Ugiyadi, Maharani; Tan, Marselina I; Giri-Rachman, Ernawati A; Zuhairi, Fawzi R; Sumarsono, Sony H
2014-05-01
MDCK and Vero cell lines have been used as substrates for influenza virus replication. However, Vero cells produced lower influenza virus titer yield compared to MDCK. Influenza virus needs molecules for internalisation of the virus into the host cell, such as influenza virus receptor and clathrin. Human influenza receptor is usually a membrane protein containing Sia(α2,6) Gal, which is added into the protein in the golgi apparatus by α2,6 sialyltransferase (SIAT1). Light clathrin A (LCA), light clathrin B (LCB) and heavy clathrin (HC) are the main components needed for virus endocytosis. Therefore, it is necessary to compare the expression of SIAT1 and clathrin in Vero and MDCK cells. This study is reporting the expression of SIAT1 and clathrin observed in both cells with respect to the levels of (1) RNA by using RT-PCR, (2) protein by using dot blot analysis and confocal microscope. The results showed that Vero and MDCK cells expressed both SIAT1 and clathrin proteins, and the expression of SIAT1 in MDCK was higher compared to Vero cells. On the other hand, the expressions of LCA, LCB and HC protein in MDCK cells were not significantly different to Vero cells. This result showed that the inability of Vero cells to internalize H1N1 influenza virus was possibly due to the lack of transmembrane protein receptor which contained Sia(α2,6) Gal.
Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei
2012-12-04
The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.
Ji, Chun-Miao; Wang, Bin; Zhou, Jiyong; Huang, Yao-Wei
2018-04-01
A monkey cell line Vero (ATCC CCL-81) is commonly used for porcine epidemic diarrhea virus (PEDV) propagation in vitro. However, it is still controversial whether the porcine aminopeptidase N (pAPN) counterpart on Vero cells (Vero-APN) confers PEDV entry. We found that endogenous expression of Vero-APN was undetectable in the mRNA and the protein levels in Vero cells. We cloned the partial Vero-APN gene (3340-bp) containing exons 1 to 9 from cellular DNA and subsequently generated two APN-knockout Vero cell lines by CRISPR/Cas9 approach. PEDV infection of two APN-knockout Vero cells had the same efficiency as the Vero cells with or without neuraminidase treatment. A Vero cells stably expressing pAPN did not increase PEDV production. SiRNA-knockdown of pAPN in porcine jejunum epithelial cells had no effects on PEDV infection. The results suggest that there exists an additional cellular receptor on Vero or porcine jejunal cells independent of APN for PEDV entry. Copyright © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gan, Qiong-Zhi; Sun, Xin-Yuan; Ouyang, Jian-Ming, E-mail: toyjm@jnu.edu.cn
2016-02-01
The adhesion and internalization between African green monkey kidney epithelial (Vero) cells (before and after oxidative damage by hydrogen peroxide) and calcium oxalate monohydrate (COM) nanocrystals (97 ± 35 nm) were investigated so as to discuss the molecular and cellular mechanism of kidney stone formation. Scanning electron microscope (SEM) was used to observe the Vero–COM nanocrystal adhesion; the nanocrystal-cell adhesion was evaluated by measuring the content of malonaldehyde (MDA), the activity of superoxide dismutase (SOD), the expression level of cell surface osteopontin (OPN) and the change of Zeta potential. Confocal microscopy and flow cytometry were used for the observation and quantitative analysis of crystal internalization. In the process of adhesion, the cell viability and the SOD activity declined, the MDA content, Zeta potential, and the OPN expression level increased. The adhesive capacity of injured Vero was obviously stronger than normal cells; in addition the injured cells promoted the aggregation of COM nanocrystals. The capacity of normal cells to internalize crystals was obviously stronger than that of injured cells. Cell injury increased adhesive sites on cell surface, thereby facilitating the aggregation of COM nanocrystals and their attachment, which results in enhanced risk of calcium oxalate stone formation. - Graphical abstract: The adhesion and internalization differences between Vero cells before and after oxidative damage and calcium oxalate monohydrate nanocrystals were comparatively studied. - Highlights: • Adhesion capacity of injured Vero cells was stronger than normal cells. • Internalization capacity of injured Vero cells was weaker than normal cells. • Injured cells promoted the aggregation of COM nanocrystals. • COM adhesion could aggravate cell injury in both normal and injured cells.
Replication-competent human adenovirus 11p vectors can propagate in Vero cells
International Nuclear Information System (INIS)
Gokumakulapalle, Madhuri; Mei, Ya-Fang
2016-01-01
The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.
Replication-competent human adenovirus 11p vectors can propagate in Vero cells
Energy Technology Data Exchange (ETDEWEB)
Gokumakulapalle, Madhuri; Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se
2016-08-15
The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.
International Nuclear Information System (INIS)
Yeung, Y.-S.; Yip, C.-W.; Hon, C.-C.; Chow, Ken Y.C.; Ma, Iris C.M.; Zeng Fanya; Leung, Frederick C.C.
2008-01-01
We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level
Influence of culture conditions on Vero cell propagation on non-porous microcarriers
Directory of Open Access Journals (Sweden)
Marta Cristina de Oliveira Souza
2005-06-01
Full Text Available Animal cell cultures are widely employed for the production of viral vaccines and for recombinant protein expression. The cell line Vero is a continuous, adherent cell line, which has been recommended by the World Health Organization for the production of human vaccines. For the large-scale production of vaccines, microcarriers, which are microspheres that serve as support for the cells, are being increasingly used. The use of microcarriers in stirred bioreactors allows high cell densities and, consequently, high virus titres to be achieved. With the aim of selecting appropriate culture conditions for the cultivation of Vero cells at high cell densities, in this work the influence of several variables (agitation rate, ratio of inoculated cells to microcarrier mass and fetal bovine serum concentration on cell growth on Cytodex 1 microcarriers was studied. Under the best conditions determined, a comparison with Vero cell cultivation on Cytodex 3 microcarriers was carried out.Cultivos de células animais são amplamente utilizados para a produção de vacinas virais e para a expressão de proteínas recombinantes. A linhagem celular Vero é uma linhagem contínua, dependente de ancoragem, recomendada pela Organização Mundial de Saúde para a produção de vacinas de uso humano. Para a produção de vacinas virais em larga escala, vêm sendo cada vez mais empregados microcarregadores, que são microesferas que servem de suporte para as células. O emprego de microcarregadores em biorreatores agitados permite a obtenção de altas densidades celulares e, conseqüentemente, de altos títulos de antígenos virais. Com o objetivo de selecionar condições de cultivo adequadas, estudou-se, neste trabalho, o efeito das variáveis agitação, razão de células inoculadas por microcarregador e concentração de soro fetal bovino sobre o crescimento de células Vero em microcarregadores Cytodex 1. Nas melhores condições selecionadas, o desempenho dos
New World hantaviruses activate IFNlambda production in type I IFN-deficient vero E6 cells.
Directory of Open Access Journals (Sweden)
Joseph Prescott
Full Text Available Hantaviruses indigenous to the New World are the etiologic agents of hantavirus cardiopulmonary syndrome (HCPS. These viruses induce a strong interferon-stimulated gene (ISG response in human endothelial cells. African green monkey-derived Vero E6 cells are used to propagate hantaviruses as well as many other viruses. The utility of the Vero E6 cell line for virus production is thought to owe to their lack of genes encoding type I interferons (IFN, rendering them unable to mount an efficient innate immune response to virus infection. Interferon lambda, a more recently characterized type III IFN, is transcriptionally controlled much like the type I IFNs, and activates the innate immune system in a similar manner.We show that Vero E6 cells respond to hantavirus infection by secreting abundant IFNlambda. Three New World hantaviruses were similarly able to induce IFNlambda expression in this cell line. The IFNlambda contained within virus preparations generated with Vero E6 cells independently activates ISGs when used to infect several non-endothelial cell lines, whereas innate immune responses by endothelial cells are specifically due to viral infection. We show further that Sin Nombre virus replicates to high titer in human hepatoma cells (Huh7 without inducing ISGs.Herein we report that Vero E6 cells respond to viral infection with a highly active antiviral response, including secretion of abundant IFNlambda. This cytokine is biologically active, and when contained within viral preparations and presented to human epithelioid cell lines, results in the robust activation of innate immune responses. We also show that both Huh7 and A549 cell lines do not respond to hantavirus infection, confirming that the cytoplasmic RNA helicase pathways possessed by these cells are not involved in hantavirus recognition. We demonstrate that Vero E6 actively respond to virus infection and inhibiting IFNlambda production in these cells might increase their utility
The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line
Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro
2014-01-01
Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ∼9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ∼59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831
Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu
2016-08-02
In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.
Directory of Open Access Journals (Sweden)
Célia Sayoko Takata
1994-06-01
Full Text Available A suscetibilidade da linhagem de células Vero ao vírus do sarampo é bem conhecida e sua utilização no controle da potência da vacina contra o sarampo é amplamente difundida. Com o objetivo de comparar a suscetibilidade de células Vero empregadas em titulações, amostras provenientes de dois laboratórios controladores (Vero IB e Vero INCQS, foram testadas frente a três cepas vacinais: Moraten, Schwarz e Biken CAM-70. Foram titulados 72 lotes de vacinas contra o sarampo, sendo 25 produzidos com a cepa Moraten, 24 com a cepa Schwarz e 23 com a cepa Biken CAM-70. A análise estatística dos resultados obtidos nas titulações, feita através dos testes Limites para uma Média e "t" de Student, mostrou que para as cepas Moraten e Biken CAM-70, as diferenças de títulos não foram estatisticamente significantes, o mesmo não ocorrendo com a cepa Schwarz, para a qual as células Vero IB se mostraram mais sensíveis.Vero cells used by distinct measles vaccine control laboratories had their susceptibility to Moraten, Schwarz and Biken CAM-70 vaccine strains assayed. Of a total of 72 lots of measles vaccine whose potency was titrated by microtechnique in two Vero cell samples (Vero IB and Vero INCQS, 25 had been produced with Moraten strain, 24 with Schwarz and 23 with Biken CAM-70. The statistical analysis of the results demonstrated that both Vero cells assayed presented comparable susceptibility to Moraten and Biken CAM-70 strains. As to the Schwarz strain, Vero IB cells were more susceptible than the other cell sample tested, thus confirming the existence of different sensitivities of Vero cells to some measles vaccine strains, or even to viruses derived from the same strain but with different passage histories. An altered cell susceptibility to virus replication may significantly alter the results in potency testing. Such alteration may be caused not only by the adoption of distinct protocols for the maintenance of cell cultures by
Flavone Enhances Dengue Virus Type-2 (NGC Strain Infectivity and Replication in Vero Cells
Directory of Open Access Journals (Sweden)
Keivan Zandi
2012-02-01
Full Text Available This study investigates the effects of 2-phenyl-1-benzopyran-4-one (flavone on DENV-2 infectivity in Vero cells. Virus adsorption and attachment and intracellular virus replication were investigated using a foci forming unit assay (FFUA and quantitative RT-PCR, respectively. Addition of flavone (100 μg/mL significantly increased the number of DENV-2 foci by 35.66% ± 1.52 and 49.66% ± 2.51 when added during and after virus adsorption to the Vero cells, respectively. The average foci size after 4 days of infection increased by 33% ± 2.11 and 89% ± 2.13. The DENV-2 specific RNA copy number in the flavone-treated infected cells increased by 6.41- and 23.1-fold when compared to the mock-treated infected cells. Flavone (100 μg/mL did not promote or inhibit Vero cell proliferation. The CC50 value of flavone against Vero cells was 446 µg/mL. These results suggest that flavone might enhance dengue virus replication by acting antagonistically towards flavonoids known to inhibit dengue virus replication.
The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line
Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro
2014-01-01
Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes...
Directory of Open Access Journals (Sweden)
Tahamtan, Y.
2014-11-01
Full Text Available Enterohemorrhagic Escherichia coli (EHEC, such as E. coli O157:H7, are emerging food-borne pathogens worldwide. This micro-organism can damage the epithelial tissue of the large intestine. The cytotoxic effects can be neutralized by probiotics such as Bifidobacterium bifidum. Probiotics are viable cells that have beneficial effects on the health of the host. The preventing activity of B. bifidum against E. coli O157 was studied using a Vero cell model. Vero cell was pretreated with viable B. bifidum and incubated for either 3 h to 24 h and then collected from the cell to make modified Vero cell (MVC. Indirect antibacterial effects of B. bifidum were demonstrated by reduction of attachment of E. coli O157:H7 to MVC. The maximum reduction was resulted in pretreatment of Vero cell with B. bifidum for 24 h before infection. B. bifidum attenuated E. coli O157:H7 attachment to MVC up to 10 days of incubation. To our knowledge, MCV prevented Vero cell line injury induced by E. coli O157:H7. Therefore, B. bifidum can be used for inhibition of E. coli O157:H7 cytopathic effect (CPE in Vero cell model, even as pretreatment of the cell line.
Carbamazepine induces mitotic arrest in mammalian Vero cells
International Nuclear Information System (INIS)
Perez Martin, J.M.; Fernandez Freire, P.; Labrador, V.; Hazen, M.J.
2008-01-01
We reported recently that the anticonvulsant drug carbamazepine, at supratherapeutic concentrations, exerts antiproliferative effects in mammalian Vero cells, but the underlying mechanism has not been elucidated. This motivates us to examine rigorously whether growth arrest was associated with structural changes in cellular organization during mitosis. In the present work, we found that exposure of the cells to carbamazepine led to an increase in mitotic index, mainly due to the sustained block at the metaphase/anaphase boundary, with the consequent inhibition of cell proliferation. Indirect immunofluorescence, using antibodies directed against spindle apparatus proteins, revealed that mitotic arrest was associated with formation of monopolar spindles, caused by impairment of centrosome separation. The final consequence of the spindle defects induced by carbamazepine, depended on the duration of cell cycle arrest. Following the time course of accumulation of metaphase and apoptotic cells during carbamazepine treatments, we observed a causative relationship between mitotic arrest and induction of cell death. Conversely, cells released from the block of metaphase by removal of the drug, continued to progress through mitosis and resume normal proliferation. Our results show that carbamazepine shares a common antiproliferative mechanism with spindle-targeted drugs and contribute to a better understanding of the cytostatic activity previously described in Vero cells. Additional studies are in progress to extend these initial findings that define a novel mode of action of carbamazepine in cultured mammalian cells
Carbamazepine induces mitotic arrest in mammalian Vero cells
Energy Technology Data Exchange (ETDEWEB)
Perez Martin, J.M.; Fernandez Freire, P.; Labrador, V. [Departamento de Biologia, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Hazen, M.J. [Departamento de Biologia, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)], E-mail: mariajose.hazen@uam.es
2008-01-01
We reported recently that the anticonvulsant drug carbamazepine, at supratherapeutic concentrations, exerts antiproliferative effects in mammalian Vero cells, but the underlying mechanism has not been elucidated. This motivates us to examine rigorously whether growth arrest was associated with structural changes in cellular organization during mitosis. In the present work, we found that exposure of the cells to carbamazepine led to an increase in mitotic index, mainly due to the sustained block at the metaphase/anaphase boundary, with the consequent inhibition of cell proliferation. Indirect immunofluorescence, using antibodies directed against spindle apparatus proteins, revealed that mitotic arrest was associated with formation of monopolar spindles, caused by impairment of centrosome separation. The final consequence of the spindle defects induced by carbamazepine, depended on the duration of cell cycle arrest. Following the time course of accumulation of metaphase and apoptotic cells during carbamazepine treatments, we observed a causative relationship between mitotic arrest and induction of cell death. Conversely, cells released from the block of metaphase by removal of the drug, continued to progress through mitosis and resume normal proliferation. Our results show that carbamazepine shares a common antiproliferative mechanism with spindle-targeted drugs and contribute to a better understanding of the cytostatic activity previously described in Vero cells. Additional studies are in progress to extend these initial findings that define a novel mode of action of carbamazepine in cultured mammalian cells.
Papaxanthos-Roche, A; Taupin, J L; Mayer, G; Daniel, J Y; Moreau, J F
1994-09-01
In the light of the newly discovered implications of human interleukin for DA cells and leukemia inhibitory factor in embryology, we searched for the presence of this soluble cytokine in the supernatant of Vero cell coculture systems. Using a bioassay as well as a specific ELISA, we demonstrated that Vero cells are able to release large quantities of human interleukin for DA cells and leukemia inhibitory factor in the embryo-growing medium of such cocultures.
Directory of Open Access Journals (Sweden)
Miguel G. Toscano
2017-09-01
Full Text Available Replication-defective (RD recombinant simian virus 40 (SV40-based gene delivery vectors hold a great potential for clinical applications because of their presumed non-immunogenicity and capacity to induce immune tolerance to the transgene products in humans. However, the clinical use of SV40 vectors has been hampered by the lack of a packaging cell line that produces replication-competent (RC free SV40 particles in the vector production process. To solve this problem, we have adapted the current SV40 vector genome used for the production of vector particles and generated a novel Vero-based packaging cell line named SuperVero that exclusively expresses the SV40 large T antigen. SuperVero cells produce similar numbers of SV40 vector particles compared to the currently used packaging cell lines, albeit in the absence of contaminating RC SV40 particles. Our unique SV40 vector platform named SVac paves the way to clinically test a whole new generation of SV40-based therapeutics for a broad range of important diseases.
Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells
Directory of Open Access Journals (Sweden)
Kleber Juvenal Silva Farias
2013-01-01
Full Text Available Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2. Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU. These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.
Chloroquine inhibits dengue virus type 2 replication in Vero cells but not in C6/36 cells.
Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes
2013-01-01
Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU). These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.
Yang, Jiajia; Lin, Yao; Jiang, Liming; Xi, Juemin; Wang, Xiaodan; Guan, Jiaoqiong; Chen, Junying; Pan, Yue; Luo, Jia; Ye, Chao; Sun, Qiangming
2018-05-02
To elucidate the differences in microRNAs during dengue virus infection between Vero cell-adapted strain (DENV-2-Vero) and its source, the clinical C6/36 isolated strain (DENV-2-C6/36), a comparison analysis was performed in Vero cells by high throughput sequencing. The results showed that the expression of 16 known and 3 novel miRNAs exhibited marked differences. 5 known miRNAs were up-regulated in DENV-2-C6/36 group, while 11 known microRNAs were down-regulated in DENV-2-Vero group. The GO enrichment and KEGG pathway analysis showed that there was a distinct difference in regulating viral replication between two strains. In DENV-2-Vero infection group, significantly enriched GO terms included virion attachment to host cells, viral structural protein/genome processing and packaging. Meanwhile, the regulation of cell death and apoptosis between two groups were different in the early stage of infection. KEGG enrichment analysis showed that DENV-2-C6/36 infection induced more intense regulation of immune-related pathways, including Fc gamma R-mediated phagocytosis, etc. DENV-2-Vero infection could partially alleviate the immune defense of Vero cells compared with DENV-2-C6/36. The results indicated that the distinct microRNA changes induced by two DENV-2 strains may be partly related to their infective abilities. Our data provide useful insights that help elucidate the host-pathogen interactions following DENV infection. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Danusupadmo, C.J. Sugiarto
1985-01-01
Vero and primary monkey kidney cells in culture were gamma irradiated with doses of 0, 0.4 and 0.8 Gy at a dose-rate of 1.30-1.45x10 3 Gy/hour. At harvest time 3 days post irradiation, 0.4 Gy proved to be able to lower the number of vero cells in such a degree that it became significantly different from the control, whereas 0.8 Gy could not suppress the number of primary cells to a level that differed significantly from its control. At harvest time of 7 days post irradiation, 0.4 Gy was found effective in lowering both vero and primary cells so that the number of the harvested cells were significantly different from the controls. At harvest time of 3 days post irradiation, 0.8 Gy caused both cell types reached levels that were not significantly different from 0.4 Gy, but at 7 days post irradiation the number of vero cells was very significantly different from that of 0.4 Gy, while the number of primary cells remained equal to that of 0.4 Gy. This phenomenon showed that irradiation could cause greater injurious effect at more advanced post irradiation times, while the more proliferative vero cells proved to be more susceptible to irradiation than primary cells, but at the same time more potential in performing repair. (author)
Clubbe, Jayne; Naylor, Clive J
2011-11-28
Throughout the world, avian metapneumovirus (AMPV) infection of subtype A is principally controlled by two live vaccines both derived from UK field strain #8544. Improvements of those vaccines by use of reverse genetics technology was found to be hampered by the inability of #8544 to replicate in the commonly exploited Vero cell based reverse genetics system. A systematic reverse genetics based genome modification of a DNA copy of #8544, employing sequence data from a Vero grown, #8544 derived, live vaccine; was used to determine mutations required to facilitate virus recovery and replication in Vero cells. This identified a single coding substitution in the M2:2 reading frame as responsible. Furthermore, ablation of M2:2 was found to elicit the same outcome. M2:2 sequence analysis of seven AMPVs found Vero cell adaption to be associated with non similar amino acid changes in M2:2. The study shows that M2:2 modification of field virus #8544 will enable research leading to improved vaccines. This may have more general application to other AMPV field strains. Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yu-Fen Tseng
Full Text Available Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14, a reassortant virus between A/Vietnam/1194/2004 (H5N1 virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15 was generated and can grow over 10(8 TCID(50/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes.
A purified inactivated Japanese encephalitis virus vaccine made in Vero cells.
Srivastava, A K; Putnak, J R; Lee, S H; Hong, S P; Moon, S B; Barvir, D A; Zhao, B; Olson, R A; Kim, S O; Yoo, W D; Towle, A C; Vaughn, D W; Innis, B L; Eckels, K H
2001-08-14
A second generation, purified, inactivated vaccine (PIV) against Japanese encephalitis (JE) virus was produced and tested in mice where it was found to be highly immunogenic and protective. The JE-PIV was made from an attenuated strain of JE virus propagated in certified Vero cells, purified, and inactivated with formalin. Its manufacture followed current GMP guidelines for the production of biologicals. The manufacturing process was efficient in generating a high yield of virus, essentially free of contaminating host cell proteins and nucleic acids. The PIV was formulated with aluminum hydroxide and administered to mice by subcutaneous inoculation. Vaccinated animals developed high-titered JE virus neutralizing antibodies in a dose dependent fashion after two injections. The vaccine protected mice against morbidity and mortality after challenge with live, virulent, JE virus. Compared with the existing licensed mouse brain-derived vaccine, JE-Vax, the Vero cell-derived JE-PIV was more immunogenic and as effective as preventing encephalitis in mice. The JE-PIV is currently being tested for safety and immunogenicity in volunteers.
A NEW COPPER (II)-IMIDAZOLE DERIVATIVE EFFECTIVELY INHIBITS REPLICATION OF DENV-2 IN VERO CELL
Sucipto, Teguh Hari; Churrotin, Siti; Setyawati, Harsasi; Martak, Fahimah; Mulyatno, Kris Cahyo; Amarullah, Ilham Harlan; Kotaki, Tomohiro; Kameoka, Masanori; Yotopranoto, Subagyo; Soegijanto, and Soegeng
2018-01-01
Background: Dengue is a kind of infectious disease that was distributed in the tropical and sub-tropical areas. To date, there is no clinically approved dengue vaccine or antiviral for humans, even though there have been great efforts towards this end. Therefore, finding the effective compound against dengue virus (DENV) replication is very important. Among the complex compounds, copper(II)-imidazole derivatives are of interest because of their biological and medicinal benefits. Materials and Methods: In the present study, antiviral activity of [Cu(2,4,5-triphenylimidazole)2]n, was evaluated against different stages of dengue virus type 2 (DENV-2) replication in Vero cell using focus forming unit reduction assay and quantitative ELISA. Results: [Cu(2,4,5-triphenylimidazole)2]n inhibited DENV-2 replication in Vero cells with IC50 = 2.3 μg/ml and SI= 19.42 when cells were treated 2 days after virus infection, whereas its CC50 for cytotoxicity to Vero cells was 44.174 μg/ml. Conclusion: The compound has high anti-DENV2 activity, less toxicity, and a high possibility to be considered a drug candidate. PMID:29619441
Liao, Ting T; Wang, Lei; Jia, Ru W; Fu, Xiao H; Chua, Hong
2014-01-01
Membrane damage related to morphological change in Vero cells is a sensitive index of the composite biotoxicity of trace lipophilic chemicals. However, judging whether the morphological change in Vero cells happens and its ratio are difficult because it is not a quantitative characteristic. To find biomarkers of cell morphological change for quantitatively representing the ratio of morphological changed cell, the mechanism of cell membrane damage driven by typical lipophilic chemicals, such as trichlorophenol (TCP) and perfluorooctanesulphonate (PFOS), was explored. The ratio of morphologically changed cells generally increased with increased TCP or PFOS concentrations, and the level of four major components of phospholipids varied with concentrations of TCP or PFOS, but only the ratio of phosphatidylcholine (PC)/phosphatidylethanolamine (PE) decreased regularly as TCP or PFOS concentrations increased. Analysis of membrane proteins showed that the level of vimentin in normal cell membranes is high, while it decreases or vanishes after TCP exposure. These variations in phospholipid and membrane protein components may result in membrane leakage and variation in rigid structure, which leads to changes in cell morphology. Therefore, the ratio of PC/PE and amount of vimentin may be potential biomarkers for representing the ratio of morphological changed Vero cell introduced by trace lipophilic compounds, thus their composite bio-toxicity.
Mali, Prashant Y.
2015-01-01
Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374
Directory of Open Access Journals (Sweden)
Syahida Ahmad
2012-10-01
Full Text Available The direct feeding of Jatropha meal containing phorbol esters (PEs indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang and African green monkey kidney (Vero cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 μg/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA values as positive control i.e., 124.5 and 106.3 μg/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-δ and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-δ and caspase-3 as their mode of actions.
International Nuclear Information System (INIS)
Kim, Il Han; Choi, Eun Kyung; Ha, Sung Whan; Park, Charn Il; Cha, Chang Yong
1988-01-01
Recovery from potentially lethal damage (PLDR) after irradiation was studied in plateau-phase culture of Vero cells in vitro. Unfed plateau-phase cells were irradiated with dose of 1 to 9 Gy using Cs-137 irradiator. Cells then were incubated again and left in situ for 0, 1, 2, 3, 4, 5, 6 and 24 hours and then were trypsinized, explanted, and subcultured in fresh RPMI-1640 media containing 0.33% agar. Cell survival was measured by colony forming ability. An adequate number of heavily irradiated Vero cells were added as feeder cells to make the total cell number constant in every culture dish. As the postirradiation in situ incubation time increased, surviving fraction increased saturation level at 2 to 4 hours after in situ incubation. As the radiation dose increased, the rate of PLDR also increased. In analysis of cell survival curve fitted to the linear-quadratic model, the linear inactivation coefficient (a) decreased largely and reached nearly to zero but the quadratic inactivation coefficient (b) increased minimally by increment of postirradiation in situ incubation time. So PLDR mainly affected the damage expressed as a. In the multitarget model, significant change was not obtained in D0 but in Dq. Therefore, shoulder region in cell survival curve was mainly affected by PLDR and terminal slope was not influenced at all. And dose-modifying factor by PLDR was relatively higher in shoulder region, that is, in low dose area below 3 Gy
[Cytotoxic effect of Vibrio cholerae non-O1 on Vero cells].
Figueroa-Arredondo, P; García-Lozano, H; Gutiérrez-Cogco, L; Valdespino-Gómez, J L
1994-01-01
At the present time there is still in Mexico a diarrhoeal outbreak due to Vibrio cholerae O1. In INDRE we have isolated from the same outbreak last year (jan-apr), 70 strains of Vibrio cholerae Non-O1. These were isolated from patients with a diarrhoeal illness different from cholera. Patients were of different ages and sex, and from various geographic areas. The isolated strains were confirmed by serological agglutination test with polyclonal antisera, and they neither belong to O1 serogroup or O139. We assayed all the 70 strains in Vero cells, searching for cytotoxic effect, probably attributed to cholera toxin, or any other toxin. The strains were screened by PCR for cholera toxin gene detection, and negative results were obtained. We have found only one CT-producer strain, but it was a rough one so, we are not able to affirm that is not a V. cholerae O1 serotype. Vibrio cholerae Non-O1 strains, tested in Vero cells assay, produced cytotoxic effect within 24 h. It was found that 48/70 strains (66.6%), had cytotoxic activity, showing rounding and then lysis of cells. From our results we concluded that this cytotoxic effect, is not cholera toxin related, instead we propose it could be due to an unknown virulence factor, probably a different toxin in mexican Vibrio cholerae Non-O1 strains.
Directory of Open Access Journals (Sweden)
Mohd Azmir Arifin
2010-01-01
Full Text Available The aim of this study is to prepare a model for the production of Newcastle disease virus (NDV lentogenic F strain using cell culture in bioreactor for live attenuated vaccine preparation. In this study, firstly we investigated the growth of Vero cells in several culture media. The maximum cell number was yielded by culture of Vero cells in Dulbecco's Modified Eagle Medium (DMEM which was 1.93×106 cells/ml. Secondly Vero cells were grown in two-litre stirred tank bioreactor by using several commercial microcarriers. We achieved the maximum cell concentration about 7.95×105 cells/ml when using Cytodex 1. Later we produced Newcastle Disease virus in stirred tank bioreactor based on the design developed using Taguchi L4 method. Results reveal that higher multiplicity of infection (MOI and size of cell inoculums can yield higher virus titer. Finally, virus samples were purified using high-speed centrifugation based on 3∗∗(3-1 Fractional Factorial Design. Statistical analysis showed that the maximum virus titer can be achieved at virus sample concentration of 58.45% (v/v, centrifugation speed of 13729 rpm, and centrifugation time of 4 hours. As a conclusion, high yield of virus titer could be achieved through optimization of cell culture in bioreactor and separation by high-speed centrifugation.
Directory of Open Access Journals (Sweden)
Yan Mylene L
2011-08-01
Full Text Available Abstract Background Influenza virus is a major health concern that has huge impacts on the human society, and vaccination remains as one of the most effective ways to mitigate this disease. Comparing the two types of commercially available Influenza vaccine, the live attenuated virus vaccine is more cross-reactive and easier to administer than the traditional inactivated vaccines. One promising live attenuated Influenza vaccine that has completed Phase I clinical trial is deltaFLU, a deletion mutant lacking the viral Nonstructural Protein 1 (NS1 gene. As a consequence of this gene deletion, this mutant virus can only propagate effectively in cells with a deficient interferon-mediated antiviral response. To demonstrate the manufacturability of this vaccine candidate, a batch bioreactor production process using adherent Vero cells on microcarriers in commercially available animal-component free, serum-free media is described. Results Five commercially available animal-component free, serum-free media (SFM were evaluated for growth of Vero cells in agitated Cytodex 1 spinner flask microcarrier cultures. EX-CELL Vero SFM achieved the highest cell concentration of 2.6 × 10^6 cells/ml, whereas other SFM achieved about 1.2 × 10^6 cells/ml. Time points for infection between the late exponential and stationary phases of cell growth had no significant effect in the final virus titres. A virus yield of 7.6 Log10 TCID50/ml was achieved using trypsin concentration of 10 μg/ml and MOI of 0.001. The Influenza vaccine production process was scaled up to a 3 liter controlled stirred tank bioreactor to achieve a cell density of 2.7 × 10^6 cells/ml and virus titre of 8.3 Log10 TCID50/ml. Finally, the bioreactor system was tested for the production of the corresponding wild type H1N1 Influenza virus, which is conventionally used in the production of inactivated vaccine. High virus titres of up to 10 Log10 TCID50/ml were achieved. Conclusions We describe for the
International Nuclear Information System (INIS)
Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.
1986-01-01
The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated 35 S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with 32 P-ATP (in vitro method) or 32 Pi (in vivo method). Finally, analysis of 3 H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells
Diphtheria toxin-induced channels in Vero cells selective for monovalent cations
International Nuclear Information System (INIS)
Sandvig, K.; Olsnes, S.
1988-01-01
Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of 45 Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed
International Nuclear Information System (INIS)
Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.
2013-01-01
Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants
Energy Technology Data Exchange (ETDEWEB)
Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)
2013-07-05
Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.
International Nuclear Information System (INIS)
Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang
2012-01-01
Highlights: ► Vero cell-based HPAI H5N1 vaccine with stable high yield. ► Stable high yield derived from the YNVa H3N2 backbone. ► H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.
Paudel, Sarita; Shin, Hyun-Jin
2015-12-01
To understand the molecular mechanisms of Avian metapneumovirus (aMPV) and the requirements involved in the infection and fusion, trypsin treatment was done in the different stages of virus; before infection, during entry and after virus infection followed by aMPV infection. The growth kinetics of aMPV was compared in time dependent manner. The effect of trypsin was found in the later stage of aMPV infection increasing the numbers of infected cells with the significant higher titer of infectious virions to that of trypsin treated before infection, during entry and aMPV. A serine protease inhibitor reduced aMPV replication in a significant way, whereas cysteine peptidase (E-64), aspartic protease (pepstatin A), and metalloprotease (phosphoramidon) inhibitors had no effect on aMPV replication. Inoculation of aMPV on Vero cells expressing the membrane-associated protease TMPRSS2 resulted in higher virus titers than that inoculated on normal Vero cells and is statistically significant (p < 0.05). Also, an inhibitor of clathrin/caveolae-mediated endocytosis had no effect on virus progeny, indicating that aMPV does not use the endocytic pathway for entry but undergoes direct fusion. The effect of lysosomotropic agents was not significant, suggesting that aMPV does not require low-pH environment in endosomes to fuse its envelope with the plasma membrane. Copyright © 2015 Elsevier Ltd. All rights reserved.
VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt
Directory of Open Access Journals (Sweden)
Laura Lafon-Hughes
2014-10-01
Full Text Available Poly-ADP-ribose (PAR is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs and degraded by poly-ADP-ribose-glycohydrolase (PARG. Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair. Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt. In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO. PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China); Wang, Yue [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People' s Republic of China (China); Liao, Guoyang [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China)
2012-05-18
Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.
Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells
Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes
2013-01-01
Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR a...
Directory of Open Access Journals (Sweden)
Andrea Rodrigues Esposito
2013-01-01
Full Text Available Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. it is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. in this study, poly(lactide-co-glycolide, plga, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on vero cells culture. the plga membranes, which were characterized by sem and contact angle, showed increased surface rugosity and narrower contact angles. cell adhesion, cytotoxicity assay, sem and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction. Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. It is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. Plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. In this study, poly(lactide-co-glycolide, PLGA, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on Vero cells culture. The PLGA membranes, which were characterized by SEM and contact angle, showed increased surface rugosity and narrower contact angles. Cell adhesion, cytotoxicity assay, SEM and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction.
Rjiba-Touati, Karima; Ayed-Boussema, Imen; Soualeh, Nidhal; Achour, Abdellatif; Bacha, Hassen; Abid, Salwa
2013-08-01
Cisplatin (CDDP) and mitomycin C (MMC), two alkylating agents used against various solid tumours, are a common source of acute kidney injury. Thus, strategies for minimizing CDDP and MMC toxicity are of a clinical interest. In this study, we aimed to investigate the protective role of recombinant human erythropoietin (rhEPO) against oxidative stress and genotoxicity induced by CDDP and MMC in cultured Vero cells. Three types of treatments were performed: (i) cells were treated with rhEPO 24 h before exposure to CDDP/MMC (pre-treatment), (ii) cells were treated with rhEPO and CDDP/MMC simultaneously (co-treatment), (iii) cells were treated with rhEPO 24 h after exposure to CDDP/MMC (post-treatment). Our results showed that rhEPO decreased the reactive oxygen species levels, the malondialdehyde levels and ameliorated glutathione (reduced and oxidized glutathione) modulation induced by CDDP and MMC in cultured Vero cells. Furthermore, rhEPO administration prevented alkylating agents-induced DNA damage accessed by comet test. Altogether, our results suggested a protective role of rhEPO, against CDDP- and MMC-induced oxidative stress and genotoxicity, especially in pre-treatment condition.
Directory of Open Access Journals (Sweden)
Pless-Petig Gesine
2012-10-01
Full Text Available Abstract Background In modern biotechnology, there is a need for pausing cell lines by cold storage to adapt large-scale cell cultures to the variable demand for their products. We compared various cell culture media/solutions for cold storage of Vero-B4 kidney cells, a cell line widely used in biotechnology. Results Cold storage in RPMI 1640 medium, a recommended cell culture medium for Vero-B4 cells, surprisingly, strongly enhanced cold-induced cell injury in these cells in comparison to cold storage in Krebs-Henseleit buffer or other cell culture media (DMEM, L-15 and M199. Manufacturer, batch, medium supplements and the most likely components with concentrations outside the range of the other media/solutions (vitamin B12, inositol, biotin, p-aminobenzoic acid did not cause this aggravation of cold-induced injury in RPMI 1640. However, a modified Krebs-Henseleit buffer with a low calcium concentration (0.42 mM, a high concentration of inorganic phosphate (5.6 mM, and glucose (11.1 mM; i.e. concentrations as in RPMI 1640 evoked a cell injury and loss of metabolic function corresponding to that observed in RPMI 1640. Deferoxamine improved cell survival and preserved metabolic function in modified Krebs-Henseleit buffer as well as in RPMI 1640. Similar Ca2+ and phosphate concentrations did not increase cold-induced cell injury in the kidney cell line LLC-PK1, porcine aortic endothelial cells or rat hepatocytes. However, more extreme conditions (Ca2+ was nominally absent and phosphate concentration raised to 25 mM as in the organ preservation solution University of Wisconsin solution also increased cold-induced injury in rat hepatocytes and porcine aortic endothelial cells. Conclusion These data suggest that the combination of low calcium and high phosphate concentrations in the presence of glucose enhances cold-induced, iron-dependent injury drastically in Vero-B4 cells, and that a tendency for this pathomechanism also exists in other cell types.
Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad
2016-01-01
Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.
Directory of Open Access Journals (Sweden)
Mahmoud Huleihel
Full Text Available Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA was performed on the Raman spectra after principal component analysis (PCA with a leave one out (LOO approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.
Alteration of cell cycle progression by Sindbis virus infection
Energy Technology Data Exchange (ETDEWEB)
Yi, Ruirong; Saito, Kengo [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Isegawa, Naohisa [Laboratory Animal Center, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Shirasawa, Hiroshi, E-mail: sirasawa@faculty.chiba-u.jp [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan)
2015-07-10
We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.
Alteration of cell cycle progression by Sindbis virus infection
International Nuclear Information System (INIS)
Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi
2015-01-01
We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G 1 phase preferred to proliferate during S/G 2 phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G 1 phase than in cells infected during S/G 2 phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases
VERO MODA Settles in Taobao Mall
Institute of Scientific and Technical Information of China (English)
2010-01-01
@@ In the wake of the successive opening up of Jack&Jones' and ONLY's official flagship stores in Taobao Mall, the Danish Bestseller Fashion Group's other brand, VERO MODA, landed the Mall on July 2nd. At present, the first two brands' online sales have exceeded 500 million yuan per month. Based on the encouraging sales figures, VERO MODA, as Bestseller's third-largest brand on Taobao platform, is expected to scale new network marketing miracle.
Lee, Jong-Seon; Kim, Ju-Hwan; Seo, Young-Seok; Yang, Jung-Bo; Kim, Yong-Il; Kim, Hye-Jin; Lee, Ki-Hwan
2013-09-01
This study was conducted to examine the influences of supplementation of the serum substituents and available period of serum-free Vero cell conditioned media (SF-VCM) manufactured from Dulbecco's modified Eagle medium cultured with Vero cells for in vitro development of mouse preimplantation embryos. A total of 1,099 two-cell embryos collected from imprinting control region mice were cultured in SF-VCM with 10% and 20% human follicular fluid (hFF), serum substitute supplement (SSS), and serum protein substitute (SPS). Development of embryos was observed every 24 hours. Results between different groups were analyzed by chi-square test, and considered statistically significant when P-value was less than 0.05. The rates of embryonic development cultured in SF-VCM supplemented with serum substituents were significantly higher compare with serum-free group (P media up to 4 weeks did not affect on embryonic development.
Chen, Jun; Liang, Xiu; Chen, Pei-fu
2011-04-01
Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.
Directory of Open Access Journals (Sweden)
Mendel Friedman
2013-08-01
Full Text Available Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1 in Vero cells by two independent assays: the green fluorescent protein (GFP assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed.
Salman, A; Shufan, E; Zeiri, L; Huleihel, M
2014-07-01
Herpes viruses are involved in a variety of human disorders. Herpes Simplex Virus type 1 (HSV-1) is the most common among the herpes viruses and is primarily involved in human cutaneous disorders. Although the symptoms of infection by this virus are usually minimal, in some cases HSV-1 might cause serious infections in the eyes and the brain leading to blindness and even death. A drug, acyclovir, is available to counter this virus. The drug is most effective when used during the early stages of the infection, which makes early detection and identification of these viral infections highly important for successful treatment. In the present study we evaluated the potential of Raman spectroscopy as a sensitive, rapid, and reliable method for the detection and identification of HSV-1 viral infections in cell cultures. Using Raman spectroscopy followed by advanced statistical methods enabled us, with sensitivity approaching 100%, to differentiate between a control group of Vero cells and another group of Vero cells that had been infected with HSV-1. Cell sites that were "rich in membrane" gave the best results in the differentiation between the two categories. The major changes were observed in the 1195-1726 cm(-1) range of the Raman spectrum. The features in this range are attributed mainly to proteins, lipids, and nucleic acids. Copyright © 2014. Published by Elsevier Inc.
Lima, Helimar Gonçalves; Gomes, Danilo Cavalcante; Santos, Nathália Silva; Dias, Êuder Reis; Botura, Mariana Borges; Batatinha, Maria José Moreira; Branco, Alexsandro
2017-10-01
This study was designed to assess the in vitro anthelmintic activity of the fraction containing alkaloid from Prosopis juliflora pods on goat gastrointestinal nematodes using the egg hatch assay (EHA), larval migration inhibition assay (LMIA), and larval motility assay (LMA). The alkaloid-rich fraction (AF) - content juliprosopine as major alkaloid - was obtained from ethyl acetate extract after fractionation in Sephadex LH-20 chromatography column and its characterization were made by nuclear magnetic resonance analysis together with literature data comparison. The concentrations tested were 4.0, 2.67, 1.78, 1.19, and 0.79 mg/mL (EHA) and 4 mg/mL (LMIA and LMA). The in vitro cytotoxicity on Vero cell cultures was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and trypan blue tests. High ovicidal activity was observed with IC 50 and IC 90 values at 1.1 and 1.43 mg/mL for AF. On the other hand, this fraction showed low larvicidal activity and high toxic effect. Thus, P. juliflora pod alkaloid rich-fraction has ovicidal activity in vitro against goat gastrointestinal nematodes and cytotoxic in Vero cell cultures. Prosopis juliflora alkaloid-rich fraction (AF) showed in vitro anthelmintic effect against gastrointestinal nematodes of goatsThe AF was more effective against eggs than third larval stage (L 3 ) of gastrointestinal nematodesThe AF showed cytotoxicity activity on Vero cell lineThe juliprosopine was the main alkaloid found in the AF from P. juliflora pods. Abbreviations used: AF: Alkaloid-rich fraction; DMSO: Dimethyl sulfoxide; EE: Ethyl acetate extract; EHA: Egg hatch assay; IC50: Inhibitory concentration 50%; IC90: Inhibitory concentration 90%; L3: Infective larvae; LMA: Larval motility assay; LMIA: Larval migration inhibition assay; MTT: Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; PBS: Phosphate buffered saline; RPMI: Roswell Park Memorial Institute médium; TLC
International Nuclear Information System (INIS)
Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai
2003-01-01
To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses
Martínez-Betancur, Viviana; Marín-Villa, Marcel; Martínez-Gutierrez, Marlén
2014-08-01
Dengue virus (DENV) is the causative agent of dengue and severe dengue. To understand better the dengue virus-host interaction, it is important to determine how the expression of cellular proteins is modified due to infection. Therefore, a comparison of protein expression was conducted in Vero cells infected with two different DENV strains, both serotype 2: DENV-2/NG (associated with dengue) and DENV-2/16681 (associated with severe dengue). The viability of the infected cells was determined, and neither strain induced cell death at 48 hr. In addition, the viral genomes and infectious viral particles were quantified, and the genome of the DENV-2/16681 strain was determined to have a higher replication rate compared with the DENV-2/NG strain. Finally, the proteins from infected and uninfected cultures were separated using two-dimensional gel electrophoresis, and the differentially expressed proteins were identified by mass spectrometry. Compared with the uninfected controls, the DENV-2/NG- and DENV-2/16681-infected cultures had five and six differentially expressed proteins, respectively. The most important results were observed when the infected cultures were compared to each other (DENV-2/NG vs. DENV-2/16681), and 18 differentially expressed proteins were identified. Based on their cellular functions, many of these proteins were linked to the increase in the replication efficiency of DENV. Among the proteins were calreticulin, acetyl coenzyme A, acetyl transferase, and fatty acid-binding protein. It was concluded that the infection of Vero cells with DENV-2/NG or DENV-2/16681 differentially modifies the expression of certain proteins, which can, in turn, facilitate infection. © 2013 Wiley Periodicals, Inc.
Dynamics of actin-based movement by Rickettsia rickettsii in vero cells.
Heinzen, R A; Grieshaber, S S; Van Kirk, L S; Devin, C J
1999-08-01
Actin-based motility (ABM) is a virulence mechanism exploited by invasive bacterial pathogens in the genera Listeria, Shigella, and Rickettsia. Due to experimental constraints imposed by the lack of genetic tools and their obligate intracellular nature, little is known about rickettsial ABM relative to Listeria and Shigella ABM systems. In this study, we directly compared the dynamics and behavior of ABM of Rickettsia rickettsii and Listeria monocytogenes. A time-lapse video of moving intracellular bacteria was obtained by laser-scanning confocal microscopy of infected Vero cells synthesizing beta-actin coupled to green fluorescent protein (GFP). Analysis of time-lapse images demonstrated that R. rickettsii organisms move through the cell cytoplasm at an average rate of 4.8 +/- 0.6 micrometer/min (mean +/- standard deviation). This speed was 2.5 times slower than that of L. monocytogenes, which moved at an average rate of 12.0 +/- 3.1 micrometers/min. Although rickettsiae moved more slowly, the actin filaments comprising the actin comet tail were significantly more stable, with an average half-life approximately three times that of L. monocytogenes (100.6 +/- 19.2 s versus 33.0 +/- 7.6 s, respectively). The actin tail associated with intracytoplasmic rickettsiae remained stationary in the cytoplasm as the organism moved forward. In contrast, actin tails of rickettsiae trapped within the nucleus displayed dramatic movements. The observed phenotypic differences between the ABM of Listeria and Rickettsia may indicate fundamental differences in the mechanisms of actin recruitment and polymerization.
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Krug, Peter W; Holinka, Lauren G; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R; Borca, Manuel V
2015-02-01
African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been
Barrett, P Noel; Terpening, Sara J; Snow, Doris; Cobb, Ronald R; Kistner, Otfried
2017-09-01
Rapid development and production of vaccines against emerging diseases requires well established, validated, robust technologies to allow industrial scale production and accelerated licensure of products. Areas covered: A versatile Vero cell platform has been developed and utilized to deliver a wide range of candidate and licensed vaccines against emerging viral diseases. This platform builds on the 35 years' experience and safety record with inactivated whole virus vaccines such as polio vaccine. The current platform has been optimized to include a novel double inactivation procedure in order to ensure a highly robust inactivation procedure for novel emerging viruses. The utility of this platform in rapidly developing inactivated whole virus vaccines against pandemic (-like) influenza viruses and other emerging viruses such as West Nile, Chikungunya, Ross River and SARS is reviewed. The potential of the platform for development of vaccines against other emerging viruses such as Zika virus is described. Expert commentary: Use of this platform can substantially accelerate process development and facilitate licensure because of the substantial existing data set available for the cell matrix. However, programs to provide vaccines against emerging diseases must allow alternative clinical development paths to licensure, without the requirement to carry out large scale field efficacy studies.
Konsentrasi Aman Kurkumin dan PGV-0 terhadap Sel Vero Berdasarkan Hasil Uji Sitotoksik
Directory of Open Access Journals (Sweden)
Dewi Marbawati
2015-08-01
Full Text Available Curcumin (1,7-bis(3-methoxyphenyl 4'hidroksi -1.6 heptadien, 3,5-dione is the yellow pigment of Curcuma longa. Curcumin has various biological activities such as antioxidant, antibacterial, antifungal, antiprotozoal and antivirus. Various benefits of curcumin can not be separated from the weakness which is not stable to pH and light. Pentagamavunon-0 (PGV-0 were made by changing the β diketone group on cluster analog of curcumin into monoketon while eliminating active methylene group so it is more stable to pH and light. PGV-0 also has potential as a stronger antioxidant and antiinflammatory agent than other curcumin analogues. The objective of this research was to determine the safe concentrations of curcumin and PGV-0 on vero cells due to the increased use of the two compounds through the cytotoxic test. This research includes experimental research. Cytotoxic test performed with microculture tetrazolium technique (MTT method. Use of MTT to evaluate the cytotoxic is based on changes of tetrazolium salt into formazan crystals by mitochondrial enzyme succinate dehydrogenase with the help of cellular NADH. The results showed that the safe concentrations of curcumin and PGV-0 on vero cells respectively are 6.25 and 1.5625 ppm. Based on the cytotoxic test the secure concentration of curcumin was higher than PGV-0.
Directory of Open Access Journals (Sweden)
Szekely Laszlo
2003-04-01
Full Text Available Abstract Background Ebola virus causes severe, often fatal hemorrhagic fever in humans. The mechanism of escape from cellular anti-viral mechanisms is not yet fully understood. The promyelocytic leukaemia (PML associated nuclear body is part of the interferon inducible cellular defense system. Several RNA viruses have been found to interfere with the anti-viral function of the PML body. The possible interaction between Ebola virus and the PML bodies has not yet been explored. Results We found that two cell lines, Vero E6 and MCF7, support virus production at high and low levels respectively. The expression of viral proteins was visualized and quantified using high resolution immunofluorescence microscopy. Ebola encoded NP and VP35 accumulated in cytoplasmic inclusion bodies whereas VP40 was mainly membrane associated but it was also present diffusely in the cytoplasm as well as in the euchromatic areas of the nucleus. The anti-VP40 antibody also allowed the detection of extracellular virions. Interferon-alpha treatment decreased the production of all three viral proteins and delayed the development of cytopathic effects in both cell lines. Virus infection and interferon-alpha treatment induced high levels of PML protein expression in MCF7 but much less in Vero E6 cells. No disruption of PML bodies, a common phenomenon induced by a variety of different viruses, was observed. Conclusion We have established a simple fixation and immunofluorescence staining procedure that allows specific co-detection and precise sub-cellular localization of the PML nuclear bodies and the Ebola virus encoded proteins NP, VP35 and VP40 in formaldehyde treated cells. Interferon-alpha treatment delays virus production in vitro. Intact PML bodies may play an anti-viral role in Ebola infected cells.
International Nuclear Information System (INIS)
Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.
1987-01-01
The rates of bicarbonate-dependent uptake and efflux of 22 Na + in Vero cells were studied and compared with the uptake and efflux of 36 Cl - . Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na + was much less affected by changes in pH. The bicarbonate-linked uptake of 22 Na + was dependent on internal Cl- but not on internal Na + . At a constant external concentration of HCO 3 -, the amount of 22 Na + associated with the cells increased when the internal concentration of HCO 3 - decreased and vice versa, which is compatible with the possibility that the ion pair NaCO 3 - is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of 36 Cl - both in the absence and presence of Na + . At alkaline internal pH, HCO 3 - stimulated the efflux of 36 Cl - from preloaded cells, while at acidic internal pH both Na + and HCO 3 - were required to induce 36 Cl - efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane
An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.
Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena
2015-08-20
Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S
2014-01-01
Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit
Directory of Open Access Journals (Sweden)
Mary M Melia
Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.
Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji
2006-03-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.
SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT
International Nuclear Information System (INIS)
Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H
2016-01-01
Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and
SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT
Energy Technology Data Exchange (ETDEWEB)
Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)
2016-06-15
Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and
Sun, Xin-Yuan; Ouyang, Jian-Ming; Gan, Qiong-Zhi; Liu, Ai-Jie
2016-11-01
Urinary crystals in normal and kidney stone patients often differ in crystal sizes and surface structures, but the effects of different crystal properties on renal tubular epithelial cells remain unclear. This study aimed to compare the cytotoxicity of micron/nano-calcium oxalate monohydrate (COM) crystals with sizes of 50 nm, 200 nm, 1 μm, 3 μm, and 10 μm to African green monkey renal epithelial (Vero) cells, to reveal the effect of crystal size and surface structure on cell injury, and to investigate the pathological mechanism of calcium oxalate kidney stones. Cell viability, cellular biochemical parameters, and internalized crystal amount in Vero cells were closely associated with the size of COM crystals. At the same concentration (200 μg/mL), COM-1 μm induced the most serious injury to Vero cells and caused the most significant change to cellular biochemical parameters, which were related to the specific porous structure and highest internalized amount in Vero cells. By contrast, COM-50 nm and COM-200 nm crystals lost their small size effect because of serious aggregation and weakened their toxicity to cells. COM-3 μm and COM-10 μm crystals were too large for cells to completely internalize; these crystals also exhibited a low specific surface area and thus weakened their toxicity. The excessive expression of intracellular ROS and reduction of the free-radical scavenger SOD were the main reasons for cell injury and eventually caused necrotic cell death. Crystal size, surface structure, aggregation, and internalization amount were closely related to the cytotoxicity of COM crystals.
Directory of Open Access Journals (Sweden)
Lev Shapira
2016-12-01
Full Text Available Although many viral particles can enter a single cell, the number of viral genomes per cell that establish infection is limited. However, mechanisms underlying this restriction were not explored in depth. For herpesviruses, one of the possible mechanisms suggested is chromatinization and silencing of the incoming genomes. To test this hypothesis, we followed infection with three herpes simplex virus 1 (HSV-1 fluorescence-expressing recombinants in the presence or absence of histone deacetylases inhibitors (HDACi’s. Unexpectedly, a lower number of viral genomes initiated expression in the presence of these inhibitors. This phenomenon was observed using several HDACi: Trichostatin A (TSA, Suberohydroxamic Acid (SBX, Valporic Acid (VPA and Suberoylanilide Hydoxamic Acid (SAHA. We found that HDACi presence did not change the progeny outcome from the infected cells but did alter the kinetic of the gene expression from the viral genomes. Different cell types (HFF, Vero and U2OS, which vary in their capability to activate intrinsic and innate immunity, show a cell specific basal average number of viral genomes establishing infection. Importantly, in all cell types, treatment with TSA reduced the number of viral genomes. ND10 nuclear bodies are known to interact with the incoming herpes genomes and repress viral replication. The viral immediate early protein, ICP0, is known to disassemble the ND10 bodies and to induce degradation of some of the host proteins in these domains. HDACi treated cells expressed higher levels of some of the host ND10 proteins (PML and ATRX, which may explain the lower number of viral genomes initiating expression per cell. Corroborating this hypothesis, infection with three HSV-1 recombinants carrying a deletion in the gene coding for ICP0, show a reduction in the number of genomes being expressed in U2OS cells. We suggest that alterations in the levels of host proteins involved in intrinsic antiviral defense may result in
Directory of Open Access Journals (Sweden)
Joseph J
2009-01-01
Full Text Available Being intracellular parasites, microsporidia can only be propagated in cell culture systems. This study evaluated three cell lines to determine the most suitable host-parasite In vitro system. Confluent monolayers of vero, SIRC, and HeLa cell lines, grown in 24-well tissue culture plates, were inoculated with varying concentrations (1 x 10 4 to 1 x 10 8 spores/mL of Vittaforma corneae, Encephalitozoon hellem, Encephalitozoon cuniculi, and Encephalitozoon intestinalis spores. Growth was compared quantitatively at weekly intervals. Encephalitozoon species showed the highest amount of growth when cultured in vero cell line, while there was no significant difference in their growth in SIRC and HeLa cell lines. In comparison, V. corneae showed the highest growth in SIRC cells, followed by vero cells. The analytical sensitivity was found to be 1 x 10 4 spores/mL for vero cell line compared to 1 x 10 5 spores/mL for SIRC cell line and 1 x 10 7 spores/mL for HeLa cell line. HeLa cells also showed rapid disruption of cells, and the spores could not be easily distinguished from cell debris. This is the first report of the comparison of vero, SIRC, and HeLa for the propagation of microsporidial spores. Vero cell line was found to be more sensitive than SIRC and HeLa cells, and we believe that the inclusion of vero cell line in the routine culture protocols of ocular parasitology laboratories would result in a significant increase in the diagnostic yield.
Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study
Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon
2016-12-01
The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.
77 FR 42425 - Amendment of Air Traffic Service (ATS) Routes in the Vicinity of Vero Beach, FL
2012-07-19
...This action amends the legal descriptions of Jet Routes J-45 and J-79, and VHF omnidirectional range (VOR) Federal airways V-3, V-51, V-159, V-225, V-295 and V-537, in the vicinity of Vero Beach, FL. The FAA is taking this action because the name of the Vero Beach, FL, VOR Tactical Air Navigation (VORTAC) facility, which is included in the descriptions of the above routes, is being changed to the Treasure VORTAC.
Directory of Open Access Journals (Sweden)
Jialin Zhang
Full Text Available From 2013 to 2015, peste des petits ruminants (PPR broke out in more than half of the provinces of China; thus, the application and development of diagnostic methods are very important for the control of PPR. Here, an immunoperoxidase monolayer assay (IPMA was developed to detect antibodies against PPR. However, during IPMA development, we found that Vero cells were not the appropriate choice because staining results were not easily observed. Therefore, we first established a baby hamster kidney-goat signaling lymphocyte activation molecule (BHK-SLAM cell line that could stably express goat SLAM for at least 20 generations. Compared with Vero cells, the PPR-mediated cytopathic effect occurred earlier in BHK-SLAM cells, and large syncytia appeared after virus infection. Based on this cell line and recombinant PPR virus expressing the green fluorescent protein (GFP (rPPRV-GFP, an IPMA for PPR diagnosis was developed. One hundred and ninety-eight PPR serum samples from goats or sheep were tested by the IPMA and virus neutralization test (VNT. Compared with the VNT, the sensitivity and specificity of the IPMA were 91% and 100%, respectively, and the coincidence rate of the two methods was 95.5%. The IPMA assay could be completed in 4 h, compared with more than 6 d for the VNT using rPPRV-GFP, and it is easily performed, as the staining results can be observed under a microscope. Additionally, unlike the VNT, the IPMA does not require antigen purification, which will reduce its cost. In conclusion, the established IPMA will be an alternative method that replaces the VNT for detecting antibodies against PPRV in the field.
International Nuclear Information System (INIS)
Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen
2008-01-01
Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins
Directory of Open Access Journals (Sweden)
Jean-Marc Brunner
Full Text Available Although the pathology of Morbillivirus in the central nervous system (CNS is well described, the molecular basis of neurodegenerative events still remains poorly understood. As a model to explore Morbillivirus-mediated CNS dysfunctions, we used canine distemper virus (CDV that we inoculated into two different cell systems: a monkey cell line (Vero and rat primary hippocampal neurons. Importantly, the recombinant CDV used in these studies not only efficiently infects both cell types but recapitulates the uncommon, non-cytolytic cell-to-cell spread mediated by virulent CDVs in brain of dogs. Here, we demonstrated that both CDV surface glycoproteins (F and H markedly accumulated in the endoplasmic reticulum (ER. This accumulation triggered an ER stress, characterized by increased expression of the ER resident chaperon calnexin and the proapoptotic transcription factor CHOP/GADD 153. The expression of calreticulin (CRT, another ER resident chaperon critically involved in the response to misfolded proteins and in Ca(2+ homeostasis, was also upregulated. Transient expression of recombinant CDV F and H surface glycoproteins in Vero cells and primary hippocampal neurons further confirmed a correlation between their accumulation in the ER, CRT upregulation, ER stress and disruption of ER Ca(2+ homeostasis. Furthermore, CDV infection induced CRT fragmentation with re-localisation of a CRT amino-terminal fragment, also known as vasostatin, on the surface of infected and neighbouring non-infected cells. Altogether, these results suggest that ER stress, CRT fragmentation and re-localization on the cell surface may contribute to cytotoxic effects and ensuing cell dysfunctions triggered by Morbillivirus, a mechanism that might potentially be relevant for other neurotropic viruses.
Eficiencia de cultivo in vitro de Toxoplasma gondii en las líneas celulares THP1 y Vero
Directory of Open Access Journals (Sweden)
Jorge Andrés Cuellar
2012-03-01
Full Text Available Introducción. El cultivo in vitro es un método importante para la obtención de Toxoplasma gondii confines de diagnóstico clínico o biotecnológico. Objetivo. Determinar el porcentaje de invasión y producción de T. gondii en las líneas celulares THP1y Vero. Materiales y métodos. Se determinó la curva de crecimiento para las células Vero y THP1 por conteoen hemocitómetro. Posteriormente, se identificó el porcentaje de invasión de T. gondii en células THP1y Vero por citometría de flujo, en diferentes proporciones célula/taquizoíto de 1/5, 1/20, 1/50. Por otrolado, se calculó el índice de rendimiento de T. gondii, cepa RH, y del aislamiento CIBM1 en célulasTHP1. Resultados. Las células Vero crecen más rápidamente que las células THP1, con un crecimientoexponencial en un periodo de siete días. El aislamiento CIBM1 infecta las células THP1 en las tresproporciones diferentes de 1/5,1/20 y 1/50 con porcentajes de invasión de 57,1 %, 15,5 % y 12,2 %, yen células Vero, de 25,3 %, 17,8 % y 8,8 %. La cepa RH de T. gondii mostró porcentajes de invasiónmás bajos, de 32,6 %, 14,8 % y 8,1 % en células THP1 y de 22,3 %, 14,1 % y 3,4 % en células Vero. Conclusiones. El aislamiento CIBM1 presentó mayor rendimiento con respecto a la cepa RH de T.gondii en células THP1, siendo estas células una buena línea para estudiar el proceso de invasión yprobar candidatos farmacológicos para reducir la infección por T. gondii. doi: http://dx.doi.org/10.7705/biomedica.v32i3.485
Coswig, Lia Treptow; dos Santos, Márcia Bianchi; Hafez, Hafez Mohamed; Ferreira, Helena Lage; Arns, Clarice Weis
2010-07-01
Primary isolation of avian metapneumovirus (aMPV) is carried out using tracheal organ culture (TOC) or chicken embryonated eggs with subsequent adaptation in chicken embryo fibroblasts (CEF) or Vero cultures. This study was conducted to evaluate six different cell lines and two avian culture systems for the propagation of aMPV subtypes A and B. The chicken embryo related (CER) cells were used successfully for primary isolation. In addition to Vero and baby hamster kidney (BHK-21) cells, CER cells were also shown to be the most appropriate for propagation of aMPV considering high titres. Propagation of A and B subtypes in CEF and TOC remained efficient after the primary isolation and several passages of viruses in the CER cell line. The growth curves were created using CER, Vero and BHK-21 cell lines. Compared with growth, both yielded higher titres in CER cells during the first 30 h after infection, but no significant difference was observed in the results obtained from CER and Vero cells. This data show that CER cells are adequate for aMPV subtypes A and B propagation, giving similar results to Vero cells. Copyright 2010 Elsevier B.V. All rights reserved.
Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells
Energy Technology Data Exchange (ETDEWEB)
Clark, Kristina B. [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); Hsiao, Hui-Mien; Bassit, Leda [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Crowe, James E. [Departments of Pediatrics, Pathology, Microbiology, and Immunology, Vanderbilt University, Nashville, TN (United States); Schinazi, Raymond F. [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Perng, Guey Chuen [Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Villinger, Francois [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); New Iberia Research Center, University of Louisiana at Lafayette, New Iberia, LA (United States)
2016-06-15
Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.
Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells
International Nuclear Information System (INIS)
Clark, Kristina B.; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E.; Schinazi, Raymond F.; Perng, Guey Chuen; Villinger, Francois
2016-01-01
Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.
Monath, Thomas P; Caldwell, Joseph R; Mundt, Wolfgang; Fusco, Joan; Johnson, Casey S; Buller, Mark; Liu, Jian; Gardner, Bridget; Downing, Greg; Blum, Paul S; Kemp, Tracy; Nichols, Richard; Weltzin, Richard
2004-10-01
The threat of smallpox as a biological weapon has spurred efforts to create stockpiles of vaccine for emergency preparedness. In lieu of preparing vaccine in animal skin (the original method), we cloned vaccinia virus (New York City Board of Health strain, Dryvax by plaque purification and amplified the clone in cell culture. The overarching goal was to produce a modern vaccine that was equivalent to the currently licensed Dryvax in its preclinical and clinical properties, and could thus reliably protect humans against smallpox. A variety of clones were evaluated, and many were unacceptably virulent in animal models. One clonal virus (ACAM1000) was selected and produced at clinical grade in MRC-5 human diploid cells. ACAM1000 was comparable to Dryvax in immunogenicity and protective activity but was less neurovirulent for mice and nonhuman primates. To meet requirements for large quantities of vaccine after the events of September 11th 2001, the ACAM1000 master virus seed was used to prepare vaccine (designated ACAM2000) at large scale in Vero cells under serum-free conditions. The genomes of ACAM1000 and ACAM2000 had identical nucleotide sequences, and the vaccines had comparable biological phenotypes. ACAM1000 and ACAM2000 were evaluated in three Phase 1 clinical trials. The vaccines produced major cutaneous reactions and evoked neutralizing antibody and cell-mediated immune responses in the vast majority of subjects and had a reactogenicity profile similar to that of Dryvax.
Busson, Laurent; Crucitti, Tania; De Foor, Marc; Van den Wijngaert, Sigi; Vandenberg, Olivier
2013-08-01
This article reports the fortuitous recovery of nine Chlamydia trachomatis serovar L strains in cell cultures (Vero and LLC-MK(2) cell line) designed for viral culture. Nine ano-genital swabs were inoculated on confluent Vero, MRC5 and LLC-MK(2) cell cultures. They were collected from HIV-positive patients who were primarily men who have sex with men (MSM) presenting ulcerations that mimicked herpes simplex infections. A cytopathogenic effect was observed on Vero and LLC-MK(2) cells on day 14. The presence of C trachomatis serovar L in the cell lines was confirmed by Real Time-PCR. C trachomatis serovar L can grow on Vero and LLC-MK(2) cell lines designed for viral cultures. Lymphogranuloma venereum must be considered as a differential diagnosis for herpes-like lesions, particularly in MSM with high-risk behaviours.
Reina, J; Ballesteros, F; Mari, M; Munar, M
2001-01-01
Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211
Inhibition of Dengue Virus 3 in Mammalian Cell Culture by Synthetic ...
African Journals Online (AJOL)
HP
Purpose: To evaluate the inhibition of Dengue virus 3 by synthetic siRNAs targeting the untranslated regions UTR and structural regions of DENV3 genome in Vero-81 cell line. Methods: Vero-81 cells transfected with synthetic siRNAs were challenged by DENV3. The effectiveness of siRNAs was confirmed by four ...
Characterization of cell lines stably transfected with rubella virus replicons
International Nuclear Information System (INIS)
Tzeng, Wen-Pin; Xu, Jie; Frey, Teryl K.
2012-01-01
Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was ∼9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.
Characterization of cell lines stably transfected with rubella virus replicons
Energy Technology Data Exchange (ETDEWEB)
Tzeng, Wen-Pin; Xu, Jie [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States); Frey, Teryl K., E-mail: tfrey@gsu.edu [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States)
2012-07-20
Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was {approx}9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.
Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin
International Nuclear Information System (INIS)
Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.
1989-01-01
An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of 125 I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of 125 I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies
Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin
Energy Technology Data Exchange (ETDEWEB)
Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.
1989-03-01
An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.
Directory of Open Access Journals (Sweden)
Chia-Chyi Liu
Full Text Available BACKGROUND: Enterovirus 71 (EV71 infections manifest most commonly as a childhood exanthema known as hand-foot-and-mouth disease (HFMD and can cause neurological disease during acute infection. PRINCIPAL FINDING: In this study, we describe the production, purification and characterization of EV71 virus produced from Vero cells grown in a five-liter serum-free bioreactor system containing 5 g/L Cytodex 1 microcarrier. The viral titer was >10(6 TCID(50/mL by 6 days post infection when a MOI of 10(-5 was used at the initial infection. Two EV71 virus fractions were separated and detected when the harvested EV71 virus concentrate was purified by sucrose gradient zonal ultracentrifugation. The EV71 viral particles detected in the 24-28% sucrose fractions had an icosahedral structure 30-31 nm in diameter and had low viral infectivity and RNA content. Three major viral proteins (VP0, VP1 and VP3 were observed by SDS-PAGE. The EV71 viral particles detected in the fractions containing 35-38% sucrose were 33-35 nm in size, had high viral infectivity and RNA content, and were composed of four viral proteins (VP1, VP2, VP3 and VP4, as shown by SDS-PAGE analyses. The two virus fractions were formalin-inactivated and induced high virus neutralizing antibody responses in mouse immunogenicity studies. Both mouse antisera recognized the immunodominant linear neutralization epitope of VP1 (residues 211-225. CONCLUSION: These results provide important information for cell-based EV71 vaccine development, particularly for the preparation of working standards for viral antigen quantification.
Energy Technology Data Exchange (ETDEWEB)
Conceição, R.A. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil); Ludovico, M.S. [Departamento de Microbiologia, Universidade Estadual de Londrina, Londrina, PR (Brazil); Andrade, C.G.T.J. [Departamento de Biologia Geral, Universidade Estadual de Londrina, Londrina, PR (Brazil); Yano, T. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil)
2012-04-13
The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 10{sup 7} CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.
Directory of Open Access Journals (Sweden)
Agustina Setiawati
2017-05-01
Full Text Available Many studies were designed explore chemopreventive activity of natural products on colon cancer especially addressing COX-2 as molecular target. Another promising source of natural product that potentially exhibit anticancer activity on colon cancer is Ganoderma lucidum. This study assessed selectivity of cytotoxic effect of G. lucidum extract on WiDr to Vero cells and investigated molecular mechanism on COX-2. G. lucidum ex-tract was prepared by reflux extraction method; in vitro anticancer was assayed by MTT method on WiDr and Vero cell line. This study applied apoptosis induction assay to observe cell death mechanism using double staining method; further COX-2 expression was stained by immunocytochemistry method. G. lucidum extract has cytotoxic effect on WiDr cells with IC50 135 µg/mL. However, the cytotoxic effect had low selectivity to-wards Vero cells with Selectivity Index (SI 3.66. The extract induced apoptosis and suppressed COX-2 ex-pression in WiDr cells. G. lucidum extract was potential to be developed as anticancer agent towards colon cancer.
Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T
2016-02-21
The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between +1.5 Gy to +6.0 Gy (CyberKnife: +0.5 Gy to +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were -1.0 mm to +0.7 mm (lateral) /-0.6 mm to +0.1 mm (superior-inferior) for CyberKnife and -0.8 mm to +0.2 mm /-0.8 mm to +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.
Tung, Hsuan; Wei, Sung-Chan; Lo, Huei-Ru; Chao, Yu-Chan
2016-01-01
Baculoviruses have gained popularity as pest control agents and for protein production in insect systems. These viruses are also becoming popular for gene expression, tissue engineering and gene therapy in mammalian systems. Baculovirus infection triggers a heat shock response, and this response is crucial for its successful infection of host insect cells. However, the viral protein(s) or factor(s) that trigger this response are not yet clear. Previously, we revealed that IE2-an early gene product of the baculovirus-could form unique nuclear bodies for the strong trans-activation of various promoters in mammalian cells. Here, we purified IE2 nuclear bodies from Vero E6 cells and investigated the associated proteins by using mass spectrometry. Heat shock proteins (HSPs) were found to be one of the major IE2-associated proteins. Our experiments show that HSPs are greatly induced by IE2 and are crucial for the trans-activation function of IE2. Interestingly, blocking both heat shock protein expression and the proteasome pathway preserved the IE2 protein and its nuclear body structure, and revived its function. These observations reveal that HSPs do not function directly to assist the formation of the nuclear body structure, but may rather protect IE2 from proteasome degradation. Aside from functional studies in mammalian cells, we also show that HSPs were stimulated and required to determine IE2 protein levels, in insect cells infected with baculovirus. Upon inhibiting the expression of heat shock proteins, baculovirus IE2 was substantially suppressed, resulting in a significantly suppressed viral titer. Thus, we demonstrate a unique feature in that IE2 can function in both insect and non-host mammalian cells to stimulate HSPs, which may be associated with IE2 stabilization and lead to the protection of the its strong gene activation function in mammalian cells. On the other hand, during viral infection in insect cells, IE2 could also strongly stimulate HSPs and
International Nuclear Information System (INIS)
Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro
2011-01-01
Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression of C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-γ signaling pathway via inhibition of phosphorylated STAT1 dimerization.
Enhanced capacity of DNA repair in human cytomegalovirus-infected cells
International Nuclear Information System (INIS)
Nishiyama, Y.; Rapp, F.
1981-01-01
Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants
Fujimoto, Y; Ozaki, K; Iwamori, N; Takakuwa, H; Ono, E
2016-03-01
Cell entry of herpes simplex virus type 2 (HSV-2) requires the interaction of viral glycoprotein D (gD) with the receptor nectin-1 and herpesvirus entry mediator (HVEM). In addition, it is known that nectin-2 is also functional as a receptor for HSV-2, although the binding to the gD is weak. To examine an antiviral potential of a soluble form of human nectin-2 (hNectin-2Ig), transfected Vero cells expressing the entire ectodomain of nectin-2 fused to the Fc portion of human IgG were established. Specific binding of hNectin-2Ig to HSV-2 gD was confirmed by ELISA. Competitive ELISA demonstrated that accumulation of hNectin-2Ig in transfected cells increased significantly in a cell culture time dependent manner. Viral growth of several HSV-2 strains was significantly inhibited in the transfected cells that were cultured for 72 hr compared with control Vero cells, but not in cells that were cultured for 24 hr. These results indicate that accumulation of a soluble form of nectin-2 is required for exerting the resistance against HSV-2 infection.
SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System
International Nuclear Information System (INIS)
Hayashi, N; Takada, Y; Mizuno, T; Nakae, H; Murai, T
2016-01-01
Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.
SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System
Energy Technology Data Exchange (ETDEWEB)
Hayashi, N [Graduate school of Health Sciences, Fujita Health University, Tayoake, Aichi (Japan); Takada, Y; Mizuno, T; Nakae, H [Department of Radiology, Ogaki Tokushukai Hospital, Ogaki, Gifu (Japan); Murai, T [Department of Radiation Oncology, Nagoya City University, Nagoya, Aichi (Japan)
2016-06-15
Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.
International Nuclear Information System (INIS)
Hafeez, S.; Tahir, Z.
2014-01-01
To determine the seroconversion following rabies vaccination by intradermal route in cases of animal bite attending Anti rabies center, Lahore for post exposure prophylaxis. Study Design: Cross sectional descriptive study. Place and Duration: Antirabies center, Birdwood road Lahore, Microbiology laboratory, office of Bacteriologist, Government of Punjab, Lahore. Patients and Methods: Victims of all ages and both sexes having exposure with suspected rabid animal within 24 - 72 hours were included, fulfilling inclusion and exclusion criteria, over 3 months period from February to April 20. Patients of Category II and III wounds were included. Purified vero cell vaccine (PVR V) with antigenic content> 2.5 ml was used for intradermal vaccination according to modified Thai Red Cross regimen (2-2-2-0-2). Each victim received 0.1 ml intradermal dose on each deltoid on day 0, 3, 7 and 28th day of bite. Blood samples from victims were taken on day 0, 14 and 35. Antibody titers were estimated by ELISA kit. Results: Fifty cases were studied including 20 children. Male female ratio was 4:1. Optimum serocon version (> 0.5 IU/ml) was achieved in all cases by day 14. Antibody levels increased further (> 4 IV/ml) in 92% cases on day 35. Geometric mean titers were 3.2 IU/ml and 6.2 IU/ml on day 14 and 35 respectively. Conclusion: Intradermal route for cell culture rabies vaccine for postexposure prophylaxis in animal bite victims was efficacious and safe. The smaller dosage of vaccine was economically affordable by patients in referral centers. (author)
Heat shock proteins (Hsp 70) response is not systematic to cell stress
International Nuclear Information System (INIS)
Hassen, Wafa; Ayed-Boussema, Imen; Bouslimi, Amel; Bacha, Hassen
2007-01-01
Ochratoxin A (OTA) is a mycotoxin routinely detected in improperly stored animal and human food supplies as well as in human sera worldwide. OTA has multiple toxic effects; however, the most prominent is nephrotoxicity. Thus, OTA is involved in the pathogenesis of human nephropathy in Balkan areas. In this study, we address the question of the appropriate functioning of the basal cellular defense mechanisms, after exposure to OTA, which, up to now, has not been investigated satisfactorily. In this context, we have monitored the effect of OTA on (i) the inhibition of cell viability, (ii) the oxidative damage using the GSH depletion, (iii) the inhibition of protein synthesis through the incorporation of [ 3 H] Leucine and (iv) the induction of Hsp 70 gene expression as a parameter of cytotoxicity, oxidative damage and particularly as a protective and adaptative response. This study was conducted using the Human Hep G2 hepatocytes and monkey kidney Vero cells under exposure conditions ranging from non-cytotoxic to sub-lethal. Our results clearly showed that OTA inhibits cell proliferation, strongly reduces protein synthesis and induces the decrease of GSH in concentration-dependent manner in both Hep G2 and Vero cells. However, although cytotoxicity and oxidative damage (main inducers of Hsp expression) occur, no change was observed in Hsp 70 level under the multiple tested conditions. Inhibition of protein synthesis could not explain the absence of Hsp 70 response since concentrations, which did not influence protein synthesis, also failed to display the expected Hsp 70 response. Our data are consistent with recently published reports where considerable differences were noticed in the ability of relevant toxicants to induce Hsp. These results raised doubt about the universal character of Hsp induction which seems to be more complex than originally envisioned. It could be concluded that Hsp 70 induction is not systematic to cell stress
International Nuclear Information System (INIS)
Butt, H.I.; Shahzad, M.I.; Bashir, Q.
2011-01-01
Growth hormone cDNA of local goat breed-beetal was amplified by RT PCR and gene including leader sequence was cloned in pTZR57 cloning vector. The cGH-pTZR57 clone was confirmed by restriction digestion and sequence analyses before finally sub-cloning the gene in pND- a mammalian expression vector. The clones were again confirmed by restriction digestion and PCR analyses. Highly purified, supercoiled cGH-pND construct was used to transfect Vero cell lines for expression studies. The in vitro expression of cGH was checked by dot-ELISA technique. After confirming its in vitro cell line based expression, the construct was injected to 4 weeks old balb/c mice intramuscularly. Two animals were euthanized per week till four weeks to monitor the in vivo biological activity by evaluating the tibia epiphyseal width and body weight gain assays. Significant increase in tibia epiphyseal width and gain in body weight was observed from vaccinated animals. The study supports the concept that DNA based therapeutics are an efficient and cost effective method for gene delivery and in vivo transgene expressions. (author)
Manipulating mammalian cell morphologies using chemical-mechanical polished integrated circuit chips
Moussa, Hassan I.; Logan, Megan; Siow, Geoffrey C.; Phann, Darron L.; Rao, Zheng; Aucoin, Marc G.; Tsui, Ting Y.
2017-12-01
Tungsten chemical-mechanical polished integrated circuits were used to study the alignment and immobilization of mammalian (Vero) cells. These devices consist of blanket silicon oxide thin films embedded with micro- and nano-meter scale tungsten metal line structures on the surface. The final surfaces are extremely flat and smooth across the entire substrate, with a roughness in the order of nanometers. Vero cells were deposited on the surface and allowed to adhere. Microscopy examinations revealed that cells have a strong preference to adhere to tungsten over silicon oxide surfaces with up to 99% of cells adhering to the tungsten portion of the surface. Cells self-aligned and elongated into long threads to maximize contact with isolated tungsten lines as thin as 180 nm. The orientation of the Vero cells showed sensitivity to the tungsten line geometric parameters, such as line width and spacing. Up to 93% of cells on 10 μm wide comb structures were aligned within ± 20° of the metal line axis. In contrast, only 22% of cells incubated on 0.18 μm comb patterned tungsten lines were oriented within the same angular interval. This phenomenon is explained using a simple model describing cellular geometry as a function of pattern width and spacing, which showed that cells will rearrange their morphology to maximize their contact to the embedded tungsten. Finally, it was discovered that the materials could be reused after cleaning the surfaces, while maintaining cell alignment capability.
Porcine platelet lysate as a supplement for animal cell culture
Aldén, Anna; Gonzalez, Lorena; Persson, Anna; Christensson, Kerstin; Holmqvist, Olov
2007-01-01
A novel supplementation of cell growth media based on a porcine platelet lysate was developed for culture of animal-derived cells. The platelet lysate was produced from porcine blood and contained lysate of platelets and plasma components. It showed satisfactory microbiological integrity and it carried only low amount of endotoxins (platelet lysate supported well proliferation of Vero (African green monkey transformed kidney epithelial cells), Chinese hamster ovary (CHO) and hybridoma cells comparable to fetal bovine serum (FBS). Platelet lysate shows promise as a viable choice over FBS as it can be produced in large quantities, high lot-to-lot consistency and with an attractive price structure. Furthermore it is a strong alternative to FBS for ethical reasons. It is expected that it can be used as a general supplementation for most animal cells for research studies on the proliferation of cells and their expression of products. PMID:19002989
Directory of Open Access Journals (Sweden)
Bonaldo Myrna C
2011-03-01
Full Text Available Abstract Background The attenuated Yellow fever (YF 17D vaccine virus is one of the safest and most effective viral vaccines administered to humans, in which it elicits a polyvalent immune response. Herein, we used the YF 17D backbone to express a Trypanosoma cruzi CD8+ T cell epitope from the Amastigote Surface Protein 2 (ASP-2 to provide further evidence for the potential of this virus to express foreign epitopes. The TEWETGQI CD8+ T cell epitope was cloned and expressed based on two different genomic insertion sites: in the fg loop of the viral Envelope protein and the protease cleavage site between the NS2B and NS3. We investigated whether the site of expression had any influence on immunogenicity of this model epitope. Results Recombinant viruses replicated similarly to vaccine virus YF 17D in cell culture and remained genetically stable after several serial passages in Vero cells. Immunogenicity studies revealed that both recombinant viruses elicited neutralizing antibodies to the YF virus as well as generated an antigen-specific gamma interferon mediated T-cell response in immunized mice. The recombinant viruses displayed a more attenuated phenotype than the YF 17DD vaccine counterpart in mice. Vaccination of a mouse lineage highly susceptible to infection by T. cruzi with a homologous prime-boost regimen of recombinant YF viruses elicited TEWETGQI specific CD8+ T cells which might be correlated with a delay in mouse mortality after a challenge with a lethal dose of T. cruzi. Conclusions We conclude that the YF 17D platform is useful to express T. cruzi (Protozoan antigens at different functional regions of its genome with minimal reduction of vector fitness. In addition, the model T. cruzi epitope expressed at different regions of the YF 17D genome elicited a similar T cell-based immune response, suggesting that both expression sites are useful. However, the epitope as such is not protective and it remains to be seen whether expression
Expression of heparanase in basal cell carcinoma and squamous cell carcinoma.
Pinhal, Maria Aparecida Silva; Almeida, Maria Carolina Leal; Costa, Alessandra Scorse; Theodoro, Thérèse Rachell; Serrano, Rodrigo Lorenzetti; Machado, Carlos D'Apparecida Santos
2016-01-01
Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparanase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in culture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of heparanase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased heparanase expression in squamous cell carcinoma compared to the Basal cell carcinoma. The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment.
Expression of Two N1 Clones with Single Amino Acid Dissimilarity of Avian Influenza H5N1 Virus
Directory of Open Access Journals (Sweden)
RISZA HARTAWAN
2012-12-01
Full Text Available Two clones of N1 gene derived from isolate A/Dk/Tangerang/Bbalitvet-ACIAR-TE11/2007 (H5N1 exhibit single mismatch of amino acid sequence at position 242 that is threonine and methionine for the clone #3 and #5, respectively. In order to evaluate the effect of the amino acid substitution, these clones were inserted into two different expression vectors that are pEGFP-C1 and pcDNA-3.3 TOPO® TA cloning. Subsequently, the respective recombinant clones were transfected into eukaryotic cells, including CEF, RK13 and VERO using Lipofectamine ‘plus’ reagent. As a result, the clone #3 retaining atypical sequence showed lower expression level rather than the clone #15 in both vectors and all type of cells. The 3D conformational modelling revealed that the mutation occurs in the inner part of glycoprotein embedded within envelope or matrix. Therefore, the missense mutation seems has no effect on the antigenic properties of neuraminidase but this substitution by any means causes lethal mutagenesis in the individual gene expression by reducing level of protein transcript.
Jagannathan, S; Chaansha, S; Rajesh, K; Santhiya, T; Charles, C; Venkataramana, K N
2009-09-15
Vero cells are utilized for production of rabies vaccine. This study deals with the optimize quantity media require for the rabies vaccine production in the smooth roller surface. The rabies virus (Pasteur vaccine strain) is infected to monolayer of the various experimented bottles. To analyze the optimal quantity of media for the production of rabies viral harvest during the process of Vero cell derived rabies vaccine. The trials are started from 200 to 400 mL (PTARV-1, PTARV-2, PTARV-3, PTARV-4 and PTARV-5). The samples are taken in an appropriate time intervals for analysis of In Process Quality Control (IPQC) tests. The collected viral harvests are further processed to rabies vaccine in a pilot level and in addition to scale up an industrial level. Based on the evaluation the PTARV-2 (250 mL) show highly encouraging results for the Vero cell derived rabies vaccine production.
Fractalkine expression induces endothelial progenitor cell lysis by natural killer cells.
Directory of Open Access Journals (Sweden)
Dilyana Todorova
Full Text Available BACKGROUND: Circulating CD34(+ cells, a population that includes endothelial progenitors, participate in the maintenance of endothelial integrity. Better understanding of the mechanisms that regulate their survival is crucial to improve their regenerative activity in cardiovascular and renal diseases. Chemokine-receptor cross talk is critical in regulating cell homeostasis. We hypothesized that cell surface expression of the chemokine fractalkine (FKN could target progenitor cell injury by Natural Killer (NK cells, thereby limiting their availability for vascular repair. METHODOLOGY/PRINCIPAL FINDINGS: We show that CD34(+-derived Endothelial Colony Forming Cells (ECFC can express FKN in response to TNF-α and IFN-γ inflammatory cytokines and that FKN expression by ECFC stimulates NK cell adhesion, NK cell-mediated ECFC lysis and microparticles release in vitro. The specific involvement of membrane FKN in these processes was demonstrated using FKN-transfected ECFC and anti-FKN blocking antibody. FKN expression was also evidenced on circulating CD34(+ progenitor cells and was detected at higher frequency in kidney transplant recipients, when compared to healthy controls. The proportion of CD34(+ cells expressing FKN was identified as an independent variable inversely correlated to CD34(+ progenitor cell count. We further showed that treatment of CD34(+ circulating cells isolated from adult blood donors with transplant serum or TNF-α/IFN-γ can induce FKN expression. CONCLUSIONS: Our data highlights a novel mechanism by which FKN expression on CD34(+ progenitor cells may target their NK cell mediated killing and participate to their immune depletion in transplant recipients. Considering the numerous diseased contexts shown to promote FKN expression, our data identify FKN as a hallmark of altered progenitor cell homeostasis with potential implications in better evaluation of vascular repair in patients.
Huckleberry, Kylie A.; Kane, Gary A.; Mathis, Rita J.; Cook, Sarah G.; Clutton, Jonathan E.; Drew, Michael R.
2015-01-01
Thousands of neurons are born each day in the dentate gyrus (DG), but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in the DG. The immediate-early gene (IEG) zif268 appears to be an important mediator of these effects, as its expression can be induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Richardson et al., 1992; Veyrac et al., 2013). Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs). We first quantified zif268 expression in doublecortin-positive (DCX+) immature neurons and in the general granule cell population after brief exposure to a novel environment (NE). In the general granule cell population, zif268 expression peaked 1 h after NE exposure and returned to baseline by 8 h post-exposure. However, in the DCX+ cells, zif268 expression was suppressed relative to home cage for at least 8 h post-exposure. We next asked whether suppression of zif268 in DCX+ immature cells occurs in other behavioral paradigms that recruit the hippocampus. Exposure to Morris water maze (MWM) training, an enriched environment, or a NE caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 expression among the general granule cell population. The same behavioral procedures activated zif268 expression in 6-week-old BrdU-labeled adult-born neurons, indicating that zif268 suppression is specific to immature neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. NE exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly
Tropomyosin Receptor Kinase A Expression on Merkel Cell Carcinoma Cells.
Wehkamp, Ulrike; Stern, Sophie; Krüger, Sandra; Hauschild, Axel; Röcken, Christoph; Egberts, Friederike
2017-11-01
Merkel cell carcinoma (MCC) is a malignant neuroendocrine skin tumor frequently associated with the Merkel cell polyomavirus. Immune checkpoint therapy showed remarkable results, although not all patients are responsive to this therapy. Anti-tropomyosin receptor kinase A (TrkA)-targeted treatment has shown promising results in several tumor entities. To determine TrkA expression in MCC as a rationale for potential targeted therapy. This case series study investigated the MCC specimens of 55 patients treated at the Department of Dermatology, University Hospital of Schleswig-Holstein, Kiel, Germany, from January 1, 2005, through December 31, 2015. Thirty-nine of the 55 samples were suitable for further histopathologic examination. Expression of TrkA was explored by immunohistochemical analysis. Diagnosis of MCC was confirmed by staining positive for cytokeratin 20 (CK20) and synaptophysin. Expression of TrkA on the tumor cells. Specimens of 39 patients (21 women and 18 men; mean [SD] age, 75.0 [7.8] years) underwent immunohistochemical investigation. Thirty-eight of 38 specimens expressed CK20 and synaptophysin on the MCC tumor cells (100% expression). Merkel cell polyomavirus was detected in 32 of 38 specimens (84%). Tropomyosin receptor kinase A was found in all 36 evaluable specimens on the tumor cells; 34 (94%) showed a weak and 2 (6%) showed a strong cytoplasmic expression. In addition, strongly positive perinuclear dots were observed in 30 of 36 specimens (83%). Tropomyosin receptor kinase A was expressed on MCC tumor cells in 100% of evaluable specimens. This result may lead to the exploration of new targeted treatment options in MCC, especially for patients who do not respond to anti-programmed cell death protein 1 treatment.
Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data
Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris
2016-01-01
Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...
Shi, Nianmin; Zhang, Yibin; Zheng, Huizhen; Zhu, Zhenggang; Wang, Dingming; Li, Sihai; Li, Yuhua; Yang, Liqing; Zhang, Junnan; Bai, Yunhua; Lu, Qiang; Zhang, Zheng; Luo, Fengji; Yu, Chun; Li, Li
2017-06-03
To compare the safety, immunogenicity and long-term effect of a purified vero cell cultured rabies vaccine in post-exposure subjects following 2 intramuscular regimens, Zagreb or Essen regimen. Serum samples were collected before vaccination and on days 7, 14, 42, 180 and 365 post vaccination. Solicited adverse events were recorded for 7 d following each vaccine dose, and unsolicited adverse events throughout the entire study period. This study was registered with ClinicalTrials.gov (NCT01821911 and NCT01827917). No serious adverse events were reported. Although Zagreb regimen had a higher incidence of adverse reactions than Essen regimen at the first and second injection, the incidence was similar at the third and fourth injection between these 2 groups as well. At day 42, 100% subjects developed adequate rabies virus neutralizing antibody concentrations (≥ 0.5IU/ml) for both regimens. At days 180 and 365, the antibody level decreased dramatically, however, the percentage of subjects with adequate antibody concentrations still remained high (above 75% and 50% respectively). None of confirmed rabies virus exposured subjects had rabies one year later, and percentage of subjects with adequate antibody concentrations reached 100% at days 14 and 42. Rabies post-exposure prophylaxis vaccination with PVRV following a Zagreb regimen had a similar safety, immunogenicity and long-term effect to the Essen regimen in China.
Expression of stanniocalcin 1 in thyroid side population cells and thyroid cancer cells.
Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S; Hewitt, Stephen M; Ward, Jerrold M; Kimura, Shioko
2015-04-01
Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma-derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer.
Rho GTPase expression in human myeloid cells.
Directory of Open Access Journals (Sweden)
Suzanne F G van Helden
Full Text Available Myeloid cells are critical for innate immunity and the initiation of adaptive immunity. Strict regulation of the adhesive and migratory behavior is essential for proper functioning of these cells. Rho GTPases are important regulators of adhesion and migration; however, it is unknown which Rho GTPases are expressed in different myeloid cells. Here, we use a qPCR-based approach to investigate Rho GTPase expression in myeloid cells.We found that the mRNAs encoding Cdc42, RhoQ, Rac1, Rac2, RhoA and RhoC are the most abundant. In addition, RhoG, RhoB, RhoF and RhoV are expressed at low levels or only in specific cell types. More differentiated cells along the monocyte-lineage display lower levels of Cdc42 and RhoV, while RhoC mRNA is more abundant. In addition, the Rho GTPase expression profile changes during dendritic cell maturation with Rac1 being upregulated and Rac2 downregulated. Finally, GM-CSF stimulation, during macrophage and osteoclast differentiation, leads to high expression of Rac2, while M-CSF induces high levels of RhoA, showing that these cytokines induce a distinct pattern. Our data uncover cell type specific modulation of the Rho GTPase expression profile in hematopoietic stem cells and in more differentiated cells of the myeloid lineage.
Forced Expression of ZNF143 Restrains Cancer Cell Growth
International Nuclear Information System (INIS)
Izumi, Hiroto; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi
2011-01-01
We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division
Forced Expression of ZNF143 Restrains Cancer Cell Growth
Energy Technology Data Exchange (ETDEWEB)
Izumi, Hiroto, E-mail: h-izumi@med.uoeh-u.ac.jp; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi [Department of Molecular Biology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555 (Japan)
2011-10-19
We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.
Forced Expression of ZNF143 Restrains Cancer Cell Growth
Directory of Open Access Journals (Sweden)
Kimitoshi Kohno
2011-10-01
Full Text Available We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143 regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1, aurora kinase B (AURKB and some minichromosome maintenance complex components (MCM. However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.
CD25+ B-1a Cells Express Aicda
Directory of Open Access Journals (Sweden)
Hiroaki Kaku
2017-06-01
Full Text Available B-1a cells are innate-like B-lymphocytes producing natural antibodies. Activation-induced cytidine deaminase (AID, a product of the Aicda gene, plays a central role in class-switch recombination and somatic hypermutation in B cells. Although a role for Aicda in B-1a cells has been suggested on the basis of experiments with knock out (KO mice, whether B-1a cells express Aicda, and if so, which B-1a cell subpopulation expresses Aicda, remains unknown. Here, we demonstrate that B-1 cells express Aicda, but at a level below that expressed by germinal center (GC B cells. We previously reported that B-1a cells can be subdivided based on CD25 expression. We show here that B-1a cell Aicda expression is concentrated in the CD25+ B-1a cell subpopulation. These results suggest the possibility that previous studies of memory B cells identified on the basis of Aicda expression may have inadvertently included an unknown number of CD25+ B-1a cells. Although B-1a cells develop normally in the absence of Aicda, a competitive reconstitution assay reveals enhanced vigor for AID KO B-1a cell bone marrow (BM progenitors, as compared with wild-type BM B-1 cell progenitors. These results suggest that AID inhibits the development of B-1a cells from BM B-1 cell progenitors in a competitive environment.
Nakayama, Ayumi; Miura, Hirohito; Ooki, Makoto; Harada, Shuitsu
2015-03-01
Sox2 is proposed to regulate the differentiation of bipotential progenitor cells into taste bud cells. However, detailed expression of Sox2 remains unclear. In this report, Sox2 expression during taste bud development in the fungiform (FF), circumvallate (CV) and soft palate (SP) areas is examined together with Prox1. First, we immunohistochemically checked Prox1 expression in adults and found that almost all taste bud cells are Prox1-positive. During FF development, intense Sox2 expression was restricted to taste bud primordia expressing Prox1 at E12.5. However, at E14.5, Sox2 was intensely expressed outside the developing taste buds resolving to perigemmal Sox2 expression in adults. In the SP, at E14.5, taste bud primordia emerged as Prox1-expressing cell clusters. However, intense Sox2 expression was not restricted to taste bud primordia but was detected widely in the epithelium. During development, Sox2 expression outside developing taste buds was generally down-regulated but was retained in the perigemmal region similarly to that in the FF. In the CV, the initial stage of taste bud development remained unclear because of the lack of taste bud primordia comparable to that in the FF and SP. Here, we show that Prox1-expressing cells appear in the apical epithelium at E12.5, in the inner trench wall at E17.5 and in the outer trench wall at E18.5. Sox2 was again not restricted to developing taste bud cells expressing Prox1 during CV development. The expression patterns support that Sox2 does not serve as a cell fate selector between taste bud cells and surrounding keratinocytes but rather may contribute to them both.
Susceptibility of various cell lines to Neospora caninum tachyzoites cultivation
Directory of Open Access Journals (Sweden)
Khordadmehr, M.,
2014-05-01
Full Text Available Neospora caninum is a coccidian protozoan parasite which is a major cause of bovine abortions and neonatal mortality in cattle, sheep, goat and horse. Occasionally, cultured cells are used for isolation and multiplication of the agent in vitro with several purposes. In this study the tachyzoite yields of N. caninum were compared in various cell cultures as the host cell lines. Among the cell cultures tested, two presented good susceptibility to the agent: cell lines Vero and MA-104. SW742 and TLI (in vitro suspension culture of lymphoid cells infected with Theileria lestoquardi showed moderate sensitivity. No viable tachyzoite were detected in the culture of MDCK and McCoy cell lines. These results demonstrate that MA-104 and SW742 cells present adequate susceptibility to N. caninum compared to Vero cells, which have been largely used to multiply the parasite in vitro. Moreover, these have easy manipulation, fast multiplication and relatively low nutritional requirements. In addition, the result of this study showed that TLI cell line as a suspension cell culture is susceptible to Nc-1 tachyzoites infection and could be used as an alternative host cell line for tachyzoites culture in vitro studies.
Decorin expression in quiescent myogenic cells
International Nuclear Information System (INIS)
Nishimura, Takanori; Nozu, Kenjiro; Kishioka, Yasuhiro; Wakamatsu, Jun-ichi; Hattori, Akihito
2008-01-01
Satellite cells are quiescent muscle stem cells that promote postnatal muscle growth and repair. When satellite cells are activated by myotrauma, they proliferate, migrate, differentiate, and ultimately fuse to existing myofibers. The remainder of these cells do not differentiate, but instead return to quiescence and remain in a quiescent state until activation begins the process again. This ability to maintain their own population is important for skeletal muscle to maintain the capability to repair during postnatal life. However, the mechanisms by which satellite cells return to quiescence and maintain the quiescent state are still unclear. Here, we demonstrated that decorin mRNA expression was high in cell cultures containing a higher ratio of quiescent satellite cells when satellite cells were stimulated with various concentrations of hepatocyte growth factor. This result suggests that quiescent satellite cells express decorin at a high level compared to activated satellite cells. Furthermore, we examined the expression of decorin in reserve cells, which were undifferentiated myoblasts remaining after induction of differentiation by serum-deprivation. Decorin mRNA levels in reserve cells were higher than those in differentiated myotubes and growing myoblasts. These results suggest that decorin participates in the quiescence of myogenic cells
LENUS (Irish Health Repository)
McDonnell, R J
1997-12-12
An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.
Zuffa, T
1987-10-01
The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.
Haemopedia: An Expression Atlas of Murine Hematopoietic Cells
Directory of Open Access Journals (Sweden)
Carolyn A. de Graaf
2016-09-01
Full Text Available Hematopoiesis is a multistage process involving the differentiation of stem and progenitor cells into distinct mature cell lineages. Here we present Haemopedia, an atlas of murine gene-expression data containing 54 hematopoietic cell types, covering all the mature lineages in hematopoiesis. We include rare cell populations such as eosinophils, mast cells, basophils, and megakaryocytes, and a broad collection of progenitor and stem cells. We show that lineage branching and maturation during hematopoiesis can be reconstructed using the expression patterns of small sets of genes. We also have identified genes with enriched expression in each of the mature blood cell lineages, many of which show conserved lineage-enriched expression in human hematopoiesis. We have created an online web portal called Haemosphere to make analyses of Haemopedia and other blood cell transcriptional datasets easier. This resource provides simple tools to interrogate gene-expression-based relationships between hematopoietic cell types and genes of interest.
Siriwarin, Boondaree; Weerapreeyakul, Natthida
2016-07-25
Sesamol is a phenolic lignan found in sesame seeds (Sesamum indicum L.) and sesame oil. The anticancer effects and molecular mechanisms underlying its apoptosis-inducing effect were investigated in human lung adenocarcinoma (SK-LU-1) cells. Sesamol inhibited SK-LU-1 cell growth with an IC50 value of 2.7 mM and exhibited less toxicity toward normal Vero cells after 48 h of treatment (Selective index = 3). Apoptotic bodies-the hallmark of apoptosis-were observed in sesamol-treated SK-LU-1 cells, stained with DAPI. Sesamol increased the activity of caspase 8, 9, and 3/7, indicating that apoptotic cell death occurred through both extrinsic and intrinsic pathways. Sesamol caused the loss of mitochondrial transmembrane potential signifying intrinsic apoptosis induction. Decreasing Bid expression revealed crosstalk between the intrinsic and extrinsic apoptotic pathways; demonstrating clearly that sesamol induces apoptosis through both pathways in human lung adenocarcinoma (SK-LU-1) cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Foxp3 expression in human cancer cells
Directory of Open Access Journals (Sweden)
Gourgoulianis Konstantinos I
2008-04-01
Full Text Available Abstract Objective Transcription factor forkhead box protein 3 (Foxp3 specifically characterizes the thymically derived naturally occurring regulatory T cells (Tregs. Limited evidence indicates that it is also expressed, albeit to a lesser extent, in tissues other than thymus and spleen, while, very recently, it was shown that Foxp3 is expressed by pancreatic carcinoma. This study was scheduled to investigate whether expression of Foxp3 transcripts and mature protein occurs constitutively in various tumor types. Materials and methods Twenty five tumor cell lines of different tissue origins (lung cancer, colon cancer, breast cancer, melanoma, erythroid leukemia, acute T-cell leukemia were studied. Detection of Foxp3 mRNA was performed using both conventional RT-PCR and quantitative real-time PCR while protein expression was assessed by immunocytochemistry and flow cytometry, using different antibody clones. Results Foxp3 mRNA as well as Foxp3 protein was detected in all tumor cell lines, albeit in variable levels, not related to the tissue of origin. This expression correlated with the expression levels of IL-10 and TGFb1. Conclusion We offer evidence that Foxp3 expression, characterizes tumor cells of various tissue origins. The biological significance of these findings warrants further investigation in the context of tumor immune escape, and especially under the light of current anti-cancer efforts interfering with Foxp3 expression.
Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham
2009-01-01
The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.
Non-Small Cell Lung Cancer Cells Expressing CD44 Are Enriched for Stem Cell-Like Properties
Leung, Elaine Lai-Han; Fiscus, Ronald R.; Tung, James W.; Tin, Vicky Pui-Chi; Cheng, Lik Cheung; Sihoe, Alan Dart-Loon; Fink, Louis M.; Ma, Yupo; Wong, Maria Pik
2010-01-01
Background The cancer stem cell theory hypothesizes that cancers are perpetuated by cancer stem cells (CSC) or tumor initiating cells (TIC) possessing self-renewal and other stem cell-like properties while differentiated non-stem/initiating cells have a finite life span. To investigate whether the hypothesis is applicable to lung cancer, identification of lung CSC and demonstration of these capacities is essential. Methodology/Principal Finding The expression profiles of five stem cell markers (CD34, CD44, CD133, BMI1 and OCT4) were screened by flow cytometry in 10 lung cancer cell lines. CD44 was further investigated by testing for in vitro and in vivo tumorigenecity. Formation of spheroid bodies and in vivo tumor initiation ability were demonstrated in CD44+ cells of 4 cell lines. Serial in vivo tumor transplantability in nude mice was demonstrated using H1299 cell line. The primary xenografts initiated from CD44+ cells consisted of mixed CD44+ and CD44− cells in similar ratio as the parental H1299 cell line, supporting in vivo differentiation. Semi-quantitative Real-Time PCR (RT-PCR) showed that both freshly sorted CD44+ and CD44+ cells derived from CD44+-initiated tumors expressed the pluripotency genes OCT4/POU5F1, NANOG, SOX2. These stemness markers were not expressed by CD44− cells. Furthermore, freshly sorted CD44+ cells were more resistant to cisplatin treatment with lower apoptosis levels than CD44− cells. Immunohistochemical analysis of 141 resected non-small cell lung cancers showed tumor cell expression of CD44 in 50.4% of tumors while no CD34, and CD133 expression was observed in tumor cells. CD44 expression was associated with squamous cell carcinoma but unexpectedly, a longer survival was observed in CD44-expressing adenocarcinomas. Conclusion/Significance Overall, our results demonstrated that stem cell-like properties are enriched in CD44-expressing subpopulations of some lung cancer cell lines. Further investigation is required to clarify
Feng, Xiu L; Liu, Qing T; Cao, Rui B; Zhou, Bin; Wang, Fang Q; Deng, Wen L; Qiu, Ya F; Zhang, Yu; Ishag, Hassan; Ma, Zhi Y; Zheng, Qi S; Chen, Pu Y
2012-06-01
The bursa of Fabricius (BF) is the central humoral immune organ unique to birds. Here, we isolated a novel bursal pentapeptide I (BPP-I), LGPGP, from BF. BPP-I could play inhibition effect on MCF-7 but not on CEF or Vero cell proliferation in vitro, and enhance antitumor factor p53 protein expression. Also, BPP-I stimulated antibody production in a dose-dependent manner in hybridoma cell. Furthermore, BPP-I could induce various immune responses in mice immunization experiments, including increase antibody production and cytokines IL-4 and IFN-γ level, and induce T-cell immunophenotyping. These results suggest that BPP-I is a potential immunomodulator of antitumor and immunity. The study could provide some novel insights on the probable candidate reagent for the antitumor and immune improvement.
Directory of Open Access Journals (Sweden)
Laura Masami SUMITA
Full Text Available SUMMARY Zika virus (ZKV infection is a huge public health problem in Brazil because of the increased incidence of microcephaly in neonates from infected mothers. Detection of specific IgG antibodies in maternal serum samples constitutes an important approach for diagnosing ZKV infection and evaluating its relationship with neonatal microcephaly. However, as there is no serological test produced in Brazil to detect IgM and IgG antibodies against ZKV, we sought to examine specific IgG in serum samples from patients or suspected mothers to detect previous infection and to test for specificity with regard to flaviviral infections occurring in the same area. Brazilian Zika virus native antigens were obtained from infected Vero cell layers or free virions in the culture medium and then used in ELISA. We tested sera from eight ZKV RNA-diagnosed infected patients (ZKVR, seven neonates with microcephaly and their mothers after delivery (MM, 140 dengue virus IgM-positive (DM and IgG (DG-positive patients, and 100 yellow fever (YF-vaccinated patients. According to the ELISA, ZKVR samples were mostly positive (7/8, and all the MM serum samples were positive for ZKV IgG (7/7. In contrast, cross-reactions for dengue or yellow fever-vaccinated patients were observed, including DM (48/95, DG (10/45 or YF (3/100 serum samples; however, these cross-reactions exhibited low antigen avidity so that 6 M urea largely removed this cross-reactivity, with only a few cross-reacting samples remaining (8/140. ELISA based on extracted virions was much more specific, with all ZKVR (8/8 and MM sera being positive for ZKV IgG (7/7 and only borderline cross-reactivity found for DM (6/95, DG (3/45 or YF (4/100-vaccinated serum samples. This technique (ELISA can identify specific IgG in ZKV-infected patients and may be helpful in diagnosing congenital infetions after maternal RNA virus clearance or in epidemiological studies.
CNPase Expression in Olfactory Ensheathing Cells
Directory of Open Access Journals (Sweden)
Christine Radtke
2011-01-01
Full Text Available A large body of work supports the proposal that transplantation of olfactory ensheathing cells (OECs into nerve or spinal cord injuries can promote axonal regeneration and remyelination. Yet, some investigators have questioned whether the transplanted OECs associate with axons and form peripheral myelin, or if they recruit endogenous Schwann cells that form myelin. Olfactory bulbs from transgenic mice expressing the enhanced green fluorescent protein (eGFP under the control of the 2-3-cyclic nucleotide 3-phosphodiesterase (CNPase promoter were studied. CNPase is expressed in myelin-forming cells throughout their lineage. We examined CNPase expression in both in situ in the olfactory bulb and in vitro to determine if OECs express CNPase commensurate with their myelination potential. eGFP was observed in the outer nerve layer of the olfactory bulb. Dissociated OECs maintained in culture had both intense eGFP expression and CNPase immunostaining. Transplantation of OECs into transected peripheral nerve longitudinally associated with the regenerated axons. These data indicate that OECs in the outer nerve layer of the olfactory bulb of CNPase transgenic mice express CNPase. Thus, while OECs do not normally form myelin on olfactory nerve axons, their expression of CNPase is commensurate with their potential to form myelin when transplanted into injured peripheral nerve.
RickA expression is not sufficient to promote actin-based motility of Rickettsia raoultii.
Directory of Open Access Journals (Sweden)
Premanand Balraj
Full Text Available BACKGROUND: Rickettsia raoultii is a novel Rickettsia species recently isolated from Dermacentor ticks and classified within the spotted fever group (SFG. The inability of R. raoultii to spread within L929 cells suggests that this bacterium is unable to polymerize host cell actin, a property exhibited by all SFG rickettsiae except R. peacocki. This result led us to investigate if RickA, the protein thought to generate actin nucleation, was expressed within this rickettsia species. METHODOLOGY/PRINCIPAL FINDINGS: Amplification and sequencing of R. raoultii rickA showed that this gene encoded a putative 565 amino acid protein highly homologous to those found in other rickettsiae. Using immunofluorescence assays, we determined that the motility pattern (i.e. microcolonies or cell-to-cell spreading of R. raoultii was different depending on the host cell line in which the bacteria replicated. In contrast, under the same experimental conditions, R. conorii shares the same phenotype both in L929 and in Vero cells. Transmission electron microscopy analysis of infected cells showed that non-motile bacteria were free in the cytosol instead of enclosed in a vacuole. Moreover, western-blot analysis demonstrated that the defect of R. raoultii actin-based motility within L929 cells was not related to lower expression of RickA. CONCLUSION/SIGNIFICANCE: These results, together with previously published data about R. typhi, strongly suggest that another factor, apart from RickA, may be involved with be responsible for actin-based motility in bacteria from the Rickettsia genus.
Foxl1-Expressing Mesenchymal Cells Constitute the Intestinal Stem Cell NicheSummary
Directory of Open Access Journals (Sweden)
Reina Aoki
2016-03-01
Full Text Available Background & Aims: Intestinal epithelial stem cells that express leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5 and/or B cell specific Moloney murine leukemia virus integration site 1 (Bmi1 continuously replicate and generate differentiated cells throughout life. Previously, Paneth cells were suggested to constitute an epithelium-intrinsic niche that regulates the behavior of these stem cells. However, ablating Paneth cells has no effect on the maintenance of functional stem cells. Here, we show definitively that a small subset of mesenchymal subepithelial cells expressing the winged-helix transcription factor forkhead box l1 (Foxl1 are a critical component of the intestinal stem cell niche. Methods: We genetically ablated Foxl1+ mesenchymal cells in adult mice using 2 separate models by expressing either the human or simian diphtheria toxin receptor under Foxl1 promoter control. Conclusions: Killing Foxl1+ cells by diphtheria toxin administration led to an abrupt cessation of proliferation of both epithelial stem- and transit-amplifying progenitor cell populations that was associated with a loss of active Wnt signaling to the intestinal epithelium. Therefore, Foxl1-expressing mesenchymal cells constitute the fundamental niche for intestinal stem cells. Keywords: Intestinal Stem Cell Niche, Wnt, Mesenchyme
Rethinking cell-cycle-dependent gene expression in Schizosaccharomyces pombe.
Cooper, Stephen
2017-11-01
Three studies of gene expression during the division cycle of Schizosaccharomyces pombe led to the proposal that a large number of genes are expressed at particular times during the S. pombe cell cycle. Yet only a small fraction of genes proposed to be expressed in a cell-cycle-dependent manner are reproducible in all three published studies. In addition to reproducibility problems, questions about expression amplitudes, cell-cycle timing of expression, synchronization artifacts, and the problem with methods for synchronizing cells must be considered. These problems and complications prompt the idea that caution should be used before accepting the conclusion that there are a large number of genes expressed in a cell-cycle-dependent manner in S. pombe.
Chen, Xu; Ye, Haiyan; Li, Shilin; Jiao, Baihai; Wu, Jianqin; Zeng, Peibin; Chen, Limin
2017-01-01
Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by a novel bunyavirus (SFTS virus, SFTSV). At present there is still no specific antiviral treatment for SFTSV; To understand which cells support SFTSV life cycle and whether SFTSV infection activates host innate immunity, four different cell lines (Vero, Hela, Huh7.5.1, and Huh7.0) were infected with SFTSV. Intracellular/extracellular viral RNA and expression of IFNα, and IFNß were detected by real-time RT- PCR following infection. To confirm the role of non-structural protein (NSs) of SFTSV in exogenous IFNα-induced Jak/STAT signaling, p-STAT1 (Western Blot), ISRE activity (Luciferase assay) and ISG expression (real-time PCR) were examined following IFNα stimulation in the presence or absence of over-expression of NSs in Hela cells. Our study showed that all the four cell lines supported SFTSV life cycle and SFTSV activated host innate immunity to produce type I IFNs in Hela cells but not in Huh7.0, Huh7.5.1 or Vero cells. NSs inhibited exogenous IFNα-induced Jak/STAT signaling as shown by decreased p-STAT1 level, suppressed ISRE activity and down-regulated ISG expression. Suppression of the exogenous Type I IFN-induced Jak/STAT signaling by NSs might be one of the mechanisms of SFTSV to evade host immune surveillance.
International Nuclear Information System (INIS)
Scharmach, E.; Hessel, S.; Niemann, B.; Lampen, A.
2009-01-01
The human colon adenocarcinoma cell line Caco-2 is frequently used to study human intestinal metabolism and transport of xenobiotica. Previous studies have shown that both Caco-2 cells and human colon cells constitutively express the multigene family of detoxifying enzymes glutathione S-transferases (GSTs), particularly GST alpha and GST pi. GSTs may play a fundamental role in the molecular interplay between phase I, II enzymes and ABC-transporters. The gut fermentation product, butyrate, can modulate the potential for detoxification. The aim of this study was to investigate the basal expression of further cytosolic GSTs in Caco-2 cells during cell differentiation. In addition, a comparison was made with expression levels in MCF-7 and HepG2, two other cell types with barrier functions. Finally, the butyrate-mediated modulation of gene and protein expression was determined by real time PCR and western blot analysis. In Caco-2, gene and protein expression levels of GST alpha increased during cell differentiation. High levels of GSTO1 and GSTP1 were constantly expressed. No expression of GSTM5 and GSTT1 was detected. HepG2 expressed GSTO1 and MCF-7 GSTZ1 most intensively. No expression of GSTA5, GSTM5, or GSTP1 was detected in either cell. Incubation of Caco-2 cells with butyrate (5 mM) significantly induced GSTA1 and GSTM2 in proliferating Caco-2 cells. In differentiated cells, butyrate tended to increase GSTO1 and GSTP1. The results of this study show that a differentiation-dependent expression of GSTs in Caco-2 cells may reflect the in vivo situation and indicate the potential of butyrate to modify intestinal metabolism. GSTA1-A4 have been identified as good markers for cell differentiation. The Caco-2 cell line is a useful model for assessing the potential of food-related substances to modulate the GST expression pattern.
Scharmach, E; Hessel, S; Niemann, B; Lampen, A
2009-11-30
The human colon adenocarcinoma cell line Caco-2 is frequently used to study human intestinal metabolism and transport of xenobiotica. Previous studies have shown that both Caco-2 cells and human colon cells constitutively express the multigene family of detoxifying enzymes glutathione S-transferases (GSTs), particularly GST alpha and GST pi. GSTs may play a fundamental role in the molecular interplay between phase I, II enzymes and ABC-transporters. The gut fermentation product, butyrate, can modulate the potential for detoxification. The aim of this study was to investigate the basal expression of further cytosolic GSTs in Caco-2 cells during cell differentiation. In addition, a comparison was made with expression levels in MCF-7 and HepG2, two other cell types with barrier functions. Finally, the butyrate-mediated modulation of gene and protein expression was determined by real time PCR and western blot analysis. In Caco-2, gene and protein expression levels of GST alpha increased during cell differentiation. High levels of GSTO1 and GSTP1 were constantly expressed. No expression of GSTM5 and GSTT1 was detected. HepG2 expressed GSTO1 and MCF-7 GSTZ1 most intensively. No expression of GSTA5, GSTM5, or GSTP1 was detected in either cell. Incubation of Caco-2 cells with butyrate (5 mM) significantly induced GSTA1 and GSTM2 in proliferating Caco-2 cells. In differentiated cells, butyrate tended to increase GSTO1 and GSTP1. The results of this study show that a differentiation-dependent expression of GSTs in Caco-2 cells may reflect the in vivo situation and indicate the potential of butyrate to modify intestinal metabolism. GSTA1-A4 have been identified as good markers for cell differentiation. The Caco-2 cell line is a useful model for assessing the potential of food-related substances to modulate the GST expression pattern.
Oncomirs Expression Profiling in Uterine Leiomyosarcoma Cells
Directory of Open Access Journals (Sweden)
Bruna Cristine de Almeida
2017-12-01
Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that act as regulators of gene expression at the post-transcriptional level. They play a key role in several biological processes. Their abnormal expression may lead to malignant cell transformation. This study aimed to evaluate the expression profile of 84 miRNAs involved in tumorigenesis in immortalized cells of myometrium (MM, uterine leiomyoma (ULM, and uterine leiomyosarcoma (ULMS. Specific cell lines were cultured and qRT-PCR was performed. Thirteen miRNAs presented different expression profiles in ULM and the same thirteen in ULMS compared to MM. Eight miRNAs were overexpressed, and five were underexpressed in ULM. In ULMS cells, five miRNAs exhibited an overexpression and eight were down-regulated. Six miRNAs (miR-1-3p, miR-130b-3p, miR-140-5p, miR-202-3p, miR-205-5p, and miR-7-5p presented a similar expression pattern in cell lines compared to patient samples. Of these, only three miRNAs showed significant expression in ULM (miR-1-3p, miR-140-5p, and miR-7-5p and ULMS (miR-1-3p, miR-202-3p, and miR-7-5p. Our preliminary approach identified 24 oncomirs with an altered expression profile in ULM and ULMS cells. We identified four differentially expressed miRNAs with the same profile when compared with patients’ samples, which strongly interacted with relevant genes, including apoptosis regulator (BCL2, epidermal growth factor receptor (EGFR, vascular endothelial growth factor A (VEGFA, insulin like growth factor 1 receptor (IGF1R,serine/threonine kinase (RAF1, receptor tyrosine kinase (MET, and bHLH transcription factor (MYCN. This led to alterations in their mRNA-target.
Automatic Control of Gene Expression in Mammalian Cells.
Fracassi, Chiara; Postiglione, Lorena; Fiore, Gianfranco; di Bernardo, Diego
2016-04-15
Automatic control of gene expression in living cells is paramount importance to characterize both endogenous gene regulatory networks and synthetic circuits. In addition, such a technology can be used to maintain the expression of synthetic circuit components in an optimal range in order to ensure reliable performance. Here we present a microfluidics-based method to automatically control gene expression from the tetracycline-inducible promoter in mammalian cells in real time. Our approach is based on the negative-feedback control engineering paradigm. We validated our method in a monoclonal population of cells constitutively expressing a fluorescent reporter protein (d2EYFP) downstream of a minimal CMV promoter with seven tet-responsive operator motifs (CMV-TET). These cells also constitutively express the tetracycline transactivator protein (tTA). In cells grown in standard growth medium, tTA is able to bind the CMV-TET promoter, causing d2EYFP to be maximally expressed. Upon addition of tetracycline to the culture medium, tTA detaches from the CMV-TET promoter, thus preventing d2EYFP expression. We tested two different model-independent control algorithms (relay and proportional-integral (PI)) to force a monoclonal population of cells to express an intermediate level of d2EYFP equal to 50% of its maximum expression level for up to 3500 min. The control input is either tetracycline-rich or standard growth medium. We demonstrated that both the relay and PI controllers can regulate gene expression at the desired level, despite oscillations (dampened in the case of the PI controller) around the chosen set point.
Expression of MIF and CD74 in leukemic cell lines: correlation to DR expression destiny.
Georgouli, Mirella; Papadimitriou, Lina; Glymenaki, Maria; Patsaki, Valia; Athanassakis, Irene
2016-06-01
Invariant chain (Ii) or CD74 is a non-polymorphic glycoprotein, which apart from its role as a chaperone dedicated to MHCII molecules, is known to be a high-affinity receptor for macrophage migration inhibitory factor (MIF). The present study aimed to define the roles of CD74 and MIF in the immune surveillance escape process. Towards this direction, the cell lines HL-60, Raji, K562 and primary pre-B leukemic cells were examined for expression and secretion of MIF. Flow cytometry analysis detected high levels of MIF and intracellular/membrane CD74 expression in all leukemic cells tested, while MIF secretion was shown to be inversely proportional to intracellular HLA-DR (DR) expression. In the MHCII-negative cells, IFN-γ increased MIF expression and induced its secretion in HL-60 and K562 cells, respectively. In K562 cells, CD74 (Iip33Iip35) was shown to co-precipitate with HLA-DOβ (DOβ), inhibiting thus MIF or DR binding. Induced expression of DOα in K562 (DOα-DOβ+) cells in different transfection combinations decreased MIF expression and secretion, while increasing surface DR expression. Thus, MIF could indeed be part of the antigen presentation process.
DEFF Research Database (Denmark)
Isa, Adiba; Nehlin, Jan; Sabir, Hardee Jawad
2010-01-01
HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C...... at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either...... undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC) using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced...
CD40 expression in Wehi-164 cell line.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad
2010-07-01
CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body's defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system.
Canine distemper virus induces apoptosis in cervical tumor derived cell lines
Directory of Open Access Journals (Sweden)
Rajão Daniela S
2011-06-01
Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.
International Nuclear Information System (INIS)
Zhu, Mingyue; Guo, Junli; Li, Wei; Xia, Hua; Lu, Yan; Dong, Xu; Chen, Yi; Xie, Xieju; Fu, Shigan; Li, Mengsen
2015-01-01
Hepatitis B virus (HBV)-X protein(HBx) is a transactivator of host several cellular genes including alpha-fetoprotein(AFP) and AFP receptor(AFPR) which contributes to HBV-associated tumor development. The expression of AFP/AFPR are correlated with hepatocellular carcinoma(HCC)-initial cells. But the role of AFP and AFPR in promoting occurrence of HBV-related HCC were still unclear. A total of 71 clinical patients’ liver specimens, normal human liver cells L-02 and HCC cell lines, PLC/PRF/5 were selected for analyzing the effects of HBx on expression of AFP, AFPR and Src. The expression of goal proteins were detected by Immunohistochemical stained and Western blotting; HBx-expressed vectors were constructed and transfected into L-02 cells, laser confocal microscopy was applied to observe expression and location of AFP, AFPR and Src in the normal liver cells and HCC cells, soft agar colony formation assay was used to observe colonies formed of the cells. We confirmed HBx gives preference to promote the expression of AFP and AFPR; HBx priors to up-regulate the expression of AFPR and AFP in L-02 cells and in normal liver specimens; AFPR signal been able to stimulate Src expression. The results also indicated that phosphatidylinositol 3-kinase(PI3K) inhibitors Ly294002 and GDC0941 effectively suppress AFPR mediated up-regulation expression of Src in AFPR positive HCC lines. HBx priors to drive the expression of AFP and AFPR to promote expression of Src in normal liver cells and hepatoma cells; AFP and AFPR maybe play pivotal role in HBV-related hepatocarcinogenesis; Targeting AFPR is an available therapeutic strategy of HCC. The online version of this article (doi:10.1186/s12885-015-1384-9) contains supplementary material, which is available to authorized users
Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts
DEFF Research Database (Denmark)
Rygaard, K; Vindeløv, L L; Spang-Thomsen, M
1993-01-01
A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse....... WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc......-myc. In general, the level of expression of c-myc and N-myc was similar at the mRNA and the protein level. Expression of c-myc was positively correlated with the proliferative index (sum of S and G2+M phases) of cell lines, but not with the population doubling time. In general, L-myc-expressing cell lines had...
Hemoglobin Expression in Nonerythroid Cells: Novel or Ubiquitous?
Directory of Open Access Journals (Sweden)
Debarchana Saha
2014-01-01
Full Text Available Hemoglobin (Hb is a major protein involved in transport of oxygen (O2. Red blood cells (RBCs contain maximum amount of Hb and because of their unique structure and plasticity they transport O2 to various tissues of the body at an optimal concentration. Recently, it has been reported that, apart from RBCs, Hb is also expressed by nonerythroid cells such as epithelial cells of different origin. The cells expressing Hb are from the tissues where maintenance of O2 homeostasis is of paramount importance. Hb expression has been observed in the epithelial cells from human tissues including lungs, neurons, retina, and endometrium. Our group has recently demonstrated that Hb is expressed by the cervicovaginal epithelial cells. We further showed that, apart from maintaining O2 homeostasis, Hb and the peptides derived from it play an indispensable role in the protection of vaginal epithelium by exhibiting antimicrobial activity. In this review, we discuss the significance of Hb expression in vaginal epithelial cells and its role in the recognition of pathogens thereby reducing the risk and/or severity of inflammation and/or infections and the possible mechanism by which Hb exhibits antimicrobial and antioxidative functions.
Prostate stromal cells express the progesterone receptor to control cancer cell mobility.
Yu, Yue; Lee, Jennifer Suehyun; Xie, Ning; Li, Estelle; Hurtado-Coll, Antonio; Fazli, Ladan; Cox, Michael; Plymate, Stephen; Gleave, Martin; Dong, Xuesen
2014-01-01
Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR) was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1) and interlukin-6 (IL-6) by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.
Prostate stromal cells express the progesterone receptor to control cancer cell mobility.
Directory of Open Access Journals (Sweden)
Yue Yu
Full Text Available Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood.Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels.Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1 and interlukin-6 (IL-6 by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion.Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.
Alvarez-Vallina, L; Yañez, R; Blanco, B; Gil, M; Russell, S J
2000-04-01
Adoptive therapy with autologous T cells expressing chimeric T-cell receptors (chTCRs) is of potential interest for the treatment of malignancy. To limit possible T-cell-mediated damage to normal tissues that weakly express the targeted tumor antigen (Ag), we have tested a strategy for the suppression of target cell recognition by engineered T cells. Jurkat T cells were transduced with an anti-hapten chTCR tinder the control of a tetracycline-suppressible promoter and were shown to respond to Ag-positive (hapten-coated) but not to Ag-negative target cells. The engineered T cells were then reacted with hapten-coated target cells at different effector to target cell ratios before and after exposure to tetracycline. When the engineered T cells were treated with tetracycline, expression of the chTCR was greatly decreased and recognition of the hapten-coated target cells was completely suppressed. Tetracycline-mediated suppression of target cell recognition by engineered T cells may be a useful strategy to limit the toxicity of the approach to cancer gene therapy.
Expression and significance of Axin2 in pancreatic cancer cells
Directory of Open Access Journals (Sweden)
ZHANG Tao
2016-05-01
Full Text Available ObjectiveTo investigate the expression of Axin2 in pancreatic cancer cells, and to observe the influence of Axin2 on the proliferation, invasion, and migration of human pancreatic cancer cells (PANC-1. MethodsQuantitative real-time PCR was used to measure the expression of Axin2 in pancreatic cancer cell lines with different invasive abilities (PANC-1, Mia PaCa-2, and BxPC-3 and immortalized normal pancreatic cells (H6C7. PANC-1 cells with low expression were transfected with over-expressed Axin2 plasmid by transient transfection. MTT assay, Transwell assay, and scratch assay were used to determine the proliferation, invasion, and migration of cells transfected with over-expressed Axin2. One-way analysis of variance was used for comparison between multiple groups, and SNK-q test was used for comparison between any two groups. ResultsThe relative expression levels of Axin2 in PANC-1, BxPC-3, Mia PaCa-2, and H6C7 cells were 0.13±0.01, 0.42±0.05, 0.24±0.011, and 1.00±0.00, respectively, and PANC-1 cells had the lowest expression level of Axin2, with significant differences compared with the other cells (all P<0.05. When PANC-1 cells were transfected with over-expressed Axin2 plasmid, the cells in the over-expression group had a significant increase in the expression level of Axin2 compared with those in the blank group and the negative control group (both P<0.05. Compared with those in the non-transfection group and the blank group, PANC-1 cells in the over-expression group showed significant reductions in the proliferation, invasion, and migration abilities. ConclusionThe expression of Axin2 is down-regulated in pancreatic cancer cell lines and decreases with the increasing invasion ability, suggesting the role of tumor suppressor gene. High expression of Axin2 can reduce the proliferation, invasion, and migration abilities of PANC-1 cells.
In vitro anticancer activity and cytotoxicity of some papaver alkaloids ...
African Journals Online (AJOL)
Materials and Methods: The Vero and HeLa cell lines were treated with various concentrations (1-300 μg/mL) of alkaloids for 48 h. Values for cytotoxicity measured by MTT assay were expressed as the concentration that causes a 50% decrease in cell viability (IC50) (μg/mL). Results: Berberine and macranthine were the ...
Directory of Open Access Journals (Sweden)
V. Erukhimovitch
2013-01-01
Full Text Available Fourier transform infrared microspectroscopy (FTIR-M can detect small molecular changes in cells and therefore was previously applied for the identification of different biological samples. In the present study, FTIR spectroscopy was used for the identification and discrimination of Vero cells infected with herpes viruses or contaminated with bacteria or fungi in cell culture. Vero cells in culture were infected herpes simplex virus type 1 (HSV-1 or contaminated with E. coli bacteria or Candida albicans fungi and analyzed by FTIR microscopy at 24 h postinfection/contamination. Specific different spectral changes were observed according to the infecting or contaminating agent. For instance, both pure fungi and cell culture contaminated with this fungi showed specific peaks at 1030 cm−1 and at 1373 cm−1 regions, while pure E. coli and cell culture contaminated with this bacteria showed a specific and unique peak at 1657 cm−1. These results support the potential of developing FTIR microspectroscopy as a simple, reagent free method for identification and discrimination between different tissue infection or contamination with various pathogens.
Advantages and Applications of CAR-Expressing Natural Killer Cells
Directory of Open Access Journals (Sweden)
Wolfgang eGlienke
2015-02-01
Full Text Available In contrast to donor T cells, natural killer (NK cells are known to mediate anti-cancer effects without the risk of inducing graft-versus-host disease (GvHD. In order to improve cytotoxicity against resistant cancer cells, auspicious efforts have been made with chimeric antigen receptor (CAR expressing T- and NK cells. These CAR-modified cells express antigen receptors against tumor-associated surface antigens, thus redirecting the effector cells and enhancing tumor-specific immunosurveillance. However, many cancer antigens are also expressed on healthy tissues, potentially leading to off tumor/ on target toxicity by CAR-engineered cells. In order to control such potentially severe side effects, the insertion of suicide genes into CAR-modified effectors can provide a means for efficient depletion of these cells. While CAR-expressing T cells have entered successfully clinical trials, experience with CAR-engineered NK cells is mainly restricted to pre-clinical investigations and predominantly to NK cell lines. In this review we summarize the data on CAR expressing NK cells focusing on the possible advantage using these short-lived effector cells and discuss the necessity of suicide switches. Furthermore, we address the compliance of such modified NK cells with regulatory requirements as a new field in cellular immunotherapy.
Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines
Directory of Open Access Journals (Sweden)
Yamaguchi Ryoji
2009-10-01
Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.
Glioblastoma formation from cell population depleted of Prominin1-expressing cells.
Directory of Open Access Journals (Sweden)
Kenji Nishide
2009-08-01
Full Text Available Prominin1 (Prom1, also known as CD133 in human has been widely used as a marker for cancer stem cells (CSCs, which self-renew and are tumorigenic, in malignant tumors including glioblastoma multiforme (GBM. However, there is other evidence showing that Prom1-negative cancer cells also form tumors in vivo. Thus it remains controversial whether Prom1 is a bona fide marker for CSCs. To verify if Prom1-expressing cells are essential for tumorigenesis, we established a mouse line, whose Prom1-expressing cells can be eliminated conditionally by a Cre-inducible DTA gene on the Prom1 locus together with a tamoxifen-inducible CreER(TM, and generated glioma-initiating cells (GICs-LD by overexpressing both the SV40 Large T antigen and an oncogenic H-Ras(L61 in neural stem cells of the mouse line. We show here that the tamoxifen-treated GICs-LD (GICs-DTA form tumor-spheres in culture and transplantable GBM in vivo. Thus, our studies demonstrate that Prom1-expressing cells are dispensable for gliomagenesis in this mouse model.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Geometry of the Gene Expression Space of Individual Cells.
Directory of Open Access Journals (Sweden)
Yael Korem
2015-07-01
Full Text Available There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a
CD133 expression in chemo-resistant Ewing sarcoma cells
Directory of Open Access Journals (Sweden)
Kovar Heinrich
2010-03-01
Full Text Available Abstract Background Some human cancers demonstrate cellular hierarchies in which tumor-initiating cancer stem cells generate progeny cells with reduced tumorigenic potential. This cancer stem cell population is proposed to be a source of therapy-resistant and recurrent disease. Ewing sarcoma family tumors (ESFT are highly aggressive cancers in which drug-resistant, relapsed disease remains a significant clinical problem. Recently, the cell surface protein CD133 was identified as a putative marker of tumor-initiating cells in ESFT. We evaluated ESFT tumors and cell lines to determine if high levels of CD133 are associated with drug resistance. Methods Expression of the CD133-encoding PROM1 gene was determined by RT-PCR in ESFT tumors and cell lines. CD133 protein expression was assessed by western blot, FACS and/or immunostaining. Cell lines were FACS-sorted into CD133+ and CD133- fractions and proliferation, colony formation in soft agar, and in vivo tumorigenicity compared. Chemosensitivity was measured using MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxy-methoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium assays. Results PROM1 expression was either absent or extremely low in most tumors. However, PROM1 was highly over-expressed in 4 of 48 cases. Two of the 4 patients with PROM1 over-expressing tumors rapidly succumbed to primary drug-resistant disease and two are long-term, event-free survivors. The expression of PROM1 in ESFT cell lines was similarly heterogeneous. The frequency of CD133+ cells ranged from 2-99% and, with one exception, no differences in the chemoresistance or tumorigenicity of CD133+ and CD133- cell fractions were detected. Importantly, however, the STA-ET-8.2 cell line was found to retain a cellular hierarchy in which relatively chemo-resistant, tumorigenic CD133+ cells gave rise to relatively chemo-sensitive, less tumorigenic, CD133- progeny. Conclusions Up to 10% of ESFT express high levels of PROM1. In some tumors and cell
B cell lymphomas express CX3CR1 a non-B cell lineage adhesion molecule
DEFF Research Database (Denmark)
Andreasson, U.; Ek, S.; Merz, H.
2008-01-01
normally is not expressed on B cells, is expressed both at the mRNA and protein level in several subtypes of lymphoma. CX3CR1 has also shown to be involved in the homing to specific tissues that express the ligand, CX3CL1, in breast and prostate cancer and may thus be involved in dissemination of lymphoma......To study the differential expression of cell membrane-bound receptors and their potential role in growth and/or survival of the tumor cells, highly purified follicular lymphoma cells were analyzed, using gene expression analysis, and compared to non-malignant B cell populations. Filtering...... the genome for overexpressed genes coding for cell membrane-bound proteins/receptors resulted in a hit list of 27 identified genes. Among these, we have focused on the aberrant over expression of CX3CR1, in different types of B cell lymphoma, as compared to non-malignant B cells. We show that CX3CR1, which...
Directory of Open Access Journals (Sweden)
Kylie A. Huckleberry
2015-08-01
Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult
Human thymic epithelial cells express functional HLA-DP molecules
DEFF Research Database (Denmark)
Jørgensen, A; Röpke, C; Nielsen, M
1996-01-01
T lymphocytes, we examined whether human thymic epithelial cells (TEC) expressed HLA-DP molecules. We present evidence that TEC obtained from short time culture express low but significant levels of HLA-DP molecules. The expression of HLA-DP molecules was comparable to or higher than the expression...... of HLA-DP allospecific primed lymphocyte typing (PLT) CD4 T cell lines. IFN-gamma treatment strongly upregulated the HLA-DP allospecific PLT responses whereas other PLT responses remained largely unchanged. In conclusion, these data indicate that human thymus epithelial cells express significant levels...
Alvarez, Rene; Seal, Bruce S
2005-01-01
Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the
Directory of Open Access Journals (Sweden)
Alvarez Rene
2005-04-01
Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among
Absence of annexin I expression in B-cell non-Hodgkin's lymphomas and cell lines
Directory of Open Access Journals (Sweden)
Gopalakrishnan Velliyur K
2004-03-01
Full Text Available Abstract Background Annexin I, one of the 20 members of the annexin family of calcium and phospholipid-binding proteins, has been implicated in diverse biological processes including signal transduction, mediation of apoptosis and immunosuppression. Previous studies have shown increased annexin I expression in pancreatic and breast cancers, while it is absent in prostate and esophageal cancers. Results Data presented here show that annexin I mRNA and protein are undetectable in 10 out of 12 B-cell lymphoma cell lines examined. Southern blot analysis indicates that the annexin I gene is intact in B-cell lymphoma cell lines. Aberrant methylation was examined as a cause for lack of annexin I expression by treating cells 5-Aza-2-deoxycytidine. Reexpression of annexin I was observed after prolonged treatment with the demethylating agent indicating methylation may be one of the mechanisms of annexin I silencing. Treatment of Raji and OMA-BL-1 cells with lipopolysaccharide, an inflammation inducer, and with hydrogen peroxide, a promoter of oxidative stress, also failed to induce annexin I expression. Annexin I expression was examined in primary lymphoma tissues by immunohistochemistry and presence of annexin I in a subset of normal B-cells and absence of annexin I expression in the lymphoma tissues were observed. These results show that annexin I is expressed in normal B-cells, and its expression is lost in all primary B-cell lymphomas and 10 of 12 B-cell lymphoma cell lines. Conclusions Our results suggest that, similar to prostate and esophageal cancers, annexin I may be an endogenous suppressor of cancer development, and loss of annexin I may contribute to B-cell lymphoma development.
Directory of Open Access Journals (Sweden)
Xiao-Yang Wang
Full Text Available Clara cells are non-ciliated, secretory bronchiolar epithelial cells that serve to detoxify harmful inhaled substances. Clara cells also function as stem/progenitor cells for repair in the bronchioles. Clara cell secretory protein (CCSP is specifically expressed in pulmonary Clara cells and is widely used as a Clara cell marker. In addition CCSP promoter is commonly used to direct gene expression into the lung in transgenic models. The discovery of CCSP immunoreactivity in plasma membranes of airway lining cells prompted us to explore the possibility of enriching Clara cells by flow cytometry. We established a novel and simple method for the isolation of CCSP-expressing cell Clara cells using a combination of mechanical and enzymatic dissociation followed by flow cytometry sorting technology. We showed that ∼25% of dissociated cells from whole lung expressed CCSP. In the resulting preparation, up to 98% of cells expressed CCSP. Notably, we found that several common stem cell markers including CD44, CD133, Sca-1 and Sox2 were expressed in CCSP(+ cells. Moreover, CCSP(+ cells were able to form spheroid colonies in vitro with 0.97‰ efficiency. Parallel studies in vivo confirmed that a small population of CCSP(-expressing cells in mouse airways also demonstrates stem cell-like properties such as label retention and harboring rare bronchioalveolar stem cells (BASCs in terminal bronchioles (TBs. We conclude that CCSP(+ cells exhibit a number of stem cell-like features including stem cell marker expression, bronchosphere colony formation and self-renewal ability. Clara cell isolation by flow cytometry sorting is a useful method for investigating the function of primary Clara cells in stem cell research and mouse models.
The Expression of BTS-2 Enhances Cell Growth and Invasiveness in Renal Cell Carcinoma.
Pham, Quoc Thang; Oue, Naohide; Yamamoto, Yuji; Shigematsu, Yoshinori; Sekino, Yohei; Sakamoto, Naoya; Sentani, Kazuhiro; Uraoka, Naohiro; Tiwari, Mamata; Yasui, Wataru
2017-06-01
Renal cell carcinoma (RCC) is one of the most common types of cancer in developed countries. Bone marrow stromal cell antigen 2 (BST2) gene, which encodes BST2 transmembrane glycoprotein, is overexpressed in several cancer types. In the present study, we analyzed the expression and function of BST2 in RCC. BST2 expression was analyzed by immunohistochemistry in 123 RCC cases. RNA interference was used to inhibit BST2 expression in a RCC cell line. Immunohistochemical analysis showed that 32% of the 123 RCC cases were positive for BST2. BST2 expression was positively associated with tumour stage. Furthermore, BST2 expression was an independent predictor of survival in patients with RCC. BST2 siRNA-transfected Caki-1 cells displayed significantly reduced cell growth and invasive activity relative to negative control siRNA-transfected cells. These results suggest that BST2 plays an important role in the progression of RCC. Because BST2 is expressed on the cell membrane, BST2 is a good therapeutic target for RCC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Efflux protein expression in human stem cell-derived retinal pigment epithelial cells.
Directory of Open Access Journals (Sweden)
Kati Juuti-Uusitalo
Full Text Available Retinal pigment epithelial (RPE cells in the back of the eye nourish photoreceptor cells and form a selective barrier that influences drug transport from the blood to the photoreceptor cells. At the molecular level, ATP-dependent efflux transporters have a major role in drug delivery in human RPE. In this study, we assessed the relative expression of several ATP-dependent efflux transporter genes (MRP1, -2, -3, -4, -5, -6, p-gp, and BCRP, the protein expression and localization of MRP1, MRP4, and MRP5, and the functionality of MRP1 efflux pumps at different maturation stages of undifferentiated human embryonic stem cells (hESC and RPE derived from the hESC (hESC-RPE. Our findings revealed that the gene expression of ATP-dependent efflux transporters MRP1, -3, -4, -5, and p-gp fluctuated during hESC-RPE maturation from undifferentiated hESC to fusiform, epithelioid, and finally to cobblestone hESC-RPE. Epithelioid hESC-RPE had the highest expression of MRP1, -3, -4, and P-gp, whereas the most mature cobblestone hESC-RPE had the highest expression of MRP5 and MRP6. These findings indicate that a similar efflux protein profile is shared between hESC-RPE and the human RPE cell line, ARPE-19, and suggest that hESC-RPE cells are suitable in vitro RPE models for drug transport studies. Embryonic stem cell model might provide a novel tool to study retinal cell differentiation, mechanisms of RPE-derived diseases, drug testing and targeted drug therapy.
Dudimah, Fred D.; Abraha, Abraham; Wang, Xiaofei; Whalen, Margaret M.
2010-01-01
Tributyltin (TBT) activates the mitogen activated protein kinase (MAPK), p44/42 in human natural killer (NK) cells. TBT also reduces NK cytotoxic function and decreases the expression of several NK-cell proteins. To understand the role that p44/42 activation plays in TBT-induced loss of NK cell function, we have investigated how selective activation of p44/42 by phorbol 12-myristate 13-acetate (PMA) affects NK cells. Previously we showed that PMA caused losses of lytic function similar to those seen with TBT exposures. Here we examined activation of p44/42 in the regulation of NK-cell protein expression and how this regulation may explain the protein expression changes seen with TBT exposures. NK cells exposed to PMA were examined for levels of cell-surface proteins, granzyme mRNA, and perforin mRNA expression. The expression of CD11a, CD16, CD18, and CD56 were reduced, perforin mRNA levels were unchanged and granzyme mRNA levels were increased. To verify that activation of p44/42 was responsible for the alterations seen in CD11a, CD16, CD18, and CD56 with PMA, NK cells were treated with the p44/42 pathway inhibitor (PD98059) prior to PMA exposures. In the presence of PD98059, PMA caused no decreases in the expression of the cell-surface proteins. Results of these studies indicate that the activation of p44/42 may lead to the loss of NK cell cytotoxic function by decreasing the expression of CD11a, CD16, CD18, and CD56. Further, activation of p44/42 appears to be at least in part responsible for the TBT-induced decreases in expression of CD16, CD18, and CD56. PMID:20883105
Directory of Open Access Journals (Sweden)
Mikaël Boullé
2016-11-01
Full Text Available Cell-to-cell spread of HIV, a directed mode of viral transmission, has been observed to be more rapid than cell-free infection. However, a mechanism for earlier onset of viral gene expression in cell-to-cell spread was previously uncharacterized. Here we used time-lapse microscopy combined with automated image analysis to quantify the timing of the onset of HIV gene expression in a fluorescent reporter cell line, as well as single cell staining for infection over time in primary cells. We compared cell-to-cell spread of HIV to cell-free infection, and limited both types of transmission to a two-hour window to minimize differences due to virus transit time to the cell. The mean time to detectable onset of viral gene expression in cell-to-cell spread was accelerated by 19% in the reporter cell line and by 35% in peripheral blood mononuclear cells relative to cell-free HIV infection. Neither factors secreted by infected cells, nor contact with infected cells in the absence of transmission, detectably changed onset. We recapitulated the earlier onset by infecting with multiple cell-free viruses per cell. Surprisingly, the acceleration in onset of viral gene expression was not explained by cooperativity between infecting virions. Instead, more rapid onset was consistent with a model where the fastest expressing virus out of the infecting virus pool sets the time for infection independently of the other co-infecting viruses.
Polyclonal T-cells express CD1a in Langerhans cell histiocytosis (LCH lesions.
Directory of Open Access Journals (Sweden)
Jennifer A West
Full Text Available Langerhans cell histiocytosis (LCH is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a(+/CD3(+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs. We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a(+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH.
Radhakrishnan, Karthika; Bhagya, Kongattu P; Kumar, Anil Tr; Devi, Anandavalli N; Sengottaiyan, Jeeva; Kumar, Pradeep G
2016-08-01
Autoimmune regulator (AIRE) is a gene associated with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). AIRE is expressed heavily in the thymic epithelial cells and is involved in maintaining self-tolerance through regulating the expression of tissue-specific antigens. The testes are the most predominant extrathymic location where a heavy expression of AIRE is reported. Homozygous Aire-deficient male mice were infertile, possibly due to impaired spermatogenesis, deregulated germ cell apoptosis, or autoimmunity. We report that AIRE is expressed in the testes of neonatal, adolescent, and adult mice. AIRE expression was detected in glial cell derived neurotrophic factor receptor alpha (GFRα)(+) (spermatogonia), GFRα(-)/synaptonemal complex protein (SCP3)(+) (meiotic), and GFRα(-)/Phosphoglycerate kinase 2 (PGK2)(+) (postmeiotic) germ cells in mouse testes. GC1-spg, a germ-cell-derived cell line, did not express AIRE. Retinoic acid induced AIRE expression in GC1-spg cells. Ectopic expression of AIRE in GC1-spg cells using label-free LC-MS/MS identified a total of 371 proteins that were differentially expressed. 100 proteins were up-regulated, and 271 proteins were down-regulated. Data are available via ProteomeXchange with identifier PXD002511. Functional analysis of the differentially expressed proteins showed increased levels of various nucleic-acid-binding proteins and transcription factors and a decreased level of various cytoskeletal and structural proteins in the AIRE overexpressing cells as compared with the empty vector-transfected controls. The transcripts of a select set of the up-regulated proteins were also elevated. However, there was no corresponding decrease in the mRNA levels of the down-regulated set of proteins. Molecular function network analysis indicated that AIRE influenced gene expression in GC1-spg cells by acting at multiple levels, including transcription, translation, RNA processing, protein transport, protein
Exosomes from asbestos-exposed cells modulate gene expression in mesothelial cells.
Munson, Phillip; Lam, Ying-Wai; Dragon, Julie; MacPherson, Maximilian; Shukla, Arti
2018-03-19
Asbestos exposure is a determinate cause of many diseases, such as mesothelioma, fibrosis, and lung cancer, and poses a major human health hazard. At this time, there are no identified biomarkers to demarcate asbestos exposure before the presentation of disease and symptoms, and there is only limited understanding of the underlying biology that governs asbestos-induced disease. In our study, we used exosomes, 30-140 nm extracellular vesicles, to gain insight into these knowledge gaps. As inhaled asbestos is first encountered by lung epithelial cells and macrophages, we hypothesize that asbestos-exposed cells secrete exosomes with signature proteomic cargo that can alter the gene expression of mesothelial cells, contributing to disease outcomes like mesothelioma. In the present study using lung epithelial cells (BEAS2B) and macrophages (THP-1), we first show that asbestos exposure causes changes in abundance of some proteins in the exosomes secreted from these cells. Furthermore, exposure of human mesothelial cells (HPM3) to these exosomes resulted in gene expression changes related to epithelial-to-mesenchymal transition and other cancer-related genes. This is the first report to indicate that asbestos-exposed cells secrete exosomes with differentially abundant proteins and that those exosomes have a gene-altering effect on mesothelial cells.-Munson, P., Lam, Y.-W., Dragon, J. MacPherson, M., Shukla, A. Exosomes from asbestos-exposed cells modulate gene expression in mesothelial cells.
Characterization of TLX expression in neural stem cells and progenitor cells in adult brains.
Li, Shengxiu; Sun, Guoqiang; Murai, Kiyohito; Ye, Peng; Shi, Yanhong
2012-01-01
TLX has been shown to play an important role in regulating the self-renewal and proliferation of neural stem cells in adult brains. However, the cellular distribution of endogenous TLX protein in adult brains remains to be elucidated. In this study, we used immunostaining with a TLX-specific antibody to show that TLX is expressed in both neural stem cells and transit-amplifying neural progenitor cells in the subventricular zone (SVZ) of adult mouse brains. Then, using a double thymidine analog labeling approach, we showed that almost all of the self-renewing neural stem cells expressed TLX. Interestingly, most of the TLX-positive cells in the SVZ represented the thymidine analog-negative, relatively quiescent neural stem cell population. Using cell type markers and short-term BrdU labeling, we demonstrated that TLX was also expressed in the Mash1+ rapidly dividing type C cells. Furthermore, loss of TLX expression dramatically reduced BrdU label-retaining neural stem cells and the actively dividing neural progenitor cells in the SVZ, but substantially increased GFAP staining and extended GFAP processes. These results suggest that TLX is essential to maintain the self-renewing neural stem cells in the SVZ and that the GFAP+ cells in the SVZ lose neural stem cell property upon loss of TLX expression. Understanding the cellular distribution of TLX and its function in specific cell types may provide insights into the development of therapeutic tools for neurodegenerative diseases by targeting TLX in neural stem/progenitors cells.
Gene expression of manganese superoxide dismutase in human glioma cells
Directory of Open Access Journals (Sweden)
Novi S. Hardiany
2010-02-01
Full Text Available Aim This study analyze the MnSOD gene expression as endogenous antioxidant in human glioma cells compared with leucocyte cells as control.Methods MnSOD gene expression of 20 glioma patients was analyzed by measuring the relative expression of mRNA and enzyme activity of MnSOD in brain and leucocyte cells. The relative expression of mRNA MnSOD was determined by using quantitative Real Time RT-PCR and the enzyme activity of MnSOD using biochemical kit assay (xantine oxidase inhibition. Statistic analysis for mRNA and enzyme activity of MnSOD was performed using Kruskal Wallis test.Results mRNA of MnSOD in glioma cells of 70% sample was 0.015–0.627 lower, 10% was 1.002-1.059 and 20% was 1.409-6.915 higher than in leucocyte cells. Also the specific activity of MnSOD enzyme in glioma cells of 80% sample showed 0,064-0,506 lower and 20% sample was 1.249-2.718 higher than in leucocyte cells.Conclusion MnSOD gene expression in human glioma cells are significantly lower than its expression in leucocytes cells. (Med J Indones 2010; 19:21-5Keywords : MnSOD, glioma, gene expression
Expression of cadherin and NCAM in human small cell lung cancer cell lines and xenografts
DEFF Research Database (Denmark)
Rygaard, K; Møller, C; Bock, E
1992-01-01
characterised, the cadherin family and the Ig superfamily member, neural cell adhesion molecule (NCAM). We investigated expression of these two adhesion molecule families in small cell lung cancer (SCLC) cell lines and xenografts by immunoblotting. Nineteen tumours established from 15 patients with SCLC were......Tumour cell adhesion, detachment and aggregation seem to play an important part in tumour invasion and metastasis, and numerous cell adhesion molecules are expressed by tumour cells. Several families of cell-cell adhesion molecules have been described, of which two groups are particularly well...... embryonic development, which may play a role in connection with tumour invasion and metastasis, was found in 14/18 NCAM expressing SCLC tumours. Individual tumours grown as cell lines and as nude mouse xenografts showed no qualitative differences in cadherin or NCAM expression....
Effect of ultrasound on herpes simplex virus infection in cell culture
Directory of Open Access Journals (Sweden)
Iwai Soichi
2011-09-01
Full Text Available Abstract Background Ultrasound has been shown to increase the efficiency of gene expression from retroviruses, adenoviruses and adeno-associated viruses. The effect of ultrasound to stimulate cell membrane permeabilization on infection with an oncolytic herpes simplex virus type 1 (HSV-1 was examined. Results Vero monkey kidney cells were infected with HSV-1 and exposed to 1 MHz ultrasound after an adsorption period. The number of plaques was significantly greater than that of the untreated control. A combination of ultrasound and microbubbles further increased the plaque number. Similar results were obtained using a different type of HSV-1 and oral squamous cell carcinoma (SCC cells. The appropriate intensity, duty cycle and time of ultrasound to increase the plaque number were 0.5 W/cm2, 20% duty cycle and 10 sec, respectively. Ultrasound with microbubbles at an intensity of 2.0 W/cm2, at 50% duty cycle, or for 40 sec reduced cell viability. Conclusion These results indicate that ultrasound promotes the entry of oncolytic HSV-1 into cells. It may be useful to enhance the efficiency of HSV-1 infection in oncolytic virotherapy.
Inflammation increases cells expressing ZSCAN4 and progenitor cell markers in the adult pancreas
Azuma, Sakiko; Yokoyama, Yukihiro; Yamamoto, Akiko; Kyokane, Kazuhiro; Niida, Shumpei; Ishiguro, Hiroshi; Ko, Minoru S. H.
2013-01-01
We have recently identified the zinc finger and SCAN domain containing 4 (Zscan4), which is transiently expressed and regulates telomere elongation and genome stability in mouse embryonic stem (ES) cells. The aim of this study was to examine the expression of ZSCAN4 in the adult pancreas and elucidate the role of ZSCAN4 in tissue inflammation and subsequent regeneration. The expression of ZSCAN4 and other progenitor or differentiated cell markers in the human pancreas was immunohistochemically examined. Pancreas sections of alcoholic or autoimmune pancreatitis patients before and under maintenance corticosteroid treatment were used in this study. In the adult human pancreas a small number of ZSCAN4-positive (ZSCAN4+) cells are present among cells located in the islets of Langerhans, acini, ducts, and oval-shaped cells. These cells not only express differentiated cell markers for each compartment of the pancreas but also express other tissue stem/progenitor cell markers. Furthermore, the number of ZSCAN4+ cells dramatically increased in patients with chronic pancreatitis, especially in the pancreatic tissues of autoimmune pancreatitis actively regenerating under corticosteroid treatment. Interestingly, a number of ZSCAN4+ cells in the pancreas of autoimmune pancreatitis returned to the basal level after 1 yr of maintenance corticosteroid treatment. In conclusion, coexpression of progenitor cell markers and differentiated cell markers with ZSCAN4 in each compartment of the pancreas may indicate the presence of facultative progenitors for both exocrine and endocrine cells in the adult pancreas. PMID:23599043
Mishra, Amrendra; Sriram, Harshini; Chandarana, Pinal; Tanavde, Vivek; Kumar, Rekha V; Gopinath, Ashok; Govindarajan, Raman; Ramaswamy, S; Sadasivam, Subhashini
2018-05-01
The goal of this study was to isolate cancer stem-like cells marked by high expression of CD44, a putative cancer stem cell marker, from primary oral squamous cell carcinomas and identify distinctive gene expression patterns in these cells. From 1 October 2013 to 4 September 2015, 76 stage III-IV primary oral squamous cell carcinoma of the gingivobuccal sulcus were resected. In all, 13 tumours were analysed by immunohistochemistry to visualise CD44-expressing cells. Expression of CD44 within The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma RNA-sequencing data was also assessed. Seventy resected tumours were dissociated into single cells and stained with antibodies to CD44 as well as CD45 and CD31 (together referred as Lineage/Lin). From 45 of these, CD44 + Lin - and CD44 - Lin - subpopulations were successfully isolated using fluorescence-activated cell sorting, and good-quality RNA was obtained from 14 such sorted pairs. Libraries from five pairs were sequenced and the results analysed using bioinformatics tools. Reverse transcription quantitative polymerase chain reaction was performed to experimentally validate the differential expression of selected candidate genes identified from the transcriptome sequencing in the same 5 and an additional 9 tumours. CD44 was expressed on the surface of poorly differentiated tumour cells, and within the The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma samples, its messenger RNA levels were higher in tumours compared to normal. Transcriptomics revealed that 102 genes were upregulated and 85 genes were downregulated in CD44 + Lin - compared to CD44 - Lin - cells in at least 3 of the 5 tumours sequenced. The upregulated genes included those involved in immune regulation, while the downregulated genes were enriched for genes involved in cell adhesion. Decreased expression of PCDH18, MGP, SPARCL1 and KRTDAP was confirmed by reverse transcription quantitative polymerase chain reaction. Lower expression of
Kotani, Takeshi; Toyono, Takashi; Seta, Yuji; Kitou, Ayae; Kataoka, Shinji; Toyoshima, Kuniaki
2013-09-01
Synaptogyrins are conserved components of the exocytic apparatus and function as regulators of Ca(2+)-dependent exocytosis. The synaptogyrin family comprises three isoforms: two neuronal (synaptogyrin-1 and -3) and one ubiquitous (synaptogyrin-2) form. Although the expression patterns of the exocytic proteins synaptotagmin-1, SNAP-25, synaptobrevin-2 and synaptophysin have been elucidated in taste buds, the function and expression pattern of synaptogyrin-1 in rat gustatory tissues have not been determined. Therefore, we examined the expression patterns of synaptogyrin-1 and several cell-specific markers of type II and III cells in rat gustatory tissues. Reverse transcription/polymerase chain reaction assays and immunoblot analysis revealed the expression of synaptogyrin-1 mRNA and its protein in circumvallate papillae. In fungiform, foliate and circumvallate papillae, the antibody against synaptogyrin-1 immunolabeled a subset of taste bud cells and intra- and subgemmal nerve processes. Double-labeling experiments revealed the expression of synaptogyrin-1 in most taste cells immunoreactive for aromatic L-amino acid decarboxylase and the neural cell adhesion molecule. A subset of synaptogyrin-1-immunoreactive taste cells also expressed phospholipase Cβ2, gustducin, or sweet taste receptor (T1R2). In addition, most synaptogyrin-1-immunoreactive taste cells expressed synaptobrevin-2. These results suggest that synaptogyrin-1 plays a regulatory role in transmission at the synapses of type III cells and is involved in exocytic function with synaptobrevin-2 in a subset of type II cells in rat taste buds.
Characterization of TLX expression in neural stem cells and progenitor cells in adult brains.
Directory of Open Access Journals (Sweden)
Shengxiu Li
Full Text Available TLX has been shown to play an important role in regulating the self-renewal and proliferation of neural stem cells in adult brains. However, the cellular distribution of endogenous TLX protein in adult brains remains to be elucidated. In this study, we used immunostaining with a TLX-specific antibody to show that TLX is expressed in both neural stem cells and transit-amplifying neural progenitor cells in the subventricular zone (SVZ of adult mouse brains. Then, using a double thymidine analog labeling approach, we showed that almost all of the self-renewing neural stem cells expressed TLX. Interestingly, most of the TLX-positive cells in the SVZ represented the thymidine analog-negative, relatively quiescent neural stem cell population. Using cell type markers and short-term BrdU labeling, we demonstrated that TLX was also expressed in the Mash1+ rapidly dividing type C cells. Furthermore, loss of TLX expression dramatically reduced BrdU label-retaining neural stem cells and the actively dividing neural progenitor cells in the SVZ, but substantially increased GFAP staining and extended GFAP processes. These results suggest that TLX is essential to maintain the self-renewing neural stem cells in the SVZ and that the GFAP+ cells in the SVZ lose neural stem cell property upon loss of TLX expression. Understanding the cellular distribution of TLX and its function in specific cell types may provide insights into the development of therapeutic tools for neurodegenerative diseases by targeting TLX in neural stem/progenitors cells.
Amniotic Fluid Cells Show Higher Pluripotency-Related Gene Expression Than Allantoic Fluid Cells.
Kehl, Debora; Generali, Melanie; Görtz, Sabrina; Geering, Diego; Slamecka, Jaroslav; Hoerstrup, Simon P; Bleul, Ulrich; Weber, Benedikt
2017-10-01
Amniotic fluid represents an abundant source of multipotent stem cells, referred as broadly multipotent given their differentiation potential and expression of pluripotency-related genes. However, the origin of this broadly multipotent cellular fraction is not fully understood. Several sources have been proposed so far, including embryonic and extraembryonic tissues. In this regard, the ovine developmental model uniquely allows for direct comparison of fetal fluid-derived cells from two separate fetal fluid cavities, the allantois and the amnion, over the entire duration of gestation. As allantoic fluid mainly collects fetal urine, cells originating from the efferent urinary tract can directly be compared with cells deriving from the extraembryonic amniotic tissues and the fetus. This study shows isolation of cells from the amniotic [ovine amniotic fluid cells (oAFCs)] and allantoic fluid [ovine allantoic fluid cells (oALCs)] in a strictly paired fashion with oAFCs and oALCs derived from the same fetus. Both cell types showed cellular phenotypes comparable to standard mesenchymal stem cells (MSCs), with trilineage differentiation potential, and expression of common ovine MSC markers. However, the expression of MSC markers per single cell was higher in oAFCs as measured by flow cytometry. oAFCs exhibited higher proliferative capacities and showed significantly higher expression of pluripotency-related genes OCT4, STAT3, NANOG, and REX1 by quantitative real-time polymerase chain reaction compared with paired oALCs. No significant decrease of pluripotency-related gene expression was noted over gestation, implying that cells with high differentiation potential may be isolated at the end of pregnancy. In conclusion, this study suggests that cells with highest stem cell characteristics may originate from the fetus itself or the amniotic fetal adnexa rather than from the efferent urinary tract or the allantoic fetal adnexa.
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Aksoy, Mark O; Yang, Yi; Ji, Rong; Reddy, P J; Shahabuddin, Syed; Litvin, Judith; Rogers, Thomas J; Kelsen, Steven G
2006-05-01
We recently demonstrated that human bronchial epithelial cells (HBEC) constitutively express the CXC chemokine receptor CXCR3, which when activated, induces directed cell migration. The present study in HBEC examined the relative expression of the CXCR3 splice variants CXCR3-A and -B, cell cycle dependence of CXCR3 expression, and the effects of the CXCR3 ligand, the interferon-gamma-inducible CXC chemokine I-TAC/CXCL11, on DNA synthesis and cell proliferation. Both CXCR3-A and -B mRNA, assessed by real-time RT-PCR, were expressed in normal HBEC (NHBEC) and the HBEC line 16-HBE. However, CXCR3-B mRNA was 39- and 6-fold greater than CXCR3-A mRNA in NHBEC and 16-HBE, respectively. Although most HBEC (>80%) assessed by flow cytometry and immunofluorescence microscopy contained intracellular CXCR3, only a minority (75%) were in the S + G(2)/M phases of the cell cycle. Stimulation of CXCR3 with I-TAC enhanced thymidine incorporation and cell proliferation and increased p38 and ERK1/2 phosphorylation. These data indicate that 1) human airway epithelial cells primarily express CXCR3-B mRNA, 2) surface expression of CXCR3 is largely confined to the S + G(2)/M phases of the cell cycle, and 3) activation of CXCR3 induces DNA synthesis, cell proliferation, and activation of MAPK pathways. We speculate that activation of CXCR3 exerts a mitogenic effect in HBEC, which may be important during airway mucosal injury in obstructive airway diseases such as asthma and chronic obstructive pulmonary disease.
Directory of Open Access Journals (Sweden)
Shan-Ming Lu
2017-10-01
Full Text Available Objective: To study the correlation of Slug gene expression with lymph node metastasis and invasion molecule expression in oral squamous cell carcinoma tissue. Methods: Oral squamous cell carcinoma tissue surgical removed in Affiliated Stomatological Hospital of Nanjing Medical University between March 2015 and April 2017 was selected and divided into the oral squamous cell carcinoma tissue with neck lymph node metastasis and the oral squamous cell carcinoma tissues without lymph node metastasis according to the condition of lymph node metastasis. The expression of Slug, epithelial-mesenchymal transition molecules and invasion molecules in the oral squamous cell carcinoma tissue were detected. Results: Slug, N-cadherin, Vimentin, CD147, OPN, GRP78, SDF-1 and CXCR4 protein expression in oral squamous cell carcinoma tissue with neck lymph node metastasis were significantly higher than those in oral squamous cell carcinoma tissue without lymph node metastasis while E-cadherin, P120ctn and ZO-1 protein expression were significantly lower than those in oral squamous cell carcinoma tissue without lymph node metastasis; N-cadherin, Vimentin, CD147, OPN, GRP78, SDF-1 and CXCR4 protein expression in oral squamous cell carcinoma tissue with high Slug expression were significantly higher than those in oral squamous cell carcinoma tissue with low Slug expression while E-cadherin, P120ctn and ZO-1 protein expression were significantly lower than those in oral squamous cell carcinoma tissue with low Slug expression. Conclusion: The highly expressed Slug in oral squamous cell carcinoma tissue can promote the epithelial-mesenchymal transition and invasion of the cells to participate in the lymph node metastasis of tumor cells.
The effect of the colostral cells on gene expression of cytokines in cord blood cells.
Hrdý, Jiří; Novotná, Olga; Kocourková, Ingrid; Prokešová, Ludmila
2017-11-01
Beneficial effect of maternal milk is acknowledged, but there is still question whether maternal milk from allergic mother is as good as from healthy one. In our study, we have assayed the effect of cells from colostrum of healthy and allergic mothers on gene expression of cytokines in cord blood cells of newborns of healthy and allergic mothers. Cytokines typical for Th1 (IL-2, IFN-gamma), Th2 (IL-4, IL-13), Tregs (IL-10, TGF-beta), and IL-8 were followed. We were not able to detect significant influence of colostral cells on gene expression of cytokines in cord blood after 2-day coculture using Transwell system. There was no difference in gene expression of cytokines in nonstimulated cord blood cells of newborns of healthy and allergic mothers, but generally increased gene expression of cytokines except IL-10 and TGF-beta after polyclonal stimulation was detected in cord blood cells of children of allergic mothers. There was no difference in IL-10 expression in stimulated cord blood cells of children of healthy and allergic mothers. Gene expression of TGF-beta was even decreased in stimulated cord blood cells of children of allergic mothers in comparison to healthy ones. We have not observed difference in the capacity of colostral cells of healthy and allergic mothers to influence gene expression of cytokines in cord blood cells, but we have described difference in the reactivity of cord blood cells between children of allergic and healthy mothers.
UV-induced changes in cell cycle and gene expression within rabbit lens epithelial cells
Energy Technology Data Exchange (ETDEWEB)
Sidjanin, D. [Northern Illinois Univ., De Kalb, IL (United States). Dept. of Biological Sciences; Grdina, D. [Argonne National Lab., IL (United States); Woloschak, G.E. [Northern Illinois Univ., De Kalb, IL (United States). Dept. of Biological Sciences
1994-11-01
Damage to lens epithelial cells is a probable initiation process in cataract formation induced by ultraviolet radiation. These experiments investigated the ability of 254 nm radiation on cell cycle progression and gene expression in rabbit lens epithelial cell line N/N1003A. No changes in expression of c-fos, c-jun, alpha- tubulin, or vimentin was observed following UV exposure. Using flow cytometry, an accumulation of cells in G1/S phase of the cell cycle 1 hr following exposure. The observed changes in gene expression, especially the decreased histone transcripts reported here may play a role in UV induced inhibition of cell cycle progression.
Directory of Open Access Journals (Sweden)
Libermann Towia
2008-05-01
Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that
Murine cell glycolipids customization by modular expression of glycosyltransferases.
Cid, Emili; Yamamoto, Miyako; Buschbeck, Marcus; Yamamoto, Fumiichiro
2013-01-01
Functional analysis of glycolipids has been hampered by their complex nature and combinatorial expression in cells and tissues. We report an efficient and easy method to generate cells with specific glycolipids. In our proof of principle experiments we have demonstrated the customized expression of two relevant glycosphingolipids on murine fibroblasts, stage-specific embryonic antigen 3 (SSEA-3), a marker for stem cells, and Forssman glycolipid, a xenoantigen. Sets of genes encoding glycosyltansferases were transduced by viral infection followed by multi-color cell sorting based on coupled expression of fluorescent proteins.
Expression of uncoupling protein 1 in bovine muscle cells.
Abd Eldaim, M A; Hashimoto, O; Ohtsuki, H; Yamada, T; Murakami, M; Onda, K; Sato, R; Kanamori, Y; Qiao, Y; Tomonaga, S; Matsui, T; Funaba, M
2016-12-01
Uncoupling protein 1 (Ucp1) is predominantly expressed in brown/beige adipocytes in mammals. Although myogenic cells have been suggested to commit to a brown adipocyte lineage through the induction of Prdm16 expression, Prdm16 is also expressed in skeletal muscle. Thus, we examined expression of Ucp1 in bovine myogenic cells. Considering that Ucp1 is a principle molecule that induces energy expenditure in brown/beige adipocytes, expression of Ucp1 is not preferable in beef cattle because of potential decrease in energy (fattening) efficiency. The RT-PCR analyses revealed the expression of Ucp1 in the skeletal muscle of cattle; expression levels were markedly lower than those in the brown fat of calves. Immunohistochemical analyses showed that Ucp1 surrounded muscle fibers, but not adipocytes residing in skeletal muscle. Myosatellite cells cultured in myogenic medium showed an increase in the expression levels of myogenic regulatory factors ( levels were greater in cells after myogenic culture for 12 d than in those after myogenic culture for 6 d ( bovine skeletal muscle, which suggests the necessity for further studies on Ucp1-mediated energy expenditure in bovine skeletal muscle.
International Nuclear Information System (INIS)
Rubina, Kseniya A.; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I.; Poliakov, Alexei A.; Treshalina, Helena M.; Tkachuk, Vsevolod A.
2015-01-01
T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells
Energy Technology Data Exchange (ETDEWEB)
Rubina, Kseniya A., E-mail: rkseniya@mail.ru; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation); Poliakov, Alexei A. [Division of Developmental Neurobiology, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA (United Kingdom); Treshalina, Helena M. [Federal State Budgetary Scietific Institution «N.N. Blokhin Russian Cancer Research Center» (FSBSI “N.N.Blokhin RCRC”), Kashirskoe Shosse 24, Moscow 115478 (Russian Federation); Tkachuk, Vsevolod A. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation)
2015-07-21
T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.
Analysis of allelic expression patterns in clonal somatic cells by single-cell RNA-seq.
Reinius, Björn; Mold, Jeff E; Ramsköld, Daniel; Deng, Qiaolin; Johnsson, Per; Michaëlsson, Jakob; Frisén, Jonas; Sandberg, Rickard
2016-11-01
Cellular heterogeneity can emerge from the expression of only one parental allele. However, it has remained controversial whether, or to what degree, random monoallelic expression of autosomal genes (aRME) is mitotically inherited (clonal) or stochastic (dynamic) in somatic cells, particularly in vivo. Here we used allele-sensitive single-cell RNA-seq on clonal primary mouse fibroblasts and freshly isolated human CD8 + T cells to dissect clonal and dynamic monoallelic expression patterns. Dynamic aRME affected a considerable portion of the cells' transcriptomes, with levels dependent on the cells' transcriptional activity. Notably, clonal aRME was detected, but it was surprisingly scarce (aRME occurs transiently within individual cells, and patterns of aRME are thus primarily scattered throughout somatic cell populations rather than, as previously hypothesized, confined to patches of clonally related cells.
High expression of markers of apoptosis in Langerhans cell histiocytosis
DEFF Research Database (Denmark)
Petersen, Bodil Laub; Lundegaard, Pia Rengtved; Bank, M I
2003-01-01
53 and the number of cells in apoptosis detected with TUNEL. Langerhans cell histiocytosis cells showed strong expression of p53 and in some cases co-expression of Fas and Fas-L. The expression of Fas-L was significantly higher in infiltrates from patients with single-system disease. The actual...... number of pathological Langerhans cells in apoptosis as estimated by TUNEL was low. CONCLUSIONS: The low number of TUNEL-reactive cells can be explained by the rapid turnover of apoptotic cells in the tissue, not leaving the apoptotic cells long enough in the tissue to be detected. The co......-expression of Fas and Fas-L in some Langerhans cells can lead to an autocrine apoptotic shortcut, mediating the death of the double-positive cells. Our findings suggest that apoptosis mediated through the Fas/Fas-L pathway may contribute to the spontaneous regression of lesions in single-system disease. A delicate...
SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients
International Nuclear Information System (INIS)
Su, Z; Li, Z; Mamalui, M
2016-01-01
Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative
SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients
Energy Technology Data Exchange (ETDEWEB)
Su, Z; Li, Z [University of Florida, Jacksonville, FL (United States); Mamalui, M [University of Florida/Radiation Oncology, Jacksonville, FL (United States)
2016-06-15
Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative
Energy Technology Data Exchange (ETDEWEB)
Sontag, Ryan L.; Weber, Thomas J.
2012-05-04
In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediated toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.
Freedom of expression: cell-type-specific gene profiling.
Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H
2014-01-01
Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.
Song, Eun Ah; Lim, Joo Weon; Kim, Hyeyoung
2017-07-01
Cerulein pancreatitis mirrors human acute pancreatitis. In pancreatic acinar cells exposed to cerulein, reactive oxygen species (ROS) mediate inflammatory signaling by Janus kinase (JAK) 2/signal transducer and activator of transcription (STAT) 3, and cytokine induction. Docosahexaenoic acid (DHA) acts as an agonist of peroxisome proliferator activated receptor γ (PPARγ), which mediates the expression of some antioxidant enzymes. We hypothesized that DHA may induce PPARγ-target catalase expression and reduce ROS levels, leading to the inhibition of JAK2/STAT3 activation and IL-6 expression in cerulein-stimulated acinar cells. Pancreatic acinar AR42J cells were treated with DHA in the presence or absence of the PPARγ antagonist GW9662, or treated with the PPARγ agonist troglitazone, and then stimulated with cerulein. Expression of IL-6 and catalase, ROS levels, JAK2/STAT3 activation, and nuclear translocation of PPARγ were assessed. DHA suppressed the increase in ROS, JAK2/STAT3 activation, and IL-6 expression induced nuclear translocation of PPARγ and catalase expression in cerulein-stimulated AR42J cells. Troglitazone inhibited the cerulein-induced increase in ROS and IL-6 expression, but induced catalase expression similar to DHA in AR42J cells. GW9662 abolished the inhibitory effect of DHA on cerulein-induced increase in ROS and IL-6 expression in AR42J cells. DHA-induced expression of catalase was suppressed by GW9662 in cerulein-stimulated AR42J cells. Thus, DHA induces PPARγ activation and catalase expression, which inhibits ROS-mediated activation of JAK2/STAT3 and IL-6 expression in cerulein-stimulated pancreatic acinar cells. Copyright © 2017. Published by Elsevier Ltd.
Cell adhesion signaling regulates RANK expression in osteoclast precursors.
Directory of Open Access Journals (Sweden)
Ayako Mochizuki
Full Text Available Cells with monocyte/macrophage lineage expressing receptor activator of NF-κB (RANK differentiate into osteoclasts following stimulation with the RANK ligand (RANKL. Cell adhesion signaling is also required for osteoclast differentiation from precursors. However, details of the mechanism by which cell adhesion signals induce osteoclast differentiation have not been fully elucidated. To investigate the participation of cell adhesion signaling in osteoclast differentiation, mouse bone marrow-derived macrophages (BMMs were used as osteoclast precursors, and cultured on either plastic cell culture dishes (adherent condition or the top surface of semisolid methylcellulose gel loaded in culture tubes (non-adherent condition. BMMs cultured under the adherent condition differentiated into osteoclasts in response to RANKL stimulation. However, under the non-adherent condition, the efficiency of osteoclast differentiation was markedly reduced even in the presence of RANKL. These BMMs retained macrophage characteristics including phagocytic function and gene expression profile. Lipopolysaccharide (LPS and tumor necrosis factor -αTNF-α activated the NF-κB-mediated signaling pathways under both the adherent and non-adherent conditions, while RANKL activated the pathways only under the adherent condition. BMMs highly expressed RANK mRNA and protein under the adherent condition as compared to the non-adherent condition. Also, BMMs transferred from the adherent to non-adherent condition showed downregulated RANK expression within 24 hours. In contrast, transferring those from the non-adherent to adherent condition significantly increased the level of RANK expression. Moreover, interruption of cell adhesion signaling by echistatin, an RGD-containing disintegrin, decreased RANK expression in BMMs, while forced expression of either RANK or TNFR-associated factor 6 (TRAF6 in BMMs induced their differentiation into osteoclasts even under the non
International Nuclear Information System (INIS)
Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw
2005-01-01
The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals
Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.
D'Amour, Kevin A; Bang, Anne G; Eliazer, Susan; Kelly, Olivia G; Agulnick, Alan D; Smart, Nora G; Moorman, Mark A; Kroon, Evert; Carpenter, Melissa K; Baetge, Emmanuel E
2006-11-01
Of paramount importance for the development of cell therapies to treat diabetes is the production of sufficient numbers of pancreatic endocrine cells that function similarly to primary islets. We have developed a differentiation process that converts human embryonic stem (hES) cells to endocrine cells capable of synthesizing the pancreatic hormones insulin, glucagon, somatostatin, pancreatic polypeptide and ghrelin. This process mimics in vivo pancreatic organogenesis by directing cells through stages resembling definitive endoderm, gut-tube endoderm, pancreatic endoderm and endocrine precursor--en route to cells that express endocrine hormones. The hES cell-derived insulin-expressing cells have an insulin content approaching that of adult islets. Similar to fetal beta-cells, they release C-peptide in response to multiple secretory stimuli, but only minimally to glucose. Production of these hES cell-derived endocrine cells may represent a critical step in the development of a renewable source of cells for diabetes cell therapy.
Energy Technology Data Exchange (ETDEWEB)
Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)
2011-02-10
The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable
Directory of Open Access Journals (Sweden)
Kseniya A. Rubina
2015-07-01
Full Text Available T-cadherin is a glycosyl-phosphatidylinositol (GPI anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.
Src Induces Podoplanin Expression to Promote Cell Migration*
Shen, Yongquan; Chen, Chen-Shan; Ichikawa, Hitoshi; Goldberg, Gary S.
2010-01-01
Nontransformed cells can force tumor cells to assume a normal morphology and phenotype by the process of contact normalization. Transformed cells must escape this process to become invasive and malignant. However, mechanisms underlying contact normalization have not been elucidated. Here, we have identified genes that are affected by contact normalization of Src-transformed cells. Tumor cells must migrate to become invasive and malignant. Src must phosphorylate the adaptor protein Cas (Crk-associated substrate) to promote tumor cell motility. We report here that Src utilizes Cas to induce podoplanin (Pdpn) expression to promote tumor cell migration. Pdpn is a membrane-bound extracellular glycoprotein that associates with endogenous ligands to promote tumor cell migration leading to cancer invasion and metastasis. In fact, Pdpn expression accounted for a major part of the increased migration seen in Src-transformed cells. Moreover, nontransformed cells suppressed Pdpn expression in adjacent Src-transformed cells. Of >39,000 genes, Pdpn was one of only 23 genes found to be induced by transforming Src activity and suppressed by contact normalization of Src-transformed cells. In addition, we found 16 genes suppressed by Src and induced by contact normalization. These genes encode growth factor receptors, adaptor proteins, and products that have not yet been annotated and may play important roles in tumor cell growth and migration. PMID:20123990
Expression of GABAergic receptors in mouse taste receptor cells.
Directory of Open Access Journals (Sweden)
Margaret R Starostik
Full Text Available BACKGROUND: Multiple excitatory neurotransmitters have been identified in the mammalian taste transduction, with few studies focused on inhibitory neurotransmitters. Since the synthetic enzyme glutamate decarboxylase (GAD for gamma-aminobutyric acid (GABA is expressed in a subset of mouse taste cells, we hypothesized that other components of the GABA signaling pathway are likely expressed in this system. GABA signaling is initiated by the activation of either ionotropic receptors (GABA(A and GABA(C or metabotropic receptors (GABA(B while it is terminated by the re-uptake of GABA through transporters (GATs. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcriptase-PCR (RT-PCR analysis, we investigated the expression of different GABA signaling molecules in the mouse taste system. Taste receptor cells (TRCs in the circumvallate papillae express multiple subunits of the GABA(A and GABA(B receptors as well as multiple GATs. Immunocytochemical analyses examined the distribution of the GABA machinery in the circumvallate papillae. Both GABA(A-and GABA(B- immunoreactivity were detected in the peripheral taste receptor cells. We also used transgenic mice that express green fluorescent protein (GFP in either the Type II taste cells, which can respond to bitter, sweet or umami taste stimuli, or in the Type III GAD67 expressing taste cells. Thus, we were able to identify that GABAergic receptors are expressed in some Type II and Type III taste cells. Mouse GAT4 labeling was concentrated in the cells surrounding the taste buds with a few positively labeled TRCs at the margins of the taste buds. CONCLUSIONS/SIGNIFICANCE: The presence of GABAergic receptors localized on Type II and Type III taste cells suggests that GABA is likely modulating evoked taste responses in the mouse taste bud.
Lineage relationship of prostate cancer cell types based on gene expression
Directory of Open Access Journals (Sweden)
Ware Carol B
2011-05-01
Full Text Available Abstract Background Prostate tumor heterogeneity is a major factor in disease management. Heterogeneity could be due to multiple cancer cell types with distinct gene expression. Of clinical importance is the so-called cancer stem cell type. Cell type-specific transcriptomes are used to examine lineage relationship among cancer cell types and their expression similarity to normal cell types including stem/progenitor cells. Methods Transcriptomes were determined by Affymetrix DNA array analysis for the following cell types. Putative prostate progenitor cell populations were characterized and isolated by expression of the membrane transporter ABCG2. Stem cells were represented by embryonic stem and embryonal carcinoma cells. The cancer cell types were Gleason pattern 3 (glandular histomorphology and pattern 4 (aglandular sorted from primary tumors, cultured prostate cancer cell lines originally established from metastatic lesions, xenografts LuCaP 35 (adenocarcinoma phenotype and LuCaP 49 (neuroendocrine/small cell carcinoma grown in mice. No detectable gene expression differences were detected among serial passages of the LuCaP xenografts. Results Based on transcriptomes, the different cancer cell types could be clustered into a luminal-like grouping and a non-luminal-like (also not basal-like grouping. The non-luminal-like types showed expression more similar to that of stem/progenitor cells than the luminal-like types. However, none showed expression of stem cell genes known to maintain stemness. Conclusions Non-luminal-like types are all representatives of aggressive disease, and this could be attributed to the similarity in overall gene expression to stem and progenitor cell types.
Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen
2015-01-01
The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027
Reduced Ang2 expression in aging endothelial cells
International Nuclear Information System (INIS)
Hohensinner, P.J.; Ebenbauer, B.; Kaun, C.; Maurer, G.; Huber, K.; Wojta, J.
2016-01-01
Aging endothelial cells are characterized by increased cell size, reduced telomere length and increased expression of proinflammatory cytokines. In addition, we describe here that aging reduces the migratory distance of endothelial cells. Furthermore, we observe an increase of the quiescence protein Ang1 and a decrease of the endothelial activation protein Ang2 upon aging. Supplementing Ang2 to aged endothelial cells restored their migratory capacity. We conclude that aging shifts the balance of the Ang1/Ang2 network favouring a quiescent state. Activation of endothelial cells in aging might be necessary to enhance wound healing capacities. -- Highlights: •Endothelial cells display signs of aging before reaching proliferative senescence. •Aging endothelial cells express more angiopoietin 1 and less angiopoietin 2 than young endothelial cells. •Migratory capacity is reduced in aging endothelial cells.
Reduced Ang2 expression in aging endothelial cells
Energy Technology Data Exchange (ETDEWEB)
Hohensinner, P.J., E-mail: philipp.hohensinner@meduniwien.ac.at [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ebenbauer, B. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); Kaun, C.; Maurer, G. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Huber, K. [Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); 3rd Medical Department, Wilhelminenhospital, Vienna (Austria); Sigmund Freud University, Medical Faculty, Vienna (Austria); Wojta, J. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); Core Facilities, Medical University of Vienna, Vienna (Austria)
2016-06-03
Aging endothelial cells are characterized by increased cell size, reduced telomere length and increased expression of proinflammatory cytokines. In addition, we describe here that aging reduces the migratory distance of endothelial cells. Furthermore, we observe an increase of the quiescence protein Ang1 and a decrease of the endothelial activation protein Ang2 upon aging. Supplementing Ang2 to aged endothelial cells restored their migratory capacity. We conclude that aging shifts the balance of the Ang1/Ang2 network favouring a quiescent state. Activation of endothelial cells in aging might be necessary to enhance wound healing capacities. -- Highlights: •Endothelial cells display signs of aging before reaching proliferative senescence. •Aging endothelial cells express more angiopoietin 1 and less angiopoietin 2 than young endothelial cells. •Migratory capacity is reduced in aging endothelial cells.
Increasing RpoS expression causes cell death in Borrelia burgdorferi.
Directory of Open Access Journals (Sweden)
Linxu Chen
Full Text Available RpoS, one of the two alternative σ factors in Borrelia burgdorferi, is tightly controlled by multiple regulators and, in turn, determines expression of many critical virulence factors. Here we show that increasing RpoS expression causes cell death. The immediate effect of increasing RpoS expression was to promote bacterial division and as a consequence result in a rapid increase in cell number before causing bacterial death. No DNA fragmentation or degradation was observed during this induced cell death. Cryo-electron microscopy showed induced cells first formed blebs, which were eventually released from dying cells. Apparently blebbing initiated cell disintegration leading to cell death. These findings led us to hypothesize that increasing RpoS expression triggers intracellular programs and/or pathways that cause spirochete death. The potential biological significance of induced cell death may help B. burgdorferi regulate its population to maintain its life cycle in nature.
Differential Effect of Medium on the Ratio of ICM/TE of Bovine Embryos in a Co-culture System
Directory of Open Access Journals (Sweden)
Mohsen Forouzanfar
2010-01-01
Full Text Available Background: This study was undertaken to investigate the efficiency of two differentembryo somatic cell co-culture conditions, tissue culture medium 199 (TCM199–vero cellsand Menezo B2 (B2-vero cells, for the in vitro developmental quantity and quality of bovineembryos.Materials and Methods: Bovine oocytes were allowed to mature and subsequently undergofertilization in vitro. Their presumptive zygotes were cultured in either TCM199 or B2 culturemedia in conjunction with vero cells for up to nine days. The culture media were refreshedevery two days and the proportion of embryos that cleaved and further developed to themorula and blastocyst (early, expand and hatched stages were recorded. Hatched blastocystsunderwent differential staining in order to determine the numbers of inner cell mass (ICMand tropho ectoderm (TE and total cell number (TCN.Results: Of the two groups, no significant difference was seen between the proportions ofthe presumptive zygotes cleaved, those which developed to 8-16 cells, morula and reacheddays 7or 8 blastocyst stage or hatched. However, the values for TCN and TE of the TCM199-vero embryos were significantly greater than those of B2-vero embryos. The values for ICM/TCN and ICM/TE were significantly greater in the B2-vero group versus the TCM199-verogroup.Conclusion: Both TCM199 and B2 culture media in conjunction with vero cells were ofthe same efficiency when used for in vitro development of bovine presumptive zygotes.However, TCM199 was superior in providing embryos with more embryo cell numbers,whereas B2 medium was superior in providing embryos with greater ICM/TE and ICM/TCN ratios.
Chemokine receptor expression by inflammatory T cells in EAE
DEFF Research Database (Denmark)
Mony, Jyothi Thyagabhavan; Khorooshi, Reza; Owens, Trevor
2014-01-01
Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS). The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS). The CCL20...... receptor CCR6 has been reported to be selectively expressed by CD4(+) T cells that produce the cytokine IL-17 (Th17 cells). Th17 cells and interferon-gamma (IFNγ)-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE). We have assessed...... whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4(+) T cells produced IFNγ in flow cytometric cytokine assays...
Dissecting stem cell differentiation using single cell expression profiling
Moignard, Victoria Rachel; Göttgens, Berthold
2016-01-01
Many assumptions about the way cells behave are based on analyses of populations. However, it is now widely recognized that even apparently pure populations can display a remarkable level of heterogeneity. This is particularly true in stem cell biology where it hinders our understanding of normal development and the development of strategies for regenerative medicine. Over the past decade technologies facilitating gene expression analysis at the single cell level have become widespread, provi...
Functional Expression of Programmed Death-Ligand 1 (B7-H1 by Immune Cells and Tumor Cells
Directory of Open Access Journals (Sweden)
Rachel M. Gibbons Johnson
2017-08-01
Full Text Available The programmed death-1 (PD-1 and its ligand PD-L1 (B7-H1 signaling pathway has been the focus of much enthusiasm in the fields of tumor immunology and oncology with recent FDA approval of the anti-PD-1 antibodies pembrolizumab and nivolumab and the anti-PD-L1 antibodies durvalumab, atezolimuab, and avelumab. These therapies, referred to here as PD-L1/PD-1 checkpoint blockade therapies, are designed to block the interaction between PD-L1, expressed by tumor cells, and PD-1, expressed by tumor-infiltrating CD8+ T cells, leading to enhanced antitumor CD8+ T cell responses and tumor regression. The influence of PD-L1 expressed by tumor cells on antitumor CD8+ T cell responses is well characterized, but the impact of PD-L1 expressed by immune cells has not been well defined for antitumor CD8+ T cell responses. Although PD-L1 expression by tumor cells has been used as a biomarker in selection of patients for PD-L1/PD-1 checkpoint blockade therapies, patients whose tumor cells lack PD-L1 expression often respond positively to PD-L1/PD-1 checkpoint blockade therapies. This suggests that PD-L1 expressed by non-malignant cells may also contribute to antitumor immunity. Here, we review the functions of PD-L1 expressed by immune cells in the context of CD8+ T cell priming, contraction, and differentiation into memory populations, as well as the role of PD-L1 expressed by tumor cells in regulating antitumor CD8+ T cell responses.
Expression of Cat Podoplanin in Feline Squamous Cell Carcinomas.
Itai, Shunsuke; Yamada, Shinji; Kaneko, Mika K; Harada, Hiroyuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2017-12-01
Oral squamous cell carcinoma is an aggressive tumor in cats; however, molecular-targeted therapies against this tumor, including antibody therapy, have not been developed. Sensitive and specific monoclonal antibodies (mAbs) against highly expressed membrane proteins are needed to develop antibody therapies. Podoplanin, a type I transmembrane glycoprotein, is expressed in many human malignant tumors, including brain tumor, esophageal cancer, lung cancer, mesothelioma, and oral cancer. Podoplanin binds to C-type lectin-like receptor-2 (CLEC-2) and activates platelet aggregation, which is involved in cancer metastasis. Until now, we have established several mAbs against podoplanin in humans, mice, rats, rabbits, dogs, cattle, and cats. We have reported podoplanin expression in canine melanoma and squamous cell carcinomas using an anti-dog podoplanin mAb PMab-38. In this study, we investigated podoplanin expression in 40 feline squamous cell carcinomas (14 cases of mouth floor, 13 of skin, 9 of ear, and 4 of tongue) by immunohistochemical analysis using an anti-cat podoplanin mAb PMab-52, which we recently developed by cell-based immunization and screening (CBIS) method. Of the total 40 cases, 38 (95%) showed positive staining for PMab-52. In particular, 12 cases (30%) showed a strong membrane-staining pattern of squamous cell carcinoma cells. PMab-52 can be useful for antibody therapy against feline podoplanin-expressing squamous cell carcinomas.
Transitional cell carcinoma express vitamin D receptors
DEFF Research Database (Denmark)
Hermann, G G; Andersen, C B
1997-01-01
Recently, vitamin D analogues have shown antineoplastic effect in several diseases. Vitamin D analogues exert its effect by interacting with the vitamin D receptor (VDR). Studies of VDR in transitional cell carcinoma (TCC) have not been reported. The purpose of the present study was therefore.......05). Similarly, also tumor grade appeared to be related to the number of cells expressing the receptor. Normal urothlium also expressed VDR but only with low intensity. Our study shows that TCC cells possess the VDR receptor which may make them capable to respond to stimulation with vitamin D, but functional...... studies of vitamin D's effect on TCC cells in vitro are necessary before the efficacy of treatment with vitamin D analogues in TCC can be evaluated in patients....
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Microarray gene expression profiling and analysis in renal cell carcinoma
Directory of Open Access Journals (Sweden)
Sadhukhan Provash
2004-06-01
Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most
Shi, Ming-Zhu; Xie, De-Yu
2011-04-01
We report metabolic engineering of Arabidopsis red cells and genome-wide gene expression analysis associated with anthocyanin biosynthesis and other metabolic pathways between red cells and wild-type (WT) cells. Red cells of A. thaliana were engineered for the first time from the leaves of production of anthocyanin pigment 1-Dominant (pap1-D). These red cells produced seven anthocyanin molecules including a new one that was characterized by LC-MS analysis. Wild-type cells established as a control did not produce anthocyanins. A genome-wide microarray analysis revealed that nearly 66 and 65% of genes in the genome were expressed in the red cells and wild-type cells, respectively. In comparison with the WT cells, 3.2% of expressed genes in the red cells were differentially expressed. The expression levels of 14 genes involved in the biosynthetic pathway of anthocyanin were significantly higher in the red cells than in the WT cells. Microarray and RT-PCR analyses demonstrated that the TTG1-GL3/TT8-PAP1 complex regulated the biosynthesis of anthocyanins. Furthermore, most of the genes with significant differential expression levels in the red cells versus the WT cells were characterized with diverse biochemical functions, many of which were mapped to different metabolic pathways (e.g., ribosomal protein biosynthesis, photosynthesis, glycolysis, glyoxylate metabolism, and plant secondary metabolisms) or organelles (e.g., chloroplast). We suggest that the difference in gene expression profiles between the two cell lines likely results from cell types, the overexpression of PAP1, and the high metabolic flux toward anthocyanins.
LENUS (Irish Health Repository)
Wall, P G
1996-02-02
We have reviewed all general outbreaks of infection due to Vero cytotoxin producing Escherichia coli (VTEC) O157 reported in England and Wales from 1992 to 1994. One hundred and seventy-three people were affected in 18 outbreaks, compared with 76 people in seven outbreaks in the preceding three years (1989 to 1991). Outbreaks occurred throughout England and Wales. Thirty-eight per cent of cases were admitted to hospital, 21% developed haemolytic uraemic syndrome, and 3% died. VTEC O157 infection causes particular concern because of its serious complications--haemorrhagic colitis and haemolytic uraemic syndrome, its capacity to spread from person to person as well as by food and water, and its reservoir in dairy and beef cattle.
Vicenti, Ilaria; Boccuto, Adele; Giannini, Alessia; Dragoni, Filippo; Saladini, Francesco; Zazzi, Maurizio
2018-01-15
A strong correlation between Zika virus (ZIKV) infection and severe neurological disease in newborns and occasionally adults has emerged in the Brazilian outbreak. Efficient human cell-based assays are required to test candidate inhibitors of ZIKV replication. The aim of this work was to investigate ZIKV propagation and quantification in different cell lines. The human (U87, A549, Huh7), mosquito (C6/36) and monkey (VERO E6) cell lines tested were all permissive to ZIKV infection. When assessed by plaque forming units (PFU) in three different target cell lines, the maximal production of ZIKV was achieved in Huh7 at day 3 post-infection (6.38±0.44 log 10 PFU/ml). The C6/36 cell line showed a low and slow production of virus when compared with other cell lines. A549 readout cells generated a larger number of plaques compared to Huh7 but not to VERO E6 cells. ZIKV PFU and RNA titers showed the highest correlation when Huh7 and A549 were used as the producer and readout cells, respectively. Also, U87 cells produced ZIKV RNA titers which were highly correlated with PFU independently from the readout cell line. Using the best virus-cell system, sofosbuvir and ribavirin EC 50 were 1.2μM and 1.1μM when measured through plaque assay, and 4.2μM and 5.2μM when measured by quantitative real time PCR (qRT-PCR), respectively. In summary, ZIKV can efficiently infect different human cell lines and rapidly reach peak viral titers. Overall, A549 cells appear to be as efficient as the VERO E6 gold standard for plaque assay allowing the use of human, rather than simian, cells for evaluating candidate anti-ZIKV compounds by the reference assay. The possibility to replace the labor-intensive plaque assay with the more rapid and easy-to-perform qRT-PCR is appealing and warrants further investigation. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Inada, Akari; Weir, Gordon C.; Bonner-Weir, Susan
2005-01-01
We have previously found that cyclin A expression is markedly reduced in pancreatic β-cells by cell-specific overexpression of repressor inducible cyclic AMP early repressor (ICER Iγ) in transgenic mice. Here we further examined regulatory effects of ICER Iγ on cyclin A gene expression using Min6 cells, an insulin-producing cell line. The cyclin A promoter luciferase assay showed that ICER Iγ directly repressed cyclin A gene transcription. In addition, upon ICER Iγ overexpression, cyclin A mRNA levels markedly decreased, thereby confirming an inhibitory effect of ICER Iγ on cyclin A expression. Suppression of cyclin A results in inhibition of BrdU incorporation. Under normal culture conditions endogenous cyclin A is abundant in these cells, whereas ICER is hardly detectable. However, serum starvation of Min6 cells induces ICER Iγ expression with a concomitant very low expression level of cyclin A. Cyclin A protein is not expressed unless the cells are in active DNA replication. These results indicate a potentially important anti-proliferative effect of ICER Iγ in pancreatic β cells. Since ICER Iγ is greatly increased in diabetes as well as in FFA- or high glucose-treated islets, this effect may in part exacerbate diabetes by limiting β-cell proliferation
Lalani, Aly-Khan A; Gray, Kathryn P; Albiges, Laurence; Callea, Marcella; Pignon, Jean-Christophe; Pal, Soumitro; Gupta, Mamta; Bhatt, Rupal S; McDermott, David F; Atkins, Michael B; Woude, G F Vande; Harshman, Lauren C; Choueiri, Toni K; Signoretti, Sabina
2017-11-28
In preclinical models, c-Met promotes survival of renal cancer cells through the regulation of programmed death-ligand 1 (PD-L1). However, this relationship in human clear cell renal cell carcinoma (ccRCC) is not well characterized. We evaluated c-Met expression in ccRCC patients using paired primary and metastatic samples and assessed the association with PD-L1 expression and other clinical features. Areas with predominant and highest Fuhrman nuclear grade (FNG) were selected. c-Met expression was evaluated by IHC using an anti-Met monoclonal antibody (MET4 Ab) and calculated by a combined score (CS, 0-300): intensity of c-Met staining (0-3) x % of positive cells (0-100). PD-L1 expression in tumor cells was previously assessed by IHC and PD-L1+ was defined as PD-L1 > 0% positive cells. Our cohort consisted of 45 pairs of primary and metastatic ccRCC samples. Overall, c-Met expression was higher in metastatic sites compared to primary sites (average c-Met CS: 55 vs. 28, p = 0.0003). Higher c-Met expression was associated with higher FNG (4 vs. 3) in primary tumors (average c-Met CS: 52 vs. 20, p = 0.04). c-Met expression was numerically greater in PD-L1+ vs. PD-L1- tumors. Higher c-Met expression in metastatic sites compared to primary tumors suggests that testing for biomarkers of response to c-Met inhibitors should be conducted in metastases. While higher c-Met expression in PD-L1+ tumors requires further investigation, it supports exploring these targets in combination clinical trials.
Defining the expression of marker genes in equine mesenchymal stromal cells
Directory of Open Access Journals (Sweden)
Deborah J Guest
2008-11-01
Full Text Available Deborah J Guest1, Jennifer C Ousey1, Matthew RW Smith21Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU; 2Reynolds House Referrals, Greenwood Ellis and Partners, 166 High Street, Newmarket, Suffolk, CB8 9WS, UKAbstract: Mesenchymal stromal (MS cells have been derived from multiple sources in the horse including bone marrow, adipose tissue and umbilical cord blood. To date these cells have been investigated for their differentiation potential and are currently being used to treat damage to horse musculoskeletal tissues. However, no work has been done in horse MS cells to examine the expression profile of proteins and cell surface antigens that are expressed in human MS cells. The identification of such profiles in the horse will allow the comparison of putative MS cells isolated from different laboratories and different tissues. At present it is difficult to ascertain whether equivalent cells are being used in different reports. Here, we report on the expression of a range of markers used to define human MS cells. Using immunocytochemistry we show that horse MS cells homogenously express collagens, alkaline phosphatase activity, CD44, CD90 and CD29. In contrast, CD14, CD79α and the embryonic stem cell markers Oct-4, SSEA (stage specific embryonic antigen -1, -3, -4, TRA (tumor rejection antigen -1–60 and -1–81 are not expressed. The MS cells also express MHC class I antigens but do not express class II antigens, although they are inducible by treatment with interferon gamma (IFN-γ.Keywords: mesenchymal stem cells, equine, gene expression
CD40 expression in Wehi-164 cell line
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad
2010-01-01
CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body’s defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein ex...
Iwasaki, Takeshi; Matsushita, Michiko; Nonaka, Daisuke; Nagata, Keiko; Kato, Masako; Kuwamoto, Satoshi; Murakami, Ichiro; Hayashi, Kazuhiko
2016-02-01
Merkel cell carcinoma (MCC) is a clinically aggressive neuroendocrine skin cancer; 80% of the cases are associated with the Merkel cell polyomavirus (MCPyV). We previously reported that MCPyV-negative MCCs have more irregular nuclei with abundant cytoplasm and significantly unfavorable outcomes than do MCPyV-positive MCCs. These results suggest that some cell adhesion or structural stabilization molecules are differently expressed depending on MCPyV infection status. Thus, we investigated the association of prognosis or MCPyV infection status in MCCs with cell adhesion molecule 1 (CADM1)/differentially expressed in adenocarcinoma of the lung protein 1 (DAL-1)/membrane protein, palmitoylated 3 (MPP3) tripartite complex and mal T-cell differentiation protein (MAL) expression, which play important roles in cell adhesion and oncogenesis and are related to cancer outcomes in various malignancies, to elucidate the role of these molecules. We analyzed the pathological and molecular characteristics of 26 MCPyV-positive and 15 MCPyV-negative MCCs. Univariate Cox regression analysis showed that advanced age (hazard ratio [HR], 8.249; P = .007) and high CADM1 expression (HR, 5.214; P = .012) were significantly unfavorable overall survival parameters, whereas MCPyV infection (HR, 0.043, P Merkel cells expressed DAL-1 and MAL but not CADM1. This study revealed that MCPyV-negative MCCs significantly expressed higher CADM1 and lower MAL than MCPyV-positive MCCs; these expression levels were markedly related to unfavorable outcomes. These data will give us important insights to develop novel molecular target therapies for MCCs. Copyright © 2015 Elsevier Inc. All rights reserved.
Expression pattern of matrix metalloproteinases in human gynecological cancer cell lines
International Nuclear Information System (INIS)
Schröpfer, Andrea; Kammerer, Ulrike; Kapp, Michaela; Dietl, Johannes; Feix, Sonja; Anacker, Jelena
2010-01-01
Matrix metalloproteinases (MMPs) are involved in the degradation of protein components of the extracellular matrix and thus play an important role in tumor invasion and metastasis. Their expression is related to the progression of gynecological cancers (e.g. endometrial, cervical or ovarian carcinoma). In this study we investigated the expression pattern of the 23 MMPs, currently known in humans, in different gynecological cancer cell lines. In total, cell lines from three endometrium carcinomas (Ishikawa, HEC-1-A, AN3 CA), three cervical carcinomas (HeLa, Caski, SiHa), three chorioncarcinomas (JEG, JAR, BeWo), two ovarian cancers (BG-1, OAW-42) and one teratocarcinoma (PA-1) were examined. The expression of MMPs was analyzed by RT-PCR, Western blot and gelatin zymography. We demonstrated that the cell lines examined can constitutively express a wide variety of MMPs on mRNA and protein level. While MMP-2, -11, -14 and -24 were widely expressed, no expression was seen for MMP-12, -16, -20, -25, -26, -27 in any of the cell lines. A broad range of 16 MMPs could be found in the PA1 cells and thus this cell line could be used as a positive control for general MMP experiments. While the three cervical cancer cell lines expressed 10-14 different MMPs, the median expression in endometrial and choriocarcinoma cells was 7 different enzymes. The two investigated ovarian cancer cell lines showed a distinctive difference in the number of expressed MMPs (2 vs. 10). Ishikawa, Caski, OAW-42 and BeWo cell lines could be the best choice for all future experiments on MMP regulation and their role in endometrial, cervical, ovarian or choriocarcinoma development, whereas the teratocarcinoma cell line PA1 could be used as a positive control for general MMP experiments
International Nuclear Information System (INIS)
Gehrau, Ricardo C.; D'Astolfo, Diego S.; Andreoli, Veronica; Bocco, Jose L.; Koritschoner, Nicolas P.
2011-01-01
The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC 50 ). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p 50 concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable marker for the efficiency of cell death upon cancer treatment.
Cell model for the study of receptor and regulatory functions of human proHB-EGF
Directory of Open Access Journals (Sweden)
N. V. Korotkevych
2014-08-01
Full Text Available Developing of new models and approaches, particularly with fluorescent techniques, for investigation of intracellular transport of proHB-EGF and its ligand-receptor complexes is strongly required. In order to create a model for studying proHB-EGF functions the genetic construction pEGFP-N1-proHB-EGF, encoding proHB-EGF-EGFP which is fluorescent-labeled form of proHB-EGF with enhanced green fluorescent protein EGFP in the cytoplasmic terminus of the molecule, was obtained. Eukaryotic cells expressing fusion protein proHB-EGF-EGFP on the cell surface were obtained by transfection with pEGFP-N1-proHB-EGF. Expressed in the Vero cells proHB-EGF-EGFP could bind fluorescent derivative of nontoxic receptor-binding subunit B of diphtheria toxin mCherry-SubB. After stimulation of transfected cells with TPA (12-O-Tetradecanoylphorbol-13-acetate, proHB-EGF-EGFP formed a fluorescentl-labeled C-terminal fragment of the molecule – CTF-EGFP. Thus, the obtained genetic construction pEGFP-N1-proHB-EGF could be helpful in visualization of molecules proHB-EGF and CTF in cells, may open new possibilities for the studying of their functions, such as receptor function of proHB-EGF for diphtheria toxin, intracellular translocation of CTF and provide possibilities for natural proHB-EGF ligands search.
High epitope expression levels increase competition between T cells.
Directory of Open Access Journals (Sweden)
Almut Scherer
2006-08-01
Full Text Available Both theoretical predictions and experimental findings suggest that T cell populations can compete with each other. There is some debate on whether T cells compete for aspecific stimuli, such as access to the surface on antigen-presenting cells (APCs or for specific stimuli, such as their cognate epitope ligand. We have developed an individual-based computer simulation model to study T cell competition. Our model shows that the expression level of foreign epitopes per APC determines whether T cell competition is mainly for specific or aspecific stimuli. Under low epitope expression, competition is mainly for the specific epitope stimuli, and, hence, different epitope-specific T cell populations coexist readily. However, if epitope expression levels are high, aspecific competition becomes more important. Such between-specificity competition can lead to competitive exclusion between different epitope-specific T cell populations. Our model allows us to delineate the circumstances that facilitate coexistence of T cells of different epitope specificity. Understanding mechanisms of T cell coexistence has important practical implications for immune therapies that require a broad immune response.
HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells.
Gornalusse, Germán G; Hirata, Roli K; Funk, Sarah E; Riolobos, Laura; Lopes, Vanda S; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G; Hanafi, Laïla-Aïcha; Clegg, Dennis O; Turtle, Cameron; Russell, David W
2017-08-01
Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this 'missing-self' response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8 + T cells, do not bind anti-HLA antibodies and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression.
HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells
Gornalusse, Germán G.; Hirata, Roli K.; Funk, Sarah; Riolobos, Laura; Lopes, Vanda S.; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G.; Hanafi, Laïla-Aïcha; Clegg, Dennis O.; Turtle, Cameron; Russell, David W.
2017-01-01
Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this ‘missing self’ response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8+ T cells, do not bind anti-HLA antibodies, and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression. PMID:28504668
Expression of Pluripotency Markers in Nonpluripotent Human Neural Stem and Progenitor Cells.
Vincent, Per Henrik; Benedikz, Eirikur; Uhlén, Per; Hovatta, Outi; Sundström, Erik
2017-06-15
Nonpluripotent neural progenitor cells (NPCs) derived from the human fetal central nervous system were found to express a number of messenger RNA (mRNA) species associated with pluripotency, such as NANOG, REX1, and OCT4. The expression was restricted to small subpopulations of NPCs. In contrast to pluripotent stem cells, there was no coexpression of the pluripotency-associated genes studied. Although the expression of these genes rapidly declined during the in vitro differentiation of NPCs, we found no evidence that the discrete expression was associated with the markers of multipotent neural stem cells (CD133 + /CD24 lo ), the capacity of sphere formation, or high cell proliferation rates. The rate of cell death among NPCs expressing pluripotency-associated genes was also similar to that of other NPCs. Live cell imaging showed that NANOG- and REX1-expressing NPCs continuously changed morphology, as did the nonexpressing cells. Depletion experiments showed that after the complete removal of the subpopulations of NANOG- and REX1-expressing NPCs, the expression of these genes appeared in other NPCs within a few days. The percentage of NANOG- and REX1-expressing cells returned to that observed before depletion. Our results are best explained by a model in which there is stochastic transient expression of pluripotency-associated genes in proliferating NPCs.
Spatial reconstruction of single-cell gene expression data.
Satija, Rahul; Farrell, Jeffrey A; Gennert, David; Schier, Alexander F; Regev, Aviv
2015-05-01
Spatial localization is a key determinant of cellular fate and behavior, but methods for spatially resolved, transcriptome-wide gene expression profiling across complex tissues are lacking. RNA staining methods assay only a small number of transcripts, whereas single-cell RNA-seq, which measures global gene expression, separates cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos and generated a transcriptome-wide map of spatial patterning. We confirmed Seurat's accuracy using several experimental approaches, then used the strategy to identify a set of archetypal expression patterns and spatial markers. Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems.
Protein Expression Analyses at the Single Cell Level
Directory of Open Access Journals (Sweden)
Masae Ohno
2014-09-01
Full Text Available The central dogma of molecular biology explains how genetic information is converted into its end product, proteins, which are responsible for the phenotypic state of the cell. Along with the protein type, the phenotypic state depends on the protein copy number. Therefore, quantification of the protein expression in a single cell is critical for quantitative characterization of the phenotypic states. Protein expression is typically a dynamic and stochastic phenomenon that cannot be well described by standard experimental methods. As an alternative, fluorescence imaging is being explored for the study of protein expression, because of its high sensitivity and high throughput. Here we review key recent progresses in fluorescence imaging-based methods and discuss their application to proteome analysis at the single cell level.
Matrix metalloproteinase-9 expression in folliculostellate cells of rat anterior pituitary gland.
Ilmiawati, Cimi; Horiguchi, Kotaro; Fujiwara, Ken; Yashiro, Takashi
2012-03-01
Folliculostellate (FS) cells of the anterior pituitary gland express a variety of regulatory molecules. Using transgenic rats that express green fluorescent protein specifically in FS cells, we recently demonstrated that FS cells in vitro showed marked changes in motility, proliferation, and that formation of cellular interconnections in the presence of laminin, a component of the extracellular matrix, closely resembled those observed in vivo. These findings suggested that FS cells express matrix metalloproteinase-9 (MMP-9), which assists their function on laminin. In the present study, we investigate MMP-9 expression in rat anterior pituitary gland and examine its role in motility and proliferation of FS cells on laminin. Immunohistochemistry, RT-PCR, immunoblotting, and gelatin zymography were performed to assess MMP-9 expression in the anterior pituitary gland and cultured FS cells. Real-time RT-PCR was used to quantify MMP-9 expression in cultured FS cells under different conditions and treatments. MMP-9 expression was inhibited by pharmacological inhibitor or downregulated by siRNA and time-lapse images were acquired. A 5-bromo-2'-deoxyuridine assay was performed to analyze the proliferation of FS cells. Our results showed that MMP-9 was expressed in FS cells, that this expression was upregulated by laminin, and that laminin induced MMP-9 secretion by FS cells. MMP-9 inhibition and downregulation did not impair FS motility; however, it did impair the capacity of FS cells to form interconnections and it significantly inhibited proliferation of FS cells on laminin. We conclude that MMP-9 is necessary in FS cell interconnection and proliferation in the presence of laminin.
Cholinergic regulation of VIP gene expression in human neuroblastoma cells
DEFF Research Database (Denmark)
Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan
1997-01-01
Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...
Expression profile of CREB knockdown in myeloid leukemia cells
International Nuclear Information System (INIS)
Pellegrini, Matteo; Cheng, Jerry C; Voutila, Jon; Judelson, Dejah; Taylor, Julie; Nelson, Stanley F; Sakamoto, Kathleen M
2008-01-01
The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line transduced with CREB shRNA. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. Decreased expression of specific histone genes was validated in K562, TF-1, and primary AML cells transduced with CREB shRNA. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. We speculate that regulation of histone genes may play an important role by possibly altering the regulation of DNA replication during the cell cycle
Ionizing radiation enhances immunogenicity of cells expressing a tumor-specific T-cell epitope
International Nuclear Information System (INIS)
Ciernik, Ilja F.; Romero, Pedro; Berzofsky, Jay A.; Carbone, David P.
1999-01-01
Background: p53 point mutations represent potential tumor-specific cytolytic T lymphocyte (CTL) epitopes. Whether ionizing radiation (IR) alters the immunological properties of cells expressing mutant p53 in respect of the CTL epitope generated by a defined point mutation has not been evaluated. Methods: Mutant p53-expressing syngeneic, nontumor forming BALB/c 3T3 fibroblasts, tumor forming ras-transfected BALB/c 3T3 sarcomas, and DBA/2-derived P815 mastocytoma cells, which differ at the level of minor histocompatibility antigens, were used as cellular vaccines. Cells were either injected with or without prior IR into naive BALB/c mice. Cellular cytotoxicity was assessed after secondary restimulation of effector spleen cells in vitro. Results: Injection of P815 mastocytoma cells expressing the mutant p53 induced mutation-specific CTL in BALB/c mice irrespective of prior irradiation. However, syngeneic fibroblasts or fibrosarcomas endogenously expressing mutant p53 were able to induce significant mutation-specific CTL only when irradiated prior to injection into BALB/c mice. IR of fibroblasts did not detectably alter the expression of cell surface molecules involved in immune response induction, nor did it alter the short-term in vitro viability of the fibroblasts. Interestingly, radioactively-labeled fibroblasts injected into mice after irradiation showed altered organ distribution, suggesting that the in vivo fate of these cells may play a crucial role in their immunogenicity. Conclusions: These findings indicate that IR can alter the immunogenicity of syngeneic normal as well as tumor forming fibroblasts in vivo, and support the view that ionizing radiation enhances immunogenicity of cellular tumor vaccines
Differential expression of cell adhesion genes
DEFF Research Database (Denmark)
Stein, Wilfred D; Litman, Thomas; Fojo, Tito
2005-01-01
that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...... in cell adhesion and the cytoskeleton. If the proteins involved in tethering cells to the extracellular matrix are important in conferring drug resistance, it may be possible to improve chemotherapy by designing drugs that target these proteins....
Jääskeläinen, Kirsi M; Plyusnina, Angelina; Lundkvist, Ake; Vaheri, Antti; Plyusnin, Alexander
2008-01-11
The competitiveness of two Tula hantavirus (TULV) isolates, TULV/Lodz and TULV/Moravia, was evaluated in interferon (IFN) -competent and IFN-deficient cells. The two isolates differ in the length of the open reading frame (ORF) encoding the nonstructural protein NSs, which has previously been shown to inhibit IFN response in infected cells. In IFN-deficient Vero E6 cells both TULV isolates survived equally well. In contrast, in IFN-competent MRC5 cells TULV/Lodz isolate, that possesses the NSs ORF for the full-length protein of 90 aa, survived for more consequent passages than TULV/Moravia isolate, which contains the ORF for truncated NSs protein (66-67 aa). Our data show that expression of a full-length NSs protein is beneficial for the virus survival and competitiveness in IFN-competent cells and not essential in IFN-deficient cells. These results suggest that the N-terminal aa residues are important for the full activity of the NSs protein.
Morvan, Maelig G; Champsaur, Marine; Reizis, Boris; Lanier, Lewis L
2017-05-01
To investigate how dendritic cells (DCs) interact with NK cells in vivo, we developed a novel mouse model in which Rae-1ε, a ligand of the NKG2D receptor, is expressed in cells with high levels of CD11c. In these CD11c-Rae1 mice, expression of Rae-1 was confirmed on all subsets of DCs and a small subset of B and T cells, but not on NK cells. DC numbers and activation status were unchanged, and NK cells in these CD11c-Rae1 mice presented the same Ly49 repertoire and maturation levels as their littermate wildtype controls. Early NK cell activation after mouse CMV infection was slightly lower than in wildtype mice, but NK cell expansion and viral control were comparable. Notably, we demonstrate that chronic interaction of NK cells with NKG2D ligand-expressing DCs leads to a reversible NKG2D down-modulation, as well as impaired NKG2D-dependent NK cell functions, including tumor rejection. In addition to generating a useful mouse model, our studies reveal in vivo the functional importance of the NK cell and DC cross-talk.
International Nuclear Information System (INIS)
Kobune, M; Iyama, S; Kikuchi, S; Horiguchi, H; Sato, T; Murase, K; Kawano, Y; Takada, K; Ono, K; Kamihara, Y; Hayashi, T; Miyanishi, K; Sato, Y; Takimoto, R; Kato, J
2012-01-01
Aberrant reactivation of hedgehog (Hh) signaling has been described in a wide variety of human cancers including cancer stem cells. However, involvement of the Hh-signaling system in the bone marrow (BM) microenvironment during the development of myeloid neoplasms is unknown. In this study, we assessed the expression of Hh-related genes in primary human CD34 + cells, CD34 + blastic cells and BM stromal cells. Both Indian Hh (Ihh) and its signal transducer, smoothened (SMO), were expressed in CD34 + acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS)-derived cells. However, Ihh expression was relatively low in BM stromal cells. Remarkably, expression of the intrinsic Hh-signaling inhibitor, human Hh-interacting protein (HHIP) in AML/MDS-derived stromal cells was markedly lower than in healthy donor-derived stromal cells. Moreover, HHIP expression levels in BM stromal cells highly correlated with their supporting activity for SMO + leukemic cells. Knockdown of HHIP gene in stromal cells increased their supporting activity although control cells marginally supported SMO + leukemic cell proliferation. The demethylating agent, 5-aza-2′-deoxycytidine rescued HHIP expression via demethylation of HHIP gene and reduced the leukemic cell-supporting activity of AML/MDS-derived stromal cells. This indicates that suppression of stromal HHIP could be associated with the proliferation of AML/MDS cells
The Expression Profiles of Lysophospholipid Receptors (LPLRs in Different Endothelial Cells
Directory of Open Access Journals (Sweden)
Yu-Wei Lee
2006-03-01
Full Text Available Sphingosine-1-phosphate (S1P and lysophosphatidic acid (LPA are two bioactive lysophospholipids (LPLs, stored primarily in platelets and released during platelet activation. Both LPLs are capable of regulating endothelial cell functions. The physiological functions of S1P and LPA are mediated by interacting with eight different G-protein coupled receptors: S1P1 through 5 and LPA1 through 3, which activate three different heterotrimeric GTP proteins-including Gi、Gq and G(12/13. The expression of LPL receptors in endothelial cells would affect the responses of S1P and LPA to these cells. There is no previous report discussing the expression profiles of LPL receptors in different endothelial cells from various species. In this study, we aim to investigate the expression profiles of S1P and LPA receptors in different endothelial cells isolated from human, rat, mouse and bovine origin. We used RT-PCR to determine LPLs receptors expression profiles in different endothelial cells. Our results indicated that endothelial cells from various species express different LPL receptors. Endothelial cells isolated from the same source of different species also had different LPLs receptors expression profiles. Therefore, different endothelial cells should respond to LPLs in different manners.
Nakayama, Shinichi; Monzen, Hajime; Onishi, Yuichi; Kaneshige, Soichiro; Kanno, Ikuo
2018-06-01
The purpose of this study was a dosimetric validation of the Vero4DRT for brain stereotactic radiotherapy (SRT) with extremely small fields calculated by the treatment planning system (TPS) iPlan (Ver.4.5.1; algorithm XVMC). Measured and calculated data (e.g. percentage depth dose [PDD], dose profile, and point dose) were compared for small square fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 using ionization chambers of 0.01 or 0.04 cm 3 and a diamond detector. Dose verifications were performed using an ionization chamber and radiochromic film (EBT3; the equivalent field sizes used were 8.2, 8.7, 8.9, 9.5, and 12.9 mm 2 ) for five brain SRT cases irradiated with dynamic conformal arcs. The PDDs and dose profiles for the measured and calculated data were in good agreement for fields larger than or equal to 10 × 10 mm 2 when an appropriate detector was chosen. The dose differences for point doses in fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 were +0.48%, +0.56%, -0.52%, and +11.2% respectively. In the dose verifications for the brain SRT plans, the mean dose difference between the calculated and measured doses were -0.35% (range, -0.94% to +0.47%), with the average pass rates for the gamma index under the 3%/2 mm criterion being 96.71%, 93.37%, and 97.58% for coronal, sagittal, and axial planes respectively. The Vero4DRT system provides accurate delivery of radiation dose for small fields larger than or equal to 10 × 10 mm 2 . Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.
Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin
2018-06-05
CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Juel, Helene Bæk; Faber, Carsten; Udsen, Maja
2012-01-01
Purpose. To investigate the effects of T-cell–derived cytokines on gene and protein expression of chemokines in a human RPE cell line (ARPE-19). Methods. We used an in vitro coculture system in which the RPE and CD3/CD28–activated T-cells were separated by a membrane. RPE cell expression of chemo......Purpose. To investigate the effects of T-cell–derived cytokines on gene and protein expression of chemokines in a human RPE cell line (ARPE-19). Methods. We used an in vitro coculture system in which the RPE and CD3/CD28–activated T-cells were separated by a membrane. RPE cell expression...
Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.
Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan
2014-02-01
Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.
Marín-Llera, Jessica Cristina; Chimal-Monroy, Jesús
2018-05-01
Skeletal progenitors are derived from resident limb bud mesenchymal cells of the vertebrate embryos. However, it remains poorly understood if they represent stem cells, progenitors, or multipotent mesenchymal stromal cells (MSC). Derived-MSC of different adult tissues under in vitro experimental conditions can differentiate into the same cellular lineages that are present in the limb. Here, comparing non-cultured versus cultured mesenchymal limb bud cells, we determined the expression of MSC-associated markers, the in vitro differentiation capacity and their gene expression profile. Results showed that in freshly isolated limb bud mesenchymal cells, the proportion of cells expressing Sca1, CD44, CD105, CD90, and CD73 is very low and a low expression of lineage-specific genes was observed. However, recently seeded limb bud mesenchymal cells acquired Sca1 and CD44 markers and the expression of the key differentiation genes Runx2 and Sox9, while Scx and Pparg genes decreased. Also, their chondrogenic differentiation capacity decreased through cellular passages while the osteogenic increased. Our findings suggest that the modification of the cell adhesion process through the in vitro method changed the limb mesenchymal cell immunophenotype leading to the expression and maintenance of common MSC-associated markers. These findings could have a significant impact on MSC study and isolation strategy because they could explain common variations observed in the MSC immunophenotype in different tissues. © 2018 International Federation for Cell Biology.
Podoplanin expression in oral potentially malignant disorders and oral squamous cell carcinoma.
A G, Deepa; Janardanan-Nair, Bindu; B R, Varun
2017-12-01
Podoplanin is a type I transmembrane sialomucin-like glycoprotein that is specifically expressed in lymphatic endothelial cells. Studies have shown that assessment of podoplanin expression in the epithelial cells can be used to predict the malignant transformation of potentially malignant disorders and the metastatic tendency of primary head and neck squamous cell carcinoma. The aim of our study was to compare the expression of podoplanin in oral leukoplakia, oral submucous fibrosis and oral squamous cell carcinoma with that in normal buccal mucosa by immunohistochemical methods. Immunohistochemical expression of podoplanin was analyzed in 20 cases each of oral leukoplakia, oral submucous fibrosis, oral squamous cell carcinoma and normal buccal mucosa, with monoclonal antibody D2-40. The expression of podoplanin was graded from grade 0-4. There was a statistically significant upregulation of the grades of podoplanin expression in oral squamous cell carcinoma(100%), oral submucous fibrosis (90%) and oral leukoplakia (65%) when compared to that in normal mucosa(35%). Podoplanin expression increased with decrease in grades of differentiation in oral squamous cell carcinoma . Podoplanin expression in the samples of oral submucous fibrosis was higher than that in oral leukoplakia. Evaluation of podoplanin expression in the epithelial cells of oral dysplastic lesions may provide valuable information to predict their risk of malignant transformation. Key words: Immunohistochemistry, Oral leukoplakia, Oral submucous fibrosis, Podoplanin, Squamous cell carcinoma.
Osteoprotegerin expression in triple-negative breast cancer cells promotes metastasis
International Nuclear Information System (INIS)
Weichhaus, Michael; Segaran, Prabu; Renaud, Ashleigh; Geerts, Dirk; Connelly, Linda
2014-01-01
Osteoprotegerin (OPG) is a secreted member of the tumor necrosis factor (TNF) receptor superfamily that has been well characterized as a negative regulator of bone remodeling. OPG is also expressed in human breast cancer tissues and cell lines. In vitro studies suggest that OPG exerts tumor-promoting effects by binding to TNF-related apoptosis inducing ligand (TRAIL), thereby preventing induction of apoptosis. However, the in vivo effect of OPG expression by primary breast tumors has not been characterized. We knocked down OPG expression in MDA-MB-231 and MDA-MB-436 human breast cancer cells using shRNA and siRNA to investigate impact on metastasis in the chick embryo model. We observed a reduction in metastasis with OPG knockdown cells. We found that lowering OPG expression did not alter sensitivity to TRAIL-induced apoptosis; however, the OPG knockdown cells had a reduced level of invasion. In association with this we observed reduced expression of the proteases Cathepsin D and Matrix Metalloproteinase-2 upon OPG knockdown, indicating that OPG may promote metastasis via modulation of protease expression and invasion. We conclude that OPG has a metastasis-promoting effect in breast cancer cells
Leukomogenic factors downregulate heparanase expression in acute myeloid leukemia cells
International Nuclear Information System (INIS)
Eshel, Rinat; Ben-Zaken, Olga; Vainas, Oded; Nadir, Yona; Minucci, Saverio; Polliack, Aaron; Naparstek, Ella; Vlodavsky, Israel; Katz, Ben-Zion
2005-01-01
Heparanase is a heparan sulfate-degrading endoglycosidase expressed by mature monocytes and myeloid cells, but not by immature hematopoietic progenitors. Heparanase gene expression is upregulated during differentiation of immature myeloid cells. PML-RARα and PLZF-RARα fusion gene products associated with acute promyelocytic leukemia abrogate myeloid differentiation and heparanase expression. AML-Eto, a translocation product associated with AML FAB M2, also downregulates heparanase gene expression. The common mechanism that underlines the activity of these three fusion gene products involves the recruitment of histone deacetylase complexes to specific locations within the DNA. We found that retinoic acid that dissociates PML-RARα from the DNA, and which is used to treat acute promyelocytic leukemia patients, restores heparanase expression to normal levels in an acute promyelocytic leukemia cell line. The retinoic acid effects were also observed in primary acute promyelocytic leukemia cells and in a retinoic acid-treated acute promyelocytic leukemia patient. Histone deacetylase inhibitor reverses the downregulation of heparanase expression induced by the AML-Eto fusion gene product in M2 type AML. In summary, we have characterized a link between leukomogenic factors and the downregulation of heparanase in myeloid leukemic cells
SCA-1 Expression Level Identifies Quiescent Hematopoietic Stem and Progenitor Cells
Directory of Open Access Journals (Sweden)
Mina N.F. Morcos
2017-06-01
Full Text Available Blood cell generation depends on continuous cellular output by the sequential hierarchy of hematopoietic stem cell (HSC and progenitor populations that all contain quiescent and actively cycling cells. Hematopoietic stem and progenitor cells (HSPCs express the surface molecule Stem cell antigen 1 (SCA-1/LY6A. Using histone 2B-red fluorescent fusion protein label retention and cell-cycle reporter mice, we demonstrate that high SCA-1 expression (SCA-1hi identifies not only quiescent HSCs but quiescent cells on all hierarchical levels within the lineage−SCA-1+KIT+ (LSK population. Each transplanted SCA-1hi HSPC population also displayed self-renewal potential superior to that of the respective SCA-1lo population. SCA-1 expression is inducible by type I interferon (IFN. We show, however, that quiescence and high self-renewal capacity of cells with brighter SCA-1 expression at steady state were independent of type I IFN signaling. We conclude that SCA-1 expression levels can be used to prospectively isolate functionally heterogeneous HSPC subpopulations.
Expression of Podoplanin in the Mouse Tooth Germ and Apical Bud Cells
Sawa, Yoshihiko; Iwasawa, Kana; Ishikawa, Hiroyuki
2008-01-01
This study was designed to investigate the distribution of cells expressing podoplanin in the mouse tooth bud. Podoplanin expression was detected in enamel epithelia of the cervical loop at cell-cell contacts strongly, and weakly on the loosely aggregated stellate reticulum in the center and the neighboring stratum intermedium. Odontoblasts exhibited intense podoplanin expression at the junction with predentin while no expression was detected in the enamel organ containing ameloblasts. These results suggest that proliferating inner and outer enamel epithelia express podoplanin but that the expression is suppressed in the differentiated epithelia containing ameloblasts. On the other hand the podoplanin expression occurs in the differentiating odontoblasts and the expression is sustained in differentiated odontoblasts, indicating that odontoblasts have the strong ability to express podoplanin. In cultured apical bud cells podoplanin was detected at cell-cell contacts. In real-time PCR analysis the amount of podoplanin mRNA of the apical buds was 2-fold compared with the amount of kidney used as a positive control. These findings indicate that apical bud cells have the strong ability to express the podoplanin gene. Podoplanin is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. The podoplanin may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. PMID:18989465
Langerin-expressing dendritic cells in gut-associated lymphoid tissues.
Chang, Sun-Young; Kweon, Mi-Na
2010-03-01
Dendritic cells (DCs) are key regulators of the immune system. They act as professional antigen-presenting cells and are capable of activating naive T cells and stimulating the growth and differentiation of B cells. According to their molecular expression, DCs can be divided into several subsets with different functions. We focus on DC subsets expressing langerin, a C-type lectin. Langerin expression is predominant in skin DCs, but langerin-expressing DCs also exist in mucosal tissue and can be induced by immunization and sometimes by nutrient deficiency. Topical transcutaneous immunization induces langerin(+)CD8 alpha(-) DCs in mesenteric lymph nodes (MLNs), which mediate the production of antigen-specific immunoglobulin A antibody in the intestine. Yet, in one recent study, langerin(+) DCs were generated in gut-associated lymphoid tissue and contributed to the suppressive intestinal immune environment in the absence of retinoic acid. In this review, we focus on the phenotypic and functional characteristics of langerin(+) DCs in the mucosal tissues, especially MLNs.
International Nuclear Information System (INIS)
Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D.
2004-01-01
Previous results indicated that the herpes simplex virus 1 (HSV-1) U L 31 gene is necessary and sufficient for localization of the U L 34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U L 31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U L 31 gene. The replication of the U L 31 deletion virus was restored on U L 31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U L 34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U L 34 protein localized at the nuclear membrane in rabbit skin cells, and U L 31 complementing CV1 cells infected with the U L 31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U L 34 protein to the nuclear membrane. We speculate that this function partially complements that of U L 31 and may explain why U L 31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells
International Nuclear Information System (INIS)
Dyberg, Cecilia; Papachristou, Panagiotis; Haug, Bjørn Helge; Lagercrantz, Hugo; Kogner, Per; Ringstedt, Thomas; Wickström, Malin; Johnsen, John Inge
2016-01-01
The non-canonical Wnt/Planar cell polarity (PCP) signaling pathway is a major player in cell migration during embryonal development and has recently been implicated in tumorigenesis. Transfections with cDNA plasmids or siRNA were used to increase and suppress Prickle1 and Vangl2 expression in neuroblastoma cells and in non-tumorigenic cells. Cell viability was measured by trypan blue exclusion and protein expression was determined with western blotting. Transcriptional activity was studied with luciferase reporter assay and mRNA expression with real-time RT-PCR. Immunofluorescence stainings were used to study the effects of Vangl2 overexpression in non-tumorigenic embryonic cells. Statistical significance was tested with t-test or one-way ANOVA. Here we show that high expression of the PCP core genes Prickle1 and Vangl2 is associated with low-risk neuroblastoma, suppression of neuroblastoma cell growth and decreased Wnt/β-catenin signaling. Inhibition of Rho-associated kinases (ROCKs) that are important in mediating non-canonical Wnt signaling resulted in increased expression of Prickle1 and inhibition of β-catenin activity in neuroblastoma cells. In contrast, overexpression of Vangl2 in MYC immortalized neural stem cells induced accumulation of active β-catenin and decreased the neural differentiation marker Tuj1. Similarly, genetically modified mice with forced overexpression of Vangl2 in nestin-positive cells showed decreased Tuj1 differentiation marker during embryonal development. Our experimental data demonstrate that high expression of Prickle1 and Vangl2 reduce the growth of neuroblastoma cells and indicate different roles of PCP proteins in tumorigenic cells compared to normal cells. These results suggest that the activity of the non-canonical Wnt/PCP signaling pathway is important for neuroblastoma development and that manipulation of the Wnt/PCP pathway provides a possible therapy for neuroblastoma. The online version of this article (doi:10.1186/s
International Nuclear Information System (INIS)
Petit, Chad M.; Melancon, Jeffrey M.; Chouljenko, Vladimir N.; Colgrove, Robin; Farzan, Michael; Knipe, David M.; Kousoulas, K.G.
2005-01-01
The SARS-coronavirus (SARS-CoV) is the etiological agent of severe acute respiratory syndrome (SARS). The SARS-CoV spike (S) glycoprotein mediates membrane fusion events during virus entry and virus-induced cell-to-cell fusion. To delineate functional domains of the SARS-CoV S glycoprotein, single point mutations, cluster-to-lysine and cluster-to-alanine mutations, as well as carboxyl-terminal truncations were investigated in transient expression experiments. Mutagenesis of either the coiled-coil domain of the S glycoprotein amino terminal heptad repeat, the predicted fusion peptide, or an adjacent but distinct region, severely compromised S-mediated cell-to-cell fusion, while intracellular transport and cell-surface expression were not adversely affected. Surprisingly, a carboxyl-terminal truncation of 17 amino acids substantially increased S glycoprotein-mediated cell-to-cell fusion suggesting that the terminal 17 amino acids regulated the S fusogenic properties. In contrast, truncation of 26 or 39 amino acids eliminating either one or both of the two endodomain cysteine-rich motifs, respectively, inhibited cell fusion in comparison to the wild-type S. The 17 and 26 amino-acid deletions did not adversely affect S cell-surface expression, while the 39 amino-acid truncation inhibited S cell-surface expression suggesting that the membrane proximal cysteine-rich motif plays an essential role in S cell-surface expression. Mutagenesis of the acidic amino-acid cluster in the carboxyl terminus of the S glycoprotein as well as modification of a predicted phosphorylation site within the acidic cluster revealed that this amino-acid motif may play a functional role in the retention of S at cell surfaces. This genetic analysis reveals that the SARS-CoV S glycoprotein contains extracellular domains that regulate cell fusion as well as distinct endodomains that function in intracellular transport, cell-surface expression, and cell fusion
Interdependence of cell growth and gene expression: origins and consequences.
Scott, Matthew; Gunderson, Carl W; Mateescu, Eduard M; Zhang, Zhongge; Hwa, Terence
2010-11-19
In bacteria, the rate of cell proliferation and the level of gene expression are intimately intertwined. Elucidating these relations is important both for understanding the physiological functions of endogenous genetic circuits and for designing robust synthetic systems. We describe a phenomenological study that reveals intrinsic constraints governing the allocation of resources toward protein synthesis and other aspects of cell growth. A theory incorporating these constraints can accurately predict how cell proliferation and gene expression affect one another, quantitatively accounting for the effect of translation-inhibiting antibiotics on gene expression and the effect of gratuitous protein expression on cell growth. The use of such empirical relations, analogous to phenomenological laws, may facilitate our understanding and manipulation of complex biological systems before underlying regulatory circuits are elucidated.
Zfp206 regulates ES cell gene expression and differentiation.
Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R
2006-01-01
Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.
Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S
2000-11-15
Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.
Ghaye, Aurélie P; Bergemann, David; Tarifeño-Saldivia, Estefania; Flasse, Lydie C; Von Berg, Virginie; Peers, Bernard; Voz, Marianne L; Manfroid, Isabelle
2015-09-02
In contrast to mammals, the zebrafish has the remarkable capacity to regenerate its pancreatic beta cells very efficiently. Understanding the mechanisms of regeneration in the zebrafish and the differences with mammals will be fundamental to discovering molecules able to stimulate the regeneration process in mammals. To identify the pancreatic cells able to give rise to new beta cells in the zebrafish, we generated new transgenic lines allowing the tracing of multipotent pancreatic progenitors and endocrine precursors. Using novel bacterial artificial chromosome transgenic nkx6.1 and ascl1b reporter lines, we established that nkx6.1-positive cells give rise to all the pancreatic cell types and ascl1b-positive cells give rise to all the endocrine cell types in the zebrafish embryo. These two genes are initially co-expressed in the pancreatic primordium and their domains segregate, not as a result of mutual repression, but through the opposite effects of Notch signaling, maintaining nkx6.1 expression while repressing ascl1b in progenitors. In the adult zebrafish, nkx6.1 expression persists exclusively in the ductal tree at the tip of which its expression coincides with Notch active signaling in centroacinar/terminal end duct cells. Tracing these cells reveals that they are able to differentiate into other ductal cells and into insulin-expressing cells in normal (non-diabetic) animals. This capacity of ductal cells to generate endocrine cells is supported by the detection of ascl1b in the nkx6.1:GFP ductal cell transcriptome. This transcriptome also reveals, besides actors of the Notch and Wnt pathways, several novel markers such as id2a. Finally, we show that beta cell ablation in the adult zebrafish triggers proliferation of ductal cells and their differentiation into insulin-expressing cells. We have shown that, in the zebrafish embryo, nkx6.1+ cells are bona fide multipotent pancreatic progenitors, while ascl1b+ cells represent committed endocrine precursors. In
International Nuclear Information System (INIS)
Vallian, S.; Chang, K.S.
2004-01-01
Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML
Control of CD56 expression and tumor cell cytotoxicity in human Vγ2Vδ2 T cells
Directory of Open Access Journals (Sweden)
Focaccetti Chiara
2009-09-01
Full Text Available Abstract Background In lymphocyte subsets, expression of CD56 (neural cell adhesion molecule-1 correlates with cytotoxic effector activity. For cells bearing the Vγ2Vδ2 T cell receptor, isoprenoid pyrophosphate stimulation leads to uniform activation and proliferation, but only a fraction of cells express CD56 and display potent cytotoxic activity against tumor cells. Our goal was to show whether CD56 expression was regulated stochastically, similar to conventional activation antigens, or whether CD56 defined a lineage of cells committed to the cytotoxic phenotype. Results Tracking individual cell clones defined by their Vγ2 chain CDR3 region sequences, we found that CD56 was expressed on precursor cytotoxic T cells already present in the population irrespective of their capacity to proliferate after antigen stimulation. Public T cell receptor sequences found in the CD56+ subset from one individual might appear in the CD56- subset of another donor. The commitment of individual clones to CD56+ or CD56- lineages was stable for each donor over a 1 year interval. Conclusion The ability to express CD56 was not predicted by TCR sequence or by the strength of signal received by the TCR. For γδ T cells, cytotoxic effector function is acquired when cytotoxic precursors within the population are stimulated to proliferate and express CD56. Expression of CD56 defines a committed lineage to the cytotoxic phenotype.
Directory of Open Access Journals (Sweden)
Biagosch J
2010-10-01
Full Text Available Abstract Resistance to cisplatin in the course of chemotherapy contributes to the poor prognosis of small cell lung cancer (SCLC. B cell lymphoma-2 is the founding member of a large family of proteins that either promote or inhibit apoptosis. We aimed at investigating if the pro-apoptotic members Bad, Bax, Bim and Bid are involved in cisplatin-resistance. Cisplatin-resistance in the SCLC cell line H1339 was induced by repetitive exposure to cisplatin. Protein expression was quantified by Western Blot and immuno-fluorescence analysis. Protein expression was altered using siRNA interference. Four "cycles" of 0.5 μg/ml cisplatin led to partial cisplatin-resistance in H1339 cells. The expression of Bad, Bim and Bid was comparable in naïve and resistant cells while the expression of Bax was reduced in the resistant clone. But, reducing Bax expression in naïve cells did not lead to altered cisplatin sensitivity neither in H1339 nor in H187 SCLC cells. We conclude that the reduced Bax expression after exposure to cisplatin is not sufficient to induce cis-platin-resistance in SCLC cells.
Nuclear hormone receptor expression in mouse kidney and renal cell lines.
Directory of Open Access Journals (Sweden)
Daisuke Ogawa
Full Text Available Nuclear hormone receptors (NHRs are transcription factors that regulate carbohydrate and lipid metabolism, immune responses, and inflammation. Although several NHRs, including peroxisome proliferator-activated receptor-γ (PPARγ and PPARα, demonstrate a renoprotective effect in the context of diabetic nephropathy (DN, the expression and role of other NHRs in the kidney are still unrecognized. To investigate potential roles of NHRs in the biology of the kidney, we used quantitative real-time polymerase chain reaction to profile the expression of all 49 members of the mouse NHR superfamily in mouse kidney tissue (C57BL/6 and db/m, and cell lines of mesangial (MES13, podocyte (MPC, proximal tubular epithelial (mProx24 and collecting duct (mIMCD3 origins in both normal and high-glucose conditions. In C57BL/6 mouse kidney cells, hepatocyte nuclear factor 4α, chicken ovalbumin upstream promoter transcription factor II (COUP-TFII and COUP-TFIII were highly expressed. During hyperglycemia, the expression of the NHR 4A subgroup including neuron-derived clone 77 (Nur77, nuclear receptor-related factor 1, and neuron-derived orphan receptor 1 significantly increased in diabetic C57BL/6 and db/db mice. In renal cell lines, PPARδ was highly expressed in mesangial and proximal tubular epithelial cells, while COUP-TFs were highly expressed in podocytes, proximal tubular epithelial cells, and collecting duct cells. High-glucose conditions increased the expression of Nur77 in mesangial and collecting duct cells, and liver x receptor α in podocytes. These data demonstrate NHR expression in mouse kidney cells and cultured renal cell lines and suggest potential therapeutic targets in the kidney for the treatment of DN.
Zhang, Ye; Rohde, Larry H.; Gridley, Daila S.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu
2009-01-01
Cellular responses to damages from ionizing radiation (IR) exposure are influenced not only by the genes involved in DNA double strand break (DSB) repair, but also by non- DSB repair genes. We demonstrated previously that suppressed expression of several non-DSB repair genes, such as XPA, elevated IR-induced cytogenetic damages. In the present study, we exposed human fibroblasts that were treated with control or XPA targeting siRNA to 250 MeV protons (0 to 4 Gy), and analyzed chromosome aberrations and expressions of genes involved in DNA repair. As expected, after proton irradiation, cells with suppressed expression of XPA showed a significantly elevated frequency of chromosome aberrations compared with control siRNA treated (CS) cells. Protons caused more severe DNA damages in XPA knock-down cells, as 36% cells contained multiple aberrations compared to 25% in CS cells after 4Gy proton irradiation. Comparison of gene expressions using the real-time PCR array technique revealed that expressions of p53 and its regulated genes in irradiated XPA suppressed cells were altered similarly as in CS cells, suggesting that the impairment of IR induced DNA repair in XPA suppressed cells is p53-independent. Except for XPA, which was more than 2 fold down regulated in XPA suppressed cells, several other DNA damage sensing and repair genes (GTSE1, RBBP8, RAD51, UNG and XRCC2) were shown a more than 1.5 fold difference between XPA knock-down cells and CS cells after proton exposure. The possible involvement of these genes in the impairment of DNA repair in XPA suppressed cells will be further investigated.
Horiguchi, Kotaro; Higuchi, Masashi; Yoshida, Saishu; Nakakura, Takashi; Tateno, Kozue; Hasegawa, Rumi; Takigami, Shu; Ohsako, Shunji; Kato, Takako; Kato, Yukio
2014-11-01
S100β-positive cells, which do not express the classical pituitary hormones, appear to possess multifunctional properties and are assumed to be heterogeneous in the anterior pituitary gland. The presence of several protein markers has shown that S100β-positive cells are composed of populations such as stem/progenitor cells, epithelial cells, astrocytes and dendritic cells. Recently, we succeeded in separating S100β-positive cells into round-cell (dendritic-cell-like) and process-cell types. We also found the characteristic expression of anti-inflammatory factors (interleukin-6, Il-6) and membrane receptors (integrin β-6) in the round type. Here, we further investigate the function of the subpopulation of S100β-positive cells. Since IL-6 is also a paracrine factor that regulates hormone producing-cells, we examine whether a correlation exists among extracellular acid stress, IL-6 and hormone production by using primary cultures of anterior pituitary cells. Dendritic-cell-like S100β-positive cells notably expressed Gpr68 (proton receptor) and Il-6. Furthermore, the expression of Il-6 and proopiomelanocortin (Pomc) was up-regulated by extracellular acidification. The functional role of IL-6 and GPR68 in the gene expression of Pomc during extracellular acidification was also examined. Small interfering RNA for Il-6 up-regulated Pomc expression and that for Gpr68 reversed the down-regulation of Il-6 and up-regulated Pomc expression by extracellular acidification. Thus, S100β-positive dendritic-like cells can sense an increase in extracellular protons via GPR68 and respond by the production of IL-6 in order to suppress the up-regulation of Pomc expression.
Induction of Ski Protein Expression upon Luteinization in Rat Granulosa Cells
Directory of Open Access Journals (Sweden)
Hyun Kim
2012-05-01
Full Text Available Ski protein is implicated in proliferation/differentiation in a variety of cells. We had previously reported that Ski protein is present in granulosa cells of atretic follicles, but not in preovulatory follicles, suggesting that Ski has a role in apoptosis of granulosa cells. The alternative fate of granulosa cells other than apoptosis is to differentiate to luteal cells; however, it is unknown whether Ski is expressed and has a role in granulosa cells undergoing luteinization. Thus, the aim of the present study was to locate Ski protein in the rat ovary during luteinizationto predict the possible role of Ski. In order to examine the expression pattern of Ski protein along with the progress of luteinization, follicular growth was induced by administration of equine chorionic gonadtropin to immature female rats, and luteinization was induced by human chorionic gonadtropin treatment to mimic luteinizing hormone (LH surge. While no Ski-positive granulosa cells were present in preovulatory follicle, Ski protein expression was induced in response to LH surge, and was maintained after the formation of the corpus luteum (CL. Though Ski protein is absent in granulosa cells of preovulatory follicle, its mRNA (c-Ski was expressed and the level was unchanged even after LH surge. Taken together, these results demonstrated that Ski protein expression is induced in granulosa cells upon luteinization, and suggests that its expression is regulated post-transcriptionally.
LENUS (Irish Health Repository)
Shields, Conor J
2012-02-03
BACKGROUND: Hypertonic saline infusion dampens inflammatory responses and suppresses neutrophil-endothelial interaction by reducing adhesion molecule expression. This study tested the hypothesis that hypertonic saline attenuates tumor cell adhesion to the endothelium through a similar mechanism. METHODS: Human colon cancer cells (LS174T) were transfected with green fluorescent protein and exposed to lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-6 under hypertonic and isotonic conditions for 1 and 4 hours. Confluent human umbilical vein endothelial cells were similarly exposed. Cellular apoptosis and expression of adhesion molecules and laminin were measured by flow cytometry. Tumor cell adhesion to endothelium and laminin was assessed with fluorescence microscopy. Data are represented as mean +\\/- standard error of mean, and an ANOVA test was performed to gauge statistical significance, with P <.05 considered significant. RESULTS: Hypertonic exposure significantly reduced tumor cell adhesion despite the presence of the perioperative cell stressors (42 +\\/- 2.9 vs 172.5 +\\/- 12.4, P <.05), attenuated tumor cell beta-1 integrin (14.43 vs 23.84, P <.05), and endothelial cell laminin expression (22.78 +\\/- 2.2 vs 33.74 +\\/- 2.4, P <.05), but did not significantly alter cell viability. CONCLUSION: Hypertonic saline significantly attenuates tumor cell adhesion to endothelium by inhibiting adhesion molecule and laminin expression. This may halt the metastatic behavior of tumor cells shed at surgery.
Differential expression of nanog1 and nanogp8 in colon cancer cells
International Nuclear Information System (INIS)
Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki; Nakagama, Hitoshi; Okamoto, Koji
2012-01-01
Highlights: ► Nanog is expressed in a majority of colon cancer cell lines examined. ► Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. ► Nanog mediates cell proliferation of colon cancer cells. ► Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.
Differential expression of nanog1 and nanogp8 in colon cancer cells
Energy Technology Data Exchange (ETDEWEB)
Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Nakagama, Hitoshi, E-mail: hnakagam@ncc.go.jp [Division of Cancer Development System, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Okamoto, Koji, E-mail: kojokamo@ncc.go.jo [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)
2012-02-10
Highlights: Black-Right-Pointing-Pointer Nanog is expressed in a majority of colon cancer cell lines examined. Black-Right-Pointing-Pointer Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. Black-Right-Pointing-Pointer Nanog mediates cell proliferation of colon cancer cells. Black-Right-Pointing-Pointer Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.
Real-Time Gene Expression Profiling of Live Shewanella Oneidensis Cells
Energy Technology Data Exchange (ETDEWEB)
Xiaoliang Sunney Xie
2009-03-30
The overall objective of this proposal is to make real-time observations of gene expression in live Shewanella oneidensis cells with high sensitivity and high throughput. Gene expression, a central process to all life, is stochastic because most genes often exist in one or two copies per cell. Although the central dogma of molecular biology has been proven beyond doubt, due to insufficient sensitivity, stochastic protein production has not been visualized in real time in an individual cell at the single-molecule level. We report the first direct observation of single protein molecules as they are generated, one at a time in a single live E. coli cell, yielding quantitative information about gene expression [Science 2006; 311: 1600-1603]. We demonstrated a general strategy for live-cell single-molecule measurements: detection by localization. It is difficult to detect single fluorescence protein molecules inside cytoplasm - their fluorescence is spread by fast diffusion to the entire cell and overwhelmed by the strong autofluorescence. We achieved single-molecule sensitivity by immobilizing the fluorescence protein on the cell membrane, where the diffusion is much slowed. We learned that under the repressed condition protein molecules are produced in bursts, with each burst originating from a stochastically-transcribed single messenger RNA molecule, and that protein copy numbers in the bursts follow a geometric distribution. We also simultaneously published a paper reporting a different method using β-glactosidase as a reporter [Nature 440, 358 (2006)]. Many important proteins are expressed at low levels, inaccessible by previous proteomic techniques. Both papers allowed quantification of protein expression with unprecedented sensitivity and received overwhelming acclaim from the scientific community. The Nature paper has been identified as one of the most-cited papers in the past year [http://esi-topics.com/]. We have also an analytical framework describing the
[Expression of embryonic markers in pterygium derived mesenchymal cells].
Pascual, G; Montes, M A; Pérez-Rico, C; Pérez-Kohler, B; Bellón, J M; Buján, J
2010-12-01
Destruction of the limbal epithelium barrier is the most important mechanism of pterygium formation (conjunctiva proliferation, encroaching onto the cornea). It is thought to arise from activated and proliferating limbal epithelial stem cells. The objective of this study is to evaluate the presence of undifferentiated mesenchymal cells (stem cells) in cultured cells extracted from human pterygium. Cells from 6 human pterygium were isolated by explantation and placed in cultures with amniomax medium. Once the monolayer was reached the cells were seeded onto 24 well microplates. The cells were studied in the second sub-culture. The immunohistochemical expression of different embryonic stem cell markers, OCT3/4 and CD9, was analysed. The differentiated phenotypes were characterised with the monoclonal antibodies anti-CD31, α-actin and vimentin. All the cell populations obtained from pterygium showed vimentin expression. Less than 1% of the cells were positive for CD31 and α-actin markers. The majority of the cell population was positive for OCT3/4 and CD9. The cell population obtained from pterygium expressed mesenchymal cell phenotype and embryonic markers, such us OCT3/4 and CD9. This undifferentiated population could be involved in the large recurrence rate of this type of tissue after surgery. Copyright © 2010 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.
Expression of E-cadherin and vimentin in oral squamous cell carcinoma
Zhou, Jingping; Tao, Detao; Xu, Qing; Gao, Zhenlin; Tang, Daofang
2015-01-01
The aim of the study is to determine the levels of E-cadherin, vimentin expression in tumor tissues from patients with oral squamous cell carcinoma (OSCC), and the relationship between the expression of E-cadherin, vimentin and epithelial-mesenchymal transition, in order to explore its values for predicting the invasion and metastasis of oral squamous cell carcinoma, short survival of patients in many types of cancer. E-cadherin and vimentin expression of 10 benign and 42 OSCC tumor tissues was examined by immunohistochemical staining. E-cadherin is positively expressed in normal oral mucosa epithelium, but vimentin expression is not found in normal oral mucosa epithelia; the E-cadherin and vimentin were expressed in 26 of 42 (61.9%) and 16 of 42 (38.1%), respectively. No statistically difference was found for E-cadherin and vimentin expression in patients with different age, gender and tumor location, E-cadherin and vimentin expression was significantly associated with lymph node metastasis and tissue location (P oral squamous cell carcinoma for E-cadherin and vimentin positive expression (P oral squamous cell carcinoma. Our study preliminarily confirmed that EMT phenomenon is existed during the development of oral squamous cell carcinoma. Co-evaluation of E-cadherin and vimentin might be a valuable tool for predicting OSCC patient outcome. PMID:26045832
International Nuclear Information System (INIS)
Anastassiou, Dimitris; Rumjantseva, Viktoria; Cheng, Weiyi; Huang, Jianzhong; Canoll, Peter D; Yamashiro, Darrell J; Kandel, Jessica J
2011-01-01
The biological mechanisms underlying cancer cell motility and invasiveness remain unclear, although it has been hypothesized that they involve some type of epithelial-mesenchymal transition (EMT). We used xenograft models of human cancer cells in immunocompromised mice, profiling the harvested tumors separately with species-specific probes and computationally analyzing the results. Here we show that human cancer cells express in vivo a precise multi-cancer invasion-associated gene expression signature that prominently includes many EMT markers, among them the transcription factor Slug, fibronectin, and α-SMA. We found that human, but not mouse, cells express the signature and Slug is the only upregulated EMT-inducing transcription factor. The signature is also present in samples from many publicly available cancer gene expression datasets, suggesting that it is produced by the cancer cells themselves in multiple cancer types, including nonepithelial cancers such as neuroblastoma. Furthermore, we found that the presence of the signature in human xenografted cells was associated with a downregulation of adipocyte markers in the mouse tissue adjacent to the invasive tumor, suggesting that the signature is triggered by contextual microenvironmental interactions when the cancer cells encounter adipocytes, as previously reported. The known, precise and consistent gene composition of this cancer mesenchymal transition signature, particularly when combined with simultaneous analysis of the adjacent microenvironment, provides unique opportunities for shedding light on the underlying mechanisms of cancer invasiveness as well as identifying potential diagnostic markers and targets for metastasis-inhibiting therapeutics
Directory of Open Access Journals (Sweden)
Danka Đevenica
2016-08-01
Full Text Available Objective(s: The aim of this study was to estimate effects of hyperbaric (HB treatment by determination of CD15s and CD11b leukocyte proinflammatory markers expression. In addition, this study describes changes in CD77 and CD34 expression on rat endothelial cells in renal, pulmonary and cardiac tissue following exposure to hyperbaric pressure. Materials and Methods:Expression of CD11b and CD15s on leukocytes, as well as CD77 and CD34 expression on endothelial cells in cell suspensions of renal, pulmonary and cardiac tissue in rats after hyperbaric treatment and in control rats were determined by flow cytometry. Results: Hyperbaric treatment significantly increased percentage of leukocytes expressing CD15s+CD11b- (from 1.71±1.11 to 23.42±2.85, P
Piprek, Rafal P; Kolasa, Michal; Podkowa, Dagmara; Kloc, Malgorzata; Kubiak, Jacek Z
2017-10-01
Unlike other organ anlagens, the primordial gonad is sexually bipotential in all animals. In mouse, the bipotential gonad differentiates into testis or ovary depending on the genetic sex (XY or XX) of the fetus. During gonad development cells segregate, depending on genetic sex, into distinct compartments: testis cords and interstitium form in XY gonad, and germ cell cysts and stroma in XX gonad. However, our knowledge of mechanisms governing gonadal sex differentiation remains very vague. Because it is known that adhesion molecules (CAMs) play a key role in organogenesis, we suspected that diversified expression of CAMs should also play a crucial role in gonad development. Using microarray analysis we identified 129 CAMs and factors regulating cell adhesion during sexual differentiation of mouse gonad. To identify genes expressed differentially in three cell lines in XY and XX gonads: i) supporting (Sertoli or follicular cells), ii) interstitial or stromal cells, and iii) germ cells, we used transgenic mice expressing EGFP reporter gene and FACS cell sorting. Although a large number of CAMs expressed ubiquitously, expression of certain genes was cell line- and genetic sex-specific. The sets of CAMs differentially expressed in supporting versus interstitial/stromal cells may be responsible for segregation of these two cell lines during gonadal development. There was also a significant difference in CAMs expression pattern between XY supporting (Sertoli) and XX supporting (follicular) cells but not between XY and XX germ cells. This indicates that differential CAMs expression pattern in the somatic cells but not in the germ line arbitrates structural organization of gonadal anlagen into testis or ovary. Copyright © 2017 Elsevier B.V. All rights reserved.
BRCA1-IRIS regulates cyclin D1 expression in breast cancer cells
International Nuclear Information System (INIS)
Nakuci, Enkeleda; Mahner, Sven; DiRenzo, James; ElShamy, Wael M.
2006-01-01
The regulator of cell cycle progression, cyclin D1, is up-regulated in breast cancer cells; its expression is, in part, dependent on ERα signaling. However, many ERα-negative tumors and tumor cell lines (e.g., SKBR3) also show over-expression of cyclin D1. This suggests that, in addition to ERα signaling, cyclin D1 expression is under the control of other signaling pathways; these pathways may even be over-expressed in the ERα-negative cells. We previously noticed that both ERα-positive and -negative cell lines over-express BRCA1-IRIS mRNA and protein. Furthermore, the level of over-expression of BRCA1-IRIS in ERα-negative cell lines even exceeded its over-expression level in ERα-positive cell lines. In this study, we show that: (1) BRCA1-IRIS forms complex with two of the nuclear receptor co-activators, namely, SRC1 and SRC3 (AIB1) in an ERα-independent manner. (2) BRCA1-IRIS alone, or in connection with co-activators, is recruited to the cyclin D1 promoter through its binding to c-Jun/AP1 complex; this binding activates the cyclin D1 expression. (3) Over-expression of BRCA1-IRIS in breast cells over-activates JNK/c-Jun; this leads to the induction of cyclin D1 expression and cellular proliferation. (4) BRCA1-IRIS activation of JNK/c-Jun/AP1 appears to account for this, because in cells that were depleted from BRCA1-IRIS, JNK remained inactive. However, depletion of SRC1 or SRC3 instead reduced c-Jun expression. Our data suggest that this novel signaling pathway links BRCA1-IRIS to cellular proliferation through c-Jun/AP1 nuclear pathway; finally, this culminates in the increased expression of the cyclin D1 gene
Expression of Pluripotency Markers in Nonpluripotent Human Neural Stem and Progenitor Cells
DEFF Research Database (Denmark)
Vincent, P.; Benedikz, Eirikur; Uhlén, Per
2017-01-01
Nonpluripotent neural progenitor cells (NPCs) derived from the human fetal central nervous system were found to express a number of messenger RNA (mRNA) species associated with pluripotency, such as NANOG, REX1, and OCT4. The expression was restricted to small subpopulations of NPCs. In contrast...... to pluripotent stem cells, there was no coexpression of the pluripotency-associated genes studied. Although the expression of these genes rapidly declined during the in vitro differentiation of NPCs, we found no evidence that the discrete expression was associated with the markers of multipotent neural stem...... cells (CD133+/CD24lo), the capacity of sphere formation, or high cell proliferation rates. The rate of cell death among NPCs expressing pluripotency-associated genes was also similar to that of other NPCs. Live cell imaging showed that NANOG- and REX1-expressing NPCs continuously changed morphology...
Mechanisms underlying differential expression of interleukin-8 in breast cancer cells
Freund, Ariane; Jolivel, Valérie; Durand, Sébastien; Kersual, Nathalie; Chalbos, Dany; Chavey, Carine; Vignon, Françoise; Lazennec, Gwendal
2004-01-01
We have recently reported that Interleukin-8 (IL-8) expression was inversely correlated to estrogen-receptor (ER)-status and was overexpressed in invasive breast cancer cells. In the present study, we show that IL-8 overexpression in breast cancer cells involves a higher transcriptional activity of IL-8 gene promoter. Cloning of IL-8 promoter from MDA-MB-231 and MCF-7 cells expressing high and low levels of IL-8, respectively, shows the integrity of the promoter in both cell lines. Deletion and site-directed mutagenesis of the promoter demonstrate that NF-κB and AP-1 and to a lesser extent C/EBP binding sites play a crucial role in the control of IL-8 promoter activity in MDA-MB-231 cells. Knock-down of NF-κB and AP-1 activities by adenovirus-mediated expression of a NF-κB super-repressor and RNA interference, respectively, decreased IL-8 expression in MDA-MB-231 cells. On the contrary, restoration of Fra-1, Fra-2, c-Jun, p50, p65, C/EBPα and C/EBPβ expression levels in MCF-7 cells led to a promoter activity comparable to that observed in MDA-MB-231 cells. Our data constitute the first extensive study of IL-8 gene overexpression in breast cancer cells and suggest that the high expression of IL-8 in invasive cancer cells requires a complex cooperation between NF-κB, AP-1 and C/EBP transcription factors. PMID:15208657
DEFF Research Database (Denmark)
Norrman, Karin; Strömbeck, Anna; Semb, Henrik
2013-01-01
for the three activin A based protocols applied. Our data provide novel insights in DE gene expression at the cellular level of in vitro differentiated human embryonic stem cells, and illustrate the power of using single-cell gene expression profiling to study differentiation heterogeneity and to characterize...... of anterior definitive endoderm (DE). Here, we differentiated human embryonic stem cells towards DE using three different activin A based treatments. Differentiation efficiencies were evaluated by gene expression profiling over time at cell population level. A panel of key markers was used to study DE...... formation. Final DE differentiation was also analyzed with immunocytochemistry and single-cell gene expression profiling. We found that cells treated with activin A in combination with sodium butyrate and B27 serum-free supplement medium generated the most mature DE cells. Cell population studies were...
Impact of cell culture process changes on endogenous retrovirus expression.
Brorson, Kurt; De Wit, Christina; Hamilton, Elizabeth; Mustafa, Mehnaz; Swann, Patrick G; Kiss, Robert; Taticek, Ron; Polastri, Gian; Stein, Kathryn E; Xu, Yuan
2002-11-05
Cell culture process changes (e.g., changes in scale, medium formulation, operational conditions) and cell line changes are common during the development life cycle of a therapeutic protein. To ensure that the impact of such process changes on product quality and safety is minimal, it is standard practice to compare critical product quality and safety attributes before and after the changes. One potential concern introduced by cell culture process improvements is the possibility of increased endogenous retrovirus expression to a level above the clearance capability of the subsequent purification process. To address this, retrovirus expression was measured in scaled down and full production scaled Chinese hamster ovary (CHO) cell cultures of four monoclonal antibodies and one recombinant protein before and after process changes. Two highly sensitive, quantitative (Q)-PCR-based assays were used to measure endogenous retroviruses. It is shown that cell culture process changes that primarily alter media components, nutrient feed volume, seed density, cell bank source (i.e., master cell bank vs. working cell bank), and vial size, or culture scale, singly or in combination, do not impact the rate of retrovirus expression to an extent greater than the variability of the Q-PCR assays (0.2-0.5 log(10)). Cell culture changes that significantly alter the metabolic state of the cells and/or rates of protein expression (e.g., pH and temperature shifts, NaButyrate addition) measurably impact the rate of retrovirus synthesis (up to 2 log(10)). The greatest degree of variation in endogenous retrovirus expression was observed between individual cell lines (up to 3 log(10)). These data support the practice of measuring endogenous retrovirus output for each new cell line introduced into manufacturing or after process changes that significantly increase product-specific productivity or alter the metabolic state, but suggest that reassessment of retrovirus expression after other
PAX2 regulates ADAM10 expression and mediates anchorage-independent cell growth of melanoma cells.
Directory of Open Access Journals (Sweden)
Sophia Boyoung Lee
Full Text Available PAX transcription factors play an important role during development and carcinogenesis. In this study, we investigated PAX2 protein levels in melanocytes and melanoma cells by Western Blot and immunofluorescence analysis and characterized the role of PAX2 in the pathogenesis of melanoma. In vitro we found weak PAX2 protein expression in keratinocytes and melanocytes. Compared to melanocytes increased PAX2 protein levels were detectable in melanoma cell lines. Interestingly, in tissue sections of melanoma patients nuclear PAX2 expression strongly correlated with nuclear atypia and the degree of prominent nucleoli, indicating an association of PAX2 with a more atypical cellular phenotype. In addition, with chromatin immunoprecipitation assay, PAX2 overexpression and PAX2 siRNA we present compelling evidence that PAX2 can regulate ADAM10 expression, a metalloproteinase known to play important roles in melanoma metastasis. In human tissue samples we found co-expression of PAX2 and ADAM10 in melanocytes of benign nevi and in melanoma cells of patients with malignant melanoma. Importantly, the downregulation of PAX2 by specific siRNA inhibited the anchorage independent cell growth and decreased the migratory and invasive capacity of melanoma cells. Furthermore, the downregulation of PAX2 abrogated the chemoresistance of melanoma cells against cisplatin, indicating that PAX2 expression mediates cell survival and plays important roles during melanoma progression.
Spatial reconstruction of single-cell gene expression
Satija, Rahul; Farrell, Jeffrey A.; Gennert, David; Schier, Alexander F.; Regev, Aviv
2015-01-01
Spatial localization is a key determinant of cellular fate and behavior, but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast, single-cell RNA-seq allows for deep profiling of cellular gene expression, but established methods separate cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos, inferring a transcriptome-wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches, and used it to identify a set of archetypal expression patterns and spatial markers. Additionally, Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. PMID:25867923
Expression of nicotinic acetylcholine receptors on human B-lymphoma cells
Directory of Open Access Journals (Sweden)
Skok M. V.
2009-12-01
Full Text Available Aim. To find a correlation between the level of nicotinic acetylcholine receptor (nAChR expression and B lymphocyte differentiation or activation state. Methods. Expression of nAChRs in the REH, Ramos and Daudi cell lines was studied by flow cytometry using nAChR subunit-specific antibodies; cell proliferation was studied by MTT test. Results. It is shown that the level of 42/4 and 7 nAChRs expression increased along with B lymphocyte differentiation (Ramos > REH and activation (Daudi > > Ramos and depended on the antigen-specific receptor expression. The nAChR stimulation/blockade did not influence the intensity of cell proliferation.
Directory of Open Access Journals (Sweden)
Verena Krähling
Full Text Available BACKGROUND: The fruit bat species Rousettus aegyptiacus was identified as a potential reservoir for the highly pathogenic filovirus Marburg virus. To establish a basis for a molecular understanding of the biology of filoviruses in the reservoir host, we have adapted a set of molecular tools for investigation of filovirus replication in a recently developed cell line, R06E, derived from the species Rousettus aegyptiacus. METHODOLOGY/PRINCIPAL FINDINGS: Upon infection with Ebola or Marburg viruses, R06E cells produced viral titers comparable to VeroE6 cells, as shown by TCID(50 analysis. Electron microscopic analysis of infected cells revealed morphological signs of filovirus infection as described for human- and monkey-derived cell lines. Using R06E cells, we detected an unusually high amount of intracellular viral proteins, which correlated with the accumulation of high numbers of filoviral nucleocapsids in the cytoplasm. We established protocols to produce Marburg infectious virus-like particles from R06E cells, which were then used to infect naïve target cells to investigate primary transcription. This was not possible with other cell lines previously tested. Moreover, we established protocols to reliably rescue recombinant Marburg viruses from R06E cells. CONCLUSION/SIGNIFICANCE: These data indicated that R06E cells are highly suitable to investigate the biology of filoviruses in cells derived from their presumed reservoir.
Resveratrol Represses Pokemon Expression in Human Glioma Cells.
Yang, Yutao; Cui, Jiajun; Xue, Feng; Overstreet, Anne-Marie; Zhan, Yiping; Shan, Dapeng; Li, Hui; Li, Hui; Wang, Yongjun; Zhang, Mengmeng; Yu, Chunjiang; Xu, Zhi-Qing David
2016-03-01
POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health. In this study, we investigated the role of Pokemon in RSV-induced biological effects and the effect of RSV on the expression of Pokemon in glioma cells. We found that overexpression of Pokemon decreased RSV-induced cell apoptosis, senescence, and anti-proliferative effects. Moreover, we showed that RSV could efficiently decrease the activity of the Pokemon promoter and the expression of Pokemon. Meanwhile, RSV also inhibited Sp1 DNA binding activity to the Pokemon promoter; whereas, it did not influence the expression and nuclear translocation of Sp1. In addition, we found that RSV could increase the recruitment of HDAC1, but decreased p300 to the Pokemon promoter. Taken together, all these results extended our understanding on the anti-cancer mechanism of RSV in glioma cells.
Expression of GARP selectively identifies activated human FOXP3+ regulatory T cells.
Wang, Rui; Kozhaya, Lina; Mercer, Frances; Khaitan, Alka; Fujii, Hodaka; Unutmaz, Derya
2009-08-11
The molecules that define human regulatory T cells (Tregs) phenotypically and functionally remain to be fully characterized. We recently showed that activated human Tregs express mRNA for a transmembrane protein called glycoprotein A repetitions predominant (GARP, or LRRC32). Here, using a GARP-specific mAb, we demonstrate that expression of GARP on activated Tregs correlates with their suppressive capacity. However, GARP was not induced on T cells activated in the presence of TGFbeta, which expressed high levels of FOXP3 and lacked suppressive function. Ectopic expression of FOXP3 in conventional T cells was also insufficient for induction of GARP expression in most donors. Functionally, silencing GARP in Tregs only moderately attenuated their suppressive activity. CD25+ T cells sorted for high GARP expression displayed more potent suppressive activity compared with CD25+GARP- cells. Remarkably, CD25+GARP- T cells expanded in culture contained 3-5 fold higher IL-17-secreting cells compared with either CD25+GARP+ or CD25-GARP- cells, suggesting that high GARP expression can potentially discriminate Tregs from those that have switched to Th17 lineage. We also determined whether GARP expression correlates with FOXP3-expressing T cells in human immunodeficiency virus (HIV) -infected subjects. A subset of HIV+ individuals with high percentages of FOXP3+ T cells did not show proportionate increase in GARP+ T cells. This finding suggests that higher FOXP3 levels observed in these HIV+ individuals is possibly due to immune activation rather than to an increase in Tregs. Our findings highlight the significance of GARP both in dissecting duality of Treg/Th17 cell differentiation and as a marker to identify bona fide Tregs during diseases with chronic immune activation.
Dynamic methylation and expression of Oct4 in early neural stem cells.
Lee, Shih-Han; Jeyapalan, Jennie N; Appleby, Vanessa; Mohamed Noor, Dzul Azri; Sottile, Virginie; Scotting, Paul J
2010-09-01
Neural stem cells are a multipotent population of tissue-specific stem cells with a broad but limited differentiation potential. However, recent studies have shown that over-expression of the pluripotency gene, Oct4, alone is sufficient to initiate a process by which these can form 'induced pluripotent stem cells' (iPS cells) with the same broad potential as embryonic stem cells. This led us to examine the expression of Oct4 in endogenous neural stem cells, as data regarding its expression in neural stem cells in vivo are contradictory and incomplete. In this study we have therefore analysed the expression of Oct4 and other genes associated with pluripotency throughout development of the mouse CNS and in neural stem cells grown in vitro. We find that Oct4 is still expressed in the CNS by E8.5, but that this expression declines rapidly until it is undetectable by E15.5. This decline is coincident with the gradual methylation of the Oct4 promoter and proximal enhancer. Immunostaining suggests that the Oct4 protein is predominantly cytoplasmic in location. We also found that neural stem cells from all ages expressed the pluripotency associated genes, Sox2, c-Myc, Klf4 and Nanog. These data provide an explanation for the varying behaviour of cells from the early neuroepithelium at different stages of development. The expression of these genes also provides an indication of why Oct4 alone is sufficient to induce iPS formation in neural stem cells at later stages.
Directory of Open Access Journals (Sweden)
Antonios Perdikaris
2009-03-01
Full Text Available A novel miniature cell biosensor detection system for the detection of Hepatis B virus (HBV-associated antigens and anti-HBV is described. The biosensor is based on “membrane-engineered” Vero fibroblast cells immobilized in an alginate matrix. The membrane-engineering process involved the electroinsertion of anti-HBV specific antibodies (anti-HBs, anti-HBe or antigens (HBsAg in the membranes of the Vero cells. The attachment of a homologous antigen to the electroinserted antibody (or, respectively, of the antibody to the electroinserted antigen triggered specific changes to the cell membrane potential that were measured by appropriate microelectrodes, according to the principle of the Bioelectric Recognition Assay (BERA. The sensor was used for screening 133 clinical blood serum samples according to a double-blind protocol. Considerably higher sensor responses were observed against HBV-positive samples, compared with responses against negative samples or samples positive for heterologous hepatitis viruses such as Hepatitis C (HCV virus. Detection of anti-HBs antibodies was made possible by using a biosensor based on immobilized Vero cells bearing the respective antigen (HBsAg. The observed response was rapid (45 sec and quite reproducible. Fluorescence microscopy observations showed that attachment of HBV particles to cells membrane-engineered with anti-HBs was associated with a decrease of [Ca2+]cyt. The perspectives for using the novel biosensor as a qualitative, rapid screening, high throughput assay for HBV antigens and anti-HBs in clinical samples is discussed.
Single-cell real-time imaging of transgene expression upon lipofection
Energy Technology Data Exchange (ETDEWEB)
Fiume, Giuseppe [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); Di Rienzo, Carmine [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); NEST, Scuola Normale Superiore and Istituto Nanoscienze-CNR, Piazza San Silvestro 12, 56127, Pisa (Italy); Marchetti, Laura [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); Pozzi, Daniela; Caracciolo, Giulio [Department of Molecular Medicine, “Sapienza” University of Rome, Viale Regina Elena 291, 00161, Rome (Italy); Cardarelli, Francesco, E-mail: francesco.cardarelli@iit.it [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy)
2016-05-20
Here we address the process of lipofection by quantifying the expression of a genetically-encoded fluorescent reporter at the single-cell level, and in real-time, by confocal imaging in live cells. The Lipofectamine gold-standard formulation is compared to the alternative promising DC-Chol/DOPE formulation. In both cases, we report that only dividing cells are able to produce a detectable amount of the fluorescent reporter protein. Notably, by measuring fluorescence over time in each pair of daughter cells, we find that Lipofectamine-based transfection statistically yields a remarkably higher degree of “symmetry” in protein expression between daughter cells as compared to DC-Chol/DOPE. A model is envisioned in which the degree of symmetry of protein expression is linked to the number of bioavailable DNA copies within the cell before nuclear breakdown. Reported results open new perspectives for the understanding of the lipofection mechanism and define a new experimental platform for the quantitative comparison of transfection reagents. -- Highlights: •The process of lipofection is followed by quantifying the transgene expression in real time. •The Lipofectamine gold-standard is compared to the promising DC-Chol/DOPE formulation. •We report that only dividing cells are able to produce the fluorescent reporter protein. •The degree of symmetry of protein expression in daughter cells is linked to DNA bioavailability. •A new experimental platform for the quantitative comparison of transfection reagents is proposed.
Single-cell real-time imaging of transgene expression upon lipofection
International Nuclear Information System (INIS)
Fiume, Giuseppe; Di Rienzo, Carmine; Marchetti, Laura; Pozzi, Daniela; Caracciolo, Giulio; Cardarelli, Francesco
2016-01-01
Here we address the process of lipofection by quantifying the expression of a genetically-encoded fluorescent reporter at the single-cell level, and in real-time, by confocal imaging in live cells. The Lipofectamine gold-standard formulation is compared to the alternative promising DC-Chol/DOPE formulation. In both cases, we report that only dividing cells are able to produce a detectable amount of the fluorescent reporter protein. Notably, by measuring fluorescence over time in each pair of daughter cells, we find that Lipofectamine-based transfection statistically yields a remarkably higher degree of “symmetry” in protein expression between daughter cells as compared to DC-Chol/DOPE. A model is envisioned in which the degree of symmetry of protein expression is linked to the number of bioavailable DNA copies within the cell before nuclear breakdown. Reported results open new perspectives for the understanding of the lipofection mechanism and define a new experimental platform for the quantitative comparison of transfection reagents. -- Highlights: •The process of lipofection is followed by quantifying the transgene expression in real time. •The Lipofectamine gold-standard is compared to the promising DC-Chol/DOPE formulation. •We report that only dividing cells are able to produce the fluorescent reporter protein. •The degree of symmetry of protein expression in daughter cells is linked to DNA bioavailability. •A new experimental platform for the quantitative comparison of transfection reagents is proposed.
HIV-1 induces DCIR expression in CD4+ T cells.
Directory of Open Access Journals (Sweden)
Alexandra A Lambert
2010-11-01
Full Text Available The C-type lectin receptor DCIR, which has been shown very recently to act as an attachment factor for HIV-1 in dendritic cells, is expressed predominantly on antigen-presenting cells. However, this concept was recently challenged by the discovery that DCIR can also be detected in CD4(+ T cells found in the synovial tissue from rheumatoid arthritis (RA patients. Given that RA and HIV-1 infections share common features such as a chronic inflammatory condition and polyclonal immune hyperactivation status, we hypothesized that HIV-1 could promote DCIR expression in CD4(+ T cells. We report here that HIV-1 drives DCIR expression in human primary CD4(+ T cells isolated from patients (from both aviremic/treated and viremic/treatment naive persons and cells acutely infected in vitro (seen in both virus-infected and uninfected cells. Soluble factors produced by virus-infected cells are responsible for the noticed DCIR up-regulation on uninfected cells. Infection studies with Vpr- or Nef-deleted viruses revealed that these two viral genes are not contributing to the mechanism of DCIR induction that is seen following acute infection of CD4(+ T cells with HIV-1. Moreover, we report that DCIR is linked to caspase-dependent (induced by a mitochondria-mediated generation of free radicals and -independent intrinsic apoptotic pathways (involving the death effector AIF. Finally, we demonstrate that the higher surface expression of DCIR in CD4(+ T cells is accompanied by an enhancement of virus attachment/entry, replication and transfer. This study shows for the first time that HIV-1 induces DCIR membrane expression in CD4(+ T cells, a process that might promote virus dissemination throughout the infected organism.
Park, Song Yi; Shin, Jee-Hye; Kee, Sun-Ho
2017-09-01
β-Catenin is a central player in Wnt signaling, and activation of Wnt signaling is associated with cancer development. E-cadherin in complex with β-catenin mediates cell-cell adhesion, which suppresses β-catenin-dependent Wnt signaling. Recently, a tumor-suppressive role for E-cadherin has been reconsidered, as re-expression of E-cadherin was reported to enhance the metastatic potential of malignant tumors. To explore the role of E-cadherin, we established an E-cadherin-expressing cell line, EC96, from AGS cells that featured undetectable E-cadherin expression and a high level of Wnt signaling. In EC96 cells, E-cadherin re-expression enhanced cell proliferation, although Wnt signaling activity was reduced. Subsequent analysis revealed that nuclear factor-κB (NF-κB) activation and consequent c-myc expression might be involved in E-cadherin expression-mediated cell proliferation. To facilitate rapid proliferation, EC96 cells enhance glucose uptake and produce ATP using both mitochondria oxidative phosphorylation and glycolysis, whereas AGS cells use these mechanisms less efficiently. These events appeared to be mediated by NF-κB activation. Therefore, E-cadherin re-expression and subsequent induction of NF-κB signaling likely enhance energy production and cell proliferation. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Regulated gene expression in cultured type II cells of adult human lung.
Ballard, Philip L; Lee, Jae W; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R; Fischer, Horst; Illek, Beate; Gonzales, Linda W; Kolla, Venkatadri; Matthay, Michael A
2010-07-01
Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at approximately 95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for approximately 4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of approximately 3% of probed genes by > or =1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (> or =10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells.
Tracking neuronal marker expression inside living differentiating cells using molecular beacons
DEFF Research Database (Denmark)
Ilieva, Mirolyuba; Della Vedova, Paolo; Hansen, Ole
2013-01-01
and tyrosine hydroxylase mRNAs were expressed 2 and 3 days post induction of differentiation, respectively. Oct 4 was not detected with MB in these cells and signal was not increased over time suggesting that MB are generally stable inside the cells. The gene expression changes measured using MBs were...... confirmed using qRT-PCR. These results suggest that MBs are simple to use sensors inside living cell, and particularly useful for studying dynamic gene expression in heterogeneous cell populations....
STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma
DEFF Research Database (Denmark)
Brender, C; Nielsen, M; Kaltoft, K
2001-01-01
) obtained from affected skin from a patient with mycosis fungoides (MF) and from peripheral blood from a patient with Sezary syndrome (SS). In contrast, constitutive SOCS-3 expression is not found in the leukemic Jurkat T-cell line, the MOLT-4 acute lymphoblastic leukemia cell line, and the monocytic......, it has been hypothesized that an aberrant SOCS expression plays a role in neoplastic transformation. This study reports on a constitutive SOCS-3 expression in cutaneous T-cell lymphoma (CTCL) cell lines. SOCS-3 protein is constitutively expressed in tumor cell lines (but not in nonmalignant T cells...... leukemic cell line U937. Expression of SOCS-3 coincides with a constitutive activation of STAT3 in CTCL tumor cells, and stable transfection of CTCL tumor cells with a dominant negative STAT3 strongly inhibits SOCS-3 expression, whereas transfection with wild-type STAT3 does not. Moreover, the reduced SOCS...
The regulation of CD5 expression in murine T cells
Directory of Open Access Journals (Sweden)
Herzenberg Leonard A
2001-05-01
Full Text Available Abstract Background CD5 is a pan-T cell surface marker that is also present on a subset of B cells, B-1a cells.Functional and developmental subsets of T cells express characteristic CD5 levels that vary over roughly a 30-fold range. Previous investigators have cloned a 1.7 Kb fragment containing the CD5 promoter and showed that it can confer similar lymphocyte-specific expression pattern as observed for endogenous CD5 expression. Results We further characterize the CD5 promoter and identify minimal and regulatory regions on the CD5 promoter. Using a luciferase reporter system, we show that a 43 bp region on the CD5 promoter regulates CD5 expression in resting mouse thymoma EL4 T cells and that an Ets binding site within the 43 bp region mediates the CD5 expression. In addition, we show that Ets-1, a member of the Ets family of transcription factors, recognizes the Ets binding site in the electrophoretic mobility shift assay (EMSA. This Ets binding site is directly responsible for the increase in reporter activity when co-transfected with increasing amounts of Ets-1 expression plasmid. We also identify two additional evolutionarily-conserved regions in the CD5 promoter (CD5X and CD5Y and demonstrate the respective roles of the each region in the regulation of CD5 transcription. Conclusion Our studies define a minimal and regulatory promoter for CD5 and show that the CD5 expression level in T cells is at least partially dependent on the level of Ets-1 protein. Based on the findings in this report, we propose a model of CD5 transcriptional regulation in T cells.
Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes
Energy Technology Data Exchange (ETDEWEB)
Aires, M.B. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, J.R.A. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Souza, K.S.; Farias, P.S. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, A.C.V. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Fioretto, E.T. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Maria, D.A. [Laboratório de Bioquímica e Biofísica, Instituto Butantan, São Paulo, SP (Brazil)
2015-07-10
The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers.
Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes
International Nuclear Information System (INIS)
Aires, M.B.; Santos, J.R.A.; Souza, K.S.; Farias, P.S.; Santos, A.C.V.; Fioretto, E.T.; Maria, D.A.
2015-01-01
The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers
Combs, Rodney G; Yu, Erwin; Roe, Susanna; Piatchek, Michele Bailey; Jones, Heather L; Mott, John; Kennard, Malcolm L; Goosney, Danika L; Monteith, Diane
2011-01-01
The artificial chromosome expression (ACE) technology system uses an engineered artificial chromosome containing multiple site-specific recombination acceptor sites for the rapid and efficient construction of stable cell lines. The construction of Chinese hamster ovary(CHO) cell lines expressing an IgG1 monoclonal antibody (MAb) using the ACE system has been previously described (Kennard et al., Biotechnol Bioeng. 2009;104:540-553). To further demonstrate the manufacturing feasibility of the ACE system, four CHO cell lines expressing the human IgG1 MAb 4A1 were evaluated in batch and fed-batch shake flasks and in a 2-L fed-batch bioreactor. The batch shake flasks achieved titers between 0.7 and 1.1 g/L, whereas the fed-batch shake flask process improved titers to 2.5–3.0 g/L. The lead 4A1 ACE cell line achieved titers of 4.0 g/L with an average specific productivity of 40 pg/(cell day) when cultured in a non optimized 2-L fed-batch bioreactor using a completely chemically defined process. Generational stability characterization of the lead 4A1-expressing cell line demonstrated that the cell line was stable for up to 75 days in culture. Product quality attributes of the 4A1 MAb produced by the ACE system during the stability evaluation period were unchanged and also comparable to existing expression technologies such as the CHO-dhfr system. The results of this evaluation demonstrate that a clonal, stable MAb-expressing CHO cell line can be produced using ACE technology that performs competitively using a chemically defined fed-batch bioreactor process with comparable product quality attributes to cell lines generated by existing technologies.
International Nuclear Information System (INIS)
Velcich, Anna; Corner, Georgia; Paul, Doru; Zhuang Min; Mariadason, John M.; Laboisse, Christian; Augenlicht, Leonard
2005-01-01
Several cell types are present in the intestinal epithelium that likely arise from a common precursor, the stem cell, and each mature cell type expresses a unique set of genes that characterizes its functional phenotype. Although the process of differentiation is intimately linked to the cessation of proliferation, the mechanisms that dictate intestinal cell fate determination are not well characterized. To investigate the reprogramming of gene expression during the cell lineage allocation/differentiation process, we took advantage of a unique system of two clonal derivatives of HT29 cells, Cl16E and Cl19A cells, which spontaneously differentiate as mucus producing goblet and chloride-secreting cells, respectively, as a function of time. By profiling gene expression, we found that these two cell lines show remarkably similar kinetics of change in gene expression and common clusters of coordinately regulated genes. This demonstrates that lineage-specific differentiation of intestinal epithelial cells is characterized overall by the sequential recruitment of functionally similar gene sets independent of the final phenotype of the mature cells
Genetic engineering of human NK cells to express CXCR2 improves migration to renal cell carcinoma.
Kremer, Veronika; Ligtenberg, Maarten A; Zendehdel, Rosa; Seitz, Christina; Duivenvoorden, Annet; Wennerberg, Erik; Colón, Eugenia; Scherman-Plogell, Ann-Helén; Lundqvist, Andreas
2017-09-19
Adoptive natural killer (NK) cell transfer is being increasingly used as cancer treatment. However, clinical responses have so far been limited to patients with hematological malignancies. A potential limiting factor in patients with solid tumors is defective homing of the infused NK cells to the tumor site. Chemokines regulate the migration of leukocytes expressing corresponding chemokine receptors. Various solid tumors, including renal cell carcinoma (RCC), readily secrete ligands for the chemokine receptor CXCR2. We hypothesize that infusion of NK cells expressing high levels of the CXCR2 chemokine receptor will result in increased influx of the transferred NK cells into tumors, and improved clinical outcome in patients with cancer. Blood and tumor biopsies from 14 primary RCC patients were assessed by flow cytometry and chemokine analysis. Primary NK cells were transduced with human CXCR2 using a retroviral system. CXCR2 receptor functionality was determined by Calcium flux and NK cell migration was evaluated in transwell assays. We detected higher concentrations of CXCR2 ligands in tumors compared with plasma of RCC patients. In addition, CXCL5 levels correlated with the intratumoral infiltration of CXCR2-positive NK cells. However, tumor-infiltrating NK cells from RCC patients expressed lower CXCR2 compared with peripheral blood NK cells. Moreover, healthy donor NK cells rapidly lost their CXCR2 expression upon in vitro culture and expansion. Genetic modification of human primary NK cells to re-express CXCR2 improved their ability to specifically migrate along a chemokine gradient of recombinant CXCR2 ligands or RCC tumor supernatants compared with controls. The enhanced trafficking resulted in increased killing of target cells. In addition, while their functionality remained unchanged compared with control NK cells, CXCR2-transduced NK cells obtained increased adhesion properties and formed more conjugates with target cells. To increase the success of NK
CD200-expressing human basal cell carcinoma cells initiate tumor growth.
Colmont, Chantal S; Benketah, Antisar; Reed, Simon H; Hawk, Nga V; Telford, William G; Ohyama, Manabu; Udey, Mark C; Yee, Carole L; Vogel, Jonathan C; Patel, Girish K
2013-01-22
Smoothened antagonists directly target the genetic basis of human basal cell carcinoma (BCC), the most common of all cancers. These drugs inhibit BCC growth, but they are not curative. Although BCC cells are monomorphic, immunofluorescence microscopy reveals a complex hierarchical pattern of growth with inward differentiation along hair follicle lineages. Most BCC cells express the transcription factor KLF4 and are committed to terminal differentiation. A small CD200(+) CD45(-) BCC subpopulation that represents 1.63 ± 1.11% of all BCC cells resides in small clusters at the tumor periphery. By using reproducible in vivo xenograft growth assays, we determined that tumor initiating cell frequencies approximate one per 1.5 million unsorted BCC cells. The CD200(+) CD45(-) BCC subpopulation recreated BCC tumor growth in vivo with typical histological architecture and expression of sonic hedgehog-regulated genes. Reproducible in vivo BCC growth was achieved with as few as 10,000 CD200(+) CD45(-) cells, representing ~1,500-fold enrichment. CD200(-) CD45(-) BCC cells were unable to form tumors. These findings establish a platform to study the effects of Smoothened antagonists on BCC tumor initiating cell and also suggest that currently available anti-CD200 therapy be considered, either as monotherapy or an adjunct to Smoothened antagonists, in the treatment of inoperable BCC.
Palovaara, J.P.J.
2017-01-01
SuperSeries contain expression data from the nuclei of cell types involved in patterning events, with focus on root apical stem cell formation, at 16-cell stage, early globular stage and late globular stage in the early Arabidopsis embryo (atlas). Expression data comparing nuclear and cellular RNA
Lack of FasL expression in cultured human retinal pigment epithelial cells
DEFF Research Database (Denmark)
Kaestel, C G; Madsen, H O; Prause, J U
2001-01-01
Retinal pigment epithelial (RPE) cells have been proposed to play a part in maintaining the eye as an immune privileged organ. However, our knowledge of the implicated mechanism is still sparse. Fas ligand (FasL) expression of RPE cells is generally recognized to be essential for the immune...... privilege of the eye, but due to contradictory published results, it is unclear whether RPE cells express this molecule. The purpose of this study was to investigate the expression of FasL in RPE cells in vitro and in vivo. Cultured human fetal and adult RPE cells were examined by flow cytometry, Western...... blotting, RT-PCR and RNase Protection assay for FasL expression. Additionally, sections of ocular tissue were stained for FasL by immunohistochemistry. None of the used methods indicated FasL expression in cultured fetal or adult RPE cells of various passages. However, RPE cells in vivo, as judged from...
A cell-based fluorescent assay to detect the activity of AB toxins that inhibit protein synthesis
AB-type protein toxins, produced by numerous bacterial pathogens and some plants, elicit a cytotoxic effect involving the inhibition of protein synthesis. To develop an improved method to detect the inhibition of protein synthesis by AB-type toxins, the present study characterized a Vero cell line t...
Paired Expression Analysis of Tumor Cell Surface Antigens
Directory of Open Access Journals (Sweden)
Rimas J. Orentas
2017-08-01
Full Text Available Adoptive immunotherapy with antibody-based therapy or with T cells transduced to express chimeric antigen receptors (CARs is useful to the extent that the cell surface membrane protein being targeted is not expressed on normal tissues. The most successful CAR-based (anti-CD19 or antibody-based therapy (anti-CD20 in hematologic malignancies has the side effect of eliminating the normal B cell compartment. Targeting solid tumors may not provide a similar expendable marker. Beyond antibody to Her2/NEU and EGFR, very few antibody-based and no CAR-based therapies have seen broad clinical application for solid tumors. To expand the way in which the surfaceome of solid tumors can be analyzed, we created an algorithm that defines the pairwise relative overexpression of surface antigens. This enables the development of specific immunotherapies that require the expression of two discrete antigens on the surface of the tumor target. This dyad analysis was facilitated by employing the Hotelling’s T-squared test (Hotelling–Lawley multivariate analysis of variance for two independent variables in comparison to a third constant entity (i.e., gene expression levels in normal tissues. We also present a unique consensus scoring mechanism for identifying transcripts that encode cell surface proteins. The unique application of our bioinformatics processing pipeline and statistical tools allowed us to compare the expression of two membrane protein targets as a pair, and to propose a new strategy based on implementing immunotherapies that require both antigens to be expressed on the tumor cell surface to trigger therapeutic effector mechanisms. Specifically, we found that, for MYCN amplified neuroblastoma, pairwise expression of ACVR2B or anaplastic lymphoma kinase (ALK with GFRA3, GFRA2, Cadherin 24, or with one another provided the strongest hits. For MYCN, non-amplified stage 4 neuroblastoma, neurotrophic tyrosine kinase 1, or ALK paired with GFRA2, GFRA3, SSK
International Nuclear Information System (INIS)
Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z
2014-01-01
Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ∼ 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/−0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/−1.1 is better than cone-based plan (5.32+/−1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets
Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines
DEFF Research Database (Denmark)
Damstrup, L; Rygaard, K; Spang-Thomsen, M
1992-01-01
of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...
Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming
2015-09-01
Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.
Methods of expressing and detecting activity of expansin in plant cells
Energy Technology Data Exchange (ETDEWEB)
Hood, Elizabeth E.; Yoon, Sangwoong
2017-10-10
A method of expressing heterologous expansin in a plant cell is provided where a nucleic acid molecule encoding expansin is introduced into the plant cell and in an embodiment is operably linked to a promoter preferentially expressing in the seed tissue of the plant, and in another embodiment is linked to a promoter preferentially expressing in the embryo tissue of the seed. An embodiment provides the nucleic acid molecule is operably linked to a second nucleic acid molecule that directs expression to the endoplasmic reticulum, vacuole or cell wall. Plants and plant parts expressing expansin are provided. An assay for detection of expansin activity is also provided.
Estrogen regulation of TRPM8 expression in breast cancer cells
International Nuclear Information System (INIS)
Chodon, Dechen; Guilbert, Arnaud; Dhennin-Duthille, Isabelle; Gautier, Mathieu; Telliez, Marie-Sophie; Sevestre, Henri; Ouadid-Ahidouch, Halima
2010-01-01
The calcium-permeable cation channel TRPM8 (melastatin-related transient receptor potential member 8) is over-expressed in several cancers. The present study aimed at investigating the expression, function and potential regulation of TRPM8 channels by ER alpha (estrogen receptor alpha) in breast cancer. RT-PCR, Western blot, immuno-histochemical, and siRNA techniques were used to investigate TRPM8 expression, its regulation by estrogen receptors, and its expression in breast tissue. To investigate the channel activity in MCF-7 cells, we used the whole cell patch clamp and the calcium imaging techniques. TRPM8 channels are expressed at both mRNA and protein levels in the breast cancer cell line MCF-7. Bath application of the potent TRPM8 agonist Icilin (20 μM) induced a strong outwardly rectifying current at depolarizing potentials, which is associated with an elevation of cytosolic calcium concentration, consistent with established TRPM8 channel properties. RT-PCR experiments revealed a decrease in TRPM8 mRNA expression following steroid deprivation for 48 and 72 hours. In steroid deprived medium, addition of 17-beta-estradiol (E 2 , 10 nM) increased both TRPM8 mRNA expression and the number of cells which respond to Icilin, but failed to affect the Ca 2+ entry amplitude. Moreover, silencing ERα mRNA expression with small interfering RNA reduced the expression of TRPM8. Immuno-histochemical examination of the expression of TRPM8 channels in human breast tissues revealed an over-expression of TRPM8 in breast adenocarcinomas, which is correlated with estrogen receptor positive (ER + ) status of the tumours. Taken together, these results show that TRPM8 channels are expressed and functional in breast cancer and that their expression is regulated by ER alpha
Zhang, Lingxin; Yang, Chen; Lewis, James S; El-Mofty, Samir K; Chernock, Rebecca D
2017-08-01
Follicular dendritic cell sarcoma is a rare mesenchymal neoplasm that most commonly occurs in cervical lymph nodes. It has histologic and clinical overlap with the much more common p16-positive human papillomavirus (HPV)-related squamous cell carcinoma of the oropharynx, which characteristically has nonkeratinizing morphology and often presents as an isolated neck mass. Not surprisingly, follicular dendritic cell sarcomas are commonly misdiagnosed as squamous cell carcinoma. Immunohistochemistry is helpful in separating the 2 entities. Follicular dendritic cell sarcoma expresses dendritic markers such as CD21 and CD23 and is almost always cytokeratin negative. However, in many cases of HPV-related oropharyngeal carcinoma, only p16 immunohistochemistry as a prognostic and surrogate marker for HPV is performed. p16 expression in follicular dendritic cell sarcoma has not been characterized. Here, we investigate the expression of p16 in follicular dendritic cell sarcoma and correlate it with retinoblastoma protein expression. A pilot study of dendritic marker expression in HPV-related oropharyngeal squamous cell carcinoma was also performed. We found that 4 of 8 sarcomas expressed p16 with strong and diffuse staining in 2 cases. In 2 of the 4 cases, p16 expression corresponded to loss of retinoblastoma protein expression. Dendritic marker expression (CD21 and CD23) was not found in HPV-related oropharyngeal squamous cell carcinomas. As such, positive p16 immunohistochemistry cannot be used as supportive evidence for the diagnosis of squamous cell carcinoma as strong and diffuse p16 expression may also occur in follicular dendritic cell sarcoma. Cytokeratins and dendritic markers are critical in separating the two tumor types. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
M J Pont
Full Text Available Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage-restricted expression as potential targets for immunotherapy of hematological cancers.
Directory of Open Access Journals (Sweden)
Jie Zhang
2011-01-01
Full Text Available Leukocyte adhesion to the vascular endothelium and subsequent transendothelial migration play essential roles in the pathogenesis of cardiovascular diseases such as atherosclerosis. The leukocyte adhesion is mediated by localized activation of the endothelium through the action of inflammatory cytokines. The exact proinflammatory factors, however, that activate the endothelium and their cellular sources remain incompletely defined.Using bone marrow-derived mast cells from wild-type, Tnf(-/-, Ifng(-/-, Il6(-/- mice, we demonstrated that all three of these pro-inflammatory cytokines from mast cells induced the expression of vascular cell adhesion molecule-1 (VCAM-1, intercellular adhesion molecule-1 (ICAM-1, P-selectin, and E-selectin in murine heart endothelial cells (MHEC at both mRNA and protein levels. Compared with TNF-α and IL6, IFN-γ appeared weaker in the induction of the mRNA levels, but at protein levels, both IL6 and IFN-γ were weaker inducers than TNF-α. Under physiological shear flow conditions, mast cell-derived TNF-α and IL6 were more potent than IFN-γ in activating MHEC and in promoting neutrophil adhesion. Similar observations were made when neutrophils or macrophages were used. Neutrophils and macrophages produced the same sets of pro-inflammatory cytokines as did mast cells to induce MHEC adhesion molecule expression, with the exception that macrophage-derived IFN-γ showed negligible effect in inducing VCAM-1 expression in MHEC.Mast cells, neutrophils, and macrophages release pro-inflammatory cytokines such as TNF-α, IFN-γ, and IL6 that induce expression of adhesion molecules in endothelium and recruit of leukocytes, which is essential to the pathogenesis of vascular inflammatory diseases.
Human amnion epithelial cells expressing HLA-G as novel cell-based treatment for liver disease.
Strom, Stephen C; Gramignoli, Roberto
2016-09-01
Despite routine liver transplantation and supporting medical therapies, thousands of patients currently wait for an organ and there is an unmet need for more refined and widely available regenerative strategies to treat liver diseases. Cell transplants attempt to maximize the potential for repair and/or regeneration in liver and other organs. Over 40years of laboratory pre-clinical research and 25years of clinical procedures have shown that certain liver diseases can be treated by the infusion of isolated cells (hepatocyte transplant). However, like organ transplants, hepatocyte transplant suffers from a paucity of tissues useful for cell production. Alternative sources have been investigated, yet with limited success. The tumorigenic potential of pluripotent stem cells together with their primitive level of hepatic differentiation, have limited the use of stem cell populations. Stem cell sources from human placenta, and the amnion tissue in particular are receiving renewed interest in the field of regenerative medicine. Unlike pluripotent stem cells, human amnion epithelial (AE) cells are easily available without ethical or religious concerns; they do not express telomerase and are not immortal or tumorigenic when transplanted. In addition, AE cells have been reported to express genes normally expressed in mature liver, when transplanted into the liver. Moreover, because of the possibility of an immune-privileged status related to their expression of HLA-G, it might be possible to transplant human AE cells without immunosuppression of the recipient. Copyright © 2016. Published by Elsevier Inc.
Elevated HLA-A expression impairs HIV control through inhibition of NKG2A-expressing cells.
Ramsuran, Veron; Naranbhai, Vivek; Horowitz, Amir; Qi, Ying; Martin, Maureen P; Yuki, Yuko; Gao, Xiaojiang; Walker-Sperling, Victoria; Del Prete, Gregory Q; Schneider, Douglas K; Lifson, Jeffrey D; Fellay, Jacques; Deeks, Steven G; Martin, Jeffrey N; Goedert, James J; Wolinsky, Steven M; Michael, Nelson L; Kirk, Gregory D; Buchbinder, Susan; Haas, David; Ndung'u, Thumbi; Goulder, Philip; Parham, Peter; Walker, Bruce D; Carlson, Jonathan M; Carrington, Mary
2018-01-05
The highly polymorphic human leukocyte antigen ( HLA ) locus encodes cell surface proteins that are critical for immunity. HLA-A expression levels vary in an allele-dependent manner, diversifying allele-specific effects beyond peptide-binding preference. Analysis of 9763 HIV-infected individuals from 21 cohorts shows that higher HLA-A levels confer poorer control of HIV. Elevated HLA-A expression provides enhanced levels of an HLA-A-derived signal peptide that specifically binds and determines expression levels of HLA-E, the ligand for the inhibitory NKG2A natural killer (NK) cell receptor. HLA-B haplotypes that favor NKG2A-mediated NK cell licensing (i.e., education) exacerbate the deleterious effect of high HLA-A on HIV control, consistent with NKG2A-mediated inhibition impairing NK cell clearance of HIV-infected targets. Therapeutic blockade of HLA-E:NKG2A interaction may yield benefit in HIV disease. Copyright © 2017, American Association for the Advancement of Science.
Gene expression profiling of liver cancer stem cells by RNA-sequencing.
Directory of Open Access Journals (Sweden)
David W Y Ho
Full Text Available BACKGROUND: Accumulating evidence supports that tumor growth and cancer relapse are driven by cancer stem cells. Our previous work has demonstrated the existence of CD90(+ liver cancer stem cells (CSCs in hepatocellular carcinoma (HCC. Nevertheless, the characteristics of these cells are still poorly understood. In this study, we employed a more sensitive RNA-sequencing (RNA-Seq to compare the gene expression profiling of CD90(+ cells sorted from tumor (CD90(+CSCs with parallel non-tumorous liver tissues (CD90(+NTSCs and elucidate the roles of putative target genes in hepatocarcinogenesis. METHODOLOGY/PRINCIPAL FINDINGS: CD90(+ cells were sorted respectively from tumor and adjacent non-tumorous human liver tissues using fluorescence-activated cell sorting. The amplified RNAs of CD90(+ cells from 3 HCC patients were subjected to RNA-Seq analysis. A differential gene expression profile was established between CD90(+CSCs and CD90(+NTSCs, and validated by quantitative real-time PCR (qRT-PCR on the same set of amplified RNAs, and further confirmed in an independent cohort of 12 HCC patients. Five hundred genes were differentially expressed (119 up-regulated and 381 down-regulated genes between CD90(+CSCs and CD90(+NTSCs. Gene ontology analysis indicated that the over-expressed genes in CD90(+CSCs were associated with inflammation, drug resistance and lipid metabolism. Among the differentially expressed genes, glypican-3 (GPC3, a member of glypican family, was markedly elevated in CD90(+CSCs compared to CD90(+NTSCs. Immunohistochemistry demonstrated that GPC3 was highly expressed in forty-two human liver tumor tissues but absent in adjacent non-tumorous liver tissues. Flow cytometry indicated that GPC3 was highly expressed in liver CD90(+CSCs and mature cancer cells in liver cancer cell lines and human liver tumor tissues. Furthermore, GPC3 expression was positively correlated with the number of CD90(+CSCs in liver tumor tissues. CONCLUSIONS
Gene Expression Profiling of Liver Cancer Stem Cells by RNA-Sequencing
Lam, Chi Tat; Ng, Michael N. P.; Yu, Wan Ching; Lau, Joyce; Wan, Timothy; Wang, Xiaoqi; Yan, Zhixiang; Liu, Hang; Fan, Sheung Tat
2012-01-01
Background Accumulating evidence supports that tumor growth and cancer relapse are driven by cancer stem cells. Our previous work has demonstrated the existence of CD90+ liver cancer stem cells (CSCs) in hepatocellular carcinoma (HCC). Nevertheless, the characteristics of these cells are still poorly understood. In this study, we employed a more sensitive RNA-sequencing (RNA-Seq) to compare the gene expression profiling of CD90+ cells sorted from tumor (CD90+CSCs) with parallel non-tumorous liver tissues (CD90+NTSCs) and elucidate the roles of putative target genes in hepatocarcinogenesis. Methodology/Principal Findings CD90+ cells were sorted respectively from tumor and adjacent non-tumorous human liver tissues using fluorescence-activated cell sorting. The amplified RNAs of CD90+ cells from 3 HCC patients were subjected to RNA-Seq analysis. A differential gene expression profile was established between CD90+CSCs and CD90+NTSCs, and validated by quantitative real-time PCR (qRT-PCR) on the same set of amplified RNAs, and further confirmed in an independent cohort of 12 HCC patients. Five hundred genes were differentially expressed (119 up-regulated and 381 down-regulated genes) between CD90+CSCs and CD90+NTSCs. Gene ontology analysis indicated that the over-expressed genes in CD90+CSCs were associated with inflammation, drug resistance and lipid metabolism. Among the differentially expressed genes, glypican-3 (GPC3), a member of glypican family, was markedly elevated in CD90+CSCs compared to CD90+NTSCs. Immunohistochemistry demonstrated that GPC3 was highly expressed in forty-two human liver tumor tissues but absent in adjacent non-tumorous liver tissues. Flow cytometry indicated that GPC3 was highly expressed in liver CD90+CSCs and mature cancer cells in liver cancer cell lines and human liver tumor tissues. Furthermore, GPC3 expression was positively correlated with the number of CD90+CSCs in liver tumor tissues. Conclusions/Significance The identified genes
International Nuclear Information System (INIS)
Porter, Holly A.; Carey, Gregory B.; Keegan, Achsah D.
2012-01-01
The adapters IRS1 and IRS2 link growth factor receptors to downstream signaling pathways that regulate proliferation and survival. Both suppress factor-withdrawal-induced apoptosis and have been implicated in cancer progression. However, recent studies suggest IRS1 and IRS2 mediate differential functions in cancer pathogenesis. IRS1 promoted breast cancer proliferation, while IRS2 promoted metastasis. The role of IRS1 and IRS2 in controlling cell responses to chemotherapy is unknown. To determine the role of IRS1 and IRS2 in the sensitivity of cells to chemotherapy, we treated 32D cells lacking or expressing IRS proteins with various concentrations of chemotherapeutic agents. We found that expression of IRS1, in contrast to IRS2, enhanced the sensitivity of 32D cells to chemotherapy-induced apoptosis. When IRS2 was expressed with IRS1, the cells no longer showed enhanced sensitivity. Expression of IRS1 did not alter the expression of pro- and anti-apoptotic proteins; however, 32D-IRS1 cells expressed higher levels of Annexin A2. In 32D-IRS1 cells, IRS1 and Annexin A2 were both located in cytoplasmic and membrane fractions. We also found that IRS1 coprecipitated with Annexin A2, while IRS2 did not. Decreasing Annexin A2 levels reduced 32D-IRS1 cell sensitivity to chemotherapy. These results suggest IRS1 enhances sensitivity to chemotherapy in part through Annexin A2. -- Highlights: ► IRS1 enhanced the sensitivity of 32D cells to chemotherapy-induced apoptosis. ► This sensitivity is abrogated by the expression of IRS2. ► Expressing IRS1 in 32D cells increased levels of Annexin A2. ► Both IRS1 and Annexin A2 were located in cytoplasmic and membrane fractions. ► Decreasing Annexin A2 in 32D-IRS1 cells abated their sensitivity to chemotherapy.
Ferritin expression in rat hepatocytes and Kupffer cells after lead nitrate treatment.
Fan, Yang; Yamada, Toshiyuki; Shimizu, Takeshi; Nanashima, Naoki; Akita, Miki; Suto, Kohji; Tsuchida, Shigeki
2009-02-01
Lead nitrate induces hepatocyte proliferation and subsequent apoptosis in rat livers. Iron is a constituent of heme and is also required for cell proliferation. In this study, the expression of ferritin light-chain (FTL), the major iron storage protein, was investigated in rat livers after a single intravenous injection of lead nitrate. Western blotting and immunohistochemistry revealed that FTL was increased in hepatocytes around the central veins and strongly expressed in nonparenchymal cells. Some FTL-positive nonparenchymal cells were identified as Kupffer cells that were positive for CD68. FTL-positive Kupffer cells occupied about 60% of CD68-positive cells in the periportal and perivenous areas. The relationships between FTL expression and apoptosis induction or the engulfment of apoptotic cells were examined. TUNEL-positive cells were increased in the treatment group, and enhanced expression of milk fat globule EGF-like 8 was demonstrated in some Kupffer cells and hepatocytes, indicating enhanced apoptosis induction and phagocytosis of apoptotic cells. FTL-positive Kupffer cells were not detected without lead nitrate treatment or in rat livers treated with clofibrate, which induces hepatocyte proliferation but not apoptosis. These results suggest that FTL expression in Kupffer cells after lead treatment is dependent on phagocytosis of apoptotic cells.
[Expression of c-MPL in leukemic stem cells from acute myeloid leukemia patients].
Yu, Pei; Qiu, Shao-Wei; Rao, Qing; Lin, Dong; Xing, Hai-Yan; Tang, Ke-Jing; Tian, Zheng; Wang, Min; Wang, Jian-Xiang
2012-10-01
This study was aimed to investigate the expression of c-MPL in acute myeloid leukemia (AML) and the correlation of the c-MPL expression with CD34 and CD38, so as to define the expression of c-MPL in leukemic stem cells. The expression levels of CD34, CD38 and c-MPL were detected by flow cytometry in bone marrow cells from 29 newly diagnosed AML patients. The relationship of c-MPL positive cell ratio with clinical parameters and correlation of c-MPL with CD34 and CD38 expression in AML patients were analyzed. The results showed that expression level of c-MPL in AML patients was significantly higher than that of normal controls (P MPL did not correlate with age, sex, white blood cell count, AML1-ETO fusion gene and remission after chemotherapy, but the expression of c-MPL in M2 and M5 patients was higher than that of normal control (P MPL in CD34 positive AML patients was obviously higher than that in CD34 negative AML patients (P MPL was significantly higher expressed in CD34(+) cells than that in CD34(-) cells (P MPL expression was not significantly different between CD34(+)CD38(-) and CD34(+)CD38(-) cell groups. Positive correlation between c-MPL and CD34 expression was observed (r = 0.380, P = 0.042). It is concluded that expression of c-MPL is higher in AML patients, and positively correlates with the expression level of CD34. The c-MPL expresses in leukemic stem cells.
Directory of Open Access Journals (Sweden)
Jing Dan
2017-03-01
Full Text Available AIM: To construct a recombinant eukaryotic expression vector of rat beta defensin-2(rBD-2, transfect it into the rat corneal epithelial cells with lipofection, determine the expression of target gene in the transfected cells, and discuss the potentiality of recombinant plasmid expressed in corneal epithelial cells, hoping to provide an experimental foundation for further study on the antimicrobial activity of rBD-2 in vitro and in vivo and to assess the probability of defensins as a new application for infectious corneal diseases in the future. METHODS: The synthetic rBD-2 DNA fragment was inserted between the XhoI and BamHI restriction enzyme cutting sites of eukaryotic expression vector pIRES2-ZsGreen1 to construct the recombinant plasmid pIRES2-ZsGreen1-rBD-2, then transformed it into E.coli DH5α, positive clones were screened by kanamycin and identified with restriction endonucleases and sequencing analysis. Transfection into the rat corneal epithelial cells was performed by lipofection. Then the experiment was divided into three groups: rat corneal epithelial cell was transfected with the recombinant plasmid pIRES2- ZsGreen1-rBD-2, rat corneal epithelial cell was transfected with the empty plasmid pIRES2-ZsGreen1 and the non-transfected group. The inverted fluorescence microscope was used to observe the transfection process. At last, the level of rBD-2 mRNA expressed in the transfected cells and the control groups are compared by the real-time fluoresence relative quantitative PCR. RESULTS: The recombinant eukaryotic expression vector of pIRES2-ZsGreen1-rBD-2 was successfully constructed. The level of rBD-2 mRNA in transfected cells was significantly higher than that in control groups through the real-time fluorescence relative quantitative PCR. CONCLUSION: The recombinant eukaryotic expression vector pIRES2-ZsGreen1-rBD-2 could be transfected into rat corneal epithelial cells, and exogenous rBD-2 gene could be transcripted into mRNA in
Expression of sodium/iodide symporter transgene in neural stem cells
International Nuclear Information System (INIS)
Kim, Yun Hui; Lee, Dong Soo; Kang, Joo Hyun; Lee, Yong Jin; Chung, June Key; Lee, Myung Chul
2004-01-01
The ability to noninvasively track the migration of neural progenitor cells would have significant clinical and research implications. We generated stably transfected F3 human neural progenitor cells with human sodium/iodide symporter (hNIS) for noninvasively tracking F3. In this study, the expression patterns of hNIS gene in F3-NIS were examined according to the cultured time and the epigenetic modulation. F3 human neural stem cells had been obtained from Dr. Seung U. Kim (Ajou University, Suwon, Korea). hNIS and hygromycin resistance gene were linked with IRES (internal Ribosome Entry Site) under control of CMV promoter. This construct was transfected to F3 with Liposome. To investigate the restoration of hNIS gene expression in F3-NIS, cells were treated with demethylating agent (5-Azacytidine) and Histone deacetylase inhibitor (Trichostatin A: TSA). The expression of hNIS was measured by I-125 uptake assay and RT-PCR analysis. The iodide uptake of the F3-NIS was higher 12.86 times than F3 cell line. According to the cell passage number, hNIS expression in F3-NIS gradually diminished. After treatment of 5-Azacytidine and TSA with serial doses (up to 20μM, up to 62.5nM, respectively) for 24 hours, I-125 uptake and mRNA of hNIS in F3-NIS were increased. These results suggest that hNIS transfected F3 might undergo a change in its biological characters by cell passage. Therefore, the gene expression of exogenous gene transferred human stem cell might be affected to the epigenetic modulation such as promoter methylation and Histone deacetylation and to the cell culture conditions
Directory of Open Access Journals (Sweden)
Larimore Kevin
2012-06-01
Full Text Available Abstract Background The ICOS-B7h costimulatory receptor-ligand pair is required for germinal center formation, the production of isotype-switched antibodies, and antibody affinity maturation in response to T cell-dependent antigens. However, the potentially distinct roles of regulated B7h expression on B cells and dendritic cells in T cell-dependent antibody responses have not been defined. Results We generated transgenic mice with lineage-restricted B7h expression to assess the cell-type specific roles of B7h expression on B cells and dendritic cells in regulating T cell-dependent antibody responses. Our results show that endogenous B7h expression is reduced on B cells after activation in vitro and is also reduced in vivo on antibody-secreting plasma B cells in comparison to both naïve and germinal center B cells from which they are derived. Increasing the level of B7h expression on activated and plasma B cells in B-B7hTg mice led to an increase in the number of antibody-secreting plasma cells generated after immunization and a corresponding increase in the concentration of antigen-specific high affinity serum IgG antibodies of all isotypes, without affecting the number of responding germinal center B cells. In contrast, ICOS costimulation mediated by dendritic cells in DC-B7hTg mice contributed to germinal center formation and selectively increased IgG2a production without affecting the overall magnitude of antibody responses. Conclusions Using transgenic mice with lineage-restricted B7h expression, we have revealed distinct roles of ICOS costimulation mediated by dendritic cells and B cells in the regulation of T cell-dependent antibody responses.
Shakhbazau, Antos; Shcharbin, Dzmitry; Seviaryn, Ihar; Goncharova, Natalya; Kosmacheva, Svetlana; Potapnev, Mihail; Bryszewska, Maria; Kumar, Ranjan; Biernaskie, Jeffrey; Midha, Rajiv
2012-05-07
This study reports the use of a nonviral expression system based on polyamidoamine dendrimers for time-restricted neurotrophin overproduction in mesenchymal stem cells and skin precursor-derived Schwann cells. The dendrimers were used to deliver plasmids for brain-derived neurotrophic factor (BDNF) or neurotrophin-3 (NT-3) expression in both rodent and human stem cells, and the timelines of expression were studied. We have found that, despite the fact that transfection efficiencies and protein expression levels were comparable, dendrimer-driven expression in human mesenchymal stem cells was characterized by a more rapid decline compared to rodent cells. Transient expression systems can be beneficial for some neurotrophins, which were earlier reported to cause unwanted side effects in virus-based long-term expression models. Nonviral neurotrophin expression is a biologically safe and accessible alternative to increase the therapeutic potential of autologous adult stem cells and stem cell-derived functional differentiated cells.
A balance of FGF and BMP signals regulates cell cycle exit and Equarin expression in lens cells
Jarrin, Miguel; Pandit, Tanushree; Gunhaga, Lena
2012-01-01
In embryonic and adult lenses, a balance of cell proliferation, cell cycle exit, and differentiation is necessary to maintain physical function. The molecular mechanisms regulating the transition of proliferating lens epithelial cells to differentiated primary lens fiber cells are poorly characterized. To investigate this question, we used gain- and loss-of-function analyses to modulate fibroblast growth factor (FGF) and/or bone morphogenetic protein (BMP) signals in chick lens/retina explants. Here we show that FGF activity plays a key role for proliferation independent of BMP signals. Moreover, a balance of FGF and BMP signals regulates cell cycle exit and the expression of Ccdc80 (also called Equarin), which is expressed at sites where differentiation of lens fiber cells occurs. BMP activity promotes cell cycle exit and induces Equarin expression in an FGF-dependent manner. In contrast, FGF activity is required but not sufficient to induce cell cycle exit or Equarin expression. Furthermore, our results show that in the absence of BMP activity, lens cells have increased cell cycle length or are arrested in the cell cycle, which leads to decreased cell cycle exit. Taken together, these findings suggest that proliferation, cell cycle exit, and early differentiation of primary lens fiber cells are regulated by counterbalancing BMP and FGF signals. PMID:22718906
Germ cell development in the Honeybee (Apis mellifera; Vasa and Nanos expression
Directory of Open Access Journals (Sweden)
Dearden Peter K
2006-02-01
Full Text Available Abstract Background Studies of specification of germ-cells in insect embryos has indicated that in many taxa the germ cells form early in development, and their formation is associated with pole plasm, germ plasm or an organelle called the oosome. None of these morphological features associated with germ cell formation have been identified in the Honeybee Apis mellifera. In this study I report the cloning and expression analysis of Honeybee homologues of vasa and nanos, germ cell markers in insects and other animals. Results Apis vasa and nanos RNAs are present in early honeybee embryos, but the RNAs clear rapidly, without any cells expressing these germ cell markers past stage 2. These genes are then only expressed in a line of cells in the abdomen from stage 9 onwards. These cells are the developing germ cells that are moved dorsally by dorsal closure and are placed in the genital ridge. Conclusion This study of the expression of germ cell markers in the honeybee implies that in this species either germ cells are formed by an inductive event, late in embryogenesis, or they are formed early in development in the absence of vasa and nanos expression. This contrasts with germ cell development in other members of the Hymenoptera, Diptera and Lepidoptera.
Expression of caspase-3 gene in apoptotic HL-60 cell and different human tumor cell lines
International Nuclear Information System (INIS)
Li Xiaoming; Song Tianbao
1999-01-01
Objective: To research the expression of caspase-3 gene in the apoptotic and the control HL-60 cells and in the different human tumor cell lines. Methods: Caspase-3 mRNA in the control and γ-radiation-induced apoptotic HL-60 cells, and in the 6 types of human tumor cell lines, was analysed by Northern blot. Results: The caspase-3 gene transcript was more highly expressed in leukemia cells HL-60, CEM, K562 and neuroblastoma SH-SY5Y than in cervical adenocarcinoma HeLa and breast carcinoma MCF7, and more highly in the radiation-induced apoptotic HL-60 than in the control HL-60 cells. Conclusion: The high level of expression of caspase-3 may aid the efforts to understand the tumor cell sensitivity to radiation, apoptosis and its inherent ability to survive
Weld, R; Heinemann, J; Eady, C
2001-03-01
The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.
Cytotoxicity of extracts of spices to cultured cells.
Unnikrishnan, M C; Kuttan, R
1988-01-01
The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.
Energy Technology Data Exchange (ETDEWEB)
Wu, Feng; Jordan, Ashley; Kluz, Thomas [Department of Environmental Medicine, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987 (United States); Shen, Steven [Center for Health Informatics and Bioinformatics, New York University Langone Medical Center, New York, NY 10016 (United States); Sun, Hong; Cartularo, Laura A. [Department of Environmental Medicine, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987 (United States); Costa, Max, E-mail: Max.Costa@nyumc.org [Department of Environmental Medicine, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987 (United States)
2016-02-15
The special AT-rich sequence-binding protein 2 (SATB2) is a protein that binds to the nuclear matrix attachment region of the cell and regulates gene expression by altering chromatin structure. In our previous study, we reported that SATB2 gene expression was induced in human bronchial epithelial BEAS-2B cells transformed by arsenic, chromium, nickel and vanadium. In this study, we show that ectopic expression of SATB2 in the normal human bronchial epithelial cell-line BEAS-2B increased anchorage-independent growth and cell migration, meanwhile, shRNA-mediated knockdown of SATB2 significantly decreased anchorage-independent growth in Ni transformed BEAS-2B cells. RNA sequencing analyses of SATB2 regulated genes revealed the enrichment of those involved in cytoskeleton, cell adhesion and cell-movement pathways. Our evidence supports the hypothesis that SATB2 plays an important role in BEAS-2B cell transformation. - Highlights: • We performed SATB2 overexpression in the BEAS-2B cell line. • We performed SATB2 knockdown in a Ni transformed BEAS-2B cell line. • SATB2 induced anchorage-independent growth and increased cell migration. • SATB2 knockdown significantly decreased anchorage-independent growth. • We identified alterations in gene involved in cytoskeleton, cell adhesion.
International Nuclear Information System (INIS)
Wu, Feng; Jordan, Ashley; Kluz, Thomas; Shen, Steven; Sun, Hong; Cartularo, Laura A.; Costa, Max
2016-01-01
The special AT-rich sequence-binding protein 2 (SATB2) is a protein that binds to the nuclear matrix attachment region of the cell and regulates gene expression by altering chromatin structure. In our previous study, we reported that SATB2 gene expression was induced in human bronchial epithelial BEAS-2B cells transformed by arsenic, chromium, nickel and vanadium. In this study, we show that ectopic expression of SATB2 in the normal human bronchial epithelial cell-line BEAS-2B increased anchorage-independent growth and cell migration, meanwhile, shRNA-mediated knockdown of SATB2 significantly decreased anchorage-independent growth in Ni transformed BEAS-2B cells. RNA sequencing analyses of SATB2 regulated genes revealed the enrichment of those involved in cytoskeleton, cell adhesion and cell-movement pathways. Our evidence supports the hypothesis that SATB2 plays an important role in BEAS-2B cell transformation. - Highlights: • We performed SATB2 overexpression in the BEAS-2B cell line. • We performed SATB2 knockdown in a Ni transformed BEAS-2B cell line. • SATB2 induced anchorage-independent growth and increased cell migration. • SATB2 knockdown significantly decreased anchorage-independent growth. • We identified alterations in gene involved in cytoskeleton, cell adhesion.
Struthers, J K; Swanepoel, R
1982-06-01
A non-structural protein of mol. wt. 34 X 10(3) was demonstrated in the nuclei of Rift Valley fever virus-infected Vero cells by SDS-polyacrylamide gel electro-phoresis. The protein appears to correspond to the virus-induced antigen demonstrated by indirect immunofluorescence in intranuclear inclusions.
IL-15 expression on RA synovial fibroblasts promotes B cell survival.
Directory of Open Access Journals (Sweden)
Marta Benito-Miguel
Full Text Available INTRODUCTION: The purpose of this study was to examine the role of RA Synovial Fibroblast (RASFib IL-15 expression on B cell survival. METHODS: Magnetically sorted peripheral blood memory B cells from 15 healthy subjects were cocultured with RASFib. RESULTS: RASFib constitutively expressed membrane IL-15. Survival of isolated B cells cultured for 6 days, below 5%, was extended in coculture with RASFib to 52+/-8% (p<0.001. IL-15 neutralizing agents but not isotype controls, reduced this rate to 31+/-6% (p<0.05. Interestingly, rhIL-15 had no effect on isolated B cells but significantly increased their survival in coculture with RASFib. In parallel, B cell IL-15R chains were upregulated in cocultures. BAFF and VCAM-1, that are expressed on RASFib, were tested as potential candidates involved in upregulating B cell IL-15R. Culture of B cells in the presence of rhBAFF or rhVCAM-1 resulted in significantly increased survival, together with upregulation of all three IL-15R chains; in parallel, rhIL-15 potentiated the anti-apoptotic effect of BAFF and VCAM-1. Both BAFF and VCAM-1 neutralizing agents downmodulated the effect of RASFib on B cell survival and IL-15R expression. In parallel, rhIL-15 had a lower effect on the survival of B cells cocultured with RASFib in the presence of BAFF or VCAM-1 neutralizing agents. Peripheral blood B cells from 15 early RA patients demonstrated an upregulated IL-15R and increased survival in cocultures. CONCLUSION: IL-15 expression on RASFib significantly contributes to the anti-apoptotic effect of RASFib on B cells. IL-15 action is facilitated by BAFF and VCAM-1 expressed on RASFib, through an upregulation of IL-15R chains.
Tao, Wen; Evans, Barbara-Graham; Yao, Jing; Cooper, Scott; Cornetta, Kenneth; Ballas, Christopher B; Hangoc, Giao; Broxmeyer, Hal E
2007-03-01
Validated gene transfer and expression tracers are essential for elucidating functions of mammalian genes. Here, we have determined the suitability and unintended side effects of enhanced green fluorescent protein (EGFP) and DsRed-Express fluorescent protein as expression tracers in long-term hematopoietic stem cells (HSCs). Retrovirally transduced mouse bone marrow cells expressing either EGFP or DsRed-Express in single or mixed dual-color cell populations were clearly discerned by flow cytometry and fluorescence microscopy. The results from in vivo competitive repopulation assays demonstrated that EGFP-expressing HSCs were maintained nearly throughout the lifespan of the transplanted mice and retained long-term multilineage repopulating potential. All mice assessed at 15 months post-transplantation were EGFP positive, and, on average, 24% total peripheral white blood cells expressed EGFP. Most EGFP-expressing recipient mice lived at least 22 months. In contrast, Discosoma sp. red fluorescent protein (DsRed)-expressing donor cells dramatically declined in transplant-recipient mice over time, particularly in the competitive setting, in which mixed EGFP- and DsRed-expressing cells were cotransplanted. Moreover, under in vitro culture condition favoring preservation of HSCs, purified EGFP-expressing cells grew robustly, whereas DsRed-expressing cells did not. Therefore, EGFP has no detectable deteriorative effects on HSCs, and is nearly an ideal long-term expression tracer for hematopoietic cells; however, DsRed-Express fluorescent protein is not suitable for these cells.
Plasma Cell Ontogeny Defined by Quantitative Changes in Blimp-1 Expression
Kallies, Axel; Hasbold, Jhagvaral; Tarlinton, David M.; Dietrich, Wendy; Corcoran, Lynn M.; Hodgkin, Philip D.; Nutt, Stephen L.
2004-01-01
Plasma cells comprise a population of terminally differentiated B cells that are dependent on the transcriptional regulator B lymphocyte–induced maturation protein 1 (Blimp-1) for their development. We have introduced a gfp reporter into the Blimp-1 locus and shown that heterozygous mice express the green fluorescent protein in all antibody-secreting cells (ASCs) in vivo and in vitro. In vitro, these cells display considerable heterogeneity in surface phenotype, immunoglobulin secretion rate, and Blimp-1 expression levels. Importantly, analysis of in vivo ASCs induced by immunization reveals a developmental pathway in which increasing levels of Blimp-1 expression define developmental stages of plasma cell differentiation that have many phenotypic and molecular correlates. Thus, maturation from transient plasmablast to long-lived ASCs in bone marrow is predicated on quantitative increases in Blimp-1 expression. PMID:15492122
Directory of Open Access Journals (Sweden)
Mathieu Dalvai
Full Text Available Antiestrogens are designed to antagonize hormone induced proliferation and ERalpha target gene expression in mammary tumor cells. Commonly used drugs such as OH-Tamoxifen and ICI 182780 (Fulvestrant block cell cycle progression in G0/G1. Inversely, the effect of cell cycle stage on ER regulated gene expression has not been tested directly. We show that in ERalpha-positive breast cancer cells (MCF-7 the estrogen receptor gene and downstream target genes are cell cycle regulated with expression levels varying as much as three-fold between phases of the cell cycle. Steroid free culture conditions commonly used to assess the effect of hormones or antiestrogens on gene expression also block MCF-7 cells in G1-phase when several ERalpha target genes are overexpressed. Thus, cell cycle effects have to be taken into account when analyzing the impact of hormonal treatments on gene transcription. We found that antiestrogens repress transcription of several ERalpha target genes specifically in S phase. This observation corroborates the more rapid and strong impact of antiestrogen treatments on cell proliferation in thymidine, hydroxyurea or aphidicolin arrested cells and correlates with an increase of apoptosis compared to similar treatments in lovastatin or nocodazol treated cells. Hence, cell cycle effects synergize with the action of antiestrogens. An interesting therapeutic perspective could be to enhance the action of anti-estrogens by associating hormone-therapy with specific cell cycle drugs.
Regulation of CD93 cell surface expression by protein kinase C isoenzymes.
Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi
2006-01-01
Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell
Directory of Open Access Journals (Sweden)
Cecilia González
Full Text Available The identification of erythrocyte antibodies in the serum of patients rely on panels of human red blood cells (RBCs, which coexpress many antigens and are not easily available for low-incidence blood group phenotypes. These problems have been addressed by generating cell lines expressing unique blood group antigens, which may be used as an alternative to human RBCs. However, the use of cell lines implies several drawbacks, like the requirement of cell culture facilities and the high cost of cryopreservation. The application of cell stabilization methods could facilitate their use as reagent cells in clinical laboratories.We generated stably-transfected cells expressing low-incidence blood group antigens (Dia and Lua. High-expresser clones were used to assess the effect of TransFix® treatment and lyophilization as cell preservation methods. Cells were kept at 4°C and cell morphology, membrane permeability and antigenic properties were evaluated at several time-points after treatment.TransFix® addition to cell suspensions allows cell stabilization and proper antigen detection for at least 120 days, despite an increase in membrane permeability and a reduction in antigen expression levels. Lyophilized cells showed minor morphological changes and antigen expression levels were rather conserved at days 1, 15 and 120, indicating a high stability of the freeze-dried product. These stabilized cells have been proved to react specifically with human sera containing alloantibodies.Both stabilization methods allow long-term preservation of the transfected cells antigenic properties and may facilitate their distribution and use as reagent-cells expressing low-incidence antigens, overcoming the limited availability of such rare RBCs.
International Nuclear Information System (INIS)
Kozbor, D.; Burioni, R.; Ar-Rushdi, A.; Zmijewski, C.; Croce, C.M.
1987-01-01
Somatic cell hybrids were obtained between human T and B cells and tested for the expression of differentiated traits of both cell lineages. The T-cell parent SUP-T1 is CD3 - , CD4 + , CD1 + , CD8 + , is weakly positive for HLA class I determinants, and has an inversion of chromosome 14 due to a site-specific recombination event between an immunoglobulin heavy-chain variable gene and the joining segment of the T-cell receptor α chain. The B-cell parent, the 6-thioguanine- and ouabain-resistant mutant GM1500, is a lymphoblastoid cell line that secretes IgG2, K chains, and expresses B1, B532, and HLA class I and II antigens. All hybrids expressed characteristics of B cells (Ig + , B1 + , B532 + , EBNA + , HLA antigens), whereas only CD4 among the T-cell markers was expressed. The level of T-cell receptor β-chain transcript was greatly reduced and no RNA of the chimeric T-cell receptor α-chain joining segment-immunoglobulin heavy-chain variable region was detected. Southern blot analysis indicated that absence of T-cell differentiation markers in the hybrids was not due to chromosomal loss. Rather, some B-cell-specific factor present in the hybrids may account for the suppression
Witek, Rafal P; Yang, Liu; Liu, Renshui; Jung, Youngmi; Omenetti, Alessia; Syn, Wing-Kin; Choi, Steve S; Cheong, Yeiwon; Fearing, Caitlin M; Agboola, Kolade M; Chen, Wei; Diehl, Anna Mae
2009-01-01
Angiogenesis contributes to vascular remodeling during cirrhosis. In cirrhotic livers, cholangiocytes, and myofibroblastic hepatic stellate cells (MF-HSC) produce Hedgehog (Hh) ligands. During embryogenesis Hh ligands are released from ligand-producing cells in microparticles and activate Hh signaling in endothelial cells. We studied whether adult liver cell-derived microparticles contain Hh ligands that alter hepatic sinusoidal endothelial cells (SEC). MF-HSC and cholangiocytes were exposed to platelet-derived growth factor to induce Hh ligands; microparticles were isolated from medium, analyzed by transmission electron microscopy and immunoblots, and applied to Hh-reporter-containing cells. Microparticles were obtained from serum and bile of rats after bile duct ligation (BDL) or sham surgery and applied to normal primary liver SEC with or without cyclopamine, an Hh signaling inhibitor. Effects on SEC gene expression were evaluated by quantitative reverse-transcription polymerase chain reaction and immunoblotting. Hh target gene expression and SEC activation markers were compared in primary SEC and in liver sections from healthy and BDL rats. Platelet-derived growth factor-treated MF-HSC and cholangiocytes released exosome-enriched microparticles containing biologically-active Hh ligands. BDL increased release of Hh-containing exosome-enriched microparticles into plasma and bile. Transmission electron microscopy and immunoblots revealed similarities among microparticles from all sources; all microparticles induced similar Hh-dependent changes in SEC gene expression. SEC from healthy livers did not express Hh target genes or activation markers, but both were up-regulated in SEC after BDL. Hh-containing exosome-enriched microparticles released from liver cells alter hepatic SEC gene expression, suggesting a novel mechanism for cirrhotic vasculopathy.
Glucose transporters are expressed in taste receptor cells.
Merigo, Flavia; Benati, Donatella; Cristofoletti, Mirko; Osculati, Francesco; Sbarbati, Andrea
2011-08-01
In the intestine, changes of sugar concentration generated in the lumen during digestion induce adaptive responses of glucose transporters in the epithelium. A close matching between the intestinal expression of glucose transporters and the composition and amount of the diet has been provided by several experiments. Functional evidence has demonstrated that the regulation of glucose transporters into enterocytes is induced by the sensing of sugar of the enteroendocrine cells through activation of sweet taste receptors (T1R2 and T1R3) and their associated elements of G-protein-linked signaling pathways (e.g. α-gustducin, phospholipase C β type 2 and transient receptor potential channel M5), which are signaling molecules also involved in the perception of sweet substances in the taste receptor cells (TRCs) of the tongue. Considering this phenotypical similarity between the intestinal cells and TRCs, we evaluated whether the TRCs themselves possess proteins of the glucose transport mechanism. Therefore, we investigated the expression of the typical intestinal glucose transporters (i.e. GLUT2, GLUT5 and SGLT1) in rat circumvallate papillae, using immunohistochemistry, double-labeling immunofluorescence, immunoelectron microscopy and reverse transcriptase-polymerase chain reaction analysis. The results showed that GLUT2, GLUT5 and SGLT1 are expressed in TRCs; their immunoreactivity was also observed in cells that displayed staining for α-gustducin and T1R3 receptor. The immunoelectron microscopic results confirmed that GLUT2, GLUT5 and SGLT1 were predominantly expressed in cells with ultrastructural characteristics of chemoreceptor cells. The presence of glucose transporters in TRCs adds a further link between chemosensory information and cellular responses to sweet stimuli that may have important roles in glucose homeostasis, contributing to a better understanding of the pathways implicated in glucose metabolism. © 2011 The Authors. Journal of Anatomy © 2011
Directory of Open Access Journals (Sweden)
Anupama Dey
2017-08-01
Full Text Available The birth of new neurons, or neurogenesis, in the adult midbrain is important for progressing dopamine cell-replacement therapies for Parkinson's disease. Most studies suggest newborn cells remain undifferentiated or differentiate into glia within the adult midbrain. However, some studies suggest nestin + neural precursor cells (NPCs have a propensity to generate new neurons here. We sought to confirm this by administering tamoxifen to adult NesCreERT2/R26eYFP transgenic mice, which permanently labelled adult nestin-expressing cells and their progeny with enhanced yellow fluorescent protein (eYFP. eYFP+ midbrain cells were then characterized 1–32 weeks later in acutely prepared brain slices using whole-cell patch clamp electrophysiology combined with single-cell RT-qPCR. Most eYFP+ cells exhibited a mature neuronal phenotype with large amplitude fast action potentials (APs, spontaneous post-synaptic currents (sPSCs, and expression of ‘mature’ neuronal genes (NeuN, Gad1, Gad2 and/or VGLUT2. This was the case even at the earliest time-point following tamoxifen (i.e. 1 week. In comparison to neighboring eYFP− (control cells, eYFP+ cells discharged more APs per unit current injection, and had faster AP time-to-peak, hyperpolarized resting membrane potential, smaller membrane capacitance and shorter duration sPSCs. eYFP+ cells were also differentiated from eYFP− cells by increased expression of ‘immature’ pro-neuronal genes (Pax6, Ngn2 and/or Msx1. However, further analyses failed to reveal evidence of a place of birth, neuronal differentiation, maturation and integration indicative of classical neurogenesis. Thus our findings do not support the notion that nestin + NPCs in the adult SNc and midbrain generate new neurons via classical neurogenesis. Rather, they raise the possibility that mature neurons express nestin under unknown circumstances, and that this is associated with altered physiology and gene expression.
Png, Yi Tian; Vinanica, Natasha; Kamiya, Takahiro; Shimasaki, Noriko; Coustan-Smith, Elaine; Campana, Dario
2017-11-28
Effective immunotherapies for T-cell malignancies are lacking. We devised a novel approach based on chimeric antigen receptor (CAR)-redirected T lymphocytes. We selected CD7 as a target because of its consistent expression in T-cell acute lymphoblastic leukemia (T-ALL), including the most aggressive subtype, early T-cell precursor (ETP)-ALL. In 49 diagnostic T-ALL samples (including 14 ETP-ALL samples), median CD7 expression was >99%; CD7 expression remained high at relapse (n = 14), and during chemotherapy (n = 54). We targeted CD7 with a second-generation CAR (anti-CD7-41BB-CD3ζ), but CAR expression in T lymphocytes caused fratricide due to the presence of CD7 in the T cells themselves. To downregulate CD7 and control fratricide, we applied a new method (protein expression blocker [PEBL]), based on an anti-CD7 single-chain variable fragment coupled with an intracellular retention domain. Transduction of anti-CD7 PEBL resulted in virtually instantaneous abrogation of surface CD7 expression in all transduced T cells; 2.0% ± 1.7% were CD7 + vs 98.1% ± 1.5% of mock-transduced T cells (n = 5; P < .0001). PEBL expression did not impair T-cell proliferation, interferon-γ and tumor necrosis factor-α secretion, or cytotoxicity, and eliminated CAR-mediated fratricide. PEBL-CAR T cells were highly cytotoxic against CD7 + leukemic cells in vitro and were consistently more potent than CD7 + T cells spared by fratricide. They also showed strong anti-leukemic activity in cell line- and patient-derived T-ALL xenografts. The strategy described in this study fits well with existing clinical-grade cell manufacturing processes and can be rapidly implemented for the treatment of patients with high-risk T-cell malignancies.
Temporal dynamics and transcriptional control using single-cell gene expression analysis.
Kouno, Tsukasa; de Hoon, Michiel; Mar, Jessica C; Tomaru, Yasuhiro; Kawano, Mitsuoki; Carninci, Piero; Suzuki, Harukazu; Hayashizaki, Yoshihide; Shin, Jay W
2013-01-01
Changes in environmental conditions lead to expression variation that manifest at the level of gene regulatory networks. Despite a strong understanding of the role noise plays in synthetic biological systems, it remains unclear how propagation of expression heterogeneity in an endogenous regulatory network is distributed and utilized by cells transitioning through a key developmental event. Here we investigate the temporal dynamics of a single-cell transcriptional network of 45 transcription factors in THP-1 human myeloid monocytic leukemia cells undergoing differentiation to macrophages. We systematically measure temporal regulation of expression and variation by profiling 120 single cells at eight distinct time points, and infer highly controlled regulatory modules through which signaling operates with stochastic effects. This reveals dynamic and specific rewiring as a cellular strategy for differentiation. The integration of both positive and negative co-expression networks further identifies the proto-oncogene MYB as a network hinge to modulate both the pro- and anti-differentiation pathways. Compared to averaged cell populations, temporal single-cell expression profiling provides a much more powerful technique to probe for mechanistic insights underlying cellular differentiation. We believe that our approach will form the basis of novel strategies to study the regulation of transcription at a single-cell level.
Pancreas developing markers expressed on human mononucleated umbilical cord blood cells
International Nuclear Information System (INIS)
Pessina, A.; Eletti, B.; Croera, C.; Savalli, N.; Diodovich, C.; Gribaldo, L.
2004-01-01
Haematopoietic system represents the main source of haematopoietic stem cells and probably of multipotential adult progenitor cells and mesenchimal stem cells at first described as colony forming unit-fibroblast. Whereas there are many studies on the gene expression profile of the different precursors along their haematopoietic differentiation, few data (sometimes conflicting) have been reported about the phenotype of the cells (present in bone marrow and possibly in cord blood) able to differentiate into non-haematopoietic cells. As both postnatal bone marrow and umbilical cord blood contain nestin positive cells able to proliferate and differentiate into the main neural phenotype (neuron, astroglia and oligodendroglia) many authors considered nestin a neuroepithelial precursor marker that seems to be essential also in multipotential progenitor cells of pancreas present both in rat and in human pancreatic islets (called nestin positive islet derived progenitors). Although the importance of nestin in these cells appears to be evident, it remains yet to clarify the number and the sequential expression of the genes coding all the transcription factors essential for beta cells differentiation and therefore the conditions able to induce the expression of many important transcription factors genes such as isl-1, pax-4, pdx-1 and ngn-3. Among them pdx-1 is a gene essential for pancreas development which is able to control ngn-3 in activating the expression of other differentiation factors for endocrine cells. Here, we describe for the first time in human umbilical cord blood cells (UCB) the pattern of expression of a panel of markers (nestin, CK-8, CK-18) and transcription factors (Isl-1, Pdx-1, Pax-4, Ngn-3) considered important for beta cells differentiation. Our data demonstrate that UCB contains a cell population having a phenotype very similar to endocrine cell precursors in transition to beta cells
Energy Technology Data Exchange (ETDEWEB)
Cong, Yingying; Li, Xiaoxue; Bai, Yunyun [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); Lv, Xiaonan [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); CAS Key Lab for Biomedical Effects of Nanomaterials and Nanosafety, National Center for Nanoscience & Technology of China, Beijing 100090 (China); Herrler, Georg [Institute for Virology, University of Veterinary Medicine, Hannover D-30559 (Germany); Enjuanes, Luis [Department of Molecular and Cell Biology, Centro Nacional de Biotecnología (CNB-CSIC), Campus Universidad Autónoma de Madrid, Cantoblanco, Madrid (Spain); Zhou, Xingdong [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); Qu, Bo [Faculty of Life Sciences, Northeast Agricultural University, Harbin 150030 (China); Meng, Fandan [Institute for Virology, University of Veterinary Medicine, Hannover D-30559 (Germany); Cong, Chengcheng [College Animal Husbandry and Veterinary Medicine, Shenyang Agricultural University, Shenyang 110161 (China); Ren, Xiaofeng; Li, Guangxing [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China)
2015-04-15
Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs.
International Nuclear Information System (INIS)
Cong, Yingying; Li, Xiaoxue; Bai, Yunyun; Lv, Xiaonan; Herrler, Georg; Enjuanes, Luis; Zhou, Xingdong; Qu, Bo; Meng, Fandan; Cong, Chengcheng; Ren, Xiaofeng; Li, Guangxing
2015-01-01
Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs
International Nuclear Information System (INIS)
Ke, Chien-Chih; Liu, Ren-Shyan; Yang, An-Hang; Liu, Ching-Sheng; Chi, Chin-Wen; Tseng, Ling-Ming; Tsai, Yi-Fan; Ho, Jennifer H.; Lee, Chen-Hsen; Lee, Oscar K.
2013-01-01
131 I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133 + cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133 + cells and higher radioresistance. After γ-irradiation of the cells, the CD133 + population was enriched due to the higher apoptotic rate of CD133 - cells. In vivo 131 I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133 + cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133 + cells. (orig.)
Axotomy induces MHC class I antigen expression on rat nerve cells
DEFF Research Database (Denmark)
Maehlen, J; Schröder, H D; Klareskog, L
1988-01-01
Immunomorphological staining demonstrates that class I major histocompatibility complex (MHC)-coded antigen expression can be selectively induced on otherwise class I-negative rat nerve cells by peripheral axotomy. Induction of class I as well as class II antigen expression was simultaneously seen...... on non-neural cells in the immediate vicinity of the injured nerve cells. As nerve regeneration after axotomy includes growth of new nerve cell processes and formation of new nerve cell contacts, the present findings raise the question of a role for MHC-coded molecules in cell-cell interactions during...... nerve cell growth....
Intercellular adhesion molecule-1 expression by skeletal muscle cells augments myogenesis
International Nuclear Information System (INIS)
Goh, Qingnian; Dearth, Christopher L.; Corbett, Jacob T.; Pierre, Philippe; Chadee, Deborah N.; Pizza, Francis X.
2015-01-01
We previously demonstrated that the expression of intercellular adhesion molecule-1 (ICAM-1) by skeletal muscle cells after muscle overload contributes to ensuing regenerative and hypertrophic processes in skeletal muscle. The objective of the present study is to reveal mechanisms through which skeletal muscle cell expression of ICAM-1 augments regenerative and hypertrophic processes of myogenesis. This was accomplished by genetically engineering C2C12 myoblasts to stably express ICAM-1, and by inhibiting the adhesive and signaling functions of ICAM-1 through the use of a neutralizing antibody or cell penetrating peptide, respectively. Expression of ICAM-1 by cultured skeletal muscle cells augmented myoblast–myoblast adhesion, myotube formation, myonuclear number, myotube alignment, myotube–myotube fusion, and myotube size without influencing the ability of myoblasts to proliferate or differentiate. ICAM-1 augmented myotube formation, myonuclear accretion, and myotube alignment through a mechanism involving adhesion-induced activation of ICAM-1 signaling, as these dependent measures were reduced via antibody and peptide inhibition of ICAM-1. The adhesive and signaling functions of ICAM-1 also facilitated myotube hypertrophy through a mechanism involving myotube–myotube fusion, protein synthesis, and Akt/p70s6k signaling. Our findings demonstrate that ICAM-1 expression by skeletal muscle cells augments myogenesis, and establish a novel mechanism through which the inflammatory response facilitates growth processes in skeletal muscle. - Highlights: • We examined mechanisms through which skeletal muscle cell expression of ICAM-1 facilitates events of in vitro myogenesis. • Expression of ICAM-1 by cultured myoblasts did not influence their ability to proliferate or differentiate. • Skeletal muscle cell expression of ICAM-1 augmented myoblast fusion, myotube alignment, myotube–myotube fusion, and myotube size. • ICAM-1 augmented myogenic processes through
Intercellular adhesion molecule-1 expression by skeletal muscle cells augments myogenesis
Energy Technology Data Exchange (ETDEWEB)
Goh, Qingnian; Dearth, Christopher L.; Corbett, Jacob T. [Department of Kinesiology, The University of Toledo, Toledo, OH (United States); Pierre, Philippe [Centre d’Immunologie de Marseille-Luminy U2M, Aix-Marseille Université, Marseille (France); INSERM U631, Institut National de la Santé et Recherche Médicale, Marseille (France); CNRS UMR6102, Centre National de la Recherche Scientifique, Marseille (France); Chadee, Deborah N. [Department of Biological Sciences, The University of Toledo, Toledo, OH (United States); Pizza, Francis X., E-mail: Francis.Pizza@utoledo.edu [Department of Kinesiology, The University of Toledo, Toledo, OH (United States)
2015-02-15
We previously demonstrated that the expression of intercellular adhesion molecule-1 (ICAM-1) by skeletal muscle cells after muscle overload contributes to ensuing regenerative and hypertrophic processes in skeletal muscle. The objective of the present study is to reveal mechanisms through which skeletal muscle cell expression of ICAM-1 augments regenerative and hypertrophic processes of myogenesis. This was accomplished by genetically engineering C2C12 myoblasts to stably express ICAM-1, and by inhibiting the adhesive and signaling functions of ICAM-1 through the use of a neutralizing antibody or cell penetrating peptide, respectively. Expression of ICAM-1 by cultured skeletal muscle cells augmented myoblast–myoblast adhesion, myotube formation, myonuclear number, myotube alignment, myotube–myotube fusion, and myotube size without influencing the ability of myoblasts to proliferate or differentiate. ICAM-1 augmented myotube formation, myonuclear accretion, and myotube alignment through a mechanism involving adhesion-induced activation of ICAM-1 signaling, as these dependent measures were reduced via antibody and peptide inhibition of ICAM-1. The adhesive and signaling functions of ICAM-1 also facilitated myotube hypertrophy through a mechanism involving myotube–myotube fusion, protein synthesis, and Akt/p70s6k signaling. Our findings demonstrate that ICAM-1 expression by skeletal muscle cells augments myogenesis, and establish a novel mechanism through which the inflammatory response facilitates growth processes in skeletal muscle. - Highlights: • We examined mechanisms through which skeletal muscle cell expression of ICAM-1 facilitates events of in vitro myogenesis. • Expression of ICAM-1 by cultured myoblasts did not influence their ability to proliferate or differentiate. • Skeletal muscle cell expression of ICAM-1 augmented myoblast fusion, myotube alignment, myotube–myotube fusion, and myotube size. • ICAM-1 augmented myogenic processes through
Porter, Holly A.; Carey, Gregory B.; Keegan, Achsah D.
2012-01-01
The adaptors IRS1 and IRS2 link growth factor receptors to downstream signaling pathways that regulate proliferation and survival. Both suppress factor-withdrawal-induced apoptosis and have been implicated in cancer progression. However, recent studies suggest IRS1 and IRS2 mediate differential functions in cancer pathogenesis. IRS1 promoted breast cancer proliferation, while IRS2 promoted metastasis. The role of IRS1 and IRS2 in controlling cell responses to chemotherapy is unknown. To determine the role of IRS1 and IRS2 in the sensitivity of cells to chemotherapy, we treated 32D cells lacking or expressing IRS proteins with various concentrations of chemotherapeutic agents. We found that expression of IRS1, in contrast to IRS2, enhanced the sensitivity of 32D cells to chemotherapy-induced apoptosis. When IRS2 was expressed with IRS1, the cells no longer showed enhanced sensitivity. Expression of IRS1 did not alter the expression of pro- and anti-apoptotic proteins; however, 32D-IRS1 cells expressed higher levels of Annexin A2. In 32D-IRS1 cells, IRS1 and Annexin A2 were both located in cytoplasmic and membrane fractions. We also found that IRS1 coprecipitated with Annexin A2, while IRS2 did not. Decreasing Annexin A2 levels reduced 32D-IRS1 cell sensitivity to chemotherapy. These results suggest IRS1 enhances sensitivity to chemotherapy in part through Annexin A2. PMID:22652453
Global gene expression response to telomerase in bovine adrenocortical cells
International Nuclear Information System (INIS)
Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H.
2005-01-01
The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state
International Nuclear Information System (INIS)
Lesinski, Gregory B; Zimmerer, Jason M; Kreiner, Melanie; Trefry, John; Bill, Matthew A; Young, Gregory S; Becknell, Brian; Carson, William E III
2010-01-01
Endogenously produced interferons can regulate the growth of melanoma cells and are administered exogenously as therapeutic agents to patients with advanced cancer. We investigated the role of negative regulators of interferon signaling known as suppressors of cytokine signaling (SOCS) in mediating interferon-resistance in human melanoma cells. Basal and interferon-alpha (IFN-α) or interferon-gamma (IFN-γ)-induced expression of SOCS1 and SOCS3 proteins was evaluated by immunoblot analysis in a panel of n = 10 metastatic human melanoma cell lines, in human embryonic melanocytes (HEM), and radial or vertical growth phase melanoma cells. Over-expression of SOCS1 and SOCS3 proteins in melanoma cells was achieved using the PINCO retroviral vector, while siRNA were used to inhibit SOCS1 and SOCS3 expression. Tyr 701 -phosphorylated STAT1 (P-STAT1) was measured by intracellular flow cytometry and IFN-stimulated gene expression was measured by Real Time PCR. SOCS1 and SOCS3 proteins were expressed at basal levels in melanocytes and in all melanoma cell lines examined. Expression of the SOCS1 and SOCS3 proteins was also enhanced following stimulation of a subset of cell lines with IFN-α or IFN-γ. Over-expression of SOCS proteins in melanoma cell lines led to significant inhibition of Tyr 701 -phosphorylated STAT1 (P-STAT1) and gene expression following stimulation with IFN-α (IFIT2, OAS-1, ISG-15) or IFN-γ (IRF1). Conversely, siRNA inhibition of SOCS1 and SOCS3 expression in melanoma cells enhanced their responsiveness to interferon stimulation. These data demonstrate that SOCS proteins are expressed in human melanoma cell lines and their modulation can influence the responsiveness of melanoma cells to IFN-α and IFN-γ
Progestin and thrombin regulate tissue factor expression in human term decidual cells.
Lockwood, C J; Murk, W; Kayisli, U A; Buchwalder, L F; Huang, S-T; Funai, E F; Krikun, G; Schatz, F
2009-06-01
Perivascular cell membrane-bound tissue factor (TF) initiates hemostasis via thrombin generation. The identity and potential regulation of TF-expressing cells at the human maternal-fetal interface that confers hemostatic protection during normal and preterm delivery is unclear. The objective of the study were to identify TF-expressing cells at the maternal-fetal interface in term and preterm decidual sections by immunohistochemistry and evaluate progestin, thrombin, TNF-alpha, and IL-1beta effects on TF expression by cultured human term decidual cells (DCs). Serial placental sections were immunostained for TF. Leukocyte-free term DC monolayers were incubated with 10(-8) M estradiol (E2) or E2 plus 10(-7) M medroxyprogestrone acetate (MPA) +/- thrombin or TNF-alpha or IL-1beta. ELISA and Western blotting assessed TF in cell lysates. Quantitative real-time RT-PCR measured TF mRNA levels. Immunolocalized TF in DC membranes in preterm and term placental sections displayed higher Histologic Scores than villous mesenchymal cells (P term placental sections, DC-expressed TF exceeds that of other cell types at the maternal-fetal interface and is localized at the cell membranes in which it can bind to factor VII and meet the hemostatic demands of labor and delivery via thrombin formation. Unlike the general concept that TF is constitutive in cells that highly express it, MPA and thrombin significantly enhanced TF expression in term DC monolayers.
Expression of cDNAs in human Natural Killer cell lines by retroviral transduction.
Miah, S M Shahjahan; Campbell, Kerry S
2010-01-01
Human NK-like cell lines are difficult to transfect using standard mammalian expression vectors and conventional transfection protocols, but they are susceptible to retroviral transduction as a means to introduce cDNAs. Our laboratory has exploited this technique to study a number of receptors in human NK cell lines. The method utilizes a bicistronic retroviral vector that co-expresses either drug resistance or enhanced green fluorescent protein (EGFP) in parallel with the gene of interest. After a single infection with recombinant retrovirus, transduced NK cells can be sorted for expression of EGFP or the transduced cell surface marker. Alternatively, cells expressing the transduced cDNAs can be selected for by treatment with neomycin, puromycin, or hygromycin. Using this method, the sorted/selected cells uniformly express the gene of interest and the expression is stable for many weeks of culture.
Sex-Dependent Gene Expression in Human Pluripotent Stem Cells
Directory of Open Access Journals (Sweden)
Daniel Ronen
2014-08-01
Full Text Available Males and females have a variety of sexually dimorphic traits, most of which result from hormonal differences. However, differences between male and female embryos initiate very early in development, before hormonal influence begins, suggesting the presence of genetically driven sexual dimorphisms. By comparing the gene expression profiles of male and X-inactivated female human pluripotent stem cells, we detected Y-chromosome-driven effects. We discovered that the sex-determining gene SRY is expressed in human male pluripotent stem cells and is induced by reprogramming. In addition, we detected more than 200 differentially expressed autosomal genes in male and female embryonic stem cells. Some of these genes are involved in steroid metabolism pathways and lead to sex-dependent differentiation in response to the estrogen precursor estrone. Thus, we propose that the presence of the Y chromosome and specifically SRY may drive sex-specific differences in the growth and differentiation of pluripotent stem cells.
DEFF Research Database (Denmark)
Nørgaard, P; Spang-Thomsen, M; Poulsen, H S
1996-01-01
In small-cell lung cancer cell lines resistance to growth inhibition by transforming growth factor (TGF)-beta 1, was previously shown to correlate with lack of TGF-beta receptor I (RI) and II (RII) proteins. To further investigate the role of these receptors, the expression of mRNA for RI, RII...... and beta-glycan (RIII) was examined. The results showed that loss of RII mRNA correlated with TGF-beta 1 resistance. In contrast, RI-and beta-glycan mRNA was expressed by all cell lines, including those lacking expression of these proteins. According to Southern blot analysis, the loss of type II m......RNA was not due to gross structural changes in the gene. The effect of TGF-beta 1 on expression of TGF-beta receptor mRNA (receptor autoregulation) was examined by quantitative Northern blotting in four cell lines with different expression of TGF-beta receptor proteins. In two cell lines expressing all three TGF...
Deficient Fas expression by CD4+ CCR5+ T cells in multiple sclerosis
DEFF Research Database (Denmark)
Julià, Eva; Montalban, Xavier; Al-Zayat, Hammad
2006-01-01
OBJECTIVE: To evaluate whether T cells expressing CCR5 and CXCR3 from multiple sclerosis (MS) patients are more resistant to apoptosis. METHODS: Expression of CD69, TNF-R1, Fas, FasL, bcl-2, and bax was investigated in 41 MS patients and 12 healthy controls by flow cytometry in CD4+ and CD8+ T...... cells expressing CCR5 and CXCR3. RESULTS: In MS patients, the percentage of CD69 was increased and Fas expression decreased in CD4+ CCR5+ T cells. INTERPRETATION: The lower Fas expression in activated CD4+ CCR5+ T cells might contribute to disease pathogenesis by prolonging cell survival and favoring...
Directory of Open Access Journals (Sweden)
Li Qianqian
2010-10-01
Full Text Available Abstract Background Spontaneous immortalisation of cultured mammary epithelial cells (MECs is an extremely rare event, and the molecular mechanism behind spontaneous immortalisation of MECs is unclear. Here, we report the establishment of a spontaneously immortalised bovine mammary epithelial cell line (BME65Cs and the changes in gene expression associated with BME65Cs cells. Results BME65Cs cells maintain the general characteristics of normal mammary epithelial cells in morphology, karyotype and immunohistochemistry, and are accompanied by the activation of endogenous bTERT (bovine Telomerase Reverse Transcriptase and stabilisation of the telomere. Currently, BME65Cs cells have been passed for more than 220 generations, and these cells exhibit non-malignant transformation. The expression of multiple genes was investigated in BME65Cs cells, senescent BMECs (bovine MECs cells, early passage BMECs cells and MCF-7 cells (a human breast cancer cell line. In comparison with early passage BMECs cells, the expression of senescence-relevant apoptosis-related gene were significantly changed in BME65Cs cells. P16INK4a was downregulated, p53 was low expressed and Bax/Bcl-2 ratio was reversed. Moreover, a slight upregulation of the oncogene c-Myc, along with an undetectable level of breast tumor-related gene Bag-1 and TRPS-1, was observed in BME65Cs cells while these genes are all highly expressed in MCF-7. In addition, DNMT1 is upregulated in BME65Cs. These results suggest that the inhibition of both senescence and mitochondrial apoptosis signalling pathways contribute to the immortality of BME65Cs cells. The expression of p53 and p16INK4a in BME65Cs was altered in the pattern of down-regulation but not "loss", suggesting that this spontaneous immortalization is possibly initiated by other mechanism rather than gene mutation of p53 or p16INK4a. Conclusions Spontaneously immortalised BME65Cs cells maintain many characteristics of normal BMEC cells and
Directory of Open Access Journals (Sweden)
Bron Dominique
2008-04-01
Full Text Available Abstract Background Neuronal tissue has limited potential to self-renew or repair after neurological diseases. Cellular therapies using stem cells are promising approaches for the treatment of neurological diseases. However, the clinical use of embryonic stem cells or foetal tissues is limited by ethical considerations and other scientific problems. Thus, bone marrow mesenchymal stomal cells (BM-MSC could represent an alternative source of stem cells for cell replacement therapies. Indeed, many studies have demonstrated that MSC can give rise to neuronal cells as well as many tissue-specific cell phenotypes. Methods BM-MSC were differentiated in neuron-like cells under specific induction (NPBM + cAMP + IBMX + NGF + Insulin. By day ten, differentiated cells presented an expression profile of real neurons. Functionality of these differentiated cells was evaluated by calcium influx through glutamate receptor AMPA3. Results Using microarray analysis, we compared gene expression profile of these different samples, before and after neurogenic differentiation. Among the 1943 genes differentially expressed, genes down-regulated are involved in osteogenesis, chondrogenesis, adipogenesis, myogenesis and extracellular matrix component (tuftelin, AGC1, FADS3, tropomyosin, fibronectin, ECM2, HAPLN1, vimentin. Interestingly, genes implicated in neurogenesis are increased. Most of them are involved in the synaptic transmission and long term potentialisation as cortactin, CASK, SYNCRIP, SYNTL4 and STX1. Other genes are involved in neurite outgrowth, early neuronal cell development, neuropeptide signaling/synthesis and neuronal receptor (FK506, ARHGAP6, CDKRAP2, PMCH, GFPT2, GRIA3, MCT6, BDNF, PENK, amphiregulin, neurofilament 3, Epha4, synaptotagmin. Using real time RT-PCR, we confirmed the expression of selected neuronal genes: NEGR1, GRIA3 (AMPA3, NEF3, PENK and Epha4. Functionality of these neuron-like cells was demonstrated by Ca2+ influx through glutamate
Differential marker expression by cultures rich in mesenchymal stem cells
2013-01-01
Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471
Kim, Dae Seong; Lee, Myoung Woo; Lee, Tae-Hee; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee
2017-03-01
The results of clinical trials using mesenchymal stem cells (MSCs) are controversial due to the heterogeneity of human MSCs and differences in culture conditions. In this regard, it is important to identify gene expression patterns according to culture conditions, and to determine how the cells are expanded and when they should be clinically used. In the current study, stemness gene expression was investigated in adipose tissue-derived MSCs (AT-MSCs) harvested following culture at different densities. AT-MSCs were plated at a density of 200 or 5,000 cells/cm 2 . After 7 days of culture, stemness gene expression was examined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. The proliferation rate of AT-MSCs harvested at a low density (~50% confluent) was higher than that of AT-MSCs harvested at a high density (~90% confluent). Although there were differences in the expression levels of stemness gene, such as octamer-binding transcription factor 4, nanog homeobox ( Nanog ), SRY-box 2, Kruppel like factor 4, v-myc avian myelocytomatosis viral oncogene homolog ( c-Myc ), and lin-28 homolog A, in the AT-MSCs obtained from different donors, RT-qPCR analysis demonstrated differential gene expression patterns according to the cell culture density. Expression levels of stemness genes, particularly Nanog and c-Myc , were upregulated in AT-MSCs harvested at a low density (~50% confluent) in comparison to AT-MSCs from the same donor harvested at a high density (~90% confluent). These results imply that culture conditions, such as the cell density at harvesting, modulate the stemness gene expression and proliferation of MSCs.
DEFF Research Database (Denmark)
Pedersen, M.W.; Andersen, Thomas Thykjær; Ørntoft, Torben Falck
2001-01-01
Previous studies have shown a correlation between expression of the EGF receptor type III mutation (EGFRvIII) and a more malignant phenotype of various cancers including: non-small-cell lung cancer, glioblastoma multiforme, prostate cancer and breast cancer. Thus, a detailed molecular genetic...... understanding of how the EGFRvIII contributes to the malignant phenotype is of major importance for future therapy. The GeneChip Hu6800Set developed by Affymetrix was used to identify changes in gene expression caused by the expression of EGFRvIII. The cell line selected for the study was an EGF receptor...... negative small-cell-lung cancer cell line, GLC3, stably transfected with the EGFRvIII gene in a Tet-On system. By comparison of mRNA levels in EGFRvIII-GLC3 with those of Tet-On-GLC3, it was found that the levels of mRNAs encoding several transcription factors (ATF-3, JunD, and c-Myb), cell adhesion...
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Emson, P C; Westmore, K; Augood, S J [MRC Molecular Neuroscience Group, The Department of Neurobiology, The Babraham Institute, Babraham, Cambridge (United Kingdom)
1996-12-11
The chemical phenotype of proneurotensin messenger RNA-expressing cells was determined in the acute haloperidol-treated rat striatum using a combination of [{sup 35}S]-labelled and alkaline phosphatase-labelled oligonucleotides. Cellular sites of proneurotensin messenger RNA expression were visualized simultaneously on tissue sections processed to reveal cellular sites of preproenkephalin A messenger RNA or the dopamine and adenylate cyclase phosphoprotein-32, messenger RNA. The cellular co-expression of preproenkepahlin A and preprotachykinin messenger RNA was also examined within forebrain structures. Cellular sites of preproenkephalin A and dopamine and adenylate cyclase phosphoprotein-32 messenger RNAs were visualized using alkaline phosphatase-labelled oligonucleotides whilst sites of preprotachykinin and proneurotensin messenger RNA expression were detected using [{sup 35}S]-labelled oligos. Cellular sites of enkephalin and dopamine and adenylate cyclase phosphoprotein-32 gene expression were identified microscopically by the concentration of purple alkaline phosphatase reaction product within the cell cytoplasm, whereas sites of substance P and proneurotensin gene expression were identified by the dense clustering of silver grains overlying cells.An intense hybridization signal was detected for all three neuropeptide messenger RNAs in the striatum, the nucleus accumbens and septum. Dopamine and adenylate cyclase phosphoprotein-32 messenger RNA was detected within the neostriatum but not within the septum. In all forebrain regions examined, with the exception of the islands of Cajella, the cellular expression of enkephalin messenger RNA and substance P messenger RNA was discordant; the two neuropeptide messenger RNAs were detected essentially in different cells, although in the striatum and nucleus accumbens occasional isolated cells were detected which contained both hybridization signals; dense clusters of silver grains overlay alkaline phosphatase
International Nuclear Information System (INIS)
Emson, P.C.; Westmore, K.; Augood, S.J.
1996-01-01
The chemical phenotype of proneurotensin messenger RNA-expressing cells was determined in the acute haloperidol-treated rat striatum using a combination of [ 35 S]-labelled and alkaline phosphatase-labelled oligonucleotides. Cellular sites of proneurotensin messenger RNA expression were visualized simultaneously on tissue sections processed to reveal cellular sites of preproenkephalin A messenger RNA or the dopamine and adenylate cyclase phosphoprotein-32, messenger RNA. The cellular co-expression of preproenkepahlin A and preprotachykinin messenger RNA was also examined within forebrain structures. Cellular sites of preproenkephalin A and dopamine and adenylate cyclase phosphoprotein-32 messenger RNAs were visualized using alkaline phosphatase-labelled oligonucleotides whilst sites of preprotachykinin and proneurotensin messenger RNA expression were detected using [ 35 S]-labelled oligos. Cellular sites of enkephalin and dopamine and adenylate cyclase phosphoprotein-32 gene expression were identified microscopically by the concentration of purple alkaline phosphatase reaction product within the cell cytoplasm, whereas sites of substance P and proneurotensin gene expression were identified by the dense clustering of silver grains overlying cells.An intense hybridization signal was detected for all three neuropeptide messenger RNAs in the striatum, the nucleus accumbens and septum. Dopamine and adenylate cyclase phosphoprotein-32 messenger RNA was detected within the neostriatum but not within the septum. In all forebrain regions examined, with the exception of the islands of Cajella, the cellular expression of enkephalin messenger RNA and substance P messenger RNA was discordant; the two neuropeptide messenger RNAs were detected essentially in different cells, although in the striatum and nucleus accumbens occasional isolated cells were detected which contained both hybridization signals; dense clusters of silver grains overlay alkaline phosphatase-positive cells
Mannose receptor is highly expressed by peritoneal dendritic cells in endometriosis.
Izumi, Gentaro; Koga, Kaori; Takamura, Masashi; Makabe, Tomoko; Nagai, Miwako; Urata, Yoko; Harada, Miyuki; Hirata, Tetsuya; Hirota, Yasushi; Fujii, Tomoyuki; Osuga, Yutaka
2017-01-01
To characterize peritoneal dendritic cells (DCs) in endometriosis and to clarify their role in its etiology. Experimental. University hospital. Sixty-three women (35 patients with endometriosis and 28 control women) who had undergone laparoscopic surgery. Peritoneal DCs from endometriosis and control samples were analyzed for the expression of cell surface markers. Monocyte-derived dendritic cells (Mo-DCs) were cultured with dead endometrial stromal cells (dESCs) to investigate changes in phagocytic activity and cytokine expression. Cell surface markers and cytokine expression and identification with the use of flow cytometry or reverse-transcription polymerase chain reaction (RT-PCR). Changes in cytokine expression and phagocytic activity of Mo-DCs cultured with dESCs and d-mannan were measured with the use of flow cytometry and RT-PCR. The proportion of mannose receptor (MR)-positive myeloid DC type 1 was higher in endometriosis samples than in control samples. The blocking of MR reduced phagocytosis of dESCs by Mo-DCs. Mo-DCs cultured with dESCs expressed higher levels of interleukin (IL) 1β and IL-6 than control samples. Peritoneal DCs in endometriosis tissue express high levels of MR, which promotes phagocytosis of dead endometrial cells and thereby contributes to the etiology of endometriosis. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Ebola virus infection induces irregular dendritic cell gene expression.
Melanson, Vanessa R; Kalina, Warren V; Williams, Priscilla
2015-02-01
Filoviruses subvert the human immune system in part by infecting and replicating in dendritic cells (DCs). Using gene arrays, a phenotypic profile of filovirus infection in human monocyte-derived DCs was assessed. Monocytes from human donors were cultured in GM-CSF and IL-4 and were infected with Ebola virus Kikwit variant for up to 48 h. Extracted DC RNA was analyzed on SuperArray's Dendritic and Antigen Presenting Cell Oligo GEArray and compared to uninfected controls. Infected DCs exhibited increased expression of cytokine, chemokine, antiviral, and anti-apoptotic genes not seen in uninfected controls. Significant increases of intracellular antiviral and MHC I and II genes were also noted in EBOV-infected DCs. However, infected DCs failed to show any significant difference in co-stimulatory T-cell gene expression from uninfected DCs. Moreover, several chemokine genes were activated, but there was sparse expression of chemokine receptors that enabled activated DCs to home to lymph nodes. Overall, statistically significant expression of several intracellular antiviral genes was noted, which may limit viral load but fails to stop replication. EBOV gene expression profiling is of vital importance in understanding pathogenesis and devising novel therapeutic treatments such as small-molecule inhibitors.
Yang, R; Elankumaran, Y; Hijjawi, N; Ryan, U
2015-06-01
A cell-free culture system for Cryptosporidium parvum was analysed using scanning electron microscopy (SEM) to characterise life cycle stages and compare gene expression in cell-free culture and cell culture using HCT-8 cells. Cryptosporidium parvum samples were harvested at 2 h, 8 h, 14 h, 26 h, 50 h, 74 h, 98 h, 122 h and 170 h, chemically fixed and specimens were observed using a Zeiss 1555 scanning electron microscope. The presence of sporozoites, trophozoites and type I merozoites were identified by SEM. Gene expression in cell culture and cell-free culture was studied using reverse transcriptase quantitative PCR (RT-qPCR) of the sporozoite surface antigen protein (cp15), the glycoprotein 900 (gp900), the Cryptosporidium oocyst wall protein (COWP) and 18S ribosomal RNA (rRNA) genes in both cell free and conventional cell culture. In cell culture, cp15 expression peaked at 74 h, gp900 expression peaked at 74 h and 98 h and COWP expression peaked at 50 h. In cell-free culture, CP15 expression peaked at 98 h, gp900 expression peaked at 74 h and COWP expression peaked at 122 h. The present study is the first to compare gene expression of C. parvum in cell culture and cell-free culture and to characterise life cycle stages of C. parvum in cell-free culture using SEM. Findings from this study showed that gene expression patterns in cell culture and cell-free culture were similar but in cell-free culture, gene expression was delayed for CP15 and COWP in cell free culture compared with the cell culture system and was lower. Although three life cycle stageswere conclusively identified, improvements in SEM methodology should lead to the detection of more life cycle stages. Copyright © 2015 Elsevier Inc. All rights reserved.
Cytochromes P450 are Expressed in Proliferating Cells in Barrett's Metaplasia
Directory of Open Access Journals (Sweden)
Steven J. Hughes
1999-06-01
Full Text Available The expression of cytochromes P450 (CYP in Barrett's esophagus and esophageal squamous mucosa was investigated. Esophagectomy specimens from 23 patients were examined for CYP expression of CYP1A2, CYP3A4, CYP2C9/10, and CYP2E1 by immunohistochemical analysis, and the expression of CYP1A1, CYP3A4, CYP1B1, CYP2E1, and CYP2C9/10 in these tissues was further confirmed by reverse transcription polymerase chain reaction. Immunohistochemical analysis of esophageal squamous mucosa (n = 12 showed expression of CYP1A2, CYP3A4, CYP2E1, and CYP2C9/10 proteins, but it was noted that cells within the basal proliferative zone did not express CYPs. Immunohistochemical analysis of Barrett's esophagus (n = 13 showed expression of CYP1A2, CYP3A4, CYP2E1, and CYP2C9/10 that was prominent in the basal glandular regions, which are areas containing a high percentage of actively proliferating cells. Immunohistochemical staining for both proliferating cell nuclear antigen and the CYPs further supported the colocalization of CYP expression to areas of active cell proliferation in Barrett's esophagus, whereas in the esophageal squamous epithelium, CYP expression is limited to cells that are not proliferating. RT-PCR with amplification product sequence analysis confirmed CYP1A1, CYP3A4, CYP1B1, CYP2E1, and CYP2C9/10 mRNA expression in Barrett's esophagus. These data suggest that the potential ability of cells in Barrett's esophagus to both activate carcinogens and proliferate may be important risk factors affecting carcinogenesis in this metaplastic tissue.
Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya
2008-07-16
Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.
Directory of Open Access Journals (Sweden)
Rui Wang
2008-07-01
Full Text Available Regulatory T (T(reg cells control immune activation and maintain tolerance. How T(regs mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32, which within T cells is specifically expressed in T(regs activated through the T cell receptor (TCR. Ectopic expression of GARP in human naïve T (T(N cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N cells induced expression of T(reg master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.
Directory of Open Access Journals (Sweden)
Loy John Dustin
2013-01-01
Full Text Available Abstract Background Bovine viral diarrhea virus is one of the most significant and costly viral pathogens of cattle worldwide. Alphavirus-derived replicon particles have been shown to be safe and highly effective vaccine vectors against a variety of human and veterinary pathogens. Replicon particles are non-propagating, DIVA compatible, and can induce both humoral and cell mediated immune responses. This is the first experiment to demonstrate that Alphavirus-based replicon particles can be utilized in a standard prime/boost vaccination strategy in calves against a commercially significant bovine pathogen. Findings Replicon particles that express bovine viral diarrhea virus sub-genotype 1b E2 glycoprotein were generated and expression was confirmed in vitro using polyclonal and monoclonal antibodies specific to E2. Vaccine made from particles was generated in Vero cells and administered to BVDV free calves in a prime/boost regimen at two dosage levels. Vaccination resulted in neutralizing antibody titers that cross-neutralized both type 1 and type 2 BVD genotypes following booster vaccination. Additionally, high dose vaccine administration demonstrated some protection from clinical disease and significantly reduced the degree of leukopenia caused by viral infection. Conclusions Replicon particle vaccines administered in a prime/boost regimen expressing BVDV E2 glycoprotein can induce cross-neutralizing titers, reduce leukopenia post challenge, and mitigate clinical disease in calves. This strategy holds promise for a safe and effective vaccine to BVDV.
Dynamic gene expression for metabolic engineering of mammalian cells in culture.
Le, Huong; Vishwanathan, Nandita; Kantardjieff, Anne; Doo, Inseok; Srienc, Michael; Zheng, Xiaolu; Somia, Nikunj; Hu, Wei-Shou
2013-11-01
Recombinant mammalian cells are the major hosts for the production of protein therapeutics. In addition to high expression of the product gene, a hyper-producer must also harbor superior phenotypic traits related to metabolism, protein secretion, and growth control. Introduction of genes endowing the relevant hyper-productivity traits is a strategy frequently used to enhance the productivity. Most of such cell engineering efforts have been performed using constitutive expression systems. However, cells respond to various environmental cues and cellular events dynamically according to cellular needs. The use of inducible systems allows for time dependent expression, but requires external manipulation. Ideally, a transgene's expression should be synchronous to the host cell's own rhythm, and at levels appropriate for the objective. To that end, we identified genes with different expression dynamics and intensity ranges using pooled transcriptome data. Their promoters may be used to drive the expression of the transgenes following the desired dynamics. We isolated the promoter of the Thioredoxin-interacting protein (Txnip) gene and demonstrated its capability to drive transgene expression in concert with cell growth. We further employed this Chinese hamster promoter to engineer dynamic expression of the mouse GLUT5 fructose transporter in Chinese hamster ovary (CHO) cells, enabling them to utilize sugar according to cellular needs rather than in excess as typically seen in culture. Thus, less lactate was produced, resulting in a better growth rate, prolonged culture duration, and higher product titer. This approach illustrates a novel concept in metabolic engineering which can potentially be used to achieve dynamic control of cellular behaviors for enhanced process characteristics. © 2013 Published by Elsevier Inc.
DEFF Research Database (Denmark)
Collombat, Patrick; Xu, Xiaobo; Ravassard, Philippe
2009-01-01
We have previously reported that the loss of Arx and/or Pax4 gene activity leads to a shift in the fate of the different endocrine cell subtypes in the mouse pancreas, without affecting the total endocrine cell numbers. Here, we conditionally and ectopically express Pax4 using different cell......-specific promoters and demonstrate that Pax4 forces endocrine precursor cells, as well as mature alpha cells, to adopt a beta cell destiny. This results in a glucagon deficiency that provokes a compensatory and continuous glucagon+ cell neogenesis requiring the re-expression of the proendocrine gene Ngn3. However......, the newly formed alpha cells fail to correct the hypoglucagonemia since they subsequently acquire a beta cell phenotype upon Pax4 ectopic expression. Notably, this cycle of neogenesis and redifferentiation caused by ectopic expression of Pax4 in alpha cells is capable of restoring a functional beta cell...
miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy
Directory of Open Access Journals (Sweden)
Martinson Jeremy
2010-02-01
Full Text Available Abstract Background Type-1 T cells are critical for effective anti-tumor immune responses. The recently discovered microRNAs (miRs are a large family of small regulatory RNAs that control diverse aspects of cell function, including immune regulation. We identified miRs differentially regulated between type-1 and type-2 T cells, and determined how the expression of such miRs is regulated. Methods We performed miR microarray analyses on in vitro differentiated murine T helper type-1 (Th1 and T helper type-2 (Th2 cells to identify differentially expressed miRs. We used quantitative RT-PCR to confirm the differential expression levels. We also used WST-1, ELISA, and flow cytometry to evaluate the survival, function and phenotype of cells, respectively. We employed mice transgenic for the identified miRs to determine the biological impact of miR-17-92 expression in T cells. Results Our initial miR microarray analyses revealed that the miR-17-92 cluster is one of the most significantly over-expressed miR in murine Th1 cells when compared with Th2 cells. RT-PCR confirmed that the miR-17-92 cluster expression was consistently higher in Th1 cells than Th2 cells. Disruption of the IL-4 signaling through either IL-4 neutralizing antibody or knockout of signal transducer and activator of transcription (STAT6 reversed the miR-17-92 cluster suppression in Th2 cells. Furthermore, T cells from tumor bearing mice and glioma patients had decreased levels of miR-17-92 when compared with cells from non-tumor bearing counterparts. CD4+ T cells derived from miR-17-92 transgenic mice demonstrated superior type-1 phenotype with increased IFN-γ production and very late antigen (VLA-4 expression when compared with counterparts derived from wild type mice. Human Jurkat T cells ectopically expressing increased levels of miR-17-92 cluster members demonstrated increased IL-2 production and resistance to activation-induced cell death (AICD. Conclusion The type-2-skewing
Directory of Open Access Journals (Sweden)
Takahiro Nagatake
Full Text Available Enteroendocrine cells are solitary epithelial cells scattered throughout the gastrointestinal tract and produce various types of hormones, constituting one of the largest endocrine systems in the body. The study of these rare epithelial cells has been hampered by the difficulty in isolating them because of the lack of specific cell surface markers. Here, we report that enteroendocrine cells selectively express a tight junction membrane protein, claudin-4 (Cld4, and are efficiently isolated with the use of an antibody specific for the Cld4 extracellular domain and flow cytometry. Sorted Cld4+ epithelial cells in the small intestine exclusively expressed a chromogranin A gene (Chga and other enteroendocrine cell-related genes (Ffar1, Ffar4, Gpr119, and the population was divided into two subpopulations based on the activity of binding to Ulex europaeus agglutinin-1 (UEA-1. A Cld4+UEA-1- cell population almost exclusively expressed glucose-dependent insulinotropic polypeptide gene (Gip, thus representing K cells, whereas a Cld4+UEA-1+ cell population expressed other gut hormone genes, including glucagon-like peptide 1 (Gcg, pancreatic polypeptide-like peptide with N-terminal tyrosine amide (Pyy, cholecystokinin (Cck, secretin (Sct, and tryptophan hydroxylase 1 (Tph1. In addition, we found that orally administered luminal antigens were taken up by the solitary Cld4+ cells in the small intestinal villi, raising the possibility that enteroendocrine cells might also play a role in initiation of mucosal immunity. Our results provide a useful tool for the cellular and functional characterization of enteroendocrine cells.
Directory of Open Access Journals (Sweden)
Anajwala Chetan C.
2010-06-01
Full Text Available Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nux-vomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC50 value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 µg/ml by SRB assay and 775.1 & 1461µg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic.
Epigenetic mechanisms of peptidergic regulation of gene expression during aging of human cells.
Ashapkin, V V; Linkova, N S; Khavinson, V Kh; Vanyushin, B F
2015-03-01
Expression levels of genes encoding specific transcription factors and other functionally important proteins vary upon aging of pancreatic and bronchial epithelium cell cultures. The peptides KEDW and AEDL tissue-specifically affect gene expression in pancreatic and bronchial cell cultures, respectively. It is established in this work that the DNA methylation patterns of the PDX1, PAX6, NGN3, NKX2-1, and SCGB1A1 gene promoter regions change upon aging in pancreatic and bronchial cell cultures in correlation with variations in their expression levels. Thus, stable changes in gene expression upon aging of cell cultures could be caused by changes in their promoter methylation patterns. The methylation patterns of the PAX4 gene in pancreatic cells as well as those of the FOXA1, SCGB3A2, and SFTPA1 genes in bronchial cells do not change upon aging and are unaffected by peptides, whereas their expression levels change in both cases. The promoter region of the FOXA2 gene in pancreatic cells contains a small number of methylated CpG sites, their methylation levels being affected by cell culture aging and KEDW, though without any correlation with gene expression levels. The promoter region of the FOXA2 gene is completely unmethylated in bronchial cells irrespective of cell culture age and AEDL action. Changes in promoter methylation might be the cause of age- and peptide-induced variations in expression levels of the PDX1, PAX6, and NGN3 genes in pancreatic cells and NKX2-1 and SCGB1A1 genes in bronchial cells. Expression levels of the PAX4 and FOXA2 genes in pancreatic cells and FOXA1, FOXA2, SCGB3A2, and SFTPA1 genes in bronchial cells seem to be controlled by some other mechanisms.
Horiguchi, Kotaro; Fujiwara, Ken; Higuchi, Masashi; Yoshida, Saishu; Tsukada, Takehiro; Ueharu, Hiroki; Chen, Mo; Hasegawa, Rumi; Takigami, Shu; Ohsako, Shunji; Yashiro, Takashi; Kato, Takako; Kato, Yukio
2014-09-01
Chemokines are mostly small secreted polypeptides whose signals are mediated by seven trans-membrane G-protein-coupled receptors. Their functions include the control of leukocytes and the intercellular mediation of cell migration, proliferation, and adhesion in several tissues. We have previously revealed that the CXC chemokine ligand 12 (CXCL12) and its receptor 4 (CXCR4) are expressed in the anterior pituitary gland, and that the CXCL12/CXCR4 axis evokes the migration and interconnection of S100β-protein-positive cells (S100β-positive cells), which do not produce classical anterior pituitary hormones. However, little is known of the cells producing the other CXCLs and CXCRs or of their characteristics in the anterior pituitary. We therefore examined whether CXCLs and CXCRs occurred in the rat anterior pituitary lobe. We used reverse transcription plus the polymerase chain reaction to analyze the expression of Cxcl and Cxcr and identified the cells that expressed Cxcl by in situ hybridization. Transcripts of Cxcl10 and its receptor (Cxcr3 and toll-like receptor 4, Tlr4) were clearly detected: cells expressing Cxcl10 and Tlr4 were identified amongst S100β-positive cells and those expressing Cxcr3 amongst adrenocorticotropic hormone (ACTH)-producing cells. We also investigated Cxcl10 expression in subpopulations of S100β-positive cells. We separated cultured S100β-positive cells into the round-type (dendritic-cell-like) and process-type (astrocyte- or epithelial-cell-like) by their adherent activity to laminin, a component of the extracellular matrix; CXCL10 was expressed only in round-type S100β-positive cells. Thus, CXCL10 produced by a subpopulation of S100β-positive cells probably exerts an autocrine/paracrine effect on S100β-positive cells and ACTH-producing cells in the anterior lobe.
Ontogeny of human IgE?expressing B cells and plasma cells
Ramadani, F.; Bowen, H.; Upton, N.; Hobson, P. S.; Chan, Y.?C.; Chen, J.?B.; Chang, T. W.; McDonnell, J. M.; Sutton, B. J.; Fear, D. J.; Gould, H. J.
2016-01-01
BACKGROUND: IgE-expressing (IgE+) plasma cells (PCs) provide a continuous source of allergen specific IgE that is central to allergic responses. The extreme sparsity of IgE+ cells in vivo has confined their study almost entirely to mouse models.OBJECTIVE: To characterise the development pathway of human IgE+ PCs and to determine the ontogeny of human IgE+ PCs.METHODS: To generate human IgE+ cells we cultured tonsil B cells with IL-4 and anti-CD40. Using FACS and RT-PCR we examined the phenoty...
2013-01-01
Background Ghrelin is a 28 amino acid peptide hormone that is expressed in the stomach and a range of peripheral tissues, where it frequently acts as an autocrine/paracrine growth factor. Ghrelin is modified by a unique acylation required for it to activate its cognate receptor, the growth hormone secretagogue receptor (GHSR), which mediates many of the actions of ghrelin. Recently, the enzyme responsible for adding the fatty acid residue (octanoyl/acyl group) to the third amino acid of ghrelin, GOAT (ghrelin O-acyltransferase), was identified. Methods We used cell culture, quantitative real-time reverse transcription (RT)-PCR and immunohistochemistry to demonstrate the expression of GOAT in prostate cancer cell lines and tissues from patients. Real-time RT-PCR was used to demonstrate the expression of prohormone convertase (PC)1/3, PC2 and furin in prostate cancer cell lines. Prostate-derived cell lines were treated with ghrelin and desacyl ghrelin and the effect on GOAT expression was measured using quantitative RT-PCR. Results We have demonstrated that GOAT mRNA and protein are expressed in the normal prostate and human prostate cancer tissue samples. The RWPE-1 and RWPE-2 normal prostate-derived cell lines and the LNCaP, DU145, and PC3 prostate cancer cell lines express GOAT and at least one other enzyme that is necessary to produce mature, acylated ghrelin from proghrelin (PC1/3, PC2 or furin). Finally, ghrelin, but not desacyl ghrelin (unacylated ghrelin), can directly regulate the expression of GOAT in the RWPE-1 normal prostate derived cell line and the PC3 prostate cancer cell line. Ghrelin treatment (100nM) for 6 hours significantly decreased GOAT mRNA expression two-fold (P ghrelin did not regulate GOAT expression in the DU145 and LNCaP prostate cancer cell lines. Conclusions This study demonstrates that GOAT is expressed in prostate cancer specimens and cell lines. Ghrelin regulates GOAT expression, however, this is likely to be cell-type specific
Collombat, Patrick; Xu, Xiaobo; Ravassard, Philippe; Sosa-Pineda, Beatriz; Dussaud, Sébastien; Billestrup, Nils; Madsen, Ole D; Serup, Palle; Heimberg, Harry; Mansouri, Ahmed
2009-08-07
We have previously reported that the loss of Arx and/or Pax4 gene activity leads to a shift in the fate of the different endocrine cell subtypes in the mouse pancreas, without affecting the total endocrine cell numbers. Here, we conditionally and ectopically express Pax4 using different cell-specific promoters and demonstrate that Pax4 forces endocrine precursor cells, as well as mature alpha cells, to adopt a beta cell destiny. This results in a glucagon deficiency that provokes a compensatory and continuous glucagon+ cell neogenesis requiring the re-expression of the proendocrine gene Ngn3. However, the newly formed alpha cells fail to correct the hypoglucagonemia since they subsequently acquire a beta cell phenotype upon Pax4 ectopic expression. Notably, this cycle of neogenesis and redifferentiation caused by ectopic expression of Pax4 in alpha cells is capable of restoring a functional beta cell mass and curing diabetes in animals that have been chemically depleted of beta cells.
eXpression2Kinases (X2K) Web: linking expression signatures to upstream cell signaling networks.
Clarke, Daniel J B; Kuleshov, Maxim V; Schilder, Brian M; Torre, Denis; Duffy, Mary E; Keenan, Alexandra B; Lachmann, Alexander; Feldmann, Axel S; Gundersen, Gregory W; Silverstein, Moshe C; Wang, Zichen; Ma'ayan, Avi
2018-05-25
While gene expression data at the mRNA level can be globally and accurately measured, profiling the activity of cell signaling pathways is currently much more difficult. eXpression2Kinases (X2K) computationally predicts involvement of upstream cell signaling pathways, given a signature of differentially expressed genes. X2K first computes enrichment for transcription factors likely to regulate the expression of the differentially expressed genes. The next step of X2K connects these enriched transcription factors through known protein-protein interactions (PPIs) to construct a subnetwork. The final step performs kinase enrichment analysis on the members of the subnetwork. X2K Web is a new implementation of the original eXpression2Kinases algorithm with important enhancements. X2K Web includes many new transcription factor and kinase libraries, and PPI networks. For demonstration, thousands of gene expression signatures induced by kinase inhibitors, applied to six breast cancer cell lines, are provided for fetching directly into X2K Web. The results are displayed as interactive downloadable vector graphic network images and bar graphs. Benchmarking various settings via random permutations enabled the identification of an optimal set of parameters to be used as the default settings in X2K Web. X2K Web is freely available from http://X2K.cloud.
Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation
International Nuclear Information System (INIS)
Osabe, Makoto; Sugatani, Junko; Takemura, Akiko; Yamazaki, Yasuhiro; Ikari, Akira; Kitamura, Naomi; Negishi, Masahiko; Miwa, Masao
2008-01-01
Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2 cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation
Directory of Open Access Journals (Sweden)
Neil Q. Tay
2017-11-01
Full Text Available CD8+ T cells play an important role in providing protective immunity against a wide range of pathogens, and a number of different factors control their activation. Although CD40L-mediated CD40 licensing of dendritic cells (DCs by CD4+ T cells is known to be necessary for the generation of a robust CD8+ T cell response, the contribution of CD8+ T cell-expressed CD40L on DC licensing is less clear. We have previously shown that CD8+ T cells are able to induce the production of IL-12 p70 by DCs in a CD40L-dependent manner, providing some evidence that CD8+ T cell-mediated activation of DCs is possible. To better understand the role of CD40L on CD8+ T cell responses, we generated and characterized CD40L-expressing CD8+ T cells both in vitro and in vivo. We found that CD40L was expressed on 30–50% of effector CD8+ T cells when stimulated and that this expression was transient. The expression of CD40L on CD8+ T cells promoted the proliferation and differentiation of both the CD40L-expressing CD8+ T cells and the bystander effector CD8+ T cells. This process occurred via a cell-extrinsic manner and was mediated by DCs. These data demonstrate the existence of a mechanism where CD8+ T cells and DCs cooperate to maximize CD8+ T cell responses.
[Knock-down of BCL11A expression in breast cancer cells promotes MDA-MB-231 cell apoptosis].
Li, Hongli; Gui, Chen; Yan, Lijun
2016-11-01
Objective To detect the expression and pathological significance of B-cell CLL/lymphoma 11A (BCL11A) in breast cancer and investigate the effect of its silencing on the apoptosis of human MDA-MB-231 breast cancer cells. MethodsImmunohistochemistry was used to detect the expression of BCL11A in 62 cases of human breast cancer tissues and 8 cases of normal tissues. We synthesized siRNA targeting BCL11A, and then siRNA was transfected into MDA-MB-231 cells. Forty-eight hours later, the suppression effect of siRNA on BCL11A was determined by quantitative real-time PCR and Western blotting. The apoptosis of MDA-MB-231 cells was detected by flow cytometry. Results The BCL11A protein was mainly expressed in cytoplasm. The expression level of BCL11A in breast cancer tissues was higher than that in paracancerous tissues. The expression had correlations with tumor grade, tumor stage, while it had no correlations with the patients' age and tumor size. BCL11A-siRNA significantly suppressed the expression of BCL11A mRNA and protein as compared with the control group. MDA-MB-231 cells transfected with BCL11A-siRNA had higher apoptosis rate compared with the control group. Conclusion The BCL11A protein is highly expressed in breast cancer and knock-down of BCL11A promotes the apoptosis of MDA-MB-231 cells.
Directory of Open Access Journals (Sweden)
Lingling Tang
2018-02-01
Full Text Available Lung squamous cell carcinoma (LSCC is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6 significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.
Zha, Xianfeng; Yin, Qingsong; Tan, Huo; Wang, Chunyan; Chen, Shaohua; Yang, Lijian; Li, Bo; Wu, Xiuli; Li, Yangqiu
2013-05-01
Antigen-specific, T-cell receptor (TCR)-modified cytotoxic T lymphocytes (CTLs) that target tumors are an attractive strategy for specific adoptive immunotherapy. Little is known about whether there are any alterations in the gene expression profile after TCR gene transduction in T cells. We constructed TCR gene-redirected CTLs with specificity for diffuse large B-cell lymphoma (DLBCL)-associated antigens to elucidate the gene expression profiles of TCR gene-redirected T-cells, and we further analyzed the gene expression profile pattern of these redirected T-cells by Affymetrix microarrays. The resulting data were analyzed using Bioconductor software, a two-fold cut-off expression change was applied together with anti-correlation of the profile ratios to render the microarray analysis set. The fold change of all genes was calculated by comparing the three TCR gene-modified T-cells and a negative control counterpart. The gene pathways were analyzed using Bioconductor and Kyoto Encyclopedia of Genes and Genomes. Identical genes whose fold change was greater than or equal to 2.0 in all three TCR gene-redirected T-cell groups in comparison with the negative control were identified as the differentially expressed genes. The differentially expressed genes were comprised of 33 up-regulated genes and 1 down-regulated gene including JUNB, FOS, TNF, INF-γ, DUSP2, IL-1B, CXCL1, CXCL2, CXCL9, CCL2, CCL4, and CCL8. These genes are mainly involved in the TCR signaling, mitogen-activated protein kinase signaling, and cytokine-cytokine receptor interaction pathways. In conclusion, we characterized the gene expression profile of DLBCL-specific TCR gene-redirected T-cells. The changes corresponded to an up-regulation in the differentiation and proliferation of the T-cells. These data may help to explain some of the characteristics of the redirected T-cells.
International Nuclear Information System (INIS)
Hatta, Mitsutoki; Naganuma, Kaori; Kato, Kenichi; Yamazaki, Jun
2015-01-01
In tumor tissues, alterations of gene expression caused by aberrant epigenetic modifications confer phenotypic diversity on malignant cells. Although 3-deazaneplanocin A (DZNep) has been shown to reactivate tumor suppressor genes in several cancer cells, it remains unclear whether DZNep attenuates the malignant phenotypes of oral squamous cell carcinoma (OSCC) cells. In this study, we investigated the effect of DZNep on the expression of genes related to aggressive phenotypes, such as epithelial–mesenchymal transition, in OSCC cells. We found that DZNep reduced the cellular levels of polycomb group proteins (EZH2, SUZ12, BMI1, and RING1A) and the associated trimethylation of Lys27 on histone H3 and monoubiquitination of Lys119 on histone H2A in the poorly differentiated OSCC cell line SAS. Immunocytochemical staining demonstrated that DZNep induced the reorganization of filamentous actin and the membrane localization of E-cadherin associated with cell–cell adhesions. We also found an inhibitory effect of DZNep on cell proliferation using a WST assay. Finally, quantitative RT-PCR analysis demonstrated that genes involved in the aggressive phenotypes (TWIST2, EGFR, ACTA2, TGFB1, WNT5B, and APLIN) were down-regulated, whereas epithelial phenotype genes (CDH1, CLDN4, IVL, and TGM1) were up-regulated in SAS cells treated with DZNep. Collectively, our findings suggest that DZNep reverses the aggressive characteristics of OSCC cells through the dynamic regulation of epithelial plasticity via the reprogramming of gene expression patterns. - Highlights: • DZNep reduced PcG proteins and associated histone modifications in OSCC cells. • DZNep enhanced cell–cell adhesion indicative of epithelial phenotype in OSCC cells. • DZNep suppressed the aggressive phenotype-related gene expression in OSCC cells. • DZNep activated the gene expression of epithelial markers in OSCC cells.
Energy Technology Data Exchange (ETDEWEB)
Hatta, Mitsutoki, E-mail: hatta@college.fdcnet.ac.jp [Department of Physiological Science and Molecular Biology, Fukuoka Dental College, Fukuoka (Japan); Naganuma, Kaori [Department of Oral and Maxillofacial Surgery, Fukuoka Dental College, Fukuoka (Japan); Kato, Kenichi; Yamazaki, Jun [Department of Physiological Science and Molecular Biology, Fukuoka Dental College, Fukuoka (Japan)
2015-12-04
In tumor tissues, alterations of gene expression caused by aberrant epigenetic modifications confer phenotypic diversity on malignant cells. Although 3-deazaneplanocin A (DZNep) has been shown to reactivate tumor suppressor genes in several cancer cells, it remains unclear whether DZNep attenuates the malignant phenotypes of oral squamous cell carcinoma (OSCC) cells. In this study, we investigated the effect of DZNep on the expression of genes related to aggressive phenotypes, such as epithelial–mesenchymal transition, in OSCC cells. We found that DZNep reduced the cellular levels of polycomb group proteins (EZH2, SUZ12, BMI1, and RING1A) and the associated trimethylation of Lys27 on histone H3 and monoubiquitination of Lys119 on histone H2A in the poorly differentiated OSCC cell line SAS. Immunocytochemical staining demonstrated that DZNep induced the reorganization of filamentous actin and the membrane localization of E-cadherin associated with cell–cell adhesions. We also found an inhibitory effect of DZNep on cell proliferation using a WST assay. Finally, quantitative RT-PCR analysis demonstrated that genes involved in the aggressive phenotypes (TWIST2, EGFR, ACTA2, TGFB1, WNT5B, and APLIN) were down-regulated, whereas epithelial phenotype genes (CDH1, CLDN4, IVL, and TGM1) were up-regulated in SAS cells treated with DZNep. Collectively, our findings suggest that DZNep reverses the aggressive characteristics of OSCC cells through the dynamic regulation of epithelial plasticity via the reprogramming of gene expression patterns. - Highlights: • DZNep reduced PcG proteins and associated histone modifications in OSCC cells. • DZNep enhanced cell–cell adhesion indicative of epithelial phenotype in OSCC cells. • DZNep suppressed the aggressive phenotype-related gene expression in OSCC cells. • DZNep activated the gene expression of epithelial markers in OSCC cells.
Cell-type-specific expression of NFIX in the developing and adult cerebellum.
Fraser, James; Essebier, Alexandra; Gronostajski, Richard M; Boden, Mikael; Wainwright, Brandon J; Harvey, Tracey J; Piper, Michael
2017-07-01
Transcription factors from the nuclear factor one (NFI) family have been shown to play a central role in regulating neural progenitor cell differentiation within the embryonic and post-natal brain. NFIA and NFIB, for instance, promote the differentiation and functional maturation of granule neurons within the cerebellum. Mice lacking Nfix exhibit delays in the development of neuronal and glial lineages within the cerebellum, but the cell-type-specific expression of this transcription factor remains undefined. Here, we examined the expression of NFIX, together with various cell-type-specific markers, within the developing and adult cerebellum using both chromogenic immunohistochemistry and co-immunofluorescence labelling and confocal microscopy. In embryos, NFIX was expressed by progenitor cells within the rhombic lip and ventricular zone. After birth, progenitor cells within the external granule layer, as well as migrating and mature granule neurons, expressed NFIX. Within the adult cerebellum, NFIX displayed a broad expression profile, and was evident within granule cells, Bergmann glia, and interneurons, but not within Purkinje neurons. Furthermore, transcriptomic profiling of cerebellar granule neuron progenitor cells showed that multiple splice variants of Nfix are expressed within this germinal zone of the post-natal brain. Collectively, these data suggest that NFIX plays a role in regulating progenitor cell biology within the embryonic and post-natal cerebellum, as well as an ongoing role within multiple neuronal and glial populations within the adult cerebellum.
Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis
DEFF Research Database (Denmark)
Jensen, J; Krakauer, M; Sellebjerg, F
2001-01-01
CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...
Wormley, Floyd L.; Chaiban, Joseph; Fidel, Paul L.
2001-01-01
Cell-mediated immunity by Th1-type CD4+ T cells is the predominant host defense mechanism against mucosal candidiasis. However, studies using an estrogen-dependent murine model of vaginal candidiasis have demonstrated little to no change in resident vaginal T cells during infection and no systemic T-cell infiltration despite the presence of Candida-specific systemic Th1-type responses in infected mice. The present study was designed to further investigate these observations by characterizing T-cell activation and cell adhesion molecule expression during primary and secondary C. albicans vaginal infections. While flow cytometry analysis of activation markers showed some evidence for activation of CD3+ draining lymph node and/or vaginal lymphocytes during both primary and secondary vaginal Candida infection, CD3+ cells expressing the homing receptors and integrins α4β7, αM290β7, and α4β1 in draining lymph nodes of mice with primary and secondary infections were reduced compared to results for uninfected mice. At the local level, few vaginal lymphocytes expressed integrins, with only minor changes observed during both primary and secondary infections. On the other hand, immunohistochemical analysis of vaginal cell adhesion molecule expression showed increases in mucosal addressin cell adhesion molecule 1 and vascular cell adhesion molecule 1 expression during both primary and secondary infections. Altogether, these data suggest that although the vaginal tissue is permissive to cellular infiltration during a vaginal Candida infection, the reduced numbers of systemic cells expressing the reciprocal cellular adhesion molecules may preempt cellular infiltration, thereby limiting Candida-specific T-cell responses against infection. PMID:11447188
2011-03-01
Medical Systems, Fort Detrick, Maryland, United States of America Introduction Shiga toxin (Stx) produced by the bacteria Shigella dysenteriae and Shiga...the exception that Vero cells (ATCC CCL-81) (green African monkey ) replaced Sp2/0-Ag14 [73]. Vero cells were maintained in EMEM medium (Eagle’s minimum
Isolamento de Rickettsia em cultura de células vero
Directory of Open Access Journals (Sweden)
Melles Heloisa Helena Barbosa
1999-01-01
Full Text Available Embora o diagnóstico da febre maculosa baseie-se em sinais e sintomas característicos, o mesmo requer confirmação laboratorial, pois existem alguns diagnósticos diferenciais possíveis como meningococcemia, leptospirose, infecção por enterovírus e febre tifóide. A confirmação laboratorial pode ser feita através da pesquisa de anticorpos específicos, possível somente alguns dias após o aparecimento da doença, através do isolamento do agente em amostras de sangue e/ou biópsia de pele, e ainda, de amostras de carrapatos coletados do paciente ou de animais reservatório. O isolamento a partir de sangue ou biópsia de pele resulta em diagnóstico precoce da doença, pois na fase de rickettsemia ainda não há anticorpos detectáveis no sangue. Assim, com o objetivo de facilitar o diagnóstico precoce da febre maculosa, estabelecemos um método de isolamento de rickettsia em cultura de células vero. Para a padronização foi inoculada amostra padrão de Rickettsia rickettsii, cepa Sheyla Smith, cedida pelo CDC. A identificação foi feita através da reação de imunofluorescência indireta. A presença de microrganismos verdes fluorescentes visualizados no interior do citoplasma das células caracterizou o crescimento do agente. Posteriormente, a metodologia foi confirmada pelo isolamento do agente da febre maculosa em amostras de biópsia de pele de paciente proveniente de área endêmica no Estado de São Paulo, bem como, de amostras de carrapato do gênero Amblyomma, considerado o reservatório e transmissor da doença no Brasil.
L-Dopa decarboxylase expression profile in human cancer cells.
Chalatsa, Ioanna; Nikolouzou, Eleftheria; Fragoulis, Emmanuel G; Vassilacopoulou, Dido
2011-02-01
L-Dopa decarboxylase (DDC) catalyses the decarboxylation of L-Dopa. It has been shown that the DDC gene undergoes alternative splicing within its 5'-untranslated region (UTR), in a tissue-specific manner, generating identical protein products. The employment of two alternative 5'UTRs is thought to be responsible for tissue-specific expression of the human DDC mRNA. In this study, we focused on the investigation of the nature of the mRNA expression in human cell lines of neural and non-neural origin. Our results show the expression of a neural-type DDC mRNA splice variant, lacking exon 3 in all cell lines studied. Co-expression of the full length non-neural DDC mRNA and the neural-type DDC splice variant lacking exon 3 was detected in all cell lines. The alternative DDC protein isoform, Alt-DDC, was detected in SH-SY5Y and HeLa cells. Our findings suggest that the human DDC gene undergoes complex processing, leading to the formation of multiple mRNA isoforms. The study of the significance of this phenomenon of multiple DDC mRNA isoforms could provide us with new information leading to the elucidation of the complex biological pathways that the human enzyme is involved in.
Bissa, Massimiliano; Forlani, Greta; Zanotto, Carlo; Tosi, Giovanna; De Giuli Morghen, Carlo; Accolla, Roberto S; Radaelli, Antonia
2018-01-01
A complete eradication of an HIV infection has never been achieved by vaccination and the search for new immunogens that can induce long-lasting protective responses is ongoing. Avipoxvirus recombinants are host-restricted for replication to avian species and they do not have the undesired side effects induced by vaccinia recombinants. In particular, Fowlpox (FP) recombinants can express transgenes over long periods and can induce protective immunity in mammals, mainly due to CD4-dependent CD8+ T cells. In this context, the class II transactivator (CIITA) has a pivotal role in triggering the adaptive immune response through induction of the expression of class-II major histocompatibility complex molecule (MHC-II), that can present antigens to CD4+ T helper cells. Here, we report on construction of novel FPgp and FPenv recombinants that express the highly immunogenic SIV Gag-pro and Env structural antigens. Several FP-based recombinants, with single or dual genes, were also developed that express CIITA, driven from H6 or SP promoters. These recombinants were used to infect CEF and Vero cells in vitro and determine transgene expression, which was evaluated by real-time PCR and Western blotting. Subcellular localisation of the different proteins was evaluated by confocal microscopy, whereas HLA-DR or MHC-II expression was measured by flow cytometry. Fowlpox recombinants were also used to infect syngeneic T/SA tumour cells, then injected into Balb/c mice to elicit MHC-II immune response and define the presentation of the SIV transgene products in the presence or absence of FPCIITA. Antibodies to Env were measured by ELISA. Our data show that the H6 promoter was more efficient than SP to drive CIITA expression and that CIITA can enhance the levels of the gag/pro and env gene products only when infection is performed by FP single recombinants. Also, CIITA expression is higher when carried by FP single recombinants than when combined with FPgp or FPenv constructs and can
Implication of PHF2 Expression in Clear Cell Renal Cell Carcinoma
Directory of Open Access Journals (Sweden)
Cheol Lee
2017-07-01
Full Text Available Background Clear cell renal cell carcinoma (CCRCC is presumed to be associated with adipogenic differentiation. Histone modification is known to be important for adipogenesis, and the function of histone demethylase plant homeodomain finger 2 (PHF2 has been noted. In addition, PHF2 may act as a tumor suppressor via epigenetic regulation of p53 and is reported to be reduced in colon cancer and stomach cancer tissues. In this study, we examined PHF2 expression in CCRCC specimens by immunohistochemistry. Methods We studied 254 CCRCCs and 56 non-neoplastic renal tissues from patients who underwent radical or partial nephrectomy between 2000 and 2003 at the Seoul National University Hospital. Tissue microarray blocks were prepared, and immunohistochemical staining for PHF2 was performed. Results Among 254 CCRCC cases, 150 cases (59.1% showed high expression and 104 cases (40.1% showed low expression. High expression of PHF2 was significantly correlated with a low Fuhrman nuclear grade (p < .001, smaller tumor size (p < .001, low overall stage (p = .003, longer cancer-specific survival (p = .002, and progression-free survival (p < .001 of the patients. However, it was not an independent prognostic factor in multivariate analysis adjusted for Fuhrman nuclear grade and overall stage. Conclusions Our study showed that low expression of PHF2 is associated with aggressiveness and poor prognosis of CCRCC.
Regulation of stem cell factor expression in inflammation and asthma
Directory of Open Access Journals (Sweden)
Carla A Da Silva
2005-03-01
Full Text Available Stem cell factor (SCF is a major mast cell growth factor, which could be involved in the local increase of mast cell number in the asthmatic airways. In vivo, SCF expression increases in asthmatic patients and this is reversed after treatment with glucocorticoids. In vitro in human lung fibroblasts in culture, IL-1beta, a pro-inflammatory cytokine, confirms this increased SCF mRNA and protein expression implying the MAP kinases p38 and ERK1/2 very early post-treatment, and glucocorticoids confirm this decrease. Surprisingly, glucocorticoids potentiate the IL-1beta-enhanced SCF expression at short term treatment, implying increased SCF mRNA stability and SCF gene transcription rate. This potentiation involves p38 and ERK1/2. Transfection experiments with the SCF promoter including intron1 also confirm this increase and decrease of SCF expression by IL-1beta and glucocorticoids, and the potentiation by glucocorticoids of the IL-1beta-induced SCF expression. Deletion of the GRE or kappaB sites abolishes this potentiation, and the effect of IL-1beta or glucocorticoids alone. DNA binding of GR and NF-kappaB are also demonstrated for these effects. In conclusion, this review concerns new mechanisms of regulation of SCF expression in inflammation that could lead to potential therapeutic strategy allowing to control mast cell number in the asthmatic airways.
Negative correlation of LIV-1 and E-cadherin expression in hepatocellular carcinoma cells.
Directory of Open Access Journals (Sweden)
Rongxi Shen
Full Text Available LIV-1, a zinc transporter, is a mediator downstream of STAT3 both in zebrafish and mammalian cells, and is involved in epithelial-mesenchymal transition (EMT. Despite LIV-1 participates in cancer growth and metastasis, little is known about the association of LIV-1 with human liver cancer development. Therefore, the expression of LIV-1 mRNA was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR in 4 cultured cell lines (3 carcinoma and 1 normal liver cell lines, and the localization of LIV-1 protein was investigated by immunohistochemistry. Expression of LIV-1 protein was analyzed by Western blot both in 4 cultured cell lines and 120 liver tissues (100 carcinoma and 20 histologically normal tissues, and the relationship between its expression and clinicopathological finding was investigated in 100 hepatocellular carcinoma(HCC tissues. Then stable siRNA expressing Hep-G2 cells were generated to assess the function of LIV-1 in liver cancer cells. We found that LIV-1 mRNA was more highly expressed in liver cancer cell lines compared to normal liver cell line. Western blot showed the expression of LIV-1 was higher in 61% liver carcinoma tissues than that in normal liver tissues. Down-regulated LIV-1 cells showed significant inhibition of proliferation in vitro and reduction of tumor growth in vivo. Furthermore, E-cadherin expression increased in LIV-1 siRNA expressing Hep-G2. These findings indicated that LIV-1 may induce the EMT in HCC cells.
Growth hormone increases vascular cell adhesion molecule 1 expression
DEFF Research Database (Denmark)
Hansen, Troels Krarup; Fisker, Sanne; Dall, Rolf
2004-01-01
We investigated the impact of GH administration on endothelial adhesion molecules, vascular cell adhesion molecule-1 (VCAM-1) and E-selectin, in vivo and in vitro. Soluble VCAM-1, E-selectin, and C-reactive protein concentrations were measured before and after treatment in 25 healthy subjects...... and 25 adult GH-deficient (GHD) patients randomized to GH treatment or placebo. Furthermore, we studied the direct effect of GH and IGF-I and serum from GH-treated subjects on basal and TNF alpha-stimulated expression of VCAM-1 and E-selectin on cultured human umbilical vein endothelial cells. Baseline......% confidence interval: 95.0-208.7 microg/liter); P cells, there was no direct stimulatory effect of either GH or IGF-I on the expression of VCAM-1 and E-selectin, but serum from GH-treated healthy subjects significantly increased the expression of VCAM-1 (P
International Nuclear Information System (INIS)
De Clercq, E.; Bernaerts, R.; Balzarini, J.; Herdewijn, P.; Verbruggen, A.
1985-01-01
The carbocyclic analogues of (E)-5-(2-bromovinyl)-2'-deoxyuridine (BVDU) and (E)-5-(2-iodovinyl)-2'-deoxyuridine (IVDU), in which the sugar moiety is replaced by a cyclopentane ring and which have been designated as C-BVDU and C-IVDU, respectively, are, like their parent compounds BVDU and IVDU, potent and selective inhibitors of herpes simplex virus type 1 (HSV-1) and, to a lesser extent, herpes simplex virus type 2 (HSV-2) replication. The authors have now synthesized the radiolabeled C-IVDU analogue, C-[ 125 I]IVDU, and determined its metabolism by HSV-infected and mock-infected Vero cells. C-[ 125 I]IVDU was effectively phosphorylated by HSV-1-infected cells and, to a lesser extent, HSV-2-infected cells. C-[ 125 I]IVDU was not phosphorylated to an appreciable extent by either mock-infected cells or cells that had been infected with a thymidine kinase-deficient mutant of HSV-1. Furthermore, C-[ 125 I]IVDU was incorporated into both viral and cellular DNA of HSV-1-infected Vero cells. This finding represents the first demonstration of the incorporation of a cyclopentylpyrimidine into DNA
Cao, Lin-Lin; Du, Changzheng; Liu, Hangqi; Pei, Lin; Qin, Li; Jia, Mei; Wang, Hui
2018-04-01
Lysine-specific demethylase 2A (KDM2A), a specific H3K36me1/2 demethylase, has been reported to be closely associated with several types of cancer. In this study, we aimed to investigate the expression and function of KDM2A in colorectal adenocarcinoma. A total of 215 colorectal adenocarcinoma specimens were collected, and then subjected to immunohistochemistry assay to evaluate the expression levels of KDM2A, cyclin D1 and other proteins in colorectal adenocarcinoma tissues. Real-time polymerase chain reaction, Western blot, and other molecular biology methods were used to explore the role of KDM2A in colorectal adenocarcinoma cells. In this study, we report that the expression level of KDM2A is high in colorectal adenocarcinoma tissues, and this high expression promotes the proliferation and colony formation of colorectal adenocarcinoma cells, as demonstrated by KDM2A knockdown experiments. In addition, the expression of KDM2A is closely associated with cyclin D1 expression in colorectal adenocarcinoma tissues and cell lines. Our study reveals a novel role for high-expressed KDM2A in colorectal adenocarcinoma cell growth, and that the expression of KDM2A is associated with that of cyclin D1 in colorectal adenocarcinoma.
Expression of HER2/Neu in B-Cell Acute Lymphoblastic Leukemia.
Rodriguez-Rodriguez, Sergio; Pomerantz, Alan; Demichelis-Gomez, Roberta; Barrera-Lumbreras, Georgina; Barrales-Benitez, Olga; Aguayo-Gonzalez, Alvaro
2016-01-01
The expression of HER2/neu in B-cell acute lymphoblastic leukemia has been reported in previous studies. The objective of this research was to study the expression of HER2/neu on the blasts of patients with acute leukemia from the Instituto Nacional de Ciencias Medicas y Nutricion Salvador Zubiran. From June 2015 to February 2016, a HER2/neu monoclonal antibody was added to the panel of antibodies that we routinely use in patients with acute leukemia. An expression of ≥ 30% was considered positive. We studied 33 patients: 19 had de novo leukemia (57.6%), three (9.1%) were in relapse, and in 11 (33.3%) their status could not be specified. Seventeen patients (51.5%) were classified as B-cell acute lymphoblastic leukemia with a median expression of HER2/neu of 0.3% (range 0-90.2). Three patients with B-cell acute lymphoblastic leukemia were positive for HER2/neu: 89.4%, 90.9%, and 62.4%. The first and third patient had de novo B-cell acute lymphoblastic leukemia. The second patient was in second relapse after allogeneic stem cell transplant. All three patients were categorized as high-risk at the time of diagnosis. In the studied Mexican population, we found a positive expression of HER2/neu in 17% of the B-cell acute lymphoblastic leukemia patients, similar to previous studies in which the expression was found in 15-50%.
Dong, Jianfeng; Cheng, Lijun; Zhao, Minchao; Pan, Xiangfeng; Feng, Zhiqiang; Wang, Dawei
2017-05-01
Oropharyngeal head and neck squamous cell carcinoma is a common malignant tumor in the oral cavity. High-risk human papillomavirus 16 infection is a major cause of oropharyngeal head and neck squamous cell carcinoma development. Strong antitumor immune responses, especially CD8 + T cell responses, are thought to be essential to effective cancer treatment and are associated with better prognosis in oropharyngeal head and neck squamous cell carcinoma. In this study, we examined the role of the Tim-3/Gal-9 pathway in oropharyngeal head and neck squamous cell carcinoma patients. We found that Gal-9 expression by CD4 + T cells was increased in human papillomavirus-positive oropharyngeal head and neck squamous cell carcinoma patients, but not in human papillomavirus-negative oropharyngeal head and neck squamous cell carcinoma patients. Increased Gal-9 secretion by CD4 + T cells presented multiple immunosuppressive effects. Coculturing monocytes with high Gal-9-expressing CD4 + T cells resulted in the expansion of Tim-3 + monocytes, which suppressed interferon gamma production by activated CD8 + T cells. Subsequently, total monocytes incubated with exogenous Gal-9, or high Gal-9-expressing CD4 + T cells, suppressed the expression of interferon gamma by CD8 + T cells. Exogenous Gal-9 and high Gal-9-expressing CD4 + T cells also suppressed the secretion of both interleukin 10 and interleukin 12 by monocytes. These effects are Tim-3/Gal-9-dependent because blocking Tim-3 and/or Gal-9 could enhance the support of CD8 + T cell interferon gamma production and the interleukin 10 and interleukin 12 secretion by monocytes. Together, these data suggest that the high Tim-3 expression in monocytes could be utilized by tumor-promoting Gal-9 expression on CD4 + T cells. Immunotherapy in human papillomavirus-positive oropharyngeal head and neck squamous cell carcinoma patients therefore faces an additional challenge posed by Tim-3 and Gal-9 and likely requires the blockade of these
Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell.
Li, Ning; Zhang, Fangfang; Li, Suyun; Zhou, Suzhen
2014-02-21
It is reported that MicroRNA-503 (miR-503) regulates cell apoptosis, and thus modulates the resistance of non-small cell lung cancer cells (NSCLC) to cisplatin. However, the exact role of miR-503 in NSCLC remains unknown. In the present study, the level of miR-503 expression in NSCLC was evaluated using realtime PCR, and the DNA methylation status within miR-503 promoter was analyzed by Combined Bisulfite Restriction Analysis (COBRA) or bisulfite-treated DNA sequencing assays (BSP). We found that the expression of miR-503 was significantly decreased in NSCLC tissues compared to normal tissues. A statistically significant inverse association was found between miR-503 methylation status and expression of the miR-503 in tumor tissues (PFANCA) gene and represses its expression at the transcriptional level. Taken together, our results suggest that miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin at least in part by targeting FANCA. Copyright © 2014 Elsevier Inc. All rights reserved.
types sat 1 and sat 2 in bhk, bk, vero and lk cell
African Journals Online (AJOL)
BSN
i\\IATERIALS AND i\\IETllODS. Viruses: 1\\ total or 14 F~~[) ,·1rus isolates \\\\l'l"L' used. I hesc include. :\\ig I 9..J ..... CELLS LOG TCI. DR50. 3.24. 119 ... 3.4 1. 4.25. 4.56. 5.25. 4.38. ·---. --I. I. TABLE IV: TITRE OF SOME SAT 2 STRAINS OF F\\1D IN BTY urns AND BHK - 21. CELLS. VIRUS STRAINS TITRE IN BTY. 1 l"IRE 11 IBRS ...
Al Sayed, Mohamad F; Ruckstuhl, Carla A; Hilmenyuk, Tamara; Claus, Christina; Bourquin, Jean-Pierre; Bornhauser, Beat C; Radpour, Ramin; Riether, Carsten; Ochsenbein, Adrian F
2017-07-20
The interaction of the tumor necrosis factor receptor (TNFR) CD27 with its ligand CD70 is an emerging target to treat cancer. CD27 signaling provides costimulatory signals to cytotoxic T cells but also increases the frequency of regulatory T cells. Similar to other TNFR ligands, CD70 has been shown to initiate intracellular signaling pathways (CD70 reverse signaling). CD27 is expressed on a majority of B-cell non-Hodgkin lymphoma, but its role in the immune control of lymphoma and leukemia is unknown. We therefore generated a cytoplasmic deletion mutant of CD27 (CD27-trunc) to study the role of CD70 reverse signaling in the immunosurveillance of B-cell malignancies in vivo. Expression of CD27-trunc on malignant cells increased the number of tumor-infiltrating interferon γ-producing natural killer (NK) cells. In contrast, the antitumoral T-cell response remained largely unchanged. CD70 reverse signaling in NK cells was mediated via the AKT signaling pathway and increased NK cell survival and effector function. The improved immune control by activated NK cells prolonged survival of CD27-trunc-expressing lymphoma-bearing mice. Finally, CD70 reverse signaling enhanced survival and effector function of human NK cells in a B-cell acute lymphoblastic leukemia xenotransplants model. Therefore, CD70 reverse signaling in NK cells contributes to the immune control of CD27-expressing B-cell lymphoma and leukemia. © 2017 by The American Society of Hematology.
Analysis of gene expression levels in individual bacterial cells without image segmentation
International Nuclear Information System (INIS)
Kwak, In Hae; Son, Minjun; Hagen, Stephen J.
2012-01-01
Highlights: ► We present a method for extracting gene expression data from images of bacterial cells. ► The method does not employ cell segmentation and does not require high magnification. ► Fluorescence and phase contrast images of the cells are correlated through the physics of phase contrast. ► We demonstrate the method by characterizing noisy expression of comX in Streptococcus mutans. -- Abstract: Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly.
Dental enamel cells express functional SOCE channels.
Nurbaeva, Meerim K; Eckstein, Miriam; Concepcion, Axel R; Smith, Charles E; Srikanth, Sonal; Paine, Michael L; Gwack, Yousang; Hubbard, Michael J; Feske, Stefan; Lacruz, Rodrigo S
2015-10-30
Dental enamel formation requires large quantities of Ca(2+) yet the mechanisms mediating Ca(2+) dynamics in enamel cells are unclear. Store-operated Ca(2+) entry (SOCE) channels are important Ca(2+) influx mechanisms in many cells. SOCE involves release of Ca(2+) from intracellular pools followed by Ca(2+) entry. The best-characterized SOCE channels are the Ca(2+) release-activated Ca(2+) (CRAC) channels. As patients with mutations in the CRAC channel genes STIM1 and ORAI1 show abnormal enamel mineralization, we hypothesized that CRAC channels might be an important Ca(2+) uptake mechanism in enamel cells. Investigating primary murine enamel cells, we found that key components of CRAC channels (ORAI1, ORAI2, ORAI3, STIM1, STIM2) were expressed and most abundant during the maturation stage of enamel development. Furthermore, inositol 1,4,5-trisphosphate receptor (IP3R) but not ryanodine receptor (RyR) expression was high in enamel cells suggesting that IP3Rs are the main ER Ca(2+) release mechanism. Passive depletion of ER Ca(2+) stores with thapsigargin resulted in a significant raise in [Ca(2+)]i consistent with SOCE. In cells pre-treated with the CRAC channel blocker Synta-66 Ca(2+) entry was significantly inhibited. These data demonstrate that enamel cells have SOCE mediated by CRAC channels and implicate them as a mechanism for Ca(2+) uptake in enamel formation.
Directory of Open Access Journals (Sweden)
José Antonio GARZÓN BLANCO
2010-02-01
Full Text Available RESUMEN: Lucio Vero, hijo de Elio, un oscuro y tempranamente fallecido primer sucesor de Adriano, parece destinado, desde un primer momento, a ocupar un papel secundario en el gobierno conjunto con Marco Aurelio. La Historia Augusta lo presenta como un personaje despreocupado, con una vida relajada y placentera, frente a la severidad y austeridad de Marco Aurelio; actualmente, parece que los hechos no se ajustan a esta descripción como han demostrado P. Lambrechts y otros autores modernos. Sus acuñaciones numismáticas, más cortas que las de su colega en el Imperio al haber muerto prematuramente, presentan en general los patrones de las emisiones de Marco Aurelio, y también ciertas originalidades entre las que destacarían algunos rasgos de la personalidad y de las actuaciones de Lucio Vero, por lo cual merece la pena su estudio, aunque solo sea por aclarar aspectos poco nítidos de la política general de finales del siglo II.ABSTRACT: This word es trying to investigate in important aspects the imperial roman propaganda through numismatics. The second century D.C. has been called with every right «The Golden Age of the Antoninos»; indeed, during this century a unique class emerges in Universal History: That of Philosopher emperors or friends of the philosophers, their activities during their mandates were always governed by the principle of philosophical humanism. Apart from the classical sources, this study of coins is the best source which fells us about these concepts; all taken from the II century A.D. from governement of Lucius Verus.
Single-cell real-time imaging of transgene expression upon lipofection.
Fiume, Giuseppe; Di Rienzo, Carmine; Marchetti, Laura; Pozzi, Daniela; Caracciolo, Giulio; Cardarelli, Francesco
2016-05-20
Here we address the process of lipofection by quantifying the expression of a genetically-encoded fluorescent reporter at the single-cell level, and in real-time, by confocal imaging in live cells. The Lipofectamine gold-standard formulation is compared to the alternative promising DC-Chol/DOPE formulation. In both cases, we report that only dividing cells are able to produce a detectable amount of the fluorescent reporter protein. Notably, by measuring fluorescence over time in each pair of daughter cells, we find that Lipofectamine-based transfection statistically yields a remarkably higher degree of "symmetry" in protein expression between daughter cells as compared to DC-Chol/DOPE. A model is envisioned in which the degree of symmetry of protein expression is linked to the number of bioavailable DNA copies within the cell before nuclear breakdown. Reported results open new perspectives for the understanding of the lipofection mechanism and define a new experimental platform for the quantitative comparison of transfection reagents. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Expression of Nanog gene promotes NIH3T3 cell proliferation
International Nuclear Information System (INIS)
Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu
2005-01-01
Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion
Zhou, Yong; Zha, Jie; Lin, Zhijuan; Fang, Zhihong; Zeng, Hanyan; Zhao, Jintao; Luo, Yiming; Li, Zhifeng; Xu, Bing
2018-01-15
Diffuse large B cell lymphoma (DLBCL) is a common B cell malignancy with approximately 30% of patients present relapsed or refractory disease after first-line therapy. Research of further treatment options is needed. Cytotoxic CD4 + T cells express cytolytic molecules and have potential antitumor function. Here, we showed that the CD19 + cells from DLBCL patients presented significantly reduced expression of MHC II molecules than those from healthy controls. Three years after the first-line treatment, patients that presented relapsed disease had significantly lower MHC II expression on their CD19 + cells than patients who did not show recurrence. Examining cytotoxic CD4 + T cells show that DLBCL patients presented significantly elevated frequencies of granzyme A-, granzyme B-, and/or perforin-expressing cytotoxic CD4 + T cells. Also, frequency of cytotoxic CD4 + T cells in DLBCL patients was positively correlated with the MHC II expression level. Subsequently, the cytotoxic potential of CD4 + T cells against autologous CD19 + cells was investigated. We found that the cytotoxic potential of CD4 + T cells was highest in MHC II-high, intermediate in MHC II-mid, and lowest in MHC II-low patients. The percentage of MHC II-expressing viable CD19 + cells presented a significant reduction after longer incubation with cytotoxic CD4 + T cells, suggesting that cytotoxic CD4 + T cells preferentially eliminated MHC II-expressing CD19 + cells. Blocking MHC II on CD19 + cells significantly reduced the cytolytic capacity of CD4 + T cells. Despite these discoveries, the frequency of cytotoxic CD4 + T cells did not predict the clinical outcome of DLBCL patients. Together, these results demonstrated that cytotoxic CD4 + T cells presented an MHC II-dependent cytotoxic potential against autologous CD19 + cells and could potentially represent a future treatment option for DLBCL. Copyright © 2017 Elsevier Inc. All rights reserved.
PDGFR-Β expression in small cell lung cancer patients
International Nuclear Information System (INIS)
Shinohara, Eric T.; Gonzalez, Adriana; Massion, Pierre P.; Olson, Sandra J.; Albert, Jeffrey M.; Shyr, Yu; Carbone, David P.; Johnson, David H.; Hallahan, Dennis E.; Lu Bo
2007-01-01
Background: Platelet derived growth factor (PDGF) and PDGFR-β are expressed and have been found to have prognostic value in several human cancers. Data in non-small-cell cancer cell lines have suggested that PDGFR is a therapeutic target for drug development. In the current study PDGFR-β expression and prognostic value in small cell lung cancer (SCLC) was investigated. Methods and Materials: Paraffin-embedded tissue blocks from 53 patients with limited and extensive stage SCLC were obtained for immunohistochemical staining. Tumors from each patient were sampled 3 times and stained with PDGFR-β specific antibody. Patients were divided into low and high staining groups based on intensity. Results: There was high intensity PDGFR-β staining in 20 patients with SCLC. Another 29 expressed low intensity PDGFR-β staining, with only 4 patients showing no PDGFR-β staining. There was no statistically significant difference in 5 year overall survival between patients with low levels of PDGFR-β staining vs. those with high level staining SCLC tumors (p = 0.538). Conclusions: The present study found that the majority of SCLC patients express, at least, a low level of PDGF-β. However, the level of PDGFR-β expression was not a statistically significant predictor of 5 year overall survival in SCLC
DEFF Research Database (Denmark)
Møller, C J; Christgau, S; Williamson, M R
1992-01-01
The endocrine cells of the pancreas develop from the endoderm and yet display several characteristics of a neuronal phenotype. During embryonic life, ductal epithelial cells give rise to first the glugagon-producing cells (alpha-cells) and then cells that express insulin (beta-cells), somatostatin...... primary islet cells at all ages express unsialylated NCAM and E-cadherin, as do insulinomas, the glucagonomas express the polysialylated NCAM, which is characteristic for developing neurons. The glucagonomas also lose E-cadherin expression and instead express a cadherin which is similar to N...
Directory of Open Access Journals (Sweden)
Susanna Commandeur
Full Text Available Tuberculosis (TB, caused by Mycobacterium tuberculosis (Mtb, remains a leading cause of death worldwide. A better understanding of the role of CD4+ and CD8+ T cells, which are both important to TB protection, is essential to unravel the mechanisms of protection and to identify the key antigens seen by these T cells. We have recently identified a set of in vivo expressed Mtb genes (IVE-TB which is expressed during in vivo pulmonary infection in mice, and shown that their encoded antigens are potently recognized by polyclonal T cells from tuberculin skin test-positive, in vitro ESAT-6/CFP10-responsive individuals. Here we have cloned T cells specific for one of these newly identified in vivo expressed Mtb (IVE-TB antigens, Rv2034. T cells were enriched based on the expression of CD154 (CD40L, which represents a new method for selecting antigen-specific (low frequency T cells independent of their specific function. An Rv2034-specific CD4+ T-cell clone expressed the Th1 markers T-bet, IFN-γ, TNF-α, IL-2 and the cytotoxicity related markers granzyme B and CD107a as measured by flow cytometry. The clone specifically recognized Rv2034 protein, Rv2034 peptide p81-100 and Mtb lysate. Remarkably, while the recognition of the dominant p81-100 epitope was HLA-DR restricted, the T-cell clone also recognized a neighboring epitope (p88-107 in an HLA-DR- as well as HLA-DQ1-restricted fashion. Importantly, the T-cell clone was able to inhibit Mtb outgrowth from infected monocytes significantly. The characterization of the polyfunctional and Mtb inhibitory T-cell response to IVE-TB Rv2034 at the clonal level provides detailed further insights into the potential of IVE-TB antigens as new vaccine candidate antigens in TB. Our new approach allowed the identification of T-cell subsets that likely play a significant role in controlling Mtb infection, and can be applied to the analysis of T-cell responses in patient populations.
Fanconi anemia genes are highly expressed in primitive CD34+ hematopoietic cells
Directory of Open Access Journals (Sweden)
Brodeur Isabelle
2003-06-01
Full Text Available Abstract Background Fanconi anemia (FA is a complex recessive genetic disease characterized by progressive bone marrow failure (BM and a predisposition to cancer. We have previously shown using the Fancc mouse model that the progressive BM failure results from a hematopoietic stem cell defect suggesting that function of the FA genes may reside in primitive hematopoietic stem cells. Methods Since genes involved in stem cell differentiation and/or maintenance are usually regulated at the transcription level, we used a semiquantitative RT-PCR method to evaluate FA gene transcript levels in purified hematopoietic stem cells. Results We show that most FA genes are highly expressed in primitive CD34-positive and negative cells compared to lower levels in more differentiated cells. However, in CD34- stem cells the Fancc gene was found to be expressed at low levels while Fancg was undetectable in this population. Furthermore, Fancg expression is significantly decreased in Fancc -/- stem cells as compared to wild-type cells while the cancer susceptibility genes Brca1 and Fancd1/Brac2 are upregulated in Fancc-/- hematopoietic cells. Conclusions These results suggest that FA genes are regulated at the mRNA level, that increased Fancc expression in LTS-CD34+ cells correlates with a role at the CD34+ differentiation stage and that lack of Fancc affects the expression of other FA gene, more specifically Fancg and Fancd1/Brca2, through an unknown mechanism.
Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX
Directory of Open Access Journals (Sweden)
Hangjun Ruan
1999-11-01
Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.
Energy Technology Data Exchange (ETDEWEB)
Ebe, Kazuyu, E-mail: nrr24490@nifty.com; Tokuyama, Katsuichi; Baba, Ryuta; Ogihara, Yoshisada; Ichikawa, Kosuke; Toyama, Joji [Joetsu General Hospital, 616 Daido-Fukuda, Joetsu-shi, Niigata 943-8507 (Japan); Sugimoto, Satoru [Juntendo University Graduate School of Medicine, Bunkyo-ku, Tokyo 113-8421 (Japan); Utsunomiya, Satoru; Kagamu, Hiroshi; Aoyama, Hidefumi [Graduate School of Medical and Dental Sciences, Niigata University, Niigata 951-8510 (Japan); Court, Laurence [The University of Texas MD Anderson Cancer Center, Houston, Texas 77030-4009 (United States)
2015-08-15
Purpose: To develop and evaluate a new video image-based QA system, including in-house software, that can display a tracking state visually and quantify the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system. Methods: Sixteen trajectories in six patients with pulmonary cancer were obtained with the ExacTrac in the Vero4DRT system. Motion data in the cranio–caudal direction (Y direction) were used as the input for a programmable motion table (Quasar). A target phantom was placed on the motion table, which was placed on the 2D ionization chamber array (MatriXX). Then, the 4D modeling procedure was performed on the target phantom during a reproduction of the patient’s tumor motion. A substitute target with the patient’s tumor motion was irradiated with 6-MV x-rays under the surrogate infrared system. The 2D dose images obtained from the MatriXX (33 frames/s; 40 s) were exported to in-house video-image analyzing software. The absolute differences in the Y direction between the center of the exposed target and the center of the exposed field were calculated. Positional errors were observed. The authors’ QA results were compared to 4D modeling function errors and gimbal motion errors obtained from log analyses in the ExacTrac to verify the accuracy of their QA system. The patients’ tumor motions were evaluated in the wave forms, and the peak-to-peak distances were also measured to verify their reproducibility. Results: Thirteen of sixteen trajectories (81.3%) were successfully reproduced with Quasar. The peak-to-peak distances ranged from 2.7 to 29.0 mm. Three trajectories (18.7%) were not successfully reproduced due to the limited motions of the Quasar. Thus, 13 of 16 trajectories were summarized. The mean number of video images used for analysis was 1156. The positional errors (absolute mean difference + 2 standard deviation) ranged from 0.54 to 1.55 mm. The error values differed by less than 1 mm from 4D modeling function errors
International Nuclear Information System (INIS)
Ebe, Kazuyu; Tokuyama, Katsuichi; Baba, Ryuta; Ogihara, Yoshisada; Ichikawa, Kosuke; Toyama, Joji; Sugimoto, Satoru; Utsunomiya, Satoru; Kagamu, Hiroshi; Aoyama, Hidefumi; Court, Laurence
2015-01-01
Purpose: To develop and evaluate a new video image-based QA system, including in-house software, that can display a tracking state visually and quantify the positional accuracy of dynamic tumor tracking irradiation in the Vero4DRT system. Methods: Sixteen trajectories in six patients with pulmonary cancer were obtained with the ExacTrac in the Vero4DRT system. Motion data in the cranio–caudal direction (Y direction) were used as the input for a programmable motion table (Quasar). A target phantom was placed on the motion table, which was placed on the 2D ionization chamber array (MatriXX). Then, the 4D modeling procedure was performed on the target phantom during a reproduction of the patient’s tumor motion. A substitute target with the patient’s tumor motion was irradiated with 6-MV x-rays under the surrogate infrared system. The 2D dose images obtained from the MatriXX (33 frames/s; 40 s) were exported to in-house video-image analyzing software. The absolute differences in the Y direction between the center of the exposed target and the center of the exposed field were calculated. Positional errors were observed. The authors’ QA results were compared to 4D modeling function errors and gimbal motion errors obtained from log analyses in the ExacTrac to verify the accuracy of their QA system. The patients’ tumor motions were evaluated in the wave forms, and the peak-to-peak distances were also measured to verify their reproducibility. Results: Thirteen of sixteen trajectories (81.3%) were successfully reproduced with Quasar. The peak-to-peak distances ranged from 2.7 to 29.0 mm. Three trajectories (18.7%) were not successfully reproduced due to the limited motions of the Quasar. Thus, 13 of 16 trajectories were summarized. The mean number of video images used for analysis was 1156. The positional errors (absolute mean difference + 2 standard deviation) ranged from 0.54 to 1.55 mm. The error values differed by less than 1 mm from 4D modeling function errors
Zahoor, Muhammad; Westhrin, Marita; Aass, Kristin Roseth; Moen, Siv Helen; Misund, Kristine; Psonka-Antonczyk, Katarzyna Maria; Giliberto, Mariaserena; Buene, Glenn; Sundan, Anders; Waage, Anders; Sponaas, Anne-Marit; Standal, Therese
2017-12-26
Multiple myeloma (MM) is a hematologic cancer characterized by expansion of malignant plasma cells in the bone marrow. Most patients develop an osteolytic bone disease, largely caused by increased osteoclastogenesis. The myeloma bone marrow is hypoxic, and hypoxia may contribute to MM disease progression, including bone loss. Here we identified interleukin-32 (IL-32) as a novel inflammatory cytokine expressed by a subset of primary MM cells and MM cell lines. We found that high IL-32 gene expression in plasma cells correlated with inferior survival in MM and that IL-32 gene expression was higher in patients with bone disease compared with those without. IL-32 was secreted from MM cells in extracellular vesicles (EVs), and those EVs, as well as recombinant human IL-32, promoted osteoclast differentiation both in vitro and in vivo. The osteoclast-promoting activity of the EVs was IL-32 dependent. Hypoxia increased plasma-cell IL-32 messenger RNA and protein levels in a hypoxia-inducible factor 1α-dependent manner, and high expression of IL-32 was associated with a hypoxic signature in patient samples, suggesting that hypoxia may promote expression of IL-32 in MM cells. Taken together, our results indicate that targeting IL-32 might be beneficial in the treatment of MM bone disease in a subset of patients.
Effect of blocking Rac1 expression in cholangiocarcinoma QBC939 cells
Directory of Open Access Journals (Sweden)
Liu Xudong
2011-05-01
Full Text Available Cholangiocarcinomas (CCs are malignant tumors that originate from epithelial cells lining the biliary tree and gallbladder. Ras correlative C3 creotoxin substrate 1 (Rac1, a small guanosine triphosphatase, is a critical mediator of various aspects of endothelial cell functions. The objective of the present investigation was to study the effect of blocking Rac1 expression in CCs. Seventy-four extrahepatic CC (ECC specimens and matched adjacent normal mucosa were obtained from the Department of Pathology, Inner Mongolia Medicine Hospital, between 2007 and 2009. Our results showed that the expression of Rac1 was significantly higher (53.12% in tumor tissues than in normal tissues. Western blotting data indicated a significant reduction in Rac1-miRNA cell protein levels. Rac1-miRNA cell growth rate was significantly different at 24, 48, and 72 h after transfection. Flow cytometry analysis showed that Rac1-miRNA cells undergo apoptosis more effectively than control QBC939 cells. Blocking Rac1 expression by RNAi effectively inhibits the growth of CCs. miRNA silencing of the Rac1 gene suppresses proliferation and induces apoptosis of QBC939 cells. These results suggest that Rac1 may be a new gene therapy target for CC. Blocking Rac1 expression in CC cells induces apoptosis of these tumor cells and may thus represent a new therapeutic approach.
Directory of Open Access Journals (Sweden)
Bettina S Buchmaier
Full Text Available Osmotic stress has been shown to regulate cytoskeletal protein expression. It is generally known that vimentin is rapidly degraded during apoptosis by multiple caspases, resulting in diverse vimentin fragments. Despite the existence of the known apoptotic vimentin fragments, we demonstrated in our study the existence of different forms of vimentin VIM I, II, III, and IV with different molecular weights in various renal cell lines. Using a proteomics approach followed by western blot analyses and immunofluorescence staining, we proved the apoptosis-independent existence and differential regulation of different vimentin forms under varying conditions of osmolarity in renal cells. Similar impacts of osmotic stress were also observed on the expression of other cytoskeleton intermediate filament proteins; e.g., cytokeratin. Interestingly, 2D western blot analysis revealed that the forms of vimentin are regulated independently of each other under glucose and NaCl osmotic stress. Renal cells, adapted to high NaCl osmotic stress, express a high level of VIM IV (the form with the highest molecular weight, besides the three other forms, and exhibit higher resistance to apoptotic induction with TNF-α or staurosporin compared to the control. In contrast, renal cells that are adapted to high glucose concentration and express only the lower-molecular-weight forms VIM I and II, were more susceptible to apoptosis. Our data proved the existence of different vimentin forms, which play an important role in cell resistance to osmotic stress and are involved in cell protection against apoptosis.
Digital sorting of complex tissues for cell type-specific gene expression profiles.
Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong
2013-03-07
Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.
International Nuclear Information System (INIS)
Pascal, Laura E; Liu, Alvin Y; Vêncio, Ricardo ZN; Page, Laura S; Liebeskind, Emily S; Shadle, Christina P; Troisch, Pamela; Marzolf, Bruz; True, Lawrence D; Hood, Leroy E
2009-01-01
Prostate cancer cells in primary tumors have been typed CD10 - /CD13 - /CD24 hi /CD26 + /CD38 lo /CD44 - /CD104 - . This CD phenotype suggests a lineage relationship between cancer cells and luminal cells. The Gleason grade of tumors is a descriptive of tumor glandular differentiation. Higher Gleason scores are associated with treatment failure. CD26 + cancer cells were isolated from Gleason 3+3 (G3) and Gleason 4+4 (G4) tumors by cell sorting, and their gene expression or transcriptome was determined by Affymetrix DNA array analysis. Dataset analysis was used to determine gene expression similarities and differences between G3 and G4 as well as to prostate cancer cell lines and histologically normal prostate luminal cells. The G3 and G4 transcriptomes were compared to those of prostatic cell types of non-cancer, which included luminal, basal, stromal fibromuscular, and endothelial. A principal components analysis of the various transcriptome datasets indicated a closer relationship between luminal and G3 than luminal and G4. Dataset comparison also showed that the cancer transcriptomes differed substantially from those of prostate cancer cell lines. Genes differentially expressed in cancer are potential biomarkers for cancer detection, and those differentially expressed between G3 and G4 are potential biomarkers for disease stratification given that G4 cancer is associated with poor outcomes. Differentially expressed genes likely contribute to the prostate cancer phenotype and constitute the signatures of these particular cancer cell types
Rezaei, Maryam; Cao, Jiahui; Friedrich, Katrin; Kemper, Björn; Brendel, Oliver; Grosser, Marianne; Adrian, Manuela; Baretton, Gustavo; Breier, Georg; Schnittler, Hans-Joachim
2018-01-01
The cadherin switch has profound consequences on cancer invasion and metastasis. The endothelial-specific vascular endothelial cadherin (VE-cadherin) has been demonstrated in diverse cancer types including breast cancer and is supposed to modulate tumor progression and metastasis, but underlying mechanisms need to be better understood. First, we evaluated VE-cadherin expression by tissue microarray in 392 cases of breast cancer tumors and found a diverse expression and distribution of VE-cadherin. Experimental expression of fluorescence-tagged VE-cadherin (VE-EGFP) in undifferentiated, fibroblastoid and E-cadherin-negative MDA-231 (MDA-VE-EGFP) as well as in differentiated E-cadherin-positive MCF-7 human breast cancer cell lines (MCF-VE-EGFP), respectively, displayed differentiation-dependent functional differences. VE-EGFP expression reversed the fibroblastoid MDA-231 cells to an epithelial-like phenotype accompanied by increased β-catenin expression, actin and vimentin remodeling, increased cell spreading and barrier function and a reduced migration ability due to formation of VE-cadherin-mediated cell junctions. The effects were largely absent in both MDA-VE-EGFP and in control MCF-EGFP cell lines. However, MCF-7 cells displayed a VE-cadherin-independent planar cell polarity and directed cell migration that both developed in MDA-231 only after VE-EGFP expression. Furthermore, VE-cadherin expression had no effect on tumor cell proliferation in monocultures while co-culturing with endothelial cells enhanced tumor cell proliferation due to integration of the tumor cells into monolayer where they form VE-cadherin-mediated cell contacts with the endothelium. We propose an interactive VE-cadherin-based crosstalk that might activate proliferation-promoting signals. Together, our study shows a VE-cadherin-mediated cell dynamics and an endothelial-dependent proliferation in a differentiation-dependent manner.
Sharma, Ruchi; George, Aman; Kamble, Nitin M; Chauhan, Manmohan S; Singla, Suresh; Manik, Radhey S; Palta, Prabhat
2012-01-01
The present study examined the expression profile of buffalo fetal fibroblasts (BFF) used as a feeder layer for embryonic stem (ES) cell-like cells. The expression of important growth factors was detected in cells at different passages. Mitomycin-C inactivation increased relative expression levels of ACTIVIN-A, TGF-β1, BMP-4 and GREMLIN but not of fibroblast growth factor-2 (FGF-2). The expression level of ACTIVIN-A, transforming growth factor-β1 (TGF-β1), bone morphogenetic protein-4 (BMP-4) and FGF-2 was similar in buffalo fetal fibroblast (BFF) cultured in stem cell medium (SCM), SCM+1000IU mL(-1) leukemia inhibitory factor (LIF), SCM+5 ngmL(-1) FGF-2 or SCM+LIF+FGF-2 for 24 h whereas GREMLIN expression was higher in FGF-2-supplemented groups. In spent medium, the concentration of ACTIVIN-A was higher in FGF-2-supplemented groups whereas that of TGF-β1 was similar in SCM and LIF+FGF-2, which was higher than when either LIF or FGF-2 was used alone. Following culture of ES cell-like cells on a feeder layer for 24 h, the TGF-β1 concentration was higher with LIF+FGF-2 than with LIF or FGF-2 alone which, in turn, was higher than that in SCM. In the LIF+FGF-2 group, the concentration of TGF-β1 was lower and that of ACTIVIN-A was higher in spent medium at 24 h than at 48 h of culture. These results suggest that BFF produce signalling molecules that may help in self-renewal of buffalo ES cell-like cells.
Gene expression patterns in pancreatic tumors, cells and tissues.
Directory of Open Access Journals (Sweden)
Anson W Lowe
2007-03-01
Full Text Available Cancers of the pancreas originate from both the endocrine and exocrine elements of the organ, and represent a major cause of cancer-related death. This study provides a comprehensive assessment of gene expression for pancreatic tumors, the normal pancreas, and nonneoplastic pancreatic disease.DNA microarrays were used to assess the gene expression for surgically derived pancreatic adenocarcinomas, islet cell tumors, and mesenchymal tumors. The addition of normal pancreata, isolated islets, isolated pancreatic ducts, and pancreatic adenocarcinoma cell lines enhanced subsequent analysis by increasing the diversity in gene expression profiles obtained. Exocrine, endocrine, and mesenchymal tumors displayed unique gene expression profiles. Similarities in gene expression support the pancreatic duct as the origin of adenocarcinomas. In addition, genes highly expressed in other cancers and associated with specific signal transduction pathways were also found in pancreatic tumors.The scope of the present work was enhanced by the inclusion of publicly available datasets that encompass a wide spectrum of human tissues and enabled the identification of candidate genes that may serve diagnostic and therapeutic goals.
Transient expression of P-type ATPases in tobacco epidermal cells
DEFF Research Database (Denmark)
Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura
2016-01-01
Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....
International Nuclear Information System (INIS)
Cao, Qizhi; Fu, Aili; Yang, Shude; He, Xiaoli; Wang, Yue; Zhang, Xiaoshu; Zhou, Jiadi; Luan, Xiying; Yu, Wenzheng; Xue, Jiangnan
2015-01-01
Previous studies have shown that leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) is expressed on most types of hamatopoietic cells and negatively regulate immune response, but the roles of LAIR-1 in tumor of the non-hematopoietic lineage have not been determined. Despite advances in therapy of epithelial ovarian cancer (EOC), many questions relating to EOC pathogenesis remain unanswered. The aim of this study was to investigate the clinical significance of LAIR-1 expression in EOC and explore the possible association between LAIR-1 and cancer. In this study, a tissue microarray containing 78 ovarian cancer cases was stained following a standard immunohistochemical protocol for LAIR-1 and the correlation of LAIR-1 expression with clinicopathologic features was assessed. LAIR-1 was detected to express in tumor cells of ovarian cancer tissues (73.1%) and EOC cell lines COC1 and HO8910, not in normal ovarian tissues. In addition, LAIR-1 expression correlates significantly with tumor grade (p = 0.004). Furthermore, down-regulation of LAIR-1 in HO8910 cells increased cell proliferation, colony formation and cell invasion. These data suggest that LAIR-1 has a relevant impact on EOC progression and may be helpful for a better understanding of molecular pathogenesis of cancer. - Highlights: • LAIR-1 is expressed in epithelial ovarian cancer cells. • LAIR-1 expression correlates significantly with tumor grade. • Down-regulation of LAIR-1 expression increased cell proliferation and invasion. • LAIR-1 may be a novel candidate for cancer diagnosis and therapy
Gene Expression Profile of Proton Beam Irradiated Breast Cancer Stem Cells
Energy Technology Data Exchange (ETDEWEB)
Jung, Myung Hwan; Park, Jeong Chan [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2015-05-15
Cancer stem cells (CSCs) possess characteristics associated with normal stem cells. The mechanisms regulating CSC radio-resistance, including to proton beam, remain unclear. They showed that a subset of cells expressing CD44 with weak or no CD24 expression could establish new tumors in xenograft mice. Recently, BCSC-targeting therapies have been evaluated by numerous groups. Strategies include targeting BCSC self-renewal, indirectly targeting the microenvironment, and directly killing BCSCs by chemical agents that induce differentiation, immunotherapy, and oncolytic viruses. However, the mechanisms regulating CSC radio-resistance, particularly proton beam resistance, remain unclear. The identification of CSC-related gene expression patterns would make up offer data for better understanding CSCs properties. In this study we investigated the gene expression profile of BCSCs isolation from MCF-7 cell line. Reducing BCSC resistance to pulsed proton beams is essential to improve therapeutic efficacy and decrease the 5-year recurrence rate. In this respect, the information of the level of gene expression patterns in BCSCs is attractive for understanding molecular mechanisms of radio-resistance of BCSCs.
Alterations in gene expression profiles between radioresistant and radiosensitive cell lines
International Nuclear Information System (INIS)
Zhou Fuxiang; Zhou Yunfeng; Xie Conghua; Dai Jing; Cao Zhen; Yu Haijun; Liao Zhengkai; Luo Zhiguo
2007-01-01
Objective: To study the-difference of gene expressions by the contrastive model including the cells with same pathological origin and genetic background, but definitely different radioresponse, and to find the main molecular targets related to radiosensitivity. Methods: Human larynx squamous carcinoma cell, Hep -2 was irradiated with dose of 637 cGy repeatedly to establish a radioresistant daughter cell line. The radiobiology characteristics were obtained using clone forming assay. The difference of gene expression between parent and daughter cells was detected by cDNA microarray using two different arrays including 14000 genes respectively. Results: A radioresistant cell strain Hep-2R was isolated from its parental strain Hep-2 cell. The SF 2 , D 0 , α, β for Hep-2R cell line were 0.6798, 3.24, 0.2951 and 0.0363, respectively, while 0.4148, 2.06, 0.1074 and 0.0405 for Hep-2, respectively (for SF 2 , χ 2 =63.957, P<0.001). Compared with Hep-2 cells, the expressions of 41 genes were significantly altered in the radioresistant Hep-2R cells, including 22 genes up-regulated and 19 genes down-regulated, which were involved in DNA repair, regulation of the cell cycle, cell proliferation, cytoskeleton, protein synthesis, cellular metabolism and especially apoptosis which is responsible for the different radiosensitivity between these two larynx cancer cells. The telomere protection protein gene, POT1, was the mostly up-regulated by 3.348 times. Conclusions: There is difference of gene expression between the radioresistant contrastive models. POT1 gene may be the target of radiosensitization. (authors)
Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia
2016-01-01
As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675
In vitro protein expression: an emerging alternative to cell-based approaches.
He, Mingyue
2011-04-30
Protein expression remains a bottleneck in the production of proteins. Owing to several advantages, cell-free translation is emerging as an alternative to cell-based methods for the generation of proteins. Recent advances have led to many novel applications of cell-free systems in biotechnology, proteomics and fundamental biological research. This special issue of New Biotechnology describes recent advances in cell-free protein expression systems and their applications. Copyright © 2010 Elsevier B.V. All rights reserved.
Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression
International Nuclear Information System (INIS)
Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe
2005-01-01
We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells
Analysis of gene expression levels in individual bacterial cells without image segmentation
Energy Technology Data Exchange (ETDEWEB)
Kwak, In Hae; Son, Minjun [Physics Department, University of Florida, P.O. Box 118440, Gainesville, FL 32611-8440 (United States); Hagen, Stephen J., E-mail: sjhagen@ufl.edu [Physics Department, University of Florida, P.O. Box 118440, Gainesville, FL 32611-8440 (United States)
2012-05-11
Highlights: Black-Right-Pointing-Pointer We present a method for extracting gene expression data from images of bacterial cells. Black-Right-Pointing-Pointer The method does not employ cell segmentation and does not require high magnification. Black-Right-Pointing-Pointer Fluorescence and phase contrast images of the cells are correlated through the physics of phase contrast. Black-Right-Pointing-Pointer We demonstrate the method by characterizing noisy expression of comX in Streptococcus mutans. -- Abstract: Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly.
Energy Technology Data Exchange (ETDEWEB)
Miyazaki, Toshiaki; Ikeda, Kazuhiro; Horie-Inoue, Kuniko [Division of Gene Regulation and Signal Transduction, Research Center for Genomic Medicine, Saitama Medical University, Saitama 350-1241 (Japan); Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp [Division of Gene Regulation and Signal Transduction, Research Center for Genomic Medicine, Saitama Medical University, Saitama 350-1241 (Japan); Department of Geriatric Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655 (Japan); Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655 (Japan)
2014-09-26
Highlights: • APP knockdown reduced proliferation and migration of prostate cancer cells. • APP knockdown reduced expression of metalloproteinase and EMT-related genes. • APP overexpression promoted LNCaP cell migration. • APP overexpression increased expression of metalloproteinase and EMT-related genes. - Abstract: Amyloid precursor protein (APP) is a type I transmembrane protein, and one of its processed forms, β-amyloid, is considered to play a central role in the development of Alzheimer’s disease. We previously showed that APP is a primary androgen-responsive gene in prostate cancer and that its increased expression is correlated with poor prognosis for patients with prostate cancer. APP has also been implicated in several human malignancies. Nevertheless, the mechanism underlying the pro-proliferative effects of APP on cancers is still not well-understood. In the present study, we explored a pathophysiological role for APP in prostate cancer cells using siRNA targeting APP (siAPP). The proliferation and migration of LNCaP and DU145 prostate cancer cells were significantly suppressed by siAPP. Differentially expressed genes in siAPP-treated cells compared to control siRNA-treated cells were identified by microarray analysis. Notably, several metalloproteinase genes, such as ADAM10 and ADAM17, and epithelial–mesenchymal transition (EMT)-related genes, such as VIM, and SNAI2, were downregulated in siAPP-treated cells as compared to control cells. The expression of these genes was upregulated in LNCaP cells stably expressing APP when compared with control cells. APP-overexpressing LNCaP cells exhibited enhanced migration in comparison to control cells. These results suggest that APP may contribute to the proliferation and migration of prostate cancer cells by modulating the expression of metalloproteinase and EMT-related genes.
International Nuclear Information System (INIS)
Wang, Hongtao; Gao, Peng; Zheng, Jie
2014-01-01
Highlights: • As 2 O 3 inhibits growth of cervical cancer cells and expression of HPV oncogenes in these cells. • HPV-negative cervical cancer cells are more sensitive to As 2 O 3 than HPV-positive cervical cancer cells. • HPV-18 positive cervical cancer cells are more sensitive to As 2 O 3 than HPV-16 positive cancer cells. • Down-regulation of HPV oncogenes by As 2 O 3 is partially due to the diminished AP-1 binding. - Abstract: Arsenic trioxide (As 2 O 3 ) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As 2 O 3 induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As 2 O 3 on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As 2 O 3 than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As 2 O 3 than HPV 16-positive CaSki and SiHa cells. After As 2 O 3 treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As 2 O 3 is a potential anticancer drug for cervical cancer
Energy Technology Data Exchange (ETDEWEB)
Wang, Hongtao [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China); Gao, Peng [Department of Internal Medicine, University of Iowa, Iowa City, IA 52242 (United States); Zheng, Jie, E-mail: jiezheng54@126.com [Department of Pathology, School of Medicine, Southeast University, Nanjing 210009 (China)
2014-09-05
Highlights: • As{sub 2}O{sub 3} inhibits growth of cervical cancer cells and expression of HPV oncogenes in these cells. • HPV-negative cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-positive cervical cancer cells. • HPV-18 positive cervical cancer cells are more sensitive to As{sub 2}O{sub 3} than HPV-16 positive cancer cells. • Down-regulation of HPV oncogenes by As{sub 2}O{sub 3} is partially due to the diminished AP-1 binding. - Abstract: Arsenic trioxide (As{sub 2}O{sub 3}) has shown therapeutic effects in some leukemias and solid cancers. However, the molecular mechanisms of its anticancer efficacy have not been clearly elucidated, particularly in solid cancers. Our previous data showed that As{sub 2}O{sub 3} induced apoptosis of human papillomavirus (HPV) 16 DNA-immortalized human cervical epithelial cells and cervical cancer cells and inhibited the expression of HPV oncogenes in these cells. In the present study, we systemically examined the effects of As{sub 2}O{sub 3} on five human cervical cancer cell lines and explored the possible molecular mechanisms. MTT assay showed that HPV-negative C33A cells were more sensitive to growth inhibition induced by As{sub 2}O{sub 3} than HPV-positive cervical cancer cells, and HPV 18-positive HeLa and C4-I cells were more sensitive to As{sub 2}O{sub 3} than HPV 16-positive CaSki and SiHa cells. After As{sub 2}O{sub 3} treatment, both mRNA and protein levels of HPV E6 and E7 obviously decreased in all HPV positive cell lines. In contrast, p53 and Rb protein levels increased in all tested cell lines. Transcription factor AP-1 protein expression decreased significantly in HeLa, CaSki and C33A cells with ELISA method. These results suggest that As{sub 2}O{sub 3} is a potential anticancer drug for cervical cancer.
Dynamic iodide trapping by tumor cells expressing the thyroidal sodium iodide symporter
International Nuclear Information System (INIS)
Dingli, David; Bergert, Elizabeth R.; Bajzer, Zeljko; O'Connor, Michael K.; Russell, Stephen J.; Morris, John C.
2004-01-01
The thyroidal sodium iodide symporter (NIS) in combination with various radioactive isotopes has shown promise as a therapeutic gene in various tumor models. Therapy depends on adequate retention of the isotope in the tumor. We hypothesized that in the absence of iodide organification, isotope trapping is a dynamic process either due to slow efflux or re-uptake of the isotope by cells expressing NIS. Iodide efflux is slower in ARH-77 and K-562 cells expressing NIS compared to a thyroid cell line. Isotope retention half times varied linearly with the number of cells expressing NIS. With sufficient NIS expression, iodide efflux is a zero-order process. Efflux kinetics in the presence or absence of perchlorate also supports the hypothesis that iodide re-uptake occurs and contributes to the retention of the isotope in tumor cells. Iodide organification was insignificant. In vivo studies in tumors composed of mixed cell populations confirmed these observations
Expression and purification of recombinant nattokinase in Spodoptera frugiperda cells.
Li, Xiaoxiang; Wang, Xiaoli; Xiong, Shaoling; Zhang, Jing; Cai, Litao; Yang, Yanyan
2007-10-01
A recombinant baculovirus, rv-egfp-NK, containing a reporter gene encoding the enhanced green fluorescent protein (EGFP), was used to express nattokinase (NK), a fibrinolytic enzyme, in Spodoptera frugiperda (SF-9) cells. The recombinant protein also included a histidine tag for purification using Ni(2+) resins. The recombinant NK, approximately 30 kDa, retained fibrinolytic activity (60 U/ml). The integration of the EGFP expression cassette in the Bac-to-Bac system is thus an effective method for the expression and purification of recombinant NK protein in Spodoptera frugiperda insect cells.
Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines
Directory of Open Access Journals (Sweden)
Schuller Hildegard M
2005-08-01
Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein
Auat, Mariangeles; Cardoso, Chandra Chiappin; Santos-Pirath, Iris Mattos; Rudolf-Oliveira, Renata Cristina Messores; Matiollo, Camila; Lange, Bárbara Gil; da Silva, Jessica Pires; Dametto, Gisele Cristina; Pirolli, Mayara Marin; Colombo, Maria Daniela Holthausen Perico; Santos-Silva, Maria Claudia
2018-02-24
Flow cytometric immunophenotyping is deemed a fundamental tool for the diagnosis of B-cell neoplasms. Currently, the investigation of novel immunophenotypic markers has gained importance, as they can assist in the precise subclassification of B-cell malignancies by flow cytometry. Therefore, the purpose of the present study was to evaluate the expression of CD307a during normal B-cell maturation and in B-cell malignancies as well as to investigate its potential role in the differential diagnosis of these entities. CD307a expression was assessed by flow cytometry in normal precursor and mature B cells and in 115 samples collected from patients diagnosed with precursor and mature B-cell neoplasms. CD307a expression was compared between neoplastic and normal B cells. B-acute lymphoblastic leukemia cases exhibited minimal expression of CD307a, displaying a similar expression pattern to that of normal B-cell precursors. Mantle cell lymphoma (MCL) cases showed the lowest levels of CD307a among mature B-cell neoplasms. CD307a expression was statistically lower in MCL cases than in chronic B lymphocytic leukemia (CLL) and marginal zone lymphoma (MZL) cases. No statistical differences were observed between CD307a expression in neoplastic and normal plasma cells. These results indicate that the assessment of CD307a expression by flow cytometry could be helpful to distinguish CLL from MCL, and the latter from MZL. Although these results are not entirely conclusive, they provide a basis for further studies in a larger cohort of patients. © 2018 International Clinical Cytometry Society. © 2018 International Clinical Cytometry Society.
Expression of polypeptide GalNAc-transferases in stratified epithelia and squamous cell carcinomas
DEFF Research Database (Denmark)
Mandel, U; Hassan, H; Therkildsen, M H
1999-01-01
GalNAc-T1, -T2, and -T3. Application of this panel of novel antibodies revealed that GalNAc- transferases are differentially expressed in different cell lines, in spermatozoa, and in oral mucosa and carcinomas. For example, GalNAc-T1 and -T2 but not -T3 were highly expressed in WI38 cells, and Gal......NAc-T3 but not GalNAc-T1 or -T2 was expressed in spermatozoa. The expression patterns in normal oral mucosa were found to vary with cell differentiation, and for GalNAc-T2 and -T3 this was reflected in oral squamous cell carcinomas. The expression pattern of GalNAc-T1 was on the other hand changed...
Metallothionein gene expression in renal cell carcinoma
Directory of Open Access Journals (Sweden)
Deeksha Pal
2014-01-01
Full Text Available Introduction: Metallothioneins (MTs are a group of low-molecular weight, cysteine-rich proteins. In general, MT is known to modulate three fundamental processes: (1 the release of gaseous mediators such as hydroxyl radical or nitric oxide, (2 apoptosis and (3 the binding and exchange of heavy metals such as zinc, cadmium or copper. Previous studies have shown a positive correlation between the expression of MT with invasion, metastasis and poor prognosis in various cancers. Most of the previous studies primarily used immunohistochemistry to analyze localization of MT in renal cell carcinoma (RCC. No information is available on the gene expression of MT2A isoform in different types and grades of RCC. Materials and Methods: In the present study, total RNA was isolated from 38 histopathologically confirmed cases of RCC of different types and grades. Corresponding adjacent normal renal parenchyma was taken as control. Real-time polymerase chain reaction (RT PCR analysis was done for the MT2A gene expression using b-actin as an internal control. All statistical calculations were performed using SPSS software. Results: The MT2A gene expression was found to be significantly increased (P < 0.01 in clear cell RCC in comparison with the adjacent normal renal parenchyma. The expression of MT2A was two to three-fold higher in sarcomatoid RCC, whereas there was no change in papillary and collecting duct RCC. MT2A gene expression was significantly higher in lower grade (grades I and II, P < 0.05, while no change was observed in high-grade tumor (grade III and IV in comparison to adjacent normal renal tissue. Conclusion: The first report of the expression of MT2A in different types and grades of RCC and also these data further support the role of MT2A in tumorigenesis.
DEFF Research Database (Denmark)
Damstrup, L; Rygaard, K; Spang-Thomsen, M
1993-01-01
A panel of 21 small cell lung cancer cell (SCLC) lines were examined for the presence of Transforming growth factor beta receptors (TGF beta-r) and the expression of TGF beta mRNAs. By the radioreceptor assay we found high affinity receptors to be expressed in six cell lines. scatchard analysis......(r) = 65,000 and 90,000 and the betaglycan (type III) with M(r) = 280,000. Northern blotting showed expression of TGF beta 1 mRNA in ten, TGF beta 2 mRNA in two and TGF beta 3 mRNA in seven cell lines. Our results provide, for the first time, evidence that a large proportion of a broad panel of SCLC cell...... lines express TGF beta-receptors and also produce TGF beta mRNAs....
Expression of a novel non-coding mitochondrial RNA in human proliferating cells.
Villegas, Jaime; Burzio, Veronica; Villota, Claudio; Landerer, Eduardo; Martinez, Ronny; Santander, Marcela; Martinez, Rodrigo; Pinto, Rodrigo; Vera, María I; Boccardo, Enrique; Villa, Luisa L; Burzio, Luis O
2007-01-01
Previously, we reported the presence in mouse cells of a mitochondrial RNA which contains an inverted repeat (IR) of 121 nucleotides (nt) covalently linked to the 5' end of the mitochondrial 16S RNA (16S mtrRNA). Here, we report the structure of an equivalent transcript of 2374 nt which is over-expressed in human proliferating cells but not in resting cells. The transcript contains a hairpin structure comprising an IR of 815 nt linked to the 5' end of the 16S mtrRNA and forming a long double-stranded structure or stem and a loop of 40 nt. The stem is resistant to RNase A and can be detected and isolated after digestion with the enzyme. This novel transcript is a non-coding RNA (ncRNA) and several evidences suggest that the transcript is synthesized in mitochondria. The expression of this transcript can be induced in resting lymphocytes stimulated with phytohaemagglutinin (PHA). Moreover, aphidicolin treatment of DU145 cells reversibly blocks proliferation and expression of the transcript. If the drug is removed, the cells re-assume proliferation and over-express the ncmtRNA. These results suggest that the expression of the ncmtRNA correlates with the replicative state of the cell and it may play a role in cell proliferation.
Calpain expression and activity during lens fiber cell differentiation.
De Maria, Alicia; Shi, Yanrong; Kumar, Nalin M; Bassnett, Steven
2009-05-15
In animal models, the dysregulated activity of calcium-activated proteases, calpains, contributes directly to cataract formation. However, the physiological role of calpains in the healthy lens is not well defined. In this study, we examined the expression pattern of calpains in the mouse lens. Real time PCR and Western blotting data indicated that calpain 1, 2, 3, and 7 were expressed in lens fiber cells. Using controlled lysis, depth-dependent expression profiles for each calpain were obtained. These indicated that, unlike calpain 1, 2, and 7, which were most abundant in cells near the lens surface, calpain 3 expression was strongest in the deep cortical region of the lens. We detected calpain activities in vitro and showed that calpains were active in vivo by microinjecting fluorogenic calpain substrates into cortical fiber cells. To identify endogenous calpain substrates, membrane/cytoskeleton preparations were treated with recombinant calpain, and cleaved products were identified by two-dimensional difference electrophoresis/mass spectrometry. Among the calpain substrates identified by this approach was alphaII-spectrin. An antibody that specifically recognized calpain-cleaved spectrin was used to demonstrate that spectrin is cleaved in vivo, late in fiber cell differentiation, at or about the time that lens organelles are degraded. The generation of the calpain-specific spectrin cleavage product was not observed in lens tissue from calpain 3-null mice, indicating that calpain 3 is uniquely activated during lens fiber differentiation. Our data suggest a role for calpains in the remodeling of the membrane cytoskeleton that occurs with fiber cell maturation.
Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells
Institute of Scientific and Technical Information of China (English)
Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang
2004-01-01
AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.
Miura, Hirohito; Scott, Jennifer K.; Harada, Shuitsu; Barlow, Linda A.
2014-01-01
Background Taste buds contain ~60 elongate cells and several basal cells. Elongate cells comprise three functional taste cell types: I - glial cells, II - bitter/sweet/umami receptor cells, and III - sour detectors. Although taste cells are continuously renewed, lineage relationships among cell types are ill-defined. Basal cells have been proposed as taste bud stem cells, a subset of which express Sonic hedgehog (Shh). However, Shh+ basal cells turnover rapidly suggesting that Shh+ cells are precursors of some or all taste cell types. Results To fate map Shh-expressing cells, mice carrying ShhCreERT2 and a high (CAG-CAT-EGFP) or low (R26RLacZ) efficiency reporter allele were given tamoxifen to activate Cre in Shh+ cells. Using R26RLacZ, lineage-labeled cells occur singly within buds, supporting a post-mitotic state for Shh+ cells. Using either reporter, we show that Shh+ cells differentiate into all three taste cell types, in proportions reflecting cell type ratios in taste buds (I > II > III). Conclusions Shh+ cells are not stem cells, but are post-mitotic, immediate precursors of taste cells. Shh+ cells differentiate into each of the three taste cell types, and the choice of a specific taste cell fate is regulated to maintain the proper ratio within buds. PMID:24590958
Functional importance of GLP-1 receptor species and expression levels in cell lines.
Knudsen, Lotte Bjerre; Hastrup, Sven; Underwood, Christina Rye; Wulff, Birgitte Schjellerup; Fleckner, Jan
2012-04-10
Of the mammalian species, only the GLP-1 receptors of rat and human origin have been described and characterized. Here, we report the cloning of the homologous GLP-1 receptors from mouse, rabbit, pig, cynomolgus monkey and chimp. The GLP-1 receptor is highly conserved across species, thus underlining the physiological importance of the peptide hormone and its receptor across a wide range of mammals. We expressed the receptors by stable transfection of BHK cells, both in cell lines with high expression levels of the cloned receptors, as well as in cell lines with lower expression levels, more comparable to endogenous expression of these receptors. High expression levels of cloned GLP-1 receptors markedly increased the potency of GLP-1 and other high affinity ligands, whereas the K(d) values were not affected. For a low affinity ligand like the ago-allosteric modulator Compound 2, expression levels of the human GLP-1 receptor were important for maximal efficacy as well as potency. The two natural metabolites of GLP-1, GLP-1(9-37) and GLP-1(9-36)amide were agonists when tested on a cell line with high expression of the recombinant human GLP-1 receptor, whereas they behaved as (low potent) antagonists on a cell line that expressed the receptor endogenously, as well as cells expressing a moderate level of the recombinant human GLP-1 receptor. The amide form was a more potent agonist than the free acid from. In conclusion, receptor expression level is an important parametre for selecting cell lines with cloned GLP-1 receptors for functional characterization of physiological and pharmaceutical ligands. Copyright © 2011 Elsevier B.V. All rights reserved.
Radioimmunoassay of measles virus hemagglutinin protein G
International Nuclear Information System (INIS)
Lund, G.A.; Salmi, A.A.
1982-01-01
Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 μg of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells. (Auth.)
Radioimmunoassay of measles virus hemagglutinin protein G
Energy Technology Data Exchange (ETDEWEB)
Lund, G A; Salmi, A A [Turku Univ. (Finland)
1982-08-01
Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 ..mu..g of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells.
Directory of Open Access Journals (Sweden)
Shuqiang Li
2011-03-01
Full Text Available Chronic lymphocytic leukemia (CLL is thought to be a disease of resting lymphocytes. However, recent data suggest that CLL cells may more closely resemble activated B cells. Using microRNA (miRNA expression profiling of highly-enriched CLL cells from 38 patients and 9 untransformed B cells from normal donors before acute CpG activation and 5 matched B cells after acute CpG activation, we demonstrate an activated B cell status for CLL. Gene set enrichment analysis (GSEA identified statistically-significant similarities in miRNA expression between activated B cells and CLL cells including upregulation of miR-34a, miR-155, and miR-342-3p and downregulation of miR-103, miR-181a and miR-181b. Additionally, decreased levels of two CLL signature miRNAs miR-29c and miR-223 are associated with ZAP70(+ and IgV(H unmutated status and with shorter time to first therapy. These data indicate an activated B cell status for CLL cells and suggest that the direction of change of individual miRNAs may predict clinical course in CLL.
Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo
2017-09-01
Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Ibáñez, Elena; Stoedter, Mette; Hofmann, Peter Josef; Plano, Daniel; Calvo, Alfonso; Nguewa, Paul A; Palop, Juan Antonio; Sanmartín, Carmen; Schomburg, Lutz
2012-12-01
The essential micronutrient selenium (Se) exerts its biological effects mainly through selenoproteins thereby affecting a number of physiological pathways including intracellular redox control, stress response and cancer cell proliferation. Besides affecting selenoprotein expression, some selenocompounds have been synthesized and analyzed in order to serve as chemotherapeutic substances preferentially targeting cancer cells. This promising chemotherapeutic potential has recently been verified for a particular imidoselenocarbamate in a mouse tumor model. In the present study we tested the effects of this and a number of related Se-methyl- and Se-benzyl-imidoselenocarbamates on selenoprotein expression in nontransformed and hepatic carcinoma cells in culture. Most of the Se-benzyl-imidoselenocarbamates strongly stimulated selenoprotein P (SePP) secretion while the Se-methyl-imidoselenocarbamates elicited less pronounced effects in hepatocarcinoma HepG2 cells. However, most of the Se-methyl-imidoselenocarbamates increased glutathione peroxidase (GPx) activity and decreased thioredoxin reductase (TXNRD) activity in parallel, while the majority of the Se-benzyl-imidoselenocarbamates were without a respective effect in HepG2 cells. Performing inhibitor assays in vitro, GPx activity was unaffected by the imidoselenocarbamates. In contrast, most of the Se-methyl-imidoselenocarbamates inhibited TXNRD activity in vitro in line with the results in HepG2 cells. Both classes of imidoselenocarbamates strongly induced selenoprotein S (SELS) expression without a respective increase in ER stress or unfolded protein response which are known inducers of SELS biosynthesis. Notably, many of these effects were cancer cell-specific, and not observed in nontransformed AML12 hepatocytes. Our results indicate that these novel selenocompounds affect expression and activity of crucial selenoenzymes in a compound- and cell-specific way in hepatocytes. Especially the Se
Li, Ren; Zhou, Mingxing; Li, Jine; Wang, Zihua; Zhang, Weikai; Yue, Chunyan; Ma, Yan; Peng, Hailin; Wei, Zewen; Hu, Zhiyuan
2018-03-01
EGFR mutations companion diagnostics have been proved to be crucial for the efficacy of tyrosine kinase inhibitor targeted cancer therapies. To uncover multiple mutations occurred in minority of EGFR-mutated cells, which may be covered by the noises from majority of un-mutated cells, is currently becoming an urgent clinical requirement. Here we present the validation of a microfluidic-chip-based method for detecting EGFR multi-mutations at single-cell level. By trapping and immunofluorescently imaging single cells in specifically designed silicon microwells, the EGFR-expressed cells were easily identified. By in situ lysing single cells, the cell lysates of EGFR-expressed cells were retrieved without cross-contamination. Benefited from excluding the noise from cells without EGFR expression, the simple and cost-effective Sanger's sequencing, but not the expensive deep sequencing of the whole cell population, was used to discover multi-mutations. We verified the new method with precisely discovering three most important EGFR drug-related mutations from a sample in which EGFR-mutated cells only account for a small percentage of whole cell population. The microfluidic chip is capable of discovering not only the existence of specific EGFR multi-mutations, but also other valuable single-cell-level information: on which specific cells the mutations occurred, or whether different mutations coexist on the same cells. This microfluidic chip constitutes a promising method to promote simple and cost-effective Sanger's sequencing to be a routine test before performing targeted cancer therapy.[Figure not available: see fulltext.
International Nuclear Information System (INIS)
Rojas, Olga Lucia; Gonzalez, Ana Maria; Gonzalez, Rosabel; Perez-Schael, Irene; Greenberg, Harry B.; Franco, Manuel A.; Angel, Juana
2003-01-01
Using an intracellular cytokine assay, we recently showed that the frequencies of rotavirus (RV)-specific CD4 + and CD8 + T cells secreting INFγ, circulating in RV infected and healthy adults, are very low compared to the frequencies of circulating cytomegalovirus (CMV) reactive T cells in comparable individuals. In children with acute RV infection, these T cells were barely or not detectable. In the present study, an ELISPOT assay enabled detection of circulating RV-specific INFγ-secreting cells in children with RV diarrhea but not in children with non-RV diarrhea without evidence of a previous RV infection. Using microbead-enriched CD4 + and CD8 + T cell subsets, IFNγ-secreting RV-specific CD8 + but not CD4 + T cells were detected in recently infected children. Using the same approach, both CD4 + and CD8 + RV-specific T cells were detected in healthy adults. Furthermore, stimulation of purified subsets of PBMC that express lymphocyte homing receptors demonstrated that RV-specific INFγ-secreting CD4 + T cells from adult volunteers preferentially express the intestinal homing receptor α4β7, but not the peripheral lymph node homing receptor L-selectin. In contrast, CMV-specific INFγ-secreting CD4 + T cells preferentially express L-selectin but not α4β7. These results suggest that the expression of homing receptors on virus-specific T cells depends on the organ where these cells were originally stimulated and that their capacity to secrete INFγ is independent of the expression of these homing receptors
Patterns of expression of cell wall related genes in sugarcane
Directory of Open Access Journals (Sweden)
Lima D.U.
2001-01-01
Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database (http://sucest.lbi.dcc.unicamp.br resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the
Zhou, Fang; Du, Jin; Wang, Jianjun
2017-04-01
Albendazole (ABZ) has an anti-tumor ability and inhibits HIF-1α activity. HIF-1α is associated with glycolysis and vascular endothelial cell growth factor (VEGF) expression, which plays an important role in cancer progression. These clues indicate that ABZ exerts an anti-cancer effect by regulating glycolysis and VEGF expression. The aim of this study is to clarify the effects of ABZ on non-small cell lung cancer (NSCLC) cells and explore the underlying molecular mechanisms. The expression levels of HIF-1α and VEGF were detected using western blot analysis, and the effect of ABZ on glycolysis was evaluated by measuring the relative activities of hexokinase (HK), pyruvate kinase (PK), and lactate dehydrogenase (LDH) and detecting the production of lactate in A549 and H1299 cells. The results showed that ABZ decreased the expression levels of HIF-1α and VEGF and suppressed glycolysis in under hypoxia, but not normoxic condition. Inhibiting HIF-1α also suppressed glycolysis and VEGF expression. Additionally, ABZ inhibited the volume and weight, decreased the relative activities of HK, PK, and LDH, and reduced the levels of HIF-1α and VEGF of A549 xenografts in mouse models. In conclusion, ABZ inhibited growth of NSCLC cells by suppressing HIF-1α-dependent glycolysis and VEGF expression.
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
PKCα expression regulated by Elk-1 and MZF-1 in human HCC cells
International Nuclear Information System (INIS)
Hsieh, Y.-H.; Wu, T.-T.; Tsai, J.-H.; Huang, C.-Y.; Hsieh, Y.-S.; Liu, J.-Y.
2006-01-01
Our previous study found that PKCα was highly expressed in the poor-differentiated human HCC cells and associated with cell migration and invasion. In this study, we further investigated the gene regulation of this enzyme. We showed that PKCα expression enhancement in the poor-differentiated human HCC cells was found neither by DNA amplification nor by increasing mRNA stability using differential PCR and mRNA decay assays. After screening seven transcription factors in the putative cis-acting regulatory elements of human PKCα promoters, only Elk-1 and MZF-1 antisense oligonucleotide showed a significant reduction in the PKCα mRNA level. They also reduced cell proliferation, cell migratory and invasive capabilities, and DNA binding activities in the PKCα promoter region. Over-expression assay confirmed that the PKCα expression may be modulated by these two factors at the transcriptional level. Therefore, these results may provide a novel mechanism for PKCα expression regulation in human HCC cells
International Nuclear Information System (INIS)
Sergeant, Gregory; Eijsden, Rudy van; Roskams, Tania; Van Duppen, Victor; Topal, Baki
2012-01-01
Most cancer deaths are caused by metastases, resulting from circulating tumor cells (CTC) that detach from the primary cancer and survive in distant organs. The aim of the present study was to develop a CTC gene signature and to assess its prognostic relevance after surgery for pancreatic ductal adenocarcinoma (PDAC). Negative depletion fluorescence activated cell sorting (FACS) was developed and validated with spiking experiments using cancer cell lines in whole human blood samples. This FACS-based method was used to enrich for CTC from the blood of 10 patients who underwent surgery for PDAC. Total RNA was isolated from 4 subgroup samples, i.e. CTC, haematological cells (G), original tumour (T), and non-tumoural pancreatic control tissue (P). After RNA quality control, samples of 6 patients were eligible for further analysis. Whole genome microarray analysis was performed after double linear amplification of RNA. ‘Ingenuity Pathway Analysis’ software and AmiGO were used for functional data analyses. A CTC gene signature was developed and validated with the nCounter system on expression data of 78 primary PDAC using Cox regression analysis for disease-free (DFS) and overall survival (OS). Using stringent statistical analysis, we retained 8,152 genes to compare expression profiles of CTC vs. other subgroups, and found 1,059 genes to be differentially expressed. The pathway with the highest expression ratio in CTC was p38 mitogen-activated protein kinase (p38 MAPK) signaling, known to be involved in cancer cell migration. In the p38 MAPK pathway, TGF-β1, cPLA2, and MAX were significantly upregulated. In addition, 9 other genes associated with both p38 MAPK signaling and cell motility were overexpressed in CTC. High co-expression of TGF-β1 and our cell motility panel (≥ 4 out of 9 genes for DFS and ≥ 6 out of 9 genes for OS) in primary PDAC was identified as an independent predictor of DFS (p=0.041, HR (95% CI) = 1.885 (1.025 – 3.559)) and OS (p=0.047, HR
Matrigel Basement Membrane Matrix influences expression of microRNAs in cancer cell lines
International Nuclear Information System (INIS)
Price, Karina J.; Tsykin, Anna; Giles, Keith M.; Sladic, Rosemary T.; Epis, Michael R.; Ganss, Ruth; Goodall, Gregory J.; Leedman, Peter J.
2012-01-01
Highlights: ► Matrigel alters cancer cell line miRNA expression relative to culture on plastic. ► Many identified Matrigel-regulated miRNAs are implicated in cancer. ► miR-1290, -210, -32 and -29b represent a Matrigel-induced miRNA signature. ► miR-32 down-regulates Integrin alpha 5 (ITGA5) mRNA. -- Abstract: Matrigel is a medium rich in extracellular matrix (ECM) components used for three-dimensional cell culture and is known to alter cellular phenotypes and gene expression. microRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression and have roles in cancer. While miRNA profiles of numerous cell lines cultured on plastic have been reported, the influence of Matrigel-based culture on cancer cell miRNA expression is largely unknown. This study investigated the influence of Matrigel on the expression of miRNAs that might facilitate ECM-associated cancer cell growth. We performed miRNA profiling by microarray using two colon cancer cell lines (SW480 and SW620), identifying significant differential expression of miRNAs between cells cultured in Matrigel and on plastic. Many of these miRNAs have previously been implicated in cancer-related processes. A common Matrigel-induced miRNA signature comprised of up-regulated miR-1290 and miR-210 and down-regulated miR-29b and miR-32 was identified using RT-qPCR across five epithelial cancer cell lines (SW480, SW620, HT-29, A549 and MDA-MB-231). Experimental modulation of these miRNAs altered expression of their known target mRNAs involved in cell adhesion, proliferation and invasion, in colon cancer cell lines. Furthermore, ITGA5 was identified as a novel putative target of miR-32 that may facilitate cancer cell interactions with the ECM. We propose that culture of cancer cell lines in Matrigel more accurately recapitulates miRNA expression and function in cancer than culture on plastic and thus is a valuable approach to the in vitro study of miRNAs.
Energy Technology Data Exchange (ETDEWEB)
Xiao, Can [Department of Occupational Medicine and Environmental Health, School of Public Health, Soochow University, Suzhou 215123 (China); Department of Stomatology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Wang, Lili; Zhu, Lifang [Department of Stomatology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhang, Chenping, E-mail: zhang_cping@163.com [Department of Head and Neck Tumors, Shanghai Ninth People’s Hospital Affiliated Shanghai JiaoTong University School of Medicine, Shanghai 200011 (China); Zhou, Jianhua [Department of Occupational Medicine and Environmental Health, School of Public Health, Soochow University, Suzhou 215123 (China)
2014-11-28
Highlights: • miR-9 expression level was significantly decreased in OSCC tissues. • Curcumin significantly inhibited SCC-9 cells proliferation. • miR-9 mediates the inhibition of SCC-9 proliferation by curcumin. • Curcumin suppresses Wnt/β-catenin signaling in SCC-9 cells. • miR-9 mediates the suppression of Wnt/β-catenin signaling by curcumin. - Abstract: Curcumin, a phytochemical derived from the rhizome of Curcuma longa, has shown anticancer effects against a variety of tumors. In the present study, we investigated the effects of curcumin on the miR-9 expression in oral squamous cell carcinoma (OSCC) and explored the potential relationships between miR-9 and Wnt/β-catenin pathway in curcumin-mediated OSCC inhibition in vitro. As the results shown, the expression levels of miR-9 were significantly lower in clinical OSCC specimens than those in the adjacent non-tumor tissues. Furthermore, our results indicated that curcumin inhibited OSCC cells (SCC-9 cells) proliferation through up-regulating miR-9 expression, and suppressing Wnt/β-catenin signaling by increasing the expression levels of the GSK-3β, phosphorylated GSK-3β and β-catenin, and decreasing the cyclin D1 level. Additionally, the up-regulation of miR-9 by curcumin in SCC-9 cells was significantly inhibited by delivering anti-miR-9 but not control oligonucleotides. Downregulation of miR-9 by anti-miR-9 not only attenuated the growth-suppressive effects of curcumin on SCC-9 cells, but also re-activated Wnt/β-catenin signaling that was inhibited by curcumin. Therefore, our findings would provide a new insight into the use of curcumin against OSCC in future.
International Nuclear Information System (INIS)
Xiao, Can; Wang, Lili; Zhu, Lifang; Zhang, Chenping; Zhou, Jianhua
2014-01-01
Highlights: • miR-9 expression level was significantly decreased in OSCC tissues. • Curcumin significantly inhibited SCC-9 cells proliferation. • miR-9 mediates the inhibition of SCC-9 proliferation by curcumin. • Curcumin suppresses Wnt/β-catenin signaling in SCC-9 cells. • miR-9 mediates the suppression of Wnt/β-catenin signaling by curcumin. - Abstract: Curcumin, a phytochemical derived from the rhizome of Curcuma longa, has shown anticancer effects against a variety of tumors. In the present study, we investigated the effects of curcumin on the miR-9 expression in oral squamous cell carcinoma (OSCC) and explored the potential relationships between miR-9 and Wnt/β-catenin pathway in curcumin-mediated OSCC inhibition in vitro. As the results shown, the expression levels of miR-9 were significantly lower in clinical OSCC specimens than those in the adjacent non-tumor tissues. Furthermore, our results indicated that curcumin inhibited OSCC cells (SCC-9 cells) proliferation through up-regulating miR-9 expression, and suppressing Wnt/β-catenin signaling by increasing the expression levels of the GSK-3β, phosphorylated GSK-3β and β-catenin, and decreasing the cyclin D1 level. Additionally, the up-regulation of miR-9 by curcumin in SCC-9 cells was significantly inhibited by delivering anti-miR-9 but not control oligonucleotides. Downregulation of miR-9 by anti-miR-9 not only attenuated the growth-suppressive effects of curcumin on SCC-9 cells, but also re-activated Wnt/β-catenin signaling that was inhibited by curcumin. Therefore, our findings would provide a new insight into the use of curcumin against OSCC in future
Molecular regulation of MICA expression after HDAC inhibitor treatment of cancer cells
DEFF Research Database (Denmark)
Jensen, Helle
and NKG2D-ligands are upregulated on the surface of abnormal cells. We have previously shown that cancer cells can be stimulated to express the NKG2D-ligands MICA/B after exposure to HDAC-inhibitors (HDAC-i), an occurrence that is not observed in healthy cells. Here we characterize the molecular signal...... pathways that lead to MICA expression after HDAC-inhibitor treatment of cancer cells. Chelating Calcium with Bapta-AM or EGTA potently inhibited HDAC-inhibitor and CMV mediated MICA/B expression. It was further observed that ER Calcium stores were depleted after HDAC-inhibitor treatment. NF-kB activity can...
Directory of Open Access Journals (Sweden)
Hisakatsu Nawata
Full Text Available A change in chromosome number, known as aneuploidy, is a common characteristic of cancer. Aneuploidy disrupts gene expression in human cancer cells and immortalized human epithelial cells, but not in normal human cells. However, the relationship between aneuploidy and cancer remains unclear. To study the effects of aneuploidy in normal human cells, we generated artificial cells of human primary fibroblast having three chromosome 8 (trisomy 8 cells by using microcell-mediated chromosome transfer technique. In addition to decreased proliferation, the trisomy 8 cells lost contact inhibition and reproliferated after exhibiting senescence-like characteristics that are typical of transformed cells. Furthermore, the trisomy 8 cells exhibited chromosome instability, and the overall gene expression profile based on microarray analyses was significantly different from that of diploid human primary fibroblasts. Our data suggest that aneuploidy, even a single chromosome gain, can be introduced into normal human cells and causes, in some cases, a partial cancer phenotype due to a disruption in overall gene expression.
International Nuclear Information System (INIS)
Laybourn, K.A.; Varani, J.; Fligiel, S.E.G.; Hiserodt, J.C.
1986-01-01
Previous studies have identified the presence of laminin binding sites on murine NK and NC sensitive tumor cells by 125 I-laminin binding and laminin induced cell-cell aggregation. The finding that the addition of exogenous laminin inhibits NK/NC binding to sensitive tumor cells suggests laminin binding sites may serve as target antigens for NK cells. The present study extends earlier reports by analyzing a large panel of tumor cells for laminin binding capacity, laminin expression and sensitivity to NK/NC killing. The data indicate that all tumor cells which bind to NK/NC cells (8 lines tested) express laminin binding sites. All of these tumor cells were capable of competing for NK lysis of YAC-1 cells in cold target competition assays, and all bound enriched NK cells in direct single cell binding assays. In contrast, tumor cells expressing high levels of surface laminin (B16 melanomas, C57B1/6 fibrosarcomas, and RAS transfected 3T3 fibroblasts) but low levels of laminin binding capacity did not bind NK/NC cells and were resistant to lysis. These data support the hypothesis that expression of laminin/laminin binding sites may contribute to tumor cell sensitivity to NK/NC binding and/or killing
Meis1 regulates Foxn4 expression during retinal progenitor cell differentiation
Directory of Open Access Journals (Sweden)
Mohammed M. Islam
2013-09-01
The transcription factor forkhead box N4 (Foxn4 is a key regulator in a variety of biological processes during development. In particular, Foxn4 plays an essential role in the genesis of horizontal and amacrine neurons from neural progenitors in the vertebrate retina. Although the functions of Foxn4 have been well established, the transcriptional regulation of Foxn4 expression during progenitor cell differentiation remains unclear. Here, we report that an evolutionarily conserved 129 bp noncoding DNA fragment (Foxn4CR4.2 or CR4.2, located ∼26 kb upstream of Foxn4 transcription start site, functions as a cis-element for Foxn4 regulation. CR4.2 directs gene expression in Foxn4-positive cells, primarily in progenitors, differentiating horizontal and amacrine cells. We further determined that the gene regulatory activity of CR4.2 is modulated by Meis1 binding motif, which is bound and activated by Meis1 transcription factor. Deletion of the Meis1 binding motif or knockdown of Meis1 expression abolishes the gene regulatory activity of CR4.2. In addition, knockdown of Meis1 expression diminishes the endogenous Foxn4 expression and affects cell lineage development. Together, we demonstrate that CR4.2 and its interacting Meis1 transcription factor play important roles in regulating Foxn4 expression during early retinogenesis. These findings provide new insights into molecular mechanisms that govern gene regulation in retinal progenitors and specific cell lineage development.
DEFF Research Database (Denmark)
Hoei-Hansen, C E; Almstrup, K; Nielsen, J E
2005-01-01
AIMS: NANOG is a key regulator of embryonic stem cell (ESC) self-renewal and pluripotency. Our recent genome-wide gene expression profiling study of the precursor of testicular germ cell tumours, carcinoma in situ testis (CIS), showed close similarity between ESC and CIS, including high NANOG...... earlier than for OCT-4. We detected no expression at the protein level in normal testis. CONCLUSIONS: NANOG is a new marker for testicular CIS and germ cell tumours and the high level of NANOG along with OCT-4 are determinants of the stem cell-like pluripotency of the preinvasive CIS cell. Timing of NANOG...... expression. In the present study we analysed the protein expression of NANOG during normal development of human testis and in a large series of neoplastic/dysgenetic specimens. METHODS AND RESULTS: We detected abundant expression of NANOG in CIS and in CIS-derived testicular tumours with marked differences...
DEFF Research Database (Denmark)
Kaestel, Charlotte G; Jørgensen, Annette; Nielsen, Mette
2002-01-01
-Thymidine incorporation assay, respectively. T cells and RPE cells were cultured directly together or in a transwell system for determination of the effect of cell contact. The importance of cell surface molecules was examined by application of a panel of blocking antibodies (CD2, CD18, CD40, CD40L, CD54, CD58......) in addition to use of TCR negative T cell lines. The expression of IL2R-alpha -beta and -gamma chains of activated T cells was analysed by flow cytometry after incubation of T cells alone or with RPE cells. Human RPE cells were found to inhibit the proliferation of activated T cells by a cell contact......-beta and -gamma chain expression within 24 hr after removal from the coculture. It is concluded that the cultured human adult and foetal RPE cells inhibit the proliferation of activated T cells by a process that does not involve apoptosis. It depends on cell contact but the involved surface molecules were...
David, Robert; Groebner, Michael; Franz, Wolfgang-Michael
2005-04-01
Embryonic stem (ES) cells offer great potential in regenerative medicine and tissue engineering. Clinical applications are still hampered by the lack of protocols for gentle, high-yield isolation of specific cell types for transplantation expressing no immunogenic markers. We describe labeling of stably transfected ES cells expressing a human CD4 molecule lacking its intracellular domain (DeltaCD4) under control of the phosphoglycerate kinase promoter for magnetic cell sorting (MACS). To track the labeled ES cells, we fused DeltaCD4 to an intracellular enhanced green fluorescent protein domain (DeltaCD4EGFP). We showed functionality of the membrane-bound fluorescent fusion protein and its suitability for MACS leading to purities greater than 97%. Likewise, expression of DeltaCD4 yielded up to 98.5% positive cells independently of their differentiation state. Purities were not limited by the initial percentage of DeltaCD4(+) cells, ranging from 0.6%-16%. The viability of MACS-selected cells was demonstrated by reaggregation and de novo formation of embryoid bodies developing all three germ layers. Thus, expression of DeltaCD4 in differentiated ES cells may enable rapid, high-yield purification of a desired cell type for tissue engineering and transplantation studies.
Effects of achilline on lipid metabolism gene expression in cell culture
Directory of Open Access Journals (Sweden)
A. V. Ratkin
2016-01-01
Full Text Available Objective. Evaluation in vitro of the mechanisms of the hypolipidemic effect of sesquiterpene γ-lactone achilline in the hepatoma tissue culture (HTC.Materials and methods.The influence of sesquiterpene γ-lactone achilline and gemfibrozil (comparison drug on the viability, lipid content and expression of key genes of lipid metabolism in the hepatoma tissue culture. The lipid content was assessed by fluorescent method with the vital dye Nile Red, the cell viability was assessed using MTT assay.Results. Cultivation of of cell cultures of rat’s hepatoma cell line HTC for 48 h with achilline in a concentration of from 0.25 to 1.0 mm and gemfibrozil from 0,25 to 0,5 mm did not change cell viability compared to control. In these same concentrations of the test substance reduced the lipid content in the cells, assessed by fluorescent method with the vital dye Nile Red. To study the mechanism of hypolipidemicaction of achillinedetermined the expression of key genes of lipid metabolism in cell culture lines HTC. The possible mechanism of hypolipidemic action of achilline can be attributed to the increased transport and oxidation of long-chain fatty acids in mitochondria, as evidenced by the increase in the gene expression of carnitine-palmitoyltransferase 2 (Cpt2. The decrease in cholesterol level may be due to increased synthesis of bile acids from cholesterol, due to increased gene expression of 7-alphahydroxylase (Cyp7a1. Conclusion. In cell cultures of rat’s hepatoma cell line HTC sesquiterpene γ-lactone achilline reduces the accumulation of lipids in cells, as evidenced by the decrease in the fluorescence of Nile Red, increased gene expression of the carnitine-palmitoyltransferase 2 (Cpt2 gene and 7-alpha-hydroxylase (Cyp7a1.
Directory of Open Access Journals (Sweden)
Artémis Llamosi
2016-02-01
Full Text Available Significant cell-to-cell heterogeneity is ubiquitously observed in isogenic cell populations. Consequently, parameters of models of intracellular processes, usually fitted to population-averaged data, should rather be fitted to individual cells to obtain a population of models of similar but non-identical individuals. Here, we propose a quantitative modeling framework that attributes specific parameter values to single cells for a standard model of gene expression. We combine high quality single-cell measurements of the response of yeast cells to repeated hyperosmotic shocks and state-of-the-art statistical inference approaches for mixed-effects models to infer multidimensional parameter distributions describing the population, and then derive specific parameters for individual cells. The analysis of single-cell parameters shows that single-cell identity (e.g. gene expression dynamics, cell size, growth rate, mother-daughter relationships is, at least partially, captured by the parameter values of gene expression models (e.g. rates of transcription, translation and degradation. Our approach shows how to use the rich information contained into longitudinal single-cell data to infer parameters that can faithfully represent single-cell identity.
Expression of a fms-related oncogene in carcinogen-induced neoplastic epithelial cells
International Nuclear Information System (INIS)
Walker, C.; Nettesheim, P.; Barrett, J.C.; Gilmer, T.M.
1987-01-01
Following carcinogen exposure in vitro, normal rat tracheal epithelial cells are transformed in a multistage process in which the cultured cells become immortal and ultimately, neoplastic. Five cell lines derived from tumors produced by neoplastically transformed rat tracheal epithelial cells were examined for the expression of 11 cellular oncogenes previously implicated in pulmonary or epithelial carcinogenesis. RNA homologous to fms was expressed at a level 5-19 times higher than normal tracheal epithelial cells in three of five of the tumor-derived lines. All three lines expressing high levels of fms-related RNA gave rise to invasive tumors of epithelial origin when injected into nude mice. Increased expression of the fms-related mRNA was not due to gene amplification, and no gene rearrangement was detected by Southern analyses. RNA blot analysis using a 3' v-fms probe detected a 9.5-kilobase message in the three tumor-derived lines, whereas both normal rat aveolar macrophages and the human choriocarcinoma line BeWo expressed a fms transcript of ≅ 4 kilobases. The authors conclude from these data that the gene expressed as a 9.5-kilobase transcript in these neoplastic epithelial cells is a member of a fms-related gene family but may be distinct from the gene that encodes the macrophage colony-stimulating factor (CSF-1) receptor
Cell-surface expression of Hsp70 on hematopoietic cancer cells after inhibition of HDAC activity
DEFF Research Database (Denmark)
Jensen, Helle
frequently express Hsp70 on their cell surface, whereas the corresponding normal tissues do not. In addition, several clinically applied reagents, such as alkyl-lysophospholipides, chemotherapeutic agents, and anti-inflammatory reagents, have been found to enhance Hsp70 cell surface expression on cancer...
DEFF Research Database (Denmark)
Bottley, G; Watherston, O G; Hiew, Y-L
2007-01-01
a role for E7 in tumour immune evasion. We show that knockdown of E7 expression in HPV16- and HPV18-transformed cervical carcinoma cells by RNA interference increased expression of major histocompatibility complex (MHC) class I at the cell surface and reduced susceptibility of these cells to natural...... killer (NK) cells. Tetracycline-regulated induction of HPV16 E7 resulted in reduced expression of cell surface MHC class I molecules and increased NK cell killing. Our results suggest that, for HPV-associated malignancies, reduced MHC class I expression is the result of an active immune evasion strategy...
Cell adhesion and EGFR activation regulate EphA2 expression in cancer
DEFF Research Database (Denmark)
Larsen, Alice Bjerregaard; Stockhausen, Marie-Thérése; Poulsen, Hans Skovgaard
2010-01-01
largely unknown. Here we show that the expression of EphA2 in in vitro cultured cells, is restricted to cells growing adherently and that adhesion-induced EphA2 expression is dependent upon activation of the epidermal growth factor receptor (EGFR), mitogen activated protein kinase kinase (MEK) and Src...... family kinases (SRC). Moreover, the results show that adhesion-induced EGFR activation and EphA2 expression is affected by interactions with extracellular matrix (ECM) proteins working as integrin ligands. Stimulation with the EphA2 ligand, ephrinA1 inhibited ERK phosphorylation and cancer cell viability....... These effects were however abolished by activation of the EGF-receptor ligand system favoring Ras/MAPK signaling and cell proliferation. Based on our results, we propose a regulatory mechanism where cell adhesion induces EGFR kinase activation and EphA2 expression; and where the effect of ephrinA1 mediated...
DEFF Research Database (Denmark)
Litvinov, Ivan V; Cordeiro, Brendan; Fredholm, Simon Mayland
2014-01-01
Deregulation of STAT signaling has been implicated in the pathogenesis for a variety of cancers, including CTCL. Recent reports indicate that loss of STAT4 expression is an important prognostic marker for CTCL progression and is associated with the acquisition of T helper 2 cell phenotype......R-155 leads to upregulation in STAT4 expression in MyLa cells. In summary, our results suggest that loss of STAT4 expression and associated switch to Th2 phenotype during Mycosis Fungoides progression may be driven via aberrant histone acetylation and/or upregulation of oncogenic miR-155 microRNA....... by malignant cells. However, little is known about the molecular mechanism behind the downregulation of STAT4 in this cancer. In the current work we test the expression of STAT4 and STAT6 via RT-PCR and/or Western Blot in CTCL lesional skin samples and in immortalized patient-derived cell lines...
Directory of Open Access Journals (Sweden)
Lina Dahl
Full Text Available The molecular mechanisms regulating the expansion of the hematopoietic system including hematopoietic stem cells (HSCs in the fetal liver during embryonic development are largely unknown. The LIM-homeobox gene Lhx2 is a candidate regulator of fetal hematopoiesis since it is expressed in the fetal liver and Lhx2(-/- mice die in utero due to severe anemia. Moreover, expression of Lhx2 in embryonic stem (ES cell-derived embryoid bodies (EBs can lead to the generation of HSC-like cell lines. To further define the role of this transcription factor in hematopoietic regulation, we generated ES cell lines that enabled tet-inducible expression of Lhx2. Using this approach we observed that Lhx2 expression synergises with specific signalling pathways, resulting in increased frequency of colony forming cells in developing EB cells. The increase in growth factor-responsive progenitor cells directly correlates to the efficiency in generating HSC-like cell lines, suggesting that Lhx2 expression induce self-renewal of a distinct multipotential hematopoietic progenitor cell in EBs. Signalling via the c-kit tyrosine kinase receptor and the gp130 signal transducer by IL-6 is necessary and sufficient for the Lhx2 induced self-renewal. While inducing self-renewal of multipotential progenitor cells, expression of Lhx2 inhibited proliferation of primitive erythroid precursor cells and interfered with early ES cell commitment, indicating striking lineage specificity of this effect.
Increased Dickkopf-1 expression accelerates bone cell apoptosis in femoral head osteonecrosis.
Ko, Jih-Yang; Wang, Feng-Sheng; Wang, Ching-Jen; Wong, To; Chou, Wen-Yi; Tseng, Shin-Ling
2010-03-01
Intensive bone cell apoptosis contributes to osteonecrosis of femoral head (ONFH). Dickkopf-1 (DKK1) reportedly mediates various types of skeletal disorders. This study investigated whether DKK1 was linked to the occurrence of ONFH. Thirty-nine patients with various stages of ONFH were recruited. Bone specimens were harvested from 34 ONFH patients underwent hip arthroplasty, and from 10 femoral neck fracture patients. Bad, Bcl2 TNFalpha, DKK1, Wnt3a, LRP5, and Axin1 expressions were analyzed by quantitative RT-PCR and ELISA. Apoptotic cells were assayed using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end-labelling (TUNEL). Primary bone-marrow mesenchymal cells were treated with DKK1 RNA interference and recombinant DKK1 protein. ONFH patients with the histories of being administrated corticosteroids and excessive alcohol consumption had significantly higher Bad and DKK1 mRNA expressions in bone tissue and DKK1 abundances in serum than femoral neck fracture patients. Bone cells adjacent to osteonecrotic bone displayed strong DKK1 immunoreactivity and TUNEL staining. Increased DKK1 expression in bone tissue and serum correlated with Bad expression and TUNEL staining. Serum DKK1 abundance correlated with the severity of ONFH. The DKK1 RNA interference and recombinant DKK1 protein regulated Bad expression and apoptosis of primary bone-marrow mesenchymal cells. Knock down of DKK1 reduced dexamethasone-induced apoptosis of mesenchymal cells. Taken together, promoted DKK1 expression was associated with bone cell apoptosis in the occurrence of ONFH patients with the histories of corticosteroid and alcohol intake and progression of ONFH. DKK1 expression in injured tissue provides new insight into ONFH pathogenesis.
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available The roles of vitamin A (VA in the development of metabolic diseases remain unanswered. We have reported that retinoids synergized with insulin to induce the expression of sterol-regulatory element-binding protein 1c gene (Srebp-1c expression in primary rat hepatocytes. Additionally, the hepatic Srebp-1c expression is elevated in Zucker fatty (ZF rats, and reduced in those fed a VA deficient diet. VA is metabolized to retinoic acid (RA for regulating gene expression. We hypothesized that the expression of RA production enzymes contributes to the regulation of the hepatic Srebp-1c expression. Therefore, we analyzed their expression levels in Zucker lean (ZL and ZF rats. The mRNA levels of retinaldehyde dehydrogenase family 1 gene (Raldh1 were found to be higher in the isolated and cultured primary hepatocytes from ZF rats than that from ZL rats. The RALDH1 protein level was elevated in the liver of ZF rats. Retinol and retinal dose- and time-dependently induced the expression of RA responsive Cyp26a1 gene in hepatocytes and hepatoma cells. INS-1 cells were identified as an ideal tool to study the effects of RA production on the regulation of gene expression because only RA, but not retinal, induced Srebp-1c mRNA expression in them. Recombinant adenovirus containing rat Raldh1 cDNA was made and used to infect INS-1 cells. The over-expression of RALDH1 introduced the retinal-mediated induction of Srebp-1c expression in INS-1 cells. We conclude that the expression levels of the enzymes for RA production may contribute to the regulation of RA responsive genes, and determine the responses of the cells to retinoid treatments. The elevated hepatic expression of Raldh1 in ZF rats may cause the excessive RA production from retinol, and in turn, result in higher Srebp-1c expression. This excessive RA production may be one of the factors contributing to the elevated lipogenesis in the liver of ZF rats.
Catalog of gene expression in adult neural stem cells and their in vivo microenvironment
International Nuclear Information System (INIS)
Williams, Cecilia; Wirta, Valtteri; Meletis, Konstantinos; Wikstroem, Lilian; Carlsson, Leif; Frisen, Jonas; Lundeberg, Joakim
2006-01-01
Stem cells generally reside in a stem cell microenvironment, where cues for self-renewal and differentiation are present. However, the genetic program underlying stem cell proliferation and multipotency is poorly understood. Transcriptome analysis of stem cells and their in vivo microenvironment is one way of uncovering the unique stemness properties and provides a framework for the elucidation of stem cell function. Here, we characterize the gene expression profile of the in vivo neural stem cell microenvironment in the lateral ventricle wall of adult mouse brain and of in vitro proliferating neural stem cells. We have also analyzed an Lhx2-expressing hematopoietic-stem-cell-like cell line in order to define the transcriptome of a well-characterized and pure cell population with stem cell characteristics. We report the generation, assembly and annotation of 50,792 high-quality 5'-end expressed sequence tag sequences. We further describe a shared expression of 1065 transcripts by all three stem cell libraries and a large overlap with previously published gene expression signatures for neural stem/progenitor cells and other multipotent stem cells. The sequences and cDNA clones obtained within this framework provide a comprehensive resource for the analysis of genes in adult stem cells that can accelerate future stem cell research
Drug-loaded nanoparticles induce gene expression in human pluripotent stem cell derivatives
Gajbhiye, Virendra; Escalante, Leah; Chen, Guojun; Laperle, Alex; Zheng, Qifeng; Steyer, Benjamin; Gong, Shaoqin; Saha, Krishanu
2013-12-01
Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained higher fibroblast proliferation levels and MMP activity. The results demonstrate that the PEG-H40-DXC nanoparticle system provides an effective tool to controlling gene expression in human stem cell derivatives.Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained
Directory of Open Access Journals (Sweden)
Chryso Kanthou
Full Text Available Vascular endothelial growth factor-A (VEGF is produced by most cancer cells as multiple isoforms, which display distinct biological activities. VEGF plays an undisputed role in tumour growth, vascularisation and metastasis; nevertheless the functions of individual isoforms in these processes remain poorly understood. We investigated the effects of three main murine isoforms (VEGF188, 164 and 120 on tumour cell behaviour, using a panel of fibrosarcoma cells we developed that express them individually under endogenous promoter control. Fibrosarcomas expressing only VEGF188 (fs188 or wild type controls (fswt were typically mesenchymal, formed ruffles and displayed strong matrix-binding activity. VEGF164- and VEGF120-producing cells (fs164 and fs120 respectively were less typically mesenchymal, lacked ruffles but formed abundant cell-cell contacts. On 3D collagen, fs188 cells remained mesenchymal while fs164 and fs120 cells adopted rounded/amoeboid and a mix of rounded and elongated morphologies respectively. Consistent with their mesenchymal characteristics, fs188 cells migrated significantly faster than fs164 or fs120 cells on 2D surfaces while contractility inhibitors accelerated fs164 and fs120 cell migration. VEGF164/VEGF120 expression correlated with faster proliferation rates and lower levels of spontaneous apoptosis than VEGF188 expression. Nevertheless, VEGF188 was associated with constitutively active/phosphorylated AKT, ERK1/2 and Stat3 proteins. Differences in proliferation rates and apoptosis could be explained by defective signalling downstream of pAKT to FOXO and GSK3 in fs188 and fswt cells, which also correlated with p27/p21 cyclin-dependent kinase inhibitor over-expression. All cells expressed tyrosine kinase VEGF receptors, but these were not active/activatable suggesting that inherent differences between the cell lines are governed by endogenous VEGF isoform expression through complex interactions that are independent of tyrosine
Isolation of hair follicle bulge stem cells from YFP-expressing reporter mice.
Nakrieko, Kerry-Ann; Irvine, Timothy S; Dagnino, Lina
2013-01-01
In this article we provide a method to isolate hair follicle stem cells that have undergone targeted gene inactivation. The mice from which these cells are isolated are bred into a Rosa26-yellow fluorescent protein (YFP) reporter background, which results in YFP expression in the targeted stem cell population. These cells are isolated and purified by fluorescence-activated cell sorting, using epidermal stem cell-specific markers in conjunction with YFP fluorescence. The purified cells can be used for gene expression studies, clonogenic experiments, and biological assays, such as viability and capacity for directional migration.
Progesterone Upregulates Gene Expression in Normal Human Thyroid Follicular Cells
Directory of Open Access Journals (Sweden)
Ana Paula Santin Bertoni
2015-01-01
Full Text Available Thyroid cancer and thyroid nodules are more prevalent in women than men, so female sex hormones may have an etiological role in these conditions. There are no data about direct effects of progesterone on thyroid cells, so the aim of the present study was to evaluate progesterone effects in the sodium-iodide symporter NIS, thyroglobulin TG, thyroperoxidase TPO, and KI-67 genes expression, in normal thyroid follicular cells, derived from human tissue. NIS, TG, TPO, and KI-67 mRNA expression increased significantly after TSH 20 μUI/mL, respectively: 2.08 times, P<0.0001; 2.39 times, P=0.01; 1.58 times, P=0.0003; and 1.87 times, P<0.0001. In thyroid cells treated with 20 μUI/mL TSH plus 10 nM progesterone, RNA expression of NIS, TG, and KI-67 genes increased, respectively: 1.78 times, P<0.0001; 1.75 times, P=0.037; and 1.95 times, P<0.0001, and TPO mRNA expression also increased, though not significantly (1.77 times, P=0.069. These effects were abolished by mifepristone, an antagonist of progesterone receptor, suggesting that genes involved in thyroid cell function and proliferation are upregulated by progesterone. This work provides evidence that progesterone has a direct effect on thyroid cells, upregulating genes involved in thyroid function and growth.
Expression of p210 BCR/ABl increases hematopoietic progenitor cell radiosensitivity
International Nuclear Information System (INIS)
Santucci, M.A.; Anklesaria, P.; Das, I.J.; Sakakeeny, M.A.; FitzGerald, T.J.; Greenberger, J.S.; Laneuville, P.
1993-01-01
The cytogenetic finding of the Ph1+ chromosome and its molecular biologic marker bcr/abl gene rearrangement in cells from patients with chronic myeloid leukemia are associated with a proliferative advantage of the Ph1+ clone in vivo. Although the transition to the acute terminal phase or blastic crisis is often associated with additional cytogenetic abnormalities, the molecular events which correlate the initial cytogenetic lesion with the terminal phase are poorly understood. Defective cellular DNA repair capacity is often associated with chromosomal instability, increased mutation frequency, and biologic alterations. The authors tested whether the protein product of the bcr/abl translocation (p210) could alter DNA repair after gamma-irradiation of murine cell lines expressing the bcr/abl cDNA. The 32D cl 3 parent, 32D cl 3 pYN (containing the control vector plasmid) and each of two sources of 32D cl 3 cells expressing p210 cDNA (32D-PC1 cell line and 32D-LG7 subclone) showed a D 0 of 1.62, 1.57, 1.16, and 1.27 Gy, respectively. Thus, expression of the p210 product induced a significant increase in radiosensitivity at the clinically relevant radiation therapy dose-rate. The increased radiosensitivity of p210-expressing cells persisted if cells were held before plating in a density-inhibited state for 8 hr after gamma-irradiation, indicating little effect on the repair of potentially lethal gamma-irradiation damage. The IL-3 dependent parent 32D cl 3 cells demonstrated programmed cell death in the absence of growth factor or following gamma-irradiation to 200 cGy. Expression of p210 cDNA in the 32D-PC1 and 32D-LG7 subclones abrogated IL-3 requirement of these cell lines and inhibited gamma-irradiation induced programmed cell death. These data suggest a role for p210 in amplifying gamma-irradiation DNA damage or broadly inhibiting DNA repair, conditions that may stimulate further cytogenetic alterations in hematopoietic cells. 43 refs., 3 figs., 1 tab
The expression of SLAMF7 levels in malignant B cells: a novel ...
African Journals Online (AJOL)
Signalling lymphocyte activation molecule (SLAM) F7 is found on the surface of some immune cells including B-lymphocytes. Its activation leads to the proliferation or differentiation of immune cells. The objectives of the study were to measure SLAMF7 expression levels on B-CLL cells, and to upregulate the expression of ...