greater extent in situ in response to natural stimuli.

Development of an in vitro potency assay for human skeletal muscle derived cells.

Science.gov (United States)

Thurner, Marco; Asim, Faheem; Garczarczyk-Asim, Dorota; Janke, Katrin; Deutsch, Martin; Margreiter, Eva; Troppmair, Jakob; Marksteiner, Rainer

2018-01-01

Potency is a quantitative measure of the desired biological function of an advanced therapy medicinal product (ATMP) and is a prerequisite for market approval application (MAA). To assess the potency of human skeletal muscle-derived cells (SMDCs), which are currently investigated in clinical trials for the regeneration of skeletal muscle defects, we evaluated acetylcholinesterase (AChE), which is expressed in skeletal muscle and nervous tissue of all mammals. CD56+ SMDCs were separated from CD56- SMDCs by magnetic activated cell sorting (MACS) and both differentiated in skeletal muscle differentiation medium. AChE activity of in vitro differentiated SMDCs was correlated with CD56 expression, fusion index, cell number, cell doubling numbers, differentiation markers and compared to the clinical efficacy in patients treated with SMDCs against fecal incontinence. CD56- SMDCs did not form multinucleated myotubes and remained low in AChE activity during differentiation. CD56+ SMDCs generated myotubes and increased in AChE activity during differentiation. AChE activity was found to accurately reflect the number of CD56+ SMDCs in culture, their fusion competence, and cell doubling number. In patients with fecal incontinence responding to SMDCs treatment, the improvement of clinical symptoms was positively linked with the AChE activity of the SMDCs injected. AChE activity was found to truly reflect the in vitro differentiation status of SMDCs and to be superior to the mere use of surface markers as it reflects not only the number of myogenic SMDCs in culture but also their fusion competence and population doubling number, thus combining cell quality and quantification of the expected mode of action (MoA) of SMDCs. Moreover, the successful in vitro validation of the assay proves its suitability for routine use. Most convincingly, our results demonstrate a link between clinical efficacy and the AChE activity of the SMDCs preparations used for the treatment of fecal

Isolation and In Vitro Characterization of Epidermal Stem Cells

DEFF Research Database (Denmark)

Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

2017-01-01

flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.

Directory of Open Access Journals (Sweden)

Song-I Chun

Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.

Cell-free DNA in a three-dimensional spheroid cell culture model

DEFF Research Database (Denmark)

Aucamp, Janine; Calitz, Carlemi; Bronkhorst, Abel J.

2017-01-01

Background Investigating the biological functions of cell-free DNA (cfDNA) is limited by the interference of vast numbers of putative sources and causes of DNA release into circulation. Utilization of three-dimensional (3D) spheroid cell cultures, models with characteristics closer to the in vivo...... cultures can serve as effective, simplified in vivo-simulating “closed-circuit” models since putative sources of cfDNA are limited to only the targeted cells. In addition, cfDNA can also serve as an alternative or auxiliary marker for tracking spheroid growth, development and culture stability. Biological...... significance 3D cell cultures can be used to translate “closed-circuit” in vitro model research into data that is relevant for in vivo studies and clinical applications. In turn, the utilization of cfDNA during 3D culture research can optimize sample collection without affecting the stability of the growth...

Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells.

Science.gov (United States)

Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

2017-01-01

Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

Nuclear techniques and in vitro culture for plant improvement

International Nuclear Information System (INIS)

1986-01-01

The continuous series of food shortages in many parts of the world have led scientists to consider the possibilities of using the new techniques to develop better varieties of plants. The basis for plant breeding is suitable genetic variability and mutation induction as the means to create additional variation. In vitro techniques are a relatively new tool in practical plant breeding. These Proceedings contain 62 papers and posters presented at the symposium, as well as excerpts from the discussions. The Symposium presentations are divided into the following sessions: Genetic variation from in vitro culture; Genetic stability of in vitro cultures; In vitro culture with application of mutagens; Haploids; In vitro mutant selection; Use of genetic variation derived by in vitro culture; In vitro techniques as aids in mutation breeding and Genetic engineering. A separate abstract is prepared for each of these papers and posters

Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

Science.gov (United States)

Cassells, Alan C

2012-01-01

The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

Quantifying the correlation between spatially defined oxygen gradients and cell fate in an engineered three-dimensional culture model

OpenAIRE

Ardakani, Amir G.; Cheema, Umber; Brown, Robert A.; Shipley, Rebecca J.

2014-01-01

A challenge in three-dimensional tissue culture remains the lack of quantitative information linking nutrient delivery and cellular distribution. Both in vivo and in vitro, oxygen is delivered by diffusion from its source (blood vessel or the construct margins). The oxygen level at a defined distance from its source depends critically on the balance of diffusion and cellular metabolism. Cells may respond to this oxygen environment through proliferation, death and chemotaxis, resulting in spat...

In vitro germ cell differentiation from cynomolgus monkey embryonic stem cells.

Directory of Open Access Journals (Sweden)

Kaori Yamauchi

Full Text Available BACKGROUND: Mouse embryonic stem (ES cells can differentiate into female and male germ cells in vitro. Primate ES cells can also differentiate into immature germ cells in vitro. However, little is known about the differentiation markers and culture conditions for in vitro germ cell differentiation from ES cells in primates. Monkey ES cells are thus considered to be a useful model to study primate gametogenesis in vitro. Therefore, in order to obtain further information on germ cell differentiation from primate ES cells, this study examined the ability of cynomolgus monkey ES cells to differentiate into germ cells in vitro. METHODS AND FINDINGS: To explore the differentiation markers for detecting germ cells differentiated from ES cells, the expression of various germ cell marker genes was examined in tissues and ES cells of the cynomolgus monkey (Macaca fascicularis. VASA is a valuable gene for the detection of germ cells differentiated from ES cells. An increase of VASA expression was observed when differentiation was induced in ES cells via embryoid body (EB formation. In addition, the expression of other germ cell markers, such as NANOS and PIWIL1 genes, was also up-regulated as the EB differentiation progressed. Immunocytochemistry identified the cells expressing stage-specific embryonic antigen (SSEA 1, OCT-4, and VASA proteins in the EBs. These cells were detected in the peripheral region of the EBs as specific cell populations, such as SSEA1-positive, OCT-4-positive cells, OCT-4-positive, VASA-positive cells, and OCT-4-negative, VASA-positive cells. Thereafter, the effect of mouse gonadal cell-conditioned medium and growth factors on germ cell differentiation from monkey ES cells was examined, and this revealed that the addition of BMP4 to differentiating ES cells increased the expression of SCP1, a meiotic marker gene. CONCLUSION: VASA is a valuable gene for the detection of germ cells differentiated from ES cells in monkeys, and the

Intra-hydrogel culture prevents transformation of mesenchymal stem cells induced by monolayer expansion.

Science.gov (United States)

Jiang, Tongmeng; Liu, Junting; Ouyang, Yiqiang; Wu, Huayu; Zheng, Li; Zhao, Jinmin; Zhang, Xingdong

2018-05-01

In this study, we report that the intra-hydrogel culture system mitigates the transformation of mesenchymal stem cells (MSCs) induced by two-dimensional (2D) expansion. MSCs expanded in monolayer culture prior to encapsulation in collagen hydrogels (group eMSCs-CH) featured impaired stemness in chondrogenesis, comparing with the freshly isolated bone marrow mononuclear cells seeded directly in collagen hydrogels (group fMSCs-CH). The molecular mechanism of the in vitro expansion-triggered damage to MSCs was detected through genome-wide microarray analysis. Results indicated that pathways such as proteoglycans in cancer and pathways in cancer expansion were highly enriched in eMSCs-CH. And multiple up-regulated oncoma-associated genes were verified in eMSCs-CH compared with fMSCs-CH, indicating that expansion in vitro triggered cellular transformation was associated with signaling pathways related to tumorigenicity. Besides, focal adhesion (FA) and mitogen-activated protein kinase (MAPK) signaling pathways were also involved in in vitro expansion, indicating restructuring of the cell architecture. Thus, monolayer expansion in vitro may contribute to vulnerability of MSCs through the regulation of FA and MAPK. This study indicates that intra-hydrogel culture can mitigate the monolayer expansion induced transformation of MSCs and maintain the uniformity of the stem cells, which is a viable in vitro culture system for stem cell therapy.

[Regeneration of autologous tissue-engineered cartilage by using basic-fibroblast growth factor in vitro culture].

Science.gov (United States)

Ding, Xiao-bang; Cheng, Ning-xin; Chen, Bing; Xia, Wan-yao; Cui, Lei; Liu, Wei; Cao, Yi-lin

2004-05-01

To investigate the effect of the basic fibroblast growth factor (b-FGF) to regenerate an autologous tissue-engineered cartilage in vitro. The Cells were harvested from the elastic auricular cartilage of swine,and were plated at the concentration of 1 x 10(4) cells/cm2 , studied in vitro at two different media enviroments: Group I contained Ham's F-12 with supplements and b-FGF, Group II contained Ham's F-12 only with supplements. The passage 2 cells (after 12.75 +/- 1.26 days) were harvested and mixed with 30% pluronic F-127/Ham's F-12 at the concentration of 50 x 10(6) cells/ml. It was injected subcutaneously at 0.5 ml per implant. The implants were harvested 8 weeks after the vivo culture and examined with the histological stains. The chondrocytes displayed morphologically similar to the fibroblasts in the media containing basic-FGF. The number of cell doublings (after 12.75 +/- 1.26 days) in vitro culture was as the following: Group I, 70; Group II, 5.4. Eight 8 weeks after the vivo autologous implantation, the average weight (g) and volume (cm3) in each group was as the following: Group I, 0.371 g/0.370 cm3 Group II, 0.179 g/0.173 cm3 (P < 0.01). With the b-FGF in vitro culture, the cells were expanded by 70 times after 2 weeks. Histologically, all of the engineered cartilage in the two groups were similar to the native elastic cartilage. These results indicate that the basic-FGF could be used positively to enhance the quality and quantity of the seeding cells for the generation of the well-engineered cartilage.

Quantitative proteome changes in Arabidopsis thaliana suspension-cultured cells in response to plant natriuretic peptides

KAUST Repository

Turek, Ilona; Wheeler, Janet I.; Gehring, Christoph A; Irving, Helen R.; Marondedze, Claudius

2015-01-01

Proteome changes in the Arabidopsis thaliana suspension cells in response to the A. thaliana plant natriuretic peptide (PNP), AtPNP-A (At2g18660) were assessed using quantitative proteomics employing tandem mass tag (TMT) labeling and tandem mass spectrometry (LC–MS/MS). In this study, we characterized temporal responses of suspension-cultured cells to 1 nM and 10 pM AtPNP-A at 0, 10 and 30 min post-treatment. Both concentrations we found to yield a distinct differential proteome signature. The data shown in this article are associated with the article “Plant natriuretic peptides induce a specific set of proteins diagnostic for an adaptive response to abiotic stress” by Turek et al. (Front. Plant Sci. 5 (2014) 661) and have been deposited to the ProteomeXchange with identifier PXD001386.

Quantitative proteome changes in Arabidopsis thaliana suspension-cultured cells in response to plant natriuretic peptides

KAUST Repository

Turek, Ilona

2015-06-30

Proteome changes in the Arabidopsis thaliana suspension cells in response to the A. thaliana plant natriuretic peptide (PNP), AtPNP-A (At2g18660) were assessed using quantitative proteomics employing tandem mass tag (TMT) labeling and tandem mass spectrometry (LC–MS/MS). In this study, we characterized temporal responses of suspension-cultured cells to 1 nM and 10 pM AtPNP-A at 0, 10 and 30 min post-treatment. Both concentrations we found to yield a distinct differential proteome signature. The data shown in this article are associated with the article “Plant natriuretic peptides induce a specific set of proteins diagnostic for an adaptive response to abiotic stress” by Turek et al. (Front. Plant Sci. 5 (2014) 661) and have been deposited to the ProteomeXchange with identifier PXD001386.

X-ray microanalysis of single and cultured cells

International Nuclear Information System (INIS)

Wroblewski, J.; Roomans, G.M.

1984-01-01

X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

Using Popular Culture to Teach Quantitative Reasoning

Science.gov (United States)

Hillyard, Cinnamon

2007-01-01

Popular culture provides many opportunities to develop quantitative reasoning. This article describes a junior-level, interdisciplinary, quantitative reasoning course that uses examples from movies, cartoons, television, magazine advertisements, and children's literature. Some benefits from and cautions to using popular culture to teach…

3D Cell Culture in Alginate Hydrogels

Directory of Open Access Journals (Sweden)

Therese Andersen

2015-03-01

Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

Imatinib prevents beta cell death in vitro but does not improve islet transplantation outcome.

Science.gov (United States)

King, Aileen J F; Griffiths, Lisa A; Persaud, Shanta J; Jones, Peter M; Howell, Simon L; Welsh, Nils

2016-05-01

Introduction Improving islet transplantation outcome could not only bring benefits to individual patients but also widen the patient pool to which this life-changing treatment is available. Imatinib has previously been shown to protect beta cells from apoptosis in a variety of in vitro and in vivo models. The aim of this study was to investigate whether imatinib could be used to improve islet transplantation outcome. Methods Islets were isolated from C57Bl/6 mice and pre-cultured with imatinib prior to exposure to streptozotocin and cytokines in vitro. Cell viability and glucose-induced insulin secretion were measured. For transplantation experiments, islets were pre-cultured with imatinib for either 72 h or 24 h prior to transplantation into streptozotocin-diabetic C57Bl/6 mice. In one experimental series mice were also administered imatinib after islet transplantation. Results Imatinib partially protected islets from beta cell death in vitro. However, pre-culturing islets in imatinib or administering the drug to the mice in the days following islet transplantation did not improve blood glucose concentrations more than control-cultured islets. Conclusion Although imatinib protected against beta cell death from cytokines and streptozotocin in vitro, it did not significantly improve syngeneic islet transplantation outcome.

Phthalates Are Metabolised by Primary Thyroid Cell Cultures but Have Limited Influence on Selected Thyroid Cell Functions In Vitro

DEFF Research Database (Denmark)

Hansen, Juliana Frohnert; Brorson, Marianne Møller; Boas, Malene

2016-01-01

Phthalates are plasticisers added to a wide variety of products, resulting in measurable exposure of humans. They are suspected to disrupt the thyroid axis as epidemiological studies suggest an influence on the peripheral thyroid hormone concentration. The mechanism is still unknown as only few...... in vitro studies within this area exist. The aim of the present study was to investigate the influence of three phthalate diesters (di-ethyl phthalate, di-n-butyl phthalate (DnBP), di-(2-ethylhexyl) phthalate (DEHP)) and two monoesters (mono-n-butyl phthalate and mono-(2-ethylhexyl) phthalate (MEHP......)) on the differentiated function of primary human thyroid cell cultures. Also, the kinetics of phthalate metabolism were investigated. DEHP and its monoester, MEHP, both had an inhibitory influence on 3'-5'-cyclic adenosine monophosphate secretion from the cells, and MEHP also on thyroglobulin (Tg) secretion from...

Culturing of PC12 Cells, Neuronal Cells, Astrocytes Cultures and Brain Slices in an Open Microfluidic System

DEFF Research Database (Denmark)

Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane

The brain is the center of the nervous system, where serious neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s are products of functional loss in the neural cells (1). Typical techniques used to investigate these diseases lack precise control of the cellular surroundings......, in addition to isolating the neural tissue from nutrient delivery and to creating unwanted gradients (2). This means that typical techniques used to investigate neurodegenerative diseases cannot mimic in vivo conditions, as closely as desired. We have developed a novel microfluidic system for culturing PC12...... cells, neuronal cells, astrocytes cultures and brain slices. The microfluidic system provides efficient nutrient delivery, waste removal, access to oxygen, fine control over the neurochemical environment and access to modern microscopy. Additionally, the setup consists of an in vitro culturing...

Evidence of In Vitro Preservation of Human Nephrogenesis at the Single-Cell Level

Directory of Open Access Journals (Sweden)

Naomi Pode-Shakked

2017-07-01

Full Text Available During nephrogenesis, stem/progenitor cells differentiate and give rise to early nephron structures that segment to proximal and distal nephron cell types. Previously, we prospectively isolated progenitors from human fetal kidney (hFK utilizing a combination of surface markers. However, upon culture nephron progenitors differentiated and could not be robustly maintained in vitro. Here, by culturing hFK in a modified medium used for in vitro growth of mouse nephron progenitors, and by dissection of NCAM+/CD133− progenitor cells according to EpCAM expression (NCAM+/CD133−/EpCAM−, NCAM+/CD133−/EpCAMdim, NCAM+/CD133−/EpCAMbright, we show at single-cell resolution a preservation of uninduced and induced cap mesenchyme as well as a transitioning mesenchymal-epithelial state. Concomitantly, differentiating and differentiated epithelial lineages are also maintained. In vitro expansion of discrete stages of early human nephrogenesis in nephron stem cell cultures may be used for drug screening on a full repertoire of developing kidney cells and for prospective isolation of mesenchymal or epithelial renal lineages for regenerative medicine.

In vitro Culture of a Novel Genotype of Ehrlichia sp from Brazil

Czech Academy of Sciences Publication Activity Database

Zweygarth, E.; Schol, H.; Lis, K.; Cabezas Cruz, Alejandro; Thiel, C.; Silaghi, C.; Ribeiro, M.F.B.; Passos, L.M.F.

2013-01-01

Roč. 60, NOV 2013 (2013), s. 86-92 ISSN 1865-1674 Grant - others:EU(XE) FP7-PEOPLE-ITN No.238511 Institutional support: RVO:60077344 Keywords : Ehrlichia * Rhipicephalus (Boophilus) microplus * in vitro culture * tick cell * DH82 * endothelial cell * cattle * 16S rRNA * Brazil Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.116, year: 2013

Quantitative evaluation of interleukin-12 p40 gene expression in peripheral blood mononuclear cells.

Science.gov (United States)

Conte, Enrico; Nigro, Luciano; Fagone, Evelina; Drago, Francesco; Cacopardo, Bruno

2008-01-01

The heterodimeric cytokine IL-12 (composed of a p35 and a p40 subunit) is produced primarily by monocytes, macrophages and B cells. In vitro and in vivo experiments have demonstrated the crucial role of IL-12 in initiating and establishing both innate immunity and T cell-mediated resistance to intracellular pathogens, including Leishmania donovani, Toxoplasma gondii, Listeria monocytogenes, and Mycobacterium tuberculosis. Assessment of cytokine expression has thus become crucial to understand host responses to infections. In this study, by using the reverse transcriptase-real time PCR we developed a highly specific and sensitive assay to quantitatively evaluate IL-12p40 mRNA transcription levels in peripheral blood mononuclear cells (PBMCs) stimulated with PHA vs. unstimulated cells. We also used the ELISA to evaluate bioactive IL-12 release in culture supernatants. We provide evidence that IL-12 p40 mRNA levels were significantly up-regulated in PHA-activated PBMCs. These results were correlated with data of IL-12 levels obtained by ELISA.

An All-Recombinant Protein-Based Culture System Specifically Identifies Hematopoietic Stem Cell Maintenance Factors

Directory of Open Access Journals (Sweden)

Aki Ieyasu

2017-03-01

Full Text Available Hematopoietic stem cells (HSCs are considered one of the most promising therapeutic targets for the treatment of various blood disorders. However, due to difficulties in establishing stable maintenance and expansion of HSCs in vitro, their insufficient supply is a major constraint to transplantation studies. To solve these problems we have developed a fully defined, all-recombinant protein-based culture system. Through this system, we have identified hemopexin (HPX and interleukin-1α as responsible for HSC maintenance in vitro. Subsequent molecular analysis revealed that HPX reduces intracellular reactive oxygen species levels within cultured HSCs. Furthermore, bone marrow immunostaining and 3D immunohistochemistry revealed that HPX is expressed in non-myelinating Schwann cells, known HSC niche constituents. These results highlight the utility of this fully defined all-recombinant protein-based culture system for reproducible in vitro HSC culture and its potential to contribute to the identification of factors responsible for in vitro maintenance, expansion, and differentiation of stem cell populations.

Ultrastructural Histopathology of Vervet Monkey Colonic Epithelium After In Vitro Exposure to Cell-free Supernatants of Shigella Cultures

OpenAIRE

Hill, R. R.; Collins, N. E.; Cowley, H. M.

2011-01-01

The full dysentery syndrome of human shigellosis is often preceded by a transient diarrhoea that may be induced by bacterial extracellular products before invasion of the colonic mucosa and development of subsequent pathology. To examine this hypothesis, we studied the effects of cell-free cultures of Shigella sp. on the ultrastructure of monkey colonic epithelium in vitro. Clinical isolates of shigella strains were grown in a niche-simulating medium. Sheets of colon wall collected from verve...

The effects of energy beverages on cultured cells.

Science.gov (United States)

Doyle, Wayne; Shide, Eric; Thapa, Slesha; Chandrasekaran, Vidya

2012-10-01

The popularity and prevalence of energy beverages makes it essential to examine the interactions between the ingredients and their effects on the safety of these beverages. In this study, we used in vitro assays to examine the effects of two energy beverages on mesenchymal, epithelial and neuronal cells. Our results showed that treatment of epithelial and mesenchymal cells with either energy beverage resulted in a dose dependent delay in wound closure, in a scratch wound healing assay. In rat embryonic fibroblasts, treatment with the energy beverages led to decreased lamellipodia formation and decreased proliferation/viability; whereas in MDCK cells, energy beverage treatment resulted in actin disorganization without any effects on cell proliferation. This suggests that the mechanisms underlying delayed wound healing might be different in the two cell types. Interestingly, the delays in both cell types could not be mimicked by treatment of caffeine, taurine and glucose alone or in combinations. Furthermore, treatment of chick forebrain neuronal cultures with energy beverages resulted in a dose dependent inhibition of neurite outgrowth. The cellular assays used in this study provide a consistent, qualitative and quantitative system for examining the combinatorial effects of the various ingredients used in energy beverages. Copyright © 2012 Elsevier Ltd. All rights reserved.

In vitro assays for cobblestone area-forming cells, LTC-IC, and CFU-C

NARCIS (Netherlands)

van Os, Ronald P; Dethmers-Ausema, Bertien; de Haan, Gerald; Bunting, Kevin

2008-01-01

Various assays exist that measure the function of hematopoietic stemcells (HSCs). In this chapter, in vitro assays are described that measure the frequency of progenitors (colony-forming unit in culture; CFU-C), stem cells (long-term culture-initiating cell; LTC-IC), or both (cobblestone

Radiation damage, repopulation and cell recovery analysis of in vitro tumour cell megacolony culture data using a non-Poissonian cell repopulation TCP model

International Nuclear Information System (INIS)

Stavrev, P; Weldon, M; Warkentin, B; Stavreva, N; Fallone, B G

2005-01-01

The effects of radiation damage, tumour repopulation and cell sublethal damage repair and the possibility of extracting information about the model parameters describing them are investigated in this work. Previously published data on two different cultured cell lines were analysed with the help of a tumour control probability (TCP) model that describes tumour cell dynamics properly. Different versions of a TCP model representing the cases of full or partial cell recovery between fractions of radiation, accompanied by repopulation or no repopulation were used to fit the data and were ranked according to statistical criteria. The data analysis shows the importance of the linear-quadratic mechanism of cell damage for the description of the in vitro cell dynamics. In a previous work where in vivo data were analysed, the employment of the single hit model of cell kill and cell repopulation produced the best fit, while ignoring the quadratic term of cell damage in the current analysis leads to poor fits. It is also concluded that more experiments using different fractionation regimes producing diverse data are needed to help model analysis and better ranking of the models

Advanced Good Cell Culture Practice for human primary, stem cell-derived and organoid models as well as microphysiological systems.

Science.gov (United States)

Pamies, David; Bal-Price, Anna; Chesné, Christophe; Coecke, Sandra; Dinnyes, Andras; Eskes, Chantra; Grillari, Regina; Gstraunthaler, Gerhard; Hartung, Thomas; Jennings, Paul; Leist, Marcel; Martin, Ulrich; Passier, Robert; Schwamborn, Jens C; Stacey, Glyn N; Ellinger-Ziegelbauer, Heidrun; Daneshian, Mardas

2018-04-13

A major reason for the current reproducibility crisis in the life sciences is the poor implementation of quality control measures and reporting standards. Improvement is needed, especially regarding increasingly complex in vitro methods. Good Cell Culture Practice (GCCP) was an effort from 1996 to 2005 to develop such minimum quality standards also applicable in academia. This paper summarizes recent key developments in in vitro cell culture and addresses the issues resulting for GCCP, e.g. the development of induced pluripotent stem cells (iPSCs) and gene-edited cells. It further deals with human stem-cell-derived models and bioengineering of organo-typic cell cultures, including organoids, organ-on-chip and human-on-chip approaches. Commercial vendors and cell banks have made human primary cells more widely available over the last decade, increasing their use, but also requiring specific guidance as to GCCP. The characterization of cell culture systems including high-content imaging and high-throughput measurement technologies increasingly combined with more complex cell and tissue cultures represent a further challenge for GCCP. The increasing use of gene editing techniques to generate and modify in vitro culture models also requires discussion of its impact on GCCP. International (often varying) legislations and market forces originating from the commercialization of cell and tissue products and technologies are further impacting on the need for the use of GCCP. This report summarizes the recommendations of the second of two workshops, held in Germany in December 2015, aiming map the challenge and organize the process or developing a revised GCCP 2.0.

The effects of canine bone marrow stromal cells on neuritogenesis from dorsal root ganglion neurons in vitro.

Science.gov (United States)

Kamishina, Hiroaki; Cheeseman, Jennifer A; Clemmons, Roger M

2009-10-01

The present in vitro study was designed to evaluate whether canine bone marrow stromal cells (BMSCs) promote neurite outgrowth from dorsal root ganglion (DRG) neurons. Bone marrow aspirates were collected from iliac crests of three young adult dogs. DRG neurons were cultured on BMSCs, fibroblasts, or laminin substrates. DRG neurons were also cultured in BMSC- or fibroblast-conditioned media. DRG neurons grown on BMSCs extended longer neurites and developed a much more elaborate conformation of branching neurites compared to those on fibroblasts or laminin. Quantitative analysis revealed that these effects were associated with the emergence of increased numbers of primary and branching neurites. The effect appears to be dependent upon cell-cell interactions rather than by elaboration of diffusible molecules. With more extensive investigations into the basic biology of canine BMSCs, their ability for promoting neurite outgrowth may be translated into a novel therapeutic strategy for dogs with a variety of neurological disorders.

In Vitro Generation of Functional Liver Organoid-Like Structures Using Adult Human Cells.

Science.gov (United States)

Ramachandran, Sarada Devi; Schirmer, Katharina; Münst, Bernhard; Heinz, Stefan; Ghafoory, Shahrouz; Wölfl, Stefan; Simon-Keller, Katja; Marx, Alexander; Øie, Cristina Ionica; Ebert, Matthias P; Walles, Heike; Braspenning, Joris; Breitkopf-Heinlein, Katja

2015-01-01

In this study we used differentiated adult human upcyte® cells for the in vitro generation of liver organoids. Upcyte® cells are genetically engineered cell strains derived from primary human cells by lenti-viral transduction of genes or gene combinations inducing transient proliferation capacity (upcyte® process). Proliferating upcyte® cells undergo a finite number of cell divisions, i.e., 20 to 40 population doublings, but upon withdrawal of proliferation stimulating factors, they regain most of the cell specific characteristics of primary cells. When a defined mixture of differentiated human upcyte® cells (hepatocytes, liver sinusoidal endothelial cells (LSECs) and mesenchymal stem cells (MSCs)) was cultured in vitro on a thick layer of Matrigel™, they self-organized to form liver organoid-like structures within 24 hours. When further cultured for 10 days in a bioreactor, these liver organoids show typical functional characteristics of liver parenchyma including activity of cytochromes P450, CYP3A4, CYP2B6 and CYP2C9 as well as mRNA expression of several marker genes and other enzymes. In summary, we hereby describe that 3D functional hepatic structures composed of primary human cell strains can be generated in vitro. They can be cultured for a prolonged period of time and are potentially useful ex vivo models to study liver functions.

In vitro cultured progenitors and precursors of cardiac cell lineages from human normal and post-ischemic hearts

Directory of Open Access Journals (Sweden)

F Di Meglio

2009-08-01

Full Text Available The demonstration of the presence of dividing primitive cells in damaged hearts has sparked increased interest about myocardium regenerative processes. We examined the rate and the differentiation of in vitro cultured resident cardiac primitive cells obtained from pathological and normal human hearts in order to evaluate the activation of progenitors and precursors of cardiac cell lineages in post-ischemic human hearts. The precursors and progenitors of cardiomyocyte, smooth muscle and endothelial lineage were identified by immunocytochemistry and the expression of characteristic markers was studied by western blot and RT-PCR. The amount of proteins characteristic for cardiac cells (a-SA and MHC, VEGFR-2 and FVIII, SMA for the precursors of cardiomyocytes, endothelial and smooth muscle cells, respectively inclines toward an increase in both a-SA and MHC. The increased levels of FVIII and VEGFR2 are statistically significant, suggesting an important re-activation of neoangiogenesis. At the same time, the augmented expression of mRNA for Nkx 2.5, the trascriptional factor for cardiomyocyte differentiation, confirms the persistence of differentiative processes in terminally injured hearts. Our study would appear to confirm the activation of human heart regeneration potential in pathological conditions and the ability of its primitive cells to maintain their proliferative capability in vitro. The cardiac cell isolation method we used could be useful in the future for studying modifications to the microenvironment that positively influence cardiac primitive cell differentiation or inhibit, or retard, the pathological remodeling and functional degradation of the heart.

Spontaneous transformation of adult mesenchymal stem cells from cynomolgus macaques in vitro

International Nuclear Information System (INIS)

Ren, Zhenhua; Wang, Jiayin; Zhu, Wanwan; Guan, Yunqian; Zou, Chunlin; Chen, Zhiguo; Zhang, Y. Alex

2011-01-01

Mesenchymal stem cells (MSCs) have shown potential clinical utility in cell therapy and tissue engineering, due to their ability to proliferate as well as to differentiate into multiple lineages, including osteogenic, adipogenic, and chondrogenic specifications. Therefore, it is crucial to assess the safety of MSCs while extensive expansion ex vivo is a prerequisite to obtain the cell numbers for cell transplantation. Here we show that MSCs derived from adult cynomolgus monkey can undergo spontaneous transformation following in vitro culture. In comparison with MSCs, the spontaneously transformed mesenchymal cells (TMCs) display significantly different growth pattern and morphology, reminiscent of the characteristics of tumor cells. Importantly, TMCs are highly tumorigenic, causing subcutaneous tumors when injected into NOD/SCID mice. Moreover, no multiple differentiation potential of TMCs is observed in vitro or in vivo, suggesting that spontaneously transformed adult stem cells may not necessarily turn into cancer stem cells. These data indicate a direct transformation of cynomolgus monkey MSCs into tumor cells following long-term expansion in vitro. The spontaneous transformation of the cultured cynomolgus monkey MSCs may have important implications for ongoing clinical trials and for models of oncogenesis, thus warranting a more strict assessment of MSCs prior to cell therapy. -- Highlights: ► Spontaneous transformation of cynomolgus monkey MSCs in vitro. ► Transformed mesenchymal cells lack multipotency. ► Transformed mesenchymal cells are highly tumorigenic. ► Transformed mesenchymal cells do not have the characteristics of cancer stem cells.

Application of magnetic carriers to two examples of quantitative cell analysis

Energy Technology Data Exchange (ETDEWEB)

Zhou, Chen; Qian, Zhixi; Choi, Young Suk; David, Allan E. [Department of Chemical Engineering, 212 Ross Hall, Auburn University, Auburn, AL 36849 (United States); Todd, Paul, E-mail: pwtodd@hotmail.com [Techshot, Inc., 7200 Highway 150, Greenville, IN 47124 (United States); Hanley, Thomas R. [Department of Chemical Engineering, 212 Ross Hall, Auburn University, Auburn, AL 36849 (United States)

2017-04-01

The use of magnetophoretic mobility as a surrogate for fluorescence intensity in quantitative cell analysis was investigated. The objectives of quantitative fluorescence flow cytometry include establishing a level of labeling for the setting of parameters in fluorescence activated cell sorters (FACS) and the determination of levels of uptake of fluorescently labeled substrates by living cells. Likewise, the objectives of quantitative magnetic cytometry include establishing a level of labeling for the setting of parameters in flowing magnetic cell sorters and the determination of levels of uptake of magnetically labeled substrates by living cells. The magnetic counterpart to fluorescence intensity is magnetophoretic mobility, defined as the velocity imparted to a suspended cell per unit of magnetic ponderomotive force. A commercial velocimeter available for making this measurement was used to demonstrate both applications. Cultured Gallus lymphoma cells were immunolabeled with commercial magnetic beads and shown to have adequate magnetophoretic mobility to be separated by a novel flowing magnetic separator. Phagocytosis of starch nanoparticles having magnetic cores by cultured Chinese hamster ovary cells, a CHO line, was quantified on the basis of magnetophoretic mobility. - Highlights: • Commercial particle tracking velocimetry measures magnetophoretic mobility of labeled cells. • Magnetically labeled tumor cells were shown to have adequate mobility for capture in a specific sorter. • The kinetics of nonspecific endocytosis of magnetic nanomaterials by CHO cells was characterized. • Magnetic labeling of cells can be used like fluorescence flow cytometry for quantitative cell analysis.

Critical analysis of 3-D organoid in vitro cell culture models for high-throughput drug candidate toxicity assessments.

Science.gov (United States)

Astashkina, Anna; Grainger, David W

2014-04-01

Drug failure due to toxicity indicators remains among the primary reasons for staggering drug attrition rates during clinical studies and post-marketing surveillance. Broader validation and use of next-generation 3-D improved cell culture models are expected to improve predictive power and effectiveness of drug toxicological predictions. However, after decades of promising research significant gaps remain in our collective ability to extract quality human toxicity information from in vitro data using 3-D cell and tissue models. Issues, challenges and future directions for the field to improve drug assay predictive power and reliability of 3-D models are reviewed. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of ulipristal acetate on human embryo attachment and endometrial cell gene expression in an in vitro co-culture system.

Science.gov (United States)

Berger, C; Boggavarapu, N R; Menezes, J; Lalitkumar, P G L; Gemzell-Danielsson, K

2015-04-01

Does ulipristal acetate (UPA) used for emergency contraception (EC) interfere with the human embryo implantation process? UPA, at the dosage used for EC, does not affect human embryo implantation process, in vitro. A single pre-ovulatory dose of UPA (30 mg) acts by delaying or inhibiting ovulation and is recommended as first choice among emergency contraceptive pills due to its efficacy. The compound has also been demonstrated to have a dose-dependent effect on the endometrium, which theoretically could impair endometrial receptivity but its direct action on human embryo implantation has not yet been studied. Effect of UPA on embryo implantation process was studied in an in vitro endometrial construct. Human embryos were randomly added to the cultures and cultured for 5 more days with UPA (n = 10) or with vehicle alone (n = 10) to record the attachment of embryos. Endometrial biopsies were obtained from healthy, fertile women on cycle day LH+4 and stromal and epithelial cells were isolated. A three-dimensional in vitro endometrial co-culture system was constructed by mixing stromal cells with collagen covered with a layer of epithelial cells and cultured in progesterone containing medium until confluence. The treatment group received 200 ng/ml of UPA. Healthy, viable human embryos were placed on both control and treatment cultures. Five days later the cultures were tested for the attachment of embryos and the 3D endometrial constructs were analysed for endometrial receptivity markers by real-time PCR. There was no significant difference in the embryo attachment rate between the UPA treated group and the control group as 5 out of 10 human embryos exposed to UPA and 7 out of 10 embryos in the control group attached to the endometrial cell surface (P = 0.650). Out of 17 known receptivity genes studied here, only 2 genes, HBEGF (P = 0.009) and IL6 (P = 0.025) had a significant up-regulation and 4 genes, namely HAND2 (P = 0.003), OPN (P = 0.003), CALCR (P = 0.016) and

Effect of Cumulus cell co-culture and Protein Supplement on Success of in vitro Fertilization and Development of Pre-implanted Embryos in mice

Directory of Open Access Journals (Sweden)

Muhammad-Baqir M-R. Fakhrildin

2005-06-01

Full Text Available Successful oocyte fertilization and normal embryonic development of mice were considered the most important diagnostic criteria for the safety of materials and tools used for human in vitro fertilization and embryo transfer (IVF-ET. Therefore, we studied the influence of cumulus cells co-culture and protein supplement within culture medium on percentages of in vitro fertilization (IVF and normal development of early stages of mouse embryo later. Oocytes were collected and treated with hyaluronidase to remove cumulus cells. Oocytes were divided into four groups namely: Group-1: Oocytes incubated within modified Earl’s medium (MEM supplied with 10% inactivated bovine amniotic fluid as a protein source and cumulus cells; Group-2: Oocytes incubated with MEM supplied with cumulus cells only; Group-3: Oocytes incubated with MEM supplied with 10% inactivated bovine amniotic fluid only; and Group-4: Oocytes  incubated with MEM free of both protein source and cumulus cells. For IVF, 5-6 oocytes were incubated with active spermatozoa under paraffin oil for 18-20 hours at 37° oC in 5% CO2. Percentages of IVF and embryonic development were then recorded. Best results for IVF and normal embryonic development were achieved from oocytes of Group-1 when compared to the other groups. As compared to Group-1, the percentage of IVF for Group-2 and Group-3 were decreased insignificantly and significantly (P<0.002, respectively. Significant (P<0.01 reduction in the percentages of IVF and normal embryonic development were reported in Group-4 as compared to Group-1. Therefore, it was concluded that the presence of cumulus cells co-culture and bovine amniotic fluid as a protein source within culture medium may have an important role on the fertilizing capacity of spermatozoa and oocytes and normal development of pre-implanted mouse embryo later.

Rabbit uterine epithelial cells: Co-culture with spermatozoa

International Nuclear Information System (INIS)

Boice, M.L.

1988-01-01

A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined

Epithelialization and stromalization of porcine follicular granulosa cells during real-time proliferation - a primary cell culture approach.

Science.gov (United States)

Ciesiółka, S; Bryja, A; Budna, J; Kranc, W; Chachuła, A; Bukowska, D; Piotrowska, H; Porowski, L; Antosik, P; Bruska, M; Brüssow, K P; Nowicki, M; Zabel, M; Kempisty, B

2016-01-01

The process of oocyte growth and development takes place during long stages of folliculogenesis and oogenesis. This is accompanied by biochemical and morphological changes, occurring from the preantral to antral stages during ovarian follicle differentiation. It is well known that the process of follicle growth is associated with morphological modifications of theca (TCs) and granulosa cells (GCs). However, the relationship between proliferation and/or differentiation of porcine GCs during long-term in vitro culture requires further investigation. Moreover, the expression of cytokeratins and vimentin in porcine GCs, in relation to real-time cell proliferation, has yet to be explored. Utilizing confocal microscopy, we analyzed cytokeratin 18 (CK18), cytokeratin 8 + 18 + 19 (panCK), and vimentin (Vim) expression, as well as their protein distribution, within GCs isolated from slaughtered ovarian follicles. The cells were cultured for 168 h with protein expression and cell proliferation index analyzed at 24-h intervals. We found the highest expression of CK18, panCK, and Vim occurred at 120 h of in vitro culture (IVC) as compared with other experimental time intervals. All of the investigated proteins displayed cytoplasmic distribution. Analysis of real-time cell proliferation revealed an increased cell index after the first 24 h of IVC. Additionally, during each period between 24-168 h of IVC, a significant difference in the proliferation profile, expressed as the cell index, was also observed. We concluded that higher expression of vimentin at 120 h of in vitro proliferation might explain the culmination of the stromalization process associated with growth and domination of stromal cells in GC culture. Cytokeratin expression within GC cytoplasm confirms the presence of epithelial cells as well as epithelial-related GC development during IVC. Moreover, expression of both cytokeratins and vimentin during short-term culture suggests that the process of GC proliferation

In vitro expansion of the mammary stem/progenitor cell population by xanthosine treatment

Directory of Open Access Journals (Sweden)

Choudhary Ratan K

2012-06-01

Full Text Available Abstract Background Mammary stem cells are critical for growth and maintenance of the mammary gland and therefore are of considerable interest for improving productivity and efficiency of dairy animals. Xanthosine treatment has been demonstrated to promote expansion of putative mammary stem cells in vivo, and hepatic and hair follicle stem cells in vitro. In the latter, xanthosine promoted the symmetrical division of hepatic and hair follicle stem cells. The objective of this study was to determine if treating primary cultures of bovine mammary epithelial cells (MEC with xanthosine increases the stem/progenitor cell population by promoting symmetrical division of mammary stem cells. Results In vitro treatment with xanthosine increased the population of MEC during the exponential phase of cell growth, reducing the doubling time from 86 h in control cultures to 60 h in xanthosine-treated cultures. The bromodeoxyuridine (BrdU labeling index and the proportion of MEC in S-phase both were increased by xanthosine treatment, indicating that increased cell accretion was due to increased cell proliferation. Analysis of daughter-pairs indicated that xanthosine promoted a shift from asymmetric to symmetric cell division. Moreover, the 30 % increase in symmetric cell division was concomitant with an increase in the proportion of MEC that were positive for a putative stem cell marker (FNDC3B and a trend toward increased telomerase activity. These results suggest that xanthosine treatment in vitro can increase cell proliferation, promote symmetric cell division and enhance stem/progenitor cell activity. Conclusions Xanthosine treatment increased the proliferation rate of bovine MEC in vitro. This was likely to be mediated by an increase in the proportion of stem/progenitor cells in the MEC population due to promotion of symmetrical stem cell division by xanthosine.

An in vitro clonogenic assay to assess radiation damage in rat CNS glial progenitor cells

International Nuclear Information System (INIS)

Maazen, R.W.M. van der; Verhagen, I.; Kogel, A.J. van der

1990-01-01

Normal glial progenitor cells can be isolated from the rat central nervous system (CNS) and cultured in vitro on a monolayer of type-1 astrocytes. These monolayers are able to support and stimulate explanted glial progenitor cells to proliferate. Employing these in vitro interactions of specific glial cell types, an in vivo-in vitro clonogenic assay has been developed. This method offers the possibility to study the intrinsic radiosensitivity, repair and regeneration of glial progenitor cells after in vitro or in vivo irradiation. (author)

Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

International Nuclear Information System (INIS)

Sandru, G.; Veraguth, P.

1981-01-01

Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rads) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

Micropit: a new cell culturing approach for characterization of solitary astrocytes and small networks of these glial cells

Directory of Open Access Journals (Sweden)

William Lee

2008-12-01

Full Text Available Astrocytes play an important role in cell-cell signaling in the mammalian central nervous system. The ability of astrocytes to communicate with surrounding cells through gap-junctional coupling or signaling via the release of transmitters makes characterization of these cells difficult in vitro and even more so in vivo. To simplify the complexity of common in vitro systems, introduced by intercellular communication between astrocytes, we developed a novel cell culturing method, in which purified rat visual cortical astrocytes were grown in spatially defined cell-adhesion wells which we termed micropits. We showed that astrocytes cultured in micropit regions were viable and exhibited similar characteristics of Ca2+ dynamics and astrocytic marker expression to those of cells cultured in non-micropit regions. Examination of intracellular Ca2+ oscillations in solitary astrocytes cultured in micropits revealed less variable oscillations than those of non-micropit grouped astrocytes, which were in contact with their neighbors. Solitary cells in micropit regions can undergo ATP-mediated astrocyte-microglia signaling, demonstrating that this culturing method can also be used to investigate glial-glial interactions in a spatially well-defined microenvironment.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Comparison of EBV DNA viral load in whole blood, plasma, B-cells and B-cell culture supernatant.

Science.gov (United States)

Ouedraogo, David Eric; Bollore, Karine; Viljoen, Johannes; Foulongne, Vincent; Reynes, Jacques; Cartron, Guillaume; Vendrell, Jean-Pierre; Van de Perre, Philippe; Tuaillon, Edouard

2014-05-01

Epstein-Barr virus (EBV) genome quantitation in whole blood is used widely for therapeutic monitoring of EBV-associated disorders in immunosuppressed individuals and in patients with EBV-associated lymphoma. However, the most appropriate biological material to be used for EBV DNA quantitation remains a subject of debate. This study compare the detection rate and levels of EBV DNA from whole blood, plasma, enriched B-cells, and B-cell short-term culture supernatant using quantitative real-time PCR. Samples were collected from 33 subjects with either HIV infection or B-cell lymphoma. Overall, EBV DNA was detected in 100% of enriched B-cell samples, in 82% of B-cell culture supernatants, in 57% of plasma, and 42% of whole blood samples. A significant correlation for EBV viral load was found between enriched B-cell and B-cell culture supernatant material (ρ = 0.92; P cells (ρ = -0.02; P = 0.89), whole blood and plasma (ρ = 0.24; P = 0.24), or enriched B-cells and plasma (ρ = 0.08; P = 0.77). Testing of enriched B-cells appeared to be the most sensitive method for detection of EBV DNA as well as for exploration of the cellular reservoir. Quantitation of EBV DNA in plasma and B-cell culture supernatant may be of interest to assess EBV reactivation dynamics and response to treatment as well as to decipher EBV host-pathogen interactions in various clinical scenarios. © 2013 Wiley Periodicals, Inc.

The influence of micronutrients in cell culture: a reflection on viability and genomic stability.

Science.gov (United States)

Arigony, Ana Lúcia Vargas; de Oliveira, Iuri Marques; Machado, Miriana; Bordin, Diana Lilian; Bergter, Lothar; Prá, Daniel; Henriques, João Antonio Pêgas

2013-01-01

Micronutrients, including minerals and vitamins, are indispensable to DNA metabolic pathways and thus are as important for life as macronutrients. Without the proper nutrients, genomic instability compromises homeostasis, leading to chronic diseases and certain types of cancer. Cell-culture media try to mimic the in vivo environment, providing in vitro models used to infer cells' responses to different stimuli. This review summarizes and discusses studies of cell-culture supplementation with micronutrients that can increase cell viability and genomic stability, with a particular focus on previous in vitro experiments. In these studies, the cell-culture media include certain vitamins and minerals at concentrations not equal to the physiological levels. In many common culture media, the sole source of micronutrients is fetal bovine serum (FBS), which contributes to only 5-10% of the media composition. Minimal attention has been dedicated to FBS composition, micronutrients in cell cultures as a whole, or the influence of micronutrients on the viability and genetics of cultured cells. Further studies better evaluating micronutrients' roles at a molecular level and influence on the genomic stability of cells are still needed.

Characterization and evaluation of whey protein-based biofilms as substrates for in vitro cell cultures.

Science.gov (United States)

Gilbert, Vanessa; Rouabhia, Mahmoud; Wang, Hongxum; Arnould, Anne-Lise; Remondetto, Gabriel; Subirade, Muriel

2005-12-01

Whey proteins-based biofilms were prepared using different plasticizers in order to obtain a biomaterial for the human keratinocytes and fibroblasts in vitro culture. The film properties were evaluated by Fourier Transform Infrared Spectroscopy (FTIR) technique and mechanical tests. A relationship was found between the decrease of intermolecular hydrogen bond strength and film mechanical behavior changes, expressed by a breaking stress and Young modulus values diminishing. These results allow stating that the film molecular configuration could induce dissimilarities in its mechanical properties. The films toxicity was assessed by evaluating the cutaneous cells adherence, growth, proliferation and structural stratification. Microscopic observation demonstrated that both keratinocytes and fibroblasts adhered to the biofilms. The trypan blue exclusion test showed that keratinocytes grew at a significantly high rate on all the biofilms. Structural analysis demonstrated that keratinocytes stratified when cultured on the whey protein-based biofilms and gave rise to multi-layered epidermal structures. The most organized epidermis was obtained with whey protein isolate/DEG biofilm. This structure had a well-organized basal layer under supra-basal and corneous layers. This study demonstrated that whey proteins, an inexpensive renewable resource which can be obtained readily, were non-toxic to cutaneous cells and thus they could be useful substrates for a variety of biomedical applications, including tissue engineering.

In Vitro Differentiation and Propagation of Urothelium from Pluripotent Stem Cell Lines.

Science.gov (United States)

Osborn, Stephanie L; Kurzrock, Eric A

2018-01-01

Bioengineering of bladder tissue, particularly for those patients who have advanced bladder disease, requires a source of urothelium that is healthy, capable of significant proliferation in vitro and immunologically tolerated upon transplant. As pluripotent stem cells have the potential to fulfill such criteria, they provide a critical cell source from which urothelium might be derived in vitro and used clinically. Herein, we describe the in vitro differentiation of urothelium from the H9 human embryonic stem cell (hESC) line through the definitive endoderm (DE) phase via selective culture techniques. The protocol can be used to derive urothelium from other hESCs or human-induced pluripotent stem cells.

Transcriptomal profiling of bovine ovarian granulosa and theca interna cells in primary culture in comparison with their in vivo counterparts.

Directory of Open Access Journals (Sweden)

Nicholas Hatzirodos

Full Text Available In vitro culture of ovarian granulosa cells and theca cells has been very important for our understanding of their function and regulation. One of the most eagerly sought attributes of cell culture is the use of chemically-defined conditions. However, even under such in vitro conditions cell behaviour could differ from the in vivo situation because of differences in oxygen tension, nutrients, adhesion matrix and other factors. To examine this further we compared the transcriptomes of both granulosa cells and cells from the theca interna that were cultured in what are arguably the best in vitro conditions for maintaining the 'follicular' phenotypes of both tissue types, as displayed by their respective freshly-isolated counterparts. The array data analysed are from recently published data and use the same sizes of bovine follicles (small antral 3-6 mm and the same Affymetrix arrays. We conducted analysis using Partek, Ingenuity Pathway Analysis and GOEAST. Principal Component Analysis (PCA and hierarchical clustering clearly separated the in vivo from the in vitro groups for both cells types and transcriptomes were more homogeneous upon culture. In both cell cultures behaviours associated with cell adhesion, migration and interaction with matrix or substrate were more abundant. However, the pathways involved generally differed between the two cell types. With the thecal cultures a gene expression signature of an immune response was more abundant, probably by leukocytes amongst the cells cultured from the theca interna. These results indicate differences between in vivo and in vitro that should be considered when interpreting in vitro data.

Good Cell Culture Practice for stem cells and stem-cell-derived models.

Science.gov (United States)

Pamies, David; Bal-Price, Anna; Simeonov, Anton; Tagle, Danilo; Allen, Dave; Gerhold, David; Yin, Dezhong; Pistollato, Francesca; Inutsuka, Takashi; Sullivan, Kristie; Stacey, Glyn; Salem, Harry; Leist, Marcel; Daneshian, Mardas; Vemuri, Mohan C; McFarland, Richard; Coecke, Sandra; Fitzpatrick, Suzanne C; Lakshmipathy, Uma; Mack, Amanda; Wang, Wen Bo; Yamazaki, Daiju; Sekino, Yuko; Kanda, Yasunari; Smirnova, Lena; Hartung, Thomas

2017-01-01

The first guidance on Good Cell Culture Practice (GCCP) dates back to 2005. This document expands this to include aspects of quality assurance for in vitro cell culture focusing on the increasingly diverse cell types and culture formats used in research, product development, testing and manufacture of biotechnology products and cell-based medicines. It provides a set of basic principles of best practice that can be used in training new personnel, reviewing and improving local procedures, and helping to assure standard practices and conditions for the comparison of data between laboratories and experimentation performed at different times. This includes recommendations for the documentation and reporting of culture conditions. It is intended as guidance to facilitate the generation of reliable data from cell culture systems, and is not intended to conflict with local or higher level legislation or regulatory requirements. It may not be possible to meet all recommendations in this guidance for practical, legal or other reasons. However, when it is necessary to divert from the principles of GCCP, the risk of decreasing the quality of work and the safety of laboratory staff should be addressed and any conclusions or alternative approaches justified. This workshop report is considered a first step toward a revised GCCP 2.0.

Six cloned calves produced from adult fibroblast cells after long-term culture

Science.gov (United States)

Kubota, Chikara; Yamakuchi, Hiroshi; Todoroki, Junichi; Mizoshita, Kazunori; Tabara, Norio; Barber, Michele; Yang, Xiangzhong

2000-01-01

Cloning whole animals with somatic cells as parents offers the possibility of targeted genetic manipulations in vitro such as “gene knock-out” by homologous recombination. However, such manipulation requires prolonged culture of nuclear donor cells. Previous successes in cloning have been limited to the use of cells collected either fresh or after short-term culture. Therefore, demonstration of genetic totipotency of cells after prolonged culture is pivotal to combining site-specific genetic manipulations and cloning. Here we report birth of six clones of an aged (17-year-old) Japanese Black Beef bull using ear skin fibroblast cells as nuclear donor cells after up to 3 months of in vitro culture (10–15 passages). We observed higher developmental rates for embryos derived from later passages (10 and 15) as compared with those embryos from an early passage (passage 5). The four surviving clones are now 10–12 months of age and appear normal, similar to their naturally reproduced peers. These data show that fibroblasts of aged animals remain competent for cloning, and prolonged culture does not affect the cloning competence of adult somatic donor cells. PMID:10655472

Lab on a chip automates in vitro cell culturing

DEFF Research Database (Denmark)

Perozziello, Gerardo; Møllenbach, Jacob; Laursen, Steen

2012-01-01

A novel in vitro fertilization system is presented based on an incubation chamber and a microfluidic device which serves as advanced microfluidic cultivation chamber. The flow is controlled by hydrostatic height differences and evaporation is avoided with help of mineral oil. Six patient compartm......A novel in vitro fertilization system is presented based on an incubation chamber and a microfluidic device which serves as advanced microfluidic cultivation chamber. The flow is controlled by hydrostatic height differences and evaporation is avoided with help of mineral oil. Six patient...... compartments allow six simultaneous temperature and pH controlled cultivations with 12 embryos with continuous logging of the monitoring data. Two media can be controlled with help of opening or closing of openings at the microfluidic disposable devices. The flow rates through the single cell compartments can...

Three-dimensional in vitro cancer spheroid models for Photodynamic Therapy: Strengths and Opportunities

Science.gov (United States)

Evans, Conor

2015-03-01

Three dimensional, in vitro spheroid cultures offer considerable utility for the development and testing of anticancer photodynamic therapy regimens. More complex than monolayer cultures, three-dimensional spheroid systems replicate many of the important cell-cell and cell-matrix interactions that modulate treatment response in vivo. Simple enough to be grown by the thousands and small enough to be optically interrogated, spheroid cultures lend themselves to high-content and high-throughput imaging approaches. These advantages have enabled studies investigating photosensitizer uptake, spatiotemporal patterns of therapeutic response, alterations in oxygen diffusion and consumption during therapy, and the exploration of mechanisms that underlie therapeutic synergy. The use of quantitative imaging methods, in particular, has accelerated the pace of three-dimensional in vitro photodynamic therapy studies, enabling the rapid compilation of multiple treatment response parameters in a single experiment. Improvements in model cultures, the creation of new molecular probes of cell state and function, and innovations in imaging toolkits will be important for the advancement of spheroid culture systems for future photodynamic therapy studies.

Three-dimensional hydrogel cell culture systems for modeling neural tissue

Science.gov (United States)

Frampton, John

designed for use as a tool to predict the transport and processing that occurs prior to drug uptake in the central nervous system (CNS), and to predict BBB permeability. Electrochemical techniques and immunohistochemistry were used to validate this model and provide detailed information about cellular organization and function. Electrochemical impedance spectroscopy (EIS) provided evidence that endothelial cells cultured in the presence of astrocytes formed tight junctions capable of occluding the flow of electrical current. In a second series of experiments, a microglia-astrocyte co-culture system was developed to assess the effects of glial cells on electrode impedance recorded from neural prosthetic devices in vitro. Impedance measurements were compared with confocal images to determine the effects of glial cell density and cell type on electrode performance. The results indicate that EIS data can be used to model components of the reactive cell responses in brain tissue, and that impedance measurements recorded in vitro can be compared to measurements recorded in vivo. Taken together, these results demonstrate that alginate hydrogels can be used for the creation of 3-D neural cell scaffolds, and that such cell scaffolds can be used to model a variety of three-dimensional neural tissues in vitro, that cannot be studied in 2-D cultures.

Bioreactors to influence stem cell fate: augmentation of mesenchymal stem cell signaling pathways via dynamic culture systems.

Science.gov (United States)

Yeatts, Andrew B; Choquette, Daniel T; Fisher, John P

2013-02-01

Mesenchymal stem cells (MSCs) are a promising cell source for bone and cartilage tissue engineering as they can be easily isolated from the body and differentiated into osteoblasts and chondrocytes. A cell based tissue engineering strategy using MSCs often involves the culture of these cells on three-dimensional scaffolds; however the size of these scaffolds and the cell population they can support can be restricted in traditional static culture. Thus dynamic culture in bioreactor systems provides a promising means to culture and differentiate MSCs in vitro. This review seeks to characterize key MSC differentiation signaling pathways and provides evidence as to how dynamic culture is augmenting these pathways. Following an overview of dynamic culture systems, discussion will be provided on how these systems can effectively modify and maintain important culture parameters including oxygen content and shear stress. Literature is reviewed for both a highlight of key signaling pathways and evidence for regulation of these signaling pathways via dynamic culture systems. The ability to understand how these culture systems are affecting MSC signaling pathways could lead to a shear or oxygen regime to direct stem cell differentiation. In this way the efficacy of in vitro culture and differentiation of MSCs on three-dimensional scaffolds could be greatly increased. Bioreactor systems have the ability to control many key differentiation stimuli including mechanical stress and oxygen content. The further integration of cell signaling investigations within dynamic culture systems will lead to a quicker realization of the promise of tissue engineering and regenerative medicine. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Biosynthesis of 14C-phytoene from tomato cell suspension cultures (Lycopersicon esculentum) for utilization in prostate cancer cell culture studies.

Science.gov (United States)

Campbell, Jessica K; Rogers, Randy B; Lila, Mary Ann; Erdman, John W

2006-02-08

This work describes the development and utilization of a plant cell culture production approach to biosynthesize and radiolabel phytoene and phytofluene for prostate cancer cell culture studies. The herbicide norflurazon was added to established cell suspension cultures of tomato (Lycopersicon esculentum cv. VFNT cherry), to induce the biosynthesis and accumulation of the lycopene precursors, phytoene and phytofluene, in their natural isomeric forms (15-cis-phytoene and two cis-phytofluene isomers). Norflurazon concentrations, solvent carrier type and concentration, and duration of culture exposure to norflurazon were screened to optimize phytoene and phytofluene synthesis. Maximum yields of both phytoene and phytofluene were achieved after 7 days of treatment with 0.03 mg norflurazon/40 mL fresh medium, provided in 0.07% solvent carrier. Introduction of 14C-sucrose to the tomato cell culture medium enabled the production of 14C-labeled phytoene for subsequent prostate tumor cell uptake studies. In DU 145 prostate tumor cells, it was determined that 15-cis-phytoene and an oxidized product of phytoene were taken up and partially metabolized by the cells. The ability to biosynthesize, radiolabel, and isolate these carotenoids from tomato cell cultures is a novel, valuable methodology for further in vitro and in vivo investigations into the roles of phytoene and phytofluene in cancer chemoprevention.

Quantitative determination of in vitro immunoglobulin secretion with protein A from Staphylococcus aureus

International Nuclear Information System (INIS)

Manciulea, M.

1982-01-01

A micromethod for the quantitative determination of Ig secreted in vitro by mice lymphocytes isolated from the spleen of normal animals is described. The indicator system consists in sheep erythrocytes radiolabelled with sodium chromate ( 51 Cr) and coated with protein A of Staphylococcus aureus ( 51 Cr-labelled ES). When splenocytes were incubated in fluid phase at 37 0 C for 7/2 h with rabbit antisera to mouse Ig (IgM and IgG) and with guinea pig complement, the immune complexes formed between the secreted Ig and its specific IgG antibody are bound to protein A on the erythrocyte surface allowing the complement-mediated lysis of 51 Cr-labelled ES. The degree of haemolysis produced in this experimental system, which reflects the amount of in vitro secreted Ig, was quantitatively measured by radioactive determination of 51 Cr release. In combination with the ES plaque assay the method also gives information as immunoglobulin secretion per plaque forming cell. (Auth.)

Osteogenic stimulatory conditions enhance growth and maturation of endothelial cell microvascular networks in culture with mesenchymal stem cells

Directory of Open Access Journals (Sweden)

Torbjorn O Pedersen

2012-12-01

Full Text Available To optimize culture conditions for in vitro prevascularization of tissue-engineered bone constructs, the development of organotypic blood vessels under osteogenic stimulatory conditions (OM was investigated. Coculture of endothelial cells and mesenchymal stem cells was used to assess proangiogenic effects of mesenchymal stem cells on endothelial cells. Four different culture conditions were evaluated for their effect on development of microvascular endothelial cell networks. Mineralization, deposition of extracellular matrix, and perivascular gene expression were studied in OM. After 3 days, endothelial cells established elongated capillary-like networks, and upregulated expression of vascular markers was seen. After 15 days, all parameters evaluated were significantly increased for cultures in OM. Mature networks developed in OM presented lumens enveloped by basement membrane-like collagen IV, with obvious mineralization and upregulated perivascular gene expression from mesenchymal stem cells. Our results suggest osteogenic stimulatory conditions to be appropriate for in vitro development of vascularized bone implants for tissue engineering.

Endothelial cell cultures as a tool in biomaterial research

NARCIS (Netherlands)

Kirkpatrick, CJ; Otto, M; van Kooten, T; Krump, [No Value; Kriegsmann, J; Bittinger, F

1999-01-01

Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

Qualitative and quantitative determination of quorum sensing inhibition in vitro

DEFF Research Database (Denmark)

Jakobsen, Tim Holm; van Gennip, Maria; Christensen, Louise Dahl

2011-01-01

of reporter strains consisting of a lasB-gfp or rhlA-gfp fusion in P. aeruginosa for qualitative and quantitative evaluation of the inhibition of the two major QS pathways, monitored as reduced expression of green fluorescence. By the use of an in vitro flow cell system it is possible to study the QSI...... efficacy of potential quorum sensing inhibitors (QSIs). Work on Pseudomonas aeruginosa has shown that chemical blockage of QS is a promising new antimicrobial strategy. Several live bacterial reporter systems been developed to screen extracts and pure compounds for QSI activity. Here we describe the usage...... activity by monitoring its ability to interfere with the protective functions of bacterial biofilm. For evaluation of the global effects of QSI compounds, we present a protocol for the DNA microarray-based transcriptomics. Using these in vitro methods it is possible to evaluate the potential of various QSI...

The flame retardant DE-71 (a mixture of polybrominated diphenyl ethers) inhibits human differentiated thyroid cell function in vitro

DEFF Research Database (Denmark)

Kronborg, Thit Mynster; Hansen, Juliana Frohnert; Rasmussen, Åse Krogh

2017-01-01

Normal thyroid function is essential for general growth and metabolism, but can be affected by endocrine disrupting chemicals (EDCs). Polybrominated diphenyl ethers (PBDEs) have been used worldwide to reduce flammability in different materials and are suspected to be EDCs. The production...... of the commercial Penta- and OctaBDE mixtures is banned, but DecaBDEs and existing products may leak PBDEs into the environment. Our aim was to investigate the effect of the PentaBDE mixture DE-71 on human thyroid cells in vitro. Primary human thyroid cells were obtained as paraadenomatous tissue and cultured...... in monolayers. The influence of DE-71 on cyclic adenosine monophosphate (cAMP) and thyroglobulin (Tg) production was examined in the culture medium by competitive radioimmunoassay and enzyme-linked immunosorbent assay, respectively. Real-time quantitative PCR analysis of thyroid-specific genes was performed...

A new sensitive and quantitative HTLV-I-mediated cell fusion assay in T cells

International Nuclear Information System (INIS)

Pare, Marie-Eve; Gauthier, Sonia; Landry, Sebastien; Sun Jiangfeng; Legault, Eric; Leclerc, Denis; Tanaka, Yuetsu; Marriott, Susan J.; Tremblay, Michel J.; Barbeau, Benoit

2005-01-01

Similar to several other viruses, human T cell leukemia virus type I (HTLV-I) induces the formation of multinucleated giant cells (also known as syncytium) when amplified in tissue culture. These syncytia result from the fusion of infected cells with uninfected cells. Due to the intrinsic difficulty of infecting cells with cell-free HTLV-I virions, syncytium formation has become an important tool in the study of HTLV-I infection and transmission. Since most HTLV-I-based cell fusion assays rely on the use of non-T cells, the aim of this study was to optimize a new HTLV-I-induced cell fusion assay in which HTLV-I-infected T cell lines are co-cultured with T cells that have been transfected with an HTLV-I long terminal repeat (LTR) luciferase reporter construct. We demonstrate that co-culture of various HTLV-I-infected T cells with different transfected T cell lines resulted in induction of luciferase activity. Cell-to-cell contact and expression of the viral gp46 envelope protein was crucial for this induction while other cell surface proteins (including HSC70) did not have a significant effect. This quantitative assay was shown to be very sensitive. In this assay, the cell fusion-mediated activation of NF-κB and the HTLV-I LTR occurred through previously described Tax-dependent signaling pathways. This assay also showed that cell fusion could activate Tax-inducible cellular promoters. These results thus demonstrate that this new quantitative HTLV-I-dependent cell fusion assay is versatile, highly sensitive, and can provide an important tool to investigate cellular promoter activation and intrinsic signaling cascades that modulate cellular gene expression

In vitro co-culture experiments on prostate cancer and small intestine cells irradiated with carbon ions and x-rays

International Nuclear Information System (INIS)

Neubeck, C. von; Weyrather, W.-K.; Durante, M.