Chloroquine inhibits dengue virus type 2 replication in Vero cells but not in C6/36 cells.

Science.gov (United States)

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR and plaque assays were used to quantify the DENV-2 load in infected Vero and C6/36 cells after chloroquine treatment. Our results showed that a dose of 50 μg/ml of chloroquine was not toxic to the cells and induced a statistically significant inhibition of virus production in infected Vero cells when compared to untreated cells. In C6/36 cells, chloroquine does not induce a statistically significant difference in viral replication when compared to untreated cells, showing that this virus uses an unlikely pathway of penetration in these cells, and results were also confirmed by the plaque assay (PFU). These data suggest that the inhibition of virus infection induced by chloroquine is due to interference with acidic vesicles in mammalian cells.

Comparison analysis of microRNAs in response to dengue virus type 2 infection between the Vero cell-adapted strain and its source, the clinical C6/36 isolated strain.

Science.gov (United States)

Yang, Jiajia; Lin, Yao; Jiang, Liming; Xi, Juemin; Wang, Xiaodan; Guan, Jiaoqiong; Chen, Junying; Pan, Yue; Luo, Jia; Ye, Chao; Sun, Qiangming

2018-05-02

To elucidate the differences in microRNAs during dengue virus infection between Vero cell-adapted strain (DENV-2-Vero) and its source, the clinical C6/36 isolated strain (DENV-2-C6/36), a comparison analysis was performed in Vero cells by high throughput sequencing. The results showed that the expression of 16 known and 3 novel miRNAs exhibited marked differences. 5 known miRNAs were up-regulated in DENV-2-C6/36 group, while 11 known microRNAs were down-regulated in DENV-2-Vero group. The GO enrichment and KEGG pathway analysis showed that there was a distinct difference in regulating viral replication between two strains. In DENV-2-Vero infection group, significantly enriched GO terms included virion attachment to host cells, viral structural protein/genome processing and packaging. Meanwhile, the regulation of cell death and apoptosis between two groups were different in the early stage of infection. KEGG enrichment analysis showed that DENV-2-C6/36 infection induced more intense regulation of immune-related pathways, including Fc gamma R-mediated phagocytosis, etc. DENV-2-Vero infection could partially alleviate the immune defense of Vero cells compared with DENV-2-C6/36. The results indicated that the distinct microRNA changes induced by two DENV-2 strains may be partly related to their infective abilities. Our data provide useful insights that help elucidate the host-pathogen interactions following DENV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

The influence of 60Co gamma rays to cell reproduction (An experiment using low dose levels on vero and primary monkey kidney cells)

International Nuclear Information System (INIS)

Danusupadmo, C.J. Sugiarto

1985-01-01

Vero and primary monkey kidney cells in culture were gamma irradiated with doses of 0, 0.4 and 0.8 Gy at a dose-rate of 1.30-1.45x10 3 Gy/hour. At harvest time 3 days post irradiation, 0.4 Gy proved to be able to lower the number of vero cells in such a degree that it became significantly different from the control, whereas 0.8 Gy could not suppress the number of primary cells to a level that differed significantly from its control. At harvest time of 7 days post irradiation, 0.4 Gy was found effective in lowering both vero and primary cells so that the number of the harvested cells were significantly different from the controls. At harvest time of 3 days post irradiation, 0.8 Gy caused both cell types reached levels that were not significantly different from 0.4 Gy, but at 7 days post irradiation the number of vero cells was very significantly different from that of 0.4 Gy, while the number of primary cells remained equal to that of 0.4 Gy. This phenomenon showed that irradiation could cause greater injurious effect at more advanced post irradiation times, while the more proliferative vero cells proved to be more susceptible to irradiation than primary cells, but at the same time more potential in performing repair. (author)

Avian metapneumovirus M2:2 protein inhibits replication in Vero cells: modification facilitates live vaccine development.

Science.gov (United States)

Clubbe, Jayne; Naylor, Clive J

2011-11-28

Throughout the world, avian metapneumovirus (AMPV) infection of subtype A is principally controlled by two live vaccines both derived from UK field strain #8544. Improvements of those vaccines by use of reverse genetics technology was found to be hampered by the inability of #8544 to replicate in the commonly exploited Vero cell based reverse genetics system. A systematic reverse genetics based genome modification of a DNA copy of #8544, employing sequence data from a Vero grown, #8544 derived, live vaccine; was used to determine mutations required to facilitate virus recovery and replication in Vero cells. This identified a single coding substitution in the M2:2 reading frame as responsible. Furthermore, ablation of M2:2 was found to elicit the same outcome. M2:2 sequence analysis of seven AMPVs found Vero cell adaption to be associated with non similar amino acid changes in M2:2. The study shows that M2:2 modification of field virus #8544 will enable research leading to improved vaccines. This may have more general application to other AMPV field strains. Copyright © 2011 Elsevier Ltd. All rights reserved.

Adaptation of high-growth influenza H5N1 vaccine virus in Vero cells: implications for pandemic preparedness.

Directory of Open Access Journals (Sweden)

Yu-Fen Tseng

Full Text Available Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14, a reassortant virus between A/Vietnam/1194/2004 (H5N1 virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15 was generated and can grow over 10(8 TCID(50/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes.

A purified inactivated Japanese encephalitis virus vaccine made in Vero cells.

Science.gov (United States)

Srivastava, A K; Putnak, J R; Lee, S H; Hong, S P; Moon, S B; Barvir, D A; Zhao, B; Olson, R A; Kim, S O; Yoo, W D; Towle, A C; Vaughn, D W; Innis, B L; Eckels, K H

2001-08-14

A second generation, purified, inactivated vaccine (PIV) against Japanese encephalitis (JE) virus was produced and tested in mice where it was found to be highly immunogenic and protective. The JE-PIV was made from an attenuated strain of JE virus propagated in certified Vero cells, purified, and inactivated with formalin. Its manufacture followed current GMP guidelines for the production of biologicals. The manufacturing process was efficient in generating a high yield of virus, essentially free of contaminating host cell proteins and nucleic acids. The PIV was formulated with aluminum hydroxide and administered to mice by subcutaneous inoculation. Vaccinated animals developed high-titered JE virus neutralizing antibodies in a dose dependent fashion after two injections. The vaccine protected mice against morbidity and mortality after challenge with live, virulent, JE virus. Compared with the existing licensed mouse brain-derived vaccine, JE-Vax, the Vero cell-derived JE-PIV was more immunogenic and as effective as preventing encephalitis in mice. The JE-PIV is currently being tested for safety and immunogenicity in volunteers.

A NEW COPPER (II)-IMIDAZOLE DERIVATIVE EFFECTIVELY INHIBITS REPLICATION OF DENV-2 IN VERO CELL

Science.gov (United States)

Sucipto, Teguh Hari; Churrotin, Siti; Setyawati, Harsasi; Martak, Fahimah; Mulyatno, Kris Cahyo; Amarullah, Ilham Harlan; Kotaki, Tomohiro; Kameoka, Masanori; Yotopranoto, Subagyo; Soegijanto, and Soegeng

2018-01-01

Background: Dengue is a kind of infectious disease that was distributed in the tropical and sub-tropical areas. To date, there is no clinically approved dengue vaccine or antiviral for humans, even though there have been great efforts towards this end. Therefore, finding the effective compound against dengue virus (DENV) replication is very important. Among the complex compounds, copper(II)-imidazole derivatives are of interest because of their biological and medicinal benefits. Materials and Methods: In the present study, antiviral activity of [Cu(2,4,5-triphenylimidazole)2]n, was evaluated against different stages of dengue virus type 2 (DENV-2) replication in Vero cell using focus forming unit reduction assay and quantitative ELISA. Results: [Cu(2,4,5-triphenylimidazole)2]n inhibited DENV-2 replication in Vero cells with IC50 = 2.3 μg/ml and SI= 19.42 when cells were treated 2 days after virus infection, whereas its CC50 for cytotoxicity to Vero cells was 44.174 μg/ml. Conclusion: The compound has high anti-DENV2 activity, less toxicity, and a high possibility to be considered a drug candidate. PMID:29619441

Lipophilic organic pollutants induce changes in phospholipid and membrane protein composition leading to Vero cell morphological change.

Science.gov (United States)

Liao, Ting T; Wang, Lei; Jia, Ru W; Fu, Xiao H; Chua, Hong

2014-01-01

Membrane damage related to morphological change in Vero cells is a sensitive index of the composite biotoxicity of trace lipophilic chemicals. However, judging whether the morphological change in Vero cells happens and its ratio are difficult because it is not a quantitative characteristic. To find biomarkers of cell morphological change for quantitatively representing the ratio of morphological changed cell, the mechanism of cell membrane damage driven by typical lipophilic chemicals, such as trichlorophenol (TCP) and perfluorooctanesulphonate (PFOS), was explored. The ratio of morphologically changed cells generally increased with increased TCP or PFOS concentrations, and the level of four major components of phospholipids varied with concentrations of TCP or PFOS, but only the ratio of phosphatidylcholine (PC)/phosphatidylethanolamine (PE) decreased regularly as TCP or PFOS concentrations increased. Analysis of membrane proteins showed that the level of vimentin in normal cell membranes is high, while it decreases or vanishes after TCP exposure. These variations in phospholipid and membrane protein components may result in membrane leakage and variation in rigid structure, which leads to changes in cell morphology. Therefore, the ratio of PC/PE and amount of vimentin may be potential biomarkers for representing the ratio of morphological changed Vero cell introduced by trace lipophilic compounds, thus their composite bio-toxicity.

Assessment of cytotoxicity of Portulaca oleracea Linn. against human colon adenocarcinoma and vero cell line

Science.gov (United States)

Mali, Prashant Y.

2015-01-01

Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374

Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines

Directory of Open Access Journals (Sweden)

Syahida Ahmad

2012-10-01

Full Text Available The direct feeding of Jatropha meal containing phorbol esters (PEs indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang and African green monkey kidney (Vero cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 μg/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA values as positive control i.e., 124.5 and 106.3 μg/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-δ and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-δ and caspase-3 as their mode of actions.

A Study on Recovery from Potentially Lethal Damage induced by γ-Irradiation in Plateau-phase Vero Cells in vitro

International Nuclear Information System (INIS)

Kim, Il Han; Choi, Eun Kyung; Ha, Sung Whan; Park, Charn Il; Cha, Chang Yong

1988-01-01

Recovery from potentially lethal damage (PLDR) after irradiation was studied in plateau-phase culture of Vero cells in vitro. Unfed plateau-phase cells were irradiated with dose of 1 to 9 Gy using Cs-137 irradiator. Cells then were incubated again and left in situ for 0, 1, 2, 3, 4, 5, 6 and 24 hours and then were trypsinized, explanted, and subcultured in fresh RPMI-1640 media containing 0.33% agar. Cell survival was measured by colony forming ability. An adequate number of heavily irradiated Vero cells were added as feeder cells to make the total cell number constant in every culture dish. As the postirradiation in situ incubation time increased, surviving fraction increased saturation level at 2 to 4 hours after in situ incubation. As the radiation dose increased, the rate of PLDR also increased. In analysis of cell survival curve fitted to the linear-quadratic model, the linear inactivation coefficient (a) decreased largely and reached nearly to zero but the quadratic inactivation coefficient (b) increased minimally by increment of postirradiation in situ incubation time. So PLDR mainly affected the damage expressed as a. In the multitarget model, significant change was not obtained in D0 but in Dq. Therefore, shoulder region in cell survival curve was mainly affected by PLDR and terminal slope was not influenced at all. And dose-modifying factor by PLDR was relatively higher in shoulder region, that is, in low dose area below 3 Gy

[Cytotoxic effect of Vibrio cholerae non-O1 on Vero cells].

Science.gov (United States)

Figueroa-Arredondo, P; García-Lozano, H; Gutiérrez-Cogco, L; Valdespino-Gómez, J L

1994-01-01

At the present time there is still in Mexico a diarrhoeal outbreak due to Vibrio cholerae O1. In INDRE we have isolated from the same outbreak last year (jan-apr), 70 strains of Vibrio cholerae Non-O1. These were isolated from patients with a diarrhoeal illness different from cholera. Patients were of different ages and sex, and from various geographic areas. The isolated strains were confirmed by serological agglutination test with polyclonal antisera, and they neither belong to O1 serogroup or O139. We assayed all the 70 strains in Vero cells, searching for cytotoxic effect, probably attributed to cholera toxin, or any other toxin. The strains were screened by PCR for cholera toxin gene detection, and negative results were obtained. We have found only one CT-producer strain, but it was a rough one so, we are not able to affirm that is not a V. cholerae O1 serotype. Vibrio cholerae Non-O1 strains, tested in Vero cells assay, produced cytotoxic effect within 24 h. It was found that 48/70 strains (66.6%), had cytotoxic activity, showing rounding and then lysis of cells. From our results we concluded that this cytotoxic effect, is not cholera toxin related, instead we propose it could be due to an unknown virulence factor, probably a different toxin in mexican Vibrio cholerae Non-O1 strains.

Production of Newcastle Disease Virus by Vero Cells Grown on Cytodex 1 Microcarriers in a 2-Litre Stirred Tank Bioreactor

Directory of Open Access Journals (Sweden)

Mohd Azmir Arifin

2010-01-01

Full Text Available The aim of this study is to prepare a model for the production of Newcastle disease virus (NDV lentogenic F strain using cell culture in bioreactor for live attenuated vaccine preparation. In this study, firstly we investigated the growth of Vero cells in several culture media. The maximum cell number was yielded by culture of Vero cells in Dulbecco's Modified Eagle Medium (DMEM which was 1.93×106 cells/ml. Secondly Vero cells were grown in two-litre stirred tank bioreactor by using several commercial microcarriers. We achieved the maximum cell concentration about 7.95×105 cells/ml when using Cytodex 1. Later we produced Newcastle Disease virus in stirred tank bioreactor based on the design developed using Taguchi L4 method. Results reveal that higher multiplicity of infection (MOI and size of cell inoculums can yield higher virus titer. Finally, virus samples were purified using high-speed centrifugation based on 3∗∗(3-1 Fractional Factorial Design. Statistical analysis showed that the maximum virus titer can be achieved at virus sample concentration of 58.45% (v/v, centrifugation speed of 13729 rpm, and centrifugation time of 4 hours. As a conclusion, high yield of virus titer could be achieved through optimization of cell culture in bioreactor and separation by high-speed centrifugation.

Serum-free microcarrier based production of replication deficient Influenza vaccine candidate virus lacking NS1 using Vero cells

Directory of Open Access Journals (Sweden)

Yan Mylene L

2011-08-01

Full Text Available Abstract Background Influenza virus is a major health concern that has huge impacts on the human society, and vaccination remains as one of the most effective ways to mitigate this disease. Comparing the two types of commercially available Influenza vaccine, the live attenuated virus vaccine is more cross-reactive and easier to administer than the traditional inactivated vaccines. One promising live attenuated Influenza vaccine that has completed Phase I clinical trial is deltaFLU, a deletion mutant lacking the viral Nonstructural Protein 1 (NS1 gene. As a consequence of this gene deletion, this mutant virus can only propagate effectively in cells with a deficient interferon-mediated antiviral response. To demonstrate the manufacturability of this vaccine candidate, a batch bioreactor production process using adherent Vero cells on microcarriers in commercially available animal-component free, serum-free media is described. Results Five commercially available animal-component free, serum-free media (SFM were evaluated for growth of Vero cells in agitated Cytodex 1 spinner flask microcarrier cultures. EX-CELL Vero SFM achieved the highest cell concentration of 2.6 × 10^6 cells/ml, whereas other SFM achieved about 1.2 × 10^6 cells/ml. Time points for infection between the late exponential and stationary phases of cell growth had no significant effect in the final virus titres. A virus yield of 7.6 Log10 TCID50/ml was achieved using trypsin concentration of 10 μg/ml and MOI of 0.001. The Influenza vaccine production process was scaled up to a 3 liter controlled stirred tank bioreactor to achieve a cell density of 2.7 × 10^6 cells/ml and virus titre of 8.3 Log10 TCID50/ml. Finally, the bioreactor system was tested for the production of the corresponding wild type H1N1 Influenza virus, which is conventionally used in the production of inactivated vaccine. High virus titres of up to 10 Log10 TCID50/ml were achieved. Conclusions We describe for the

Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

International Nuclear Information System (INIS)

Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.

1986-01-01

The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated 35 S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with 32 P-ATP (in vitro method) or 32 Pi (in vivo method). Finally, analysis of 3 H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells

Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

International Nuclear Information System (INIS)

Sandvig, K.; Olsnes, S.

1988-01-01

Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of 45 Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

International Nuclear Information System (INIS)

Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.

2013-01-01

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants

Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

Energy Technology Data Exchange (ETDEWEB)

Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)

2013-07-05

Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

International Nuclear Information System (INIS)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang

2012-01-01

Highlights: ► Vero cell-based HPAI H5N1 vaccine with stable high yield. ► Stable high yield derived from the YNVa H3N2 backbone. ► H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

Role of trypsin in the replication of Avian metapneumovirus subtype C (strain MN-2a) and its entry into the Vero cells.

Science.gov (United States)

Paudel, Sarita; Shin, Hyun-Jin

2015-12-01

To understand the molecular mechanisms of Avian metapneumovirus (aMPV) and the requirements involved in the infection and fusion, trypsin treatment was done in the different stages of virus; before infection, during entry and after virus infection followed by aMPV infection. The growth kinetics of aMPV was compared in time dependent manner. The effect of trypsin was found in the later stage of aMPV infection increasing the numbers of infected cells with the significant higher titer of infectious virions to that of trypsin treated before infection, during entry and aMPV. A serine protease inhibitor reduced aMPV replication in a significant way, whereas cysteine peptidase (E-64), aspartic protease (pepstatin A), and metalloprotease (phosphoramidon) inhibitors had no effect on aMPV replication. Inoculation of aMPV on Vero cells expressing the membrane-associated protease TMPRSS2 resulted in higher virus titers than that inoculated on normal Vero cells and is statistically significant (p < 0.05). Also, an inhibitor of clathrin/caveolae-mediated endocytosis had no effect on virus progeny, indicating that aMPV does not use the endocytic pathway for entry but undergoes direct fusion. The effect of lysosomotropic agents was not significant, suggesting that aMPV does not require low-pH environment in endosomes to fuse its envelope with the plasma membrane. Copyright © 2015 Elsevier Ltd. All rights reserved.

VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

Directory of Open Access Journals (Sweden)

Laura Lafon-Hughes

2014-10-01

Full Text Available Poly-ADP-ribose (PAR is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs and degraded by poly-ADP-ribose-glycohydrolase (PARG. Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair. Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt. In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO. PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications.

High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

Energy Technology Data Exchange (ETDEWEB)

Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China); Wang, Yue [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People' s Republic of China (China); Liao, Guoyang [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People' s Republic of China (China)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

Chloroquine Inhibits Dengue Virus Type 2 Replication in Vero Cells but Not in C6/36 Cells

OpenAIRE

Farias, Kleber Juvenal Silva; Machado, Paula Renata Lima; da Fonseca, Benedito Antônio Lopes

2013-01-01

Dengue viruses are the most important arthropod-borne viruses in terms of morbidity and mortality in the world. Since there is no dengue vaccine available for human use, we have set out to investigate the use of chloroquine as an antiviral drug against dengue. Chloroquine, an amine acidotropic drug known to affect intracellular exocytic pathways by increasing endosomal pH, was used in the in vitro treatment of Vero and C6/36 cells infected with dengue virus type 2 (DENV-2). Real-time RT-PCR a...

Benefits of oxygen and nitrogen plasma treatment in Vero cell affinity to poly(lactide-co-glycolide acid

Directory of Open Access Journals (Sweden)

Andrea Rodrigues Esposito

2013-01-01

Full Text Available Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. it is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. in this study, poly(lactide-co-glycolide, plga, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on vero cells culture. the plga membranes, which were characterized by sem and contact angle, showed increased surface rugosity and narrower contact angles. cell adhesion, cytotoxicity assay, sem and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction. Cell adhesion on materials surface is critical because this phenomenon occurs before other events, as cell spreading, cell migration and cell differentiation. It is commonly accepted that the adhesion of cells on solid substrate is influenced by several substratum surface properties, such as wettability, surface charge, roughness and topography. Plasma technique is a convenient method for modifying surface properties of materials without affecting physical properties. In this study, poly(lactide-co-glycolide, PLGA, membranes were modified by oxygen and nitrogen plasma to improve polymer hydrophilicity and verify their effect on Vero cells culture. The PLGA membranes, which were characterized by SEM and contact angle, showed increased surface rugosity and narrower contact angles. Cell adhesion, cytotoxicity assay, SEM and cytochemistry analysis showed that plasma treatment was beneficial to cell growth by improving cell-polymer interaction.

Antioxidant and antigenotoxic role of recombinant human erythropoeitin against alkylating agents: cisplatin and mitomycin C in cultured Vero cells.

Science.gov (United States)

Rjiba-Touati, Karima; Ayed-Boussema, Imen; Soualeh, Nidhal; Achour, Abdellatif; Bacha, Hassen; Abid, Salwa

2013-08-01

Cisplatin (CDDP) and mitomycin C (MMC), two alkylating agents used against various solid tumours, are a common source of acute kidney injury. Thus, strategies for minimizing CDDP and MMC toxicity are of a clinical interest. In this study, we aimed to investigate the protective role of recombinant human erythropoietin (rhEPO) against oxidative stress and genotoxicity induced by CDDP and MMC in cultured Vero cells. Three types of treatments were performed: (i) cells were treated with rhEPO 24 h before exposure to CDDP/MMC (pre-treatment), (ii) cells were treated with rhEPO and CDDP/MMC simultaneously (co-treatment), (iii) cells were treated with rhEPO 24 h after exposure to CDDP/MMC (post-treatment). Our results showed that rhEPO decreased the reactive oxygen species levels, the malondialdehyde levels and ameliorated glutathione (reduced and oxidized glutathione) modulation induced by CDDP and MMC in cultured Vero cells. Furthermore, rhEPO administration prevented alkylating agents-induced DNA damage accessed by comet test. Altogether, our results suggested a protective role of rhEPO, against CDDP- and MMC-induced oxidative stress and genotoxicity, especially in pre-treatment condition.

Aggravation of cold-induced injury in Vero-B4 cells by RPMI 1640 medium – Identification of the responsible medium components

Directory of Open Access Journals (Sweden)

Pless-Petig Gesine

2012-10-01

Full Text Available Abstract Background In modern biotechnology, there is a need for pausing cell lines by cold storage to adapt large-scale cell cultures to the variable demand for their products. We compared various cell culture media/solutions for cold storage of Vero-B4 kidney cells, a cell line widely used in biotechnology. Results Cold storage in RPMI 1640 medium, a recommended cell culture medium for Vero-B4 cells, surprisingly, strongly enhanced cold-induced cell injury in these cells in comparison to cold storage in Krebs-Henseleit buffer or other cell culture media (DMEM, L-15 and M199. Manufacturer, batch, medium supplements and the most likely components with concentrations outside the range of the other media/solutions (vitamin B12, inositol, biotin, p-aminobenzoic acid did not cause this aggravation of cold-induced injury in RPMI 1640. However, a modified Krebs-Henseleit buffer with a low calcium concentration (0.42 mM, a high concentration of inorganic phosphate (5.6 mM, and glucose (11.1 mM; i.e. concentrations as in RPMI 1640 evoked a cell injury and loss of metabolic function corresponding to that observed in RPMI 1640. Deferoxamine improved cell survival and preserved metabolic function in modified Krebs-Henseleit buffer as well as in RPMI 1640. Similar Ca2+ and phosphate concentrations did not increase cold-induced cell injury in the kidney cell line LLC-PK1, porcine aortic endothelial cells or rat hepatocytes. However, more extreme conditions (Ca2+ was nominally absent and phosphate concentration raised to 25 mM as in the organ preservation solution University of Wisconsin solution also increased cold-induced injury in rat hepatocytes and porcine aortic endothelial cells. Conclusion These data suggest that the combination of low calcium and high phosphate concentrations in the presence of glucose enhances cold-induced, iron-dependent injury drastically in Vero-B4 cells, and that a tendency for this pathomechanism also exists in other cell types.

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Science.gov (United States)

Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad

2016-01-01

Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.

Directory of Open Access Journals (Sweden)

Mahmoud Huleihel

Full Text Available Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA was performed on the Raman spectra after principal component analysis (PCA with a leave one out (LOO approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment.

Alteration of cell cycle progression by Sindbis virus infection

Energy Technology Data Exchange (ETDEWEB)

Yi, Ruirong; Saito, Kengo [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Isegawa, Naohisa [Laboratory Animal Center, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan); Shirasawa, Hiroshi, E-mail: sirasawa@faculty.chiba-u.jp [Department of Molecular Virology, Graduate School of Medicine, Chiba University Graduate School of Medicine, 1-8-1 Inohana, Chiba 260-8670 (Japan)

2015-07-10

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.

Alteration of cell cycle progression by Sindbis virus infection

International Nuclear Information System (INIS)

Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi

2015-01-01

We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G 1 phase preferred to proliferate during S/G 2 phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G 1 phase than in cells infected during S/G 2 phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases

VERO MODA Settles in Taobao Mall

Institute of Scientific and Technical Information of China (English)

2010-01-01

@@ In the wake of the successive opening up of Jack&Jones' and ONLY's official flagship stores in Taobao Mall, the Danish Bestseller Fashion Group's other brand, VERO MODA, landed the Mall on July 2nd. At present, the first two brands' online sales have exceeded 500 million yuan per month. Based on the encouraging sales figures, VERO MODA, as Bestseller's third-largest brand on Taobao platform, is expected to scale new network marketing miracle.

The influence of serum substituents on serum-free Vero cell conditioned culture media manufactured from Dulbecco's modified Eagle medium in mouse embryo culture.

Science.gov (United States)

Lee, Jong-Seon; Kim, Ju-Hwan; Seo, Young-Seok; Yang, Jung-Bo; Kim, Yong-Il; Kim, Hye-Jin; Lee, Ki-Hwan

2013-09-01

This study was conducted to examine the influences of supplementation of the serum substituents and available period of serum-free Vero cell conditioned media (SF-VCM) manufactured from Dulbecco's modified Eagle medium cultured with Vero cells for in vitro development of mouse preimplantation embryos. A total of 1,099 two-cell embryos collected from imprinting control region mice were cultured in SF-VCM with 10% and 20% human follicular fluid (hFF), serum substitute supplement (SSS), and serum protein substitute (SPS). Development of embryos was observed every 24 hours. Results between different groups were analyzed by chi-square test, and considered statistically significant when P-value was less than 0.05. The rates of embryonic development cultured in SF-VCM supplemented with serum substituents were significantly higher compare with serum-free group (P media up to 4 weeks did not affect on embryonic development.

Canine distemper virus utilizes different receptors to infect chicken embryo fibroblasts and vero cells.

Science.gov (United States)

Chen, Jun; Liang, Xiu; Chen, Pei-fu

2011-04-01

Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.

Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

Directory of Open Access Journals (Sweden)

Mendel Friedman

2013-08-01

Full Text Available Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1 in Vero cells by two independent assays: the green fluorescent protein (GFP assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed.

Characterization and detection of Vero cells infected with Herpes Simplex Virus type 1 using Raman spectroscopy and advanced statistical methods.

Science.gov (United States)

Salman, A; Shufan, E; Zeiri, L; Huleihel, M

2014-07-01

Herpes viruses are involved in a variety of human disorders. Herpes Simplex Virus type 1 (HSV-1) is the most common among the herpes viruses and is primarily involved in human cutaneous disorders. Although the symptoms of infection by this virus are usually minimal, in some cases HSV-1 might cause serious infections in the eyes and the brain leading to blindness and even death. A drug, acyclovir, is available to counter this virus. The drug is most effective when used during the early stages of the infection, which makes early detection and identification of these viral infections highly important for successful treatment. In the present study we evaluated the potential of Raman spectroscopy as a sensitive, rapid, and reliable method for the detection and identification of HSV-1 viral infections in cell cultures. Using Raman spectroscopy followed by advanced statistical methods enabled us, with sensitivity approaching 100%, to differentiate between a control group of Vero cells and another group of Vero cells that had been infected with HSV-1. Cell sites that were "rich in membrane" gave the best results in the differentiation between the two categories. The major changes were observed in the 1195-1726 cm(-1) range of the Raman spectrum. The features in this range are attributed mainly to proteins, lipids, and nucleic acids. Copyright © 2014. Published by Elsevier Inc.

Prosopis juliflora Pods Alkaloid-rich Fraction: In vitro Anthelmintic Activity on Goat Gastrointestinal Parasites and Its Cytotoxicity on Vero Cells.

Science.gov (United States)

Lima, Helimar Gonçalves; Gomes, Danilo Cavalcante; Santos, Nathália Silva; Dias, Êuder Reis; Botura, Mariana Borges; Batatinha, Maria José Moreira; Branco, Alexsandro

2017-10-01

This study was designed to assess the in vitro anthelmintic activity of the fraction containing alkaloid from Prosopis juliflora pods on goat gastrointestinal nematodes using the egg hatch assay (EHA), larval migration inhibition assay (LMIA), and larval motility assay (LMA). The alkaloid-rich fraction (AF) - content juliprosopine as major alkaloid - was obtained from ethyl acetate extract after fractionation in Sephadex LH-20 chromatography column and its characterization were made by nuclear magnetic resonance analysis together with literature data comparison. The concentrations tested were 4.0, 2.67, 1.78, 1.19, and 0.79 mg/mL (EHA) and 4 mg/mL (LMIA and LMA). The in vitro cytotoxicity on Vero cell cultures was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and trypan blue tests. High ovicidal activity was observed with IC 50 and IC 90 values at 1.1 and 1.43 mg/mL for AF. On the other hand, this fraction showed low larvicidal activity and high toxic effect. Thus, P. juliflora pod alkaloid rich-fraction has ovicidal activity in vitro against goat gastrointestinal nematodes and cytotoxic in Vero cell cultures. Prosopis juliflora alkaloid-rich fraction (AF) showed in vitro anthelmintic effect against gastrointestinal nematodes of goatsThe AF was more effective against eggs than third larval stage (L 3 ) of gastrointestinal nematodesThe AF showed cytotoxicity activity on Vero cell lineThe juliprosopine was the main alkaloid found in the AF from P. juliflora pods. Abbreviations used: AF: Alkaloid-rich fraction; DMSO: Dimethyl sulfoxide; EE: Ethyl acetate extract; EHA: Egg hatch assay; IC50: Inhibitory concentration 50%; IC90: Inhibitory concentration 90%; L3: Infective larvae; LMA: Larval motility assay; LMIA: Larval migration inhibition assay; MTT: Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; PBS: Phosphate buffered saline; RPMI: Roswell Park Memorial Institute médium; TLC

Receptor-binding properties of modern human influenza viruses primarily isolated in Vero and MDCK cells and chicken embryonated eggs

International Nuclear Information System (INIS)

Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai

2003-01-01

To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses

Infection of epithelial cells with dengue virus promotes the expression of proteins favoring the replication of certain viral strains.

Science.gov (United States)

Martínez-Betancur, Viviana; Marín-Villa, Marcel; Martínez-Gutierrez, Marlén

2014-08-01

Dengue virus (DENV) is the causative agent of dengue and severe dengue. To understand better the dengue virus-host interaction, it is important to determine how the expression of cellular proteins is modified due to infection. Therefore, a comparison of protein expression was conducted in Vero cells infected with two different DENV strains, both serotype 2: DENV-2/NG (associated with dengue) and DENV-2/16681 (associated with severe dengue). The viability of the infected cells was determined, and neither strain induced cell death at 48 hr. In addition, the viral genomes and infectious viral particles were quantified, and the genome of the DENV-2/16681 strain was determined to have a higher replication rate compared with the DENV-2/NG strain. Finally, the proteins from infected and uninfected cultures were separated using two-dimensional gel electrophoresis, and the differentially expressed proteins were identified by mass spectrometry. Compared with the uninfected controls, the DENV-2/NG- and DENV-2/16681-infected cultures had five and six differentially expressed proteins, respectively. The most important results were observed when the infected cultures were compared to each other (DENV-2/NG vs. DENV-2/16681), and 18 differentially expressed proteins were identified. Based on their cellular functions, many of these proteins were linked to the increase in the replication efficiency of DENV. Among the proteins were calreticulin, acetyl coenzyme A, acetyl transferase, and fatty acid-binding protein. It was concluded that the infection of Vero cells with DENV-2/NG or DENV-2/16681 differentially modifies the expression of certain proteins, which can, in turn, facilitate infection. © 2013 Wiley Periodicals, Inc.

Dynamics of actin-based movement by Rickettsia rickettsii in vero cells.

Science.gov (United States)

Heinzen, R A; Grieshaber, S S; Van Kirk, L S; Devin, C J

1999-08-01

Actin-based motility (ABM) is a virulence mechanism exploited by invasive bacterial pathogens in the genera Listeria, Shigella, and Rickettsia. Due to experimental constraints imposed by the lack of genetic tools and their obligate intracellular nature, little is known about rickettsial ABM relative to Listeria and Shigella ABM systems. In this study, we directly compared the dynamics and behavior of ABM of Rickettsia rickettsii and Listeria monocytogenes. A time-lapse video of moving intracellular bacteria was obtained by laser-scanning confocal microscopy of infected Vero cells synthesizing beta-actin coupled to green fluorescent protein (GFP). Analysis of time-lapse images demonstrated that R. rickettsii organisms move through the cell cytoplasm at an average rate of 4.8 +/- 0.6 micrometer/min (mean +/- standard deviation). This speed was 2.5 times slower than that of L. monocytogenes, which moved at an average rate of 12.0 +/- 3.1 micrometers/min. Although rickettsiae moved more slowly, the actin filaments comprising the actin comet tail were significantly more stable, with an average half-life approximately three times that of L. monocytogenes (100.6 +/- 19.2 s versus 33.0 +/- 7.6 s, respectively). The actin tail associated with intracytoplasmic rickettsiae remained stationary in the cytoplasm as the organism moved forward. In contrast, actin tails of rickettsiae trapped within the nucleus displayed dramatic movements. The observed phenotypic differences between the ABM of Listeria and Rickettsia may indicate fundamental differences in the mechanisms of actin recruitment and polymerization.

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

The progressive adaptation of a georgian isolate of African swine fever virus to vero cells leads to a gradual attenuation of virulence in swine corresponding to major modifications of the viral genome.

Science.gov (United States)

Krug, Peter W; Holinka, Lauren G; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R; Borca, Manuel V

2015-02-01

African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been

Vero cell technology for rapid development of inactivated whole virus vaccines for emerging viral diseases.

Science.gov (United States)

Barrett, P Noel; Terpening, Sara J; Snow, Doris; Cobb, Ronald R; Kistner, Otfried

2017-09-01

Rapid development and production of vaccines against emerging diseases requires well established, validated, robust technologies to allow industrial scale production and accelerated licensure of products. Areas covered: A versatile Vero cell platform has been developed and utilized to deliver a wide range of candidate and licensed vaccines against emerging viral diseases. This platform builds on the 35 years' experience and safety record with inactivated whole virus vaccines such as polio vaccine. The current platform has been optimized to include a novel double inactivation procedure in order to ensure a highly robust inactivation procedure for novel emerging viruses. The utility of this platform in rapidly developing inactivated whole virus vaccines against pandemic (-like) influenza viruses and other emerging viruses such as West Nile, Chikungunya, Ross River and SARS is reviewed. The potential of the platform for development of vaccines against other emerging viruses such as Zika virus is described. Expert commentary: Use of this platform can substantially accelerate process development and facilitate licensure because of the substantial existing data set available for the cell matrix. However, programs to provide vaccines against emerging diseases must allow alternative clinical development paths to licensure, without the requirement to carry out large scale field efficacy studies.

Konsentrasi Aman Kurkumin dan PGV-0 terhadap Sel Vero Berdasarkan Hasil Uji Sitotoksik

Directory of Open Access Journals (Sweden)

Dewi Marbawati

2015-08-01

Full Text Available Curcumin (1,7-bis(3-methoxyphenyl 4'hidroksi -1.6 heptadien, 3,5-dione is the yellow pigment of Curcuma longa. Curcumin has various biological activities such as antioxidant, antibacterial, antifungal, antiprotozoal and antivirus. Various benefits of curcumin can not be separated from the weakness which is not stable to pH and light. Pentagamavunon-0 (PGV-0 were made by changing the β diketone group on cluster analog of curcumin into monoketon while eliminating active methylene group so it is more stable to pH and light. PGV-0 also has potential as a stronger antioxidant and antiinflammatory agent than other curcumin analogues. The objective of this research was to determine the safe concentrations of curcumin and PGV-0 on vero cells due to the increased use of the two compounds through the cytotoxic test. This research includes experimental research. Cytotoxic test performed with microculture tetrazolium technique (MTT method. Use of MTT to evaluate the cytotoxic is based on changes of tetrazolium salt into formazan crystals by mitochondrial enzyme succinate dehydrogenase with the help of cellular NADH. The results showed that the safe concentrations of curcumin and PGV-0 on vero cells respectively are 6.25 and 1.5625 ppm. Based on the cytotoxic test the secure concentration of curcumin was higher than PGV-0.

Ebola virus infection inversely correlates with the overall expression levels of promyelocytic leukaemia (PML protein in cultured cells

Directory of Open Access Journals (Sweden)

Szekely Laszlo

2003-04-01

Full Text Available Abstract Background Ebola virus causes severe, often fatal hemorrhagic fever in humans. The mechanism of escape from cellular anti-viral mechanisms is not yet fully understood. The promyelocytic leukaemia (PML associated nuclear body is part of the interferon inducible cellular defense system. Several RNA viruses have been found to interfere with the anti-viral function of the PML body. The possible interaction between Ebola virus and the PML bodies has not yet been explored. Results We found that two cell lines, Vero E6 and MCF7, support virus production at high and low levels respectively. The expression of viral proteins was visualized and quantified using high resolution immunofluorescence microscopy. Ebola encoded NP and VP35 accumulated in cytoplasmic inclusion bodies whereas VP40 was mainly membrane associated but it was also present diffusely in the cytoplasm as well as in the euchromatic areas of the nucleus. The anti-VP40 antibody also allowed the detection of extracellular virions. Interferon-alpha treatment decreased the production of all three viral proteins and delayed the development of cytopathic effects in both cell lines. Virus infection and interferon-alpha treatment induced high levels of PML protein expression in MCF7 but much less in Vero E6 cells. No disruption of PML bodies, a common phenomenon induced by a variety of different viruses, was observed. Conclusion We have established a simple fixation and immunofluorescence staining procedure that allows specific co-detection and precise sub-cellular localization of the PML nuclear bodies and the Ebola virus encoded proteins NP, VP35 and VP40 in formaldehyde treated cells. Interferon-alpha treatment delays virus production in vitro. Intact PML bodies may play an anti-viral role in Ebola infected cells.

Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

International Nuclear Information System (INIS)

Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

1987-01-01

The rates of bicarbonate-dependent uptake and efflux of 22 Na + in Vero cells were studied and compared with the uptake and efflux of 36 Cl - . Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na + was much less affected by changes in pH. The bicarbonate-linked uptake of 22 Na + was dependent on internal Cl- but not on internal Na + . At a constant external concentration of HCO 3 -, the amount of 22 Na + associated with the cells increased when the internal concentration of HCO 3 - decreased and vice versa, which is compatible with the possibility that the ion pair NaCO 3 - is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of 36 Cl - both in the absence and presence of Na + . At alkaline internal pH, HCO 3 - stimulated the efflux of 36 Cl - from preloaded cells, while at acidic internal pH both Na + and HCO 3 - were required to induce 36 Cl - efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane

An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.

Science.gov (United States)

Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena

2015-08-20

Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

International Nuclear Information System (INIS)

Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S

2014-01-01

Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit

Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

Directory of Open Access Journals (Sweden)

Mary M Melia

Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene.

Science.gov (United States)

Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji

2006-03-01

Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

International Nuclear Information System (INIS)

Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H

2016-01-01

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

Energy Technology Data Exchange (ETDEWEB)

Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)

2016-06-15

Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and

Renal Epithelial Cell Injury Induced by Calcium Oxalate Monohydrate Depends on their Structural Features: Size, Surface, and Crystalline Structure.

Science.gov (United States)

Sun, Xin-Yuan; Ouyang, Jian-Ming; Gan, Qiong-Zhi; Liu, Ai-Jie

2016-11-01

Urinary crystals in normal and kidney stone patients often differ in crystal sizes and surface structures, but the effects of different crystal properties on renal tubular epithelial cells remain unclear. This study aimed to compare the cytotoxicity of micron/nano-calcium oxalate monohydrate (COM) crystals with sizes of 50 nm, 200 nm, 1 μm, 3 μm, and 10 μm to African green monkey renal epithelial (Vero) cells, to reveal the effect of crystal size and surface structure on cell injury, and to investigate the pathological mechanism of calcium oxalate kidney stones. Cell viability, cellular biochemical parameters, and internalized crystal amount in Vero cells were closely associated with the size of COM crystals. At the same concentration (200 μg/mL), COM-1 μm induced the most serious injury to Vero cells and caused the most significant change to cellular biochemical parameters, which were related to the specific porous structure and highest internalized amount in Vero cells. By contrast, COM-50 nm and COM-200 nm crystals lost their small size effect because of serious aggregation and weakened their toxicity to cells. COM-3 μm and COM-10 μm crystals were too large for cells to completely internalize; these crystals also exhibited a low specific surface area and thus weakened their toxicity. The excessive expression of intracellular ROS and reduction of the free-radical scavenger SOD were the main reasons for cell injury and eventually caused necrotic cell death. Crystal size, surface structure, aggregation, and internalization amount were closely related to the cytotoxicity of COM crystals.

Histone deacetylase inhibitors reduce the number of herpes simplex virus-1 genomes initiating expression in individual cells

Directory of Open Access Journals (Sweden)

Lev Shapira

2016-12-01

Full Text Available Although many viral particles can enter a single cell, the number of viral genomes per cell that establish infection is limited. However, mechanisms underlying this restriction were not explored in depth. For herpesviruses, one of the possible mechanisms suggested is chromatinization and silencing of the incoming genomes. To test this hypothesis, we followed infection with three herpes simplex virus 1 (HSV-1 fluorescence-expressing recombinants in the presence or absence of histone deacetylases inhibitors (HDACi’s. Unexpectedly, a lower number of viral genomes initiated expression in the presence of these inhibitors. This phenomenon was observed using several HDACi: Trichostatin A (TSA, Suberohydroxamic Acid (SBX, Valporic Acid (VPA and Suberoylanilide Hydoxamic Acid (SAHA. We found that HDACi presence did not change the progeny outcome from the infected cells but did alter the kinetic of the gene expression from the viral genomes. Different cell types (HFF, Vero and U2OS, which vary in their capability to activate intrinsic and innate immunity, show a cell specific basal average number of viral genomes establishing infection. Importantly, in all cell types, treatment with TSA reduced the number of viral genomes. ND10 nuclear bodies are known to interact with the incoming herpes genomes and repress viral replication. The viral immediate early protein, ICP0, is known to disassemble the ND10 bodies and to induce degradation of some of the host proteins in these domains. HDACi treated cells expressed higher levels of some of the host ND10 proteins (PML and ATRX, which may explain the lower number of viral genomes initiating expression per cell. Corroborating this hypothesis, infection with three HSV-1 recombinants carrying a deletion in the gene coding for ICP0, show a reduction in the number of genomes being expressed in U2OS cells. We suggest that alterations in the levels of host proteins involved in intrinsic antiviral defense may result in

In vitro culture of various species of microsporidia causing keratitis: Evaluation of three immortalized cell lines

Directory of Open Access Journals (Sweden)

Joseph J

2009-01-01

Full Text Available Being intracellular parasites, microsporidia can only be propagated in cell culture systems. This study evaluated three cell lines to determine the most suitable host-parasite In vitro system. Confluent monolayers of vero, SIRC, and HeLa cell lines, grown in 24-well tissue culture plates, were inoculated with varying concentrations (1 x 10 4 to 1 x 10 8 spores/mL of Vittaforma corneae, Encephalitozoon hellem, Encephalitozoon cuniculi, and Encephalitozoon intestinalis spores. Growth was compared quantitatively at weekly intervals. Encephalitozoon species showed the highest amount of growth when cultured in vero cell line, while there was no significant difference in their growth in SIRC and HeLa cell lines. In comparison, V. corneae showed the highest growth in SIRC cells, followed by vero cells. The analytical sensitivity was found to be 1 x 10 4 spores/mL for vero cell line compared to 1 x 10 5 spores/mL for SIRC cell line and 1 x 10 7 spores/mL for HeLa cell line. HeLa cells also showed rapid disruption of cells, and the spores could not be easily distinguished from cell debris. This is the first report of the comparison of vero, SIRC, and HeLa for the propagation of microsporidial spores. Vero cell line was found to be more sensitive than SIRC and HeLa cells, and we believe that the inclusion of vero cell line in the routine culture protocols of ocular parasitology laboratories would result in a significant increase in the diagnostic yield.

Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study

Science.gov (United States)

Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon

2016-12-01

The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.

77 FR 42425 - Amendment of Air Traffic Service (ATS) Routes in the Vicinity of Vero Beach, FL

Science.gov (United States)

2012-07-19

...This action amends the legal descriptions of Jet Routes J-45 and J-79, and VHF omnidirectional range (VOR) Federal airways V-3, V-51, V-159, V-225, V-295 and V-537, in the vicinity of Vero Beach, FL. The FAA is taking this action because the name of the Vero Beach, FL, VOR Tactical Air Navigation (VORTAC) facility, which is included in the descriptions of the above routes, is being changed to the Treasure VORTAC.

Development of an Immunoperoxidase Monolayer Assay for the Detection of Antibodies against Peste des Petits Ruminants Virus Based on BHK-21 Cell Line Stably Expressing the Goat Signaling Lymphocyte Activation Molecule.

Directory of Open Access Journals (Sweden)

Jialin Zhang

Full Text Available From 2013 to 2015, peste des petits ruminants (PPR broke out in more than half of the provinces of China; thus, the application and development of diagnostic methods are very important for the control of PPR. Here, an immunoperoxidase monolayer assay (IPMA was developed to detect antibodies against PPR. However, during IPMA development, we found that Vero cells were not the appropriate choice because staining results were not easily observed. Therefore, we first established a baby hamster kidney-goat signaling lymphocyte activation molecule (BHK-SLAM cell line that could stably express goat SLAM for at least 20 generations. Compared with Vero cells, the PPR-mediated cytopathic effect occurred earlier in BHK-SLAM cells, and large syncytia appeared after virus infection. Based on this cell line and recombinant PPR virus expressing the green fluorescent protein (GFP (rPPRV-GFP, an IPMA for PPR diagnosis was developed. One hundred and ninety-eight PPR serum samples from goats or sheep were tested by the IPMA and virus neutralization test (VNT. Compared with the VNT, the sensitivity and specificity of the IPMA were 91% and 100%, respectively, and the coincidence rate of the two methods was 95.5%. The IPMA assay could be completed in 4 h, compared with more than 6 d for the VNT using rPPRV-GFP, and it is easily performed, as the staining results can be observed under a microscope. Additionally, unlike the VNT, the IPMA does not require antigen purification, which will reduce its cost. In conclusion, the established IPMA will be an alternative method that replaces the VNT for detecting antibodies against PPRV in the field.

Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

International Nuclear Information System (INIS)

Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

2008-01-01

Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

Morbillivirus glycoprotein expression induces ER stress, alters Ca2+ homeostasis and results in the release of vasostatin.

Directory of Open Access Journals (Sweden)

Jean-Marc Brunner

Full Text Available Although the pathology of Morbillivirus in the central nervous system (CNS is well described, the molecular basis of neurodegenerative events still remains poorly understood. As a model to explore Morbillivirus-mediated CNS dysfunctions, we used canine distemper virus (CDV that we inoculated into two different cell systems: a monkey cell line (Vero and rat primary hippocampal neurons. Importantly, the recombinant CDV used in these studies not only efficiently infects both cell types but recapitulates the uncommon, non-cytolytic cell-to-cell spread mediated by virulent CDVs in brain of dogs. Here, we demonstrated that both CDV surface glycoproteins (F and H markedly accumulated in the endoplasmic reticulum (ER. This accumulation triggered an ER stress, characterized by increased expression of the ER resident chaperon calnexin and the proapoptotic transcription factor CHOP/GADD 153. The expression of calreticulin (CRT, another ER resident chaperon critically involved in the response to misfolded proteins and in Ca(2+ homeostasis, was also upregulated. Transient expression of recombinant CDV F and H surface glycoproteins in Vero cells and primary hippocampal neurons further confirmed a correlation between their accumulation in the ER, CRT upregulation, ER stress and disruption of ER Ca(2+ homeostasis. Furthermore, CDV infection induced CRT fragmentation with re-localisation of a CRT amino-terminal fragment, also known as vasostatin, on the surface of infected and neighbouring non-infected cells. Altogether, these results suggest that ER stress, CRT fragmentation and re-localization on the cell surface may contribute to cytotoxic effects and ensuing cell dysfunctions triggered by Morbillivirus, a mechanism that might potentially be relevant for other neurotropic viruses.

Eficiencia de cultivo in vitro de Toxoplasma gondii en las líneas celulares THP1 y Vero

Directory of Open Access Journals (Sweden)

Jorge Andrés Cuellar

2012-03-01

Full Text Available Introducción. El cultivo in vitro es un método importante para la obtención de Toxoplasma gondii confines de diagnóstico clínico o biotecnológico. Objetivo. Determinar el porcentaje de invasión y producción de T. gondii en las líneas celulares THP1y Vero. Materiales y métodos. Se determinó la curva de crecimiento para las células Vero y THP1 por conteoen hemocitómetro. Posteriormente, se identificó el porcentaje de invasión de T. gondii en células THP1y Vero por citometría de flujo, en diferentes proporciones célula/taquizoíto de 1/5, 1/20, 1/50. Por otrolado, se calculó el índice de rendimiento de T. gondii, cepa RH, y del aislamiento CIBM1 en célulasTHP1. Resultados. Las células Vero crecen más rápidamente que las células THP1, con un crecimientoexponencial en un periodo de siete días. El aislamiento CIBM1 infecta las células THP1 en las tresproporciones diferentes de 1/5,1/20 y 1/50 con porcentajes de invasión de 57,1 %, 15,5 % y 12,2 %, yen células Vero, de 25,3 %, 17,8 % y 8,8 %. La cepa RH de T. gondii mostró porcentajes de invasiónmás bajos, de 32,6 %, 14,8 % y 8,1 % en células THP1 y de 22,3 %, 14,1 % y 3,4 % en células Vero. Conclusiones. El aislamiento CIBM1 presentó mayor rendimiento con respecto a la cepa RH de T.gondii en células THP1, siendo estas células una buena línea para estudiar el proceso de invasión yprobar candidatos farmacológicos para reducir la infección por T. gondii.   doi: http://dx.doi.org/10.7705/biomedica.v32i3.485

Propagation of avian metapneumovirus subtypes A and B using chicken embryo related and other cell systems.

Science.gov (United States)

Coswig, Lia Treptow; dos Santos, Márcia Bianchi; Hafez, Hafez Mohamed; Ferreira, Helena Lage; Arns, Clarice Weis

2010-07-01

Primary isolation of avian metapneumovirus (aMPV) is carried out using tracheal organ culture (TOC) or chicken embryonated eggs with subsequent adaptation in chicken embryo fibroblasts (CEF) or Vero cultures. This study was conducted to evaluate six different cell lines and two avian culture systems for the propagation of aMPV subtypes A and B. The chicken embryo related (CER) cells were used successfully for primary isolation. In addition to Vero and baby hamster kidney (BHK-21) cells, CER cells were also shown to be the most appropriate for propagation of aMPV considering high titres. Propagation of A and B subtypes in CEF and TOC remained efficient after the primary isolation and several passages of viruses in the CER cell line. The growth curves were created using CER, Vero and BHK-21 cell lines. Compared with growth, both yielded higher titres in CER cells during the first 30 h after infection, but no significant difference was observed in the results obtained from CER and Vero cells. This data show that CER cells are adequate for aMPV subtypes A and B propagation, giving similar results to Vero cells. Copyright 2010 Elsevier B.V. All rights reserved.

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

Energy Technology Data Exchange (ETDEWEB)

Clark, Kristina B. [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); Hsiao, Hui-Mien; Bassit, Leda [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Crowe, James E. [Departments of Pediatrics, Pathology, Microbiology, and Immunology, Vanderbilt University, Nashville, TN (United States); Schinazi, Raymond F. [Center for AIDS Research, Department of Pediatrics, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, GA (United States); Perng, Guey Chuen [Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan, Taiwan (China); Villinger, Francois [Division of Microbiology and Immunology, Yerkes National Primate Research Center, Emory University, Atlanta, GA (United States); New Iberia Research Center, University of Louisiana at Lafayette, New Iberia, LA (United States)

2016-06-15

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

Characterization of dengue virus 2 growth in megakaryocyte–erythrocyte progenitor cells

International Nuclear Information System (INIS)

Clark, Kristina B.; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E.; Schinazi, Raymond F.; Perng, Guey Chuen; Villinger, Francois

2016-01-01

Megakaryocyte–erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. - Highlights: • DenV replicates efficiently in undifferentiated megakaryocyte–erythrocyte progenitors. • MEP produced DenV differs in protein content from Vero produced DenV. • MEP produced DenV may be more difficult to neutralize relative to Vero DenV.

ACAM2000 clonal Vero cell culture vaccinia virus (New York City Board of Health strain)--a second-generation smallpox vaccine for biological defense.

Science.gov (United States)

Monath, Thomas P; Caldwell, Joseph R; Mundt, Wolfgang; Fusco, Joan; Johnson, Casey S; Buller, Mark; Liu, Jian; Gardner, Bridget; Downing, Greg; Blum, Paul S; Kemp, Tracy; Nichols, Richard; Weltzin, Richard

2004-10-01

The threat of smallpox as a biological weapon has spurred efforts to create stockpiles of vaccine for emergency preparedness. In lieu of preparing vaccine in animal skin (the original method), we cloned vaccinia virus (New York City Board of Health strain, Dryvax by plaque purification and amplified the clone in cell culture. The overarching goal was to produce a modern vaccine that was equivalent to the currently licensed Dryvax in its preclinical and clinical properties, and could thus reliably protect humans against smallpox. A variety of clones were evaluated, and many were unacceptably virulent in animal models. One clonal virus (ACAM1000) was selected and produced at clinical grade in MRC-5 human diploid cells. ACAM1000 was comparable to Dryvax in immunogenicity and protective activity but was less neurovirulent for mice and nonhuman primates. To meet requirements for large quantities of vaccine after the events of September 11th 2001, the ACAM1000 master virus seed was used to prepare vaccine (designated ACAM2000) at large scale in Vero cells under serum-free conditions. The genomes of ACAM1000 and ACAM2000 had identical nucleotide sequences, and the vaccines had comparable biological phenotypes. ACAM1000 and ACAM2000 were evaluated in three Phase 1 clinical trials. The vaccines produced major cutaneous reactions and evoked neutralizing antibody and cell-mediated immune responses in the vast majority of subjects and had a reactogenicity profile similar to that of Dryvax.

Observation of a cytopathogenic effect on cell lines used for routine viral cultures led to the diagnosis of lymphogranuloma venereum.

Science.gov (United States)

Busson, Laurent; Crucitti, Tania; De Foor, Marc; Van den Wijngaert, Sigi; Vandenberg, Olivier

2013-08-01

This article reports the fortuitous recovery of nine Chlamydia trachomatis serovar L strains in cell cultures (Vero and LLC-MK(2) cell line) designed for viral culture. Nine ano-genital swabs were inoculated on confluent Vero, MRC5 and LLC-MK(2) cell cultures. They were collected from HIV-positive patients who were primarily men who have sex with men (MSM) presenting ulcerations that mimicked herpes simplex infections. A cytopathogenic effect was observed on Vero and LLC-MK(2) cells on day 14. The presence of C trachomatis serovar L in the cell lines was confirmed by Real Time-PCR. C trachomatis serovar L can grow on Vero and LLC-MK(2) cell lines designed for viral cultures. Lymphogranuloma venereum must be considered as a differential diagnosis for herpes-like lesions, particularly in MSM with high-risk behaviours.

Evaluation of different continuous cell lines in the isolation of mumps virus by the shell vial method from clinical samples

Science.gov (United States)

Reina, J; Ballesteros, F; Mari, M; Munar, M

2001-01-01

Aims—To compare prospectively the efficacy of the Vero, LLC-MK2, MDCK, Hep-2, and MRC-5 cell lines in the isolation of the mumps virus from clinical samples by means of the shell vial method. Methods—During an epidemic outbreak of parotiditis 48 clinical samples (saliva swabs and CSF) were studied. Two vials of the Vero, LLC-MK2, MDCK, MRC-5, and Hep-2 cell lines were inoculated with 0.2 ml of the samples by the shell vial assay. The vials were incubated at 36°C for two and five days. The vials were then fixed with acetone at -20°C for 10 minutes and stained by a monoclonal antibody against mumps virus by means of an indirect immunofluorescence assay. Results—The mumps virus was isolated from 36 samples. The Vero and LLC-MK2 cell lines showed a 100% isolation capacity, MDCK showed 77.7%, MRC-5 showed 44.4%, and Hep-2 showed 22.2%. The Vero and LLC-MK2 lines were significantly different to the other cell lines (p 5 infectious foci) were 94.4% for Vero, 97.2% for LLC-MK2, 5.5% for MDCK, 5.5% for Hep-2, and 0% for MRC-5. Conclusions—The Vero and LLC-MK2 cell lines are equally efficient at two and five days incubation for the isolation of the mumps virus from clinical samples, and the use of the shell vial method considerably shortens the time of aetiological diagnosis with higher specificity. Key Words: mumps virus • Vero cell line • LLC-MK2 cell line • MDCK cell line • Hep-2 cell line • MRC-5 cell line • isolation • shell vial PMID:11729211

Inhibition of Dengue Virus 3 in Mammalian Cell Culture by Synthetic ...

African Journals Online (AJOL)

HP

Purpose: To evaluate the inhibition of Dengue virus 3 by synthetic siRNAs targeting the untranslated regions UTR and structural regions of DENV3 genome in Vero-81 cell line. Methods: Vero-81 cells transfected with synthetic siRNAs were challenged by DENV3. The effectiveness of siRNAs was confirmed by four ...

Characterization of cell lines stably transfected with rubella virus replicons

International Nuclear Information System (INIS)

Tzeng, Wen-Pin; Xu, Jie; Frey, Teryl K.

2012-01-01

Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was ∼9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.

Characterization of cell lines stably transfected with rubella virus replicons

Energy Technology Data Exchange (ETDEWEB)

Tzeng, Wen-Pin; Xu, Jie [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States); Frey, Teryl K., E-mail: tfrey@gsu.edu [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States)

2012-07-20

Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was {approx}9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

International Nuclear Information System (INIS)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-01-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of 125 I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of 125 I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

Energy Technology Data Exchange (ETDEWEB)

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-03-01

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.

Purification and characterization of enterovirus 71 viral particles produced from vero cells grown in a serum-free microcarrier bioreactor system.

Directory of Open Access Journals (Sweden)

Chia-Chyi Liu

Full Text Available BACKGROUND: Enterovirus 71 (EV71 infections manifest most commonly as a childhood exanthema known as hand-foot-and-mouth disease (HFMD and can cause neurological disease during acute infection. PRINCIPAL FINDING: In this study, we describe the production, purification and characterization of EV71 virus produced from Vero cells grown in a five-liter serum-free bioreactor system containing 5 g/L Cytodex 1 microcarrier. The viral titer was >10(6 TCID(50/mL by 6 days post infection when a MOI of 10(-5 was used at the initial infection. Two EV71 virus fractions were separated and detected when the harvested EV71 virus concentrate was purified by sucrose gradient zonal ultracentrifugation. The EV71 viral particles detected in the 24-28% sucrose fractions had an icosahedral structure 30-31 nm in diameter and had low viral infectivity and RNA content. Three major viral proteins (VP0, VP1 and VP3 were observed by SDS-PAGE. The EV71 viral particles detected in the fractions containing 35-38% sucrose were 33-35 nm in size, had high viral infectivity and RNA content, and were composed of four viral proteins (VP1, VP2, VP3 and VP4, as shown by SDS-PAGE analyses. The two virus fractions were formalin-inactivated and induced high virus neutralizing antibody responses in mouse immunogenicity studies. Both mouse antisera recognized the immunodominant linear neutralization epitope of VP1 (residues 211-225. CONCLUSION: These results provide important information for cell-based EV71 vaccine development, particularly for the preparation of working standards for viral antigen quantification.

Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

Energy Technology Data Exchange (ETDEWEB)

Conceição, R.A. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil); Ludovico, M.S. [Departamento de Microbiologia, Universidade Estadual de Londrina, Londrina, PR (Brazil); Andrade, C.G.T.J. [Departamento de Biologia Geral, Universidade Estadual de Londrina, Londrina, PR (Brazil); Yano, T. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil)

2012-04-13

The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 10{sup 7} CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.

Cytotoxic of Ganoderma lucidum in Colon Cancer through Cyclooxygenase 2 (COX-2 as Its Molecular Target

Directory of Open Access Journals (Sweden)

Agustina Setiawati

2017-05-01

Full Text Available Many studies were designed explore chemopreventive activity of natural products on colon cancer especially addressing COX-2 as molecular target. Another promising source of natural product that potentially exhibit anticancer activity on colon cancer is Ganoderma lucidum. This study assessed selectivity of cytotoxic effect of G. lucidum extract on WiDr to Vero cells and investigated molecular mechanism on COX-2. G. lucidum ex-tract was prepared by reflux extraction method; in vitro anticancer was assayed by MTT method on WiDr and Vero cell line. This study applied apoptosis induction assay to observe cell death mechanism using double staining method; further COX-2 expression was stained by immunocytochemistry method. G. lucidum extract has cytotoxic effect on WiDr cells with IC50 135 µg/mL. However, the cytotoxic effect had low selectivity to-wards Vero cells with Selectivity Index (SI 3.66. The extract induced apoptosis and suppressed COX-2 ex-pression in WiDr cells. G. lucidum extract was potential to be developed as anticancer agent towards colon cancer.

Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms.

Science.gov (United States)

Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T

2016-02-21

The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to +6.0 Gy (CyberKnife: +0.5 Gy to +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to +0.2 mm /-0.8 mm to +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

Baculovirus IE2 Stimulates the Expression of Heat Shock Proteins in Insect and Mammalian Cells to Facilitate Its Proper Functioning.

Science.gov (United States)

Tung, Hsuan; Wei, Sung-Chan; Lo, Huei-Ru; Chao, Yu-Chan

2016-01-01

Baculoviruses have gained popularity as pest control agents and for protein production in insect systems. These viruses are also becoming popular for gene expression, tissue engineering and gene therapy in mammalian systems. Baculovirus infection triggers a heat shock response, and this response is crucial for its successful infection of host insect cells. However, the viral protein(s) or factor(s) that trigger this response are not yet clear. Previously, we revealed that IE2-an early gene product of the baculovirus-could form unique nuclear bodies for the strong trans-activation of various promoters in mammalian cells. Here, we purified IE2 nuclear bodies from Vero E6 cells and investigated the associated proteins by using mass spectrometry. Heat shock proteins (HSPs) were found to be one of the major IE2-associated proteins. Our experiments show that HSPs are greatly induced by IE2 and are crucial for the trans-activation function of IE2. Interestingly, blocking both heat shock protein expression and the proteasome pathway preserved the IE2 protein and its nuclear body structure, and revived its function. These observations reveal that HSPs do not function directly to assist the formation of the nuclear body structure, but may rather protect IE2 from proteasome degradation. Aside from functional studies in mammalian cells, we also show that HSPs were stimulated and required to determine IE2 protein levels, in insect cells infected with baculovirus. Upon inhibiting the expression of heat shock proteins, baculovirus IE2 was substantially suppressed, resulting in a significantly suppressed viral titer. Thus, we demonstrate a unique feature in that IE2 can function in both insect and non-host mammalian cells to stimulate HSPs, which may be associated with IE2 stabilization and lead to the protection of the its strong gene activation function in mammalian cells. On the other hand, during viral infection in insect cells, IE2 could also strongly stimulate HSPs and

Measles virus C protein suppresses gamma-activated factor formation and virus-induced cell growth arrest

International Nuclear Information System (INIS)

Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro

2011-01-01

Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression of C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-γ signaling pathway via inhibition of phosphorylated STAT1 dimerization.

Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

International Nuclear Information System (INIS)

Nishiyama, Y.; Rapp, F.

1981-01-01

Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants

Accumulation of a soluble form of human nectin-2 is required for exerting the resistance against herpes simplex virus type 2 infection in transfected cells.

Science.gov (United States)

Fujimoto, Y; Ozaki, K; Iwamori, N; Takakuwa, H; Ono, E

2016-03-01

Cell entry of herpes simplex virus type 2 (HSV-2) requires the interaction of viral glycoprotein D (gD) with the receptor nectin-1 and herpesvirus entry mediator (HVEM). In addition, it is known that nectin-2 is also functional as a receptor for HSV-2, although the binding to the gD is weak. To examine an antiviral potential of a soluble form of human nectin-2 (hNectin-2Ig), transfected Vero cells expressing the entire ectodomain of nectin-2 fused to the Fc portion of human IgG were established. Specific binding of hNectin-2Ig to HSV-2 gD was confirmed by ELISA. Competitive ELISA demonstrated that accumulation of hNectin-2Ig in transfected cells increased significantly in a cell culture time dependent manner. Viral growth of several HSV-2 strains was significantly inhibited in the transfected cells that were cultured for 72 hr compared with control Vero cells, but not in cells that were cultured for 24 hr. These results indicate that accumulation of a soluble form of nectin-2 is required for exerting the resistance against HSV-2 infection.

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

International Nuclear Information System (INIS)

Hayashi, N; Takada, Y; Mizuno, T; Nakae, H; Murai, T

2016-01-01

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

SU-F-T-255: Accuracy and Precision of Dynamic Tracking Irradiation with VERO-4DRT System

Energy Technology Data Exchange (ETDEWEB)

Hayashi, N [Graduate school of Health Sciences, Fujita Health University, Tayoake, Aichi (Japan); Takada, Y; Mizuno, T; Nakae, H [Department of Radiology, Ogaki Tokushukai Hospital, Ogaki, Gifu (Japan); Murai, T [Department of Radiation Oncology, Nagoya City University, Nagoya, Aichi (Japan)

2016-06-15

Purpose: The VERO-4DRT system is able to provide dynamic tracking irradiation (DTI) for the target with respiratory motion. This technique requires enough commissioning for clinical implementation. The purpose of this study is to make sure the accuracy and precision of DTI using VERO- 4DRT through commissioning from fundamental evaluation to end-to-end test. Method: We evaluated several contents for DTI commissioning: the accuracy of absorption dose at isocenter in DTI, the field size and penumbra of DTI, the accuracy of 4D modeling in DTI. All evaluations were performed by respiratory motion phantom (Quasar phantom). These contents were compared the results between static irradiation and DTI. The shape of radiation field was set to square from 3 cm × 3 cm to 10 cm × 10 cm. The micro 3D chamber and Gafchromic EBT3 film were used for absorbed dose and relative dose distribution measurement, respectively. The sine and irregular shaped waves were used for demonstrative respiratory motion. The visicoil was implanted into the phantom for guidance of respiratory motion. The respiration patterns of frequency and motion amount were set to 10–15 BPM and 1–2 cm, respectively. Results: As the result of absorbed dose of DTI in comparison with static irradiation, the average dose error at isocenter was 0.5% even though various respiratory patterns were set on. As the result of relative dose distribution, the field size (set it on 50% dose line) was not significantly changed in all respiratory patterns. However, the penumbra was larger in greater respiratory motion (up to 4.1 mm). The 4D modeling coincidence between actual and created waves was within 1%. Conclusion: The DTI using VERO-4DRT can provide sufficient accuracy and precision in absorbed dose and distribution. However, the patientspecific quantitative internal margin corresponding respiratory motion should be taken into consideration with image guidance.

Antibody titers in animal bite victims after post exposure vaccination with intradermally administered purified vero cell rabies vaccine using modified thai red cross regimen

International Nuclear Information System (INIS)

Hafeez, S.; Tahir, Z.

2014-01-01

To determine the seroconversion following rabies vaccination by intradermal route in cases of animal bite attending Anti rabies center, Lahore for post exposure prophylaxis. Study Design: Cross sectional descriptive study. Place and Duration: Antirabies center, Birdwood road Lahore, Microbiology laboratory, office of Bacteriologist, Government of Punjab, Lahore. Patients and Methods: Victims of all ages and both sexes having exposure with suspected rabid animal within 24 - 72 hours were included, fulfilling inclusion and exclusion criteria, over 3 months period from February to April 20. Patients of Category II and III wounds were included. Purified vero cell vaccine (PVR V) with antigenic content> 2.5 ml was used for intradermal vaccination according to modified Thai Red Cross regimen (2-2-2-0-2). Each victim received 0.1 ml intradermal dose on each deltoid on day 0, 3, 7 and 28th day of bite. Blood samples from victims were taken on day 0, 14 and 35. Antibody titers were estimated by ELISA kit. Results: Fifty cases were studied including 20 children. Male female ratio was 4:1. Optimum serocon version (> 0.5 IU/ml) was achieved in all cases by day 14. Antibody levels increased further (> 4 IV/ml) in 92% cases on day 35. Geometric mean titers were 3.2 IU/ml and 6.2 IU/ml on day 14 and 35 respectively. Conclusion: Intradermal route for cell culture rabies vaccine for postexposure prophylaxis in animal bite victims was efficacious and safe. The smaller dosage of vaccine was economically affordable by patients in referral centers. (author)

Heat shock proteins (Hsp 70) response is not systematic to cell stress

International Nuclear Information System (INIS)

Hassen, Wafa; Ayed-Boussema, Imen; Bouslimi, Amel; Bacha, Hassen

2007-01-01

Ochratoxin A (OTA) is a mycotoxin routinely detected in improperly stored animal and human food supplies as well as in human sera worldwide. OTA has multiple toxic effects; however, the most prominent is nephrotoxicity. Thus, OTA is involved in the pathogenesis of human nephropathy in Balkan areas. In this study, we address the question of the appropriate functioning of the basal cellular defense mechanisms, after exposure to OTA, which, up to now, has not been investigated satisfactorily. In this context, we have monitored the effect of OTA on (i) the inhibition of cell viability, (ii) the oxidative damage using the GSH depletion, (iii) the inhibition of protein synthesis through the incorporation of [ 3 H] Leucine and (iv) the induction of Hsp 70 gene expression as a parameter of cytotoxicity, oxidative damage and particularly as a protective and adaptative response. This study was conducted using the Human Hep G2 hepatocytes and monkey kidney Vero cells under exposure conditions ranging from non-cytotoxic to sub-lethal. Our results clearly showed that OTA inhibits cell proliferation, strongly reduces protein synthesis and induces the decrease of GSH in concentration-dependent manner in both Hep G2 and Vero cells. However, although cytotoxicity and oxidative damage (main inducers of Hsp expression) occur, no change was observed in Hsp 70 level under the multiple tested conditions. Inhibition of protein synthesis could not explain the absence of Hsp 70 response since concentrations, which did not influence protein synthesis, also failed to display the expected Hsp 70 response. Our data are consistent with recently published reports where considerable differences were noticed in the ability of relevant toxicants to induce Hsp. These results raised doubt about the universal character of Hsp induction which seems to be more complex than originally envisioned. It could be concluded that Hsp 70 induction is not systematic to cell stress

Biological activity evaluation of cloned and expressed caprine growth hormone from local Pakistani goat breed beetal

International Nuclear Information System (INIS)

Butt, H.I.; Shahzad, M.I.; Bashir, Q.

2011-01-01

Growth hormone cDNA of local goat breed-beetal was amplified by RT PCR and gene including leader sequence was cloned in pTZR57 cloning vector. The cGH-pTZR57 clone was confirmed by restriction digestion and sequence analyses before finally sub-cloning the gene in pND- a mammalian expression vector. The clones were again confirmed by restriction digestion and PCR analyses. Highly purified, supercoiled cGH-pND construct was used to transfect Vero cell lines for expression studies. The in vitro expression of cGH was checked by dot-ELISA technique. After confirming its in vitro cell line based expression, the construct was injected to 4 weeks old balb/c mice intramuscularly. Two animals were euthanized per week till four weeks to monitor the in vivo biological activity by evaluating the tibia epiphyseal width and body weight gain assays. Significant increase in tibia epiphyseal width and gain in body weight was observed from vaccinated animals. The study supports the concept that DNA based therapeutics are an efficient and cost effective method for gene delivery and in vivo transgene expressions. (author)

Manipulating mammalian cell morphologies using chemical-mechanical polished integrated circuit chips

Science.gov (United States)

Moussa, Hassan I.; Logan, Megan; Siow, Geoffrey C.; Phann, Darron L.; Rao, Zheng; Aucoin, Marc G.; Tsui, Ting Y.

2017-12-01

Tungsten chemical-mechanical polished integrated circuits were used to study the alignment and immobilization of mammalian (Vero) cells. These devices consist of blanket silicon oxide thin films embedded with micro- and nano-meter scale tungsten metal line structures on the surface. The final surfaces are extremely flat and smooth across the entire substrate, with a roughness in the order of nanometers. Vero cells were deposited on the surface and allowed to adhere. Microscopy examinations revealed that cells have a strong preference to adhere to tungsten over silicon oxide surfaces with up to 99% of cells adhering to the tungsten portion of the surface. Cells self-aligned and elongated into long threads to maximize contact with isolated tungsten lines as thin as 180 nm. The orientation of the Vero cells showed sensitivity to the tungsten line geometric parameters, such as line width and spacing. Up to 93% of cells on 10 μm wide comb structures were aligned within ± 20° of the metal line axis. In contrast, only 22% of cells incubated on 0.18 μm comb patterned tungsten lines were oriented within the same angular interval. This phenomenon is explained using a simple model describing cellular geometry as a function of pattern width and spacing, which showed that cells will rearrange their morphology to maximize their contact to the embedded tungsten. Finally, it was discovered that the materials could be reused after cleaning the surfaces, while maintaining cell alignment capability.

Porcine platelet lysate as a supplement for animal cell culture

Science.gov (United States)

Aldén, Anna; Gonzalez, Lorena; Persson, Anna; Christensson, Kerstin; Holmqvist, Olov

2007-01-01

A novel supplementation of cell growth media based on a porcine platelet lysate was developed for culture of animal-derived cells. The platelet lysate was produced from porcine blood and contained lysate of platelets and plasma components. It showed satisfactory microbiological integrity and it carried only low amount of endotoxins (platelet lysate supported well proliferation of Vero (African green monkey transformed kidney epithelial cells), Chinese hamster ovary (CHO) and hybridoma cells comparable to fetal bovine serum (FBS). Platelet lysate shows promise as a viable choice over FBS as it can be produced in large quantities, high lot-to-lot consistency and with an attractive price structure. Furthermore it is a strong alternative to FBS for ethical reasons. It is expected that it can be used as a general supplementation for most animal cells for research studies on the proliferation of cells and their expression of products. PMID:19002989

Biological and immunological characterization of recombinant Yellow Fever 17D Viruses expressing a Trypanosoma cruzi Amastigote Surface Protein-2 CD8+ T cell epitope at two distinct regions of the genome

Directory of Open Access Journals (Sweden)

Bonaldo Myrna C

2011-03-01

Full Text Available Abstract Background The attenuated Yellow fever (YF 17D vaccine virus is one of the safest and most effective viral vaccines administered to humans, in which it elicits a polyvalent immune response. Herein, we used the YF 17D backbone to express a Trypanosoma cruzi CD8+ T cell epitope from the Amastigote Surface Protein 2 (ASP-2 to provide further evidence for the potential of this virus to express foreign epitopes. The TEWETGQI CD8+ T cell epitope was cloned and expressed based on two different genomic insertion sites: in the fg loop of the viral Envelope protein and the protease cleavage site between the NS2B and NS3. We investigated whether the site of expression had any influence on immunogenicity of this model epitope. Results Recombinant viruses replicated similarly to vaccine virus YF 17D in cell culture and remained genetically stable after several serial passages in Vero cells. Immunogenicity studies revealed that both recombinant viruses elicited neutralizing antibodies to the YF virus as well as generated an antigen-specific gamma interferon mediated T-cell response in immunized mice. The recombinant viruses displayed a more attenuated phenotype than the YF 17DD vaccine counterpart in mice. Vaccination of a mouse lineage highly susceptible to infection by T. cruzi with a homologous prime-boost regimen of recombinant YF viruses elicited TEWETGQI specific CD8+ T cells which might be correlated with a delay in mouse mortality after a challenge with a lethal dose of T. cruzi. Conclusions We conclude that the YF 17D platform is useful to express T. cruzi (Protozoan antigens at different functional regions of its genome with minimal reduction of vector fitness. In addition, the model T. cruzi epitope expressed at different regions of the YF 17D genome elicited a similar T cell-based immune response, suggesting that both expression sites are useful. However, the epitope as such is not protective and it remains to be seen whether expression

Expression of heparanase in basal cell carcinoma and squamous cell carcinoma.

Science.gov (United States)

Pinhal, Maria Aparecida Silva; Almeida, Maria Carolina Leal; Costa, Alessandra Scorse; Theodoro, Thérèse Rachell; Serrano, Rodrigo Lorenzetti; Machado, Carlos D'Apparecida Santos

2016-01-01

Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparanase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in culture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of heparanase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased heparanase expression in squamous cell carcinoma compared to the Basal cell carcinoma. The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment.

Expression of Two N1 Clones with Single Amino Acid Dissimilarity of Avian Influenza H5N1 Virus

Directory of Open Access Journals (Sweden)

RISZA HARTAWAN

2012-12-01

Full Text Available Two clones of N1 gene derived from isolate A/Dk/Tangerang/Bbalitvet-ACIAR-TE11/2007 (H5N1 exhibit single mismatch of amino acid sequence at position 242 that is threonine and methionine for the clone #3 and #5, respectively. In order to evaluate the effect of the amino acid substitution, these clones were inserted into two different expression vectors that are pEGFP-C1 and pcDNA-3.3 TOPO® TA cloning. Subsequently, the respective recombinant clones were transfected into eukaryotic cells, including CEF, RK13 and VERO using Lipofectamine ‘plus’ reagent. As a result, the clone #3 retaining atypical sequence showed lower expression level rather than the clone #15 in both vectors and all type of cells. The 3D conformational modelling revealed that the mutation occurs in the inner part of glycoprotein embedded within envelope or matrix. Therefore, the missense mutation seems has no effect on the antigenic properties of neuraminidase but this substitution by any means causes lethal mutagenesis in the individual gene expression by reducing level of protein transcript.

Standardization and assessment of cell culture media quantities in roller poly ethylene terephthalate bottles employed in the industrial rabies viral vaccine production.

Science.gov (United States)

Jagannathan, S; Chaansha, S; Rajesh, K; Santhiya, T; Charles, C; Venkataramana, K N

2009-09-15

Vero cells are utilized for production of rabies vaccine. This study deals with the optimize quantity media require for the rabies vaccine production in the smooth roller surface. The rabies virus (Pasteur vaccine strain) is infected to monolayer of the various experimented bottles. To analyze the optimal quantity of media for the production of rabies viral harvest during the process of Vero cell derived rabies vaccine. The trials are started from 200 to 400 mL (PTARV-1, PTARV-2, PTARV-3, PTARV-4 and PTARV-5). The samples are taken in an appropriate time intervals for analysis of In Process Quality Control (IPQC) tests. The collected viral harvests are further processed to rabies vaccine in a pilot level and in addition to scale up an industrial level. Based on the evaluation the PTARV-2 (250 mL) show highly encouraging results for the Vero cell derived rabies vaccine production.

Fractalkine expression induces endothelial progenitor cell lysis by natural killer cells.

Directory of Open Access Journals (Sweden)

Dilyana Todorova

Full Text Available BACKGROUND: Circulating CD34(+ cells, a population that includes endothelial progenitors, participate in the maintenance of endothelial integrity. Better understanding of the mechanisms that regulate their survival is crucial to improve their regenerative activity in cardiovascular and renal diseases. Chemokine-receptor cross talk is critical in regulating cell homeostasis. We hypothesized that cell surface expression of the chemokine fractalkine (FKN could target progenitor cell injury by Natural Killer (NK cells, thereby limiting their availability for vascular repair. METHODOLOGY/PRINCIPAL FINDINGS: We show that CD34(+-derived Endothelial Colony Forming Cells (ECFC can express FKN in response to TNF-α and IFN-γ inflammatory cytokines and that FKN expression by ECFC stimulates NK cell adhesion, NK cell-mediated ECFC lysis and microparticles release in vitro. The specific involvement of membrane FKN in these processes was demonstrated using FKN-transfected ECFC and anti-FKN blocking antibody. FKN expression was also evidenced on circulating CD34(+ progenitor cells and was detected at higher frequency in kidney transplant recipients, when compared to healthy controls. The proportion of CD34(+ cells expressing FKN was identified as an independent variable inversely correlated to CD34(+ progenitor cell count. We further showed that treatment of CD34(+ circulating cells isolated from adult blood donors with transplant serum or TNF-α/IFN-γ can induce FKN expression. CONCLUSIONS: Our data highlights a novel mechanism by which FKN expression on CD34(+ progenitor cells may target their NK cell mediated killing and participate to their immune depletion in transplant recipients. Considering the numerous diseased contexts shown to promote FKN expression, our data identify FKN as a hallmark of altered progenitor cell homeostasis with potential implications in better evaluation of vascular repair in patients.

Behavioral experience induces zif268 expression in mature granule cells but suppresses its expression in immature granule cells

Science.gov (United States)

Huckleberry, Kylie A.; Kane, Gary A.; Mathis, Rita J.; Cook, Sarah G.; Clutton, Jonathan E.; Drew, Michael R.

2015-01-01

Thousands of neurons are born each day in the dentate gyrus (DG), but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in the DG. The immediate-early gene (IEG) zif268 appears to be an important mediator of these effects, as its expression can be induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Richardson et al., 1992; Veyrac et al., 2013). Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs). We first quantified zif268 expression in doublecortin-positive (DCX+) immature neurons and in the general granule cell population after brief exposure to a novel environment (NE). In the general granule cell population, zif268 expression peaked 1 h after NE exposure and returned to baseline by 8 h post-exposure. However, in the DCX+ cells, zif268 expression was suppressed relative to home cage for at least 8 h post-exposure. We next asked whether suppression of zif268 in DCX+ immature cells occurs in other behavioral paradigms that recruit the hippocampus. Exposure to Morris water maze (MWM) training, an enriched environment, or a NE caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 expression among the general granule cell population. The same behavioral procedures activated zif268 expression in 6-week-old BrdU-labeled adult-born neurons, indicating that zif268 suppression is specific to immature neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. NE exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly

Tropomyosin Receptor Kinase A Expression on Merkel Cell Carcinoma Cells.

Science.gov (United States)

Wehkamp, Ulrike; Stern, Sophie; Krüger, Sandra; Hauschild, Axel; Röcken, Christoph; Egberts, Friederike

2017-11-01

Merkel cell carcinoma (MCC) is a malignant neuroendocrine skin tumor frequently associated with the Merkel cell polyomavirus. Immune checkpoint therapy showed remarkable results, although not all patients are responsive to this therapy. Anti-tropomyosin receptor kinase A (TrkA)-targeted treatment has shown promising results in several tumor entities. To determine TrkA expression in MCC as a rationale for potential targeted therapy. This case series study investigated the MCC specimens of 55 patients treated at the Department of Dermatology, University Hospital of Schleswig-Holstein, Kiel, Germany, from January 1, 2005, through December 31, 2015. Thirty-nine of the 55 samples were suitable for further histopathologic examination. Expression of TrkA was explored by immunohistochemical analysis. Diagnosis of MCC was confirmed by staining positive for cytokeratin 20 (CK20) and synaptophysin. Expression of TrkA on the tumor cells. Specimens of 39 patients (21 women and 18 men; mean [SD] age, 75.0 [7.8] years) underwent immunohistochemical investigation. Thirty-eight of 38 specimens expressed CK20 and synaptophysin on the MCC tumor cells (100% expression). Merkel cell polyomavirus was detected in 32 of 38 specimens (84%). Tropomyosin receptor kinase A was found in all 36 evaluable specimens on the tumor cells; 34 (94%) showed a weak and 2 (6%) showed a strong cytoplasmic expression. In addition, strongly positive perinuclear dots were observed in 30 of 36 specimens (83%). Tropomyosin receptor kinase A was expressed on MCC tumor cells in 100% of evaluable specimens. This result may lead to the exploration of new targeted treatment options in MCC, especially for patients who do not respond to anti-programmed cell death protein 1 treatment.

Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

OpenAIRE

Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

2016-01-01

Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

Immunogenicity, safety and antibody persistence of a purified vero cell cultured rabies vaccine (Speeda) administered by the Zagreb regimen or Essen regimen in post-exposure subjects.

Science.gov (United States)

Shi, Nianmin; Zhang, Yibin; Zheng, Huizhen; Zhu, Zhenggang; Wang, Dingming; Li, Sihai; Li, Yuhua; Yang, Liqing; Zhang, Junnan; Bai, Yunhua; Lu, Qiang; Zhang, Zheng; Luo, Fengji; Yu, Chun; Li, Li

2017-06-03

To compare the safety, immunogenicity and long-term effect of a purified vero cell cultured rabies vaccine in post-exposure subjects following 2 intramuscular regimens, Zagreb or Essen regimen. Serum samples were collected before vaccination and on days 7, 14, 42, 180 and 365 post vaccination. Solicited adverse events were recorded for 7 d following each vaccine dose, and unsolicited adverse events throughout the entire study period. This study was registered with ClinicalTrials.gov (NCT01821911 and NCT01827917). No serious adverse events were reported. Although Zagreb regimen had a higher incidence of adverse reactions than Essen regimen at the first and second injection, the incidence was similar at the third and fourth injection between these 2 groups as well. At day 42, 100% subjects developed adequate rabies virus neutralizing antibody concentrations (≥ 0.5IU/ml) for both regimens. At days 180 and 365, the antibody level decreased dramatically, however, the percentage of subjects with adequate antibody concentrations still remained high (above 75% and 50% respectively). None of confirmed rabies virus exposured subjects had rabies one year later, and percentage of subjects with adequate antibody concentrations reached 100% at days 14 and 42. Rabies post-exposure prophylaxis vaccination with PVRV following a Zagreb regimen had a similar safety, immunogenicity and long-term effect to the Essen regimen in China.

Expression of stanniocalcin 1 in thyroid side population cells and thyroid cancer cells.

Science.gov (United States)

Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S; Hewitt, Stephen M; Ward, Jerrold M; Kimura, Shioko

2015-04-01

Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma-derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer.

Rho GTPase expression in human myeloid cells.

Directory of Open Access Journals (Sweden)

Suzanne F G van Helden

Full Text Available Myeloid cells are critical for innate immunity and the initiation of adaptive immunity. Strict regulation of the adhesive and migratory behavior is essential for proper functioning of these cells. Rho GTPases are important regulators of adhesion and migration; however, it is unknown which Rho GTPases are expressed in different myeloid cells. Here, we use a qPCR-based approach to investigate Rho GTPase expression in myeloid cells.We found that the mRNAs encoding Cdc42, RhoQ, Rac1, Rac2, RhoA and RhoC are the most abundant. In addition, RhoG, RhoB, RhoF and RhoV are expressed at low levels or only in specific cell types. More differentiated cells along the monocyte-lineage display lower levels of Cdc42 and RhoV, while RhoC mRNA is more abundant. In addition, the Rho GTPase expression profile changes during dendritic cell maturation with Rac1 being upregulated and Rac2 downregulated. Finally, GM-CSF stimulation, during macrophage and osteoclast differentiation, leads to high expression of Rac2, while M-CSF induces high levels of RhoA, showing that these cytokines induce a distinct pattern. Our data uncover cell type specific modulation of the Rho GTPase expression profile in hematopoietic stem cells and in more differentiated cells of the myeloid lineage.

Forced Expression of ZNF143 Restrains Cancer Cell Growth

International Nuclear Information System (INIS)

Izumi, Hiroto; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi

2011-01-01

We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division

Forced Expression of ZNF143 Restrains Cancer Cell Growth

Energy Technology Data Exchange (ETDEWEB)

Izumi, Hiroto, E-mail: h-izumi@med.uoeh-u.ac.jp; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Kuma, Akihiro; Kitamura, Noriaki; Kohno, Kimitoshi [Department of Molecular Biology, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555 (Japan)

2011-10-19

We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143) regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1), aurora kinase B (AURKB) and some minichromosome maintenance complex components (MCM). However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells) and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

Forced Expression of ZNF143 Restrains Cancer Cell Growth

Directory of Open Access Journals (Sweden)

Kimitoshi Kohno

2011-10-01

Full Text Available We previously reported that the transcription factor Zinc Finger Protein 143 (ZNF143 regulates the expression of genes associated with cell cycle and cell division, and that downregulation of ZNF143 induces cell cycle arrest at G2/M. To assess the function of ZNF143 expression in the cell cycle, we established two cells with forced expression of ZNF143 derived from PC3 prostate cancer cell lines. These cell lines overexpress genes associated with cell cycle and cell division, such as polo-like kinase 1 (PLK1, aurora kinase B (AURKB and some minichromosome maintenance complex components (MCM. However, the doubling time of cells with forced expression of ZNF143 was approximately twice as long as its control counterpart cell line. Analysis following serum starvation and re-seeding showed that PC3 cells were synchronized at G1 in the cell cycle. Also, ZNF143 expression fluctuated, and was at its lowest level in G2/M. However, PC3 cells with forced expression of ZNF143 synchronized at G2/M, and showed lack of cell cycle-dependent fluctuation of nuclear expression of MCM proteins. Furthermore, G2/M population of both cisplatin-resistant PCDP6 cells over-expressing ZNF143 (derived from PC3 cells and cells with forced expression of ZNF143 was significantly higher than that of each counterpart, and the doubling time of PCDP6 cells is about 2.5 times longer than that of PC3 cells. These data suggested that fluctuations in ZNF143 expression are required both for gene expression associated with cell cycle and for cell division.

CD25+ B-1a Cells Express Aicda

Directory of Open Access Journals (Sweden)

Hiroaki Kaku

2017-06-01

Full Text Available B-1a cells are innate-like B-lymphocytes producing natural antibodies. Activation-induced cytidine deaminase (AID, a product of the Aicda gene, plays a central role in class-switch recombination and somatic hypermutation in B cells. Although a role for Aicda in B-1a cells has been suggested on the basis of experiments with knock out (KO mice, whether B-1a cells express Aicda, and if so, which B-1a cell subpopulation expresses Aicda, remains unknown. Here, we demonstrate that B-1 cells express Aicda, but at a level below that expressed by germinal center (GC B cells. We previously reported that B-1a cells can be subdivided based on CD25 expression. We show here that B-1a cell Aicda expression is concentrated in the CD25+ B-1a cell subpopulation. These results suggest the possibility that previous studies of memory B cells identified on the basis of Aicda expression may have inadvertently included an unknown number of CD25+ B-1a cells. Although B-1a cells develop normally in the absence of Aicda, a competitive reconstitution assay reveals enhanced vigor for AID KO B-1a cell bone marrow (BM progenitors, as compared with wild-type BM B-1 cell progenitors. These results suggest that AID inhibits the development of B-1a cells from BM B-1 cell progenitors in a competitive environment.

During development intense Sox2 expression marks not only Prox1-expressing taste bud cell but also perigemmal cell lineages.

Science.gov (United States)

Nakayama, Ayumi; Miura, Hirohito; Ooki, Makoto; Harada, Shuitsu

2015-03-01

Sox2 is proposed to regulate the differentiation of bipotential progenitor cells into taste bud cells. However, detailed expression of Sox2 remains unclear. In this report, Sox2 expression during taste bud development in the fungiform (FF), circumvallate (CV) and soft palate (SP) areas is examined together with Prox1. First, we immunohistochemically checked Prox1 expression in adults and found that almost all taste bud cells are Prox1-positive. During FF development, intense Sox2 expression was restricted to taste bud primordia expressing Prox1 at E12.5. However, at E14.5, Sox2 was intensely expressed outside the developing taste buds resolving to perigemmal Sox2 expression in adults. In the SP, at E14.5, taste bud primordia emerged as Prox1-expressing cell clusters. However, intense Sox2 expression was not restricted to taste bud primordia but was detected widely in the epithelium. During development, Sox2 expression outside developing taste buds was generally down-regulated but was retained in the perigemmal region similarly to that in the FF. In the CV, the initial stage of taste bud development remained unclear because of the lack of taste bud primordia comparable to that in the FF and SP. Here, we show that Prox1-expressing cells appear in the apical epithelium at E12.5, in the inner trench wall at E17.5 and in the outer trench wall at E18.5. Sox2 was again not restricted to developing taste bud cells expressing Prox1 during CV development. The expression patterns support that Sox2 does not serve as a cell fate selector between taste bud cells and surrounding keratinocytes but rather may contribute to them both.

Susceptibility of various cell lines to Neospora caninum tachyzoites cultivation

Directory of Open Access Journals (Sweden)

Khordadmehr, M.,

2014-05-01

Full Text Available Neospora caninum is a coccidian protozoan parasite which is a major cause of bovine abortions and neonatal mortality in cattle, sheep, goat and horse. Occasionally, cultured cells are used for isolation and multiplication of the agent in vitro with several purposes. In this study the tachyzoite yields of N. caninum were compared in various cell cultures as the host cell lines. Among the cell cultures tested, two presented good susceptibility to the agent: cell lines Vero and MA-104. SW742 and TLI (in vitro suspension culture of lymphoid cells infected with Theileria lestoquardi showed moderate sensitivity. No viable tachyzoite were detected in the culture of MDCK and McCoy cell lines. These results demonstrate that MA-104 and SW742 cells present adequate susceptibility to N. caninum compared to Vero cells, which have been largely used to multiply the parasite in vitro. Moreover, these have easy manipulation, fast multiplication and relatively low nutritional requirements. In addition, the result of this study showed that TLI cell line as a suspension cell culture is susceptible to Nc-1 tachyzoites infection and could be used as an alternative host cell line for tachyzoites culture in vitro studies.

Decorin expression in quiescent myogenic cells

International Nuclear Information System (INIS)

Nishimura, Takanori; Nozu, Kenjiro; Kishioka, Yasuhiro; Wakamatsu, Jun-ichi; Hattori, Akihito

2008-01-01

Satellite cells are quiescent muscle stem cells that promote postnatal muscle growth and repair. When satellite cells are activated by myotrauma, they proliferate, migrate, differentiate, and ultimately fuse to existing myofibers. The remainder of these cells do not differentiate, but instead return to quiescence and remain in a quiescent state until activation begins the process again. This ability to maintain their own population is important for skeletal muscle to maintain the capability to repair during postnatal life. However, the mechanisms by which satellite cells return to quiescence and maintain the quiescent state are still unclear. Here, we demonstrated that decorin mRNA expression was high in cell cultures containing a higher ratio of quiescent satellite cells when satellite cells were stimulated with various concentrations of hepatocyte growth factor. This result suggests that quiescent satellite cells express decorin at a high level compared to activated satellite cells. Furthermore, we examined the expression of decorin in reserve cells, which were undifferentiated myoblasts remaining after induction of differentiation by serum-deprivation. Decorin mRNA levels in reserve cells were higher than those in differentiated myotubes and growing myoblasts. These results suggest that decorin participates in the quiescence of myogenic cells

An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.

LENUS (Irish Health Repository)

McDonnell, R J

1997-12-12

An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.

[The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

Science.gov (United States)

Zuffa, T

1987-10-01

The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

Haemopedia: An Expression Atlas of Murine Hematopoietic Cells

Directory of Open Access Journals (Sweden)

Carolyn A. de Graaf

2016-09-01

Full Text Available Hematopoiesis is a multistage process involving the differentiation of stem and progenitor cells into distinct mature cell lineages. Here we present Haemopedia, an atlas of murine gene-expression data containing 54 hematopoietic cell types, covering all the mature lineages in hematopoiesis. We include rare cell populations such as eosinophils, mast cells, basophils, and megakaryocytes, and a broad collection of progenitor and stem cells. We show that lineage branching and maturation during hematopoiesis can be reconstructed using the expression patterns of small sets of genes. We also have identified genes with enriched expression in each of the mature blood cell lineages, many of which show conserved lineage-enriched expression in human hematopoiesis. We have created an online web portal called Haemosphere to make analyses of Haemopedia and other blood cell transcriptional datasets easier. This resource provides simple tools to interrogate gene-expression-based relationships between hematopoietic cell types and genes of interest.

Sesamol induced apoptotic effect in lung adenocarcinoma cells through both intrinsic and extrinsic pathways.

Science.gov (United States)

Siriwarin, Boondaree; Weerapreeyakul, Natthida

2016-07-25

Sesamol is a phenolic lignan found in sesame seeds (Sesamum indicum L.) and sesame oil. The anticancer effects and molecular mechanisms underlying its apoptosis-inducing effect were investigated in human lung adenocarcinoma (SK-LU-1) cells. Sesamol inhibited SK-LU-1 cell growth with an IC50 value of 2.7 mM and exhibited less toxicity toward normal Vero cells after 48 h of treatment (Selective index = 3). Apoptotic bodies-the hallmark of apoptosis-were observed in sesamol-treated SK-LU-1 cells, stained with DAPI. Sesamol increased the activity of caspase 8, 9, and 3/7, indicating that apoptotic cell death occurred through both extrinsic and intrinsic pathways. Sesamol caused the loss of mitochondrial transmembrane potential signifying intrinsic apoptosis induction. Decreasing Bid expression revealed crosstalk between the intrinsic and extrinsic apoptotic pathways; demonstrating clearly that sesamol induces apoptosis through both pathways in human lung adenocarcinoma (SK-LU-1) cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Foxp3 expression in human cancer cells

Directory of Open Access Journals (Sweden)

Gourgoulianis Konstantinos I

2008-04-01

Full Text Available Abstract Objective Transcription factor forkhead box protein 3 (Foxp3 specifically characterizes the thymically derived naturally occurring regulatory T cells (Tregs. Limited evidence indicates that it is also expressed, albeit to a lesser extent, in tissues other than thymus and spleen, while, very recently, it was shown that Foxp3 is expressed by pancreatic carcinoma. This study was scheduled to investigate whether expression of Foxp3 transcripts and mature protein occurs constitutively in various tumor types. Materials and methods Twenty five tumor cell lines of different tissue origins (lung cancer, colon cancer, breast cancer, melanoma, erythroid leukemia, acute T-cell leukemia were studied. Detection of Foxp3 mRNA was performed using both conventional RT-PCR and quantitative real-time PCR while protein expression was assessed by immunocytochemistry and flow cytometry, using different antibody clones. Results Foxp3 mRNA as well as Foxp3 protein was detected in all tumor cell lines, albeit in variable levels, not related to the tissue of origin. This expression correlated with the expression levels of IL-10 and TGFb1. Conclusion We offer evidence that Foxp3 expression, characterizes tumor cells of various tissue origins. The biological significance of these findings warrants further investigation in the context of tumor immune escape, and especially under the light of current anti-cancer efforts interfering with Foxp3 expression.

[Cytotoxic effect of physalis peruviana in cell culture of colorectal and prostate cancer and chronic myeloid leukemia].

Science.gov (United States)

Quispe-Mauricio, Angel; Callacondo, David; Rojas, José; Zavala, David; Posso, Margarita; Vaisberg, Abraham

2009-01-01

The plants have been used as drugs for centuries. However, limited research has been done on its great potential as sources of new therapeutic agents. The purpose of this study was to evaluate Physalis peruviana cytotoxic activity on cell lines HT-29, PC-3, K-562 and VERO. The HT-29 cell lines, PC-3, K-562 and VERO, were exposed to four concentrations of P. peruviana ethanolic leave and stem extracts, also at different concentrations of cisplatin and 5-fluorouracil (5-FU), which were used as positive controls. We found rates of growth within 48 hours, then we determined the inhibitory concentration 50 (IC50) using linear regression analysis and the index of selectivity of each sample. The P. peruviana ethanolic leave and stem extracts showed cytotoxic activity. The IC50 in g/mL in leaves and stems were, 0.35 (r =-0.95 p peruviana leaves and steams ethanolic extracts were more cytotoxic than cisplatin and 5 FU, on the lines HT-29, PC-3 and K562. Furthermore the P. peruviana cytotoxic effects were less than cisplatin and 5-FU for VERO control cells lines.

Non-Small Cell Lung Cancer Cells Expressing CD44 Are Enriched for Stem Cell-Like Properties

Science.gov (United States)

Leung, Elaine Lai-Han; Fiscus, Ronald R.; Tung, James W.; Tin, Vicky Pui-Chi; Cheng, Lik Cheung; Sihoe, Alan Dart-Loon; Fink, Louis M.; Ma, Yupo; Wong, Maria Pik

2010-01-01

Background The cancer stem cell theory hypothesizes that cancers are perpetuated by cancer stem cells (CSC) or tumor initiating cells (TIC) possessing self-renewal and other stem cell-like properties while differentiated non-stem/initiating cells have a finite life span. To investigate whether the hypothesis is applicable to lung cancer, identification of lung CSC and demonstration of these capacities is essential. Methodology/Principal Finding The expression profiles of five stem cell markers (CD34, CD44, CD133, BMI1 and OCT4) were screened by flow cytometry in 10 lung cancer cell lines. CD44 was further investigated by testing for in vitro and in vivo tumorigenecity. Formation of spheroid bodies and in vivo tumor initiation ability were demonstrated in CD44+ cells of 4 cell lines. Serial in vivo tumor transplantability in nude mice was demonstrated using H1299 cell line. The primary xenografts initiated from CD44+ cells consisted of mixed CD44+ and CD44− cells in similar ratio as the parental H1299 cell line, supporting in vivo differentiation. Semi-quantitative Real-Time PCR (RT-PCR) showed that both freshly sorted CD44+ and CD44+ cells derived from CD44+-initiated tumors expressed the pluripotency genes OCT4/POU5F1, NANOG, SOX2. These stemness markers were not expressed by CD44− cells. Furthermore, freshly sorted CD44+ cells were more resistant to cisplatin treatment with lower apoptosis levels than CD44− cells. Immunohistochemical analysis of 141 resected non-small cell lung cancers showed tumor cell expression of CD44 in 50.4% of tumors while no CD34, and CD133 expression was observed in tumor cells. CD44 expression was associated with squamous cell carcinoma but unexpectedly, a longer survival was observed in CD44-expressing adenocarcinomas. Conclusion/Significance Overall, our results demonstrated that stem cell-like properties are enriched in CD44-expressing subpopulations of some lung cancer cell lines. Further investigation is required to clarify

A bursal pentapeptide (BPP-I), a novel bursal-derived peptide, exhibits antiproliferation of tumor cell and immunomodulator activity.

Science.gov (United States)

Feng, Xiu L; Liu, Qing T; Cao, Rui B; Zhou, Bin; Wang, Fang Q; Deng, Wen L; Qiu, Ya F; Zhang, Yu; Ishag, Hassan; Ma, Zhi Y; Zheng, Qi S; Chen, Pu Y

2012-06-01

The bursa of Fabricius (BF) is the central humoral immune organ unique to birds. Here, we isolated a novel bursal pentapeptide I (BPP-I), LGPGP, from BF. BPP-I could play inhibition effect on MCF-7 but not on CEF or Vero cell proliferation in vitro, and enhance antitumor factor p53 protein expression. Also, BPP-I stimulated antibody production in a dose-dependent manner in hybridoma cell. Furthermore, BPP-I could induce various immune responses in mice immunization experiments, including increase antibody production and cytokines IL-4 and IFN-γ level, and induce T-cell immunophenotyping. These results suggest that BPP-I is a potential immunomodulator of antitumor and immunity. The study could provide some novel insights on the probable candidate reagent for the antitumor and immune improvement.

DETECTION OF HUMAN ANTI-ZIKA VIRUS IgG BY ELISA USING AN ANTIGEN FROM in vitro INFECTED VERO CELLS: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

Laura Masami SUMITA

Full Text Available SUMMARY Zika virus (ZKV infection is a huge public health problem in Brazil because of the increased incidence of microcephaly in neonates from infected mothers. Detection of specific IgG antibodies in maternal serum samples constitutes an important approach for diagnosing ZKV infection and evaluating its relationship with neonatal microcephaly. However, as there is no serological test produced in Brazil to detect IgM and IgG antibodies against ZKV, we sought to examine specific IgG in serum samples from patients or suspected mothers to detect previous infection and to test for specificity with regard to flaviviral infections occurring in the same area. Brazilian Zika virus native antigens were obtained from infected Vero cell layers or free virions in the culture medium and then used in ELISA. We tested sera from eight ZKV RNA-diagnosed infected patients (ZKVR, seven neonates with microcephaly and their mothers after delivery (MM, 140 dengue virus IgM-positive (DM and IgG (DG-positive patients, and 100 yellow fever (YF-vaccinated patients. According to the ELISA, ZKVR samples were mostly positive (7/8, and all the MM serum samples were positive for ZKV IgG (7/7. In contrast, cross-reactions for dengue or yellow fever-vaccinated patients were observed, including DM (48/95, DG (10/45 or YF (3/100 serum samples; however, these cross-reactions exhibited low antigen avidity so that 6 M urea largely removed this cross-reactivity, with only a few cross-reacting samples remaining (8/140. ELISA based on extracted virions was much more specific, with all ZKVR (8/8 and MM sera being positive for ZKV IgG (7/7 and only borderline cross-reactivity found for DM (6/95, DG (3/45 or YF (4/100-vaccinated serum samples. This technique (ELISA can identify specific IgG in ZKV-infected patients and may be helpful in diagnosing congenital infetions after maternal RNA virus clearance or in epidemiological studies.

CNPase Expression in Olfactory Ensheathing Cells

Directory of Open Access Journals (Sweden)

Christine Radtke

2011-01-01

Full Text Available A large body of work supports the proposal that transplantation of olfactory ensheathing cells (OECs into nerve or spinal cord injuries can promote axonal regeneration and remyelination. Yet, some investigators have questioned whether the transplanted OECs associate with axons and form peripheral myelin, or if they recruit endogenous Schwann cells that form myelin. Olfactory bulbs from transgenic mice expressing the enhanced green fluorescent protein (eGFP under the control of the 2-3-cyclic nucleotide 3-phosphodiesterase (CNPase promoter were studied. CNPase is expressed in myelin-forming cells throughout their lineage. We examined CNPase expression in both in situ in the olfactory bulb and in vitro to determine if OECs express CNPase commensurate with their myelination potential. eGFP was observed in the outer nerve layer of the olfactory bulb. Dissociated OECs maintained in culture had both intense eGFP expression and CNPase immunostaining. Transplantation of OECs into transected peripheral nerve longitudinally associated with the regenerated axons. These data indicate that OECs in the outer nerve layer of the olfactory bulb of CNPase transgenic mice express CNPase. Thus, while OECs do not normally form myelin on olfactory nerve axons, their expression of CNPase is commensurate with their potential to form myelin when transplanted into injured peripheral nerve.

RickA expression is not sufficient to promote actin-based motility of Rickettsia raoultii.

Directory of Open Access Journals (Sweden)

Premanand Balraj

Full Text Available BACKGROUND: Rickettsia raoultii is a novel Rickettsia species recently isolated from Dermacentor ticks and classified within the spotted fever group (SFG. The inability of R. raoultii to spread within L929 cells suggests that this bacterium is unable to polymerize host cell actin, a property exhibited by all SFG rickettsiae except R. peacocki. This result led us to investigate if RickA, the protein thought to generate actin nucleation, was expressed within this rickettsia species. METHODOLOGY/PRINCIPAL FINDINGS: Amplification and sequencing of R. raoultii rickA showed that this gene encoded a putative 565 amino acid protein highly homologous to those found in other rickettsiae. Using immunofluorescence assays, we determined that the motility pattern (i.e. microcolonies or cell-to-cell spreading of R. raoultii was different depending on the host cell line in which the bacteria replicated. In contrast, under the same experimental conditions, R. conorii shares the same phenotype both in L929 and in Vero cells. Transmission electron microscopy analysis of infected cells showed that non-motile bacteria were free in the cytosol instead of enclosed in a vacuole. Moreover, western-blot analysis demonstrated that the defect of R. raoultii actin-based motility within L929 cells was not related to lower expression of RickA. CONCLUSION/SIGNIFICANCE: These results, together with previously published data about R. typhi, strongly suggest that another factor, apart from RickA, may be involved with be responsible for actin-based motility in bacteria from the Rickettsia genus.

Foxl1-Expressing Mesenchymal Cells Constitute the Intestinal Stem Cell NicheSummary

Directory of Open Access Journals (Sweden)

Reina Aoki

2016-03-01

Full Text Available Background & Aims: Intestinal epithelial stem cells that express leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5 and/or B cell specific Moloney murine leukemia virus integration site 1 (Bmi1 continuously replicate and generate differentiated cells throughout life. Previously, Paneth cells were suggested to constitute an epithelium-intrinsic niche that regulates the behavior of these stem cells. However, ablating Paneth cells has no effect on the maintenance of functional stem cells. Here, we show definitively that a small subset of mesenchymal subepithelial cells expressing the winged-helix transcription factor forkhead box l1 (Foxl1 are a critical component of the intestinal stem cell niche. Methods: We genetically ablated Foxl1+ mesenchymal cells in adult mice using 2 separate models by expressing either the human or simian diphtheria toxin receptor under Foxl1 promoter control. Conclusions: Killing Foxl1+ cells by diphtheria toxin administration led to an abrupt cessation of proliferation of both epithelial stem- and transit-amplifying progenitor cell populations that was associated with a loss of active Wnt signaling to the intestinal epithelium. Therefore, Foxl1-expressing mesenchymal cells constitute the fundamental niche for intestinal stem cells. Keywords: Intestinal Stem Cell Niche, Wnt, Mesenchyme

Rethinking cell-cycle-dependent gene expression in Schizosaccharomyces pombe.

Science.gov (United States)

Cooper, Stephen

2017-11-01

Three studies of gene expression during the division cycle of Schizosaccharomyces pombe led to the proposal that a large number of genes are expressed at particular times during the S. pombe cell cycle. Yet only a small fraction of genes proposed to be expressed in a cell-cycle-dependent manner are reproducible in all three published studies. In addition to reproducibility problems, questions about expression amplitudes, cell-cycle timing of expression, synchronization artifacts, and the problem with methods for synchronizing cells must be considered. These problems and complications prompt the idea that caution should be used before accepting the conclusion that there are a large number of genes expressed in a cell-cycle-dependent manner in S. pombe.

Severe fever with thrombocytopenia syndrome virus inhibits exogenous Type I IFN signaling pathway through its NSs invitro.

Science.gov (United States)

Chen, Xu; Ye, Haiyan; Li, Shilin; Jiao, Baihai; Wu, Jianqin; Zeng, Peibin; Chen, Limin

2017-01-01

Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by a novel bunyavirus (SFTS virus, SFTSV). At present there is still no specific antiviral treatment for SFTSV; To understand which cells support SFTSV life cycle and whether SFTSV infection activates host innate immunity, four different cell lines (Vero, Hela, Huh7.5.1, and Huh7.0) were infected with SFTSV. Intracellular/extracellular viral RNA and expression of IFNα, and IFNß were detected by real-time RT- PCR following infection. To confirm the role of non-structural protein (NSs) of SFTSV in exogenous IFNα-induced Jak/STAT signaling, p-STAT1 (Western Blot), ISRE activity (Luciferase assay) and ISG expression (real-time PCR) were examined following IFNα stimulation in the presence or absence of over-expression of NSs in Hela cells. Our study showed that all the four cell lines supported SFTSV life cycle and SFTSV activated host innate immunity to produce type I IFNs in Hela cells but not in Huh7.0, Huh7.5.1 or Vero cells. NSs inhibited exogenous IFNα-induced Jak/STAT signaling as shown by decreased p-STAT1 level, suppressed ISRE activity and down-regulated ISG expression. Suppression of the exogenous Type I IFN-induced Jak/STAT signaling by NSs might be one of the mechanisms of SFTSV to evade host immune surveillance.

Glutathione S-transferase expression and isoenzyme composition during cell differentiation of Caco-2 cells

International Nuclear Information System (INIS)

Scharmach, E.; Hessel, S.; Niemann, B.; Lampen, A.

2009-01-01

The human colon adenocarcinoma cell line Caco-2 is frequently used to study human intestinal metabolism and transport of xenobiotica. Previous studies have shown that both Caco-2 cells and human colon cells constitutively express the multigene family of detoxifying enzymes glutathione S-transferases (GSTs), particularly GST alpha and GST pi. GSTs may play a fundamental role in the molecular interplay between phase I, II enzymes and ABC-transporters. The gut fermentation product, butyrate, can modulate the potential for detoxification. The aim of this study was to investigate the basal expression of further cytosolic GSTs in Caco-2 cells during cell differentiation. In addition, a comparison was made with expression levels in MCF-7 and HepG2, two other cell types with barrier functions. Finally, the butyrate-mediated modulation of gene and protein expression was determined by real time PCR and western blot analysis. In Caco-2, gene and protein expression levels of GST alpha increased during cell differentiation. High levels of GSTO1 and GSTP1 were constantly expressed. No expression of GSTM5 and GSTT1 was detected. HepG2 expressed GSTO1 and MCF-7 GSTZ1 most intensively. No expression of GSTA5, GSTM5, or GSTP1 was detected in either cell. Incubation of Caco-2 cells with butyrate (5 mM) significantly induced GSTA1 and GSTM2 in proliferating Caco-2 cells. In differentiated cells, butyrate tended to increase GSTO1 and GSTP1. The results of this study show that a differentiation-dependent expression of GSTs in Caco-2 cells may reflect the in vivo situation and indicate the potential of butyrate to modify intestinal metabolism. GSTA1-A4 have been identified as good markers for cell differentiation. The Caco-2 cell line is a useful model for assessing the potential of food-related substances to modulate the GST expression pattern.

Glutathione S-transferase expression and isoenzyme composition during cell differentiation of Caco-2 cells.

Science.gov (United States)

Scharmach, E; Hessel, S; Niemann, B; Lampen, A

2009-11-30

The human colon adenocarcinoma cell line Caco-2 is frequently used to study human intestinal metabolism and transport of xenobiotica. Previous studies have shown that both Caco-2 cells and human colon cells constitutively express the multigene family of detoxifying enzymes glutathione S-transferases (GSTs), particularly GST alpha and GST pi. GSTs may play a fundamental role in the molecular interplay between phase I, II enzymes and ABC-transporters. The gut fermentation product, butyrate, can modulate the potential for detoxification. The aim of this study was to investigate the basal expression of further cytosolic GSTs in Caco-2 cells during cell differentiation. In addition, a comparison was made with expression levels in MCF-7 and HepG2, two other cell types with barrier functions. Finally, the butyrate-mediated modulation of gene and protein expression was determined by real time PCR and western blot analysis. In Caco-2, gene and protein expression levels of GST alpha increased during cell differentiation. High levels of GSTO1 and GSTP1 were constantly expressed. No expression of GSTM5 and GSTT1 was detected. HepG2 expressed GSTO1 and MCF-7 GSTZ1 most intensively. No expression of GSTA5, GSTM5, or GSTP1 was detected in either cell. Incubation of Caco-2 cells with butyrate (5 mM) significantly induced GSTA1 and GSTM2 in proliferating Caco-2 cells. In differentiated cells, butyrate tended to increase GSTO1 and GSTP1. The results of this study show that a differentiation-dependent expression of GSTs in Caco-2 cells may reflect the in vivo situation and indicate the potential of butyrate to modify intestinal metabolism. GSTA1-A4 have been identified as good markers for cell differentiation. The Caco-2 cell line is a useful model for assessing the potential of food-related substances to modulate the GST expression pattern.

Oncomirs Expression Profiling in Uterine Leiomyosarcoma Cells

Directory of Open Access Journals (Sweden)

Bruna Cristine de Almeida

2017-12-01

Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that act as regulators of gene expression at the post-transcriptional level. They play a key role in several biological processes. Their abnormal expression may lead to malignant cell transformation. This study aimed to evaluate the expression profile of 84 miRNAs involved in tumorigenesis in immortalized cells of myometrium (MM, uterine leiomyoma (ULM, and uterine leiomyosarcoma (ULMS. Specific cell lines were cultured and qRT-PCR was performed. Thirteen miRNAs presented different expression profiles in ULM and the same thirteen in ULMS compared to MM. Eight miRNAs were overexpressed, and five were underexpressed in ULM. In ULMS cells, five miRNAs exhibited an overexpression and eight were down-regulated. Six miRNAs (miR-1-3p, miR-130b-3p, miR-140-5p, miR-202-3p, miR-205-5p, and miR-7-5p presented a similar expression pattern in cell lines compared to patient samples. Of these, only three miRNAs showed significant expression in ULM (miR-1-3p, miR-140-5p, and miR-7-5p and ULMS (miR-1-3p, miR-202-3p, and miR-7-5p. Our preliminary approach identified 24 oncomirs with an altered expression profile in ULM and ULMS cells. We identified four differentially expressed miRNAs with the same profile when compared with patients’ samples, which strongly interacted with relevant genes, including apoptosis regulator (BCL2, epidermal growth factor receptor (EGFR, vascular endothelial growth factor A (VEGFA, insulin like growth factor 1 receptor (IGF1R,serine/threonine kinase (RAF1, receptor tyrosine kinase (MET, and bHLH transcription factor (MYCN. This led to alterations in their mRNA-target.

Automatic Control of Gene Expression in Mammalian Cells.

Science.gov (United States)

Fracassi, Chiara; Postiglione, Lorena; Fiore, Gianfranco; di Bernardo, Diego

2016-04-15

Automatic control of gene expression in living cells is paramount importance to characterize both endogenous gene regulatory networks and synthetic circuits. In addition, such a technology can be used to maintain the expression of synthetic circuit components in an optimal range in order to ensure reliable performance. Here we present a microfluidics-based method to automatically control gene expression from the tetracycline-inducible promoter in mammalian cells in real time. Our approach is based on the negative-feedback control engineering paradigm. We validated our method in a monoclonal population of cells constitutively expressing a fluorescent reporter protein (d2EYFP) downstream of a minimal CMV promoter with seven tet-responsive operator motifs (CMV-TET). These cells also constitutively express the tetracycline transactivator protein (tTA). In cells grown in standard growth medium, tTA is able to bind the CMV-TET promoter, causing d2EYFP to be maximally expressed. Upon addition of tetracycline to the culture medium, tTA detaches from the CMV-TET promoter, thus preventing d2EYFP expression. We tested two different model-independent control algorithms (relay and proportional-integral (PI)) to force a monoclonal population of cells to express an intermediate level of d2EYFP equal to 50% of its maximum expression level for up to 3500 min. The control input is either tetracycline-rich or standard growth medium. We demonstrated that both the relay and PI controllers can regulate gene expression at the desired level, despite oscillations (dampened in the case of the PI controller) around the chosen set point.

Expression of MIF and CD74 in leukemic cell lines: correlation to DR expression destiny.

Science.gov (United States)

Georgouli, Mirella; Papadimitriou, Lina; Glymenaki, Maria; Patsaki, Valia; Athanassakis, Irene

2016-06-01

Invariant chain (Ii) or CD74 is a non-polymorphic glycoprotein, which apart from its role as a chaperone dedicated to MHCII molecules, is known to be a high-affinity receptor for macrophage migration inhibitory factor (MIF). The present study aimed to define the roles of CD74 and MIF in the immune surveillance escape process. Towards this direction, the cell lines HL-60, Raji, K562 and primary pre-B leukemic cells were examined for expression and secretion of MIF. Flow cytometry analysis detected high levels of MIF and intracellular/membrane CD74 expression in all leukemic cells tested, while MIF secretion was shown to be inversely proportional to intracellular HLA-DR (DR) expression. In the MHCII-negative cells, IFN-γ increased MIF expression and induced its secretion in HL-60 and K562 cells, respectively. In K562 cells, CD74 (Iip33Iip35) was shown to co-precipitate with HLA-DOβ (DOβ), inhibiting thus MIF or DR binding. Induced expression of DOα in K562 (DOα-DOβ+) cells in different transfection combinations decreased MIF expression and secretion, while increasing surface DR expression. Thus, MIF could indeed be part of the antigen presentation process.

Impaired cell surface expression of HLA-B antigens on mesenchymal stem cells and muscle cell progenitors

DEFF Research Database (Denmark)

Isa, Adiba; Nehlin, Jan; Sabir, Hardee Jawad

2010-01-01

HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C...... at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either...... undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC) using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced...

CD40 expression in Wehi-164 cell line.

Science.gov (United States)

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad

2010-07-01

CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body's defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system.

Canine distemper virus induces apoptosis in cervical tumor derived cell lines

Directory of Open Access Journals (Sweden)

Rajão Daniela S

2011-06-01

Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

HBx induced AFP receptor expressed to activate PI3K/AKT signal to promote expression of Src in liver cells and hepatoma cells

International Nuclear Information System (INIS)

Zhu, Mingyue; Guo, Junli; Li, Wei; Xia, Hua; Lu, Yan; Dong, Xu; Chen, Yi; Xie, Xieju; Fu, Shigan; Li, Mengsen

2015-01-01

Hepatitis B virus (HBV)-X protein(HBx) is a transactivator of host several cellular genes including alpha-fetoprotein(AFP) and AFP receptor(AFPR) which contributes to HBV-associated tumor development. The expression of AFP/AFPR are correlated with hepatocellular carcinoma(HCC)-initial cells. But the role of AFP and AFPR in promoting occurrence of HBV-related HCC were still unclear. A total of 71 clinical patients’ liver specimens, normal human liver cells L-02 and HCC cell lines, PLC/PRF/5 were selected for analyzing the effects of HBx on expression of AFP, AFPR and Src. The expression of goal proteins were detected by Immunohistochemical stained and Western blotting; HBx-expressed vectors were constructed and transfected into L-02 cells, laser confocal microscopy was applied to observe expression and location of AFP, AFPR and Src in the normal liver cells and HCC cells, soft agar colony formation assay was used to observe colonies formed of the cells. We confirmed HBx gives preference to promote the expression of AFP and AFPR; HBx priors to up-regulate the expression of AFPR and AFP in L-02 cells and in normal liver specimens; AFPR signal been able to stimulate Src expression. The results also indicated that phosphatidylinositol 3-kinase(PI3K) inhibitors Ly294002 and GDC0941 effectively suppress AFPR mediated up-regulation expression of Src in AFPR positive HCC lines. HBx priors to drive the expression of AFP and AFPR to promote expression of Src in normal liver cells and hepatoma cells; AFP and AFPR maybe play pivotal role in HBV-related hepatocarcinogenesis; Targeting AFPR is an available therapeutic strategy of HCC. The online version of this article (doi:10.1186/s12885-015-1384-9) contains supplementary material, which is available to authorized users

Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts

DEFF Research Database (Denmark)

Rygaard, K; Vindeløv, L L; Spang-Thomsen, M

1993-01-01

A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse....... WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc......-myc. In general, the level of expression of c-myc and N-myc was similar at the mRNA and the protein level. Expression of c-myc was positively correlated with the proliferative index (sum of S and G2+M phases) of cell lines, but not with the population doubling time. In general, L-myc-expressing cell lines had...

Hemoglobin Expression in Nonerythroid Cells: Novel or Ubiquitous?

Directory of Open Access Journals (Sweden)

Debarchana Saha

2014-01-01

Full Text Available Hemoglobin (Hb is a major protein involved in transport of oxygen (O2. Red blood cells (RBCs contain maximum amount of Hb and because of their unique structure and plasticity they transport O2 to various tissues of the body at an optimal concentration. Recently, it has been reported that, apart from RBCs, Hb is also expressed by nonerythroid cells such as epithelial cells of different origin. The cells expressing Hb are from the tissues where maintenance of O2 homeostasis is of paramount importance. Hb expression has been observed in the epithelial cells from human tissues including lungs, neurons, retina, and endometrium. Our group has recently demonstrated that Hb is expressed by the cervicovaginal epithelial cells. We further showed that, apart from maintaining O2 homeostasis, Hb and the peptides derived from it play an indispensable role in the protection of vaginal epithelium by exhibiting antimicrobial activity. In this review, we discuss the significance of Hb expression in vaginal epithelial cells and its role in the recognition of pathogens thereby reducing the risk and/or severity of inflammation and/or infections and the possible mechanism by which Hb exhibits antimicrobial and antioxidative functions.

Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

Science.gov (United States)

Yu, Yue; Lee, Jennifer Suehyun; Xie, Ning; Li, Estelle; Hurtado-Coll, Antonio; Fazli, Ladan; Cox, Michael; Plymate, Stephen; Gleave, Martin; Dong, Xuesen

2014-01-01

Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR) was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1) and interlukin-6 (IL-6) by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

Directory of Open Access Journals (Sweden)

Yue Yu

Full Text Available Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood.Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels.Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1 and interlukin-6 (IL-6 by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion.Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

Pharmacologic suppression of target cell recognition by engineered T cells expressing chimeric T-cell receptors.

Science.gov (United States)

Alvarez-Vallina, L; Yañez, R; Blanco, B; Gil, M; Russell, S J

2000-04-01

Adoptive therapy with autologous T cells expressing chimeric T-cell receptors (chTCRs) is of potential interest for the treatment of malignancy. To limit possible T-cell-mediated damage to normal tissues that weakly express the targeted tumor antigen (Ag), we have tested a strategy for the suppression of target cell recognition by engineered T cells. Jurkat T cells were transduced with an anti-hapten chTCR tinder the control of a tetracycline-suppressible promoter and were shown to respond to Ag-positive (hapten-coated) but not to Ag-negative target cells. The engineered T cells were then reacted with hapten-coated target cells at different effector to target cell ratios before and after exposure to tetracycline. When the engineered T cells were treated with tetracycline, expression of the chTCR was greatly decreased and recognition of the hapten-coated target cells was completely suppressed. Tetracycline-mediated suppression of target cell recognition by engineered T cells may be a useful strategy to limit the toxicity of the approach to cancer gene therapy.

Expression and significance of Axin2 in pancreatic cancer cells

Directory of Open Access Journals (Sweden)

ZHANG Tao

2016-05-01

Full Text Available ObjectiveTo investigate the expression of Axin2 in pancreatic cancer cells, and to observe the influence of Axin2 on the proliferation, invasion, and migration of human pancreatic cancer cells (PANC-1. MethodsQuantitative real-time PCR was used to measure the expression of Axin2 in pancreatic cancer cell lines with different invasive abilities (PANC-1, Mia PaCa-2, and BxPC-3 and immortalized normal pancreatic cells (H6C7. PANC-1 cells with low expression were transfected with over-expressed Axin2 plasmid by transient transfection. MTT assay, Transwell assay, and scratch assay were used to determine the proliferation, invasion, and migration of cells transfected with over-expressed Axin2. One-way analysis of variance was used for comparison between multiple groups, and SNK-q test was used for comparison between any two groups. ResultsThe relative expression levels of Axin2 in PANC-1, BxPC-3, Mia PaCa-2, and H6C7 cells were 0.13±0.01, 0.42±0.05, 0.24±0.011, and 1.00±0.00, respectively, and PANC-1 cells had the lowest expression level of Axin2, with significant differences compared with the other cells (all P＜0.05. When PANC-1 cells were transfected with over-expressed Axin2 plasmid, the cells in the over-expression group had a significant increase in the expression level of Axin2 compared with those in the blank group and the negative control group (both P＜0.05. Compared with those in the non-transfection group and the blank group, PANC-1 cells in the over-expression group showed significant reductions in the proliferation, invasion, and migration abilities. ConclusionThe expression of Axin2 is down-regulated in pancreatic cancer cell lines and decreases with the increasing invasion ability, suggesting the role of tumor suppressor gene. High expression of Axin2 can reduce the proliferation, invasion, and migration abilities of PANC-1 cells.

In vitro anticancer activity and cytotoxicity of some papaver alkaloids ...

African Journals Online (AJOL)

Materials and Methods: The Vero and HeLa cell lines were treated with various concentrations (1-300 μg/mL) of alkaloids for 48 h. Values for cytotoxicity measured by MTT assay were expressed as the concentration that causes a 50% decrease in cell viability (IC50) (μg/mL). Results: Berberine and macranthine were the ...

Identification of Contaminated Cells with Viruses, Bacteria, or Fungi by Fourier Transform Infrared Microspectroscopy

Directory of Open Access Journals (Sweden)

V. Erukhimovitch

2013-01-01

Full Text Available Fourier transform infrared microspectroscopy (FTIR-M can detect small molecular changes in cells and therefore was previously applied for the identification of different biological samples. In the present study, FTIR spectroscopy was used for the identification and discrimination of Vero cells infected with herpes viruses or contaminated with bacteria or fungi in cell culture. Vero cells in culture were infected herpes simplex virus type 1 (HSV-1 or contaminated with E. coli bacteria or Candida albicans fungi and analyzed by FTIR microscopy at 24 h postinfection/contamination. Specific different spectral changes were observed according to the infecting or contaminating agent. For instance, both pure fungi and cell culture contaminated with this fungi showed specific peaks at 1030 cm−1 and at 1373 cm−1 regions, while pure E. coli and cell culture contaminated with this bacteria showed a specific and unique peak at 1657 cm−1. These results support the potential of developing FTIR microspectroscopy as a simple, reagent free method for identification and discrimination between different tissue infection or contamination with various pathogens.

Advantages and Applications of CAR-Expressing Natural Killer Cells

Directory of Open Access Journals (Sweden)

Wolfgang eGlienke

2015-02-01

Full Text Available In contrast to donor T cells, natural killer (NK cells are known to mediate anti-cancer effects without the risk of inducing graft-versus-host disease (GvHD. In order to improve cytotoxicity against resistant cancer cells, auspicious efforts have been made with chimeric antigen receptor (CAR expressing T- and NK cells. These CAR-modified cells express antigen receptors against tumor-associated surface antigens, thus redirecting the effector cells and enhancing tumor-specific immunosurveillance. However, many cancer antigens are also expressed on healthy tissues, potentially leading to off tumor/ on target toxicity by CAR-engineered cells. In order to control such potentially severe side effects, the insertion of suicide genes into CAR-modified effectors can provide a means for efficient depletion of these cells. While CAR-expressing T cells have entered successfully clinical trials, experience with CAR-engineered NK cells is mainly restricted to pre-clinical investigations and predominantly to NK cell lines. In this review we summarize the data on CAR expressing NK cells focusing on the possible advantage using these short-lived effector cells and discuss the necessity of suicide switches. Furthermore, we address the compliance of such modified NK cells with regulatory requirements as a new field in cellular immunotherapy.

Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

Directory of Open Access Journals (Sweden)

Yamaguchi Ryoji

2009-10-01

Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

Glioblastoma formation from cell population depleted of Prominin1-expressing cells.

Directory of Open Access Journals (Sweden)

Kenji Nishide

2009-08-01

Full Text Available Prominin1 (Prom1, also known as CD133 in human has been widely used as a marker for cancer stem cells (CSCs, which self-renew and are tumorigenic, in malignant tumors including glioblastoma multiforme (GBM. However, there is other evidence showing that Prom1-negative cancer cells also form tumors in vivo. Thus it remains controversial whether Prom1 is a bona fide marker for CSCs. To verify if Prom1-expressing cells are essential for tumorigenesis, we established a mouse line, whose Prom1-expressing cells can be eliminated conditionally by a Cre-inducible DTA gene on the Prom1 locus together with a tamoxifen-inducible CreER(TM, and generated glioma-initiating cells (GICs-LD by overexpressing both the SV40 Large T antigen and an oncogenic H-Ras(L61 in neural stem cells of the mouse line. We show here that the tamoxifen-treated GICs-LD (GICs-DTA form tumor-spheres in culture and transplantable GBM in vivo. Thus, our studies demonstrate that Prom1-expressing cells are dispensable for gliomagenesis in this mouse model.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Geometry of the Gene Expression Space of Individual Cells.

Directory of Open Access Journals (Sweden)

Yael Korem

2015-07-01

Full Text Available There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a

CD133 expression in chemo-resistant Ewing sarcoma cells

Directory of Open Access Journals (Sweden)

Kovar Heinrich

2010-03-01

Full Text Available Abstract Background Some human cancers demonstrate cellular hierarchies in which tumor-initiating cancer stem cells generate progeny cells with reduced tumorigenic potential. This cancer stem cell population is proposed to be a source of therapy-resistant and recurrent disease. Ewing sarcoma family tumors (ESFT are highly aggressive cancers in which drug-resistant, relapsed disease remains a significant clinical problem. Recently, the cell surface protein CD133 was identified as a putative marker of tumor-initiating cells in ESFT. We evaluated ESFT tumors and cell lines to determine if high levels of CD133 are associated with drug resistance. Methods Expression of the CD133-encoding PROM1 gene was determined by RT-PCR in ESFT tumors and cell lines. CD133 protein expression was assessed by western blot, FACS and/or immunostaining. Cell lines were FACS-sorted into CD133+ and CD133- fractions and proliferation, colony formation in soft agar, and in vivo tumorigenicity compared. Chemosensitivity was measured using MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxy-methoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium assays. Results PROM1 expression was either absent or extremely low in most tumors. However, PROM1 was highly over-expressed in 4 of 48 cases. Two of the 4 patients with PROM1 over-expressing tumors rapidly succumbed to primary drug-resistant disease and two are long-term, event-free survivors. The expression of PROM1 in ESFT cell lines was similarly heterogeneous. The frequency of CD133+ cells ranged from 2-99% and, with one exception, no differences in the chemoresistance or tumorigenicity of CD133+ and CD133- cell fractions were detected. Importantly, however, the STA-ET-8.2 cell line was found to retain a cellular hierarchy in which relatively chemo-resistant, tumorigenic CD133+ cells gave rise to relatively chemo-sensitive, less tumorigenic, CD133- progeny. Conclusions Up to 10% of ESFT express high levels of PROM1. In some tumors and cell

B cell lymphomas express CX3CR1 a non-B cell lineage adhesion molecule

DEFF Research Database (Denmark)

Andreasson, U.; Ek, S.; Merz, H.

2008-01-01

normally is not expressed on B cells, is expressed both at the mRNA and protein level in several subtypes of lymphoma. CX3CR1 has also shown to be involved in the homing to specific tissues that express the ligand, CX3CL1, in breast and prostate cancer and may thus be involved in dissemination of lymphoma......To study the differential expression of cell membrane-bound receptors and their potential role in growth and/or survival of the tumor cells, highly purified follicular lymphoma cells were analyzed, using gene expression analysis, and compared to non-malignant B cell populations. Filtering...... the genome for overexpressed genes coding for cell membrane-bound proteins/receptors resulted in a hit list of 27 identified genes. Among these, we have focused on the aberrant over expression of CX3CR1, in different types of B cell lymphoma, as compared to non-malignant B cells. We show that CX3CR1, which...

Behavioral experience induces zif268 expression in mature granule cells but suppresses its expression in immature granule cells

Directory of Open Access Journals (Sweden)

Kylie A. Huckleberry

2015-08-01

Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult

Human thymic epithelial cells express functional HLA-DP molecules

DEFF Research Database (Denmark)

Jørgensen, A; Röpke, C; Nielsen, M

1996-01-01

T lymphocytes, we examined whether human thymic epithelial cells (TEC) expressed HLA-DP molecules. We present evidence that TEC obtained from short time culture express low but significant levels of HLA-DP molecules. The expression of HLA-DP molecules was comparable to or higher than the expression...... of HLA-DP allospecific primed lymphocyte typing (PLT) CD4 T cell lines. IFN-gamma treatment strongly upregulated the HLA-DP allospecific PLT responses whereas other PLT responses remained largely unchanged. In conclusion, these data indicate that human thymus epithelial cells express significant levels...

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Science.gov (United States)

Alvarez, Rene; Seal, Bruce S

2005-01-01

Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Directory of Open Access Journals (Sweden)

Alvarez Rene

2005-04-01

Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

Absence of annexin I expression in B-cell non-Hodgkin's lymphomas and cell lines

Directory of Open Access Journals (Sweden)

Gopalakrishnan Velliyur K

2004-03-01

Full Text Available Abstract Background Annexin I, one of the 20 members of the annexin family of calcium and phospholipid-binding proteins, has been implicated in diverse biological processes including signal transduction, mediation of apoptosis and immunosuppression. Previous studies have shown increased annexin I expression in pancreatic and breast cancers, while it is absent in prostate and esophageal cancers. Results Data presented here show that annexin I mRNA and protein are undetectable in 10 out of 12 B-cell lymphoma cell lines examined. Southern blot analysis indicates that the annexin I gene is intact in B-cell lymphoma cell lines. Aberrant methylation was examined as a cause for lack of annexin I expression by treating cells 5-Aza-2-deoxycytidine. Reexpression of annexin I was observed after prolonged treatment with the demethylating agent indicating methylation may be one of the mechanisms of annexin I silencing. Treatment of Raji and OMA-BL-1 cells with lipopolysaccharide, an inflammation inducer, and with hydrogen peroxide, a promoter of oxidative stress, also failed to induce annexin I expression. Annexin I expression was examined in primary lymphoma tissues by immunohistochemistry and presence of annexin I in a subset of normal B-cells and absence of annexin I expression in the lymphoma tissues were observed. These results show that annexin I is expressed in normal B-cells, and its expression is lost in all primary B-cell lymphomas and 10 of 12 B-cell lymphoma cell lines. Conclusions Our results suggest that, similar to prostate and esophageal cancers, annexin I may be an endogenous suppressor of cancer development, and loss of annexin I may contribute to B-cell lymphoma development.

Novel method for isolation of murine clara cell secretory protein-expressing cells with traces of stemness.

Directory of Open Access Journals (Sweden)

Xiao-Yang Wang

Full Text Available Clara cells are non-ciliated, secretory bronchiolar epithelial cells that serve to detoxify harmful inhaled substances. Clara cells also function as stem/progenitor cells for repair in the bronchioles. Clara cell secretory protein (CCSP is specifically expressed in pulmonary Clara cells and is widely used as a Clara cell marker. In addition CCSP promoter is commonly used to direct gene expression into the lung in transgenic models. The discovery of CCSP immunoreactivity in plasma membranes of airway lining cells prompted us to explore the possibility of enriching Clara cells by flow cytometry. We established a novel and simple method for the isolation of CCSP-expressing cell Clara cells using a combination of mechanical and enzymatic dissociation followed by flow cytometry sorting technology. We showed that ∼25% of dissociated cells from whole lung expressed CCSP. In the resulting preparation, up to 98% of cells expressed CCSP. Notably, we found that several common stem cell markers including CD44, CD133, Sca-1 and Sox2 were expressed in CCSP(+ cells. Moreover, CCSP(+ cells were able to form spheroid colonies in vitro with 0.97‰ efficiency. Parallel studies in vivo confirmed that a small population of CCSP(-expressing cells in mouse airways also demonstrates stem cell-like properties such as label retention and harboring rare bronchioalveolar stem cells (BASCs in terminal bronchioles (TBs. We conclude that CCSP(+ cells exhibit a number of stem cell-like features including stem cell marker expression, bronchosphere colony formation and self-renewal ability. Clara cell isolation by flow cytometry sorting is a useful method for investigating the function of primary Clara cells in stem cell research and mouse models.

The Expression of BTS-2 Enhances Cell Growth and Invasiveness in Renal Cell Carcinoma.

Science.gov (United States)

Pham, Quoc Thang; Oue, Naohide; Yamamoto, Yuji; Shigematsu, Yoshinori; Sekino, Yohei; Sakamoto, Naoya; Sentani, Kazuhiro; Uraoka, Naohiro; Tiwari, Mamata; Yasui, Wataru

2017-06-01

Renal cell carcinoma (RCC) is one of the most common types of cancer in developed countries. Bone marrow stromal cell antigen 2 (BST2) gene, which encodes BST2 transmembrane glycoprotein, is overexpressed in several cancer types. In the present study, we analyzed the expression and function of BST2 in RCC. BST2 expression was analyzed by immunohistochemistry in 123 RCC cases. RNA interference was used to inhibit BST2 expression in a RCC cell line. Immunohistochemical analysis showed that 32% of the 123 RCC cases were positive for BST2. BST2 expression was positively associated with tumour stage. Furthermore, BST2 expression was an independent predictor of survival in patients with RCC. BST2 siRNA-transfected Caki-1 cells displayed significantly reduced cell growth and invasive activity relative to negative control siRNA-transfected cells. These results suggest that BST2 plays an important role in the progression of RCC. Because BST2 is expressed on the cell membrane, BST2 is a good therapeutic target for RCC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Efflux protein expression in human stem cell-derived retinal pigment epithelial cells.

Directory of Open Access Journals (Sweden)

Kati Juuti-Uusitalo

Full Text Available Retinal pigment epithelial (RPE cells in the back of the eye nourish photoreceptor cells and form a selective barrier that influences drug transport from the blood to the photoreceptor cells. At the molecular level, ATP-dependent efflux transporters have a major role in drug delivery in human RPE. In this study, we assessed the relative expression of several ATP-dependent efflux transporter genes (MRP1, -2, -3, -4, -5, -6, p-gp, and BCRP, the protein expression and localization of MRP1, MRP4, and MRP5, and the functionality of MRP1 efflux pumps at different maturation stages of undifferentiated human embryonic stem cells (hESC and RPE derived from the hESC (hESC-RPE. Our findings revealed that the gene expression of ATP-dependent efflux transporters MRP1, -3, -4, -5, and p-gp fluctuated during hESC-RPE maturation from undifferentiated hESC to fusiform, epithelioid, and finally to cobblestone hESC-RPE. Epithelioid hESC-RPE had the highest expression of MRP1, -3, -4, and P-gp, whereas the most mature cobblestone hESC-RPE had the highest expression of MRP5 and MRP6. These findings indicate that a similar efflux protein profile is shared between hESC-RPE and the human RPE cell line, ARPE-19, and suggest that hESC-RPE cells are suitable in vitro RPE models for drug transport studies. Embryonic stem cell model might provide a novel tool to study retinal cell differentiation, mechanisms of RPE-derived diseases, drug testing and targeted drug therapy.

Activation of p44/42 in Human Natural Killer Cells Decreases Cell-surface Protein Expression: Relationship to Tributyltin-induced alterations of protein expression

Science.gov (United States)

Dudimah, Fred D.; Abraha, Abraham; Wang, Xiaofei; Whalen, Margaret M.

2010-01-01

Tributyltin (TBT) activates the mitogen activated protein kinase (MAPK), p44/42 in human natural killer (NK) cells. TBT also reduces NK cytotoxic function and decreases the expression of several NK-cell proteins. To understand the role that p44/42 activation plays in TBT-induced loss of NK cell function, we have investigated how selective activation of p44/42 by phorbol 12-myristate 13-acetate (PMA) affects NK cells. Previously we showed that PMA caused losses of lytic function similar to those seen with TBT exposures. Here we examined activation of p44/42 in the regulation of NK-cell protein expression and how this regulation may explain the protein expression changes seen with TBT exposures. NK cells exposed to PMA were examined for levels of cell-surface proteins, granzyme mRNA, and perforin mRNA expression. The expression of CD11a, CD16, CD18, and CD56 were reduced, perforin mRNA levels were unchanged and granzyme mRNA levels were increased. To verify that activation of p44/42 was responsible for the alterations seen in CD11a, CD16, CD18, and CD56 with PMA, NK cells were treated with the p44/42 pathway inhibitor (PD98059) prior to PMA exposures. In the presence of PD98059, PMA caused no decreases in the expression of the cell-surface proteins. Results of these studies indicate that the activation of p44/42 may lead to the loss of NK cell cytotoxic function by decreasing the expression of CD11a, CD16, CD18, and CD56. Further, activation of p44/42 appears to be at least in part responsible for the TBT-induced decreases in expression of CD16, CD18, and CD56. PMID:20883105

HIV Cell-to-Cell Spread Results in Earlier Onset of Viral Gene Expression by Multiple Infections per Cell.

Directory of Open Access Journals (Sweden)

Mikaël Boullé

2016-11-01

Full Text Available Cell-to-cell spread of HIV, a directed mode of viral transmission, has been observed to be more rapid than cell-free infection. However, a mechanism for earlier onset of viral gene expression in cell-to-cell spread was previously uncharacterized. Here we used time-lapse microscopy combined with automated image analysis to quantify the timing of the onset of HIV gene expression in a fluorescent reporter cell line, as well as single cell staining for infection over time in primary cells. We compared cell-to-cell spread of HIV to cell-free infection, and limited both types of transmission to a two-hour window to minimize differences due to virus transit time to the cell. The mean time to detectable onset of viral gene expression in cell-to-cell spread was accelerated by 19% in the reporter cell line and by 35% in peripheral blood mononuclear cells relative to cell-free HIV infection. Neither factors secreted by infected cells, nor contact with infected cells in the absence of transmission, detectably changed onset. We recapitulated the earlier onset by infecting with multiple cell-free viruses per cell. Surprisingly, the acceleration in onset of viral gene expression was not explained by cooperativity between infecting virions. Instead, more rapid onset was consistent with a model where the fastest expressing virus out of the infecting virus pool sets the time for infection independently of the other co-infecting viruses.

Polyclonal T-cells express CD1a in Langerhans cell histiocytosis (LCH lesions.

Directory of Open Access Journals (Sweden)

Jennifer A West

Full Text Available Langerhans cell histiocytosis (LCH is a complex and poorly understood disorder that has characteristics of both inflammatory and neoplastic disease. By using eight-colour flow cytometry, we have identified a previously unreported population of CD1a(+/CD3(+ T-cells in LCH lesions. The expression of CD1a is regarded as a hallmark of this disease; however, it has always been presumed that it was only expressed by pathogenic Langerhans cells (LCs. We have now detected CD1a expression by a range of T-cell subsets within all of the LCH lesions that were examined, establishing that CD1a expression in these lesions is no longer restricted to pathogenic LCs. The presence of CD1a(+ T-cells in all of the LCH lesions that we have studied to date warrants further investigation into their biological function to determine whether these cells are important in the pathogenesis of LCH.

Autoimmune Regulator (AIRE) Is Expressed in Spermatogenic Cells, and It Altered the Expression of Several Nucleic-Acid-Binding and Cytoskeletal Proteins in Germ Cell 1 Spermatogonial (GC1-spg) Cells.

Science.gov (United States)

Radhakrishnan, Karthika; Bhagya, Kongattu P; Kumar, Anil Tr; Devi, Anandavalli N; Sengottaiyan, Jeeva; Kumar, Pradeep G

2016-08-01

Autoimmune regulator (AIRE) is a gene associated with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). AIRE is expressed heavily in the thymic epithelial cells and is involved in maintaining self-tolerance through regulating the expression of tissue-specific antigens. The testes are the most predominant extrathymic location where a heavy expression of AIRE is reported. Homozygous Aire-deficient male mice were infertile, possibly due to impaired spermatogenesis, deregulated germ cell apoptosis, or autoimmunity. We report that AIRE is expressed in the testes of neonatal, adolescent, and adult mice. AIRE expression was detected in glial cell derived neurotrophic factor receptor alpha (GFRα)(+) (spermatogonia), GFRα(-)/synaptonemal complex protein (SCP3)(+) (meiotic), and GFRα(-)/Phosphoglycerate kinase 2 (PGK2)(+) (postmeiotic) germ cells in mouse testes. GC1-spg, a germ-cell-derived cell line, did not express AIRE. Retinoic acid induced AIRE expression in GC1-spg cells. Ectopic expression of AIRE in GC1-spg cells using label-free LC-MS/MS identified a total of 371 proteins that were differentially expressed. 100 proteins were up-regulated, and 271 proteins were down-regulated. Data are available via ProteomeXchange with identifier PXD002511. Functional analysis of the differentially expressed proteins showed increased levels of various nucleic-acid-binding proteins and transcription factors and a decreased level of various cytoskeletal and structural proteins in the AIRE overexpressing cells as compared with the empty vector-transfected controls. The transcripts of a select set of the up-regulated proteins were also elevated. However, there was no corresponding decrease in the mRNA levels of the down-regulated set of proteins. Molecular function network analysis indicated that AIRE influenced gene expression in GC1-spg cells by acting at multiple levels, including transcription, translation, RNA processing, protein transport, protein

Exosomes from asbestos-exposed cells modulate gene expression in mesothelial cells.

Science.gov (United States)

Munson, Phillip; Lam, Ying-Wai; Dragon, Julie; MacPherson, Maximilian; Shukla, Arti

2018-03-19

Asbestos exposure is a determinate cause of many diseases, such as mesothelioma, fibrosis, and lung cancer, and poses a major human health hazard. At this time, there are no identified biomarkers to demarcate asbestos exposure before the presentation of disease and symptoms, and there is only limited understanding of the underlying biology that governs asbestos-induced disease. In our study, we used exosomes, 30-140 nm extracellular vesicles, to gain insight into these knowledge gaps. As inhaled asbestos is first encountered by lung epithelial cells and macrophages, we hypothesize that asbestos-exposed cells secrete exosomes with signature proteomic cargo that can alter the gene expression of mesothelial cells, contributing to disease outcomes like mesothelioma. In the present study using lung epithelial cells (BEAS2B) and macrophages (THP-1), we first show that asbestos exposure causes changes in abundance of some proteins in the exosomes secreted from these cells. Furthermore, exposure of human mesothelial cells (HPM3) to these exosomes resulted in gene expression changes related to epithelial-to-mesenchymal transition and other cancer-related genes. This is the first report to indicate that asbestos-exposed cells secrete exosomes with differentially abundant proteins and that those exosomes have a gene-altering effect on mesothelial cells.-Munson, P., Lam, Y.-W., Dragon, J. MacPherson, M., Shukla, A. Exosomes from asbestos-exposed cells modulate gene expression in mesothelial cells.

Characterization of TLX expression in neural stem cells and progenitor cells in adult brains.

Science.gov (United States)

Li, Shengxiu; Sun, Guoqiang; Murai, Kiyohito; Ye, Peng; Shi, Yanhong

2012-01-01

TLX has been shown to play an important role in regulating the self-renewal and proliferation of neural stem cells in adult brains. However, the cellular distribution of endogenous TLX protein in adult brains remains to be elucidated. In this study, we used immunostaining with a TLX-specific antibody to show that TLX is expressed in both neural stem cells and transit-amplifying neural progenitor cells in the subventricular zone (SVZ) of adult mouse brains. Then, using a double thymidine analog labeling approach, we showed that almost all of the self-renewing neural stem cells expressed TLX. Interestingly, most of the TLX-positive cells in the SVZ represented the thymidine analog-negative, relatively quiescent neural stem cell population. Using cell type markers and short-term BrdU labeling, we demonstrated that TLX was also expressed in the Mash1+ rapidly dividing type C cells. Furthermore, loss of TLX expression dramatically reduced BrdU label-retaining neural stem cells and the actively dividing neural progenitor cells in the SVZ, but substantially increased GFAP staining and extended GFAP processes. These results suggest that TLX is essential to maintain the self-renewing neural stem cells in the SVZ and that the GFAP+ cells in the SVZ lose neural stem cell property upon loss of TLX expression. Understanding the cellular distribution of TLX and its function in specific cell types may provide insights into the development of therapeutic tools for neurodegenerative diseases by targeting TLX in neural stem/progenitors cells.

Gene expression of manganese superoxide dismutase in human glioma cells

Directory of Open Access Journals (Sweden)

Novi S. Hardiany

2010-02-01

Full Text Available Aim This study analyze the MnSOD gene expression as endogenous antioxidant in human glioma cells compared with leucocyte cells as control.Methods MnSOD gene expression of 20 glioma patients was analyzed by measuring the relative expression of mRNA and enzyme activity of MnSOD in brain and leucocyte cells. The relative expression of mRNA MnSOD was determined by using quantitative Real Time RT-PCR and the enzyme activity of MnSOD using biochemical kit assay (xantine oxidase inhibition. Statistic analysis for mRNA and enzyme activity of MnSOD was performed using Kruskal Wallis test.Results mRNA of MnSOD in glioma cells of 70% sample was 0.015–0.627 lower, 10% was 1.002-1.059 and 20% was 1.409-6.915 higher than in leucocyte cells. Also the specific activity of MnSOD enzyme in glioma cells of 80% sample showed 0,064-0,506 lower and 20% sample was 1.249-2.718 higher than in leucocyte cells.Conclusion MnSOD gene expression in human glioma cells are significantly lower than its expression in leucocytes cells. (Med J Indones 2010; 19:21-5Keywords : MnSOD, glioma, gene expression

Expression of cadherin and NCAM in human small cell lung cancer cell lines and xenografts

DEFF Research Database (Denmark)

Rygaard, K; Møller, C; Bock, E

1992-01-01

characterised, the cadherin family and the Ig superfamily member, neural cell adhesion molecule (NCAM). We investigated expression of these two adhesion molecule families in small cell lung cancer (SCLC) cell lines and xenografts by immunoblotting. Nineteen tumours established from 15 patients with SCLC were......Tumour cell adhesion, detachment and aggregation seem to play an important part in tumour invasion and metastasis, and numerous cell adhesion molecules are expressed by tumour cells. Several families of cell-cell adhesion molecules have been described, of which two groups are particularly well...... embryonic development, which may play a role in connection with tumour invasion and metastasis, was found in 14/18 NCAM expressing SCLC tumours. Individual tumours grown as cell lines and as nude mouse xenografts showed no qualitative differences in cadherin or NCAM expression....

Effect of ultrasound on herpes simplex virus infection in cell culture

Directory of Open Access Journals (Sweden)

Iwai Soichi

2011-09-01

Full Text Available Abstract Background Ultrasound has been shown to increase the efficiency of gene expression from retroviruses, adenoviruses and adeno-associated viruses. The effect of ultrasound to stimulate cell membrane permeabilization on infection with an oncolytic herpes simplex virus type 1 (HSV-1 was examined. Results Vero monkey kidney cells were infected with HSV-1 and exposed to 1 MHz ultrasound after an adsorption period. The number of plaques was significantly greater than that of the untreated control. A combination of ultrasound and microbubbles further increased the plaque number. Similar results were obtained using a different type of HSV-1 and oral squamous cell carcinoma (SCC cells. The appropriate intensity, duty cycle and time of ultrasound to increase the plaque number were 0.5 W/cm2, 20% duty cycle and 10 sec, respectively. Ultrasound with microbubbles at an intensity of 2.0 W/cm2, at 50% duty cycle, or for 40 sec reduced cell viability. Conclusion These results indicate that ultrasound promotes the entry of oncolytic HSV-1 into cells. It may be useful to enhance the efficiency of HSV-1 infection in oncolytic virotherapy.

Inflammation increases cells expressing ZSCAN4 and progenitor cell markers in the adult pancreas

Science.gov (United States)

Azuma, Sakiko; Yokoyama, Yukihiro; Yamamoto, Akiko; Kyokane, Kazuhiro; Niida, Shumpei; Ishiguro, Hiroshi; Ko, Minoru S. H.

2013-01-01

We have recently identified the zinc finger and SCAN domain containing 4 (Zscan4), which is transiently expressed and regulates telomere elongation and genome stability in mouse embryonic stem (ES) cells. The aim of this study was to examine the expression of ZSCAN4 in the adult pancreas and elucidate the role of ZSCAN4 in tissue inflammation and subsequent regeneration. The expression of ZSCAN4 and other progenitor or differentiated cell markers in the human pancreas was immunohistochemically examined. Pancreas sections of alcoholic or autoimmune pancreatitis patients before and under maintenance corticosteroid treatment were used in this study. In the adult human pancreas a small number of ZSCAN4-positive (ZSCAN4+) cells are present among cells located in the islets of Langerhans, acini, ducts, and oval-shaped cells. These cells not only express differentiated cell markers for each compartment of the pancreas but also express other tissue stem/progenitor cell markers. Furthermore, the number of ZSCAN4+ cells dramatically increased in patients with chronic pancreatitis, especially in the pancreatic tissues of autoimmune pancreatitis actively regenerating under corticosteroid treatment. Interestingly, a number of ZSCAN4+ cells in the pancreas of autoimmune pancreatitis returned to the basal level after 1 yr of maintenance corticosteroid treatment. In conclusion, coexpression of progenitor cell markers and differentiated cell markers with ZSCAN4 in each compartment of the pancreas may indicate the presence of facultative progenitors for both exocrine and endocrine cells in the adult pancreas. PMID:23599043

Decreased expression of cell adhesion genes in cancer stem-like cells isolated from primary oral squamous cell carcinomas.

Science.gov (United States)

Mishra, Amrendra; Sriram, Harshini; Chandarana, Pinal; Tanavde, Vivek; Kumar, Rekha V; Gopinath, Ashok; Govindarajan, Raman; Ramaswamy, S; Sadasivam, Subhashini

2018-05-01

The goal of this study was to isolate cancer stem-like cells marked by high expression of CD44, a putative cancer stem cell marker, from primary oral squamous cell carcinomas and identify distinctive gene expression patterns in these cells. From 1 October 2013 to 4 September 2015, 76 stage III-IV primary oral squamous cell carcinoma of the gingivobuccal sulcus were resected. In all, 13 tumours were analysed by immunohistochemistry to visualise CD44-expressing cells. Expression of CD44 within The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma RNA-sequencing data was also assessed. Seventy resected tumours were dissociated into single cells and stained with antibodies to CD44 as well as CD45 and CD31 (together referred as Lineage/Lin). From 45 of these, CD44 + Lin - and CD44 - Lin - subpopulations were successfully isolated using fluorescence-activated cell sorting, and good-quality RNA was obtained from 14 such sorted pairs. Libraries from five pairs were sequenced and the results analysed using bioinformatics tools. Reverse transcription quantitative polymerase chain reaction was performed to experimentally validate the differential expression of selected candidate genes identified from the transcriptome sequencing in the same 5 and an additional 9 tumours. CD44 was expressed on the surface of poorly differentiated tumour cells, and within the The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma samples, its messenger RNA levels were higher in tumours compared to normal. Transcriptomics revealed that 102 genes were upregulated and 85 genes were downregulated in CD44 + Lin - compared to CD44 - Lin - cells in at least 3 of the 5 tumours sequenced. The upregulated genes included those involved in immune regulation, while the downregulated genes were enriched for genes involved in cell adhesion. Decreased expression of PCDH18, MGP, SPARCL1 and KRTDAP was confirmed by reverse transcription quantitative polymerase chain reaction. Lower expression of

Expression of synaptogyrin-1 in T1R2-expressing type II taste cells and type III taste cells of rat circumvallate taste buds.

Science.gov (United States)

Kotani, Takeshi; Toyono, Takashi; Seta, Yuji; Kitou, Ayae; Kataoka, Shinji; Toyoshima, Kuniaki

2013-09-01

Synaptogyrins are conserved components of the exocytic apparatus and function as regulators of Ca(2+)-dependent exocytosis. The synaptogyrin family comprises three isoforms: two neuronal (synaptogyrin-1 and -3) and one ubiquitous (synaptogyrin-2) form. Although the expression patterns of the exocytic proteins synaptotagmin-1, SNAP-25, synaptobrevin-2 and synaptophysin have been elucidated in taste buds, the function and expression pattern of synaptogyrin-1 in rat gustatory tissues have not been determined. Therefore, we examined the expression patterns of synaptogyrin-1 and several cell-specific markers of type II and III cells in rat gustatory tissues. Reverse transcription/polymerase chain reaction assays and immunoblot analysis revealed the expression of synaptogyrin-1 mRNA and its protein in circumvallate papillae. In fungiform, foliate and circumvallate papillae, the antibody against synaptogyrin-1 immunolabeled a subset of taste bud cells and intra- and subgemmal nerve processes. Double-labeling experiments revealed the expression of synaptogyrin-1 in most taste cells immunoreactive for aromatic L-amino acid decarboxylase and the neural cell adhesion molecule. A subset of synaptogyrin-1-immunoreactive taste cells also expressed phospholipase Cβ2, gustducin, or sweet taste receptor (T1R2). In addition, most synaptogyrin-1-immunoreactive taste cells expressed synaptobrevin-2. These results suggest that synaptogyrin-1 plays a regulatory role in transmission at the synapses of type III cells and is involved in exocytic function with synaptobrevin-2 in a subset of type II cells in rat taste buds.

Characterization of TLX expression in neural stem cells and progenitor cells in adult brains.

Directory of Open Access Journals (Sweden)

Shengxiu Li

Full Text Available TLX has been shown to play an important role in regulating the self-renewal and proliferation of neural stem cells in adult brains. However, the cellular distribution of endogenous TLX protein in adult brains remains to be elucidated. In this study, we used immunostaining with a TLX-specific antibody to show that TLX is expressed in both neural stem cells and transit-amplifying neural progenitor cells in the subventricular zone (SVZ of adult mouse brains. Then, using a double thymidine analog labeling approach, we showed that almost all of the self-renewing neural stem cells expressed TLX. Interestingly, most of the TLX-positive cells in the SVZ represented the thymidine analog-negative, relatively quiescent neural stem cell population. Using cell type markers and short-term BrdU labeling, we demonstrated that TLX was also expressed in the Mash1+ rapidly dividing type C cells. Furthermore, loss of TLX expression dramatically reduced BrdU label-retaining neural stem cells and the actively dividing neural progenitor cells in the SVZ, but substantially increased GFAP staining and extended GFAP processes. These results suggest that TLX is essential to maintain the self-renewing neural stem cells in the SVZ and that the GFAP+ cells in the SVZ lose neural stem cell property upon loss of TLX expression. Understanding the cellular distribution of TLX and its function in specific cell types may provide insights into the development of therapeutic tools for neurodegenerative diseases by targeting TLX in neural stem/progenitors cells.

Amniotic Fluid Cells Show Higher Pluripotency-Related Gene Expression Than Allantoic Fluid Cells.

Science.gov (United States)

Kehl, Debora; Generali, Melanie; Görtz, Sabrina; Geering, Diego; Slamecka, Jaroslav; Hoerstrup, Simon P; Bleul, Ulrich; Weber, Benedikt

2017-10-01

Amniotic fluid represents an abundant source of multipotent stem cells, referred as broadly multipotent given their differentiation potential and expression of pluripotency-related genes. However, the origin of this broadly multipotent cellular fraction is not fully understood. Several sources have been proposed so far, including embryonic and extraembryonic tissues. In this regard, the ovine developmental model uniquely allows for direct comparison of fetal fluid-derived cells from two separate fetal fluid cavities, the allantois and the amnion, over the entire duration of gestation. As allantoic fluid mainly collects fetal urine, cells originating from the efferent urinary tract can directly be compared with cells deriving from the extraembryonic amniotic tissues and the fetus. This study shows isolation of cells from the amniotic [ovine amniotic fluid cells (oAFCs)] and allantoic fluid [ovine allantoic fluid cells (oALCs)] in a strictly paired fashion with oAFCs and oALCs derived from the same fetus. Both cell types showed cellular phenotypes comparable to standard mesenchymal stem cells (MSCs), with trilineage differentiation potential, and expression of common ovine MSC markers. However, the expression of MSC markers per single cell was higher in oAFCs as measured by flow cytometry. oAFCs exhibited higher proliferative capacities and showed significantly higher expression of pluripotency-related genes OCT4, STAT3, NANOG, and REX1 by quantitative real-time polymerase chain reaction compared with paired oALCs. No significant decrease of pluripotency-related gene expression was noted over gestation, implying that cells with high differentiation potential may be isolated at the end of pregnancy. In conclusion, this study suggests that cells with highest stem cell characteristics may originate from the fetus itself or the amniotic fetal adnexa rather than from the efferent urinary tract or the allantoic fetal adnexa.

CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.

Science.gov (United States)

Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco

2016-10-01

Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.

CXCR3 surface expression in human airway epithelial cells: cell cycle dependence and effect on cell proliferation.

Science.gov (United States)

Aksoy, Mark O; Yang, Yi; Ji, Rong; Reddy, P J; Shahabuddin, Syed; Litvin, Judith; Rogers, Thomas J; Kelsen, Steven G

2006-05-01

We recently demonstrated that human bronchial epithelial cells (HBEC) constitutively express the CXC chemokine receptor CXCR3, which when activated, induces directed cell migration. The present study in HBEC examined the relative expression of the CXCR3 splice variants CXCR3-A and -B, cell cycle dependence of CXCR3 expression, and the effects of the CXCR3 ligand, the interferon-gamma-inducible CXC chemokine I-TAC/CXCL11, on DNA synthesis and cell proliferation. Both CXCR3-A and -B mRNA, assessed by real-time RT-PCR, were expressed in normal HBEC (NHBEC) and the HBEC line 16-HBE. However, CXCR3-B mRNA was 39- and 6-fold greater than CXCR3-A mRNA in NHBEC and 16-HBE, respectively. Although most HBEC (>80%) assessed by flow cytometry and immunofluorescence microscopy contained intracellular CXCR3, only a minority (75%) were in the S + G(2)/M phases of the cell cycle. Stimulation of CXCR3 with I-TAC enhanced thymidine incorporation and cell proliferation and increased p38 and ERK1/2 phosphorylation. These data indicate that 1) human airway epithelial cells primarily express CXCR3-B mRNA, 2) surface expression of CXCR3 is largely confined to the S + G(2)/M phases of the cell cycle, and 3) activation of CXCR3 induces DNA synthesis, cell proliferation, and activation of MAPK pathways. We speculate that activation of CXCR3 exerts a mitogenic effect in HBEC, which may be important during airway mucosal injury in obstructive airway diseases such as asthma and chronic obstructive pulmonary disease.

Correlation of Slug gene expression with lymph node metastasis and invasion molecule expression in oral squamous cell carcinoma tissue

Directory of Open Access Journals (Sweden)

Shan-Ming Lu

2017-10-01

Full Text Available Objective: To study the correlation of Slug gene expression with lymph node metastasis and invasion molecule expression in oral squamous cell carcinoma tissue. Methods: Oral squamous cell carcinoma tissue surgical removed in Affiliated Stomatological Hospital of Nanjing Medical University between March 2015 and April 2017 was selected and divided into the oral squamous cell carcinoma tissue with neck lymph node metastasis and the oral squamous cell carcinoma tissues without lymph node metastasis according to the condition of lymph node metastasis. The expression of Slug, epithelial-mesenchymal transition molecules and invasion molecules in the oral squamous cell carcinoma tissue were detected. Results: Slug, N-cadherin, Vimentin, CD147, OPN, GRP78, SDF-1 and CXCR4 protein expression in oral squamous cell carcinoma tissue with neck lymph node metastasis were significantly higher than those in oral squamous cell carcinoma tissue without lymph node metastasis while E-cadherin, P120ctn and ZO-1 protein expression were significantly lower than those in oral squamous cell carcinoma tissue without lymph node metastasis; N-cadherin, Vimentin, CD147, OPN, GRP78, SDF-1 and CXCR4 protein expression in oral squamous cell carcinoma tissue with high Slug expression were significantly higher than those in oral squamous cell carcinoma tissue with low Slug expression while E-cadherin, P120ctn and ZO-1 protein expression were significantly lower than those in oral squamous cell carcinoma tissue with low Slug expression. Conclusion: The highly expressed Slug in oral squamous cell carcinoma tissue can promote the epithelial-mesenchymal transition and invasion of the cells to participate in the lymph node metastasis of tumor cells.

The effect of the colostral cells on gene expression of cytokines in cord blood cells.

Science.gov (United States)

Hrdý, Jiří; Novotná, Olga; Kocourková, Ingrid; Prokešová, Ludmila

2017-11-01

Beneficial effect of maternal milk is acknowledged, but there is still question whether maternal milk from allergic mother is as good as from healthy one. In our study, we have assayed the effect of cells from colostrum of healthy and allergic mothers on gene expression of cytokines in cord blood cells of newborns of healthy and allergic mothers. Cytokines typical for Th1 (IL-2, IFN-gamma), Th2 (IL-4, IL-13), Tregs (IL-10, TGF-beta), and IL-8 were followed. We were not able to detect significant influence of colostral cells on gene expression of cytokines in cord blood after 2-day coculture using Transwell system. There was no difference in gene expression of cytokines in nonstimulated cord blood cells of newborns of healthy and allergic mothers, but generally increased gene expression of cytokines except IL-10 and TGF-beta after polyclonal stimulation was detected in cord blood cells of children of allergic mothers. There was no difference in IL-10 expression in stimulated cord blood cells of children of healthy and allergic mothers. Gene expression of TGF-beta was even decreased in stimulated cord blood cells of children of allergic mothers in comparison to healthy ones. We have not observed difference in the capacity of colostral cells of healthy and allergic mothers to influence gene expression of cytokines in cord blood cells, but we have described difference in the reactivity of cord blood cells between children of allergic and healthy mothers.

UV-induced changes in cell cycle and gene expression within rabbit lens epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Sidjanin, D. [Northern Illinois Univ., De Kalb, IL (United States). Dept. of Biological Sciences; Grdina, D. [Argonne National Lab., IL (United States); Woloschak, G.E. [Northern Illinois Univ., De Kalb, IL (United States). Dept. of Biological Sciences

1994-11-01

Damage to lens epithelial cells is a probable initiation process in cataract formation induced by ultraviolet radiation. These experiments investigated the ability of 254 nm radiation on cell cycle progression and gene expression in rabbit lens epithelial cell line N/N1003A. No changes in expression of c-fos, c-jun, alpha- tubulin, or vimentin was observed following UV exposure. Using flow cytometry, an accumulation of cells in G1/S phase of the cell cycle 1 hr following exposure. The observed changes in gene expression, especially the decreased histone transcripts reported here may play a role in UV induced inhibition of cell cycle progression.

Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

Directory of Open Access Journals (Sweden)

Libermann Towia

2008-05-01

Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

Murine cell glycolipids customization by modular expression of glycosyltransferases.

Science.gov (United States)

Cid, Emili; Yamamoto, Miyako; Buschbeck, Marcus; Yamamoto, Fumiichiro

2013-01-01

Functional analysis of glycolipids has been hampered by their complex nature and combinatorial expression in cells and tissues. We report an efficient and easy method to generate cells with specific glycolipids. In our proof of principle experiments we have demonstrated the customized expression of two relevant glycosphingolipids on murine fibroblasts, stage-specific embryonic antigen 3 (SSEA-3), a marker for stem cells, and Forssman glycolipid, a xenoantigen. Sets of genes encoding glycosyltansferases were transduced by viral infection followed by multi-color cell sorting based on coupled expression of fluorescent proteins.

Expression of uncoupling protein 1 in bovine muscle cells.

Science.gov (United States)

Abd Eldaim, M A; Hashimoto, O; Ohtsuki, H; Yamada, T; Murakami, M; Onda, K; Sato, R; Kanamori, Y; Qiao, Y; Tomonaga, S; Matsui, T; Funaba, M

2016-12-01

Uncoupling protein 1 (Ucp1) is predominantly expressed in brown/beige adipocytes in mammals. Although myogenic cells have been suggested to commit to a brown adipocyte lineage through the induction of Prdm16 expression, Prdm16 is also expressed in skeletal muscle. Thus, we examined expression of Ucp1 in bovine myogenic cells. Considering that Ucp1 is a principle molecule that induces energy expenditure in brown/beige adipocytes, expression of Ucp1 is not preferable in beef cattle because of potential decrease in energy (fattening) efficiency. The RT-PCR analyses revealed the expression of Ucp1 in the skeletal muscle of cattle; expression levels were markedly lower than those in the brown fat of calves. Immunohistochemical analyses showed that Ucp1 surrounded muscle fibers, but not adipocytes residing in skeletal muscle. Myosatellite cells cultured in myogenic medium showed an increase in the expression levels of myogenic regulatory factors ( levels were greater in cells after myogenic culture for 12 d than in those after myogenic culture for 6 d ( bovine skeletal muscle, which suggests the necessity for further studies on Ucp1-mediated energy expenditure in bovine skeletal muscle.

T-Cadherin Expression in Melanoma Cells Stimulates Stromal Cell Recruitment and Invasion by Regulating the Expression of Chemokines, Integrins and Adhesion Molecules

International Nuclear Information System (INIS)

Rubina, Kseniya A.; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I.; Poliakov, Alexei A.; Treshalina, Helena M.; Tkachuk, Vsevolod A.

2015-01-01

T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells

T-Cadherin Expression in Melanoma Cells Stimulates Stromal Cell Recruitment and Invasion by Regulating the Expression of Chemokines, Integrins and Adhesion Molecules

Energy Technology Data Exchange (ETDEWEB)

Rubina, Kseniya A., E-mail: rkseniya@mail.ru; Surkova, Ekaterina I.; Semina, Ekaterina V.; Sysoeva, Veronika Y.; Kalinina, Natalia I. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation); Poliakov, Alexei A. [Division of Developmental Neurobiology, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA (United Kingdom); Treshalina, Helena M. [Federal State Budgetary Scietific Institution «N.N. Blokhin Russian Cancer Research Center» (FSBSI “N.N.Blokhin RCRC”), Kashirskoe Shosse 24, Moscow 115478 (Russian Federation); Tkachuk, Vsevolod A. [Department of Biochemistry and Molecular Medicine, Faculty of Medicine, M.V. Lomonosov Moscow State University, Lomonosovsky av., 31/5, Moscow 119192 (Russian Federation)

2015-07-21

T-cadherin is a glycosyl-phosphatidylinositol (GPI) anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate that T-cadherin overexpression leads to the increase in the expression of anti-angiogenic molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.

Analysis of allelic expression patterns in clonal somatic cells by single-cell RNA-seq.

Science.gov (United States)

Reinius, Björn; Mold, Jeff E; Ramsköld, Daniel; Deng, Qiaolin; Johnsson, Per; Michaëlsson, Jakob; Frisén, Jonas; Sandberg, Rickard

2016-11-01

Cellular heterogeneity can emerge from the expression of only one parental allele. However, it has remained controversial whether, or to what degree, random monoallelic expression of autosomal genes (aRME) is mitotically inherited (clonal) or stochastic (dynamic) in somatic cells, particularly in vivo. Here we used allele-sensitive single-cell RNA-seq on clonal primary mouse fibroblasts and freshly isolated human CD8 + T cells to dissect clonal and dynamic monoallelic expression patterns. Dynamic aRME affected a considerable portion of the cells' transcriptomes, with levels dependent on the cells' transcriptional activity. Notably, clonal aRME was detected, but it was surprisingly scarce (aRME occurs transiently within individual cells, and patterns of aRME are thus primarily scattered throughout somatic cell populations rather than, as previously hypothesized, confined to patches of clonally related cells.

High expression of markers of apoptosis in Langerhans cell histiocytosis

DEFF Research Database (Denmark)

Petersen, Bodil Laub; Lundegaard, Pia Rengtved; Bank, M I

2003-01-01

53 and the number of cells in apoptosis detected with TUNEL. Langerhans cell histiocytosis cells showed strong expression of p53 and in some cases co-expression of Fas and Fas-L. The expression of Fas-L was significantly higher in infiltrates from patients with single-system disease. The actual...... number of pathological Langerhans cells in apoptosis as estimated by TUNEL was low. CONCLUSIONS: The low number of TUNEL-reactive cells can be explained by the rapid turnover of apoptotic cells in the tissue, not leaving the apoptotic cells long enough in the tissue to be detected. The co......-expression of Fas and Fas-L in some Langerhans cells can lead to an autocrine apoptotic shortcut, mediating the death of the double-positive cells. Our findings suggest that apoptosis mediated through the Fas/Fas-L pathway may contribute to the spontaneous regression of lesions in single-system disease. A delicate...

SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients

International Nuclear Information System (INIS)

Su, Z; Li, Z; Mamalui, M

2016-01-01

Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative

SU-F-T-564: 3 Year Experience of Treatment Plan QualityAssurance for Vero SBRT Patients

Energy Technology Data Exchange (ETDEWEB)

Su, Z; Li, Z [University of Florida, Jacksonville, FL (United States); Mamalui, M [University of Florida/Radiation Oncology, Jacksonville, FL (United States)

2016-06-15

Purpose: To verify treatment plan monitor units from iPlan treatment planning system for Vero Stereotactic Body Radiotherapy (SBRT) treatment using both software-based and (homogeneous and heterogeneous) phantom-based approaches. Methods: Dynamic conformal arcs (DCA) were used for SBRT treatment of oligometastasis patients using Vero linear accelerator. For each plan, Monte Carlo calculated treatment plans MU (prescribed dose to water with 1% variance) is verified first by RadCalc software with 3% difference threshold. Beyond 3% differences, treatment plans were copied onto (homogeneous) Scanditronix phantom for non-lung patients and copied onto (heterogeneous) CIRS phantom for lung patients and the corresponding plan dose was measured using a cc01 ion chamber. The difference between the planed and measured dose was recorded. For the past 3 years, we have treated 180 patients with 315 targets. Out of these patients, 99 targets treatment plan RadCalc calculation exceeded 3% threshold and phantom based measurements were performed with 26 plans using Scanditronix phantom and 73 plans using CIRS phantom. Mean and standard deviation of the dose differences were obtained and presented. Results: For all patient RadCalc calculations, the mean dose difference is 0.76% with a standard deviation of 5.97%. For non-lung patient plan Scanditronix phantom measurements, the mean dose difference is 0.54% with standard deviation of 2.53%; for lung patient plan CIRS phantom measurements, the mean dose difference is −0.04% with a standard deviation of 1.09%; The maximum dose difference is 3.47% for Scanditronix phantom measurements and 3.08% for CIRS phantom measurements. Conclusion: Limitations in secondary MU check software lead to perceived large dose discrepancies for some of the lung patient SBRT treatment plans. Homogeneous and heterogeneous phantoms were used in plan quality assurance for non-lung patients and lung patients, respectively. Phantom based QA showed the relative

Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

Energy Technology Data Exchange (ETDEWEB)

Sontag, Ryan L.; Weber, Thomas J.

2012-05-04

In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediated toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.

Freedom of expression: cell-type-specific gene profiling.

Science.gov (United States)

Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

2014-01-01

Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.

Docosahexaenoic acid inhibits IL-6 expression via PPARγ-mediated expression of catalase in cerulein-stimulated pancreatic acinar cells.

Science.gov (United States)

Song, Eun Ah; Lim, Joo Weon; Kim, Hyeyoung

2017-07-01

Cerulein pancreatitis mirrors human acute pancreatitis. In pancreatic acinar cells exposed to cerulein, reactive oxygen species (ROS) mediate inflammatory signaling by Janus kinase (JAK) 2/signal transducer and activator of transcription (STAT) 3, and cytokine induction. Docosahexaenoic acid (DHA) acts as an agonist of peroxisome proliferator activated receptor γ (PPARγ), which mediates the expression of some antioxidant enzymes. We hypothesized that DHA may induce PPARγ-target catalase expression and reduce ROS levels, leading to the inhibition of JAK2/STAT3 activation and IL-6 expression in cerulein-stimulated acinar cells. Pancreatic acinar AR42J cells were treated with DHA in the presence or absence of the PPARγ antagonist GW9662, or treated with the PPARγ agonist troglitazone, and then stimulated with cerulein. Expression of IL-6 and catalase, ROS levels, JAK2/STAT3 activation, and nuclear translocation of PPARγ were assessed. DHA suppressed the increase in ROS, JAK2/STAT3 activation, and IL-6 expression induced nuclear translocation of PPARγ and catalase expression in cerulein-stimulated AR42J cells. Troglitazone inhibited the cerulein-induced increase in ROS and IL-6 expression, but induced catalase expression similar to DHA in AR42J cells. GW9662 abolished the inhibitory effect of DHA on cerulein-induced increase in ROS and IL-6 expression in AR42J cells. DHA-induced expression of catalase was suppressed by GW9662 in cerulein-stimulated AR42J cells. Thus, DHA induces PPARγ activation and catalase expression, which inhibits ROS-mediated activation of JAK2/STAT3 and IL-6 expression in cerulein-stimulated pancreatic acinar cells. Copyright © 2017. Published by Elsevier Ltd.

Cell adhesion signaling regulates RANK expression in osteoclast precursors.

Directory of Open Access Journals (Sweden)

Ayako Mochizuki

Full Text Available Cells with monocyte/macrophage lineage expressing receptor activator of NF-κB (RANK differentiate into osteoclasts following stimulation with the RANK ligand (RANKL. Cell adhesion signaling is also required for osteoclast differentiation from precursors. However, details of the mechanism by which cell adhesion signals induce osteoclast differentiation have not been fully elucidated. To investigate the participation of cell adhesion signaling in osteoclast differentiation, mouse bone marrow-derived macrophages (BMMs were used as osteoclast precursors, and cultured on either plastic cell culture dishes (adherent condition or the top surface of semisolid methylcellulose gel loaded in culture tubes (non-adherent condition. BMMs cultured under the adherent condition differentiated into osteoclasts in response to RANKL stimulation. However, under the non-adherent condition, the efficiency of osteoclast differentiation was markedly reduced even in the presence of RANKL. These BMMs retained macrophage characteristics including phagocytic function and gene expression profile. Lipopolysaccharide (LPS and tumor necrosis factor -αTNF-α activated the NF-κB-mediated signaling pathways under both the adherent and non-adherent conditions, while RANKL activated the pathways only under the adherent condition. BMMs highly expressed RANK mRNA and protein under the adherent condition as compared to the non-adherent condition. Also, BMMs transferred from the adherent to non-adherent condition showed downregulated RANK expression within 24 hours. In contrast, transferring those from the non-adherent to adherent condition significantly increased the level of RANK expression. Moreover, interruption of cell adhesion signaling by echistatin, an RGD-containing disintegrin, decreased RANK expression in BMMs, while forced expression of either RANK or TNFR-associated factor 6 (TRAF6 in BMMs induced their differentiation into osteoclasts even under the non

'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

International Nuclear Information System (INIS)

Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw

2005-01-01

The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals

Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.

Science.gov (United States)

D'Amour, Kevin A; Bang, Anne G; Eliazer, Susan; Kelly, Olivia G; Agulnick, Alan D; Smart, Nora G; Moorman, Mark A; Kroon, Evert; Carpenter, Melissa K; Baetge, Emmanuel E

2006-11-01

Of paramount importance for the development of cell therapies to treat diabetes is the production of sufficient numbers of pancreatic endocrine cells that function similarly to primary islets. We have developed a differentiation process that converts human embryonic stem (hES) cells to endocrine cells capable of synthesizing the pancreatic hormones insulin, glucagon, somatostatin, pancreatic polypeptide and ghrelin. This process mimics in vivo pancreatic organogenesis by directing cells through stages resembling definitive endoderm, gut-tube endoderm, pancreatic endoderm and endocrine precursor--en route to cells that express endocrine hormones. The hES cell-derived insulin-expressing cells have an insulin content approaching that of adult islets. Similar to fetal beta-cells, they release C-peptide in response to multiple secretory stimuli, but only minimally to glucose. Production of these hES cell-derived endocrine cells may represent a critical step in the development of a renewable source of cells for diabetes cell therapy.

Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

Energy Technology Data Exchange (ETDEWEB)

Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

2011-02-10

The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable

T-Cadherin Expression in Melanoma Cells Stimulates Stromal Cell Recruitment and Invasion by Regulating the Expression of Chemokines, Integrins and Adhesion Molecules

Directory of Open Access Journals (Sweden)

Kseniya A. Rubina

2015-07-01

Full Text Available T-cadherin is a glycosyl-phosphatidylinositol (GPI anchored member of the cadherin superfamily involved in the guidance of migrating cells. We have previously shown that in vivo T-cadherin overexpression leads to increased melanoma primary tumor growth due to the recruitment of mesenchymal stromal cells as well as the enhanced metastasis. Since tumor progression is highly dependent upon cell migration and invasion, the aim of the present study was to elucidate the mechanisms of T-cadherin participation in these processes. Herein we show that T-cadherin expression results in the increased invasive potential due to the upregulated expression of pro-oncogenic integrins, chemokines, adhesion molecules and extracellular matrix components. The detected increase in chemokine expression could be responsible for the stromal cell recruitment. At the same time our previous data demonstrated that T-cadherin expression inhibited neoangiogenesis in the primary tumors. We demonstrate molecules and reduction in pro-angiogenic factors. Thus, T-cadherin plays a dual role in melanoma growth and progression: T-cadherin expression results in anti-angiogenic effects in melanoma, however, this also stimulates transcription of genes responsible for migration and invasion of melanoma cells.

Src Induces Podoplanin Expression to Promote Cell Migration*

Science.gov (United States)

Shen, Yongquan; Chen, Chen-Shan; Ichikawa, Hitoshi; Goldberg, Gary S.

2010-01-01

Nontransformed cells can force tumor cells to assume a normal morphology and phenotype by the process of contact normalization. Transformed cells must escape this process to become invasive and malignant. However, mechanisms underlying contact normalization have not been elucidated. Here, we have identified genes that are affected by contact normalization of Src-transformed cells. Tumor cells must migrate to become invasive and malignant. Src must phosphorylate the adaptor protein Cas (Crk-associated substrate) to promote tumor cell motility. We report here that Src utilizes Cas to induce podoplanin (Pdpn) expression to promote tumor cell migration. Pdpn is a membrane-bound extracellular glycoprotein that associates with endogenous ligands to promote tumor cell migration leading to cancer invasion and metastasis. In fact, Pdpn expression accounted for a major part of the increased migration seen in Src-transformed cells. Moreover, nontransformed cells suppressed Pdpn expression in adjacent Src-transformed cells. Of >39,000 genes, Pdpn was one of only 23 genes found to be induced by transforming Src activity and suppressed by contact normalization of Src-transformed cells. In addition, we found 16 genes suppressed by Src and induced by contact normalization. These genes encode growth factor receptors, adaptor proteins, and products that have not yet been annotated and may play important roles in tumor cell growth and migration. PMID:20123990

Expression of GABAergic receptors in mouse taste receptor cells.

Directory of Open Access Journals (Sweden)

Margaret R Starostik

Full Text Available BACKGROUND: Multiple excitatory neurotransmitters have been identified in the mammalian taste transduction, with few studies focused on inhibitory neurotransmitters. Since the synthetic enzyme glutamate decarboxylase (GAD for gamma-aminobutyric acid (GABA is expressed in a subset of mouse taste cells, we hypothesized that other components of the GABA signaling pathway are likely expressed in this system. GABA signaling is initiated by the activation of either ionotropic receptors (GABA(A and GABA(C or metabotropic receptors (GABA(B while it is terminated by the re-uptake of GABA through transporters (GATs. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcriptase-PCR (RT-PCR analysis, we investigated the expression of different GABA signaling molecules in the mouse taste system. Taste receptor cells (TRCs in the circumvallate papillae express multiple subunits of the GABA(A and GABA(B receptors as well as multiple GATs. Immunocytochemical analyses examined the distribution of the GABA machinery in the circumvallate papillae. Both GABA(A-and GABA(B- immunoreactivity were detected in the peripheral taste receptor cells. We also used transgenic mice that express green fluorescent protein (GFP in either the Type II taste cells, which can respond to bitter, sweet or umami taste stimuli, or in the Type III GAD67 expressing taste cells. Thus, we were able to identify that GABAergic receptors are expressed in some Type II and Type III taste cells. Mouse GAT4 labeling was concentrated in the cells surrounding the taste buds with a few positively labeled TRCs at the margins of the taste buds. CONCLUSIONS/SIGNIFICANCE: The presence of GABAergic receptors localized on Type II and Type III taste cells suggests that GABA is likely modulating evoked taste responses in the mouse taste bud.

Lineage relationship of prostate cancer cell types based on gene expression

Directory of Open Access Journals (Sweden)

Ware Carol B

2011-05-01

Full Text Available Abstract Background Prostate tumor heterogeneity is a major factor in disease management. Heterogeneity could be due to multiple cancer cell types with distinct gene expression. Of clinical importance is the so-called cancer stem cell type. Cell type-specific transcriptomes are used to examine lineage relationship among cancer cell types and their expression similarity to normal cell types including stem/progenitor cells. Methods Transcriptomes were determined by Affymetrix DNA array analysis for the following cell types. Putative prostate progenitor cell populations were characterized and isolated by expression of the membrane transporter ABCG2. Stem cells were represented by embryonic stem and embryonal carcinoma cells. The cancer cell types were Gleason pattern 3 (glandular histomorphology and pattern 4 (aglandular sorted from primary tumors, cultured prostate cancer cell lines originally established from metastatic lesions, xenografts LuCaP 35 (adenocarcinoma phenotype and LuCaP 49 (neuroendocrine/small cell carcinoma grown in mice. No detectable gene expression differences were detected among serial passages of the LuCaP xenografts. Results Based on transcriptomes, the different cancer cell types could be clustered into a luminal-like grouping and a non-luminal-like (also not basal-like grouping. The non-luminal-like types showed expression more similar to that of stem/progenitor cells than the luminal-like types. However, none showed expression of stem cell genes known to maintain stemness. Conclusions Non-luminal-like types are all representatives of aggressive disease, and this could be attributed to the similarity in overall gene expression to stem and progenitor cell types.

Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance

Science.gov (United States)

Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen

2015-01-01

The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

Reduced Ang2 expression in aging endothelial cells

International Nuclear Information System (INIS)

Hohensinner, P.J.; Ebenbauer, B.; Kaun, C.; Maurer, G.; Huber, K.; Wojta, J.

2016-01-01

Aging endothelial cells are characterized by increased cell size, reduced telomere length and increased expression of proinflammatory cytokines. In addition, we describe here that aging reduces the migratory distance of endothelial cells. Furthermore, we observe an increase of the quiescence protein Ang1 and a decrease of the endothelial activation protein Ang2 upon aging. Supplementing Ang2 to aged endothelial cells restored their migratory capacity. We conclude that aging shifts the balance of the Ang1/Ang2 network favouring a quiescent state. Activation of endothelial cells in aging might be necessary to enhance wound healing capacities. -- Highlights: •Endothelial cells display signs of aging before reaching proliferative senescence. •Aging endothelial cells express more angiopoietin 1 and less angiopoietin 2 than young endothelial cells. •Migratory capacity is reduced in aging endothelial cells.

Reduced Ang2 expression in aging endothelial cells

Energy Technology Data Exchange (ETDEWEB)

Hohensinner, P.J., E-mail: philipp.hohensinner@meduniwien.ac.at [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ebenbauer, B. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); Kaun, C.; Maurer, G. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Huber, K. [Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); 3rd Medical Department, Wilhelminenhospital, Vienna (Austria); Sigmund Freud University, Medical Faculty, Vienna (Austria); Wojta, J. [Department of Internal Medicine II, Medical University of Vienna, Vienna (Austria); Ludwig Boltzmann Cluster for Cardiovascular Research, Vienna (Austria); Core Facilities, Medical University of Vienna, Vienna (Austria)

2016-06-03

Aging endothelial cells are characterized by increased cell size, reduced telomere length and increased expression of proinflammatory cytokines. In addition, we describe here that aging reduces the migratory distance of endothelial cells. Furthermore, we observe an increase of the quiescence protein Ang1 and a decrease of the endothelial activation protein Ang2 upon aging. Supplementing Ang2 to aged endothelial cells restored their migratory capacity. We conclude that aging shifts the balance of the Ang1/Ang2 network favouring a quiescent state. Activation of endothelial cells in aging might be necessary to enhance wound healing capacities. -- Highlights: •Endothelial cells display signs of aging before reaching proliferative senescence. •Aging endothelial cells express more angiopoietin 1 and less angiopoietin 2 than young endothelial cells. •Migratory capacity is reduced in aging endothelial cells.

Increasing RpoS expression causes cell death in Borrelia burgdorferi.

Directory of Open Access Journals (Sweden)

Linxu Chen

Full Text Available RpoS, one of the two alternative σ factors in Borrelia burgdorferi, is tightly controlled by multiple regulators and, in turn, determines expression of many critical virulence factors. Here we show that increasing RpoS expression causes cell death. The immediate effect of increasing RpoS expression was to promote bacterial division and as a consequence result in a rapid increase in cell number before causing bacterial death. No DNA fragmentation or degradation was observed during this induced cell death. Cryo-electron microscopy showed induced cells first formed blebs, which were eventually released from dying cells. Apparently blebbing initiated cell disintegration leading to cell death. These findings led us to hypothesize that increasing RpoS expression triggers intracellular programs and/or pathways that cause spirochete death. The potential biological significance of induced cell death may help B. burgdorferi regulate its population to maintain its life cycle in nature.

Differential Effect of Medium on the Ratio of ICM/TE of Bovine Embryos in a Co-culture System

Directory of Open Access Journals (Sweden)

Mohsen Forouzanfar

2010-01-01

Full Text Available Background: This study was undertaken to investigate the efficiency of two differentembryo somatic cell co-culture conditions, tissue culture medium 199 (TCM199–vero cellsand Menezo B2 (B2-vero cells, for the in vitro developmental quantity and quality of bovineembryos.Materials and Methods: Bovine oocytes were allowed to mature and subsequently undergofertilization in vitro. Their presumptive zygotes were cultured in either TCM199 or B2 culturemedia in conjunction with vero cells for up to nine days. The culture media were refreshedevery two days and the proportion of embryos that cleaved and further developed to themorula and blastocyst (early, expand and hatched stages were recorded. Hatched blastocystsunderwent differential staining in order to determine the numbers of inner cell mass (ICMand tropho ectoderm (TE and total cell number (TCN.Results: Of the two groups, no significant difference was seen between the proportions ofthe presumptive zygotes cleaved, those which developed to 8-16 cells, morula and reacheddays 7or 8 blastocyst stage or hatched. However, the values for TCN and TE of the TCM199-vero embryos were significantly greater than those of B2-vero embryos. The values for ICM/TCN and ICM/TE were significantly greater in the B2-vero group versus the TCM199-verogroup.Conclusion: Both TCM199 and B2 culture media in conjunction with vero cells were ofthe same efficiency when used for in vitro development of bovine presumptive zygotes.However, TCM199 was superior in providing embryos with more embryo cell numbers,whereas B2 medium was superior in providing embryos with greater ICM/TE and ICM/TCN ratios.

Chemokine receptor expression by inflammatory T cells in EAE

DEFF Research Database (Denmark)

Mony, Jyothi Thyagabhavan; Khorooshi, Reza; Owens, Trevor

2014-01-01

Chemokines direct cellular infiltration to tissues, and their receptors and signaling pathways represent targets for therapy in diseases such as multiple sclerosis (MS). The chemokine CCL20 is expressed in choroid plexus, a site of entry of T cells to the central nervous system (CNS). The CCL20...... receptor CCR6 has been reported to be selectively expressed by CD4(+) T cells that produce the cytokine IL-17 (Th17 cells). Th17 cells and interferon-gamma (IFNγ)-producing Th1 cells are implicated in induction of MS and its animal model experimental autoimmune encephalomyelitis (EAE). We have assessed...... whether CCR6 identifies specific inflammatory T cell subsets in EAE. Our approach was to induce EAE, and then examine chemokine receptor expression by cytokine-producing T cells sorted from CNS at peak disease. About 7% of CNS-infiltrating CD4(+) T cells produced IFNγ in flow cytometric cytokine assays...

Dissecting stem cell differentiation using single cell expression profiling

OpenAIRE

Moignard, Victoria Rachel; Göttgens, Berthold

2016-01-01

Many assumptions about the way cells behave are based on analyses of populations. However, it is now widely recognized that even apparently pure populations can display a remarkable level of heterogeneity. This is particularly true in stem cell biology where it hinders our understanding of normal development and the development of strategies for regenerative medicine. Over the past decade technologies facilitating gene expression analysis at the single cell level have become widespread, provi...

Functional Expression of Programmed Death-Ligand 1 (B7-H1 by Immune Cells and Tumor Cells

Directory of Open Access Journals (Sweden)

Rachel M. Gibbons Johnson

2017-08-01

Full Text Available The programmed death-1 (PD-1 and its ligand PD-L1 (B7-H1 signaling pathway has been the focus of much enthusiasm in the fields of tumor immunology and oncology with recent FDA approval of the anti-PD-1 antibodies pembrolizumab and nivolumab and the anti-PD-L1 antibodies durvalumab, atezolimuab, and avelumab. These therapies, referred to here as PD-L1/PD-1 checkpoint blockade therapies, are designed to block the interaction between PD-L1, expressed by tumor cells, and PD-1, expressed by tumor-infiltrating CD8+ T cells, leading to enhanced antitumor CD8+ T cell responses and tumor regression. The influence of PD-L1 expressed by tumor cells on antitumor CD8+ T cell responses is well characterized, but the impact of PD-L1 expressed by immune cells has not been well defined for antitumor CD8+ T cell responses. Although PD-L1 expression by tumor cells has been used as a biomarker in selection of patients for PD-L1/PD-1 checkpoint blockade therapies, patients whose tumor cells lack PD-L1 expression often respond positively to PD-L1/PD-1 checkpoint blockade therapies. This suggests that PD-L1 expressed by non-malignant cells may also contribute to antitumor immunity. Here, we review the functions of PD-L1 expressed by immune cells in the context of CD8+ T cell priming, contraction, and differentiation into memory populations, as well as the role of PD-L1 expressed by tumor cells in regulating antitumor CD8+ T cell responses.

Expression of Cat Podoplanin in Feline Squamous Cell Carcinomas.

Science.gov (United States)

Itai, Shunsuke; Yamada, Shinji; Kaneko, Mika K; Harada, Hiroyuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2017-12-01

Oral squamous cell carcinoma is an aggressive tumor in cats; however, molecular-targeted therapies against this tumor, including antibody therapy, have not been developed. Sensitive and specific monoclonal antibodies (mAbs) against highly expressed membrane proteins are needed to develop antibody therapies. Podoplanin, a type I transmembrane glycoprotein, is expressed in many human malignant tumors, including brain tumor, esophageal cancer, lung cancer, mesothelioma, and oral cancer. Podoplanin binds to C-type lectin-like receptor-2 (CLEC-2) and activates platelet aggregation, which is involved in cancer metastasis. Until now, we have established several mAbs against podoplanin in humans, mice, rats, rabbits, dogs, cattle, and cats. We have reported podoplanin expression in canine melanoma and squamous cell carcinomas using an anti-dog podoplanin mAb PMab-38. In this study, we investigated podoplanin expression in 40 feline squamous cell carcinomas (14 cases of mouth floor, 13 of skin, 9 of ear, and 4 of tongue) by immunohistochemical analysis using an anti-cat podoplanin mAb PMab-52, which we recently developed by cell-based immunization and screening (CBIS) method. Of the total 40 cases, 38 (95%) showed positive staining for PMab-52. In particular, 12 cases (30%) showed a strong membrane-staining pattern of squamous cell carcinoma cells. PMab-52 can be useful for antibody therapy against feline podoplanin-expressing squamous cell carcinomas.

Transitional cell carcinoma express vitamin D receptors

DEFF Research Database (Denmark)

Hermann, G G; Andersen, C B

1997-01-01

Recently, vitamin D analogues have shown antineoplastic effect in several diseases. Vitamin D analogues exert its effect by interacting with the vitamin D receptor (VDR). Studies of VDR in transitional cell carcinoma (TCC) have not been reported. The purpose of the present study was therefore.......05). Similarly, also tumor grade appeared to be related to the number of cells expressing the receptor. Normal urothlium also expressed VDR but only with low intensity. Our study shows that TCC cells possess the VDR receptor which may make them capable to respond to stimulation with vitamin D, but functional...... studies of vitamin D's effect on TCC cells in vitro are necessary before the efficacy of treatment with vitamin D analogues in TCC can be evaluated in patients....

CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53

International Nuclear Information System (INIS)

Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu

2017-01-01

Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.

Microarray gene expression profiling and analysis in renal cell carcinoma

Directory of Open Access Journals (Sweden)

Sadhukhan Provash

2004-06-01

Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

Engineering of red cells of Arabidopsis thaliana and comparative genome-wide gene expression analysis of red cells versus wild-type cells.

Science.gov (United States)

Shi, Ming-Zhu; Xie, De-Yu

2011-04-01

We report metabolic engineering of Arabidopsis red cells and genome-wide gene expression analysis associated with anthocyanin biosynthesis and other metabolic pathways between red cells and wild-type (WT) cells. Red cells of A. thaliana were engineered for the first time from the leaves of production of anthocyanin pigment 1-Dominant (pap1-D). These red cells produced seven anthocyanin molecules including a new one that was characterized by LC-MS analysis. Wild-type cells established as a control did not produce anthocyanins. A genome-wide microarray analysis revealed that nearly 66 and 65% of genes in the genome were expressed in the red cells and wild-type cells, respectively. In comparison with the WT cells, 3.2% of expressed genes in the red cells were differentially expressed. The expression levels of 14 genes involved in the biosynthetic pathway of anthocyanin were significantly higher in the red cells than in the WT cells. Microarray and RT-PCR analyses demonstrated that the TTG1-GL3/TT8-PAP1 complex regulated the biosynthesis of anthocyanins. Furthermore, most of the genes with significant differential expression levels in the red cells versus the WT cells were characterized with diverse biochemical functions, many of which were mapped to different metabolic pathways (e.g., ribosomal protein biosynthesis, photosynthesis, glycolysis, glyoxylate metabolism, and plant secondary metabolisms) or organelles (e.g., chloroplast). We suggest that the difference in gene expression profiles between the two cell lines likely results from cell types, the overexpression of PAP1, and the high metabolic flux toward anthocyanins.

General outbreaks of vero cytotoxin producing Escherichia coli O157 in England and Wales from 1992 to 1994.

LENUS (Irish Health Repository)

Wall, P G

1996-02-02

We have reviewed all general outbreaks of infection due to Vero cytotoxin producing Escherichia coli (VTEC) O157 reported in England and Wales from 1992 to 1994. One hundred and seventy-three people were affected in 18 outbreaks, compared with 76 people in seven outbreaks in the preceding three years (1989 to 1991). Outbreaks occurred throughout England and Wales. Thirty-eight per cent of cases were admitted to hospital, 21% developed haemolytic uraemic syndrome, and 3% died. VTEC O157 infection causes particular concern because of its serious complications--haemorrhagic colitis and haemolytic uraemic syndrome, its capacity to spread from person to person as well as by food and water, and its reservoir in dairy and beef cattle.

Comparative analysis of different cell systems for Zika virus (ZIKV) propagation and evaluation of anti-ZIKV compounds in vitro.

Science.gov (United States)

Vicenti, Ilaria; Boccuto, Adele; Giannini, Alessia; Dragoni, Filippo; Saladini, Francesco; Zazzi, Maurizio

2018-01-15

A strong correlation between Zika virus (ZIKV) infection and severe neurological disease in newborns and occasionally adults has emerged in the Brazilian outbreak. Efficient human cell-based assays are required to test candidate inhibitors of ZIKV replication. The aim of this work was to investigate ZIKV propagation and quantification in different cell lines. The human (U87, A549, Huh7), mosquito (C6/36) and monkey (VERO E6) cell lines tested were all permissive to ZIKV infection. When assessed by plaque forming units (PFU) in three different target cell lines, the maximal production of ZIKV was achieved in Huh7 at day 3 post-infection (6.38±0.44 log 10 PFU/ml). The C6/36 cell line showed a low and slow production of virus when compared with other cell lines. A549 readout cells generated a larger number of plaques compared to Huh7 but not to VERO E6 cells. ZIKV PFU and RNA titers showed the highest correlation when Huh7 and A549 were used as the producer and readout cells, respectively. Also, U87 cells produced ZIKV RNA titers which were highly correlated with PFU independently from the readout cell line. Using the best virus-cell system, sofosbuvir and ribavirin EC 50 were 1.2μM and 1.1μM when measured through plaque assay, and 4.2μM and 5.2μM when measured by quantitative real time PCR (qRT-PCR), respectively. In summary, ZIKV can efficiently infect different human cell lines and rapidly reach peak viral titers. Overall, A549 cells appear to be as efficient as the VERO E6 gold standard for plaque assay allowing the use of human, rather than simian, cells for evaluating candidate anti-ZIKV compounds by the reference assay. The possibility to replace the labor-intensive plaque assay with the more rapid and easy-to-perform qRT-PCR is appealing and warrants further investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

Induced ICER Iγ down-regulates cyclin A expression and cell proliferation in insulin-producing β cells

International Nuclear Information System (INIS)

Inada, Akari; Weir, Gordon C.; Bonner-Weir, Susan

2005-01-01

We have previously found that cyclin A expression is markedly reduced in pancreatic β-cells by cell-specific overexpression of repressor inducible cyclic AMP early repressor (ICER Iγ) in transgenic mice. Here we further examined regulatory effects of ICER Iγ on cyclin A gene expression using Min6 cells, an insulin-producing cell line. The cyclin A promoter luciferase assay showed that ICER Iγ directly repressed cyclin A gene transcription. In addition, upon ICER Iγ overexpression, cyclin A mRNA levels markedly decreased, thereby confirming an inhibitory effect of ICER Iγ on cyclin A expression. Suppression of cyclin A results in inhibition of BrdU incorporation. Under normal culture conditions endogenous cyclin A is abundant in these cells, whereas ICER is hardly detectable. However, serum starvation of Min6 cells induces ICER Iγ expression with a concomitant very low expression level of cyclin A. Cyclin A protein is not expressed unless the cells are in active DNA replication. These results indicate a potentially important anti-proliferative effect of ICER Iγ in pancreatic β cells. Since ICER Iγ is greatly increased in diabetes as well as in FFA- or high glucose-treated islets, this effect may in part exacerbate diabetes by limiting β-cell proliferation

Differential expression of c-Met between primary and metastatic sites in clear-cell renal cell carcinoma and its association with PD-L1 expression.

Science.gov (United States)

Lalani, Aly-Khan A; Gray, Kathryn P; Albiges, Laurence; Callea, Marcella; Pignon, Jean-Christophe; Pal, Soumitro; Gupta, Mamta; Bhatt, Rupal S; McDermott, David F; Atkins, Michael B; Woude, G F Vande; Harshman, Lauren C; Choueiri, Toni K; Signoretti, Sabina

2017-11-28

In preclinical models, c-Met promotes survival of renal cancer cells through the regulation of programmed death-ligand 1 (PD-L1). However, this relationship in human clear cell renal cell carcinoma (ccRCC) is not well characterized. We evaluated c-Met expression in ccRCC patients using paired primary and metastatic samples and assessed the association with PD-L1 expression and other clinical features. Areas with predominant and highest Fuhrman nuclear grade (FNG) were selected. c-Met expression was evaluated by IHC using an anti-Met monoclonal antibody (MET4 Ab) and calculated by a combined score (CS, 0-300): intensity of c-Met staining (0-3) x % of positive cells (0-100). PD-L1 expression in tumor cells was previously assessed by IHC and PD-L1+ was defined as PD-L1 > 0% positive cells. Our cohort consisted of 45 pairs of primary and metastatic ccRCC samples. Overall, c-Met expression was higher in metastatic sites compared to primary sites (average c-Met CS: 55 vs. 28, p = 0.0003). Higher c-Met expression was associated with higher FNG (4 vs. 3) in primary tumors (average c-Met CS: 52 vs. 20, p = 0.04). c-Met expression was numerically greater in PD-L1+ vs. PD-L1- tumors. Higher c-Met expression in metastatic sites compared to primary tumors suggests that testing for biomarkers of response to c-Met inhibitors should be conducted in metastases. While higher c-Met expression in PD-L1+ tumors requires further investigation, it supports exploring these targets in combination clinical trials.

Defining the expression of marker genes in equine mesenchymal stromal cells

Directory of Open Access Journals (Sweden)

Deborah J Guest

2008-11-01

Full Text Available Deborah J Guest1, Jennifer C Ousey1, Matthew RW Smith21Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU; 2Reynolds House Referrals, Greenwood Ellis and Partners, 166 High Street, Newmarket, Suffolk, CB8 9WS, UKAbstract: Mesenchymal stromal (MS cells have been derived from multiple sources in the horse including bone marrow, adipose tissue and umbilical cord blood. To date these cells have been investigated for their differentiation potential and are currently being used to treat damage to horse musculoskeletal tissues. However, no work has been done in horse MS cells to examine the expression profile of proteins and cell surface antigens that are expressed in human MS cells. The identification of such profiles in the horse will allow the comparison of putative MS cells isolated from different laboratories and different tissues. At present it is difficult to ascertain whether equivalent cells are being used in different reports. Here, we report on the expression of a range of markers used to define human MS cells. Using immunocytochemistry we show that horse MS cells homogenously express collagens, alkaline phosphatase activity, CD44, CD90 and CD29. In contrast, CD14, CD79α and the embryonic stem cell markers Oct-4, SSEA (stage specific embryonic antigen -1, -3, -4, TRA (tumor rejection antigen -1–60 and -1–81 are not expressed. The MS cells also express MHC class I antigens but do not express class II antigens, although they are inducible by treatment with interferon gamma (IFN-γ.Keywords: mesenchymal stem cells, equine, gene expression

CD40 expression in Wehi-164 cell line

OpenAIRE

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad

2010-01-01

CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body’s defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein ex...

Lower expression of CADM1 and higher expression of MAL in Merkel cell carcinomas are associated with Merkel cell polyomavirus infection and better prognosis.

Science.gov (United States)

Iwasaki, Takeshi; Matsushita, Michiko; Nonaka, Daisuke; Nagata, Keiko; Kato, Masako; Kuwamoto, Satoshi; Murakami, Ichiro; Hayashi, Kazuhiko

2016-02-01

Merkel cell carcinoma (MCC) is a clinically aggressive neuroendocrine skin cancer; 80% of the cases are associated with the Merkel cell polyomavirus (MCPyV). We previously reported that MCPyV-negative MCCs have more irregular nuclei with abundant cytoplasm and significantly unfavorable outcomes than do MCPyV-positive MCCs. These results suggest that some cell adhesion or structural stabilization molecules are differently expressed depending on MCPyV infection status. Thus, we investigated the association of prognosis or MCPyV infection status in MCCs with cell adhesion molecule 1 (CADM1)/differentially expressed in adenocarcinoma of the lung protein 1 (DAL-1)/membrane protein, palmitoylated 3 (MPP3) tripartite complex and mal T-cell differentiation protein (MAL) expression, which play important roles in cell adhesion and oncogenesis and are related to cancer outcomes in various malignancies, to elucidate the role of these molecules. We analyzed the pathological and molecular characteristics of 26 MCPyV-positive and 15 MCPyV-negative MCCs. Univariate Cox regression analysis showed that advanced age (hazard ratio [HR], 8.249; P = .007) and high CADM1 expression (HR, 5.214; P = .012) were significantly unfavorable overall survival parameters, whereas MCPyV infection (HR, 0.043, P Merkel cells expressed DAL-1 and MAL but not CADM1. This study revealed that MCPyV-negative MCCs significantly expressed higher CADM1 and lower MAL than MCPyV-positive MCCs; these expression levels were markedly related to unfavorable outcomes. These data will give us important insights to develop novel molecular target therapies for MCCs. Copyright © 2015 Elsevier Inc. All rights reserved.

Expression pattern of matrix metalloproteinases in human gynecological cancer cell lines

International Nuclear Information System (INIS)

Schröpfer, Andrea; Kammerer, Ulrike; Kapp, Michaela; Dietl, Johannes; Feix, Sonja; Anacker, Jelena

2010-01-01

Matrix metalloproteinases (MMPs) are involved in the degradation of protein components of the extracellular matrix and thus play an important role in tumor invasion and metastasis. Their expression is related to the progression of gynecological cancers (e.g. endometrial, cervical or ovarian carcinoma). In this study we investigated the expression pattern of the 23 MMPs, currently known in humans, in different gynecological cancer cell lines. In total, cell lines from three endometrium carcinomas (Ishikawa, HEC-1-A, AN3 CA), three cervical carcinomas (HeLa, Caski, SiHa), three chorioncarcinomas (JEG, JAR, BeWo), two ovarian cancers (BG-1, OAW-42) and one teratocarcinoma (PA-1) were examined. The expression of MMPs was analyzed by RT-PCR, Western blot and gelatin zymography. We demonstrated that the cell lines examined can constitutively express a wide variety of MMPs on mRNA and protein level. While MMP-2, -11, -14 and -24 were widely expressed, no expression was seen for MMP-12, -16, -20, -25, -26, -27 in any of the cell lines. A broad range of 16 MMPs could be found in the PA1 cells and thus this cell line could be used as a positive control for general MMP experiments. While the three cervical cancer cell lines expressed 10-14 different MMPs, the median expression in endometrial and choriocarcinoma cells was 7 different enzymes. The two investigated ovarian cancer cell lines showed a distinctive difference in the number of expressed MMPs (2 vs. 10). Ishikawa, Caski, OAW-42 and BeWo cell lines could be the best choice for all future experiments on MMP regulation and their role in endometrial, cervical, ovarian or choriocarcinoma development, whereas the teratocarcinoma cell line PA1 could be used as a positive control for general MMP experiments

Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

International Nuclear Information System (INIS)

Gehrau, Ricardo C.; D'Astolfo, Diego S.; Andreoli, Veronica; Bocco, Jose L.; Koritschoner, Nicolas P.

2011-01-01

The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC 50 ). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p 50 concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable marker for the efficiency of cell death upon cancer treatment.

Cell model for the study of receptor and regulatory functions of human proHB-EGF

Directory of Open Access Journals (Sweden)

N. V. Korotkevych

2014-08-01

Full Text Available Developing of new models and approaches, particularly with fluorescent techniques, for investigation of intracellular transport of proHB-EGF and its ligand-receptor complexes is strongly required. In order to create a model for studying proHB-EGF functions the genetic construction pEGFP-N1-proHB-EGF, encoding proHB-EGF-EGFP which is fluorescent-labeled form of proHB-EGF with enhanced green fluorescent protein EGFP in the cytoplasmic terminus of the molecule, was obtained. Eukaryotic cells expressing fusion protein proHB-EGF-EGFP on the cell surface were obtained by transfection with pEGFP-N1-proHB-EGF. Expressed in the Vero cells proHB-EGF-EGFP could bind fluorescent derivative of nontoxic receptor-binding subunit B of diphtheria toxin mCherry-SubB. After stimulation of transfected cells with TPA (12-O-Tetradecanoylphorbol-13-acetate, proHB-EGF-EGFP formed a fluorescentl-labeled C-terminal fragment of the molecule – CTF-EGFP. Thus, the obtained genetic construction pEGFP-N1-proHB-EGF could be helpful in visualization of molecules proHB-EGF and CTF in cells, may open new possibilities for the studying of their functions, such as receptor function of proHB-EGF for diphtheria toxin, intracellular translocation of CTF and provide possibilities for natural proHB-EGF ligands search.

High epitope expression levels increase competition between T cells.

Directory of Open Access Journals (Sweden)

Almut Scherer

2006-08-01

Full Text Available Both theoretical predictions and experimental findings suggest that T cell populations can compete with each other. There is some debate on whether T cells compete for aspecific stimuli, such as access to the surface on antigen-presenting cells (APCs or for specific stimuli, such as their cognate epitope ligand. We have developed an individual-based computer simulation model to study T cell competition. Our model shows that the expression level of foreign epitopes per APC determines whether T cell competition is mainly for specific or aspecific stimuli. Under low epitope expression, competition is mainly for the specific epitope stimuli, and, hence, different epitope-specific T cell populations coexist readily. However, if epitope expression levels are high, aspecific competition becomes more important. Such between-specificity competition can lead to competitive exclusion between different epitope-specific T cell populations. Our model allows us to delineate the circumstances that facilitate coexistence of T cells of different epitope specificity. Understanding mechanisms of T cell coexistence has important practical implications for immune therapies that require a broad immune response.

HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells.

Science.gov (United States)

Gornalusse, Germán G; Hirata, Roli K; Funk, Sarah E; Riolobos, Laura; Lopes, Vanda S; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G; Hanafi, Laïla-Aïcha; Clegg, Dennis O; Turtle, Cameron; Russell, David W

2017-08-01

Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this 'missing-self' response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8 + T cells, do not bind anti-HLA antibodies and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression.

HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells

Science.gov (United States)

Gornalusse, Germán G.; Hirata, Roli K.; Funk, Sarah; Riolobos, Laura; Lopes, Vanda S.; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G.; Hanafi, Laïla-Aïcha; Clegg, Dennis O.; Turtle, Cameron; Russell, David W.

2017-01-01

Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this ‘missing self’ response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8+ T cells, do not bind anti-HLA antibodies, and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression. PMID:28504668

Expression of Pluripotency Markers in Nonpluripotent Human Neural Stem and Progenitor Cells.

Science.gov (United States)

Vincent, Per Henrik; Benedikz, Eirikur; Uhlén, Per; Hovatta, Outi; Sundström, Erik

2017-06-15

Nonpluripotent neural progenitor cells (NPCs) derived from the human fetal central nervous system were found to express a number of messenger RNA (mRNA) species associated with pluripotency, such as NANOG, REX1, and OCT4. The expression was restricted to small subpopulations of NPCs. In contrast to pluripotent stem cells, there was no coexpression of the pluripotency-associated genes studied. Although the expression of these genes rapidly declined during the in vitro differentiation of NPCs, we found no evidence that the discrete expression was associated with the markers of multipotent neural stem cells (CD133 + /CD24 lo ), the capacity of sphere formation, or high cell proliferation rates. The rate of cell death among NPCs expressing pluripotency-associated genes was also similar to that of other NPCs. Live cell imaging showed that NANOG- and REX1-expressing NPCs continuously changed morphology, as did the nonexpressing cells. Depletion experiments showed that after the complete removal of the subpopulations of NANOG- and REX1-expressing NPCs, the expression of these genes appeared in other NPCs within a few days. The percentage of NANOG- and REX1-expressing cells returned to that observed before depletion. Our results are best explained by a model in which there is stochastic transient expression of pluripotency-associated genes in proliferating NPCs.

Spatial reconstruction of single-cell gene expression data.

Science.gov (United States)

Satija, Rahul; Farrell, Jeffrey A; Gennert, David; Schier, Alexander F; Regev, Aviv

2015-05-01

Spatial localization is a key determinant of cellular fate and behavior, but methods for spatially resolved, transcriptome-wide gene expression profiling across complex tissues are lacking. RNA staining methods assay only a small number of transcripts, whereas single-cell RNA-seq, which measures global gene expression, separates cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos and generated a transcriptome-wide map of spatial patterning. We confirmed Seurat's accuracy using several experimental approaches, then used the strategy to identify a set of archetypal expression patterns and spatial markers. Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems.

Protein Expression Analyses at the Single Cell Level

Directory of Open Access Journals (Sweden)

Masae Ohno

2014-09-01

Full Text Available The central dogma of molecular biology explains how genetic information is converted into its end product, proteins, which are responsible for the phenotypic state of the cell. Along with the protein type, the phenotypic state depends on the protein copy number. Therefore, quantification of the protein expression in a single cell is critical for quantitative characterization of the phenotypic states. Protein expression is typically a dynamic and stochastic phenomenon that cannot be well described by standard experimental methods. As an alternative, fluorescence imaging is being explored for the study of protein expression, because of its high sensitivity and high throughput. Here we review key recent progresses in fluorescence imaging-based methods and discuss their application to proteome analysis at the single cell level.

Matrix metalloproteinase-9 expression in folliculostellate cells of rat anterior pituitary gland.

Science.gov (United States)

Ilmiawati, Cimi; Horiguchi, Kotaro; Fujiwara, Ken; Yashiro, Takashi

2012-03-01

Folliculostellate (FS) cells of the anterior pituitary gland express a variety of regulatory molecules. Using transgenic rats that express green fluorescent protein specifically in FS cells, we recently demonstrated that FS cells in vitro showed marked changes in motility, proliferation, and that formation of cellular interconnections in the presence of laminin, a component of the extracellular matrix, closely resembled those observed in vivo. These findings suggested that FS cells express matrix metalloproteinase-9 (MMP-9), which assists their function on laminin. In the present study, we investigate MMP-9 expression in rat anterior pituitary gland and examine its role in motility and proliferation of FS cells on laminin. Immunohistochemistry, RT-PCR, immunoblotting, and gelatin zymography were performed to assess MMP-9 expression in the anterior pituitary gland and cultured FS cells. Real-time RT-PCR was used to quantify MMP-9 expression in cultured FS cells under different conditions and treatments. MMP-9 expression was inhibited by pharmacological inhibitor or downregulated by siRNA and time-lapse images were acquired. A 5-bromo-2'-deoxyuridine assay was performed to analyze the proliferation of FS cells. Our results showed that MMP-9 was expressed in FS cells, that this expression was upregulated by laminin, and that laminin induced MMP-9 secretion by FS cells. MMP-9 inhibition and downregulation did not impair FS motility; however, it did impair the capacity of FS cells to form interconnections and it significantly inhibited proliferation of FS cells on laminin. We conclude that MMP-9 is necessary in FS cell interconnection and proliferation in the presence of laminin.

Cholinergic regulation of VIP gene expression in human neuroblastoma cells

DEFF Research Database (Denmark)

Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

1997-01-01

Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

Expression profile of CREB knockdown in myeloid leukemia cells

International Nuclear Information System (INIS)

Pellegrini, Matteo; Cheng, Jerry C; Voutila, Jon; Judelson, Dejah; Taylor, Julie; Nelson, Stanley F; Sakamoto, Kathleen M

2008-01-01

The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line transduced with CREB shRNA. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. Decreased expression of specific histone genes was validated in K562, TF-1, and primary AML cells transduced with CREB shRNA. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. We speculate that regulation of histone genes may play an important role by possibly altering the regulation of DNA replication during the cell cycle

Ionizing radiation enhances immunogenicity of cells expressing a tumor-specific T-cell epitope

International Nuclear Information System (INIS)

Ciernik, Ilja F.; Romero, Pedro; Berzofsky, Jay A.; Carbone, David P.

1999-01-01

Background: p53 point mutations represent potential tumor-specific cytolytic T lymphocyte (CTL) epitopes. Whether ionizing radiation (IR) alters the immunological properties of cells expressing mutant p53 in respect of the CTL epitope generated by a defined point mutation has not been evaluated. Methods: Mutant p53-expressing syngeneic, nontumor forming BALB/c 3T3 fibroblasts, tumor forming ras-transfected BALB/c 3T3 sarcomas, and DBA/2-derived P815 mastocytoma cells, which differ at the level of minor histocompatibility antigens, were used as cellular vaccines. Cells were either injected with or without prior IR into naive BALB/c mice. Cellular cytotoxicity was assessed after secondary restimulation of effector spleen cells in vitro. Results: Injection of P815 mastocytoma cells expressing the mutant p53 induced mutation-specific CTL in BALB/c mice irrespective of prior irradiation. However, syngeneic fibroblasts or fibrosarcomas endogenously expressing mutant p53 were able to induce significant mutation-specific CTL only when irradiated prior to injection into BALB/c mice. IR of fibroblasts did not detectably alter the expression of cell surface molecules involved in immune response induction, nor did it alter the short-term in vitro viability of the fibroblasts. Interestingly, radioactively-labeled fibroblasts injected into mice after irradiation showed altered organ distribution, suggesting that the in vivo fate of these cells may play a crucial role in their immunogenicity. Conclusions: These findings indicate that IR can alter the immunogenicity of syngeneic normal as well as tumor forming fibroblasts in vivo, and support the view that ionizing radiation enhances immunogenicity of cellular tumor vaccines

Differential expression of cell adhesion genes

DEFF Research Database (Denmark)

Stein, Wilfred D; Litman, Thomas; Fojo, Tito

2005-01-01

that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...... in cell adhesion and the cytoskeleton. If the proteins involved in tethering cells to the extracellular matrix are important in conferring drug resistance, it may be possible to improve chemotherapy by designing drugs that target these proteins....

Tula hantavirus isolate with the full-length ORF for nonstructural protein NSs survives for more consequent passages in interferon-competent cells than the isolate having truncated NSs ORF.

Science.gov (United States)

Jääskeläinen, Kirsi M; Plyusnina, Angelina; Lundkvist, Ake; Vaheri, Antti; Plyusnin, Alexander

2008-01-11

The competitiveness of two Tula hantavirus (TULV) isolates, TULV/Lodz and TULV/Moravia, was evaluated in interferon (IFN) -competent and IFN-deficient cells. The two isolates differ in the length of the open reading frame (ORF) encoding the nonstructural protein NSs, which has previously been shown to inhibit IFN response in infected cells. In IFN-deficient Vero E6 cells both TULV isolates survived equally well. In contrast, in IFN-competent MRC5 cells TULV/Lodz isolate, that possesses the NSs ORF for the full-length protein of 90 aa, survived for more consequent passages than TULV/Moravia isolate, which contains the ORF for truncated NSs protein (66-67 aa). Our data show that expression of a full-length NSs protein is beneficial for the virus survival and competitiveness in IFN-competent cells and not essential in IFN-deficient cells. These results suggest that the N-terminal aa residues are important for the full activity of the NSs protein.

Chronic In Vivo Interaction of Dendritic Cells Expressing the Ligand Rae-1ε with NK Cells Impacts NKG2D Expression and Function.

Science.gov (United States)

Morvan, Maelig G; Champsaur, Marine; Reizis, Boris; Lanier, Lewis L

2017-05-01

To investigate how dendritic cells (DCs) interact with NK cells in vivo, we developed a novel mouse model in which Rae-1ε, a ligand of the NKG2D receptor, is expressed in cells with high levels of CD11c. In these CD11c-Rae1 mice, expression of Rae-1 was confirmed on all subsets of DCs and a small subset of B and T cells, but not on NK cells. DC numbers and activation status were unchanged, and NK cells in these CD11c-Rae1 mice presented the same Ly49 repertoire and maturation levels as their littermate wildtype controls. Early NK cell activation after mouse CMV infection was slightly lower than in wildtype mice, but NK cell expansion and viral control were comparable. Notably, we demonstrate that chronic interaction of NK cells with NKG2D ligand-expressing DCs leads to a reversible NKG2D down-modulation, as well as impaired NKG2D-dependent NK cell functions, including tumor rejection. In addition to generating a useful mouse model, our studies reveal in vivo the functional importance of the NK cell and DC cross-talk.

Stromal cells expressing hedgehog-interacting protein regulate the proliferation of myeloid neoplasms

International Nuclear Information System (INIS)

Kobune, M; Iyama, S; Kikuchi, S; Horiguchi, H; Sato, T; Murase, K; Kawano, Y; Takada, K; Ono, K; Kamihara, Y; Hayashi, T; Miyanishi, K; Sato, Y; Takimoto, R; Kato, J

2012-01-01

Aberrant reactivation of hedgehog (Hh) signaling has been described in a wide variety of human cancers including cancer stem cells. However, involvement of the Hh-signaling system in the bone marrow (BM) microenvironment during the development of myeloid neoplasms is unknown. In this study, we assessed the expression of Hh-related genes in primary human CD34 + cells, CD34 + blastic cells and BM stromal cells. Both Indian Hh (Ihh) and its signal transducer, smoothened (SMO), were expressed in CD34 + acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS)-derived cells. However, Ihh expression was relatively low in BM stromal cells. Remarkably, expression of the intrinsic Hh-signaling inhibitor, human Hh-interacting protein (HHIP) in AML/MDS-derived stromal cells was markedly lower than in healthy donor-derived stromal cells. Moreover, HHIP expression levels in BM stromal cells highly correlated with their supporting activity for SMO + leukemic cells. Knockdown of HHIP gene in stromal cells increased their supporting activity although control cells marginally supported SMO + leukemic cell proliferation. The demethylating agent, 5-aza-2′-deoxycytidine rescued HHIP expression via demethylation of HHIP gene and reduced the leukemic cell-supporting activity of AML/MDS-derived stromal cells. This indicates that suppression of stromal HHIP could be associated with the proliferation of AML/MDS cells

The Expression Profiles of Lysophospholipid Receptors (LPLRs in Different Endothelial Cells

Directory of Open Access Journals (Sweden)

Yu-Wei Lee

2006-03-01

Full Text Available Sphingosine-1-phosphate (S1P and lysophosphatidic acid (LPA are two bioactive lysophospholipids (LPLs, stored primarily in platelets and released during platelet activation. Both LPLs are capable of regulating endothelial cell functions. The physiological functions of S1P and LPA are mediated by interacting with eight different G-protein coupled receptors: S1P1 through 5 and LPA1 through 3, which activate three different heterotrimeric GTP proteins－including Gi、Gq and G(12/13. The expression of LPL receptors in endothelial cells would affect the responses of S1P and LPA to these cells. There is no previous report discussing the expression profiles of LPL receptors in different endothelial cells from various species. In this study, we aim to investigate the expression profiles of S1P and LPA receptors in different endothelial cells isolated from human, rat, mouse and bovine origin. We used RT-PCR to determine LPLs receptors expression profiles in different endothelial cells. Our results indicated that endothelial cells from various species express different LPL receptors. Endothelial cells isolated from the same source of different species also had different LPLs receptors expression profiles. Therefore, different endothelial cells should respond to LPLs in different manners.

Estimation of extremely small field radiation dose for brain stereotactic radiotherapy using the Vero4DRT system.

Science.gov (United States)

Nakayama, Shinichi; Monzen, Hajime; Onishi, Yuichi; Kaneshige, Soichiro; Kanno, Ikuo

2018-06-01

The purpose of this study was a dosimetric validation of the Vero4DRT for brain stereotactic radiotherapy (SRT) with extremely small fields calculated by the treatment planning system (TPS) iPlan (Ver.4.5.1; algorithm XVMC). Measured and calculated data (e.g. percentage depth dose [PDD], dose profile, and point dose) were compared for small square fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 using ionization chambers of 0.01 or 0.04 cm 3 and a diamond detector. Dose verifications were performed using an ionization chamber and radiochromic film (EBT3; the equivalent field sizes used were 8.2, 8.7, 8.9, 9.5, and 12.9 mm 2 ) for five brain SRT cases irradiated with dynamic conformal arcs. The PDDs and dose profiles for the measured and calculated data were in good agreement for fields larger than or equal to 10 × 10 mm 2 when an appropriate detector was chosen. The dose differences for point doses in fields of 30 × 30, 20 × 20, 10 × 10 and 5 × 5 mm 2 were +0.48%, +0.56%, -0.52%, and +11.2% respectively. In the dose verifications for the brain SRT plans, the mean dose difference between the calculated and measured doses were -0.35% (range, -0.94% to +0.47%), with the average pass rates for the gamma index under the 3%/2 mm criterion being 96.71%, 93.37%, and 97.58% for coronal, sagittal, and axial planes respectively. The Vero4DRT system provides accurate delivery of radiation dose for small fields larger than or equal to 10 × 10 mm 2 . Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

Science.gov (United States)

Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

2018-06-05

CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Chemokine Expression in Retinal Pigment Epithelial ARPE-19 Cells in Response to Coculture with Activated T Cells

DEFF Research Database (Denmark)

Juel, Helene Bæk; Faber, Carsten; Udsen, Maja

2012-01-01

Purpose. To investigate the effects of T-cell–derived cytokines on gene and protein expression of chemokines in a human RPE cell line (ARPE-19). Methods. We used an in vitro coculture system in which the RPE and CD3/CD28–activated T-cells were separated by a membrane. RPE cell expression of chemo......Purpose. To investigate the effects of T-cell–derived cytokines on gene and protein expression of chemokines in a human RPE cell line (ARPE-19). Methods. We used an in vitro coculture system in which the RPE and CD3/CD28–activated T-cells were separated by a membrane. RPE cell expression...

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

Science.gov (United States)

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

A small population of resident limb bud mesenchymal cells express few MSC-associated markers, but the expression of these markers is increased immediately after cell culture.

Science.gov (United States)

Marín-Llera, Jessica Cristina; Chimal-Monroy, Jesús

2018-05-01

Skeletal progenitors are derived from resident limb bud mesenchymal cells of the vertebrate embryos. However, it remains poorly understood if they represent stem cells, progenitors, or multipotent mesenchymal stromal cells (MSC). Derived-MSC of different adult tissues under in vitro experimental conditions can differentiate into the same cellular lineages that are present in the limb. Here, comparing non-cultured versus cultured mesenchymal limb bud cells, we determined the expression of MSC-associated markers, the in vitro differentiation capacity and their gene expression profile. Results showed that in freshly isolated limb bud mesenchymal cells, the proportion of cells expressing Sca1, CD44, CD105, CD90, and CD73 is very low and a low expression of lineage-specific genes was observed. However, recently seeded limb bud mesenchymal cells acquired Sca1 and CD44 markers and the expression of the key differentiation genes Runx2 and Sox9, while Scx and Pparg genes decreased. Also, their chondrogenic differentiation capacity decreased through cellular passages while the osteogenic increased. Our findings suggest that the modification of the cell adhesion process through the in vitro method changed the limb mesenchymal cell immunophenotype leading to the expression and maintenance of common MSC-associated markers. These findings could have a significant impact on MSC study and isolation strategy because they could explain common variations observed in the MSC immunophenotype in different tissues. © 2018 International Federation for Cell Biology.

Podoplanin expression in oral potentially malignant disorders and oral squamous cell carcinoma.

Science.gov (United States)

A G, Deepa; Janardanan-Nair, Bindu; B R, Varun

2017-12-01

Podoplanin is a type I transmembrane sialomucin-like glycoprotein that is specifically expressed in lymphatic endothelial cells. Studies have shown that assessment of podoplanin expression in the epithelial cells can be used to predict the malignant transformation of potentially malignant disorders and the metastatic tendency of primary head and neck squamous cell carcinoma. The aim of our study was to compare the expression of podoplanin in oral leukoplakia, oral submucous fibrosis and oral squamous cell carcinoma with that in normal buccal mucosa by immunohistochemical methods. Immunohistochemical expression of podoplanin was analyzed in 20 cases each of oral leukoplakia, oral submucous fibrosis, oral squamous cell carcinoma and normal buccal mucosa, with monoclonal antibody D2-40. The expression of podoplanin was graded from grade 0-4. There was a statistically significant upregulation of the grades of podoplanin expression in oral squamous cell carcinoma(100%), oral submucous fibrosis (90%) and oral leukoplakia (65%) when compared to that in normal mucosa(35%). Podoplanin expression increased with decrease in grades of differentiation in oral squamous cell carcinoma . Podoplanin expression in the samples of oral submucous fibrosis was higher than that in oral leukoplakia. Evaluation of podoplanin expression in the epithelial cells of oral dysplastic lesions may provide valuable information to predict their risk of malignant transformation. Key words: Immunohistochemistry, Oral leukoplakia, Oral submucous fibrosis, Podoplanin, Squamous cell carcinoma.

Osteoprotegerin expression in triple-negative breast cancer cells promotes metastasis

International Nuclear Information System (INIS)

Weichhaus, Michael; Segaran, Prabu; Renaud, Ashleigh; Geerts, Dirk; Connelly, Linda

2014-01-01

Osteoprotegerin (OPG) is a secreted member of the tumor necrosis factor (TNF) receptor superfamily that has been well characterized as a negative regulator of bone remodeling. OPG is also expressed in human breast cancer tissues and cell lines. In vitro studies suggest that OPG exerts tumor-promoting effects by binding to TNF-related apoptosis inducing ligand (TRAIL), thereby preventing induction of apoptosis. However, the in vivo effect of OPG expression by primary breast tumors has not been characterized. We knocked down OPG expression in MDA-MB-231 and MDA-MB-436 human breast cancer cells using shRNA and siRNA to investigate impact on metastasis in the chick embryo model. We observed a reduction in metastasis with OPG knockdown cells. We found that lowering OPG expression did not alter sensitivity to TRAIL-induced apoptosis; however, the OPG knockdown cells had a reduced level of invasion. In association with this we observed reduced expression of the proteases Cathepsin D and Matrix Metalloproteinase-2 upon OPG knockdown, indicating that OPG may promote metastasis via modulation of protease expression and invasion. We conclude that OPG has a metastasis-promoting effect in breast cancer cells

Leukomogenic factors downregulate heparanase expression in acute myeloid leukemia cells

International Nuclear Information System (INIS)

Eshel, Rinat; Ben-Zaken, Olga; Vainas, Oded; Nadir, Yona; Minucci, Saverio; Polliack, Aaron; Naparstek, Ella; Vlodavsky, Israel; Katz, Ben-Zion

2005-01-01

Heparanase is a heparan sulfate-degrading endoglycosidase expressed by mature monocytes and myeloid cells, but not by immature hematopoietic progenitors. Heparanase gene expression is upregulated during differentiation of immature myeloid cells. PML-RARα and PLZF-RARα fusion gene products associated with acute promyelocytic leukemia abrogate myeloid differentiation and heparanase expression. AML-Eto, a translocation product associated with AML FAB M2, also downregulates heparanase gene expression. The common mechanism that underlines the activity of these three fusion gene products involves the recruitment of histone deacetylase complexes to specific locations within the DNA. We found that retinoic acid that dissociates PML-RARα from the DNA, and which is used to treat acute promyelocytic leukemia patients, restores heparanase expression to normal levels in an acute promyelocytic leukemia cell line. The retinoic acid effects were also observed in primary acute promyelocytic leukemia cells and in a retinoic acid-treated acute promyelocytic leukemia patient. Histone deacetylase inhibitor reverses the downregulation of heparanase expression induced by the AML-Eto fusion gene product in M2 type AML. In summary, we have characterized a link between leukomogenic factors and the downregulation of heparanase in myeloid leukemic cells

SCA-1 Expression Level Identifies Quiescent Hematopoietic Stem and Progenitor Cells

Directory of Open Access Journals (Sweden)

Mina N.F. Morcos

2017-06-01

Full Text Available Blood cell generation depends on continuous cellular output by the sequential hierarchy of hematopoietic stem cell (HSC and progenitor populations that all contain quiescent and actively cycling cells. Hematopoietic stem and progenitor cells (HSPCs express the surface molecule Stem cell antigen 1 (SCA-1/LY6A. Using histone 2B-red fluorescent fusion protein label retention and cell-cycle reporter mice, we demonstrate that high SCA-1 expression (SCA-1hi identifies not only quiescent HSCs but quiescent cells on all hierarchical levels within the lineage−SCA-1+KIT+ (LSK population. Each transplanted SCA-1hi HSPC population also displayed self-renewal potential superior to that of the respective SCA-1lo population. SCA-1 expression is inducible by type I interferon (IFN. We show, however, that quiescence and high self-renewal capacity of cells with brighter SCA-1 expression at steady state were independent of type I IFN signaling. We conclude that SCA-1 expression levels can be used to prospectively isolate functionally heterogeneous HSPC subpopulations.

Expression of Podoplanin in the Mouse Tooth Germ and Apical Bud Cells

Science.gov (United States)

Sawa, Yoshihiko; Iwasawa, Kana; Ishikawa, Hiroyuki

2008-01-01

This study was designed to investigate the distribution of cells expressing podoplanin in the mouse tooth bud. Podoplanin expression was detected in enamel epithelia of the cervical loop at cell-cell contacts strongly, and weakly on the loosely aggregated stellate reticulum in the center and the neighboring stratum intermedium. Odontoblasts exhibited intense podoplanin expression at the junction with predentin while no expression was detected in the enamel organ containing ameloblasts. These results suggest that proliferating inner and outer enamel epithelia express podoplanin but that the expression is suppressed in the differentiated epithelia containing ameloblasts. On the other hand the podoplanin expression occurs in the differentiating odontoblasts and the expression is sustained in differentiated odontoblasts, indicating that odontoblasts have the strong ability to express podoplanin. In cultured apical bud cells podoplanin was detected at cell-cell contacts. In real-time PCR analysis the amount of podoplanin mRNA of the apical buds was 2-fold compared with the amount of kidney used as a positive control. These findings indicate that apical bud cells have the strong ability to express the podoplanin gene. Podoplanin is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. The podoplanin may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. PMID:18989465

Langerin-expressing dendritic cells in gut-associated lymphoid tissues.

Science.gov (United States)

Chang, Sun-Young; Kweon, Mi-Na

2010-03-01

Dendritic cells (DCs) are key regulators of the immune system. They act as professional antigen-presenting cells and are capable of activating naive T cells and stimulating the growth and differentiation of B cells. According to their molecular expression, DCs can be divided into several subsets with different functions. We focus on DC subsets expressing langerin, a C-type lectin. Langerin expression is predominant in skin DCs, but langerin-expressing DCs also exist in mucosal tissue and can be induced by immunization and sometimes by nutrient deficiency. Topical transcutaneous immunization induces langerin(+)CD8 alpha(-) DCs in mesenteric lymph nodes (MLNs), which mediate the production of antigen-specific immunoglobulin A antibody in the intestine. Yet, in one recent study, langerin(+) DCs were generated in gut-associated lymphoid tissue and contributed to the suppressive intestinal immune environment in the absence of retinoic acid. In this review, we focus on the phenotypic and functional characteristics of langerin(+) DCs in the mucosal tissues, especially MLNs.

Cell lines that support replication of a novel herpes simplex virus 1 UL31 deletion mutant can properly target UL34 protein to the nuclear rim in the absence of UL31

International Nuclear Information System (INIS)

Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D.

2004-01-01

Previous results indicated that the herpes simplex virus 1 (HSV-1) U L 31 gene is necessary and sufficient for localization of the U L 34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U L 31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U L 31 gene. The replication of the U L 31 deletion virus was restored on U L 31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U L 34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U L 34 protein localized at the nuclear membrane in rabbit skin cells, and U L 31 complementing CV1 cells infected with the U L 31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U L 34 protein to the nuclear membrane. We speculate that this function partially complements that of U L 31 and may explain why U L 31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells

Planar cell polarity gene expression correlates with tumor cell viability and prognostic outcome in neuroblastoma

International Nuclear Information System (INIS)

Dyberg, Cecilia; Papachristou, Panagiotis; Haug, Bjørn Helge; Lagercrantz, Hugo; Kogner, Per; Ringstedt, Thomas; Wickström, Malin; Johnsen, John Inge

2016-01-01

The non-canonical Wnt/Planar cell polarity (PCP) signaling pathway is a major player in cell migration during embryonal development and has recently been implicated in tumorigenesis. Transfections with cDNA plasmids or siRNA were used to increase and suppress Prickle1 and Vangl2 expression in neuroblastoma cells and in non-tumorigenic cells. Cell viability was measured by trypan blue exclusion and protein expression was determined with western blotting. Transcriptional activity was studied with luciferase reporter assay and mRNA expression with real-time RT-PCR. Immunofluorescence stainings were used to study the effects of Vangl2 overexpression in non-tumorigenic embryonic cells. Statistical significance was tested with t-test or one-way ANOVA. Here we show that high expression of the PCP core genes Prickle1 and Vangl2 is associated with low-risk neuroblastoma, suppression of neuroblastoma cell growth and decreased Wnt/β-catenin signaling. Inhibition of Rho-associated kinases (ROCKs) that are important in mediating non-canonical Wnt signaling resulted in increased expression of Prickle1 and inhibition of β-catenin activity in neuroblastoma cells. In contrast, overexpression of Vangl2 in MYC immortalized neural stem cells induced accumulation of active β-catenin and decreased the neural differentiation marker Tuj1. Similarly, genetically modified mice with forced overexpression of Vangl2 in nestin-positive cells showed decreased Tuj1 differentiation marker during embryonal development. Our experimental data demonstrate that high expression of Prickle1 and Vangl2 reduce the growth of neuroblastoma cells and indicate different roles of PCP proteins in tumorigenic cells compared to normal cells. These results suggest that the activity of the non-canonical Wnt/PCP signaling pathway is important for neuroblastoma development and that manipulation of the Wnt/PCP pathway provides a possible therapy for neuroblastoma. The online version of this article (doi:10.1186/s

Genetic analysis of the SARS-coronavirus spike glycoprotein functional domains involved in cell-surface expression and cell-to-cell fusion

International Nuclear Information System (INIS)

Petit, Chad M.; Melancon, Jeffrey M.; Chouljenko, Vladimir N.; Colgrove, Robin; Farzan, Michael; Knipe, David M.; Kousoulas, K.G.

2005-01-01

The SARS-coronavirus (SARS-CoV) is the etiological agent of severe acute respiratory syndrome (SARS). The SARS-CoV spike (S) glycoprotein mediates membrane fusion events during virus entry and virus-induced cell-to-cell fusion. To delineate functional domains of the SARS-CoV S glycoprotein, single point mutations, cluster-to-lysine and cluster-to-alanine mutations, as well as carboxyl-terminal truncations were investigated in transient expression experiments. Mutagenesis of either the coiled-coil domain of the S glycoprotein amino terminal heptad repeat, the predicted fusion peptide, or an adjacent but distinct region, severely compromised S-mediated cell-to-cell fusion, while intracellular transport and cell-surface expression were not adversely affected. Surprisingly, a carboxyl-terminal truncation of 17 amino acids substantially increased S glycoprotein-mediated cell-to-cell fusion suggesting that the terminal 17 amino acids regulated the S fusogenic properties. In contrast, truncation of 26 or 39 amino acids eliminating either one or both of the two endodomain cysteine-rich motifs, respectively, inhibited cell fusion in comparison to the wild-type S. The 17 and 26 amino-acid deletions did not adversely affect S cell-surface expression, while the 39 amino-acid truncation inhibited S cell-surface expression suggesting that the membrane proximal cysteine-rich motif plays an essential role in S cell-surface expression. Mutagenesis of the acidic amino-acid cluster in the carboxyl terminus of the S glycoprotein as well as modification of a predicted phosphorylation site within the acidic cluster revealed that this amino-acid motif may play a functional role in the retention of S at cell surfaces. This genetic analysis reveals that the SARS-CoV S glycoprotein contains extracellular domains that regulate cell fusion as well as distinct endodomains that function in intracellular transport, cell-surface expression, and cell fusion

Interdependence of cell growth and gene expression: origins and consequences.

Science.gov (United States)

Scott, Matthew; Gunderson, Carl W; Mateescu, Eduard M; Zhang, Zhongge; Hwa, Terence

2010-11-19

In bacteria, the rate of cell proliferation and the level of gene expression are intimately intertwined. Elucidating these relations is important both for understanding the physiological functions of endogenous genetic circuits and for designing robust synthetic systems. We describe a phenomenological study that reveals intrinsic constraints governing the allocation of resources toward protein synthesis and other aspects of cell growth. A theory incorporating these constraints can accurately predict how cell proliferation and gene expression affect one another, quantitatively accounting for the effect of translation-inhibiting antibiotics on gene expression and the effect of gratuitous protein expression on cell growth. The use of such empirical relations, analogous to phenomenological laws, may facilitate our understanding and manipulation of complex biological systems before underlying regulatory circuits are elucidated.

Zfp206 regulates ES cell gene expression and differentiation.

Science.gov (United States)

Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

2006-01-01

Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells.

Science.gov (United States)

Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S

2000-11-15

Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.

Progenitor potential of nkx6.1-expressing cells throughout zebrafish life and during beta cell regeneration.

Science.gov (United States)

Ghaye, Aurélie P; Bergemann, David; Tarifeño-Saldivia, Estefania; Flasse, Lydie C; Von Berg, Virginie; Peers, Bernard; Voz, Marianne L; Manfroid, Isabelle

2015-09-02

In contrast to mammals, the zebrafish has the remarkable capacity to regenerate its pancreatic beta cells very efficiently. Understanding the mechanisms of regeneration in the zebrafish and the differences with mammals will be fundamental to discovering molecules able to stimulate the regeneration process in mammals. To identify the pancreatic cells able to give rise to new beta cells in the zebrafish, we generated new transgenic lines allowing the tracing of multipotent pancreatic progenitors and endocrine precursors. Using novel bacterial artificial chromosome transgenic nkx6.1 and ascl1b reporter lines, we established that nkx6.1-positive cells give rise to all the pancreatic cell types and ascl1b-positive cells give rise to all the endocrine cell types in the zebrafish embryo. These two genes are initially co-expressed in the pancreatic primordium and their domains segregate, not as a result of mutual repression, but through the opposite effects of Notch signaling, maintaining nkx6.1 expression while repressing ascl1b in progenitors. In the adult zebrafish, nkx6.1 expression persists exclusively in the ductal tree at the tip of which its expression coincides with Notch active signaling in centroacinar/terminal end duct cells. Tracing these cells reveals that they are able to differentiate into other ductal cells and into insulin-expressing cells in normal (non-diabetic) animals. This capacity of ductal cells to generate endocrine cells is supported by the detection of ascl1b in the nkx6.1:GFP ductal cell transcriptome. This transcriptome also reveals, besides actors of the Notch and Wnt pathways, several novel markers such as id2a. Finally, we show that beta cell ablation in the adult zebrafish triggers proliferation of ductal cells and their differentiation into insulin-expressing cells. We have shown that, in the zebrafish embryo, nkx6.1+ cells are bona fide multipotent pancreatic progenitors, while ascl1b+ cells represent committed endocrine precursors. In

Expression of PML tumor suppressor in A 431 cells reduces cellular growth by inhibiting the epidermal growth factor receptor expression

International Nuclear Information System (INIS)

Vallian, S.; Chang, K.S.

2004-01-01

Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML

Control of CD56 expression and tumor cell cytotoxicity in human Vγ2Vδ2 T cells

Directory of Open Access Journals (Sweden)

Focaccetti Chiara

2009-09-01

Full Text Available Abstract Background In lymphocyte subsets, expression of CD56 (neural cell adhesion molecule-1 correlates with cytotoxic effector activity. For cells bearing the Vγ2Vδ2 T cell receptor, isoprenoid pyrophosphate stimulation leads to uniform activation and proliferation, but only a fraction of cells express CD56 and display potent cytotoxic activity against tumor cells. Our goal was to show whether CD56 expression was regulated stochastically, similar to conventional activation antigens, or whether CD56 defined a lineage of cells committed to the cytotoxic phenotype. Results Tracking individual cell clones defined by their Vγ2 chain CDR3 region sequences, we found that CD56 was expressed on precursor cytotoxic T cells already present in the population irrespective of their capacity to proliferate after antigen stimulation. Public T cell receptor sequences found in the CD56+ subset from one individual might appear in the CD56- subset of another donor. The commitment of individual clones to CD56+ or CD56- lineages was stable for each donor over a 1 year interval. Conclusion The ability to express CD56 was not predicted by TCR sequence or by the strength of signal received by the TCR. For γδ T cells, cytotoxic effector function is acquired when cytotoxic precursors within the population are stimulated to proliferate and express CD56. Expression of CD56 defines a committed lineage to the cytotoxic phenotype.

Reduced expression of bax in small cell lung cancer cells is not sufficient to induce cisplatin-resistance

Directory of Open Access Journals (Sweden)

Biagosch J

2010-10-01

Full Text Available Abstract Resistance to cisplatin in the course of chemotherapy contributes to the poor prognosis of small cell lung cancer (SCLC. B cell lymphoma-2 is the founding member of a large family of proteins that either promote or inhibit apoptosis. We aimed at investigating if the pro-apoptotic members Bad, Bax, Bim and Bid are involved in cisplatin-resistance. Cisplatin-resistance in the SCLC cell line H1339 was induced by repetitive exposure to cisplatin. Protein expression was quantified by Western Blot and immuno-fluorescence analysis. Protein expression was altered using siRNA interference. Four "cycles" of 0.5 μg/ml cisplatin led to partial cisplatin-resistance in H1339 cells. The expression of Bad, Bim and Bid was comparable in naïve and resistant cells while the expression of Bax was reduced in the resistant clone. But, reducing Bax expression in naïve cells did not lead to altered cisplatin sensitivity neither in H1339 nor in H187 SCLC cells. We conclude that the reduced Bax expression after exposure to cisplatin is not sufficient to induce cis-platin-resistance in SCLC cells.

Nuclear hormone receptor expression in mouse kidney and renal cell lines.

Directory of Open Access Journals (Sweden)

Daisuke Ogawa

Full Text Available Nuclear hormone receptors (NHRs are transcription factors that regulate carbohydrate and lipid metabolism, immune responses, and inflammation. Although several NHRs, including peroxisome proliferator-activated receptor-γ (PPARγ and PPARα, demonstrate a renoprotective effect in the context of diabetic nephropathy (DN, the expression and role of other NHRs in the kidney are still unrecognized. To investigate potential roles of NHRs in the biology of the kidney, we used quantitative real-time polymerase chain reaction to profile the expression of all 49 members of the mouse NHR superfamily in mouse kidney tissue (C57BL/6 and db/m, and cell lines of mesangial (MES13, podocyte (MPC, proximal tubular epithelial (mProx24 and collecting duct (mIMCD3 origins in both normal and high-glucose conditions. In C57BL/6 mouse kidney cells, hepatocyte nuclear factor 4α, chicken ovalbumin upstream promoter transcription factor II (COUP-TFII and COUP-TFIII were highly expressed. During hyperglycemia, the expression of the NHR 4A subgroup including neuron-derived clone 77 (Nur77, nuclear receptor-related factor 1, and neuron-derived orphan receptor 1 significantly increased in diabetic C57BL/6 and db/db mice. In renal cell lines, PPARδ was highly expressed in mesangial and proximal tubular epithelial cells, while COUP-TFs were highly expressed in podocytes, proximal tubular epithelial cells, and collecting duct cells. High-glucose conditions increased the expression of Nur77 in mesangial and collecting duct cells, and liver x receptor α in podocytes. These data demonstrate NHR expression in mouse kidney cells and cultured renal cell lines and suggest potential therapeutic targets in the kidney for the treatment of DN.

Altered Gene Expressions and Cytogenetic Repair Efficiency in Cells with Suppressed Expression of XPA after Proton Exposure

Science.gov (United States)

Zhang, Ye; Rohde, Larry H.; Gridley, Daila S.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu

2009-01-01

Cellular responses to damages from ionizing radiation (IR) exposure are influenced not only by the genes involved in DNA double strand break (DSB) repair, but also by non- DSB repair genes. We demonstrated previously that suppressed expression of several non-DSB repair genes, such as XPA, elevated IR-induced cytogenetic damages. In the present study, we exposed human fibroblasts that were treated with control or XPA targeting siRNA to 250 MeV protons (0 to 4 Gy), and analyzed chromosome aberrations and expressions of genes involved in DNA repair. As expected, after proton irradiation, cells with suppressed expression of XPA showed a significantly elevated frequency of chromosome aberrations compared with control siRNA treated (CS) cells. Protons caused more severe DNA damages in XPA knock-down cells, as 36% cells contained multiple aberrations compared to 25% in CS cells after 4Gy proton irradiation. Comparison of gene expressions using the real-time PCR array technique revealed that expressions of p53 and its regulated genes in irradiated XPA suppressed cells were altered similarly as in CS cells, suggesting that the impairment of IR induced DNA repair in XPA suppressed cells is p53-independent. Except for XPA, which was more than 2 fold down regulated in XPA suppressed cells, several other DNA damage sensing and repair genes (GTSE1, RBBP8, RAD51, UNG and XRCC2) were shown a more than 1.5 fold difference between XPA knock-down cells and CS cells after proton exposure. The possible involvement of these genes in the impairment of DNA repair in XPA suppressed cells will be further investigated.

Proton receptor GPR68 expression in dendritic-cell-like S100β-positive cells of rat anterior pituitary gland: GPR68 induces interleukin-6 gene expression in extracellular acidification.

Science.gov (United States)

Horiguchi, Kotaro; Higuchi, Masashi; Yoshida, Saishu; Nakakura, Takashi; Tateno, Kozue; Hasegawa, Rumi; Takigami, Shu; Ohsako, Shunji; Kato, Takako; Kato, Yukio

2014-11-01

S100β-positive cells, which do not express the classical pituitary hormones, appear to possess multifunctional properties and are assumed to be heterogeneous in the anterior pituitary gland. The presence of several protein markers has shown that S100β-positive cells are composed of populations such as stem/progenitor cells, epithelial cells, astrocytes and dendritic cells. Recently, we succeeded in separating S100β-positive cells into round-cell (dendritic-cell-like) and process-cell types. We also found the characteristic expression of anti-inflammatory factors (interleukin-6, Il-6) and membrane receptors (integrin β-6) in the round type. Here, we further investigate the function of the subpopulation of S100β-positive cells. Since IL-6 is also a paracrine factor that regulates hormone producing-cells, we examine whether a correlation exists among extracellular acid stress, IL-6 and hormone production by using primary cultures of anterior pituitary cells. Dendritic-cell-like S100β-positive cells notably expressed Gpr68 (proton receptor) and Il-6. Furthermore, the expression of Il-6 and proopiomelanocortin (Pomc) was up-regulated by extracellular acidification. The functional role of IL-6 and GPR68 in the gene expression of Pomc during extracellular acidification was also examined. Small interfering RNA for Il-6 up-regulated Pomc expression and that for Gpr68 reversed the down-regulation of Il-6 and up-regulated Pomc expression by extracellular acidification. Thus, S100β-positive dendritic-like cells can sense an increase in extracellular protons via GPR68 and respond by the production of IL-6 in order to suppress the up-regulation of Pomc expression.

Induction of Ski Protein Expression upon Luteinization in Rat Granulosa Cells

Directory of Open Access Journals (Sweden)

Hyun Kim

2012-05-01

Full Text Available Ski protein is implicated in proliferation/differentiation in a variety of cells. We had previously reported that Ski protein is present in granulosa cells of atretic follicles, but not in preovulatory follicles, suggesting that Ski has a role in apoptosis of granulosa cells. The alternative fate of granulosa cells other than apoptosis is to differentiate to luteal cells; however, it is unknown whether Ski is expressed and has a role in granulosa cells undergoing luteinization. Thus, the aim of the present study was to locate Ski protein in the rat ovary during luteinizationto predict the possible role of Ski. In order to examine the expression pattern of Ski protein along with the progress of luteinization, follicular growth was induced by administration of equine chorionic gonadtropin to immature female rats, and luteinization was induced by human chorionic gonadtropin treatment to mimic luteinizing hormone (LH surge. While no Ski-positive granulosa cells were present in preovulatory follicle, Ski protein expression was induced in response to LH surge, and was maintained after the formation of the corpus luteum (CL. Though Ski protein is absent in granulosa cells of preovulatory follicle, its mRNA (c-Ski was expressed and the level was unchanged even after LH surge. Taken together, these results demonstrated that Ski protein expression is induced in granulosa cells upon luteinization, and suggests that its expression is regulated post-transcriptionally.

Hypertonic saline impedes tumor cell-endothelial cell interaction by reducing adhesion molecule and laminin expression.

LENUS (Irish Health Repository)

Shields, Conor J

2012-02-03

BACKGROUND: Hypertonic saline infusion dampens inflammatory responses and suppresses neutrophil-endothelial interaction by reducing adhesion molecule expression. This study tested the hypothesis that hypertonic saline attenuates tumor cell adhesion to the endothelium through a similar mechanism. METHODS: Human colon cancer cells (LS174T) were transfected with green fluorescent protein and exposed to lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-6 under hypertonic and isotonic conditions for 1 and 4 hours. Confluent human umbilical vein endothelial cells were similarly exposed. Cellular apoptosis and expression of adhesion molecules and laminin were measured by flow cytometry. Tumor cell adhesion to endothelium and laminin was assessed with fluorescence microscopy. Data are represented as mean +\\/- standard error of mean, and an ANOVA test was performed to gauge statistical significance, with P <.05 considered significant. RESULTS: Hypertonic exposure significantly reduced tumor cell adhesion despite the presence of the perioperative cell stressors (42 +\\/- 2.9 vs 172.5 +\\/- 12.4, P <.05), attenuated tumor cell beta-1 integrin (14.43 vs 23.84, P <.05), and endothelial cell laminin expression (22.78 +\\/- 2.2 vs 33.74 +\\/- 2.4, P <.05), but did not significantly alter cell viability. CONCLUSION: Hypertonic saline significantly attenuates tumor cell adhesion to endothelium by inhibiting adhesion molecule and laminin expression. This may halt the metastatic behavior of tumor cells shed at surgery.

Differential expression of nanog1 and nanogp8 in colon cancer cells

International Nuclear Information System (INIS)

Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki; Nakagama, Hitoshi; Okamoto, Koji

2012-01-01

Highlights: ► Nanog is expressed in a majority of colon cancer cell lines examined. ► Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. ► Nanog mediates cell proliferation of colon cancer cells. ► Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.

Differential expression of nanog1 and nanogp8 in colon cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ishiguro, Tatsuya; Sato, Ai; Ohata, Hirokazu; Sakai, Hiroaki [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Nakagama, Hitoshi, E-mail: hnakagam@ncc.go.jp [Division of Cancer Development System, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Okamoto, Koji, E-mail: kojokamo@ncc.go.jo [Division of Cancer Differentiation, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)

2012-02-10

Highlights: Black-Right-Pointing-Pointer Nanog is expressed in a majority of colon cancer cell lines examined. Black-Right-Pointing-Pointer Both nanog1 and nanogp8 are expressed in colon cancer cells with varying ratios. Black-Right-Pointing-Pointer Nanog mediates cell proliferation of colon cancer cells. Black-Right-Pointing-Pointer Nanog predominantly localizes in cytoplasm of colon cancer cells. -- Abstract: Nanog, a homeodomain transcription factor, is an essential regulator for promotion of self-renewal of embryonic stem cells and inhibition of their differentiation. It has been demonstrated that nanog1 as well as nanogp8, a retrogene of nanog1, is preferentially expressed in advanced stages of several types of cancer, suggesting their involvement during cancer progression. Here, we investigated the expression of Nanog in well-characterized colon cancer cell lines. Expression of Nanog was detectable in 5 (HCT116, HT29, RKO, SW48, SW620) out of seven cell lines examined. RNA expression analyses of nanog1 and nanogp8 indicated that, while nanog1 was a major form in SW620 as well as in teratoma cells Tera-2, nanogp8 was preferentially expressed in HT29 and HCT116. In accordance with this, shRNA-mediated knockdown of nanog1 caused the reduction of Nanog in SW620 but not in HT29. Inhibition of Nanog in SW620 cells negatively affected cell proliferation and tumor formation in mouse xenograft. Biochemical subcellular fractionation and immunostaining analyses revealed predominant localization of Nanog in cytoplasm in SW620 and HT29, while it was mainly localized in nucleus in Tera-2. Our data indicate that nanog1 and nanogp8 are differentially expressed in colon cancer cells, and suggest that their expression contributes to proliferation of colon cancer cells.

Real-Time Gene Expression Profiling of Live Shewanella Oneidensis Cells

Energy Technology Data Exchange (ETDEWEB)

Xiaoliang Sunney Xie

2009-03-30

The overall objective of this proposal is to make real-time observations of gene expression in live Shewanella oneidensis cells with high sensitivity and high throughput. Gene expression, a central process to all life, is stochastic because most genes often exist in one or two copies per cell. Although the central dogma of molecular biology has been proven beyond doubt, due to insufficient sensitivity, stochastic protein production has not been visualized in real time in an individual cell at the single-molecule level. We report the first direct observation of single protein molecules as they are generated, one at a time in a single live E. coli cell, yielding quantitative information about gene expression [Science 2006; 311: 1600-1603]. We demonstrated a general strategy for live-cell single-molecule measurements: detection by localization. It is difficult to detect single fluorescence protein molecules inside cytoplasm - their fluorescence is spread by fast diffusion to the entire cell and overwhelmed by the strong autofluorescence. We achieved single-molecule sensitivity by immobilizing the fluorescence protein on the cell membrane, where the diffusion is much slowed. We learned that under the repressed condition protein molecules are produced in bursts, with each burst originating from a stochastically-transcribed single messenger RNA molecule, and that protein copy numbers in the bursts follow a geometric distribution. We also simultaneously published a paper reporting a different method using β-glactosidase as a reporter [Nature 440, 358 (2006)]. Many important proteins are expressed at low levels, inaccessible by previous proteomic techniques. Both papers allowed quantification of protein expression with unprecedented sensitivity and received overwhelming acclaim from the scientific community. The Nature paper has been identified as one of the most-cited papers in the past year [http://esi-topics.com/]. We have also an analytical framework describing the

[Expression of embryonic markers in pterygium derived mesenchymal cells].

Science.gov (United States)

Pascual, G; Montes, M A; Pérez-Rico, C; Pérez-Kohler, B; Bellón, J M; Buján, J

2010-12-01

Destruction of the limbal epithelium barrier is the most important mechanism of pterygium formation (conjunctiva proliferation, encroaching onto the cornea). It is thought to arise from activated and proliferating limbal epithelial stem cells. The objective of this study is to evaluate the presence of undifferentiated mesenchymal cells (stem cells) in cultured cells extracted from human pterygium. Cells from 6 human pterygium were isolated by explantation and placed in cultures with amniomax medium. Once the monolayer was reached the cells were seeded onto 24 well microplates. The cells were studied in the second sub-culture. The immunohistochemical expression of different embryonic stem cell markers, OCT3/4 and CD9, was analysed. The differentiated phenotypes were characterised with the monoclonal antibodies anti-CD31, α-actin and vimentin. All the cell populations obtained from pterygium showed vimentin expression. Less than 1% of the cells were positive for CD31 and α-actin markers. The majority of the cell population was positive for OCT3/4 and CD9. The cell population obtained from pterygium expressed mesenchymal cell phenotype and embryonic markers, such us OCT3/4 and CD9. This undifferentiated population could be involved in the large recurrence rate of this type of tissue after surgery. Copyright © 2010 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

Expression of E-cadherin and vimentin in oral squamous cell carcinoma

Science.gov (United States)

Zhou, Jingping; Tao, Detao; Xu, Qing; Gao, Zhenlin; Tang, Daofang

2015-01-01

The aim of the study is to determine the levels of E-cadherin, vimentin expression in tumor tissues from patients with oral squamous cell carcinoma (OSCC), and the relationship between the expression of E-cadherin, vimentin and epithelial-mesenchymal transition, in order to explore its values for predicting the invasion and metastasis of oral squamous cell carcinoma, short survival of patients in many types of cancer. E-cadherin and vimentin expression of 10 benign and 42 OSCC tumor tissues was examined by immunohistochemical staining. E-cadherin is positively expressed in normal oral mucosa epithelium, but vimentin expression is not found in normal oral mucosa epithelia; the E-cadherin and vimentin were expressed in 26 of 42 (61.9%) and 16 of 42 (38.1%), respectively. No statistically difference was found for E-cadherin and vimentin expression in patients with different age, gender and tumor location, E-cadherin and vimentin expression was significantly associated with lymph node metastasis and tissue location (P oral squamous cell carcinoma for E-cadherin and vimentin positive expression (P oral squamous cell carcinoma. Our study preliminarily confirmed that EMT phenomenon is existed during the development of oral squamous cell carcinoma. Co-evaluation of E-cadherin and vimentin might be a valuable tool for predicting OSCC patient outcome. PMID:26045832

Human cancer cells express Slug-based epithelial-mesenchymal transition gene expression signature obtained in vivo

International Nuclear Information System (INIS)

Anastassiou, Dimitris; Rumjantseva, Viktoria; Cheng, Weiyi; Huang, Jianzhong; Canoll, Peter D; Yamashiro, Darrell J; Kandel, Jessica J

2011-01-01

The biological mechanisms underlying cancer cell motility and invasiveness remain unclear, although it has been hypothesized that they involve some type of epithelial-mesenchymal transition (EMT). We used xenograft models of human cancer cells in immunocompromised mice, profiling the harvested tumors separately with species-specific probes and computationally analyzing the results. Here we show that human cancer cells express in vivo a precise multi-cancer invasion-associated gene expression signature that prominently includes many EMT markers, among them the transcription factor Slug, fibronectin, and α-SMA. We found that human, but not mouse, cells express the signature and Slug is the only upregulated EMT-inducing transcription factor. The signature is also present in samples from many publicly available cancer gene expression datasets, suggesting that it is produced by the cancer cells themselves in multiple cancer types, including nonepithelial cancers such as neuroblastoma. Furthermore, we found that the presence of the signature in human xenografted cells was associated with a downregulation of adipocyte markers in the mouse tissue adjacent to the invasive tumor, suggesting that the signature is triggered by contextual microenvironmental interactions when the cancer cells encounter adipocytes, as previously reported. The known, precise and consistent gene composition of this cancer mesenchymal transition signature, particularly when combined with simultaneous analysis of the adjacent microenvironment, provides unique opportunities for shedding light on the underlying mechanisms of cancer invasiveness as well as identifying potential diagnostic markers and targets for metastasis-inhibiting therapeutics

Hyperbaric environment up-regulates CD15s expression on leukocytes, down-regulates CD77 expression on renal cells and up-regulates CD34 expression on pulmonary and cardiac cells in rat

Directory of Open Access Journals (Sweden)

Danka Đevenica

2016-08-01

Full Text Available Objective(s: The aim of this study was to estimate effects of hyperbaric (HB treatment by determination of CD15s and CD11b leukocyte proinflammatory markers expression.  In addition, this study describes changes in CD77 and CD34 expression on rat endothelial cells in renal, pulmonary and cardiac tissue following exposure to hyperbaric pressure. Materials and Methods:Expression of CD11b and CD15s on leukocytes, as well as CD77 and CD34 expression on endothelial cells in cell suspensions of renal, pulmonary and cardiac tissue in rats after hyperbaric treatment and in control rats were determined by flow cytometry. Results: Hyperbaric treatment significantly increased percentage of leukocytes expressing CD15s+CD11b- (from 1.71±1.11 to 23.42±2.85, P

Cell adhesion molecules expression pattern indicates that somatic cells arbitrate gonadal sex of differentiating bipotential fetal mouse gonad.

Science.gov (United States)

Piprek, Rafal P; Kolasa, Michal; Podkowa, Dagmara; Kloc, Malgorzata; Kubiak, Jacek Z

2017-10-01

Unlike other organ anlagens, the primordial gonad is sexually bipotential in all animals. In mouse, the bipotential gonad differentiates into testis or ovary depending on the genetic sex (XY or XX) of the fetus. During gonad development cells segregate, depending on genetic sex, into distinct compartments: testis cords and interstitium form in XY gonad, and germ cell cysts and stroma in XX gonad. However, our knowledge of mechanisms governing gonadal sex differentiation remains very vague. Because it is known that adhesion molecules (CAMs) play a key role in organogenesis, we suspected that diversified expression of CAMs should also play a crucial role in gonad development. Using microarray analysis we identified 129 CAMs and factors regulating cell adhesion during sexual differentiation of mouse gonad. To identify genes expressed differentially in three cell lines in XY and XX gonads: i) supporting (Sertoli or follicular cells), ii) interstitial or stromal cells, and iii) germ cells, we used transgenic mice expressing EGFP reporter gene and FACS cell sorting. Although a large number of CAMs expressed ubiquitously, expression of certain genes was cell line- and genetic sex-specific. The sets of CAMs differentially expressed in supporting versus interstitial/stromal cells may be responsible for segregation of these two cell lines during gonadal development. There was also a significant difference in CAMs expression pattern between XY supporting (Sertoli) and XX supporting (follicular) cells but not between XY and XX germ cells. This indicates that differential CAMs expression pattern in the somatic cells but not in the germ line arbitrates structural organization of gonadal anlagen into testis or ovary. Copyright © 2017 Elsevier B.V. All rights reserved.

BRCA1-IRIS regulates cyclin D1 expression in breast cancer cells

International Nuclear Information System (INIS)

Nakuci, Enkeleda; Mahner, Sven; DiRenzo, James; ElShamy, Wael M.

2006-01-01

The regulator of cell cycle progression, cyclin D1, is up-regulated in breast cancer cells; its expression is, in part, dependent on ERα signaling. However, many ERα-negative tumors and tumor cell lines (e.g., SKBR3) also show over-expression of cyclin D1. This suggests that, in addition to ERα signaling, cyclin D1 expression is under the control of other signaling pathways; these pathways may even be over-expressed in the ERα-negative cells. We previously noticed that both ERα-positive and -negative cell lines over-express BRCA1-IRIS mRNA and protein. Furthermore, the level of over-expression of BRCA1-IRIS in ERα-negative cell lines even exceeded its over-expression level in ERα-positive cell lines. In this study, we show that: (1) BRCA1-IRIS forms complex with two of the nuclear receptor co-activators, namely, SRC1 and SRC3 (AIB1) in an ERα-independent manner. (2) BRCA1-IRIS alone, or in connection with co-activators, is recruited to the cyclin D1 promoter through its binding to c-Jun/AP1 complex; this binding activates the cyclin D1 expression. (3) Over-expression of BRCA1-IRIS in breast cells over-activates JNK/c-Jun; this leads to the induction of cyclin D1 expression and cellular proliferation. (4) BRCA1-IRIS activation of JNK/c-Jun/AP1 appears to account for this, because in cells that were depleted from BRCA1-IRIS, JNK remained inactive. However, depletion of SRC1 or SRC3 instead reduced c-Jun expression. Our data suggest that this novel signaling pathway links BRCA1-IRIS to cellular proliferation through c-Jun/AP1 nuclear pathway; finally, this culminates in the increased expression of the cyclin D1 gene

Expression of Pluripotency Markers in Nonpluripotent Human Neural Stem and Progenitor Cells

DEFF Research Database (Denmark)

Vincent, P.; Benedikz, Eirikur; Uhlén, Per

2017-01-01

Nonpluripotent neural progenitor cells (NPCs) derived from the human fetal central nervous system were found to express a number of messenger RNA (mRNA) species associated with pluripotency, such as NANOG, REX1, and OCT4. The expression was restricted to small subpopulations of NPCs. In contrast...... to pluripotent stem cells, there was no coexpression of the pluripotency-associated genes studied. Although the expression of these genes rapidly declined during the in vitro differentiation of NPCs, we found no evidence that the discrete expression was associated with the markers of multipotent neural stem...... cells (CD133+/CD24lo), the capacity of sphere formation, or high cell proliferation rates. The rate of cell death among NPCs expressing pluripotency-associated genes was also similar to that of other NPCs. Live cell imaging showed that NANOG- and REX1-expressing NPCs continuously changed morphology...

Mechanisms underlying differential expression of interleukin-8 in breast cancer cells

Science.gov (United States)

Freund, Ariane; Jolivel, Valérie; Durand, Sébastien; Kersual, Nathalie; Chalbos, Dany; Chavey, Carine; Vignon, Françoise; Lazennec, Gwendal

2004-01-01

We have recently reported that Interleukin-8 (IL-8) expression was inversely correlated to estrogen-receptor (ER)-status and was overexpressed in invasive breast cancer cells. In the present study, we show that IL-8 overexpression in breast cancer cells involves a higher transcriptional activity of IL-8 gene promoter. Cloning of IL-8 promoter from MDA-MB-231 and MCF-7 cells expressing high and low levels of IL-8, respectively, shows the integrity of the promoter in both cell lines. Deletion and site-directed mutagenesis of the promoter demonstrate that NF-κB and AP-1 and to a lesser extent C/EBP binding sites play a crucial role in the control of IL-8 promoter activity in MDA-MB-231 cells. Knock-down of NF-κB and AP-1 activities by adenovirus-mediated expression of a NF-κB super-repressor and RNA interference, respectively, decreased IL-8 expression in MDA-MB-231 cells. On the contrary, restoration of Fra-1, Fra-2, c-Jun, p50, p65, C/EBPα and C/EBPβ expression levels in MCF-7 cells led to a promoter activity comparable to that observed in MDA-MB-231 cells. Our data constitute the first extensive study of IL-8 gene overexpression in breast cancer cells and suggest that the high expression of IL-8 in invasive cancer cells requires a complex cooperation between NF-κB, AP-1 and C/EBP transcription factors. PMID:15208657

Distinct gene expression signatures in human embryonic stem cells differentiated towards definitive endoderm at single-cell level

DEFF Research Database (Denmark)

Norrman, Karin; Strömbeck, Anna; Semb, Henrik

2013-01-01

for the three activin A based protocols applied. Our data provide novel insights in DE gene expression at the cellular level of in vitro differentiated human embryonic stem cells, and illustrate the power of using single-cell gene expression profiling to study differentiation heterogeneity and to characterize...... of anterior definitive endoderm (DE). Here, we differentiated human embryonic stem cells towards DE using three different activin A based treatments. Differentiation efficiencies were evaluated by gene expression profiling over time at cell population level. A panel of key markers was used to study DE...... formation. Final DE differentiation was also analyzed with immunocytochemistry and single-cell gene expression profiling. We found that cells treated with activin A in combination with sodium butyrate and B27 serum-free supplement medium generated the most mature DE cells. Cell population studies were...

Impact of cell culture process changes on endogenous retrovirus expression.

Science.gov (United States)

Brorson, Kurt; De Wit, Christina; Hamilton, Elizabeth; Mustafa, Mehnaz; Swann, Patrick G; Kiss, Robert; Taticek, Ron; Polastri, Gian; Stein, Kathryn E; Xu, Yuan

2002-11-05

Cell culture process changes (e.g., changes in scale, medium formulation, operational conditions) and cell line changes are common during the development life cycle of a therapeutic protein. To ensure that the impact of such process changes on product quality and safety is minimal, it is standard practice to compare critical product quality and safety attributes before and after the changes. One potential concern introduced by cell culture process improvements is the possibility of increased endogenous retrovirus expression to a level above the clearance capability of the subsequent purification process. To address this, retrovirus expression was measured in scaled down and full production scaled Chinese hamster ovary (CHO) cell cultures of four monoclonal antibodies and one recombinant protein before and after process changes. Two highly sensitive, quantitative (Q)-PCR-based assays were used to measure endogenous retroviruses. It is shown that cell culture process changes that primarily alter media components, nutrient feed volume, seed density, cell bank source (i.e., master cell bank vs. working cell bank), and vial size, or culture scale, singly or in combination, do not impact the rate of retrovirus expression to an extent greater than the variability of the Q-PCR assays (0.2-0.5 log(10)). Cell culture changes that significantly alter the metabolic state of the cells and/or rates of protein expression (e.g., pH and temperature shifts, NaButyrate addition) measurably impact the rate of retrovirus synthesis (up to 2 log(10)). The greatest degree of variation in endogenous retrovirus expression was observed between individual cell lines (up to 3 log(10)). These data support the practice of measuring endogenous retrovirus output for each new cell line introduced into manufacturing or after process changes that significantly increase product-specific productivity or alter the metabolic state, but suggest that reassessment of retrovirus expression after other

PAX2 regulates ADAM10 expression and mediates anchorage-independent cell growth of melanoma cells.

Directory of Open Access Journals (Sweden)

Sophia Boyoung Lee

Full Text Available PAX transcription factors play an important role during development and carcinogenesis. In this study, we investigated PAX2 protein levels in melanocytes and melanoma cells by Western Blot and immunofluorescence analysis and characterized the role of PAX2 in the pathogenesis of melanoma. In vitro we found weak PAX2 protein expression in keratinocytes and melanocytes. Compared to melanocytes increased PAX2 protein levels were detectable in melanoma cell lines. Interestingly, in tissue sections of melanoma patients nuclear PAX2 expression strongly correlated with nuclear atypia and the degree of prominent nucleoli, indicating an association of PAX2 with a more atypical cellular phenotype. In addition, with chromatin immunoprecipitation assay, PAX2 overexpression and PAX2 siRNA we present compelling evidence that PAX2 can regulate ADAM10 expression, a metalloproteinase known to play important roles in melanoma metastasis. In human tissue samples we found co-expression of PAX2 and ADAM10 in melanocytes of benign nevi and in melanoma cells of patients with malignant melanoma. Importantly, the downregulation of PAX2 by specific siRNA inhibited the anchorage independent cell growth and decreased the migratory and invasive capacity of melanoma cells. Furthermore, the downregulation of PAX2 abrogated the chemoresistance of melanoma cells against cisplatin, indicating that PAX2 expression mediates cell survival and plays important roles during melanoma progression.

Spatial reconstruction of single-cell gene expression

Science.gov (United States)

Satija, Rahul; Farrell, Jeffrey A.; Gennert, David; Schier, Alexander F.; Regev, Aviv

2015-01-01

Spatial localization is a key determinant of cellular fate and behavior, but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast, single-cell RNA-seq allows for deep profiling of cellular gene expression, but established methods separate cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos, inferring a transcriptome-wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches, and used it to identify a set of archetypal expression patterns and spatial markers. Additionally, Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. PMID:25867923

Expression of nicotinic acetylcholine receptors on human B-lymphoma cells

Directory of Open Access Journals (Sweden)

Skok M. V.

2009-12-01

Full Text Available Aim. To find a correlation between the level of nicotinic acetylcholine receptor (nAChR expression and B lymphocyte differentiation or activation state. Methods. Expression of nAChRs in the REH, Ramos and Daudi cell lines was studied by flow cytometry using nAChR subunit-specific antibodies; cell proliferation was studied by MTT test. Results. It is shown that the level of 42/4 and 7 nAChRs expression increased along with B lymphocyte differentiation (Ramos > REH and activation (Daudi > > Ramos and depended on the antigen-specific receptor expression. The nAChR stimulation/blockade did not influence the intensity of cell proliferation.

Establishment of fruit bat cells (Rousettus aegyptiacus as a model system for the investigation of filoviral infection.

Directory of Open Access Journals (Sweden)

Verena Krähling

Full Text Available BACKGROUND: The fruit bat species Rousettus aegyptiacus was identified as a potential reservoir for the highly pathogenic filovirus Marburg virus. To establish a basis for a molecular understanding of the biology of filoviruses in the reservoir host, we have adapted a set of molecular tools for investigation of filovirus replication in a recently developed cell line, R06E, derived from the species Rousettus aegyptiacus. METHODOLOGY/PRINCIPAL FINDINGS: Upon infection with Ebola or Marburg viruses, R06E cells produced viral titers comparable to VeroE6 cells, as shown by TCID(50 analysis. Electron microscopic analysis of infected cells revealed morphological signs of filovirus infection as described for human- and monkey-derived cell lines. Using R06E cells, we detected an unusually high amount of intracellular viral proteins, which correlated with the accumulation of high numbers of filoviral nucleocapsids in the cytoplasm. We established protocols to produce Marburg infectious virus-like particles from R06E cells, which were then used to infect naïve target cells to investigate primary transcription. This was not possible with other cell lines previously tested. Moreover, we established protocols to reliably rescue recombinant Marburg viruses from R06E cells. CONCLUSION/SIGNIFICANCE: These data indicated that R06E cells are highly suitable to investigate the biology of filoviruses in cells derived from their presumed reservoir.

Resveratrol Represses Pokemon Expression in Human Glioma Cells.

Science.gov (United States)

Yang, Yutao; Cui, Jiajun; Xue, Feng; Overstreet, Anne-Marie; Zhan, Yiping; Shan, Dapeng; Li, Hui; Li, Hui; Wang, Yongjun; Zhang, Mengmeng; Yu, Chunjiang; Xu, Zhi-Qing David

2016-03-01

POK erythroid myeloid ontogenic factor (Pokemon), an important proto-oncoprotein, is a transcriptional repressor that regulates the expression of many genes and plays an important role in tumorigenesis. Resveratrol (RSV), a natural polyphenolic compound, has many beneficial biological effects on health. In this study, we investigated the role of Pokemon in RSV-induced biological effects and the effect of RSV on the expression of Pokemon in glioma cells. We found that overexpression of Pokemon decreased RSV-induced cell apoptosis, senescence, and anti-proliferative effects. Moreover, we showed that RSV could efficiently decrease the activity of the Pokemon promoter and the expression of Pokemon. Meanwhile, RSV also inhibited Sp1 DNA binding activity to the Pokemon promoter; whereas, it did not influence the expression and nuclear translocation of Sp1. In addition, we found that RSV could increase the recruitment of HDAC1, but decreased p300 to the Pokemon promoter. Taken together, all these results extended our understanding on the anti-cancer mechanism of RSV in glioma cells.

Expression of GARP selectively identifies activated human FOXP3+ regulatory T cells.

Science.gov (United States)

Wang, Rui; Kozhaya, Lina; Mercer, Frances; Khaitan, Alka; Fujii, Hodaka; Unutmaz, Derya

2009-08-11

The molecules that define human regulatory T cells (Tregs) phenotypically and functionally remain to be fully characterized. We recently showed that activated human Tregs express mRNA for a transmembrane protein called glycoprotein A repetitions predominant (GARP, or LRRC32). Here, using a GARP-specific mAb, we demonstrate that expression of GARP on activated Tregs correlates with their suppressive capacity. However, GARP was not induced on T cells activated in the presence of TGFbeta, which expressed high levels of FOXP3 and lacked suppressive function. Ectopic expression of FOXP3 in conventional T cells was also insufficient for induction of GARP expression in most donors. Functionally, silencing GARP in Tregs only moderately attenuated their suppressive activity. CD25+ T cells sorted for high GARP expression displayed more potent suppressive activity compared with CD25+GARP- cells. Remarkably, CD25+GARP- T cells expanded in culture contained 3-5 fold higher IL-17-secreting cells compared with either CD25+GARP+ or CD25-GARP- cells, suggesting that high GARP expression can potentially discriminate Tregs from those that have switched to Th17 lineage. We also determined whether GARP expression correlates with FOXP3-expressing T cells in human immunodeficiency virus (HIV) -infected subjects. A subset of HIV+ individuals with high percentages of FOXP3+ T cells did not show proportionate increase in GARP+ T cells. This finding suggests that higher FOXP3 levels observed in these HIV+ individuals is possibly due to immune activation rather than to an increase in Tregs. Our findings highlight the significance of GARP both in dissecting duality of Treg/Th17 cell differentiation and as a marker to identify bona fide Tregs during diseases with chronic immune activation.

Dynamic methylation and expression of Oct4 in early neural stem cells.

Science.gov (United States)

Lee, Shih-Han; Jeyapalan, Jennie N; Appleby, Vanessa; Mohamed Noor, Dzul Azri; Sottile, Virginie; Scotting, Paul J

2010-09-01

Neural stem cells are a multipotent population of tissue-specific stem cells with a broad but limited differentiation potential. However, recent studies have shown that over-expression of the pluripotency gene, Oct4, alone is sufficient to initiate a process by which these can form 'induced pluripotent stem cells' (iPS cells) with the same broad potential as embryonic stem cells. This led us to examine the expression of Oct4 in endogenous neural stem cells, as data regarding its expression in neural stem cells in vivo are contradictory and incomplete. In this study we have therefore analysed the expression of Oct4 and other genes associated with pluripotency throughout development of the mouse CNS and in neural stem cells grown in vitro. We find that Oct4 is still expressed in the CNS by E8.5, but that this expression declines rapidly until it is undetectable by E15.5. This decline is coincident with the gradual methylation of the Oct4 promoter and proximal enhancer. Immunostaining suggests that the Oct4 protein is predominantly cytoplasmic in location. We also found that neural stem cells from all ages expressed the pluripotency associated genes, Sox2, c-Myc, Klf4 and Nanog. These data provide an explanation for the varying behaviour of cells from the early neuroepithelium at different stages of development. The expression of these genes also provides an indication of why Oct4 alone is sufficient to induce iPS formation in neural stem cells at later stages.

Development of a Novel, Ultra-rapid Biosensor for the Qualitative Detection of Hepatitis B Virus-associated Antigens and Anti-HBV, Based on “Membrane-engineered” Fibroblast Cells with Virus-Specific Antibodies and Antigens

Directory of Open Access Journals (Sweden)

Antonios Perdikaris

2009-03-01

Full Text Available A novel miniature cell biosensor detection system for the detection of Hepatis B virus (HBV-associated antigens and anti-HBV is described. The biosensor is based on “membrane-engineered” Vero fibroblast cells immobilized in an alginate matrix. The membrane-engineering process involved the electroinsertion of anti-HBV specific antibodies (anti-HBs, anti-HBe or antigens (HBsAg in the membranes of the Vero cells. The attachment of a homologous antigen to the electroinserted antibody (or, respectively, of the antibody to the electroinserted antigen triggered specific changes to the cell membrane potential that were measured by appropriate microelectrodes, according to the principle of the Bioelectric Recognition Assay (BERA. The sensor was used for screening 133 clinical blood serum samples according to a double-blind protocol. Considerably higher sensor responses were observed against HBV-positive samples, compared with responses against negative samples or samples positive for heterologous hepatitis viruses such as Hepatitis C (HCV virus. Detection of anti-HBs antibodies was made possible by using a biosensor based on immobilized Vero cells bearing the respective antigen (HBsAg. The observed response was rapid (45 sec and quite reproducible. Fluorescence microscopy observations showed that attachment of HBV particles to cells membrane-engineered with anti-HBs was associated with a decrease of [Ca2+]cyt. The perspectives for using the novel biosensor as a qualitative, rapid screening, high throughput assay for HBV antigens and anti-HBs in clinical samples is discussed.

Single-cell real-time imaging of transgene expression upon lipofection

Energy Technology Data Exchange (ETDEWEB)

Fiume, Giuseppe [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); Di Rienzo, Carmine [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); NEST, Scuola Normale Superiore and Istituto Nanoscienze-CNR, Piazza San Silvestro 12, 56127, Pisa (Italy); Marchetti, Laura [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy); Pozzi, Daniela; Caracciolo, Giulio [Department of Molecular Medicine, “Sapienza” University of Rome, Viale Regina Elena 291, 00161, Rome (Italy); Cardarelli, Francesco, E-mail: francesco.cardarelli@iit.it [Center for Nanotechnology Innovation @NEST, Istituto Italiano di Tecnologia, Piazza San Silvestro 12, 56127 Pisa (Italy)

2016-05-20

Here we address the process of lipofection by quantifying the expression of a genetically-encoded fluorescent reporter at the single-cell level, and in real-time, by confocal imaging in live cells. The Lipofectamine gold-standard formulation is compared to the alternative promising DC-Chol/DOPE formulation. In both cases, we report that only dividing cells are able to produce a detectable amount of the fluorescent reporter protein. Notably, by measuring fluorescence over time in each pair of daughter cells, we find that Lipofectamine-based transfection statistically yields a remarkably higher degree of “symmetry” in protein expression between daughter cells as compared to DC-Chol/DOPE. A model is envisioned in which the degree of symmetry of protein expression is linked to the number of bioavailable DNA copies within the cell before nuclear breakdown. Reported results open new perspectives for the understanding of the lipofection mechanism and define a new experimental platform for the quantitative comparison of transfection reagents. -- Highlights: •The process of lipofection is followed by quantifying the transgene expression in real time. •The Lipofectamine gold-standard is compared to the promising DC-Chol/DOPE formulation. •We report that only dividing cells are able to produce the fluorescent reporter protein. •The degree of symmetry of protein expression in daughter cells is linked to DNA bioavailability. •A new experimental platform for the quantitative comparison of transfection reagents is proposed.

Single-cell real-time imaging of transgene expression upon lipofection

International Nuclear Information System (INIS)

Fiume, Giuseppe; Di Rienzo, Carmine; Marchetti, Laura; Pozzi, Daniela; Caracciolo, Giulio; Cardarelli, Francesco

2016-01-01

Here we address the process of lipofection by quantifying the expression of a genetically-encoded fluorescent reporter at the single-cell level, and in real-time, by confocal imaging in live cells. The Lipofectamine gold-standard formulation is compared to the alternative promising DC-Chol/DOPE formulation. In both cases, we report that only dividing cells are able to produce a detectable amount of the fluorescent reporter protein. Notably, by measuring fluorescence over time in each pair of daughter cells, we find that Lipofectamine-based transfection statistically yields a remarkably higher degree of “symmetry” in protein expression between daughter cells as compared to DC-Chol/DOPE. A model is envisioned in which the degree of symmetry of protein expression is linked to the number of bioavailable DNA copies within the cell before nuclear breakdown. Reported results open new perspectives for the understanding of the lipofection mechanism and define a new experimental platform for the quantitative comparison of transfection reagents. -- Highlights: •The process of lipofection is followed by quantifying the transgene expression in real time. •The Lipofectamine gold-standard is compared to the promising DC-Chol/DOPE formulation. •We report that only dividing cells are able to produce the fluorescent reporter protein. •The degree of symmetry of protein expression in daughter cells is linked to DNA bioavailability. •A new experimental platform for the quantitative comparison of transfection reagents is proposed.

HIV-1 induces DCIR expression in CD4+ T cells.

Directory of Open Access Journals (Sweden)

Alexandra A Lambert

2010-11-01

Full Text Available The C-type lectin receptor DCIR, which has been shown very recently to act as an attachment factor for HIV-1 in dendritic cells, is expressed predominantly on antigen-presenting cells. However, this concept was recently challenged by the discovery that DCIR can also be detected in CD4(+ T cells found in the synovial tissue from rheumatoid arthritis (RA patients. Given that RA and HIV-1 infections share common features such as a chronic inflammatory condition and polyclonal immune hyperactivation status, we hypothesized that HIV-1 could promote DCIR expression in CD4(+ T cells. We report here that HIV-1 drives DCIR expression in human primary CD4(+ T cells isolated from patients (from both aviremic/treated and viremic/treatment naive persons and cells acutely infected in vitro (seen in both virus-infected and uninfected cells. Soluble factors produced by virus-infected cells are responsible for the noticed DCIR up-regulation on uninfected cells. Infection studies with Vpr- or Nef-deleted viruses revealed that these two viral genes are not contributing to the mechanism of DCIR induction that is seen following acute infection of CD4(+ T cells with HIV-1. Moreover, we report that DCIR is linked to caspase-dependent (induced by a mitochondria-mediated generation of free radicals and -independent intrinsic apoptotic pathways (involving the death effector AIF. Finally, we demonstrate that the higher surface expression of DCIR in CD4(+ T cells is accompanied by an enhancement of virus attachment/entry, replication and transfer. This study shows for the first time that HIV-1 induces DCIR membrane expression in CD4(+ T cells, a process that might promote virus dissemination throughout the infected organism.

E-cadherin expression increases cell proliferation by regulating energy metabolism through nuclear factor-κB in AGS cells.

Science.gov (United States)

Park, Song Yi; Shin, Jee-Hye; Kee, Sun-Ho

2017-09-01

β-Catenin is a central player in Wnt signaling, and activation of Wnt signaling is associated with cancer development. E-cadherin in complex with β-catenin mediates cell-cell adhesion, which suppresses β-catenin-dependent Wnt signaling. Recently, a tumor-suppressive role for E-cadherin has been reconsidered, as re-expression of E-cadherin was reported to enhance the metastatic potential of malignant tumors. To explore the role of E-cadherin, we established an E-cadherin-expressing cell line, EC96, from AGS cells that featured undetectable E-cadherin expression and a high level of Wnt signaling. In EC96 cells, E-cadherin re-expression enhanced cell proliferation, although Wnt signaling activity was reduced. Subsequent analysis revealed that nuclear factor-κB (NF-κB) activation and consequent c-myc expression might be involved in E-cadherin expression-mediated cell proliferation. To facilitate rapid proliferation, EC96 cells enhance glucose uptake and produce ATP using both mitochondria oxidative phosphorylation and glycolysis, whereas AGS cells use these mechanisms less efficiently. These events appeared to be mediated by NF-κB activation. Therefore, E-cadherin re-expression and subsequent induction of NF-κB signaling likely enhance energy production and cell proliferation. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Regulated gene expression in cultured type II cells of adult human lung.

Science.gov (United States)

Ballard, Philip L; Lee, Jae W; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R; Fischer, Horst; Illek, Beate; Gonzales, Linda W; Kolla, Venkatadri; Matthay, Michael A

2010-07-01

Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at approximately 95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for approximately 4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of approximately 3% of probed genes by > or =1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (> or =10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells.

Tracking neuronal marker expression inside living differentiating cells using molecular beacons

DEFF Research Database (Denmark)

Ilieva, Mirolyuba; Della Vedova, Paolo; Hansen, Ole

2013-01-01

and tyrosine hydroxylase mRNAs were expressed 2 and 3 days post induction of differentiation, respectively. Oct 4 was not detected with MB in these cells and signal was not increased over time suggesting that MB are generally stable inside the cells. The gene expression changes measured using MBs were...... confirmed using qRT-PCR. These results suggest that MBs are simple to use sensors inside living cell, and particularly useful for studying dynamic gene expression in heterogeneous cell populations....

STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma

DEFF Research Database (Denmark)

Brender, C; Nielsen, M; Kaltoft, K

2001-01-01

) obtained from affected skin from a patient with mycosis fungoides (MF) and from peripheral blood from a patient with Sezary syndrome (SS). In contrast, constitutive SOCS-3 expression is not found in the leukemic Jurkat T-cell line, the MOLT-4 acute lymphoblastic leukemia cell line, and the monocytic......, it has been hypothesized that an aberrant SOCS expression plays a role in neoplastic transformation. This study reports on a constitutive SOCS-3 expression in cutaneous T-cell lymphoma (CTCL) cell lines. SOCS-3 protein is constitutively expressed in tumor cell lines (but not in nonmalignant T cells...... leukemic cell line U937. Expression of SOCS-3 coincides with a constitutive activation of STAT3 in CTCL tumor cells, and stable transfection of CTCL tumor cells with a dominant negative STAT3 strongly inhibits SOCS-3 expression, whereas transfection with wild-type STAT3 does not. Moreover, the reduced SOCS...

The regulation of CD5 expression in murine T cells

Directory of Open Access Journals (Sweden)

Herzenberg Leonard A

2001-05-01

Full Text Available Abstract Background CD5 is a pan-T cell surface marker that is also present on a subset of B cells, B-1a cells.Functional and developmental subsets of T cells express characteristic CD5 levels that vary over roughly a 30-fold range. Previous investigators have cloned a 1.7 Kb fragment containing the CD5 promoter and showed that it can confer similar lymphocyte-specific expression pattern as observed for endogenous CD5 expression. Results We further characterize the CD5 promoter and identify minimal and regulatory regions on the CD5 promoter. Using a luciferase reporter system, we show that a 43 bp region on the CD5 promoter regulates CD5 expression in resting mouse thymoma EL4 T cells and that an Ets binding site within the 43 bp region mediates the CD5 expression. In addition, we show that Ets-1, a member of the Ets family of transcription factors, recognizes the Ets binding site in the electrophoretic mobility shift assay (EMSA. This Ets binding site is directly responsible for the increase in reporter activity when co-transfected with increasing amounts of Ets-1 expression plasmid. We also identify two additional evolutionarily-conserved regions in the CD5 promoter (CD5X and CD5Y and demonstrate the respective roles of the each region in the regulation of CD5 transcription. Conclusion Our studies define a minimal and regulatory promoter for CD5 and show that the CD5 expression level in T cells is at least partially dependent on the level of Ets-1 protein. Based on the findings in this report, we propose a model of CD5 transcriptional regulation in T cells.

Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

Energy Technology Data Exchange (ETDEWEB)

Aires, M.B. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, J.R.A. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Souza, K.S.; Farias, P.S. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Santos, A.C.V. [Departamento de Enfermagem, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Fioretto, E.T. [Departamento de Morfologia, Universidade Federal de Sergipe, São Cristóvão, SE (Brazil); Maria, D.A. [Laboratório de Bioquímica e Biofísica, Instituto Butantan, São Paulo, SP (Brazil)

2015-07-10

The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers.

Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes

International Nuclear Information System (INIS)

Aires, M.B.; Santos, J.R.A.; Souza, K.S.; Farias, P.S.; Santos, A.C.V.; Fioretto, E.T.; Maria, D.A.

2015-01-01

The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female Wistar rats (200-250 g) with induced diabetes (alloxan, 37 mg/kg) on the 8th gestational day (gd 8). At gd 15, rats from control (n=5) and diabetic (n=5) groups were anesthetized and laparotomized to remove the uterine horns for weighing of fetuses and collecting the VYS. Flow cytometry was used for characterizing VYS cells, and for determining mitochondrial activity, cell proliferation, DNA ploidy, cell cycle phases, and caspase-3 activity. Fetal weight was reduced in the diabetic group. Expression of the cell markers CD34, VEGFR1, CD115, CD117, CD14, CCR2, CD90, CD44, STRO-1, OCT3/4, and Nanog was detected in VYS cells in both groups. In the diabetic group, significantly decreased expression of CD34 (P<0.05), CCR2 (P<0.001), and OCT3/4 (P<0.01), and significantly increased expression of CD90 (P<0.05), CD117 (P<0.01), and CD14 (P<0.05) were observed. VYS cells with inactive mitochondria, activated caspase-3, and low proliferation were present in the rats with diabetes. Severe hyperglycemia caused by maternal diabetes had negative effects on pregnancy, VYS cell viability, and the expression of cell markers

Fed-batch bioreactor performance and cell line stability evaluation of the artificial chromosome expression technology expressing an IgG1 in Chinese hamster ovary cells.

Science.gov (United States)

Combs, Rodney G; Yu, Erwin; Roe, Susanna; Piatchek, Michele Bailey; Jones, Heather L; Mott, John; Kennard, Malcolm L; Goosney, Danika L; Monteith, Diane

2011-01-01

The artificial chromosome expression (ACE) technology system uses an engineered artificial chromosome containing multiple site-specific recombination acceptor sites for the rapid and efficient construction of stable cell lines. The construction of Chinese hamster ovary(CHO) cell lines expressing an IgG1 monoclonal antibody (MAb) using the ACE system has been previously described (Kennard et al., Biotechnol Bioeng. 2009;104:540-553). To further demonstrate the manufacturing feasibility of the ACE system, four CHO cell lines expressing the human IgG1 MAb 4A1 were evaluated in batch and fed-batch shake flasks and in a 2-L fed-batch bioreactor. The batch shake flasks achieved titers between 0.7 and 1.1 g/L, whereas the fed-batch shake flask process improved titers to 2.5–3.0 g/L. The lead 4A1 ACE cell line achieved titers of 4.0 g/L with an average specific productivity of 40 pg/(cell day) when cultured in a non optimized 2-L fed-batch bioreactor using a completely chemically defined process. Generational stability characterization of the lead 4A1-expressing cell line demonstrated that the cell line was stable for up to 75 days in culture. Product quality attributes of the 4A1 MAb produced by the ACE system during the stability evaluation period were unchanged and also comparable to existing expression technologies such as the CHO-dhfr system. The results of this evaluation demonstrate that a clonal, stable MAb-expressing CHO cell line can be produced using ACE technology that performs competitively using a chemically defined fed-batch bioreactor process with comparable product quality attributes to cell lines generated by existing technologies.