DEFF Research Database (Denmark)
Lorenzen, Niels; Cupit, P.M.; Secombes, C.J.
2000-01-01
and their neutralising activity was evident. Binding kinetic analyses by plasmon resonance identified differences in the dissociation rate constant (kd) as a possible explanation for the different reactivity levels of the MAbs. The Ig variable heavy (VH) and light (V kappa) domain gene sequences of the three hybridomas...... were compared. The inferred amino acid sequence of the two neutralising antibody VH domains differed by three amino acid residues (97% identity) and only one residue difference was evident in the Vk. domains. In contrast, IP1H3 shared only 38 and 39% identity with the 3F1A2 and 3F1H10 VH domains...... respectively and 49 and 50% identity with the 3F1A2 and 3F1H10 VK domains respectively. The neutralising antibodies were produced by hybridomas originating from the same fusion and the high nucleotide sequence homology of the variable Ig gene regions indicated that the plasma cell partners of the hybridomas...
Perez, M; Pacchiarotti, A; Frontani, M; Pescarmona, E; Caprini, E; Lombardo, G A; Russo, G; Faraggiana, T
2010-03-01
Accurate assessment of the somatic mutational status of clonal immunoglobulin variable region (IgV) genes is relevant in elucidating tumour cell origin in B-cell lymphoma; virgin B cells bear unmutated IgV genes, while germinal centre and postfollicular B cells carry mutated IgV genes. Furthermore, biases in the IgV repertoire and distribution pattern of somatic mutations indicate a possible antigen role in the pathogenesis of B-cell malignancies. This work investigates the cellular origin and antigenic selection in primary cutaneous B-cell lymphoma (PCBCL). We analysed the nucleotide sequence of clonal IgV heavy-chain gene (IgVH) rearrangements in 51 cases of PCBCL (25 follicle centre, 19 marginal zone and seven diffuse large B-cell lymphoma, leg-type) and compared IgVH sequences with their closest germline segment in the GenBank database. Molecular data were then correlated with histopathological features. We showed that all but one of the 51 IgVH sequences analysed exhibited extensive somatic hypermutations. The detected mutation rate ranged from 1.6% to 21%, with a median rate of 9.8% and was independent of PCBCL histotype. Calculation of antigen-selection pressure showed that 39% of the mutated IgVH genes displayed a number of replacement mutations and silent mutations in a pattern consistent with antigenic selection. Furthermore, two segments, VH1-69 (12%) and VH4-59 (14%), were preferentially used in our case series. Data indicate that neoplastic B cells of PBCBL have experienced germinal centre reaction and also suggest that the involvement of IgVH genes is not entirely random in PCBCL and that common antigen epitopes could be pathologically relevant in cutaneous lymphomagenesis.
Allegrucci, M; Newman, B A; Young-Cooper, G O; Alexander, C B; Meier, D; Kelus, A S; Mage, R G
1990-07-01
Rabbits of the Alicia strain have a mutation (ali) that segregates with the immunoglobulin heavy-chain (lgh) locus and has a cis effect upon the expression of heavy-chain variable-region (VH) genes encoding the a2 allotype. In heterozygous a1/ali or a3/ali rabbits, serum immunoglobulins are almost entirely the products of the normal a1 or a3 allele and only traces of a2 immunoglobulin are detectable. Adult homozygous ali/ali rabbits likewise have normal immunoglobulin levels resulting from increased production of a-negative immunoglobulins and some residual ability to produce the a2 allotype. By contrast, the majority of the immunoglobulins of wild-type a2 rabbits are a2-positive and only a small percentage are a-negative. Genomic DNAs from homozygous mutant and wild-type animals were indistinguishable by Southern analyses using a variety of restriction enzyme digests and lgh probes. However, when digests with infrequently cutting enzymes were analyzed by transverse alternating-field electrophoresis, the ali DNA fragments were 10-15 kilobases smaller than the wild type. These fragments hybridized to probes both for VH and for a region of DNA a few kilobases downstream of the VH genes nearest the joining region. We suggest that this relatively small deletion affects a segment containing 3' VH genes with important regulatory functions, the loss of which leads to the ali phenotype. These results, and the fact that the 3' VH genes rearrange early in B-cell development, indicate that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression.
Comparing domain interactions within antibody Fabs with kappa and lambda light chains.
Toughiri, Raheleh; Wu, Xiufeng; Ruiz, Diana; Huang, Flora; Crissman, John W; Dickey, Mark; Froning, Karen; Conner, Elaine M; Cujec, Thomas P; Demarest, Stephen J
2016-10-01
IgG antibodies are multi-domain proteins with complex inter-domain interactions. Human IgG heavy chains (HCs) associate with light chains (LCs) of the κ or λ isotype to form mature antibodies capable of binding antigen. The HC/LC interaction involves 4 domains: VH and CH1 from the HC and VL and CL from the LC. Human Fabs with κ LCs have been well characterized for their unfolding behaviors and demonstrate a significant level of cooperativity and stabilization when all 4 domains are intact. Very little is known regarding the thermodynamic properties of human Fabs with λ LCs. Here, we dissect the domain contributions to Fab stability for both κ and λ LC-containing Fabs. We find the cooperativity of unfolding between the constant domains, CH1/Cλ, and variable domains, VH/Vλ, within λ LC-containing Fabs is significantly weaker than that of κ LC-containing Fabs. The data suggests there may not be an evolutionary necessity for strong variable/constant domain cooperativity within λ LC-containing Fabs. After investigating the biophysical properties of Fabs with mismatched variable and constant domain subunits (e.g., VH/Vκ paired with CH1/Cλ or T cell receptor Cα/Cβ), the major role of the constant domains for both κ- and λ-containing Fabs may be to reduce the hydrophobic exposure at the VH/VL interface. Even though Fabs with these non-native pairings were thermodynamically less stable, they secreted well from mammalian cells as well behaved monodisperse proteins, which was in contrast to what was observed with the VH/Vκ and VH/Vλ scFvs that secreted as a mixture of monomer and aggregates.
Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin
2015-10-01
To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.
A residue-specific shift in stability and amyloidogenicity of antibody variable domains.
Nokwe, Cardine N; Zacharias, Martin; Yagi, Hisashi; Hora, Manuel; Reif, Bernd; Goto, Yuji; Buchner, Johannes
2014-09-26
Variable (V) domains of antibodies are essential for antigen recognition by our adaptive immune system. However, some variants of the light chain V domains (VL) form pathogenic amyloid fibrils in patients. It is so far unclear which residues play a key role in governing these processes. Here, we show that the conserved residue 2 of VL domains is crucial for controlling its thermodynamic stability and fibril formation. Hydrophobic side chains at position 2 stabilize the domain, whereas charged residues destabilize and lead to amyloid fibril formation. NMR experiments identified several segments within the core of the VL domain to be affected by changes in residue 2. Furthermore, molecular dynamic simulations showed that hydrophobic side chains at position 2 remain buried in a hydrophobic pocket, and charged side chains show a high flexibility. This results in a predicted difference in the dissociation free energy of ∼10 kJ mol(-1), which is in excellent agreement with our experimental values. Interestingly, this switch point is found only in VL domains of the κ family and not in VLλ or in VH domains, despite a highly similar domain architecture. Our results reveal novel insight into the architecture of variable domains and the prerequisites for formation of amyloid fibrils. This might also contribute to the rational design of stable variable antibody domains. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Steiniger, Sebastian C J; Dunkle, William E; Bammert, Gary F; Wilson, Thomas L; Krishnan, Abhiram; Dunham, Steven A; Ippolito, Gregory C; Bainbridge, Graeme
2014-05-01
Complementarity determining regions (CDR) are responsible for binding antigen and provide substantial diversity to the antibody repertoire, with VH CDR3 of the immunoglobulin variable heavy (VH) domain playing a dominant role. In this study, we examined 1200 unique canine VH and 500 unique variable light (VL) sequences of large and small canine breeds derived from peripheral B cells. Unlike the human and murine repertoire, the canine repertoire is heavily dominated by the Canis lupus familiaris IGHV1 subgroup, evolutionarily closest to the human IGHV3 subgroup. Our studies clearly show that the productive canine repertoire of all analyzed breeds shows similarities to both human and mouse; however, there are distinct differences in terms of VH CDR3 length and amino acid paratope composition. In comparison with the human and murine antibody repertoire, canine VH CDR3 regions are shorter in length than the human counterparts, but longer than the murine VH CDR3. Similar to corresponding human and mouse VH CDR3, the amino acids at the base of the VH CDR3 loop are strictly conserved. For identical CDR positions, there were significant changes in chemical paratope composition. Similar to human and mouse repertoires, the neutral amino acids tyrosine, glycine and serine dominate the canine VH CDR3 interval (comprising 35%) although the interval is nonetheless relatively depleted of tyrosine when compared to human and mouse. Furthermore, canine VH CDR3 displays an overrepresentation of the neutral amino acid threonine and the negatively charged aspartic acid while proline content is similar to that in the human repertoire. In general, the canine repertoire shows a bias towards small, negatively charged amino acids. Overall, this analysis suggests that functional canine therapeutic antibodies can be obtained from human and mouse sequences by methods of speciation and affinity maturation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chen, H T; Alexander, C B; Mage, R G
1995-06-15
Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.
Contribution of V(H replacement products in mouse antibody repertoire.
Directory of Open Access Journals (Sweden)
Lin Huang
Full Text Available VH replacement occurs through RAG-mediated recombination between the cryptic recombination signal sequence (cRSS near the 3' end of a rearranged VH gene and the 23-bp RSS from an upstream unrearranged VH gene. Due to the location of the cRSS, VH replacement leaves a short stretch of nucleotides from the previously rearranged VH gene at the newly formed V-D junction, which can be used as a marker to identify VH replacement products. To determine the contribution of VH replacement products to mouse antibody repertoire, we developed a Java-based VH Replacement Footprint Analyzer (VHRFA program and analyzed 17,179 mouse IgH gene sequences from the NCBI database to identify VH replacement products. The overall frequency of VH replacement products in these IgH genes is 5.29% based on the identification of pentameric VH replacement footprints at their V-D junctions. The identified VH replacement products are distributed similarly in IgH genes using most families of VH genes, although different families of VH genes are used differentially. The frequencies of VH replacement products are significantly elevated in IgH genes derived from several strains of autoimmune prone mice and in IgH genes encoding autoantibodies. Moreover, the identified VH replacement footprints in IgH genes from autoimmune prone mice or IgH genes encoding autoantibodies preferentially encode positively charged amino acids. These results revealed a significant contribution of VH replacement products to the diversification of antibody repertoire and potentially, to the generation of autoantibodies in mice.
Asano, Ryutaro; Nagai, Keisuke; Makabe, Koki; Takahashi, Kento; Kumagai, Takashi; Kawaguchi, Hiroko; Ogata, Hiromi; Arai, Kyoko; Umetsu, Mitsuo; Kumagai, Izumi
2018-03-02
We previously reported a functional humanized bispecific diabody (bsDb) that targeted EGFR and CD3 (hEx3-Db) and enhancement of its cytotoxicity by rearranging the domain order in the V domain. Here, we further dissected the effect of domain order in bsDbs on their cross-linking ability and binding kinetics to elucidate general rules regarding the design of functional bsDbs. Using Ex3-Db as a model system, we first classified the four possible domain orders as anti-parallel (where both chimeric single-chain components are variable heavy domain (VH)-variable light domain (VL) or VL-VH order) and parallel types (both chimeric single-chain components are mixed with VH-VL and VL-VH order). Although anti-parallel Ex3-Dbs could cross-link the soluble target antigens, their cross-linking ability between soluble targets had no correlation with their growth inhibitory effects. In contrast, the binding affinity of one of the two constructs with a parallel-arrangement V domain was particularly low, and structural modeling supported this phenomenon. Similar results were observed with E2x3-Dbs, in which the V region of the anti-EGFR antibody clone in hEx3 was replaced with that of another anti-EGFR clone. Only anti-parallel types showed affinity-dependent cancer inhibitory effects in each molecule, and E2x3-LH (both components in VL-VH order) showed the most intense anti-tumor activity in vitro and in vivo . Our results showed that, in addition to rearranging the domain order of bsDbs, increasing their binding affinity may be an ideal strategy for enhancing the cytotoxicity of anti-parallel constructs and that E2x3-LH is particularly attractive as a candidate next-generation anti-cancer drug.
Directory of Open Access Journals (Sweden)
Radhika Thokala
Full Text Available Adoptive immunotherapy infusing T cells with engineered specificity for CD19 expressed on B- cell malignancies is generating enthusiasm to extend this approach to other hematological malignancies, such as acute myelogenous leukemia (AML. CD123, or interleukin 3 receptor alpha, is overexpressed on most AML and some lymphoid malignancies, such as acute lymphocytic leukemia (ALL, and has been an effective target for T cells expressing chimeric antigen receptors (CARs. The prototypical CAR encodes a VH and VL from one monoclonal antibody (mAb, coupled to a transmembrane domain and one or more cytoplasmic signaling domains. Previous studies showed that treatment of an experimental AML model with CD123-specific CAR T cells was therapeutic, but at the cost of impaired myelopoiesis, highlighting the need for systems to define the antigen threshold for CAR recognition. Here, we show that CARs can be engineered using VH and VL chains derived from different CD123-specific mAbs to generate a panel of CAR+ T cells. While all CARs exhibited specificity to CD123, one VH and VL combination had reduced lysis of normal hematopoietic stem cells. This CAR's in vivo anti-tumor activity was similar whether signaling occurred via chimeric CD28 or CD137, prolonging survival in both AML and ALL models. Co-expression of inducible caspase 9 eliminated CAR+ T cells. These data help support the use of CD123-specific CARs for treatment of CD123+ hematologic malignancies.
Draft Genome Sequences of the Fish Pathogen Vibrio harveyi Strains VH2 and VH5
DEFF Research Database (Denmark)
Castillo, Daniel; D'Alvise, Paul; Middelboe, Mathias
2015-01-01
Vibrio harveyi is an important marine pathogen that is responsible for vibriosis outbreaks in cultured fish and invertebrates worldwide. Here, we announce the draft genome sequences of V. harveyi strains VH2 and VH5, isolated from farmed juvenile Seriola dumerili during outbreaks of vibriosis...... in Crete, Greece....
Co-evolution of affinity and stability of grafted amyloid-motif domain antibodies.
Julian, Mark C; Lee, Christine C; Tiller, Kathryn E; Rabia, Lilia A; Day, Evan K; Schick, Arthur J; Tessier, Peter M
2015-10-01
An attractive approach for designing lead antibody candidates is to mimic natural protein interactions by grafting peptide recognition motifs into the complementarity-determining regions (CDRs). We are using this approach to generate single-domain (VH) antibodies specific for amyloid-forming proteins such as the Alzheimer's Aβ peptide. Here, we use random mutagenesis and yeast surface display to improve the binding affinity of a lead VH domain grafted with Aβ residues 33-42 in CDR3. Interestingly, co-selection for improved Aβ binding and VH display on the surface of yeast yields antibody domains with improved affinity and reduced stability. The highest affinity VH domains were strongly destabilized on the surface of yeast as well as unfolded when isolated as autonomous domains. In contrast, stable VH domains with improved affinity were reliably identified using yeast surface display by replacing the display antibody that recognizes a linear epitope tag at the terminus of both folded and unfolded VH domains with a conformational ligand (Protein A) that recognizes a discontinuous epitope on the framework of folded VH domains. Importantly, we find that selection for improved stability using Protein A without simultaneous co-selection for improved Aβ binding leads to strong enrichment for stabilizing mutations that reduce antigen binding. Our findings highlight the importance of simultaneously optimizing affinity and stability to improve the rapid isolation of well-folded and specific antibody fragments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie
2013-01-01
This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156
Data of evolutionary structure change: 1JOEA-1VH2A [Confc[Archive
Lifescience Database Archive (English)
Full Text Available ID>1VH2 A 1VH2A RDHLE----GVVDV ...>H ---- EEe> ATOM 480 CA ARG A 68 6.679 -2...entryIDChain> RDHLNGDSIEIIDI >H EE> 1VH2 A 1VH2A GHDQP--IPGVS ...e> -- > ATOM 806 CA GLY A 112 3.574 -8
B lymphocyte selection and age-related changes in VH gene usage in mutant Alicia rabbits.
Zhu, X; Boonthum, A; Zhai, S K; Knight, K L
1999-09-15
Young Alicia rabbits use VHa-negative genes, VHx and VHy, in most VDJ genes, and their serum Ig is VHa negative. However, as Alicia rabbits age, VHa2 allotype Ig is produced at high levels. We investigated which VH gene segments are used in the VDJ genes of a2 Ig-secreting hybridomas and of a2 Ig+ B cells from adult Alicia rabbits. We found that 21 of the 25 VDJ genes used the a2-encoding genes, VH4 or VH7; the other four VDJ genes used four unknown VH gene segments. Because VH4 and VH7 are rarely found in VDJ genes of normal or young Alicia rabbits, we investigated the timing of rearrangement of these genes in Alicia rabbits. During fetal development, VH4 was used in 60-80% of nonproductively rearranged VDJ genes, and VHx and VHy together were used in 10-26%. These data indicate that during B lymphopoiesis VH4 is preferentially rearranged. However, the percentage of productive VHx- and VHy-utilizing VDJ genes increased from 38% at day 21 of gestation to 89% at birth (gestation day 31), whereas the percentage of VH4-utilizing VDJ genes remained at 15%. These data suggest that during fetal development, either VH4-utilizing B-lineage cells are selectively eliminated, or B cells with VHx- and VHy-utilizing VDJ genes are selectively expanded, or both. The accumulation of peripheral VH4-utilizing a2 B cells with age indicates that these B cells might be selectively expanded in the periphery. We discuss the possible selection mechanisms that regulate VH gene segment usage in rabbit B cells during lymphopoiesis and in the periphery.
Diversity and repertoire of IgW and IgM VH families in the newborn nurse shark.
Rumfelt, Lynn L; Lohr, Rebecca L; Dooley, Helen; Flajnik, Martin F
2004-05-06
Adult cartilaginous fish express three immunoglobulin (Ig) isotypes, IgM, IgNAR and IgW. Newborn nurse sharks, Ginglymostoma cirratum, produce 19S (multimeric) IgM and monomeric/dimeric IgM1gj, a germline-joined, IgM-related VH, and very low amounts of 7S (monomeric) IgM and IgNAR proteins. Newborn IgNAR VH mRNAs are diverse in the complementarity-determining region 3 (CDR3) with non-templated nucleotide (N-region) addition, which suggests that, unlike in many other vertebrates, terminal deoxynucleotidyl transferase (TdT) expressed at birth is functional. IgW is present in the lungfish, a bony fish sharing a common ancestor with sharks 460 million years ago, implying that the IgW VH family is as old as the IgM VH family. This nurse shark study examined the IgM and IgW VH repertoire from birth through adult life, and analyzed the phylogenetic relationships of these gene families. IgM and IgW VH cDNA clones isolated from newborn nurse shark primary and secondary lymphoid tissues had highly diverse and unique CDR3 with N-region addition and VDJ gene rearrangement, implicating functional TdT and RAG gene activity. Despite the clear presence of N-region additions, newborn CDR3 were significantly shorter than those of adults. The IgM clones are all included in a conventional VH family that can be classified into five discrete groups, none of which is orthologous to IgM VH genes in other elasmobranchs. In addition, a novel divergent VH family was orthologous to a published monotypic VH horn shark family. IgW VH genes have diverged sufficiently to form three families. IgM and IgW VH serine codons using the potential somatic hypermutation hotspot sequence occur mainly in VH framework 1 (FR1) and CDR1. Phylogenetic analysis of cartilaginous fish and lungfish IgM and IgW demonstrated they form two major ancient gene groups; furthermore, these VH genes generally diversify (duplicate and diverge) within a species. As in ratfish, sandbar and horn sharks, most nurse shark IgM VH
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
Limited number of immunoglobulin VH regions expressed in the mutant rabbit "Alicia".
DiPietro, L A; Short, J A; Zhai, S K; Kelus, A S; Meier, D; Knight, K L
1990-06-01
A unique feature of rabbit Ig is the presence of VH region allotypic specificities. In normal rabbits, more than 80% of circulating immunoglobulin molecules bear the VHa allotypic specificities, al, a2 or a3; the remaining 10% to 20% of immunoglobulin molecules lack VHa allotypic specificities and are designated VHa-. A mutant rabbit designated Alicia, in contrast, has predominantly serum immunoglobulin molecules that lack the VHa allotypic specificities (Kelus and Weiss, Proc. Natl. Acad. Sci. USA 1986. 83: 4883). To study the nature and molecular complexity of VHa- molecules, we cloned and determined the nucleotide sequence of seven cDNA prepared from splenic RNA of an Alicia rabbit. Six of the clones appeared to encode VHa- molecules; the framework regions encoded by these clones were remarkably similar to each other, each having an unusual insertion of four amino acids at position 10. This insertion of four amino acids has been seen in only 2 of 54 sequenced rabbit VH genes. The similarity of the sequences of the six VHa- clones to each other and their dissimilarity to most other VH genes leads us to suggest that the VHa- molecules in Alicia rabbits are derived predominantly from one or a small number of very similar VH genes. Such preferential utilization of a small number of VH genes may explain the allelic inheritance of VH allotypes.
Diversity and repertoire of IgW and IgM VH families in the newborn nurse shark
Directory of Open Access Journals (Sweden)
Dooley Helen
2004-05-01
Full Text Available Abstract Background Adult cartilaginous fish express three immunoglobulin (Ig isotypes, IgM, IgNAR and IgW. Newborn nurse sharks, Ginglymostoma cirratum, produce 19S (multimeric IgM and monomeric/dimeric IgM1gj, a germline-joined, IgM-related VH, and very low amounts of 7S (monomeric IgM and IgNAR proteins. Newborn IgNAR VH mRNAs are diverse in the complementarity-determining region 3 (CDR3 with non-templated nucleotide (N-region addition, which suggests that, unlike in many other vertebrates, terminal deoxynucleotidyl transferase (TdT expressed at birth is functional. IgW is present in the lungfish, a bony fish sharing a common ancestor with sharks 460 million years ago, implying that the IgW VH family is as old as the IgM VH family. This nurse shark study examined the IgM and IgW VH repertoire from birth through adult life, and analyzed the phylogenetic relationships of these gene families. Results IgM and IgW VH cDNA clones isolated from newborn nurse shark primary and secondary lymphoid tissues had highly diverse and unique CDR3 with N-region addition and VDJ gene rearrangement, implicating functional TdT and RAG gene activity. Despite the clear presence of N-region additions, newborn CDR3 were significantly shorter than those of adults. The IgM clones are all included in a conventional VH family that can be classified into five discrete groups, none of which is orthologous to IgM VH genes in other elasmobranchs. In addition, a novel divergent VH family was orthologous to a published monotypic VH horn shark family. IgW VH genes have diverged sufficiently to form three families. IgM and IgW VH serine codons using the potential somatic hypermutation hotspot sequence occur mainly in VH framework 1 (FR1 and CDR1. Phylogenetic analysis of cartilaginous fish and lungfish IgM and IgW demonstrated they form two major ancient gene groups; furthermore, these VH genes generally diversify (duplicate and diverge within a species. Conclusion As in ratfish
vh@nnlo-v2: new physics in Higgs Strahlung
Harlander, Robert V.; Klappert, Jonas; Liebler, Stefan; Simon, Lukas
2018-05-01
Introducing version 2 of the code vh@nnlo [1], we study the effects of a number of new-physics scenarios on the Higgs-Strahlung process. In particular, the cross section is evaluated within a general 2HDM and the MSSM. While the Drell-Yan-like contributions are consistently taken into account by a simple rescaling of the SM result, the gluon-initiated contribution is supplemented by squark-loop mediated amplitudes, and by the s-channel exchange of additional scalars which may lead to conspicuous interference effects. The latter holds as well for bottom-quark initiated Higgs Strahlung, which is also included in the new version of vh@nnlo. Using an orthogonal rotation of the three Higgs CP eigenstates in the 2HDM and the MSSM, vh@nnlo incorporates a simple means of CP mixing in these models. Moreover, the effect of vector-like quarks in the SM on the gluon-initiated contribution can be studied. Beyond concrete models, vh@nnlo allows to include the effect of higher-dimensional operators on the production of CP-even Higgs bosons. Transverse momentum distributions of the final state Higgs boson and invariant mass distributions of the Vϕ final state for the gluon- and bottom-quark initiated contributions can be studied. Distributions for the Drell-Yan-like component of Higgs Strahlung can be included through a link to MCFM. vh@nnlo can also be linked to FeynHiggs and 2HDMC for the calculation of Higgs masses and mixing angles. It can also read these parameters from an SLHA-file as produced by standard spectrum generators. Throughout the manuscript, we highlight new-physics effects in various numerical examples, both at the inclusive level and for distributions.
Directory of Open Access Journals (Sweden)
Toya Nath Baral
Full Text Available Single-domain antibodies (sdAbs derived from human V(H are considered to be less soluble and prone to aggregate which makes it difficult to determine the crystal structures. In this study, we isolated and characterized two anti-human epidermal growth factor receptor-2 (HER2 sdAbs, Gr3 and Gr6, from a synthetic human V(H phage display library. Size exclusion chromatography and surface plasmon resonance analyses demonstrated that Gr3 is a monomer, but that Gr6 is a strict dimer. To understand this different molecular behavior, we solved the crystal structure of Gr6 to 1.6 Å resolution. The crystal structure revealed that the homodimer assembly of Gr6 closely mimics the V(H-V(L heterodimer of immunoglobulin variable domains and the dimerization interface is dominated by hydrophobic interactions.
The defects influence on domain wall propagation in bistable glass-coated microwires
International Nuclear Information System (INIS)
Rodionova, V.; Zhukova, V.; Ilyn, M.; Ipatov, M.; Perov, N.; Zhukov, A.
2012-01-01
We studied the domain wall (DW) dynamics of magnetically bistable amorphous glass-coated Fe 74 B 13 Si 11 C 2 microwires. In according to our experimental results magnetic field dependences of DW velocity of studied microwires can be divided into two groups: with uniform or uniformly accelerated DW propagation along the microwire. Strong correlation between the type of the magnetic field dependence of domain wall velocity, v(H), and the distribution of the local nucleation fields has been observed. Moreover, we observed abrupt increasing of DW velocity (jump) on the magnetic field dependences of the domain wall velocity, v(H), for the both types of the v(H) dependences. At the same time usual linear increasing of the domain wall velocity with magnetic field persists below these jumps. It was found that the jump height correlates with the location of nucleation place of the new domain wall. We have measured local nucleation field distribution in all the microwires. From local nucleation field distribution we have obtained the DW nucleation locations and estimated the jump height
The defects influence on domain wall propagation in bistable glass-coated microwires
Energy Technology Data Exchange (ETDEWEB)
Rodionova, V. [Magnetism Division, Faculty of Physics, M.V. Lomonosov Moscow State University, Moscow 119991 (Russian Federation); Immanuel Kant Baltic Federal University, Kaliningrad 236041 (Russian Federation); Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, San Sebastian 20018 (Spain); Zhukova, V., E-mail: valentina.zhukova@ehu.es [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, San Sebastian 20018 (Spain); Ilyn, M.; Ipatov, M. [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, San Sebastian 20018 (Spain); Perov, N. [Magnetism Division, Faculty of Physics, M.V. Lomonosov Moscow State University, Moscow 119991 (Russian Federation); Zhukov, A. [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, San Sebastian 20018 (Spain); IKERBASQUE, Basque Foundation for Science, Bilbao 48011 (Spain)
2012-05-01
We studied the domain wall (DW) dynamics of magnetically bistable amorphous glass-coated Fe{sub 74}B{sub 13}Si{sub 11}C{sub 2} microwires. In according to our experimental results magnetic field dependences of DW velocity of studied microwires can be divided into two groups: with uniform or uniformly accelerated DW propagation along the microwire. Strong correlation between the type of the magnetic field dependence of domain wall velocity, v(H), and the distribution of the local nucleation fields has been observed. Moreover, we observed abrupt increasing of DW velocity (jump) on the magnetic field dependences of the domain wall velocity, v(H), for the both types of the v(H) dependences. At the same time usual linear increasing of the domain wall velocity with magnetic field persists below these jumps. It was found that the jump height correlates with the location of nucleation place of the new domain wall. We have measured local nucleation field distribution in all the microwires. From local nucleation field distribution we have obtained the DW nucleation locations and estimated the jump height.
International Nuclear Information System (INIS)
Denis, K.A.; Timson, L.K.; Witte, O.N.
1989-01-01
VH gene utilization in the progeny of long term lymphoid-cultured cells used for reconstitution of severe combined immunodeficient mice under varying conditions was determined. Hybridomas made from the spleens of these animals were evaluated for clonality and donor origin and a panel of 146 independent hybridomas were subsequently examined for VH expression. Hybridomas derived from the spleens of SCID mice reconstituted with fresh cells, used as a control, utilized VH families in proportion to their numerical representation in the genome. However, hybridomas from the spleens of mice reconstituted with long term cultured cells utilized a predominance of the two VH gene families most proximal to JH, characteristic of cells early in B lymphocyte development. Coinjection of thymocytes with cultured fetal liver cells, to provide good levels of T lymphocytes, did not alter this pattern of VH utilization. Irradiation (3 Gy) of the mice before cultured cell injection, which leads to more complete reconstitution of the B cell compartment, was effective in removing this bias in the VH repertoire. Hybridomas derived from these mice expressed their VH genes more in proportion to family size, characteristic of cells later in B lymphocyte development. In this manner, long term lymphoid-cultured cells can be used to study the transitions that occur in VH repertoire expression which appear to be mediated by either B lymphocyte developmental microenvironment or population size
Poloidal rotation and the evolution of H-mode and VH-mode profiles
International Nuclear Information System (INIS)
Hinton, F.L.; Staebler, G.M.; Kim, Y.B.
1993-12-01
The physics which determines poloidal rotation, and its role in the development of profiles during H- and VH-modes, is discussed. A simple phenomenological transport model, which incorporates the rvec E x rvec B flow shear suppression of turbulence, is shown to predict profile evolution similar to that observed experimentally during H-mode and VH-mode
Histidine at Position 195 is Essential for Association of Heme-b in Lcp1VH2
Oetermann, Sylvia; Vivod, Robin; Hiessl, Sebastian; Hogeback, Jens; Holtkamp, Michael; Karst, Uwe; Steinbüchel, Alexander
2018-03-01
The latex clearing protein (Lcp) is the key enzyme of polyisoprene degradation in actinomycetes (Yikmis and Steinbüchel in Appl Environ Microbiol 78:4543-4551, https://doi.org/10.1128/AEM.00001-12, 2012). In this study it was shown that Lcp from Gordonia polyisoprenivorans VH2 (Lcp1VH2) harbors a non-covalently bound heme b as cofactor, which was identified by pyridine hemochrome spectra and confirmed by LC/ESI-ToF-MS. It contains iron, most likely in the Fe3+ state. We focused on the characterization of the heme-cofactor, its accessibility with respect to the conformation of Lcp1VH2, and the identification of putative histidine residues involved in the coordination of heme. A change was detectable in UV/Vis-spectra of reduced Lcp1VH2 when imidazole was added, showing that Lcp1VH2 "as isolated" occurs in an open state, directly being accessible for external ligands. In addition, three highly conserved histidines (H195, H200 and H228), presumably acting as ligands coordinating the heme within the heme pocket, were replaced with alanines by site-directed mutagenesis. The effect of these changes on in vivo rubber-mineralization was investigated. The lcp- deletion mutant complemented with the H195A variant of lcp1 VH2 was unable to mineralize poly(cis-1,4-isoprene). In vitro analyses of purified, recombinant Lcp1VH2H195A confirmed the loss of enzyme activity, which could be ascribed to the loss of heme. Hence, H195 is essential for the association of heme-b in the central region of Lcp1VH2.
Histidine at Position 195 is Essential for Association of Heme- b in Lcp1VH2
Oetermann, Sylvia; Vivod, Robin; Hiessl, Sebastian; Hogeback, Jens; Holtkamp, Michael; Karst, Uwe; Steinbüchel, Alexander
2018-05-01
The latex clearing protein (Lcp) is the key enzyme of polyisoprene degradation in actinomycetes (Yikmis and Steinbüchel in Appl Environ Microbiol 78:4543-4551, https://doi.org/10.1128/AEM.00001-12 , 2012). In this study it was shown that Lcp from Gordonia polyisoprenivorans VH2 (Lcp1VH2) harbors a non-covalently bound heme b as cofactor, which was identified by pyridine hemochrome spectra and confirmed by LC/ESI-ToF-MS. It contains iron, most likely in the Fe3+ state. We focused on the characterization of the heme-cofactor, its accessibility with respect to the conformation of Lcp1VH2, and the identification of putative histidine residues involved in the coordination of heme. A change was detectable in UV/Vis-spectra of reduced Lcp1VH2 when imidazole was added, showing that Lcp1VH2 "as isolated" occurs in an open state, directly being accessible for external ligands. In addition, three highly conserved histidines (H195, H200 and H228), presumably acting as ligands coordinating the heme within the heme pocket, were replaced with alanines by site-directed mutagenesis. The effect of these changes on in vivo rubber-mineralization was investigated. The lcp- deletion mutant complemented with the H195A variant of lcp1 VH2 was unable to mineralize poly( cis-1,4-isoprene). In vitro analyses of purified, recombinant Lcp1VH2H195A confirmed the loss of enzyme activity, which could be ascribed to the loss of heme. Hence, H195 is essential for the association of heme- b in the central region of Lcp1VH2.
VH mode accessibility and global H-mode properties in previous and present JET configurations
Energy Technology Data Exchange (ETDEWEB)
Jones, T T.C.; Ali-Arshad, S; Bures, M; Christiansen, J P; Esch, H P.L. de; Fishpool, G; Jarvis, O N; Koenig, R; Lawson, K D; Lomas, P J; Marcus, F B; Sartori, R; Schunke, B; Smeulders, P; Stork, D; Taroni, A; Thomas, P R; Thomsen, K [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking
1994-07-01
In JET VH modes, there is a distinct confinement transition following the cessation of ELMs, observed in a wide variety of tokamak operating conditions, using both NBI and ICRF heating methods. Important factors which influence VH mode accessibility such as magnetic configuration and vessel conditions have been identified. The new JET pumped divertor configuration has much improved plasma shaping control and power and particle exhaust capability and should permit exploitation of plasmas with VH confinement properties over an even wider range of operating regimes, particularly at high plasma current; first H-modes have been obtained in the 1994 JET operating period and initial results are reported. (authors). 7 refs., 6 figs.
Directory of Open Access Journals (Sweden)
Borie Dominic C
2006-03-01
Full Text Available Abstract Background The use of porcine cells and organs as a source of xenografts for human patients would vastly increase the donor pool; however, both humans and Old World primates vigorously reject pig tissues due to xenoantibodies that react with the polysaccharide galactose α (1,3 galactose (αGal present on the surface of many porcine cells. We previously examined the xenoantibody response in patients exposed to porcine hepatocytes via treatment(s with bioartficial liver devices (BALs, composed of porcine cells in a support matrix. We determined that xenoantibodies in BAL-treated patients are predominantly directed at porcine αGal carbohydrate epitopes, and are encoded by a small number of germline heavy chain variable region (VH immunoglobulin genes. The studies described in this manuscript were designed to identify whether the xenoantibody responses and the IgVH genes encoding antibodies to porcine hepatocytes in non-human primates used as preclinical models are similar to those in humans. Adult non-immunosuppressed rhesus monkeys (Macaca mulatta were injected intra-portally with porcine hepatocytes or heterotopically transplanted with a porcine liver lobe. Peripheral blood leukocytes and serum were obtained prior to and at multiple time points after exposure, and the immune response was characterized, using ELISA to evaluate the levels and specificities of circulating xenoantibodies, and the production of cDNA libraries to determine the genes used by B cells to encode those antibodies. Results Xenoantibodies produced following exposure to isolated hepatocytes and solid organ liver grafts were predominantly encoded by genes in the VH3 family, with a minor contribution from the VH4 family. Immunoglobulin heavy-chain gene (VH cDNA library screening and gene sequencing of IgM libraries identified the genes as most closely-related to the IGHV3-11 and IGHV4-59 germline progenitors. One of the genes most similar to IGHV3-11, VH3-11cyno, has
Impurity penetration and transport during VH-mode on DIII-D
International Nuclear Information System (INIS)
Lippmann, S.I.; Evans, T.E.; Jackson, G.L.; West, W.P.
1992-05-01
A new modeling effort is made in order to understand the observed relatively low levels of impurity contamination during the VH-mode phase on DIII-D, as compared to those observed during the H-mode phase of selected discharges. The key element is the inclusion of the real 2-D flux surface geometry in the prediction of impurity penetration of sputtered atoms through the scrape-off layer into the core plasma. Of the elements which determine the impurity content in the plasma: sputtering yield, penetration, and core transport, the penetration through the scrape-off layer is found to be the most determinative factor. The low impurity content in VH-mode is attributed to the development of a scrape-off layer with higher density and temperature properties than those normally obtained in H-mode
Beta limits in H-modes and VH-modes in JET
Energy Technology Data Exchange (ETDEWEB)
Smeulders, P; Hender, T C; Huysmans, G; Marcus, F; Ali-Arshad, S; Alper, B; Balet, B; Bures, M; Deliyanakis, N; Esch, H de; Fshpool, G; Jarvis, O N; Jones, T T.C.; Ketner, W; Koenig, R; Lawson, K; Lomas, P; O` Brien, D; Sadler, G; Stok, D; Stubberfield, P; Thomas, P; Thomen, K; Wesson, J [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Nave, M F [Universidade Tecnica, Lisbon (Portugal). Inst. Superior Tecnico
1994-07-01
In Hot-ion H- and VH-modes, the highest achieved beta was about 10% below the Troyon value in the best case of discharge 26087. The operational space of the high beta discharges obtained before March 1992 has been explored as function of the parameters H{sub ITER89P}, {beta}{sub n}, q{sub 95}, I{sub p}. Also, a limiting envelope on the fusion reactivity as a function of the average plasma pressure and beta has been observed with R{sub DD} related to {beta}{sub {phi}}{sup 2}.B{sub {phi}}{sup 4}. MHD stability analysis shows that the JET VH modes at the edge are in the second region for ballooning mode stability. The dependence of ballooning stability and the n=1 external kink on the edge current density is analyzed. (authors). 6 figs., 6 refs.
Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge
2015-12-01
Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.
Henry, Kevin A
2018-01-01
Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.
Energy Technology Data Exchange (ETDEWEB)
Wei, X. [Brookhaven National Lab. (BNL), Upton, NY (United States); Braverman, J. [Brookhaven National Lab. (BNL), Upton, NY (United States); Miranda, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Rosario, M. E. [Brookhaven National Lab. (BNL), Upton, NY (United States); Costantino, C. J. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2015-02-01
This report documents the results of a study to determine the depth-dependent V/H ratios of ground motion response spectra in the free field. The V/H ratios reported herein were developed from a worldwide database of surface and downhole acceleration recordings obtained from 45 vertical array stations. This database was specifically compiled for this project, and includes information from a diversity of active tectonic regions (California, Alaska, Taiwan, Japan), site conditions (rock to soft soil), ground motion intensity levels (PGAs between 0.01 g and 0.50 g), magnitudes (between ML 2.78 and JMA 8.1), epicentral distances (between 3.2 km and 812 km), and source depths (between 1.2 km and 112 km), as well as sensors at surface and at a wide range of depths relevant to the project. To study the significance of the depth effect, V/H ratios from all the records were sorted into a number of depth bins relevant to the project, and statistics (average, standard deviation, coefficient of variation, 16th, 50th, and 84th percentiles) of the V/H ratios within each bin were computed. Similar analyses were repeated, controlling for different site conditions, ground motion intensity levels, array locations, and source depths, to study their relative effect on the V/H ratios. Our findings confirm the importance of the depth effect on the V/H ratios. The research findings in this report can be used to provide guidance on the significance of the depth effect, and the extent to which this effect should be considered in the seismic design of deeply embedded SMR structures and NPP structures in general.
Formation of amyloid fibers by monomeric light chain variable domains.
Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S
2014-10-03
Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Frequency Domain Multi-parameter Full Waveform Inversion for Acoustic VTI Media
Djebbi, Ramzi
2017-05-26
Multi-parameter full waveform inversion (FWI) for transversely isotropic (TI) media with vertical axis of symmetry (VTI) suffers from the trade-off between the parameters. The trade-off results in the leakage of one parameter\\'s update into the other during the inversion. It affects the accuracy and convergence of the inversion. The sensitivity analyses suggested a parameterisation using the horizontal velocity vh, epsilon and eta to reduce the trade-off for surface recorded seismic data.We test the (vh, epsilon, eta) parameterisation for acoustic VTI media using a scattering integral (SI) based inversion. The data is modeled in frequency domain and the model is updated using a preconditioned conjugate gradient method. We applied the method to the VTI Marmousi II model and in the inversion, we keep eta parameter fixed as the background initial model and we invert simultaneously for both vh and epsilon. The results show the suitability of the parameterisation for multi-parameter VTI acoustic inversion as well as the accuracy of the inversion approach.
International Nuclear Information System (INIS)
Yetis, H; Altinkok, A; Olutas, M; Kilic, A; Kilic, K; Cetin, O
2006-01-01
Magnetovoltage measurements (V-H curves) were carried out in superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material as a function of current (I), temperature (T), field sweep rate (dH/dt) and field orientation with respect to the transport current. A relative decrease in the dissipation measured in V-H curves was observed as dH/dt is increased, which implies that the time spent to plot the whole cycle has an importance on the evolution of the V-H curves. Thus, it could be possible to observe the relaxation effects in magnetovoltage measurements. In addition, the several significant steps and plateaus in V-H curves evolve depending on the magnitude of the transport current and also dH/dt. These observations were attributed to locking of the flux lines to decrease or increase in size of the easy motion flow channels. The strong hysteresis effects in V-H curves were discussed mainly by means of the flux trapping within the granularity of sample and the different degree of the inhomogeneous flux motion with respect to the sweeping of the external magnetic field up and down
Tschopp, Molly K; Frain, Michael P; Bishop, Malachy
2009-01-01
This article describes and presents an initial analysis of variables generally associated with empowerment towards perceived beliefs concerning quality of life work domains for individuals with disabilities. The model examines the domains of importance, satisfaction, control and degree of interference of disability that an individual feels towards work. The internet based study used results from 70 individuals with disabilities in varying aspects of work. The variables composing empowerment that correlated strongly with the work domains include: self-advocacy, self-efficacy, perceived stigma, and family resiliency as measured through coping. Quality of Life concerning work was measured through the DSC-C a domain specific QOL instrument.
Rapid isolation of IgNAR variable single-domain antibody fragments from a shark synthetic library.
Shao, Cui-Ying; Secombes, Chris J; Porter, Andrew J
2007-01-01
The immunoglobulin isotype IgNAR (Novel Antigen Receptor) was discovered in the serum of the nurse shark (Ginglymostoma cirratum) and wobbegong shark (Orectolobus maculates) as a homodimer of two protein chains, each composed of a single variable domain (V) domain and five constant domains. The IgNAR variable domain contains an intact antigen-binding site and functions as an independent domain able to react to antigen with both high specificity and affinity. Here we describe the successful construction of a synthetic phage-displayed library based upon a single anti-lysozyme clone HEL-5A7 scaffold, which was previously selected from an immune IgNAR variable domain library. The complementarity-determining region 3 (CDR3) loop of this clone was varied in both length and composition and the derived library was used to pan against two model proteins, lysozyme and leptin. A single anti-lysozyme clone (Ly-X20) and anti-leptin clone (Lep-12E1) were selected for further study. Both clones were shown to be functionally expressed in Escherichia coli, extremely thermostable and bind to corresponding antigens specifically. The results here demonstrate that a synthetic IgNAR variable domain library based on a single framework scaffold can be used as a route to generate antigen binders quickly, easily and without the need of immunization.
Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics
Directory of Open Access Journals (Sweden)
Peter Bannas
2017-11-01
Full Text Available Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL. The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL. VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv. scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa and nanobody-based human heavy chain antibodies (75 kDa can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb. Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo. Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo. Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody
Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics.
Bannas, Peter; Hambach, Julia; Koch-Nolte, Friedrich
2017-01-01
Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa) of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL). The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL). VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv). scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa) and nanobody-based human heavy chain antibodies (75 kDa) can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb). Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo . Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo . Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody-based human heavy
DEFF Research Database (Denmark)
Castillo, Daniel; Jun, Jin Woo; D'Alvise, Paul
2015-01-01
Vibrio parahaemolyticus is an important foodborne pathogen responsible for gastroenteritis outbreaks globally. It has also been identified as an important pathogen in aquatic organisms. Here, we report a draft genome sequence of V. parahaemolyticus, strain VH3, isolated from farmed juvenile greater...
Grasping the nettle: A bacterial invasin that targets immunoglobulin variable domains.
Barlow, Paul
2018-06-01
In a new paper, the protein InvD from Yersinia pseudotuberculosis , a zoonotic pathogen, is shown to assist late-stage invasion of intestinal epithelia. Remarkably, InvD acts by binding the Fab region of IgG or IgA. It straddles adjacent light-chain and heavy-chain variable domains, but its binding is different from that of antigens in that complementarity-determining regions do not participate. Structure determination revealed that its Fab-interacting domain adopts an immunoglobulin-like fold, fused to the preceding immunoglobulin-like domain and carried on a long stalk anchored to the bacterial outer membrane. Possible roles of this unusual host-pathogen interaction include avoidance of clearance from the intestine by secretory IgA. © 2018 Barlow.
Chailyan, Anna
2011-06-28
The antigen-binding site of immunoglobulins is formed by six regions, three from the light and three from the heavy chain variable domains, which, on association of the two chains, form the conventional antigen-binding site of the antibody. The mode of interaction between the heavy and light chain variable domains affects the relative position of the antigen-binding loops and therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface between the heavy and light chain variable domains and show that there are essentially two different modes for their interaction that can be identified by the presence of key amino acids in specific positions of the antibody sequences. We also show that the different packing modes are related to the type of recognized antigen.
ATLAS searches for VH, HH, VV, V+$\\gamma$/$\\gamma\\gamma$ resonances
AUTHOR|(INSPIRE)INSPIRE-00441490; The ATLAS collaboration
2017-01-01
The discovery of a Higgs boson at the Large Hadron Collider motivates searches for physics beyond the Standard Model in channels involving coupling to the Higgs boson. A search for massive resonances decaying into couples of bosons is described. The considered final states are: $HH$, $VH$, $VV$, $V\\gamma$ and $\\gamma\\gamma$ with $V$ indicating either the $W$ or the $Z$ boson. Final states with different number of leptons or photons and where, in many cases, at least one Higgs decays into a b-quark pair are studied using different jet reconstruction techniques which allow to optimize the signal acceptance for low or high Higgs boson transverse momentum. The most recent diboson resonance searches using LHC Run 2 data are described.
Linguistic explanation and domain specialization: a case study in bound variable anaphora.
Adger, David; Svenonius, Peter
2015-01-01
The core question behind this Frontiers research topic is whether explaining linguistic phenomena requires appeal to properties of human cognition that are specialized to language. We argue here that investigating this issue requires taking linguistic research results seriously, and evaluating these for domain-specificity. We present a particular empirical phenomenon, bound variable interpretations of pronouns dependent on a quantifier phrase, and argue for a particular theory of this empirical domain that is couched at a level of theoretical depth which allows its principles to be evaluated for domain-specialization. We argue that the relevant principles are specialized when they apply in the domain of language, even if analogs of them are plausibly at work elsewhere in cognition or the natural world more generally. So certain principles may be specialized to language, though not, ultimately, unique to it. Such specialization is underpinned by ultimately biological factors, hence part of UG.
Wu, Leeying; Oficjalska, Katarzyna; Lambert, Matthew; Fennell, Brian J; Darmanin-Sheehan, Alfredo; Ní Shúilleabháin, Deirdre; Autin, Bénédicte; Cummins, Emma; Tchistiakova, Lioudmila; Bloom, Laird; Paulsen, Janet; Gill, Davinder; Cunningham, Orla; Finlay, William J J
2012-01-01
Examination of 1269 unique naive chicken V(H) sequences showed that the majority of positions in the framework (FW) regions were maintained as germline, with high mutation rates observed in the CDRs. Many FW mutations could be clearly related to the modulation of CDR structure or the V(H)-V(L) interface. CDRs 1 and 2 of the V(H) exhibited frequent mutation in solvent-exposed positions, but conservation of common structural residues also found in human CDRs at the same positions. In comparison with humans and mice, the chicken CDR3 repertoire was skewed toward longer sequences, was dominated by small amino acids (G/S/A/C/T), and had higher cysteine (chicken, 9.4%; human, 1.6%; and mouse, 0.25%) but lower tyrosine content (chicken, 9.2%; human, 16.8%; and mouse 26.4%). A strong correlation (R(2) = 0.97) was observed between increasing CDR3 length and higher cysteine content. This suggests that noncanonical disulfides are strongly favored in chickens, potentially increasing CDR stability and complexity in the topology of the combining site. The probable formation of disulfide bonds between CDR3 and CDR1, FW2, or CDR2 was also observed, as described in camelids. All features of the naive repertoire were fully replicated in the target-selected, phage-displayed repertoire. The isolation of a chicken Fab with four noncanonical cysteines in the V(H) that exhibits 64 nM (K(D)) binding affinity for its target proved these constituents to be part of the humoral response, not artifacts. This study supports the hypothesis that disulfide bond-constrained CDR3s are a structural diversification strategy in the restricted germline v-gene repertoire of chickens.
THE TIME DOMAIN SPECTROSCOPIC SURVEY: VARIABLE SELECTION AND ANTICIPATED RESULTS
Energy Technology Data Exchange (ETDEWEB)
Morganson, Eric; Green, Paul J. [Harvard Smithsonian Center for Astrophysics, 60 Garden St, Cambridge, MA 02138 (United States); Anderson, Scott F.; Ruan, John J. [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Myers, Adam D. [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82071 (United States); Eracleous, Michael; Brandt, William Nielsen [Department of Astronomy and Astrophysics, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802 (United States); Kelly, Brandon [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106-9530 (United States); Badenes, Carlos [Department of Physics and Astronomy and Pittsburgh Particle Physics, Astrophysics and Cosmology Center (PITT PACC), University of Pittsburgh, 3941 O’Hara St, Pittsburgh, PA 15260 (United States); Bañados, Eduardo [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Blanton, Michael R. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Bershady, Matthew A. [Department of Astronomy, University of Wisconsin, 475 N. Charter St., Madison, WI 53706 (United States); Borissova, Jura [Instituto de Física y Astronomía, Universidad de Valparaíso, Av. Gran Bretaña 1111, Playa Ancha, Casilla 5030, and Millennium Institute of Astrophysics (MAS), Santiago (Chile); Burgett, William S. [GMTO Corp, Suite 300, 251 S. Lake Ave, Pasadena, CA 91101 (United States); Chambers, Kenneth, E-mail: emorganson@cfa.harvard.edu [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); and others
2015-06-20
We present the selection algorithm and anticipated results for the Time Domain Spectroscopic Survey (TDSS). TDSS is an Sloan Digital Sky Survey (SDSS)-IV Extended Baryon Oscillation Spectroscopic Survey (eBOSS) subproject that will provide initial identification spectra of approximately 220,000 luminosity-variable objects (variable stars and active galactic nuclei across 7500 deg{sup 2} selected from a combination of SDSS and multi-epoch Pan-STARRS1 photometry. TDSS will be the largest spectroscopic survey to explicitly target variable objects, avoiding pre-selection on the basis of colors or detailed modeling of specific variability characteristics. Kernel Density Estimate analysis of our target population performed on SDSS Stripe 82 data suggests our target sample will be 95% pure (meaning 95% of objects we select have genuine luminosity variability of a few magnitudes or more). Our final spectroscopic sample will contain roughly 135,000 quasars and 85,000 stellar variables, approximately 4000 of which will be RR Lyrae stars which may be used as outer Milky Way probes. The variability-selected quasar population has a smoother redshift distribution than a color-selected sample, and variability measurements similar to those we develop here may be used to make more uniform quasar samples in large surveys. The stellar variable targets are distributed fairly uniformly across color space, indicating that TDSS will obtain spectra for a wide variety of stellar variables including pulsating variables, stars with significant chromospheric activity, cataclysmic variables, and eclipsing binaries. TDSS will serve as a pathfinder mission to identify and characterize the multitude of variable objects that will be detected photometrically in even larger variability surveys such as Large Synoptic Survey Telescope.
Directory of Open Access Journals (Sweden)
Soe Hee Ann
Full Text Available To assess the serial changes of de novo coronary lesions treated with paclitaxel-coated balloon (PCB using intravascular ultrasound virtual histology (IVUS-VH and fractional flow reserve (FFR.This prospective observational study enrolled 27 patients with coronary artery disease treated with PCB who underwent coronary angiography, IVUS-VH and FFR before, immediately after intervention and at 9 months. 28 de novo lesions were successfully treated with PCB. Angiographic late luminal loss was 0.02 ± 0.27 mm. Mean vessel and lumen areas showed increase at 9 months (12.0 ± 3.5 mm(2 to 13.2 ± 3.9 mm(2, p <0.001; and 5.4 ± 1.2 mm(2 to 6.5 ± 1.8 mm(2, p <0.001, respectively. Although mean plaque area was unchanged (6.6 ± 2.6 mm2 to 6.6 ± 2.4 mm(2, p = 0.269, percent atheroma volume decreased significantly (53.4 ± 7.9% to 49.5 ± 6.4%, p = 0.002. The proportion of plaque compositions including fibrous, fibrofatty, dense calcium and necrotic core by IVUS-VH was unchanged at 9 months. The FFR of the treated lesion was 0.71 ± 0.13 pre-procedure, 0.87 ± 0.06 post-procedure and 0.84 ± 0.06 at follow-up.De novo coronary lesions treated with PCB showed persistent anatomical and physiological patency with plaque redistribution and vessel remodeling without chronic elastic recoil or plaque compositional change during follow-up.
Modular and aggregation resistant Vh antibodies from a phage display library
DEFF Research Database (Denmark)
Friis, Niels Anton; Mandrup, Ole Aalund; Lykkemark, Simon
2012-01-01
through immunisation of sharks or camels, or alternatively from recombinant libraries1. The domain antibodies have certain advantages, both pharmacologically and technically. Here we report the construction of a semi-synthetic and highly modular antibody library, based on a human framework (V3-23/D47......Directed evolution of antibodies through phage display is a powerful technique for producing binders of various biological targets. One of the recent innovations in the fi eld is the domain antibody, an antibody consisting only of a single variable domain. These anti bodies can be obtained either......). The antibody scaffold has been codon optimised to improve expression, and the CDR’s have been created using trinucleotide synthesis. These methods give a strict control over the randomisations, and the ability to design a library with minimal aggregation propensity. To facilitate further manipulation, unique...
Jet substructure and probes of CP violation in Vh production
Energy Technology Data Exchange (ETDEWEB)
Godbole, R.M. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); Miller, D.J. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom); Mohan, K.A. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); White, C.D. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom)
2015-04-20
We analyse the hVV (V=W,Z) vertex in a model independent way using Vh production. To that end, we consider possible corrections to the Standard Model Higgs Lagrangian, in the form of higher dimensional operators which parametrise the effects of new physics. In our analysis, we pay special attention to linear observables that can be used to probe CP violation in the same. By considering the associated production of a Higgs boson with a vector boson (W or Z), we use jet substructure methods to define angular observables which are sensitive to new physics effects, including an asymmetry which is linearly sensitive to the presence of CP odd effects. We demonstrate how to use these observables to place bounds on the presence of higher dimensional operators, and quantify these statements using a log likelihood analysis. Our approach allows one to probe separately the hZZ and hWW vertices, involving arbitrary combinations of BSM operators, at the Large Hadron Collider.
Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G
1991-02-01
The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.
Engineered Bovine Antibodies in the Development of Novel Therapeutics, Immunomodulators and Vaccines
Directory of Open Access Journals (Sweden)
Madhuri Koti
2014-05-01
Full Text Available Some bovine antibodies across all classes are unique, such as the CDR3 of the variable heavy-domain (VH CDR3, which is exceptionally long (up to 66 amino acids, unlike most conventional antibodies where the VH CDR3 loops range from 10 to 25 amino acids. The exceptionally long VH CDR3 is encoded by unusually long germline IGHD genes together with insertion of novel “a” nucleotide rich conserved short nucleotide sequence (CSNS specifically at the IGH V-D junction. Such an exceptionally long VH CDR3 confers unique “knob and stalk” structural architecture where the knob, formed by intra-VH CDR3 disulfide bridges, is separated by 20 Å solvent exposed stalk composed of anti-parallel beta strands. The substitution of the knob with cytokines, such as, erythropoietin and granulocyte colony stimulating factor 3 (granulocyte colony stimulating factor, results in expression of functional fusion proteins with enhanced pharmacokinetics. The beta stranded stalk can be substituted with other rigid structures, for example, repeat alpha helices to form coiled-coil that mimics the beta-stranded stalk and, thus, opens opportunities for insertion of this structure in the CDRs of antibodies across species. Given the versatility of such a structural platform in bovine antibody VH CDR3, it provides the opportunity for the development of new generation of diagnostics, therapeutics, vaccines and immunomodulating drugs.
Henry, Kevin A; Kim, Dae Young; Kandalaft, Hiba; Lowden, Michael J; Yang, Qingling; Schrag, Joseph D; Hussack, Greg; MacKenzie, C Roger; Tanha, Jamshid
2017-01-01
Human autonomous V H /V L single-domain antibodies (sdAbs) are attractive therapeutic molecules, but often suffer from suboptimal stability, solubility and affinity for cognate antigens. Most commonly, human sdAbs have been isolated from in vitro display libraries constructed via synthetic randomization of rearranged V H /V L domains. Here, we describe the design and characterization of three novel human V H /V L sdAb libraries through a process of: (i) exhaustive biophysical characterization of 20 potential V H /V L sdAb library scaffolds, including assessment of expression yield, aggregation resistance, thermostability and tolerance to complementarity-determining region (CDR) substitutions; (ii) in vitro randomization of the CDRs of three V H /V L sdAb scaffolds, with tailored amino acid representation designed to promote solubility and expressibility; and (iii) systematic benchmarking of the three V H /V L libraries by panning against five model antigens. We isolated ≥1 antigen-specific human sdAb against four of five targets (13 V H s and 7 V L s in total); these were predominantly monomeric, had antigen-binding affinities ranging from 5 nM to 12 µM (average: 2-3 µM), but had highly variable expression yields (range: 0.1-19 mg/L). Despite our efforts to identify the most stable V H /V L scaffolds, selection of antigen-specific binders from these libraries was unpredictable (overall success rate for all library-target screens: ~53%) with a high attrition rate of sdAbs exhibiting false positive binding by ELISA. By analyzing V H /V L sdAb library sequence composition following selection for monomeric antibody expression (binding to protein A/L followed by amplification in bacterial cells), we found that some V H /V L sdAbs had marked growth advantages over others, and that the amino acid composition of the CDRs of this set of sdAbs was dramatically restricted (bias toward Asp and His and away from aromatic and hydrophobic residues). Thus, CDR sequence
Eh-pH diagrams of the V-H2O system at 25,60 and 1000C
International Nuclear Information System (INIS)
Silva, F.T. da; Ogasawara, T.; Cassa, J.C.S.
1987-01-01
Free energies of the formation of vanadium ions in aqueous solutions at elevated temperatures were determined. Eh-pH diagrams at 25 0 C, 60 0 C and 100 0 C at different vanadium concentrations, using microcomputers were calculated and obtained. The effects of temperature and vanadium concentration on the predominance of vanadium species were examined. The Eh-pH diagrams for the V-H 2 O system were evaluated by comparisons with experimental data. (Author) [pt
Improving solubility and refolding efficiency of human V(H)s by a novel mutational approach.
Tanha, Jamshid; Nguyen, Thanh-Dung; Ng, Andy; Ryan, Shannon; Ni, Feng; Mackenzie, Roger
2006-11-01
The antibody V(H) domains of camelids tend to be soluble and to resist aggregation, in contrast to human V(H) domains. For immunotherapy, attempts have therefore been made to improve the properties of human V(H)s by camelization of a small set of framework residues. Here, we have identified through sequence comparison of well-folded llama V(H) domains an alternative set of residues (not typically camelid) for mutation. Thus, the solubility and thermal refolding efficiency of a typical human V(H), derived from the human antibody BT32/A6, were improved by introduction of two mutations in framework region (FR) 1 and 4 to generate BT32/A6.L1. Three more mutations in FR3 of BT32/A6.L1 further improved the thermal refolding efficiency while retaining solubility and cooperative melting profiles. To demonstrate practical utility, BT32/A6.L1 was used to construct a phage display library from which were isolated human V(H)s with good antigen binding activity and solubility. The engineered human V(H) domains described here may be useful for immunotherapy, due to their expected low immunogenicity, and in applications involving transient high temperatures, due to their efficient refolding after thermal denaturation.
Directory of Open Access Journals (Sweden)
Goldman Ellen R
2007-11-01
Full Text Available Abstract Background Shark heavy chain antibody, also called new antigen receptor (NAR, consists of one single Variable domain (VH, containing only two complementarity-determining regions (CDRs. The antigen binding affinity and specificity are mainly determined by these two CDRs. The good solubility, excellent thermal stability and complex sequence variation of small single domain antibodies (sdAbs make them attractive alternatives to conventional antibodies. In this report, we construct and characterize a diversity enhanced semi-synthetic NAR V display library based on naturally occurring NAR V sequences. Results A semi-synthetic shark sdAb display library with a complexity close to 1e9 was constructed. This was achieved by introducing size and sequence variations in CDR3 using randomized CDR3 primers of three different lengths. Binders against three toxins, staphylococcal enterotoxin B (SEB, ricin, and botulinum toxin A (BoNT/A complex toxoid, were isolated from panning the display library. Soluble sdAbs from selected binders were purified and evaluated using direct binding and thermal stability assays on the Luminex 100. In addition, sandwich assays using sdAb as the reporter element were developed to demonstrate their utility for future sensor applications. Conclusion We demonstrated the utility of a newly created hyper diversified shark NAR displayed library to serve as a source of thermal stable sdAbs against a variety of toxins.
Directory of Open Access Journals (Sweden)
Stewart Nuttall
2013-01-01
Full Text Available The single variable new antigen receptor domain antibody fragments (VNARs derived from shark immunoglobulin new antigen receptor antibodies (IgNARs represent some of the smallest known immunoglobulin-based protein scaffolds. As single domains, they demonstrate favorable size and cryptic epitope recognition properties, making them attractive in diagnosis and therapy of numerous disease states. Here, we examine the stability of VNAR domains with a focus on a family of VNARs specific for apical membrane antigen 1 (AMA-1 from Plasmodium falciparum. The VNARs are compared to traditional monoclonal antibodies (mAbs in liquid, lyophilized and immobilized nitrocellulose formats. When maintained in various formats at 45 °C, VNARs have improved stability compared to mAbs for periods of up to four weeks. Using circular dichroism spectroscopy we demonstrate that VNAR domains are able to refold following heating to 80 °C. We also demonstrate that VNAR domains are stable during incubation under potential in vivo conditions such as stomach acid, but not to the protease rich environment of murine stomach scrapings. Taken together, our results demonstrate the suitability of shark VNAR domains for various diagnostic platforms and related applications.
Directory of Open Access Journals (Sweden)
Carlos Rafaell Correia de Oliveira
2011-12-01
Full Text Available Little is known about heart rate (HR kinetics during exercise in the very heavy (VH and severe (SE intensity domains. The objective of this study was to describe mathematically the HR kinetics during exercise performed in these intensity domains and to compare the parameters derived from these models between situations of high (HCHO, low (LCHO and control (C carbohydrate availability. Twelve men performed three trials to exhaustion in the VH or SE domains after diet manipulation with HCHO, LCHO and C. The VH intensity was ΔLW75% (75% of the difference between VO2max and LL2 and SE was 115% of VO2max identified in a previous incremental test (20 W/3 min. HR responses were mathematically fitted by mono- and biexponential functions. In the VH domain, the residual sum of squares (RSS obtained with the biexponential model was significantly lower than that obtained with the monoexponential model (P 0.05. In the VH domain, there were no significant differences in biexponential parameters between the HCHO, LCHO and C conditions. In the SE domain, there were no significant differences in monoexponential parameters between the HCHO, LCHO and C conditions, although the time constant of the monoexponential model was significantly reduced in LCHO when compared to HCHO (51.5 ± 26.4 vs 65.4 ± 34.1 s; P < 0.05. The bi- and monoexponential mathematical models seem to be the best description of HR responses during exercise performed in the HV and SE intensity domains, respectively. In addition, carbohydrate availability only seems to affect HR kinetics during exercise performed at SE intensity.
Directory of Open Access Journals (Sweden)
Maria Augusta Peduti Dal Molin Kiss
2011-01-01
Full Text Available Little is known about heart rate (HR kinetics during exercise in the very heavy (VH and severe (SE intensity domains. The objective of this study was to describe mathematically the HR kinetics during exercise performed in these intensity domains and to compare the parameters derived from these models between situations of high (HCHO, low (LCHO and control (C carbohydrate availability. Twelve men performed three trials to exhaustion in the VH or SE domains after diet manipulation with HCHO, LCHO and C. The VH intensity was ΔLW75% (75% of the difference between VO2max and LL2 and SE was 115% of VO2max identified in a previous incremental test (20 W/3 min. HR responses were mathematically fitted by mono- and biexponential functions. In the VH domain, the residual sum of squares (RSS obtained with the biexponential model was significantly lower than that obtained with the monoexponential model (P 0.05. In the VH domain, there were no significant differences in biexponential parameters between the HCHO, LCHO and C conditions. In the SE domain, there were no significant differences in monoexponential parameters between the HCHO, LCHO and C conditions, although the time constant of the monoexponential model was significantly reduced in LCHO when compared to HCHO (51.5 ± 26.4 vs 65.4 ± 34.1 s; P < 0.05. The bi- and monoexponential mathematical models seem to be the best description of HR responses during exercise performed in the HV and SE intensity domains, respectively. In addition, carbohydrate availability only seems to affect HR kinetics during exercise performed at SE intensity.
Conserved and variable domains of RNase MRP RNA.
Dávila López, Marcela; Rosenblad, Magnus Alm; Samuelsson, Tore
2009-01-01
Ribonuclease MRP is a eukaryotic ribonucleoprotein complex consisting of one RNA molecule and 7-10 protein subunits. One important function of MRP is to catalyze an endonucleolytic cleavage during processing of rRNA precursors. RNase MRP is evolutionary related to RNase P which is critical for tRNA processing. A large number of MRP RNA sequences that now are available have been used to identify conserved primary and secondary structure features of the molecule. MRP RNA has structural features in common with P RNA such as a conserved catalytic core, but it also has unique features and is characterized by a domain highly variable between species. Information regarding primary and secondary structure features is of interest not only in basic studies of the function of MRP RNA, but also because mutations in the RNA give rise to human genetic diseases such as cartilage-hair hypoplasia.
Bende, R. J.; Aarts, W. M.; Pals, S. T.; van Noesel, C. J. M.
2002-01-01
In this study we describe alternative splicing of somatically mutated immunoglobulin (Ig) variable heavy chain (V-H) genes in three distinct primary B cell non-Hodgkin's lymphomas (B-NHL). In two V4-34 expressing lymphomas, ie a post-germinal center type B cell chronic lymphocytic leukemia (B-CLL)
Chailyan, Anna; Marcatili, Paolo; Tramontano, Anna
2011-01-01
of interaction between the heavy and light chain variable domains affects the relative position of the antigen-binding loops and therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface
Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells.
Meng, Weixu; Li, Leike; Xiong, Wei; Fan, Xuejun; Deng, Hui; Bett, Andrew J; Chen, Zhifeng; Tang, Aimin; Cox, Kara S; Joyce, Joseph G; Freed, Daniel C; Thoryk, Elizabeth; Fu, Tong-Ming; Casimiro, Danilo R; Zhang, Ningyan; A Vora, Kalpit; An, Zhiqiang
2015-01-01
Nonhuman primates (NHPs) are used as a preclinical model for vaccine development, and the antibody profiles to experimental vaccines in NHPs can provide critical information for both vaccine design and translation to clinical efficacy. However, an efficient protocol for generating monoclonal antibodies from single antibody secreting cells of NHPs is currently lacking. In this study we established a robust protocol for cloning immunoglobulin (IG) variable domain genes from single rhesus macaque (Macaca mulatta) antibody secreting cells. A sorting strategy was developed using a panel of molecular markers (CD3, CD19, CD20, surface IgG, intracellular IgG, CD27, Ki67 and CD38) to identify the kinetics of B cell response after vaccination. Specific primers for the rhesus macaque IG genes were designed and validated using cDNA isolated from macaque peripheral blood mononuclear cells. Cloning efficiency was averaged at 90% for variable heavy (VH) and light (VL) domains, and 78.5% of the clones (n = 335) were matched VH and VL pairs. Sequence analysis revealed that diverse IGHV subgroups (for VH) and IGKV and IGLV subgroups (for VL) were represented in the cloned antibodies. The protocol was tested in a study using an experimental dengue vaccine candidate. About 26.6% of the monoclonal antibodies cloned from the vaccinated rhesus macaques react with the dengue vaccine antigens. These results validate the protocol for cloning monoclonal antibodies in response to vaccination from single macaque antibody secreting cells, which have general applicability for determining monoclonal antibody profiles in response to other immunogens or vaccine studies of interest in NHPs.
Although empirical models have been developed previously, a mechanistic model is needed for estimating electrical conductivity (EC) using time domain reflectometry (TDR) with variable lengths of coaxial cable. The goals of this study are to: (1) derive a mechanistic model based on multisection tra...
Goicochea, Nancy L; Garnovskaya, Maria; Blanton, Mary G; Chan, Grace; Weisbart, Richard; Lilly, Michael B
2017-12-01
Castration-resistant prostate cancer cells exhibit continued androgen receptor signaling in spite of low levels of ligand. Current therapies to block androgen receptor signaling act by inhibiting ligand production or binding. We developed bispecific antibodies capable of penetrating cells and binding androgen receptor outside of the ligand-binding domain. Half of the bispecific antibody molecule consists of a single-chain variable fragment of 3E10, an anti-DNA antibody that enters cells. The other half is a single-chain variable fragment version of AR441, an anti-AR antibody. The resulting 3E10-AR441 bispecific antibody enters human LNCaP prostate cells and accumulates in the nucleus. The antibody binds to wild-type, mutant and splice variant androgen receptor. Binding affinity of 3E10-AR441 to androgen receptor (284 nM) was lower than that of the parental AR441 mAb (4.6 nM), but could be improved (45 nM) through alternative placement of the affinity tags, and ordering of the VH and VK domains. The 3E10-AR441 bispecific antibody blocked genomic signaling by wild-type or splice variant androgen receptor in LNCaP cells. It also blocked non-genomic signaling by the wild-type receptor. Furthermore, bispecific antibody inhibited the growth of C4-2 prostate cancer cells under androgen-stimulated conditions. The 3E10-AR441 biAb can enter prostate cancer cells and inhibits androgen receptor function in a ligand-independent manner. It may be an attractive prototype agent for prostate cancer therapy. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Pamuda Pudjisuryadi
2008-01-01
Full Text Available A meshless local Petrov-Galerkin (MLPG method that employs polygonal sub-domains constructed from several triangular patches rather than the typically used circular sub-domains is presented. Moving least-squares approximation is used to construct the trial displacements and linear, Lagrange interpolation functions are used to construct the test functions. An adaptive technique to improve the accuracy of approximate solutions is developed to minimize the computational cost. Variable domain of influence (VDOI and effective stress gradient indicator (EK for local error assessment are the focus of this study. Several numerical examples are presented to verify the efficiency and accuracy of the proposed adaptive MLPG method. The results show that the proposed adaptive technique performs as expected that is refining the problem domain in area with high stress concentration in which higher accuracy is commonly required.
Directory of Open Access Journals (Sweden)
Fleur S. van de Bovenkamp
2018-04-01
Full Text Available Immunoglobulin G (IgG can contain N-linked glycans in the variable domains, the so-called Fab glycans, in addition to the Fc glycans in the CH2 domains. These Fab glycans are acquired following introduction of N-glycosylation sites during somatic hypermutation and contribute to antibody diversification. We investigated whether Fab glycans may—in addition to affecting antigen binding—contribute to antibody stability. By analyzing thermal unfolding profiles of antibodies with or without Fab glycans, we demonstrate that introduction of Fab glycans can improve antibody stability. Strikingly, removal of Fab glycans naturally acquired during antigen-specific immune responses can deteriorate antibody stability, suggesting in vivo selection of stable, glycosylated antibodies. Collectively, our data show that variable domain N-linked glycans acquired during somatic hypermutation can contribute to IgG antibody stability. These findings indicate that introducing Fab glycans may represent a mechanism to improve therapeutic/diagnostic antibody stability.
Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M
1993-11-01
A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.
International Nuclear Information System (INIS)
Ruan, John J.; Anderson, Scott F.; Davenport, James R. A.; Green, Paul J.; Morganson, Eric; Eracleous, Michael; Brandt, William N.; Myers, Adam D.; Badenes, Carles; Bershady, Matthew A.; Chambers, Kenneth C.; Flewelling, Heather; Kaiser, Nick; Dawson, Kyle S.; Heckman, Timothy M.; Isler, Jedidah C.; Kneib, Jean-Paul; MacLeod, Chelsea L.; Ross, Nicholas P.; Paris, Isabelle
2016-01-01
The Time-Domain Spectroscopic Survey (TDSS) is an SDSS-IV eBOSS subproject primarily aimed at obtaining identification spectra of ∼220,000 optically variable objects systematically selected from SDSS/Pan-STARRS1 multi-epoch imaging. We present a preview of the science enabled by TDSS, based on TDSS spectra taken over ∼320 deg 2 of sky as part of the SEQUELS survey in SDSS-III, which is in part a pilot survey for eBOSS in SDSS-IV. Using the 15,746 TDSS-selected single-epoch spectra of photometrically variable objects in SEQUELS, we determine the demographics of our variability-selected sample and investigate the unique spectral characteristics inherent in samples selected by variability. We show that variability-based selection of quasars complements color-based selection by selecting additional redder quasars and mitigates redshift biases to produce a smooth quasar redshift distribution over a wide range of redshifts. The resulting quasar sample contains systematically higher fractions of blazars and broad absorption line quasars than from color-selected samples. Similarly, we show that M dwarfs in the TDSS-selected stellar sample have systematically higher chromospheric active fractions than the underlying M-dwarf population based on their H α emission. TDSS also contains a large number of RR Lyrae and eclipsing binary stars with main-sequence colors, including a few composite-spectrum binaries. Finally, our visual inspection of TDSS spectra uncovers a significant number of peculiar spectra, and we highlight a few cases of these interesting objects. With a factor of ∼15 more spectra, the main TDSS survey in SDSS-IV will leverage the lessons learned from these early results for a variety of time-domain science applications.
Energy Technology Data Exchange (ETDEWEB)
Ruan, John J.; Anderson, Scott F.; Davenport, James R. A. [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Green, Paul J.; Morganson, Eric [Harvard Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Eracleous, Michael; Brandt, William N. [Department of Astronomy and Astrophysics, 525 Davey Lab, The Pennsylvania State University, University Park, PA 16802 (United States); Myers, Adam D. [Department of Physics and Astronomy 3905, University of Wyoming, 1000 E. University, Laramie, WY 82071 (United States); Badenes, Carles [Department of Physics and Astronomy and Pittsburgh Particle Physics, Astrophysics, and Cosmology Center (PITT-PACC), University of Pittsburgh (United States); Bershady, Matthew A. [Department of Astronomy, University of Wisconsin-Madison, 475 N. Charter Street, Madison, WI 53706 (United States); Chambers, Kenneth C.; Flewelling, Heather; Kaiser, Nick [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Dawson, Kyle S. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Heckman, Timothy M. [Center for Astrophysical Sciences, Department of Physics and Astronomy, Johns Hopkins University, Baltimore, MD 21218 (United States); Isler, Jedidah C. [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States); Kneib, Jean-Paul [Laboratoire d’astrophysique, Ecole Polytechnique Fédérale de Lausanne Observatoire de Sauverny, 1290 Versoix (Switzerland); MacLeod, Chelsea L.; Ross, Nicholas P. [Institute for Astronomy, University of Edinburgh, Royal Observatory, Edinburgh, EH9 3HJ (United Kingdom); Paris, Isabelle, E-mail: jruan@astro.washington.edu [INAF—Osservatorio Astronomico di Trieste, Via G. B. Tiepolo 11, I-34131 Trieste (Italy); and others
2016-07-10
The Time-Domain Spectroscopic Survey (TDSS) is an SDSS-IV eBOSS subproject primarily aimed at obtaining identification spectra of ∼220,000 optically variable objects systematically selected from SDSS/Pan-STARRS1 multi-epoch imaging. We present a preview of the science enabled by TDSS, based on TDSS spectra taken over ∼320 deg{sup 2} of sky as part of the SEQUELS survey in SDSS-III, which is in part a pilot survey for eBOSS in SDSS-IV. Using the 15,746 TDSS-selected single-epoch spectra of photometrically variable objects in SEQUELS, we determine the demographics of our variability-selected sample and investigate the unique spectral characteristics inherent in samples selected by variability. We show that variability-based selection of quasars complements color-based selection by selecting additional redder quasars and mitigates redshift biases to produce a smooth quasar redshift distribution over a wide range of redshifts. The resulting quasar sample contains systematically higher fractions of blazars and broad absorption line quasars than from color-selected samples. Similarly, we show that M dwarfs in the TDSS-selected stellar sample have systematically higher chromospheric active fractions than the underlying M-dwarf population based on their H α emission. TDSS also contains a large number of RR Lyrae and eclipsing binary stars with main-sequence colors, including a few composite-spectrum binaries. Finally, our visual inspection of TDSS spectra uncovers a significant number of peculiar spectra, and we highlight a few cases of these interesting objects. With a factor of ∼15 more spectra, the main TDSS survey in SDSS-IV will leverage the lessons learned from these early results for a variety of time-domain science applications.
Hegde, Veena; Deekshit, Ravishankar; Satyanarayana, P. S.
2011-12-01
The electrocardiogram (ECG) is widely used for diagnosis of heart diseases. Good quality of ECG is utilized by physicians for interpretation and identification of physiological and pathological phenomena. However, in real situations, ECG recordings are often corrupted by artifacts or noise. Noise severely limits the utility of the recorded ECG and thus needs to be removed, for better clinical evaluation. In the present paper a new noise cancellation technique is proposed for removal of random noise like muscle artifact from ECG signal. A transform domain robust variable step size Griffiths' LMS algorithm (TVGLMS) is proposed for noise cancellation. For the TVGLMS, the robust variable step size has been achieved by using the Griffiths' gradient which uses cross-correlation between the desired signal contaminated with observation or random noise and the input. The algorithm is discrete cosine transform (DCT) based and uses symmetric property of the signal to represent the signal in frequency domain with lesser number of frequency coefficients when compared to that of discrete Fourier transform (DFT). The algorithm is implemented for adaptive line enhancer (ALE) filter which extracts the ECG signal in a noisy environment using LMS filter adaptation. The proposed algorithm is found to have better convergence error/misadjustment when compared to that of ordinary transform domain LMS (TLMS) algorithm, both in the presence of white/colored observation noise. The reduction in convergence error achieved by the new algorithm with desired signal decomposition is found to be lower than that obtained without decomposition. The experimental results indicate that the proposed method is better than traditional adaptive filter using LMS algorithm in the aspects of retaining geometrical characteristics of ECG signal.
Lehmann, Andreas; Wixted, Josephine H F; Shapovalov, Maxim V; Roder, Heinrich; Dunbrack, Roland L; Robinson, Matthew K
2015-01-01
Phage-display technology facilitates rapid selection of antigen-specific single-chain variable fragment (scFv) antibodies from large recombinant libraries. ScFv antibodies, composed of a VH and VL domain, are readily engineered into multimeric formats for the development of diagnostics and targeted therapies. However, the recombinant nature of the selection strategy can result in VH and VL domains with sub-optimal biophysical properties, such as reduced thermodynamic stability and enhanced aggregation propensity, which lead to poor production and limited application. We found that the C10 anti-epidermal growth factor receptor (EGFR) scFv, and its affinity mutant, P2224, exhibit weak production from E. coli. Interestingly, these scFv contain a fusion of lambda3 and lambda1 V-region (LV3 and LV1) genes, most likely the result of a PCR aberration during library construction. To enhance the biophysical properties of these scFvs, we utilized a structure-based approach to replace and redesign the pre-existing framework of the VL domain to one that best pairs with the existing VH. We describe a method to exchange lambda sequences with a more stable kappa3 framework (KV3) within the VL domain that incorporates the original lambda DE-loop. The resulting scFvs, C10KV3_LV1DE and P2224KV3_LV1DE, are more thermodynamically stable and easier to produce from bacterial culture. Additionally, C10KV3_LV1DE and P2224KV3_LV1DE retain binding affinity to EGFR, suggesting that such a dramatic framework swap does not significantly affect scFv binding. We provide here a novel strategy for redesigning the light chain of problematic scFvs to enhance their stability and therapeutic applicability.
Stewart, Alex; Harrison, Joseph S; Regula, Lauren K; Lai, Jonathan R
2013-04-08
Analysis of factors contributing to high affinity antibody-protein interactions provides insight into natural antibody evolution, and guides the design of antibodies with new or enhanced function. We previously studied the interaction between antibody D5 and its target, a designed protein based on HIV-1 gp41 known as 5-Helix, as a model system [Da Silva, G. F.; Harrison, J. S.; Lai, J. R., Biochemistry, 2010, 49, 5464-5472]. Antibody D5 represents an interesting case study because it is derived from the VH1-69 germline segment; this germline segment is characterized by a hydrophobic second heavy chain complementarity determining region (HCDR2) that constitutes the major functional paratope in D5 and several antibodies derived from the same progenitor. Here we explore side chain requirements for affinity and specificity in D5 using phage display. Two D5-based libraries were prepared that contained diversity in all three light chain complementarity determining regions (LCDRs 1-3), and in the third HCDR (HCDR3). The first library allowed residues to vary among a restricted set of six amino acids (Tyr/Ala/Asp/Ser/His/Pro; D5-Lib-I). The second library was designed based on a survey of existing VH1-69 antibody structures (D5-Lib-II). Both libraries were subjected to multiple rounds of selection against 5-Helix, and individual clones characterized. We found that selectants from D5-Lib-I generally had moderate affinity and specificity, while many clones from D5-Lib-II exhibited D5-like properties. Additional analysis of the D5-Lib-II functional population revealed position-specific biases for particular amino acids, many that differed from the identity of those side chains in D5. Together these results suggest that there is some permissiveness for alternative side chains in the LCDRs and HCDR3 of D5, but that replacement with a minimal set of residues is not tolerated in this scaffold for 5-Helix recognition. This work provides novel information about this high
Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions
Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol
2008-06-01
The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.
Optimal Control of Thermo--Fluid Phenomena in Variable Domains
Volkov, Oleg; Protas, Bartosz
2008-11-01
This presentation concerns our continued research on adjoint--based optimization of viscous incompressible flows (the Navier--Stokes problem) coupled with heat conduction involving change of phase (the Stefan problem), and occurring in domains with variable boundaries. This problem is motivated by optimization of advanced welding techniques used in automotive manufacturing, where the goal is to determine an optimal heat input, so as to obtain a desired shape of the weld pool surface upon solidification. We argue that computation of sensitivities (gradients) in such free--boundary problems requires the use of the shape--differential calculus as a key ingredient. We also show that, with such tools available, the computational solution of the direct and inverse (optimization) problems can in fact be achieved in a similar manner and in a comparable computational time. Our presentation will address certain mathematical and computational aspects of the method. As an illustration we will consider the two--phase Stefan problem with contact point singularities where our approach allows us to obtain a thermodynamically consistent solution.
Berstein, R M; Schluter, S F; Shen, S; Marchalonis, J J
1996-04-16
All immunoglobulins and T-cell receptors throughout phylogeny share regions of highly conserved amino acid sequence. To identify possible primitive immunoglobulins and immunoglobulin-like molecules, we utilized 3' RACE (rapid amplification of cDNA ends) and a highly conserved constant region consensus amino acid sequence to isolate a new immunoglobulin class from the sandbar shark Carcharhinus plumbeus. The immunoglobulin, termed IgW, in its secreted form consists of 782 amino acids and is expressed in both the thymus and the spleen. The molecule overall most closely resembles mu chains of the skate and human and a new putative antigen binding molecule isolated from the nurse shark (NAR). The full-length IgW chain has a variable region resembling human and shark heavy-chain (VH) sequences and a novel joining segment containing the WGXGT motif characteristic of H chains. However, unlike any other H-chain-type molecule, it contains six constant (C) domains. The first C domain contains the cysteine residue characteristic of C mu1 that would allow dimerization with a light (L) chain. The fourth and sixth domains also contain comparable cysteines that would enable dimerization with other H chains or homodimerization. Comparison of the sequences of IgW V and C domains shows homology greater than that found in comparisons among VH and C mu or VL, or CL thereby suggesting that IgW may retain features of the primordial immunoglobulin in evolution.
DEFF Research Database (Denmark)
Räber, Lorenz; Heo, Jung Ho; Radu, Maria D
2012-01-01
To demonstrate the feasibility and potential usefulness of an offline fusion of matched optical coherence tomography (OCT) and intravascular ultrasound (IVUS)/virtual histology (IVUS-VH) images.......To demonstrate the feasibility and potential usefulness of an offline fusion of matched optical coherence tomography (OCT) and intravascular ultrasound (IVUS)/virtual histology (IVUS-VH) images....
Hilborn, Jennifer V; Strauss, Esther; Hultsch, David F; Hunter, Michael A
2009-05-01
A growing body of research suggests that substantial variability exists among cognitive abilities within individuals. This within-person variability across cognitive domains is termed dispersion. The present study investigated the relationship between aging and dispersion of cognitive functions both quantitatively (overall levels of dispersion) and qualitatively (patterns of dispersion) in a sample of 304 nondemented, older adults aged 64 to 92 years (M = 74.02). Quantitatively, higher levels of dispersion were observed in the old-old adults (aged 75-92 years) and those identified as having experienced cognitive decline, suggesting that dispersion level may serve as a marker of cognitive integrity. Qualitatively, three distinct dispersion profiles were identified through clustering methods, and these were found to be related to demographic, health, and performance characteristics of the individuals, suggesting that patterns of dispersion may be meaningful indicators of individual differences.
International Nuclear Information System (INIS)
Burrell, K.H.; Osborne, T.H.; Groebner, R.J.; Rettig, C.L.
1993-01-01
VH-mode plasma exhibit energy confinement times up to 2.4 times the DIII-D/JET H-mode scaling relation and up to 3.9 times the value given by ITER89-P L-mode scaling. If this confinement improvement can be exploited in reactor plasmas, smaller prototype reactors with significantly lower unit cost can be produced. Accordingly, understanding and optimizing the confinement improvement is of significant interest. One of the possible explanations for this bulk confinement improvement is stabilization of turbulence by shear in the radial electric field, similar to the present explanation for the confinement improvement at the extreme plasma edge at the L to H transition. Preliminary measurements have shown that the region of the plasma where the electric field gradient is steepest broadens when the plasma goes from H-mode to VH-mode. More recent measurements have confirmed this broadening and have shown that the change in the electric field gradient occurs prior to the change in the thermal transport. In addition, transport analysis shows that the electric field shear increases in the same region between magnetic flux coordinate p=0.6 and 0.9 where the local thermal transport decreases. Furthermore, far infra-red (FIR) scattering measurements have detected density fluctuations in the region around p=0.8 which could be responsible for enhanced transport and which disappear at the time that the electric shear increases. These fluctuations appear as bursts of density fluctuations in the 0.5 to 1.5 MHz range. The time between bursts increases as the electric field shear increases. Once these bursts disappear, the major change in confinement takes place in most discharges. When isolated bursts occur, the heat and angular momentum pulse connected with the burst are detectable on the plasma profile diagnostics. (author) 13 refs., 4 figs
Vallot, Dorothée; Applegate, Patrick; Pettersson, Rickard
2013-04-01
Projecting future climate and ice sheet development requires sophisticated models and extensive field observations. Given the present state of our knowledge, it is very difficult to say what will happen with certainty. Despite the ongoing increase in atmospheric greenhouse gas concentrations, the possibility that a new ice sheet might form over Scandinavia in the far distant future cannot be excluded. The growth of a new Scandinavian Ice Sheet would have important consequences for buried nuclear waste repositories. The Greenland Analogue Project, initiated by the Swedish Nuclear Fuel and Waste Management Company (SKB), is working to assess the effects of a possible future ice sheet on groundwater flow by studying a constrained domain in Western Greenland by field measurements (including deep bedrock drilling in front of the ice sheet) combined with numerical modeling. To address the needs of the GAP project, we interpolated results from an ensemble of ice sheet model runs to the smaller and more finely resolved modeling domain used in the GAP project's hydrologic modeling. Three runs have been chosen with three fairly different positive degree-day factors among those that reproduced the modern ice margin at the borehole position. The interpolated results describe changes in hydrologically-relevant variables over two time periods, 115 ka to 80 ka, and 20 ka to 1 ka. In the first of these time periods, the ice margin advances over the model domain; in the second time period, the ice margin retreats over the model domain. The spatially-and temporally dependent variables that we treated include the ice thickness, basal melting rate, surface mass balance, basal temperature, basal thermal regime (frozen or thawed), surface temperature, and basal water pressure. The melt flux is also calculated.
Search for $VH\\rightarrow$ leptons + $b\\bar{b}$ with the ATLAS experiment at the LHC
AUTHOR|(CDS)2079589
The search for a Higgs boson decaying to a $b\\bar{b}$ pair is one of the key analyses ongoing at the ATLAS experiment. Despite being the largest branching ratio decay for a Standard Model Higgs boson, a large dataset is necessary to perform this analysis because of the very large backgrounds affecting the measurement. To discriminate the electroweak $H\\rightarrow b\\bar{b}$ signal from the large QCD backgrounds, the associated production of the Higgs with a $W$ or a $Z$ boson decaying leptonically is used. Different techniques have been proposed to enhance the signal over background ratio in the $VH(b\\bar{b})$ channel, from dedicated kinematic cuts, to a single large radius jet to identify the two collimated $b$'s in the Higgs high transverse momentum regime, to multivariate techniques. The high-$p_{\\mathrm{T}}$ approach, using a large radius jet to identify the $b$'s coming from the Higgs decay, has been tested against an analysis based on kinematic cuts for a dataset of $4.7$ fb$^{-1}$ luminosity at $\\sqrt{s...
Cortright, Catherine C; Center, Sharon A; Randolph, John F; McDonough, Sean P; Fecteau, Kellie A; Warner, Karen L; Chiapella, Ann M; Pierce, Rhonda L; Graham, A Heather; Wall, Linda J; Heidgerd, John H; Degen, Melisa A; Lucia, Patricia A; Erb, Hollis N
2014-10-01
To characterize signalment, clinical features, clinicopathologic variables, hepatic ultrasonographic characteristics, endocrinologic profiles, treatment response, and age at death of Scottish Terriers with progressive vacuolar hepatopathy (VH) with or without hepatocellular carcinoma (HCC). Retrospective case series. 114 Scottish Terriers with progressive VH. Electronic databases from 1980 to 2013 were searched for adult (age > 1 year) Scottish Terriers with histopathologic diagnoses of diffuse glycogen-like VH. Available sections of liver specimens were histologically reevaluated to confirm diffuse VH with or without HCC; 8 dogs with HCC only had neoplastic tissue available. Physical examination, clinicopathologic, treatment, and survival data were obtained. 39 of 114 (34%) dogs with VH had HCC detected at surgery or necropsy or by abdominal ultrasonography. Histologic findings indicated that HCC was seemingly preceded by dysplastic hepatocellular foci. No significant differences were found in clinicopathologic variables or age at death between VH-affected dogs with or without HCC. Fifteen of 26 (58%) dogs with high hepatic copper concentrations had histologic features consistent with copper-associated hepatopathy. Although signs consistent with hyperadrenocorticism were observed in 40% (46/114) of dogs, definitive diagnosis was inconsistently confirmed. Assessment of adrenal sex hormone concentrations before and after ACTH administration identified high progesterone and androstenedione concentrations in 88% (22/25) and 80% (20/25) of tested dogs, respectively. Results suggested that VH in Scottish Terriers may be linked to adrenal steroidogenesis and a predisposition to HCC. In dogs with VH, frequent serum biochemical analysis and ultrasonographic surveillance for early tumor detection are recommended.
Directory of Open Access Journals (Sweden)
Ryan B Craig
Full Text Available BACKGROUND: Anti-HIV immunoconjugates targeted to the HIV envelope protein may be used to eradicate the latent reservoir of HIV infection using activate-and-purge protocols. Previous studies have identified the two target epitopes most effective for the delivery of cytotoxic immunoconjugates the CD4-binding site of gp120, and the hairpin loop of gp41. Here we construct and test tetravalent double variable domain immunoglobulin molecules (DVD-Igs that bind to both epitopes. METHODS: Synthetic genes that encode DVD-Igs utilizing V-domains derived from human anti-gp120 and anti-gp41 Abs were designed and expressed in 293F cells. A series of constructs tested different inter-V-linker domains and orientations of the two V domains. Antibodies were tested for binding to recombinant Ag and native Env expressed on infected cells, for neutralization of infectious HIV, and for their ability to deliver cytotoxic immunoconjugates to infected cells. FINDINGS: The outer V-domain was the major determinant of binding and functional activity of the DVD-Ig. Function of the inner V-domain and bifunctional binding required at least 15 AA in the inter-V-domain linker. A molecular model showing the spatial orientation of the two epitopes is consistent with this observation. Linkers that incorporated helical domains (A[EAAAK](nA resulted in more effective DVD-Igs than those based solely on flexible domains ([GGGGS](n. In general, the DVD-Igs outperformed the less effective parental antibody and equaled the activity of the more effective. The ability of the DVD-Igs to deliver cytotoxic immunoconjugates in the absence of soluble CD4 was improved over that of either parent. CONCLUSIONS: DVD-Igs can be designed that bind to both gp120 and gp41 on the HIV envelope. DVD-Igs are effective in delivering cytotoxic immunoconjugates. The optimal design of these DVD-Igs, in which both domains are fully functional, has not yet been achieved.
Fab-dsFv: A bispecific antibody format with extended serum half-life through albumin binding.
Davé, Emma; Adams, Ralph; Zaccheo, Oliver; Carrington, Bruce; Compson, Joanne E; Dugdale, Sarah; Airey, Michael; Malcolm, Sarah; Hailu, Hanna; Wild, Gavin; Turner, Alison; Heads, James; Sarkar, Kaushik; Ventom, Andrew; Marshall, Diane; Jairaj, Mark; Kopotsha, Tim; Christodoulou, Louis; Zamacona, Miren; Lawson, Alastair D; Heywood, Sam; Humphreys, David P
2016-10-01
An antibody format, termed Fab-dsFv, has been designed for clinical indications that require monovalent target binding in the absence of direct Fc receptor (FcR) binding while retaining substantial serum presence. The variable fragment (Fv) domain of a humanized albumin-binding antibody was fused to the C-termini of Fab constant domains, such that the VL and VH domains were individually connected to the Cκ and CH1 domains by peptide linkers, respectively. The anti-albumin Fv was selected for properties thought to be desirable to ensure a durable serum half-life mediated via FcRn. The Fv domain was further stabilized by an inter-domain disulfide bond. The bispecific format was shown to be thermodynamically and biophysically stable, and retained good affinity and efficacy to both antigens simultaneously. In in vivo studies, the serum half-life of Fab-dsFv, 2.6 d in mice and 7.9 d in cynomolgus monkeys, was equivalent to Fab'-PEG.
Porous silicon biosensor for detection of variable domain of heavy-chain of HCAb antibody
Zhang, Hong-yan; Lü, Xiao-yi; Jia, Zhen-hong; Li, Jiang-wei; Zhang, Fu-chun
2012-03-01
In this paper, we produce porous silicon (PSi) by electrochemical etching, and it is the first time to evaluate the performance of label-free porous silicon biosensor for detection of variable domain of heavy chain of heavy-chain antibody (VHH). The binding of hen egg white lysozyme (HEWL) and VHH causes a red shift in the reflection spectrum of the biosensor. The red shift is proportional to the VHH concentration in the range from 14 g·ml-1 to 30 g·ml-1 with a detection limit of 0.648 ng·ml-1. The research is useful for the development of label-free biosensor applied in the rapid and sensitive determination of small molecules.
Isolation of Osteosarcoma-Associated Human Antibodies from a Combinatorial Fab Phage Display Library
Directory of Open Access Journals (Sweden)
Carmela Dantas-Barbosa
2009-01-01
Full Text Available Osteosarcoma, a highly malignant disease, is the most common primary bone tumor and is frequently found in children and adolescents. In order to isolate antibodies against osteosarcoma antigens, a combinatorial osteosarcoma Fab library displayed on the surface of phages was used. After three rounds of selection on the surface of tumor cells, several osteosarcoma-reactive Fabs were detected. From these Fabs, five were better characterized, and despite having differences in their VH (heavy chain variable domain and Vκ (kappa chain variable domain regions, they all bound to a protein with the same molecular mass. Further analysis by cell ELISA and immunocytochemistry suggested that the Fabs recognize a membrane-associated tumor antigen expressed in higher amounts in neoplasic cells than in normal tissue. These results suggest that the human Fabs selected in this work are a valuable tool for the study of this neoplasia.
Domain-General Factors Influencing Numerical and Arithmetic Processing
Directory of Open Access Journals (Sweden)
André Knops
2017-12-01
Full Text Available This special issue contains 18 articles that address the question how numerical processes interact with domain-general factors. We start the editorial with a discussion of how to define domain-general versus domain-specific factors and then discuss the contributions to this special issue grouped into two core numerical domains that are subject to domain-general influences (see Figure 1. The first group of contributions addresses the question how numbers interact with spatial factors. The second group of contributions is concerned with factors that determine and predict arithmetic understanding, performance and development. This special issue shows that domain-general (Table 1a as well as domain-specific (Table 1b abilities influence numerical and arithmetic performance virtually at all levels and make it clear that for the field of numerical cognition a sole focus on one or several domain-specific factors like the approximate number system or spatial-numerical associations is not sufficient. Vice versa, in most studies that included domain-general and domain-specific variables, domain-specific numerical variables predicted arithmetic performance above and beyond domain-general variables. Therefore, a sole focus on domain-general aspects such as, for example, working memory, to explain, predict and foster arithmetic learning is also not sufficient. Based on the articles in this special issue we conclude that both domain-general and domain-specific factors contribute to numerical cognition. But the how, why and when of their contribution still needs to be better understood. We hope that this special issue may be helpful to readers in constraining future theory and model building about the interplay of domain-specific and domain-general factors.
Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John
2015-10-01
Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.
Zhang, Wei-wei; Sun, Kun; Cheng, Shuang; Sun, Li
2008-10-01
Vibrio harveyi is an important marine pathogen that can infect a number of aquaculture species. V. harveyi degQ (degQ(Vh)), the gene encoding a DegQ homologue, was cloned from T4, a pathogenic V. harveyi strain isolated from diseased fish. DegQ(Vh) was closely related to the HtrA family members identified in other Vibrio species and could complement the temperature-sensitive phenotype of an Escherichia coli strain defective in degP. Expression of degQ(Vh) in T4 was modulated by temperature, possibly through the sigma(E)-like factor. Enzymatic analyses demonstrated that the recombinant DegQ(Vh) protein expressed in and purified from E. coli was an active serine protease whose activity required the integrity of the catalytic site and the PDZ domains. The optimal temperature and pH of the recombinant DegQ(Vh) protein were 50 degrees C and pH 8.0. A vaccination study indicated that the purified recombinant DegQ(Vh) was a protective immunogen that could confer protection upon fish against infection by V. harveyi. In order to improve the efficiency of DegQ(Vh) as a vaccine, a genetic construct in the form of the plasmid pAQ1 was built, in which the DNA encoding the processed DegQ(Vh) protein was fused with the DNA encoding the secretion region of AgaV, an extracellular beta-agarase. The E. coli strain harboring pAQ1 could express and secrete the chimeric DegQ(Vh) protein into the culture supernatant. Vaccination of fish with viable E. coli expressing chimeric degQ(Vh) significantly (P < 0.001) enhanced the survival of fish against V. harveyi challenge, which was possibly due to the relatively prolonged exposure of the immune system to the recombinant antigen produced constitutively, albeit at a gradually decreasing level, by the carrier strain.
International Nuclear Information System (INIS)
Gohil, P.; Burrell, K.H.; Groebner, R.J.; Osborne, T.H.; Doyle, E.J.; Rettig, C.L.
1993-08-01
Measurements of the radial electric field, E r , with high spatial and high time resolution in H-mode and VH-mode discharges in the DIII-D tokamak have revealed the significant influence of the shear in E r on confinement and transport in these discharges. These measurements are made using the DIII-D Charge Exchange Recombination (CER) System. At the L-H transition in DIII-D plasmas, a negative well-like E r profile develops just within the magnetic separatrix. A region of shear in E r results, which extends 1 to 2 cm into the plasma from the separatrix. At the transition, this region of sheared E r exhibits the greatest increase in impurity ion poloidal rotation velocity and the greatest reduction in plasma fluctuations. A transport barrier is formed in this same region of E x B velocity shear as is signified by large increases in the observed gradients of the ion temperature, the carbon density, the electron temperature and electron density. The development of the region of sheared E r , the increase in impurity ion poloidal rotation, the reduction in plasma turbulence, and the transport barrier all occur simultaneously at the L-H transition. Measurements of the radial electric field, plasma turbulence, thermal transport, and energy confinement have been performed for a wide range of plasma conditions and configurations. The results support the supposition that the progression of improving confinement at the L-H transition, into the H-mode and then into the VH-mode can be explained by the hypothesis of the suppression of plasma turbulence by the increasing penetration of the region of sheared E x B velocity into the plasma interior
Heart rate variability is associated with psychosocial stress in distinct social domains.
Lischke, Alexander; Jacksteit, Robert; Mau-Moeller, Anett; Pahnke, Rike; Hamm, Alfons O; Weippert, Matthias
2018-03-01
Psychosocial stress is associated with substantial morbidity and mortality. Accordingly, there is a growing interest in biomarkers that indicate whether individuals show adaptive (i.e., stress-buffering and health-promoting) or maladaptive (i.e., stress-escalating and health-impairing) stress reactions in social contexts. As heart rate variability (HRV) has been suggested to be a biomarker of adaptive behavior during social encounters, it may be possible that inter-individual differences in HRV are associated with inter-individual differences regarding stress in distinct social domains. To test this hypothesis, resting state HRV and psychosocial stress was assessed in 83 healthy community-dwelling individuals (age: 18-35years). HRV was derived from heart rate recordings during spontaneous and instructed breathing to assess the robustness of possible associations between inter-individual differences in HRV and inter-individual differences in psychosocial stress. Psychosocial stress was determined with a self-report questionnaire assessing stress in distinct social domains. A series of categorical and dimensional analyses revealed an association between inter-individual differences in HRV and inter-individual differences in psychosocial stress: Individuals with high HRV reported less stress in social life, but not in family life, work life or everyday life, than individuals with low HRV. On basis of these findings, it may be assumed that individuals with high HRV experience less psychosocial stress than individuals with low HRV. Although such an assumption needs to be corroborated by further findings, it seems to be consistent with previous findings showing that individuals with high HRV suffer less from stress and stress-related disorders than individuals with low HRV. Copyright © 2018 Elsevier Inc. All rights reserved.
Strauss, Esther; MacDonald, Stuart W S; Hunter, Michael; Moll, Alex; Hultsch, David F
2002-11-01
Intraindividual variability of physical status and affect/beliefs as well as their relations with cognition were examined in 3 groups of older adults: healthy elderly, individuals with a nonneurological health-related disturbance (arthritis) and people with neurological compromise (dementia). The findings showed that greater inconsistency in physical performance was observed in groups characterized by central nervous system dysfunction. By contrast, fluctuations in affect appeared to reflect other more transient sources, such as pain. In general, increased inconsistency in non-cognitive domains was associated with poorer cognitive function. There were cross-domain links between inconsistency in physical functioning and fluctuations in cognitive performance, although the nature of the links depended largely upon the neurological status of the individuals. Considered together, the result indicated that measures of cognitive as well as physical variability are important behavioral markers of neurological integrity.
Gough, N M; Bernard, O
1981-01-01
To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...
DEFF Research Database (Denmark)
Ohm-Laursen, Line; Nielsen, Morten; Larsen, Stine R
2006-01-01
gene (VH) replacement. Safe conclusions require large, well-defined sequence samples and algorithms minimizing stochastic assignment of segments. Two computer programs were developed for analysis of heavy chain joints. JointHMM is a profile hidden Markow model, while JointML is a maximum...
Energy Technology Data Exchange (ETDEWEB)
Kelly, Brandon C. [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106-9530 (United States); Becker, Andrew C. [Department of Astronomy, University of Washington, P.O. Box 351580, Seattle, WA 98195-1580 (United States); Sobolewska, Malgosia [Nicolaus Copernicus Astronomical Center, Bartycka 18, 00-716, Warsaw (Poland); Siemiginowska, Aneta [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Uttley, Phil [Astronomical Institute Anton Pannekoek, University of Amsterdam, Postbus 94249, 1090 GE Amsterdam (Netherlands)
2014-06-10
We present the use of continuous-time autoregressive moving average (CARMA) models as a method for estimating the variability features of a light curve, and in particular its power spectral density (PSD). CARMA models fully account for irregular sampling and measurement errors, making them valuable for quantifying variability, forecasting and interpolating light curves, and variability-based classification. We show that the PSD of a CARMA model can be expressed as a sum of Lorentzian functions, which makes them extremely flexible and able to model a broad range of PSDs. We present the likelihood function for light curves sampled from CARMA processes, placing them on a statistically rigorous foundation, and we present a Bayesian method to infer the probability distribution of the PSD given the measured light curve. Because calculation of the likelihood function scales linearly with the number of data points, CARMA modeling scales to current and future massive time-domain data sets. We conclude by applying our CARMA modeling approach to light curves for an X-ray binary, two active galactic nuclei, a long-period variable star, and an RR Lyrae star in order to illustrate their use, applicability, and interpretation.
International Nuclear Information System (INIS)
Kelly, Brandon C.; Becker, Andrew C.; Sobolewska, Malgosia; Siemiginowska, Aneta; Uttley, Phil
2014-01-01
We present the use of continuous-time autoregressive moving average (CARMA) models as a method for estimating the variability features of a light curve, and in particular its power spectral density (PSD). CARMA models fully account for irregular sampling and measurement errors, making them valuable for quantifying variability, forecasting and interpolating light curves, and variability-based classification. We show that the PSD of a CARMA model can be expressed as a sum of Lorentzian functions, which makes them extremely flexible and able to model a broad range of PSDs. We present the likelihood function for light curves sampled from CARMA processes, placing them on a statistically rigorous foundation, and we present a Bayesian method to infer the probability distribution of the PSD given the measured light curve. Because calculation of the likelihood function scales linearly with the number of data points, CARMA modeling scales to current and future massive time-domain data sets. We conclude by applying our CARMA modeling approach to light curves for an X-ray binary, two active galactic nuclei, a long-period variable star, and an RR Lyrae star in order to illustrate their use, applicability, and interpretation.
A Single Residue in Ebola Virus Receptor NPC1 Influences Cellular Host Range in Reptiles
2016-09-07
VH-2) is resistant to infection in an NPC1-36 dependent manner . We found that VH-2 cells are resistant to EBOV infection because the Rus-37...infection in a host species-dependent manner (24). Here, we demonstrate that an adjacent 89 residue, 503, highly conserved in the domain C of NPC1...Tyr sequence 194 change at residue 503 might influence EBOV GPCL–NPC1 binding in a bidirectional manner . 195 Accordingly, we expressed and
International Nuclear Information System (INIS)
Moore, L.M.; Byers, F.M. Jr.; Broxton, D.E.
1989-06-01
A thin-section operator-variance test was given to the 2 junior authors, petrographers, by the senior author, a statistician, using 16 thin sections cut from core plugs drilled by the US Geological Survey from drill hole USW VH-2 standard (HCQ) drill core. The thin sections are samples of Topopah Spring devitrified rhyolite tuff from four textural zones, in ascending order: (1) lower nonlithophysal, (2) lower lithopysal, (3) middle nonlithophysal, and (4) upper lithophysal. Drill hole USW-VH-2 is near the center of the Crater Flat, about 6 miles WSW of the Yucca Mountain in Exploration Block. The original thin-section labels were opaqued out with removable enamel and renumbered with alpha-numeric labels. The sliders were then given to the petrographer operators for quantitative thin-section modal (point-count) analysis of cryptocrystalline, spherulitic, granophyric, and void textures, as well as phenocryst minerals. Between operator variance was tested by giving the two petrographers the same slide, and within-operator variance was tested by the same operator the same slide to count in a second test set, administered at least three months after the first set. Both operators were unaware that they were receiving the same slide to recount. 14 figs., 6 tabs
Energy Technology Data Exchange (ETDEWEB)
Krauss, Liane; Kottmeier, Christoph [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Meteorology and Climate Research; Hauck, Christian [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Meteorology and Climate Research; Fribourg Univ. (Switzerland). Dept. of Geosciences
2010-12-15
Within the 'Convective and Orographically-induced Precipitation Study' (COPS) 2007 in Southwest Germany and Northeast France a soil moisture monitoring network was installed. The aim of the network is to identify the interaction between the temporal and spatial variability of the soil moisture field and its influence on the energy balance and the moisture availability in the planetary boundary layer. The network is comprised of a large number of newly developed low-cost soil moisture sensors based on the frequency-domain reflectometry method (FDR). In total 47 soil moisture stations within the COPS domain were each equipped with two to four sensors simultaneously measuring vertical profiles of soil moisture and soil temperature down to 50 cm depth. This contribution describes the soil moisture network, its installation procedure and the calibration of the sensor output signal. Furthermore we discuss the soil texture distribution within the study area and present first analyses of the spatio-temporal soil moisture variability during a 13 month period from June 2007 till June 2008 based on regional differences and site specific properties (altitude and soil texture). Results show that the altitude plays a key role for the overall soil moisture pattern relative to the area mean due to the direct linkage to precipitation patterns. Soil texture controls the vertical soil moisture gradient relative to the near surface soil moisture, as their properties control water storage and drainage characteristics. Both factors significantly influence regional soil moisture patterns in Southwest Germany. (orig.)
Neggers, R.
2017-12-01
Recent advances in supercomputing have introduced a "grey zone" in the representation of cumulus convection in general circulation models, in which this process is partially resolved. Cumulus parameterizations need to be made scale-aware and scale-adaptive to be able to conceptually and practically deal with this situation. A potential way forward are schemes formulated in terms of discretized Cloud Size Densities, or CSDs. Advantages include i) the introduction of scale-awareness at the foundation of the scheme, and ii) the possibility to apply size-filtering of parameterized convective transport and clouds. The CSD is a new variable that requires closure; this concerns its shape, its range, but also variability in cloud number that can appear due to i) subsampling effects and ii) organization in a cloud field. The goal of this study is to gain insight by means of sub-domain analyses of various large-domain LES realizations of cumulus cloud populations. For a series of three-dimensional snapshots, each with a different degree of organization, the cloud size distribution is calculated in all subdomains, for a range of subdomain sizes. The standard deviation of the number of clouds of a certain size is found to decrease with the subdomain size, following a powerlaw scaling corresponding to an inverse-linear dependence. Cloud number variability also increases with cloud size; this reflects that subsampling affects the largest clouds first, due to their typically larger neighbor spacing. Rewriting this dependence in terms of two dimensionless groups, by dividing by cloud number and cloud size respectively, yields a data collapse. Organization in the cloud field is found to act on top of this primary dependence, by enhancing the cloud number variability at the smaller sizes. This behavior reflects that small clouds start to "live" on top of larger structures such as cold pools, favoring or inhibiting their formation (as illustrated by the attached figure of cloud mask
Variability and conservation of structural domains in divide-and-conquer approaches
Energy Technology Data Exchange (ETDEWEB)
Wiegand, Thomas [ETH Zurich, Physical Chemistry (Switzerland); Gardiennet, Carole [CNRS, Université de Lorraine, CRM2, UMR 7036 (France); Cadalbert, Riccardo [ETH Zurich, Physical Chemistry (Switzerland); Lacabanne, Denis; Kunert, Britta; Terradot, Laurent, E-mail: laurent.terradot@ibcp.fr; Böckmann, Anja, E-mail: a.bockmann@ibcp.fr [Université de Lyon, Institut de Biologie et Chimie des Protéines, Bases Moléculaires et Structurales des Systèmes Infectieux, Labex Ecofect, UMR 5086 CNRS (France); Meier, Beat H., E-mail: beme@ethz.ch [ETH Zurich, Physical Chemistry (Switzerland)
2016-06-15
The use of protein building blocks for the structure determination of multidomain proteins and protein–protein complexes, also known as the “divide and conquer” approach, is an important strategy for obtaining protein structures. Atomic-resolution X-ray or NMR data of the individual domains are combined with lower-resolution electron microscopy maps or X-ray data of the full-length protein or the protein complex. Doing so, it is often assumed that the individual domain structures remain invariant in the context of the superstructure. In this work, we show the potentials and limitations of NMR to validate this approach at the example of the dodecameric DnaB helicase from Helicobacter pylori. We investigate how sequentially assigned spectra, as well as unassigned spectral fingerprints can be used to indicate the conservation of individual domains, and also to highlight conformational differences.
DEFF Research Database (Denmark)
Willumsen, B M; Papageorge, A G; Hubbert, N
1985-01-01
or increasing it to 50 amino acids has relatively little effect on the capacity of the gene to induce morphological transformation of NIH 3T3 cells. Assays of GTP binding, GTPase and autophosphorylating activities of such mutant v-rasH-encoded proteins synthesized in bacteria indicated that the sequences...... that is required for post-translational processing, membrane localization and transforming activity of the proteins. We have now used the viral oncogene (v-rasH) of Harvey sarcoma virus to study the major variable region by deleting or duplicating parts of the gene. Reducing this region to five amino acids...... that encode these biochemical activities are located upstream from the major variable region. In the context of transformation, we propose that the region of sequence heterogeneity serves principally to connect the N-terminal catalytic domain with amino acids at the C terminus that are required to anchor...
Bifunctional Anti-Non-Amyloid Component α-Synuclein Nanobodies Are Protective In Situ.
Directory of Open Access Journals (Sweden)
David C Butler
Full Text Available Misfolding, abnormal accumulation, and secretion of α-Synuclein (α-Syn are closely associated with synucleinopathies, including Parkinson's disease (PD. VH14 is a human single domain intrabody selected against the non-amyloid component (NAC hydrophobic interaction region of α-Syn, which is critical for initial aggregation. Using neuronal cell lines, we show that as a bifunctional nanobody fused to a proteasome targeting signal, VH14PEST can counteract heterologous proteostatic effects of mutant α-Syn on mutant huntingtin Exon1 and protect against α-Syn toxicity using propidium iodide or Annexin V readouts. We compared this anti-NAC candidate to NbSyn87, which binds to the C-terminus of α-Syn. NbSyn87PEST degrades α-Syn as well or better than VH14PEST. However, while both candidates reduced toxicity, VH14PEST appears more effective in both proteostatic stress and toxicity assays. These results show that the approach of reducing intracellular monomeric targets with novel antibody engineering technology should allow in vivo modulation of proteostatic pathologies.
International Nuclear Information System (INIS)
Gilman-Sachs, A.; Roux, K.H.; Horing, W.J.; Dray, S.
1982-01-01
Anti-allotype antisera were produced that identified eight rabbit IgM allotypic specificities, n80, n81, n82, n83, n84, n85, n86, and n87. The n locus Cμ genes controlling these IgM allotypic specificities are closely linked to the a (VH subgroup) locus. The genes controlling these allotypic specificities were found to be in the heavy chain chromosomal region and were assigned to 11 haplotypes present in our rabbit colony. The n locus and a locus genes appeared in the haplotypes in six combinations: a 1 n 81 , a 2 n/sup 81,n87/, a 1 n/sup 80,83/, a 2 n/sup 80,82,87/, a 3 n/sup 81,84,85/ and a 3 n/sup 80,84,86,87/. By radioprecipitation analysis, 70 to 80% of serum IgM reacts with the antiserum directed to each n locus allotypic specificity found encoded in one haplotype; thus, each allotypic specificity of the haplotype is present on the same IgM molecule. When sera from a locus allotype-suppressed homozygous rabbits were tested for expression of each n locus allotypic specificity, n80, n81, and n87 were still expressed, whereas n82, n83, n84, n85, and n86 were not. These data provide direct evidence that some IgM specificities are expressed independently of the a locus (i.e., ''true''), and other s are dependent on the expression of an a locus specificity (i.e., conformational). The expression of the ''true'' allotypic specificities probably reflects genetic control of the germline Cμ gene, and the expression of ''conformationally dependent'' allotypic specificities probably reflects the interaction of VH and Cμ gene segments. This distinction is important and must be recognized when evaluating the genetics and structure of the IgM molecule
Bedeschi, Maria Francesca; Marangi, Giuseppe; Calvello, Maria Rosaria; Ricciardi, Stefania; Leone, Francesca Pia Chiara; Baccarin, Marco; Guerneri, Silvana; Orteschi, Daniela; Murdolo, Marina; Lattante, Serena; Frangella, Silvia; Keena, Beth; Harr, Margaret H; Zackai, Elaine; Zollino, Marcella
2017-11-01
Pitt-Hopkins syndrome is a neurodevelopmental disorder characterized by severe intellectual disability and a distinctive facial gestalt. It is caused by haploinsufficiency of the TCF4 gene. The TCF4 protein has different functional domains, with the NLS (nuclear localization signal) domain coded by exons 7-8 and the bHLH (basic Helix-Loop-Helix) domain coded by exon 18. Several alternatively spliced TCF4 variants have been described, allowing for translation of variable protein isoforms. Typical PTHS patients have impairment of at least the bHLH domain. To which extent impairment of the remaining domains contributes to the final phenotype is not clear. There is recent evidence that certain loss-of-function variants disrupting TCF4 are associated with mild ID, but not with typical PTHS. We describe a frameshift-causing partial gene deletion encompassing exons 4-6 of TCF4 in an adult patient with mild ID and nonspecific facial dysmorphisms but without the typical features of PTHS, and a c.520C > T nonsense variant within exon 8 in a child presenting with a severe phenotype largely mimicking PTHS, but lacking the typical facial dysmorphism. Investigation on mRNA, along with literature review, led us to suggest a preliminary phenotypic map of loss-of-function variants affecting TCF4. An intragenic phenotypic map of loss-of-function variants in TCF4 is suggested here for the first time: variants within exons 1-4 and exons 4-6 give rise to a recurrent phenotype with mild ID not in the spectrum of Pitt-Hopkins syndrome (biallelic preservation of both the NLS and bHLH domains); variants within exons 7-8 cause a severe phenotype resembling PTHS but in absence of the typical facial dysmorphism (impairment limited to the NLS domain); variants within exons 9-19 cause typical Pitt-Hopkins syndrome (impairment of at least the bHLH domain). Understanding the TCF4 molecular syndromology can allow for proper nosology in the current era of whole genomic investigations. Copyright
Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An
2015-01-01
Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665
An Algebro-Topological Description of Protein Domain Structure
Penner, Robert Clark; Knudsen, Michael; Wiuf, Carsten; Andersen, Jørgen Ellegaard
2011-01-01
The space of possible protein structures appears vast and continuous, and the relationship between primary, secondary and tertiary structure levels is complex. Protein structure comparison and classification is therefore a difficult but important task since structure is a determinant for molecular interaction and function. We introduce a novel mathematical abstraction based on geometric topology to describe protein domain structure. Using the locations of the backbone atoms and the hydrogen bonds, we build a combinatorial object – a so-called fatgraph. The description is discrete yet gives rise to a 2-dimensional mathematical surface. Thus, each protein domain corresponds to a particular mathematical surface with characteristic topological invariants, such as the genus (number of holes) and the number of boundary components. Both invariants are global fatgraph features reflecting the interconnectivity of the domain by hydrogen bonds. We introduce the notion of robust variables, that is variables that are robust towards minor changes in the structure/fatgraph, and show that the genus and the number of boundary components are robust. Further, we invesigate the distribution of different fatgraph variables and show how only four variables are capable of distinguishing different folds. We use local (secondary) and global (tertiary) fatgraph features to describe domain structures and illustrate that they are useful for classification of domains in CATH. In addition, we combine our method with two other methods thereby using primary, secondary, and tertiary structure information, and show that we can identify a large percentage of new and unclassified structures in CATH. PMID:21629687
Gać, Paweł; Sobieszczańska, Małgorzata
2014-01-01
This report was intended to evaluate the effect of cigarette smoke on heart rate variability (HRV) in patients with arterial hypertension (AH). 223 individuals were qalified to the studies. The following groups of patients not suffering from other disease which may affect HRV were delineated: 1 - patients with AH (n=145); 2 - patients without AH (n=48). In group 1 the following patient groups were studied: A - active smokers (n=42), B - non-smokers exposed to cigarette smoke (n=30), C - non-smokers not exposed to tobacco smoke (n=34), D - former smokers (n=26). A time domain HRV analysis was carried out. Group 1 versus group 2 manifested significantly lower mean values of most parameters in the HRV time domain analysis. Subgroups A, B and D versus subgroup C also exhibited significantly lower mean values of most parameters in the HRV time domain analysis. Active cigarette smoking and passive exposure to tobacco smoke represented independent risk factors for a decreased HRV. Active and passive exposure to cigarette smoke decreases HRV in hypertensive patients. Copyright © 2013 Elsevier B.V. All rights reserved.
Lacy, Susan E; Wu, Chengbin; Ambrosi, Dominic J; Hsieh, Chung-Ming; Bose, Sahana; Miller, Renee; Conlon, Donna M; Tarcsa, Edit; Chari, Ravi; Ghayur, Tariq; Kamath, Rajesh V
2015-01-01
Interleukin-1 (IL-1) cytokines such as IL-1α, IL-1β, and IL-1Ra contribute to immune regulation and inflammatory processes by exerting a wide range of cellular responses, including expression of cytokines and chemokines, matrix metalloproteinases, and nitric oxide synthetase. IL-1α and IL-1β bind to IL-1R1 complexed to the IL-1 receptor accessory protein and induce similar physiological effects. Preclinical and clinical studies provide significant evidence for the role of IL-1 in the pathogenesis of osteoarthritis (OA), including cartilage degradation, bone sclerosis, and synovial proliferation. Here, we describe the generation and characterization of ABT-981, a dual variable domain immunoglobulin (DVD-Ig) of the IgG1/k subtype that specifically and potently neutralizes IL-1α and IL-1β. In ABT-981, the IL-1β variable domain resides in the outer domain of the DVD-Ig, whereas the IL-1α variable domain is located in the inner position. ABT-981 specifically binds to IL-1α and IL-1β, and is physically capable of binding 2 human IL-1α and 2 human IL-1β molecules simultaneously. Single-dose intravenous and subcutaneous pharmacokinetics studies indicate that ABT-981 has a half-life of 8.0 to 10.4 d in cynomolgus monkey and 10.0 to 20.3 d in rodents. ABT-981 exhibits suitable drug-like-properties including affinity, potency, specificity, half-life, and stability for evaluation in human clinical trials. ABT-981 offers an exciting new approach for the treatment of OA, potentially addressing both disease modification and symptom relief as a disease-modifying OA drug.
Sesti, Francesco; Cosi, Veronica; Calonzi, Francesca; Ruggeri, Velia; Pietropolli, Adalgisa; Di Francesco, Lucia; Piccione, Emilio
2014-09-01
To compare the operative data and early postoperative outcomes of total laparoscopic hysterectomy (TLH), laparoscopically assisted vaginal hysterectomy (LAVH) and vaginal hysterectomy (VH). One hundred and eight women requiring hysterectomy for enlarged myomatous uterus were randomly allocated into three treatment arms: TLH (n = 36); LAVH (n = 36); VH (n = 36). Randomization procedure was based on a computer-generated list. The primary outcome was the discharge time comparison. The secondary outcomes were operating time, blood loss, paralytic ileus time, intraoperative complications, postoperative pain, and early postoperative complications. The mean discharge time was shorter after VH than after LAVH and TLH (P = 0.001). Operating time significantly influenced the discharge time, considered as a dependent variable in general linear model analysis (P = 0.006). In contrast, blood loss did not influence the discharge time (P = 0.55).The mean operating time was significantly shorter in VH than in TLH and LAVH groups (P = 0.000).The intraoperative blood loss was greater during LAVH than during TLH and VH (P = 0.000).Paralytic ileus time was shorter after VH than after TLH and LAVH (P = 0.000). No intraoperative complications or conversion to laparotomy occurred. VH was the faster operative technique with smaller blood loss and shorter discharge time compared with the others two techniques. So, VH should be considered the preferred approach in patients with enlarged myomatous uteri. When VH is not feasible or salpingo-oophorectomy is required, LAVH or TLH should be considered as valid alternatives. It is necessary to continue prospective comparative studies between the various surgical options to identify the best approach for hysterectomy in each single woman.
Ma, Shu-Guo; Esamdin, Ali; Ma, Lu; Niu, Hu-Biao; Fu, Jian-Ning; Zhang, Yu; Liu, Jin-Zhong; Yang, Tao-Zhi; Song, Fang-Fang; Pu, Guang-Xin
2018-04-01
Following the LAMOST Spectroscopic Survey and the Xuyi's Photometric Survey of the Galactic Anti-center, we plan to carry out a time-domain survey of the Galactic Anti-center (TDS-GAC) to study variable stars by using the Nanshan 1-meter telescope. Before the beginning of TDS-GAC, a precursive sky survey (PSS) has been executed. The goal of the PSS is to optimize the observation strategy of TDS-GAC and to detect some strong transient events, as well as to find some short time-scale variable stars of different types. By observing a discontinuous sky area of 15.03 deg2 with the standard Johnson-Cousin-Bessel V filter, 48 variable stars are found and the time series are analyzed. Based on the behaviors of the light curves, 28 eclipsing binary stars, 10 RR Lyraes, 3 periodic pulsating variables of other types have been classified. The rest 7 variables stay unclassified with deficient data. In addition, the observation strategy of TD-GAC is described, and the pipeline of data reduction is tested.
Panayi, Efstathios; Kyriakides, George
2017-01-01
Quantifying the effects of environmental factors over the duration of the growing process on Agaricus Bisporus (button mushroom) yields has been difficult, as common functional data analysis approaches require fixed length functional data. The data available from commercial growers, however, is of variable duration, due to commercial considerations. We employ a recently proposed regression technique termed Variable-Domain Functional Regression in order to be able to accommodate these irregular-length datasets. In this way, we are able to quantify the contribution of covariates such as temperature, humidity and water spraying volumes across the growing process, and for different lengths of growing processes. Our results indicate that optimal oxygen and temperature levels vary across the growing cycle and we propose environmental schedules for these covariates to optimise overall yields. PMID:28961254
Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas
2011-01-01
B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810
Ghiotto, Fabio; Marcatili, Paolo
2011-01-01
B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV-diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥ 2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation.
Raman, Rajeev; Rajanikanth, V; Palaniappan, Raghavan U M; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P; Sharma, Yogendra; Chang, Yung-Fu
2010-12-29
Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca²+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca²+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9(th) (Lig A9) and 10(th) repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca²+ with dissociation constants of 2-4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. We demonstrate that the Lig are Ca²+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca²+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca²+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca²+ binding.
Frost, Julianty; Galdeano, Carles; Soares, Pedro; Gadd, Morgan S.; Grzes, Katarzyna M.; Ellis, Lucy; Epemolu, Ola; Shimamura, Satoko; Bantscheff, Marcus; Grandi, Paola; Read, Kevin D.; Cantrell, Doreen A.; Rocha, Sonia; Ciulli, Alessio
2016-11-01
Chemical strategies to using small molecules to stimulate hypoxia inducible factors (HIFs) activity and trigger a hypoxic response under normoxic conditions, such as iron chelators and inhibitors of prolyl hydroxylase domain (PHD) enzymes, have broad-spectrum activities and off-target effects. Here we disclose VH298, a potent VHL inhibitor that stabilizes HIF-α and elicits a hypoxic response via a different mechanism, that is the blockade of the VHL:HIF-α protein-protein interaction downstream of HIF-α hydroxylation by PHD enzymes. We show that VH298 engages with high affinity and specificity with VHL as its only major cellular target, leading to selective on-target accumulation of hydroxylated HIF-α in a concentration- and time-dependent fashion in different cell lines, with subsequent upregulation of HIF-target genes at both mRNA and protein levels. VH298 represents a high-quality chemical probe of the HIF signalling cascade and an attractive starting point to the development of potential new therapeutics targeting hypoxia signalling.
Fera, Daniela; Schmidt, Aaron G; Haynes, Barton F; Gao, Feng; Liao, Hua-Xin; Kepler, Thomas B; Harrison, Stephen C
2014-07-15
Rapidly evolving pathogens, such as human immunodeficiency and influenza viruses, escape immune defenses provided by most vaccine-induced antibodies. Proposed strategies to elicit broadly neutralizing antibodies require a deeper understanding of antibody affinity maturation and evolution of the immune response to vaccination or infection. In HIV-infected individuals, viruses and B cells evolve together, creating a virus-antibody "arms race." Analysis of samples from an individual designated CH505 has illustrated the interplay between an antibody lineage, CH103, and autologous viruses at various time points. The CH103 antibodies, relatively broad in their neutralization spectrum, interact with the CD4 binding site of gp120, with a contact dominated by CDRH3. We show by analyzing structures of progenitor and intermediate antibodies and by correlating them with measurements of binding to various gp120s that there was a shift in the relative orientation of the light- and heavy-chain variable domains during evolution of the CH103 lineage. We further show that mutations leading to this conformational shift probably occurred in response to insertions in variable loop 5 (V5) of the HIV envelope. The shift displaced the tips of the light chain away from contact with V5, making room for the inserted residues, which had allowed escape from neutralization by the progenitor antibody. These results, which document the selective mechanism underlying this example of a virus-antibody arms race, illustrate the functional significance of affinity maturation by mutation outside the complementarity determining region surface of the antibody molecule.
Predictive Variable Gain Iterative Learning Control for PMSM
Directory of Open Access Journals (Sweden)
Huimin Xu
2015-01-01
Full Text Available A predictive variable gain strategy in iterative learning control (ILC is introduced. Predictive variable gain iterative learning control is constructed to improve the performance of trajectory tracking. A scheme based on predictive variable gain iterative learning control for eliminating undesirable vibrations of PMSM system is proposed. The basic idea is that undesirable vibrations of PMSM system are eliminated from two aspects of iterative domain and time domain. The predictive method is utilized to determine the learning gain in the ILC algorithm. Compression mapping principle is used to prove the convergence of the algorithm. Simulation results demonstrate that the predictive variable gain is superior to constant gain and other variable gains.
Heart rate variability in healthy population
International Nuclear Information System (INIS)
Alamgir, M.; Hussain, M.M.
2010-01-01
Background: Heart rate variability has been considered as an indicator of autonomic status. Little work has been done on heart rate variability in normal healthy volunteers. We aimed at evolving the reference values of heart rate variability in our healthy population. Methods: Twenty-four hour holter monitoring of 37 healthy individuals was done using Holter ECG recorder 'Life card CF' from 'Reynolds Medical'. Heart rate variability in both time and frequency domains was analysed with 'Reynolds Medical Pathfinder Digital/700'. Results: The heart rate variability in normal healthy volunteers of our population was found in time domain using standard deviation of R-R intervals (SDNN), standard deviation of average NN intervals (SDANN), and Square root of the mean squared differences of successive NN intervals (RMSSD). Variation in heart rate variability indices was observed between local and foreign volunteers and RMSSD was found significantly increased (p<0.05) in local population. Conclusions: The values of heart rate variability (RMSSD) in healthy Pakistani volunteers were found increased compared to the foreign data reflecting parasympathetic dominance in our population. (author)
Directory of Open Access Journals (Sweden)
Rajeev Raman
Full Text Available BACKGROUND: Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca²+. Leptospiral immunoglobulin-like (Lig proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca²+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. PRINCIPAL FINDINGS: We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9(th (Lig A9 and 10(th repeats (Lig A10; and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon. All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca²+ with dissociation constants of 2-4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm, probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. CONCLUSIONS: We demonstrate that the Lig are Ca²+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca²+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca²+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca²+ binding.
Directory of Open Access Journals (Sweden)
Klaus Mayer
2015-11-01
Full Text Available TriFabs are IgG-shaped bispecific antibodies (bsAbs composed of two regular Fab arms fused via flexible linker peptides to one asymmetric third Fab-sized binding module. This third module replaces the IgG Fc region and is composed of the variable region of the heavy chain (VH fused to CH3 with “knob”-mutations, and the variable region of the light chain (VL fused to CH3 with matching “holes”. The hinge region does not contain disulfides to facilitate antigen access to the third binding site. To compensate for the loss of hinge-disulfides between heavy chains, CH3 knob-hole heterodimers are linked by S354C-Y349C disulphides, and VH and VL of the stem region may be linked via VH44C-VL100C disulphides. TriFabs which bind one antigen bivalent in the same manner as IgGs and the second antigen monovalent “in between” these Fabs can be applied to simultaneously engage two antigens, or for targeted delivery of small and large (fluorescent or cytotoxic payloads.
An Evaluation of the Performance Diagnostic Checklist-Human Services (PDC-HS) Across Domains.
Wilder, David A; Lipschultz, Joshua; Gehrman, Chana
2018-06-01
The Performance Diagnostic Checklist-Human Services (PDC-HS) is an informant-based tool designed to assess the environmental variables that contribute to poor employee performance in human service settings. Although the PDC-HS has been shown to effectively identify variables contributing to problematic performance, interventions based on only two of the four PDC-HS domains have been evaluated to date. In addition, the extent to which PDC-HS-indicated interventions are more effective than nonindicated interventions for two domains remains unclear. In the current study, we administered the PDC-HS to supervisors to assess the variables contributing to infrequent teaching of verbal operants and use of a timer by therapists at a center-based autism treatment program. Each of the four PDC-HS domains was identified as contributing to poor performance for at least one therapist. We then evaluated PDC-HS-indicated interventions for each domain. In addition, to assess the predictive validity of the tool, we evaluated various nonindicated interventions prior to implementing a PDC-HS-indicated intervention for two of the four domains. Results suggest that the PDC-HS-indicated interventions were effective across all four domains and were more effective than the nonindicated interventions for the two domains for which they were evaluated. Results are discussed in terms of the utility of the PDC-HS to identify appropriate interventions to manage therapist performance in human service settings.
Lin, Katherine I; Tam, Constantine S; Keating, Michael J; Wierda, William G; O'Brien, Susan; Lerner, Susan; Coombes, Kevin R; Schlette, Ellen; Ferrajoli, Alessandra; Barron, Lynn L; Kipps, Thomas J; Rassenti, Laura; Faderl, Stefan; Kantarjian, Hagop; Abruzzo, Lynne V
2009-04-02
Although immunoglobulin V(H) mutation status (IgV(H) MS) is prognostic in patients with chronic lymphocytic leukemia (CLL) who are treated with alkylating agents or single-agent fludarabine, its significance in the era of chemoimmunotherapy is not known. We determined the IgV(H) somatic mutation status (MS) in 177 patients enrolled in a phase 2 study of fludarabine, cyclophosphamide, and rituximab (FCR) and in 127 patients treated with subsequent chemoimmunotherapy protocols. IgV(H) MS did not impact significantly on the complete remission (CR) rate of patients receiving FCR or related regimens. However, CR duration was significantly shorter in patients with CLL that used unmutated IgV(H) than those whose CLL used mutated IgV(H) (TTP 47% vs 82% at 6 years, P IgV(H) MS emerged as the only determinant of remission duration (hazard ratio 3.8, P IgV(H) status.
Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran
2014-01-01
Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404
Kinetics of slow domain growth in complex systems
International Nuclear Information System (INIS)
Lindgard, P.-A.; Castan, T.
1989-01-01
The domain growth after a quench to very low and to finite temperatures T is analyzed by scaling theory and Monte Carlo simulation. The model studied has continuous variables, non-conserved order parameter and has two kinds of domain walls: sharp, straight stacking faults and broad curved soliton-like walls. For quenches to higher temperatures the growth exponent is found to approach the classical Allen-Cahn exponent n = 1/2. (A.C.A.S.) [pt
Untangling spider silk evolution with spidroin terminal domains
Directory of Open Access Journals (Sweden)
Garb Jessica E
2010-08-01
Full Text Available Abstract Background Spidroins are a unique family of large, structural proteins that make up the bulk of spider silk fibers. Due to the highly variable nature of their repetitive sequences, spidroin evolutionary relationships have principally been determined from their non-repetitive carboxy (C-terminal domains, though they offer limited character data. The few known spidroin amino (N-terminal domains have been difficult to obtain, but potentially contain critical phylogenetic information for reconstructing the diversification of spider silks. Here we used silk gland expression data (ESTs from highly divergent species to evaluate the functional significance and phylogenetic utility of spidroin N-terminal domains. Results We report 11 additional spidroin N-termini found by sequencing ~1,900 silk gland cDNAs from nine spider species that shared a common ancestor > 240 million years ago. In contrast to their hyper-variable repetitive regions, spidroin N-terminal domains have retained striking similarities in sequence identity, predicted secondary structure, and hydrophobicity. Through separate and combined phylogenetic analyses of N-terminal domains and their corresponding C-termini, we find that combined analysis produces the most resolved trees and that N-termini contribute more support and less conflict than the C-termini. These analyses show that paralogs largely group by silk gland type, except for the major ampullate spidroins. Moreover, spidroin structural motifs associated with superior tensile strength arose early in the history of this gene family, whereas a motif conferring greater extensibility convergently evolved in two distantly related paralogs. Conclusions A non-repetitive N-terminal domain appears to be a universal attribute of spidroin proteins, likely retained from the origin of spider silk production. Since this time, spidroin N-termini have maintained several features, consistent with this domain playing a key role in silk
Expression of recombinant multi-coloured fluorescent antibodies in gor -/trxB- E. coli cytoplasm
Directory of Open Access Journals (Sweden)
Markiv Anatoliy
2011-11-01
Full Text Available Abstract Background Antibody-fluorophore conjugates are invaluable reagents used in contemporary molecular cell biology for imaging, cell sorting and tracking intracellular events. However they suffer in some cases from batch to batch variation, partial loss of binding and susceptibility to photo-bleaching. In theory, these issues can all be addressed by using recombinant antibody fused directly to genetically encoded fluorescent reporters. However, single-chain fragment variable domains linked by long flexible linkers are themselves prone to disassociation and aggregation, and in some cases with isoelectric points incompatible with use in physiologically relevant milieu. Here we describe a general approach that permits fully functional intracellular production of a range of coloured fluorescent recombinant antibodies with optimally orientated VH/VL interfaces and isoelectric points compatible for use in physiological solutions at pH 7.4 with a binding site to fluorophore stoichiometry of 1:1. Results Here we report the design, assembly, intracellular bacterial production and purification of a panel of novel antibody fluorescent protein fusion constructs. The insertion of monomeric fluorescent protein derived from either Discosoma or Aequorea in-between the variable regions of anti-p185HER2-ECD antibody 4D5-8 resulted in optimal VH/VL interface interactions to create soluble coloured antibodies each with a single binding site, with isoelectric points of 6.5- 6. The fluorescent antibodies used in cell staining studies with SK-BR-3 cells retained the fluorophore properties and antibody specificity functions, whereas the conventional 4D5-8 single chain antibody with a (Gly4Ser3 linker precipitated at physiological pH 7.4. Conclusions This modular monomeric recombinant fluorescent antibody platform may be used to create a range of recombinant coloured antibody molecules for quantitative in situ, in vivo and ex vivo imaging, cell sorting and cell
Directory of Open Access Journals (Sweden)
Chen Ming-Shun
2006-01-01
Full Text Available Abstract Background To have an insight into the Mayetiola destructor (Hessian fly genome, we performed an in silico comparative genomic analysis utilizing genetic mapping, genomic sequence and EST sequence data along with data available from public databases. Results Chromosome walking and FISH were utilized to identify a contig of 50 BAC clones near the telomere of the short arm of Hessian fly chromosome X2 and near the avirulence gene vH13. These clones enabled us to correlate physical and genetic distance in this region of the Hessian fly genome. Sequence data from these BAC ends encompassing a 760 kb region, and a fully sequenced and assembled 42.6 kb BAC clone, was utilized to perform a comparative genomic study. In silico gene prediction combined with BLAST analyses was used to determine putative orthology to the sequenced dipteran genomes of the fruit fly, Drosophila melanogaster, and the malaria mosquito, Anopheles gambiae, and to infer evolutionary relationships. Conclusion This initial effort enables us to advance our understanding of the structure, composition and evolution of the genome of this important agricultural pest and is an invaluable tool for a whole genome sequencing effort.
van de Bovenkamp, Fleur S; Derksen, Ninotska I L; Ooijevaar-de Heer, Pleuni; van Schie, Karin A; Kruithof, Simone; Berkowska, Magdalena A; van der Schoot, C Ellen; IJspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E M; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S Marieke; Vidarsson, Gestur; Rispens, Theo
2018-02-20
A hallmark of B-cell immunity is the generation of a diverse repertoire of antibodies from a limited set of germline V(D)J genes. This repertoire is usually defined in terms of amino acid composition. However, variable domains may also acquire N -linked glycans, a process conditional on the introduction of consensus amino acid motifs ( N -glycosylation sites) during somatic hypermutation. High levels of variable domain glycans have been associated with autoantibodies in rheumatoid arthritis, as well as certain follicular lymphomas. However, the role of these glycans in the humoral immune response remains poorly understood. Interestingly, studies have reported both positive and negative effects on antibody affinity. Our aim was to elucidate the role of variable domain glycans during antigen-specific antibody responses. By analyzing B-cell repertoires by next-generation sequencing, we demonstrate that N -glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we subsequently show that this process is subject to selection during antigen-specific antibody responses, skewed toward IgG4, and positively contributes to antigen binding. Together, these results highlight a physiological role for variable domain glycosylation as an additional layer of antibody diversification that modulates antigen binding.
Variability of BL Lacertae type object
Energy Technology Data Exchange (ETDEWEB)
Cayatte, V
1987-10-01
This object is among the brightest and the most violently variable of this galaxy class with active nuclei. It has been studied in many wavelength domains and in polarimetry. Some important results are reported here and more particularly on its variability. These observations bring some elements for a better knowledge of the inner source.
Kachko, Alla; Costafreda, Maria Isabel; Zubkova, Iryna; Jacques, Jerome; Takeda, Kazuyo; Wells, Frances; Kaplan, Gerardo; Major, Marian E
2018-03-15
Hepatitis C virus (HCV) is the leading cause of chronic hepatitis in humans. Several host molecules participate in HCV cell entry, but this process remains unclear. The complete unraveling of the HCV entry process is important to further understand viral pathogenesis and develop therapeutics. Human hepatitis A virus (HAV) cellular receptor 1 (HAVCR1), CD365, also known as TIM-1, functions as a phospholipid receptor involved in cell entry of several enveloped viruses. Here, we studied the role of HAVCR1 in HCV infection. HAVCR1 antibody inhibited entry in a dose-dependent manner. HAVCR1 soluble constructs neutralized HCV, which did not require the HAVCR1 mucinlike region and was abrogated by a mutation of N to A at position 94 (N94A) in the Ig variable (IgV) domain phospholipid-binding pocket, indicating a direct interaction of the HAVCR1 IgV domain with HCV virions. However, knockout of HAVCR1 in Huh7 cells reduced but did not prevent HCV growth. Interestingly, the mouse HAVCR1 ortholog, also a phospholipid receptor, did not enhance infection and a soluble form failed to neutralize HCV, although replacement of the mouse IgV domain with the human HAVCR1 IgV domain restored the enhancement of HCV infection. Mutations in the cytoplasmic tail revealed that direct HAVCR1 signaling is not required to enhance HCV infection. Our data show that the phospholipid-binding function and other determinant(s) in the IgV domain of human HAVCR1 enhance HCV infection. Although the exact mechanism is not known, it is possible that HAVCR1 facilitates entry by stabilizing or enhancing attachment, leading to direct interactions with specific receptors, such as CD81. IMPORTANCE Hepatitis C virus (HCV) enters cells through a multifaceted process. We identified the human hepatitis A virus cellular receptor 1 (HAVCR1), CD365, also known as TIM-1, as a facilitator of HCV entry. Antibody blocking and silencing or knockout of HAVCR1 in hepatoma cells reduced HCV entry. Our findings that the
Vigorous physical activity predicts higher heart rate variability among younger adults.
May, Richard; McBerty, Victoria; Zaky, Adam; Gianotti, Melino
2017-06-14
Baseline heart rate variability (HRV) is linked to prospective cardiovascular health. We tested intensity and duration of weekly physical activity as predictors of heart rate variability in young adults. Time and frequency domain indices of HRV were calculated based on 5-min resting electrocardiograms collected from 82 undergraduate students. Hours per week of both moderate and vigorous activity were estimated using the International Physical Activity Questionnaire. In regression analyses, hours of vigorous physical activity, but not moderate activity, significantly predicted greater time domain and frequency domain indices of heart rate variability. Adjusted for weekly frequency, greater daily duration of vigorous activity failed to predict HRV indices. Future studies should test direct measurements of vigorous activity patterns as predictors of autonomic function in young adulthood.
Signal enhancement with variable span linear filters
Benesty, Jacob; Jensen, Jesper R
2016-01-01
This book introduces readers to the novel concept of variable span speech enhancement filters, and demonstrates how it can be used for effective noise reduction in various ways. Further, the book provides the accompanying Matlab code, allowing readers to easily implement the main ideas discussed. Variable span filters combine the ideas of optimal linear filters with those of subspace methods, as they involve the joint diagonalization of the correlation matrices of the desired signal and the noise. The book shows how some well-known filter designs, e.g. the minimum distortion, maximum signal-to-noise ratio, Wiener, and tradeoff filters (including their new generalizations) can be obtained using the variable span filter framework. It then illustrates how the variable span filters can be applied in various contexts, namely in single-channel STFT-based enhancement, in multichannel enhancement in both the time and STFT domains, and, lastly, in time-domain binaural enhancement. In these contexts, the properties of ...
Within-person variability in response speed as an indicator of cognitive impairment in older adults.
Strauss, Esther; Bielak, Allison A M; Bunce, David; Hunter, Michael A; Hultsch, David F
2007-11-01
Within-person variability may be an important indicator of central nervous system compromise. In this study, within-person variability in response speed was examined in community-dwelling older adults, ages 64-92 years, using a new framework that takes into account both the extent (single versus multiple domains affected) and nature (amnestic versus non-amnestic) of the cognitive impairment. Those with multiple domains of impairment were more variable than those who showed an isolated area of impairment, regardless of whether memory was one of the domains affected. Further, for those with difficulties in two or more non-memory domains, increased variability was most evident in more cognitively demanding situations, when individuals had to manipulate information held briefly in mind, switch cognitive set or inhibit an automatic response. Finally, group differentiation was better achieved when within-person variability as opposed to mean speed of performance was considered.
Directory of Open Access Journals (Sweden)
E. N. Gorshkova
2016-01-01
Full Text Available Almost 20 years ago, a unique class of antibodies devoid of L chains was discovered in Camelidae blood serum. Only one variable domain is responsible for antigen recognition in these unusual antibodies. A recombinant protein, which is analogue to such antigen-recognizing variable domain was called the single domain antibody (sdAb, “nanobody” or “nanoantibody”. The single-domain antibodies and their derivatives have been widely used in the field of biology, toxicology and medicine offering new opportunities for diagnosis and treatment of cancer, autoimmune diseases, infectious diseases, and for toxin neutralization. This review focuses on latest researches in the field and concerns some prospectives for creation of nanoantibody-based diagnostic and therapeutic drugs.
Directory of Open Access Journals (Sweden)
Ufuk Kirik
2017-11-01
Full Text Available B cells produce antibodies, key effector molecules in health and disease. They mature their properties, including their affinity for antigen, through hypermutation events; processes that involve, e.g., base substitution, codon insertion and deletion, often in association with an isotype switch. Investigations of antibody evolution define modes whereby particular antibody responses are able to form, and such studies provide insight important for instance for development of efficient vaccines. Antibody evolution is also used in vitro for the design of antibodies with improved properties. To better understand the basic concepts of antibody evolution, we analyzed the mutational paths, both in terms of amino acid substitution and insertions and deletions, taken by antibodies of the IgG isotype. The analysis focused on the evolution of the heavy chain variable domain of sets of antibodies, each with an origin in 1 of 11 different germline genes representing six human heavy chain germline gene subgroups. Investigated genes were isolated from cells of human bone marrow, a major site of antibody production, and characterized by next-generation sequencing and an in-house bioinformatics pipeline. Apart from substitutions within the complementarity determining regions, multiple framework residues including those in protein cores were targets of extensive diversification. Diversity, both in terms of substitutions, and insertions and deletions, in antibodies is focused to different positions in the sequence in a germline gene-unique manner. Altogether, our findings create a framework for understanding patterns of evolution of antibodies from defined germline genes.
Wei, Ying-Chieh; Wei, Ying-Yu; Chang, Kai-Hsiung; Young, Ming-Shing
2012-04-01
The objective of this study is to design and develop a programmable electrocardiogram (ECG) generator with frequency domain characteristics of heart rate variability (HRV) which can be used to test the efficiency of ECG algorithms and to calibrate and maintain ECG equipment. We simplified and modified the three coupled ordinary differential equations in McSharry's model to a single differential equation to obtain the ECG signal. This system not only allows the signal amplitude, heart rate, QRS-complex slopes, and P- and T-wave position parameters to be adjusted, but can also be used to adjust the very low frequency, low frequency, and high frequency components of HRV frequency domain characteristics. The system can be tuned to function with HRV or not. When the HRV function is on, the average heart rate can be set to a value ranging from 20 to 122 beats per minute (BPM) with an adjustable variation of 1 BPM. When the HRV function is off, the heart rate can be set to a value ranging from 20 to 139 BPM with an adjustable variation of 1 BPM. The amplitude of the ECG signal can be set from 0.0 to 330 mV at a resolution of 0.005 mV. These parameters can be adjusted either via input through a keyboard or through a graphical user interface (GUI) control panel that was developed using LABVIEW. The GUI control panel depicts a preview of the ECG signal such that the user can adjust the parameters to establish a desired ECG morphology. A complete set of parameters can be stored in the flash memory of the system via a USB 2.0 interface. Our system can generate three different types of synthetic ECG signals for testing the efficiency of an ECG algorithm or calibrating and maintaining ECG equipment. © 2012 American Institute of Physics
International Nuclear Information System (INIS)
Papadakis, N C; Christakis, D G; Tzagarakis, G N; Chlouverakis, G I; Kampanis, N A; Stergiopoulos, K N; Katonis, P G
2009-01-01
The objective of this study was to assess the gait variability of lumbar spinal stenosis (LSS) patients and to evaluate its postoperative progression. The hypothesis was that LSS patients' preoperative gait variability in the frequency domain was higher than the corresponding postoperative. A tri-axial accelerometer sensor was used for the gait measurement and a spectral differential entropy algorithm was used to measure the gait variability. Twelve subjects with LSS were measured before and after surgery. Preoperative measurements were performed 2 days before surgery. Postoperative measurements were performed 6 and 12 months after surgery. Preoperative gait variability was higher than the corresponding postoperative. Also, in most cases, gait variability appeared to decrease throughout the year
Age related differences in individual quality of life domains in youth with type 1 diabetes
Directory of Open Access Journals (Sweden)
Lett Syretta
2004-09-01
Full Text Available Abstract Background Investigating individual, as opposed to predetermined, quality of life domains may yield important information about quality of life. This study investigated the individual quality of life domains nominated by youth with type 1 diabetes. Methods Eighty young people attending a diabetes summer camp completed the Schedule for the Evaluation of Individual Quality of Life-Direct Weighting interview, which allows respondents to nominate and evaluate their own quality of life domains. Results The most frequently nominated life domains were 'family', 'friends', 'diabetes', 'school', and 'health' respectively; ranked in terms of importance, domains were 'religion', 'family', 'diabetes', 'health', and 'the golden rule'; ranked in order of satisfaction, domains were 'camp', 'religion', 'pets', and 'family' and 'a special person' were tied for fifth. Respondent age was significantly positively associated with the importance of 'friends', and a significantly negatively associated with the importance of 'family'. Nearly all respondents nominated a quality of life domain relating to physical status, however, the specific physical status domain and the rationale for its nomination varied. Some respondents nominated 'diabetes' as a domain and emphasized diabetes 'self-care behaviors' in order to avoid negative health consequences such as hospitalization. Other respondents nominated 'health' and focused more generally on 'living well with diabetes'. In an ANOVA with physical status domain as the independent variable and age as the dependent variable, participants who nominated 'diabetes' were younger (M = 12.9 years than those who nominated 'health' (M = 15.9 years. In a second ANOVA, with rationale for nomination the physical status domain as the independent variable, and age as the dependent variable, those who emphasized 'self care behaviors' were younger (M = 11.8 years than those who emphasized 'living well with diabetes' (M = 14.6 years
VH-92A Presidential Helicopter (VH-92A)
2015-12-01
provide safe, reliable, and timely transportation for the President, Vice President, Foreign Heads of State, and other official parties as directed by...the Director of the White House Military Office. Presidential helicopter transportation requirements are executed by Marine Helicopter Squadron One...Review Jul 2016 Jul 2016 Jan 2017 Jul 2016 Milestone C Jan 2019 Jan 2019 Jul 2019 Jan 2019 IOT &E Complete Mar 2020 Mar 2020 Sep 2020 Mar 2020 IOC Jul
Convex trace functions of several variables
DEFF Research Database (Denmark)
Hansen, Frank
2002-01-01
We prove that the function (x1,...,xk)¿Tr(f(x1,...,xk)), defined on k-tuples of symmetric matrices of order (n1,...,nk) in the domain of f, is convex for any convex function f of k variables. The matrix f(x1,...,xk) is defined by the functional calculus for functions of several variables, and it ...
Using the domain identification model to study major and career decision-making processes
Tendhar, Chosang; Singh, Kusum; Jones, Brett D.
2018-03-01
The purpose of this study was to examine the extent to which (1) a domain identification model could be used to predict students' engineering major and career intentions and (2) the MUSIC Model of Motivation components could be used to predict domain identification. The data for this study were collected from first-year engineering students. We used a structural equation model to test the hypothesised relationship between variables in the partial domain identification model. The findings suggested that engineering identification significantly predicted engineering major intentions and career intentions and had the highest effect on those two variables compared to other motivational constructs. Furthermore, results suggested that success, interest, and caring are plausible contributors to students' engineering identification. Overall, there is strong evidence that the domain identification model can be used as a lens to study career decision-making processes in engineering, and potentially, in other fields as well.
Partial differential equations in several complex variables
Chen, So-Chin
2001-01-01
This book is intended both as an introductory text and as a reference book for those interested in studying several complex variables in the context of partial differential equations. In the last few decades, significant progress has been made in the fields of Cauchy-Riemann and tangential Cauchy-Riemann operators. This book gives an up-to-date account of the theories for these equations and their applications. The background material in several complex variables is developed in the first three chapters, leading to the Levi problem. The next three chapters are devoted to the solvability and regularity of the Cauchy-Riemann equations using Hilbert space techniques. The authors provide a systematic study of the Cauchy-Riemann equations and the \\bar\\partial-Neumann problem, including L^2 existence theorems on pseudoconvex domains, \\frac 12-subelliptic estimates for the \\bar\\partial-Neumann problems on strongly pseudoconvex domains, global regularity of \\bar\\partial on more general pseudoconvex domains, boundary ...
Terrano, Daniel; Tsuper, Ilona; Maraschky, Adam; Holland, Nolan; Streletzky, Kiril
Temperature sensitive nanoparticles were generated from a construct (H20F) of three chains of elastin-like polypeptides (ELP) linked to a negatively charged foldon domain. This ELP system was mixed at different ratios with linear chains of ELP (H40L) which lacks the foldon domain. The mixed system is soluble at room temperature and at a transition temperature (Tt) will form swollen micelles with the hydrophobic linear chains hidden inside. This system was studied using depolarized dynamic light scattering (DDLS) and static light scattering (SLS) to determine the size, shape, and internal structure of the mixed micelles. The mixed micelle in equal parts of H20F and H40L show a constant apparent hydrodynamic radius of 40-45 nm at the concentration window from 25:25 to 60:60 uM (1:1 ratio). At a fixed 50 uM concentration of the H20F, varying H40L concentration from 5 to 80 uM resulted in a linear growth in the hydrodynamic radius from about 11 to about 62 nm, along with a 1000-fold increase in VH signal. A possible simple model explaining the growth of the swollen micelles is considered. Lastly, the VH signal can indicate elongation in the geometry of the particle or could possibly be a result from anisotropic properties from the core of the micelle. SLS was used to study the molecular weight, and the radius of gyration of the micelle to help identify the structure and morphology of mixed micelles and the tangible cause of the VH signal.
Ruan, John J.; Anderson, Scott F.; MacLeod, Chelsea L.; Becker, Andrew C.; Burnett, T. H.; Davenport, James R. A.; Ivezić, Željko; Kochanek, Christopher S.; Plotkin, Richard M.; Sesar, Branimir; Stuart, J. Scott
2012-11-01
We investigate the use of optical photometric variability to select and identify blazars in large-scale time-domain surveys, in part to aid in the identification of blazar counterparts to the ~30% of γ-ray sources in the Fermi 2FGL catalog still lacking reliable associations. Using data from the optical LINEAR asteroid survey, we characterize the optical variability of blazars by fitting a damped random walk model to individual light curves with two main model parameters, the characteristic timescales of variability τ, and driving amplitudes on short timescales \\hat{\\sigma }. Imposing cuts on minimum τ and \\hat{\\sigma } allows for blazar selection with high efficiency E and completeness C. To test the efficacy of this approach, we apply this method to optically variable LINEAR objects that fall within the several-arcminute error ellipses of γ-ray sources in the Fermi 2FGL catalog. Despite the extreme stellar contamination at the shallow depth of the LINEAR survey, we are able to recover previously associated optical counterparts to Fermi active galactic nuclei with E >= 88% and C = 88% in Fermi 95% confidence error ellipses having semimajor axis r beaming. After correcting for beaming, we estimate that the characteristic timescale of blazar variability is ~3 years in the rest frame of the jet, in contrast with the ~320 day disk flux timescale observed in quasars. The variability-based selection method presented will be useful for blazar identification in time-domain optical surveys and is also a probe of jet physics.
Vaccatides: Antifungal Glutamine-Rich Hevein-Like Peptides from Vaccaria hispanica
Directory of Open Access Journals (Sweden)
Ka H. Wong
2017-06-01
Full Text Available Hevein and hevein-like peptides are disulfide-constrained chitin-binding cysteine-rich peptides. They are divided into three subfamilies, 6C-, 8C-, and 10C-hevein-like peptides, based on the number of cysteine residues. In addition, hevein-like peptides can exist in two forms, short and long. The long C-terminal form found in hevein and 10C-hevein-like peptides contain a C-terminal protein cargo. In contrast, the short form without a protein cargo is found in all three subfamilies. Here, we report the discovery and characterization of two novel glutamine-rich and protein cargo-free 8C-hevein-like peptides, vaccatides vH1 and vH2, from Vaccaria hispanica of the Caryophyllaceae family. Proteomic analyses showed that the vaccatides are 40–41 amino acids in length and contain a chitin-binding domain. NMR determination revealed that vaccatide vH2 displays a highly compact structure with a N-terminal cystine knot and an addition C-terminal disulfide bond. Stability studies showed that this compact structure renders vaccatide vH2 resistant to thermal, chemical and proteolytic degradation. The chitin-binding vH2 was shown to inhibit the mycelium growth of four phyto-pathogenic fungal strains with IC50 values in the micromolar range. Our findings show that vaccatides represent a new family of 8C-hevein-like peptides, which are protein cargo-free and glutamine-rich, characteristics that differentiate them from the prototypic hevein and the 10C-hevein-like peptides. In summary, this study enriches the existing library of hevein-like peptides and provides insight into their molecular diversity in sequence, structure and biosynthesis. Additionally, their highly disulfide-constrained structure could be used as a scaffold for developing metabolically and orally active peptidyl therapeutics.
Antibody engineering using phage display with a coiled-coil heterodimeric Fv antibody fragment.
Directory of Open Access Journals (Sweden)
Xinwei Wang
Full Text Available A Fab-like antibody binding unit, ccFv, in which a pair of heterodimeric coiled-coil domains was fused to V(H and V(L for Fv stabilization, was constructed for an anti-VEGF antibody. The anti-VEGF ccFv showed the same binding affinity as scFv but significantly improved stability and phage display level. Furthermore, phage display libraries in the ccFv format were constructed for humanization and affinity maturation of the anti-VEGF antibody. A panel of V(H frameworks and V(H-CDR3 variants, with a significant improvement in affinity and expressibility in both E. coli and yeast systems, was isolated from the ccFv phage libraries. These results demonstrate the potential application of the ccFv antibody format in antibody engineering.
Using llama derived single domain antibodies to target botulinum neurotoxins
Swain, Marla D.; Anderson, George P.; Bernstein, Rachael D.; Liu, Jinny L.; Goldman, Ellen R.
2010-04-01
Llama serum contains both conventional IgG as well as unique forms of antibody that contain only heavy chains where antigen binding is mediated through a single variable domain. These variable domains can be expressed recombinantly and are referred to as single domain antibodies (sdAb). SdAb are among the smallest known naturally derived antigen binding fragments, possess good solubility, thermal stability, and can refold after heat and chemical denaturation. Llamas were immunized with either BoNT A or B toxoid and phage display libraries prepared. Single domain antibodies (sdAb) that were able to detect botulinum neurotoxin (BoNT) serotypes A and B were selected from their respective libraries. Here, the binders obtained by panning the BoNT B library on either BoNT B toxoid or BoNT B complex toxoid coated plates or BoNT B toxin coupled microspheres are described. Using these panning methods, we selected for binders that showed specificity for BoNT B. Phage displayed binders were screened, moved to a protein expression vector and soluble sdAb was produced. Using a Luminex flow cytometer binders were evaluated in direct binding assays. We have exploited the unique properties of sdAb and used them as biological recognition elements in immuno-based sensors that can detect BoNT B.
Jungert, Tomas; Hesser, Hugo; Träff, Ulf
2014-10-01
In social cognitive theory, self-efficacy is domain-specific. An alternative model, the cross-domain influence model, would predict that self-efficacy beliefs in one domain might influence performance in other domains. Research has also found that children who receive special instruction are not good at estimating their performance. The aim was to test two models of how self-efficacy beliefs influence achievement, and to contrast children receiving special instruction in mathematics with normally-achieving children. The participants were 73 fifth-grade children who receive special instruction and 70 children who do not receive any special instruction. In year four and five, the children's skills in mathematics and reading were assessed by national curriculum tests, and in their fifth year, self-efficacy in mathematics and reading were measured. Structural equation modeling showed that in domains where children do not receive special instruction in mathematics, self-efficacy is a mediating variable between earlier and later achievement in the same domain. Achievement in mathematics was not mediated by self-efficacy in mathematics for children who receive special instruction. For normal achieving children, earlier achievement in the language domain had an influence on later self-efficacy in the mathematics domain, and self-efficacy beliefs in different domains were correlated. Self-efficacy is mostly domain specific, but may play a different role in academic performance depending on whether children receive special instruction. The results of the present study provided some support of the Cross-Domain Influence Model for normal achieving children. © 2014 Scandinavian Psychological Associations and John Wiley & Sons Ltd.
Amstad, Fabienne T; Meier, Laurenz L; Fasel, Ursula; Elfering, Achim; Semmer, Norbert K
2011-04-01
A literature review of studies analyzing work-family conflict and its consequences was conducted, and 427 effect sizes were analyzed meta-analytically. Work-family conflict was analyzed bidirectionally in terms of work interference with family (WIF) and family interference with work (FIW). We assessed 3 categories of potential outcomes: work-related outcomes, family-related outcomes, and domain-unspecific outcomes. Results show that WIF and FIW are consistently related to all 3 types of outcomes. Both types of interrole conflict showed stronger relationships to same-domain outcomes than to cross-domain outcomes. Thus, WIF was more strongly associated with work-related than with family-related outcomes, and FIW was more strongly associated with family-related than with work-related outcomes. In moderator analyses, parenthood could not explain variability in effect sizes. However, time spent at work did moderate the relationships between WIF and family-related outcomes, as well as FIW and domain-unspecific outcomes.
Directory of Open Access Journals (Sweden)
J. Mala
2017-06-01
Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.
Taylor series maps and their domain of convergence
International Nuclear Information System (INIS)
Abell, D.T.; Dragt, A.J.
1992-01-01
This paper tries to make clear what limits the validity of a Taylor series map, and how. We describe the concept of a transfer map and quote some theorems that justify not only their existence but also their advantages. Then, we describe the Taylor series representation for transfer maps. Following that, we attempt to elucidate some of the basic theorems from the theory of functions of one and several complex variables. This material forms the core of our understanding of what limits the domain of convergence of Taylor series maps. Lastly, we use the concrete example of a simple anharmonic oscillator to illustrate how the theorems from several complex variable theory affect the domain convergence of Taylor series maps. There we describe the singularities of the anharmonic oscillator in the complex planes of the initial conditions, show how they constrain our use of a Taylor series map, and then discuss our findings
Internally generated natural variability of global-mean temperatures
International Nuclear Information System (INIS)
Wigley, T.M.L.; Raper, S.C.B.
1990-01-01
Quantitative frequency-domain and time-domain estimates are made of an important aspect of natural variability of global-mean temperatures, namely, passive internal variability resulting from the modulation of atmospheric variability by the ocean. The results are derived using an upwelling-diffusion, energy-balance climate model. In the frequency domain, analytical spectral results show a transition from a high-frequency region in which the response is determined by the mixed-layer heat capacity and is independent of the climate sensitivity (time scales less than around 10 years), to a low-frequency region in which the response depends only on the climate sensitivity. In the former region the spectral power is proportional to f -2 , where f is the frequency, while in the latter the power is independent of frequency. The range of validity of these results depends on the components of the climate system that are included in the model. In this case these restrict the low-frequency results to time scales less than about 1,000 years. A qualitative extrapolation is presented in an attempt to explain the observed low-frequency power spectra from deep-sea-core δ 18 O time series. The spectral results are also used to estimate the effective heat capacity of the ocean as a function of frequency. At low frequencies, this can range up to 50 times greater than the heat capacity of the mixed layer. Results in the time domain are obtained by solving the model equations numerically
Beyond cross-domain learning: Multiple-domain nonnegative matrix factorization
Wang, Jim Jing-Yan; Gao, Xin
2014-01-01
Traditional cross-domain learning methods transfer learning from a source domain to a target domain. In this paper, we propose the multiple-domain learning problem for several equally treated domains. The multiple-domain learning problem assumes that samples from different domains have different distributions, but share the same feature and class label spaces. Each domain could be a target domain, while also be a source domain for other domains. A novel multiple-domain representation method is proposed for the multiple-domain learning problem. This method is based on nonnegative matrix factorization (NMF), and tries to learn a basis matrix and coding vectors for samples, so that the domain distribution mismatch among different domains will be reduced under an extended variation of the maximum mean discrepancy (MMD) criterion. The novel algorithm - multiple-domain NMF (MDNMF) - was evaluated on two challenging multiple-domain learning problems - multiple user spam email detection and multiple-domain glioma diagnosis. The effectiveness of the proposed algorithm is experimentally verified. © 2013 Elsevier Ltd. All rights reserved.
Beyond cross-domain learning: Multiple-domain nonnegative matrix factorization
Wang, Jim Jing-Yan
2014-02-01
Traditional cross-domain learning methods transfer learning from a source domain to a target domain. In this paper, we propose the multiple-domain learning problem for several equally treated domains. The multiple-domain learning problem assumes that samples from different domains have different distributions, but share the same feature and class label spaces. Each domain could be a target domain, while also be a source domain for other domains. A novel multiple-domain representation method is proposed for the multiple-domain learning problem. This method is based on nonnegative matrix factorization (NMF), and tries to learn a basis matrix and coding vectors for samples, so that the domain distribution mismatch among different domains will be reduced under an extended variation of the maximum mean discrepancy (MMD) criterion. The novel algorithm - multiple-domain NMF (MDNMF) - was evaluated on two challenging multiple-domain learning problems - multiple user spam email detection and multiple-domain glioma diagnosis. The effectiveness of the proposed algorithm is experimentally verified. © 2013 Elsevier Ltd. All rights reserved.
A message-passing approach to random constraint satisfaction problems with growing domains
International Nuclear Information System (INIS)
Zhao, Chunyan; Zheng, Zhiming; Zhou, Haijun; Xu, Ke
2011-01-01
Message-passing algorithms based on belief propagation (BP) are implemented on a random constraint satisfaction problem (CSP) referred to as model RB, which is a prototype of hard random CSPs with growing domain size. In model RB, the number of candidate discrete values (the domain size) of each variable increases polynomially with the variable number N of the problem formula. Although the satisfiability threshold of model RB is exactly known, finding solutions for a single problem formula is quite challenging and attempts have been limited to cases of N ∼ 10 2 . In this paper, we propose two different kinds of message-passing algorithms guided by BP for this problem. Numerical simulations demonstrate that these algorithms allow us to find a solution for random formulas of model RB with constraint tightness slightly less than p cr , the threshold value for the satisfiability phase transition. To evaluate the performance of these algorithms, we also provide a local search algorithm (random walk) as a comparison. Besides this, the simulated time dependence of the problem size N and the entropy of the variables for growing domain size are discussed
Walch, S. P.; Bauschlicher, C. W., Jr.
1983-04-01
Calculations are performed for the predicted ground states of TiH(4-phi), VH(5-delta), CrH(6-sigma-plus), MnH(7-sigma-plus), Fett(4,6-delta) and NiH(2-delta). For FeH both the 6-delta and 4-delta states are studied, since both are likely candidates for the ground state. The ground state symmetries are predicted based on a combination of atomic coupling arguments and coupling of 4s(2)3d(n) and 4s(1)3d(n+1) terms in the molecular system. Electron correlation is included by a CASSCF/CI (SD) treatment. The CASSCF includes near-degeneracy effects, while correlation of the 3d electrons in included at the CI level.
International Nuclear Information System (INIS)
Becker, S.A.
1986-08-01
Throughout the domain of the H R diagram lie groupings of stars whose luminosity varies with time. These variable stars can be classified based on their observed properties into distinct types such as β Cephei stars, δ Cephei stars, and Miras, as well as many other categories. The underlying mechanism for the variability is generally felt to be due to four different causes: geometric effects, rotation, eruptive processes, and pulsation. In this review the focus will be on pulsation variables and how the theory of stellar evolution can be used to explain how the various regions of variability on the H R diagram are populated. To this end a generalized discussion of the evolutionary behavior of a massive star, an intermediate mass star, and a low mass star will be presented. 19 refs., 1 fig., 1 tab
Quantum Regge calculus in the Lorentzian domain and its Hamiltonian formulation
International Nuclear Information System (INIS)
Williams, R.M.; Cambridge Univ.
1986-01-01
A formalism is set up for quantum Regge calculus in the Lorentzian domain, calculating the inverse propagator in the free field case. The variables in the Arnowitt-Deser-Misner [1962, Gravitation, an Introduction to Current Research, ed. L. Witten (New York: Wiley) p 227] 3 + 1 formulation of general relativity are related to the Regge calculus variables. (author)
TRANSIENT ANOMALOUS SUB-DIFFUSION ON BOUNDED DOMAINS
MEERSCHAERT, MARK M.; NANE, ERKAN; VELLAISAMY, P.
2012-01-01
This paper develops strong solutions and stochastic solutions for the tempered fractional diffusion equation on bounded domains. First the eigenvalue problem for tempered fractional derivatives is solved. Then a separation of variables, and eigenfunction expansions in time and space, are used to write strong solutions. Finally, stochastic solutions are written in terms of an inverse subordinator.
International Nuclear Information System (INIS)
Ruan, John J.; Anderson, Scott F.; MacLeod, Chelsea L.; Becker, Andrew C.; Davenport, James R. A.; Ivezić, Željko; Burnett, T. H.; Kochanek, Christopher S.; Plotkin, Richard M.; Sesar, Branimir; Stuart, J. Scott
2012-01-01
We investigate the use of optical photometric variability to select and identify blazars in large-scale time-domain surveys, in part to aid in the identification of blazar counterparts to the ∼30% of γ-ray sources in the Fermi 2FGL catalog still lacking reliable associations. Using data from the optical LINEAR asteroid survey, we characterize the optical variability of blazars by fitting a damped random walk model to individual light curves with two main model parameters, the characteristic timescales of variability τ, and driving amplitudes on short timescales σ-circumflex. Imposing cuts on minimum τ and σ-circumflex allows for blazar selection with high efficiency E and completeness C. To test the efficacy of this approach, we apply this method to optically variable LINEAR objects that fall within the several-arcminute error ellipses of γ-ray sources in the Fermi 2FGL catalog. Despite the extreme stellar contamination at the shallow depth of the LINEAR survey, we are able to recover previously associated optical counterparts to Fermi active galactic nuclei with E ≥ 88% and C = 88% in Fermi 95% confidence error ellipses having semimajor axis r < 8'. We find that the suggested radio counterpart to Fermi source 2FGL J1649.6+5238 has optical variability consistent with other γ-ray blazars and is likely to be the γ-ray source. Our results suggest that the variability of the non-thermal jet emission in blazars is stochastic in nature, with unique variability properties due to the effects of relativistic beaming. After correcting for beaming, we estimate that the characteristic timescale of blazar variability is ∼3 years in the rest frame of the jet, in contrast with the ∼320 day disk flux timescale observed in quasars. The variability-based selection method presented will be useful for blazar identification in time-domain optical surveys and is also a probe of jet physics.
International Nuclear Information System (INIS)
Jeong, Jong-Geun; Kim, Dong-Sik; Kim, Yong-Sung; Kwon, Myung-Hee
2011-01-01
Highlights: → We generate ' H3 Tat-3D8' by grafting Tat 48-60 peptide to VH CDR of 3D8 scFv antibody. → H3 Tat-3D8 antibody retains nucleic acid binding and hydrolyzing activities. → H3 Tat-3D8 acquires a preference for TAR RNA structure. → Properties of Tat 48-60 is transferred to an antibody via Tat-grafting into a CDR. -- Abstract: The 3D8 single chain variable fragment (3D8 scFv) is an anti-nucleic acid antibody that can hydrolyze nucleic acids and enter the cytosol of cells without reaching the nucleus. The Tat peptide, derived from the basic region of the HIV-1 Tat protein, translocates to cell nuclei and has TAR RNA binding activity. In this study, we generated a Tat-grafted antibody ( H3 Tat-3D8) by replacing complementarity-determining region 3 (CDR3) within the VH domain of the 3D8 scFv with a Tat 48-60 peptide (GRKKRRQRRRPPQ). H3 Tat-3D8 retained the DNA-binding and DNA-hydrolyzing activity of the scFv, and translocated to the nuclei of HeLa cells and preferentially recognized TAR RNA. Thus, the properties associated with the Tat peptide were transferred to the antibody via Tat-grafting without loss of the intrinsic DNA-binding and hydrolyzing activities of the 3D8 scFv antibody.
International Nuclear Information System (INIS)
Nett, Jason Michael
2010-01-01
We present here the search for Standard Model VH → VWW → lll + E T (missing energy due to neutrinos) production, where V is a W or Z weak vector boson, which uses up to 5.9 fb -1 of integrated luminosity. This analysis has recently added to the CDF high-mass Higgs group three new signal topologies characterized by a tri-lepton signature, which are chosen to isolate the VH → VWW associated production signals in the three-lepton signature. As such, we define three new regions for a WH analysis, a ZH 1-jet analysis, and a ZH (ge) 2-jet analysis with which we expect to contribute an additional ∼ 5.8% (for m H = 165 GeV) acceptance to the current H → WW dilepton analysis. The ZH trilepton regions are defined by events passing a Z-boson selection: events having at least one lepton pairing (among three possible pairings) with opposite sign, same flavor, and a dilepton invariant mass within (76.0, 106.0) GeV - a ± 15 GeV window around the Z-boson mass. The WH trilepton region is then defined as the set of trilepton events that are complement to those chosen by the Z-boson selection. These three new event topologies make a substantial contribution to the H → WW group result. As a measure of the sensitivity of this search, we compute the median expected limit on the at 95% confidence level ('C.L.') on the production cross section (effectively the rate of production) for a Standard Model Higgs boson and report the result as a ratio to the theoretical production cross section. An observed limit ratio of one or less at a given mass would rule out the production of a Standard Model Higgs boson at that mass with 95% confidence. At m H = 165 GeV, the WH analysis expected limits reach 7.2 times the standard model cross section; the ZH 1-jet analysis is set at 29 times the expected standard model cross section; the ZH (ge) 2-jet analysis is set at 9.9 times the expected standard model cross section; and the combined trilepton analysis is set at 4.9 times the expected
Three-dimensional transient electromagnetic modeling in the Laplace Domain
International Nuclear Information System (INIS)
Mizunaga, H.; Lee, Ki Ha; Kim, H.J.
1998-01-01
In modeling electromagnetic responses, Maxwell's equations in the frequency domain are popular and have been widely used (Nabighian, 1994; Newman and Alumbaugh, 1995; Smith, 1996, to list a few). Recently, electromagnetic modeling in the time domain using the finite difference (FDTD) method (Wang and Hohmann, 1993) has also been used to study transient electromagnetic interactions in the conductive medium. This paper presents a new technique to compute the electromagnetic response of three-dimensional (3-D) structures. The proposed new method is based on transforming Maxwell's equations to the Laplace domain. For each discrete Laplace variable, Maxwell's equations are discretized in 3-D using the staggered grid and the finite difference method (FDM). The resulting system of equations is then solved for the fields using the incomplete Cholesky conjugate gradient (ICCG) method. The new method is particularly effective in saving computer memory since all the operations are carried out in real numbers. For the same reason, the computing speed is faster than frequency domain modeling. The proposed approach can be an extremely useful tool in developing an inversion algorithm using the time domain data
Dooley, Helen; Flajnik, Martin F; Porter, Andrew J
2003-09-01
The novel immunoglobulin isotype novel antigen receptor (IgNAR) is found in cartilaginous fish and is composed of a heavy-chain homodimer that does not associate with light chains. The variable regions of IgNAR function as independent domains similar to those found in the heavy-chain immunoglobulins of Camelids. Here, we describe the successful cloning and generation of a phage-displayed, single-domain library based upon the variable domain of IgNAR. Selection of such a library generated from nurse sharks (Ginglymostoma cirratum) immunized with the model antigen hen egg-white lysozyme (HEL) enabled the successful isolation of intact antigen-specific binders matured in vivo. The selected variable domains were shown to be functionally expressed in Escherichia coli, extremely stable, and bind to antigen specifically with an affinity in the nanomolar range. This approach can therefore be considered as an alternative route for the isolation of minimal antigen-binding fragments with favorable characteristics.
Heart Rate Variability - A Historical Perspective
Directory of Open Access Journals (Sweden)
George E Billman
2011-11-01
Full Text Available Heart rate variability (HRV, the beat-to-beat variation in either heart rate or the duration of the R-R interval – the heart period, has become a popular clinical and investigational tool. The temporal fluctuations in heart rate exhibit a marked synchrony with respiration (increasing during inspiration and decreasing during expiration – the so called respiratory sinus arrhythmia, RSA and are widely believed to reflect changes in cardiac autonomic regulation. Although the exact contributions of the parasympathetic and the sympathetic divisions of the autonomic nervous system to this variability are controversial and remain the subject of active investigation and debate, a number of time and frequency domain techniques have been developed to provide insight into cardiac autonomic regulation in both health and disease. It is the purpose of this essay to provide an historical overview of the evolution in the concept of heart rate variability. Briefly, pulse rate was first measured by ancient Greek physicians and scientists. However, it was not until the invention of the Physician’s Pulse Watch (a watch with a second hand that could be stopped in 1707 that changes in pulse rate could be accurately assessed. The Rev. Stephen Hales (1733 was the first to note that pulse varied with respiration and in 1847 Carl Ludwig was the first to record RSA. With the measurement of the ECG (1895 and advent of digital signal processing techniques in the 1960’s, investigation of HRV and its relationship to health and disease has exploded. This essay will conclude with a brief description of time domain, frequency domain, and non-linear dynamic analysis techniques (and their limitations that are commonly used to measure heart rate variability.
DEFF Research Database (Denmark)
Haberland, Hartmut
2005-01-01
politicians and in the media, especially in the discussion whether some languages undergo ‘domain loss’ vis-à-vis powerful international languages like English. An objection that has been raised here is that domains, as originally conceived, are parameters of language choice and not properties of languages...
Directory of Open Access Journals (Sweden)
Zomaya Albert Y
2006-12-01
Full Text Available Abstract Background Knowledge of protein domain boundaries is critical for the characterisation and understanding of protein function. The ability to identify domains without the knowledge of the structure – by using sequence information only – is an essential step in many types of protein analyses. In this present study, we demonstrate that the performance of DomainDiscovery is improved significantly by including the inter-domain linker index value for domain identification from sequence-based information. Improved DomainDiscovery uses a Support Vector Machine (SVM approach and a unique training dataset built on the principle of consensus among experts in defining domains in protein structure. The SVM was trained using a PSSM (Position Specific Scoring Matrix, secondary structure, solvent accessibility information and inter-domain linker index to detect possible domain boundaries for a target sequence. Results Improved DomainDiscovery is compared with other methods by benchmarking against a structurally non-redundant dataset and also CASP5 targets. Improved DomainDiscovery achieves 70% accuracy for domain boundary identification in multi-domains proteins. Conclusion Improved DomainDiscovery compares favourably to the performance of other methods and excels in the identification of domain boundaries for multi-domain proteins as a result of introducing support vector machine with benchmark_2 dataset.
Epitope mapping of the domains of human angiotensin converting enzyme.
Kugaevskaya, Elena V; Kolesanova, Ekaterina F; Kozin, Sergey A; Veselovsky, Alexander V; Dedinsky, Ilya R; Elisseeva, Yulia E
2006-06-01
Somatic angiotensin converting enzyme (sACE), contains in its single chain two homologous domains (called N- and C-domains), each bearing a functional zinc-dependent active site. The present study aims to define the differences between two sACE domains and to localize experimentally revealed antigenic determinants (B-epitopes) in the recently determined three-dimensional structure of testicular tACE. The predicted linear antigenic determinants of human sACE were determined by peptide scanning ("PEPSCAN") approach. Essential difference was demonstrated between locations of the epitopes in the N- and C-domains. Comparison of arrangement of epitopes in the human domains with the corresponding sequences of some mammalian sACEs enabled to classify the revealed antigenic determinants as variable or conserved areas. The location of antigenic determinants with respect to various structural elements and to functionally important sites of the human sACE C-domain was estimated. The majority of antigenic sites of the C-domain were located at the irregular elements and at the boundaries of secondary structure elements. The data show structural differences between the sACE domains. The experimentally revealed antigenic determinants were in agreement with the recently determined crystal tACE structure. New potential applications are open to successfully produce mono-specific and group-specific antipeptide antibodies.
van Ommen, M M; van Beilen, M; Cornelissen, F W; Smid, H G O M; Knegtering, H; Aleman, A; van Laar, T
2016-06-01
Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing. Conversely, VH in Parkinson's disease are associated with impaired visual perception and attention, as proposed by the Perception and Attention Deficit (PAD) model. Auditory hallucinations (AH) in psychosis, however, are thought to be related to increased attention. Our retrospective database study included 1119 patients with non-affective psychosis and 586 controls. The Community Assessment of Psychic Experiences established the VH rate. Scores on visual perception tests [Degraded Facial Affect Recognition (DFAR), Benton Facial Recognition Task] and attention tests [Response Set-shifting Task, Continuous Performance Test-HQ (CPT-HQ)] were compared between 75 VH patients, 706 non-VH patients and 485 non-VH controls. The lifetime VH rate was 37%. The patient groups performed similarly on cognitive tasks; both groups showed worse perception (DFAR) than controls. Non-VH patients showed worse attention (CPT-HQ) than controls, whereas VH patients did not perform differently. We did not find significant VH-related impairments in bottom-up processing or direct top-down alterations. However, the results suggest a relatively spared attentional performance in VH patients, whereas face perception and processing speed were equally impaired in both patient groups relative to controls. This would match better with the increased attention hypothesis than with the PAD model. Our finding that VH frequently co-occur with AH may support an increased attention-induced 'hallucination proneness'.
Analytic regularity and collocation approximation for elliptic PDEs with random domain deformations
Castrillon, Julio
2016-03-02
In this work we consider the problem of approximating the statistics of a given Quantity of Interest (QoI) that depends on the solution of a linear elliptic PDE defined over a random domain parameterized by N random variables. The elliptic problem is remapped onto a corresponding PDE with a fixed deterministic domain. We show that the solution can be analytically extended to a well defined region in CN with respect to the random variables. A sparse grid stochastic collocation method is then used to compute the mean and variance of the QoI. Finally, convergence rates for the mean and variance of the QoI are derived and compared to those obtained in numerical experiments.
Reduction of the Random Variables of the Turbulent Wind Field
DEFF Research Database (Denmark)
Sichani, Mahdi Teimouri; Nielsen, Søren R.K.
2012-01-01
.e. Importance Sampling (IS) or Subset Simulation (SS), will be deteriorated on problems with many random variables. The problem with PDEM is that a multidimensional integral has to be carried out over the space defined by the random variables of the system. The numerical procedure requires discretization......Applicability of the Probability Density Evolution Method (PDEM) for realizing evolution of the probability density for the wind turbines has rather strict bounds on the basic number of the random variables involved in the model. The efficiency of most of the Advanced Monte Carlo (AMC) methods, i...... of the integral domain; this becomes increasingly difficult as the dimensions of the integral domain increase. On the other hand efficiency of the AMC methods is closely dependent on the design points of the problem. Presence of many random variables may increase the number of the design points, hence affects...
Identifying core domains to assess flare in rheumatoid arthritis
DEFF Research Database (Denmark)
Bartlett, Susan J; Hewlett, Sarah; Bingham, Clifton O
2012-01-01
For rheumatoid arthritis (RA), there is no consensus on how to define and assess flare. Variability in flare definitions impairs understanding of findings across studies and limits ability to pool results. The OMERACT RA Flare Group sought to identify domains to define RA flares from patient...
Book, W. J.; Majett, M.
1982-01-01
The potential benefits of the ability to control more flexible mechanical arms are discussed. A justification is made in terms of speed of movement. A new controller design procedure is then developed to provide this capability. It uses both a frequency domain representation and a state variable representation of the arm model. The frequency domain model is used to update the modal state variable model to insure decoupled states. The technique is applied to a simple example with encouraging results.
International Nuclear Information System (INIS)
Carrascosa, Patricia; Baronio, Mariano; Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier; Borghi, Mario; Sueldo, Carlos; Papier, Sergio
2008-01-01
Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 ± 3 min, whereas for HSG was 28 ± 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results
Energy Technology Data Exchange (ETDEWEB)
Carrascosa, Patricia [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina)], E-mail: patriciacarrascosa@diagnosticomaipu.com.ar; Baronio, Mariano [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina); Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina); Borghi, Mario; Sueldo, Carlos; Papier, Sergio [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina)
2008-09-15
Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 {+-} 3 min, whereas for HSG was 28 {+-} 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results.
Modelling and prediction of crop losses from NOAA polar-orbiting operational satellites
Directory of Open Access Journals (Sweden)
Felix Kogan
2016-05-01
Full Text Available Weather-related crop losses have always been a concern for farmers, governments, traders, and policy-makers for the purpose of balanced food supply/demands, trade, and distribution of aid to the nations in need. Among weather disasters, drought plays a major role in large-scale crop losses. This paper discusses utility of operational satellite-based vegetation health (VH indices for modelling cereal yield and for early warning of drought-related crop losses. The indices were tested in Saratov oblast (SO, one of the principal grain growing regions of Russia. Correlation and regression analysis were applied to model cereal yield from VH indices during 1982–2001. A strong correlation between mean SO's cereal yield and VH indices were found during the critical period of cereals, which starts two–three weeks before and ends two–three weeks after the heading stage. Several models were constructed where VH indices served as independent variables (predictors. The models were validated independently based on SO cereal yield during 1982–2012. Drought-related cereal yield losses can be predicted three months in advance of harvest and six–eight months in advance of official grain production statistic is released. The error of production losses prediction is 7%–10%. The error of prediction drops to 3%–5% in the years of intensive droughts.
Using gene co-expression network analysis to predict biomarkers for chronic lymphocytic leukemia
Directory of Open Access Journals (Sweden)
Borlawsky Tara B
2010-10-01
Full Text Available Abstract Background Chronic lymphocytic leukemia (CLL is the most common adult leukemia. It is a highly heterogeneous disease, and can be divided roughly into indolent and progressive stages based on classic clinical markers. Immunoglobin heavy chain variable region (IgVH mutational status was found to be associated with patient survival outcome, and biomarkers linked to the IgVH status has been a focus in the CLL prognosis research field. However, biomarkers highly correlated with IgVH mutational status which can accurately predict the survival outcome are yet to be discovered. Results In this paper, we investigate the use of gene co-expression network analysis to identify potential biomarkers for CLL. Specifically we focused on the co-expression network involving ZAP70, a well characterized biomarker for CLL. We selected 23 microarray datasets corresponding to multiple types of cancer from the Gene Expression Omnibus (GEO and used the frequent network mining algorithm CODENSE to identify highly connected gene co-expression networks spanning the entire genome, then evaluated the genes in the co-expression network in which ZAP70 is involved. We then applied a set of feature selection methods to further select genes which are capable of predicting IgVH mutation status from the ZAP70 co-expression network. Conclusions We have identified a set of genes that are potential CLL prognostic biomarkers IL2RB, CD8A, CD247, LAG3 and KLRK1, which can predict CLL patient IgVH mutational status with high accuracies. Their prognostic capabilities were cross-validated by applying these biomarker candidates to classify patients into different outcome groups using a CLL microarray datasets with clinical information.
Verallo-Rowell, Vermén M
2011-01-01
The validated hypoallergenic (vh) rating system was initiated in 1988 to try to objectively validate the "hypoallergenic" claim in cosmetics. To show how the system rates cosmetic hypoallergenicity and to compare the prevalence of cosmetic contact dermatitis (CCD) among users of regular cosmetics versus cosmetics with high VH numbers. (1) Made a VH list based on top allergens from patch-test results published by the North American Contact Dermatitis Group (NACDG) and the European Surveillance System on Contact Allergies (ESSCA); (2) reviewed global regulatory, cosmetic, drug, packaging, and manufacturing practices to show how allergens may contaminate products; (3) compared cosmetic ingredients lists against the VH list to obtain the VH rating (the more allergens absent, the higher the VH rating); and (4) obtained CCD prevalence among users of regular cosmetics versus users of cosmetics with high VH ratings. (1) Two VH lists (1988, 2003) included only cosmetic allergens in the NACDG surveys, the third (2007) included cosmetic and potential contaminant noncosmetic allergens, and the fourth (2010) adds ESSCA patch-test surveys. (2) CCD prevalence is 0.05 to 0.12% (average, 0.08%) among users of cosmetics with high VH ratings versus 2.4 to 36.3% among users of regular cosmetics. The VH rating system is shown to objectively validate the hypoallergenic cosmetics claim.
Derrickson, J. H.; Wu, J.; Christl, M. J.; Fountain, W. F.; Parnell, T. A.
1999-01-01
The "all-particle" cosmic ray energy spectrum appears to be exhibiting a significant change in the spectral index just above approximately 3000 TeV. This could indicate (1) a change in the propagation of the cosmic rays in the galactic medium, and/or (2) the upper limit of the supernova shock wave acceleration mechanism, and/or (3) a new source of high-energy cosmic rays. Air shower and JACEE data indicate the spectral change is associated with a composition change to a heavier element mixture whereas DICE does not indicate this. A detector concept will be presented that utilizes the energy dependence of the production of direct Coulomb electron-positron pairs by energetic heavy ions. Monte Carlo simulations of a direct electron pair detector consisting of Pb target foils interleaved with planes of 1-mm square scintillating optical fibers will be discussed. The goal is to design a large area, non-saturating instrument to measure the energy spectrum of the individual cosmic ray elements in the "VH-group" for energies greater than 10 TeV/nucleon.
Pulsation properties of Mira long period variables
International Nuclear Information System (INIS)
Cahn, J.H.
1980-01-01
A matter of great interest to variable star students concerns the mode of pulsation of Mira long period variables. In this report we first give observational evidence for the pulsation constant Q. We then compare the observations with calculations. Next, we review two interesting groups of papers dealing with hydrodynamic properties of long period variables. In the first, a fully dynamic nonlinear calculation maps out the Mira instability domain. In the second, special attention is paid to shock propagation beyond the photosphere which in large measure accounts for the complex spectra from this region. (orig./WL)
Signal Enhancement with Variable Span Linear Filters
DEFF Research Database (Denmark)
Benesty, Jacob; Christensen, Mads Græsbøll; Jensen, Jesper Rindom
. Variable span filters combine the ideas of optimal linear filters with those of subspace methods, as they involve the joint diagonalization of the correlation matrices of the desired signal and the noise. The book shows how some well-known filter designs, e.g. the minimum distortion, maximum signal...... the time and STFT domains, and, lastly, in time-domain binaural enhancement. In these contexts, the properties of these filters are analyzed in terms of their noise reduction capabilities and desired signal distortion, and the analyses are validated and further explored in simulations....
Algebraic and radical potential fields. Stability domains in coordinate and parametric space
Uteshev, Alexei Yu.
2018-05-01
A dynamical system d X/d t = F(X; A) is treated where F(X; A) is a polynomial (or some general type of radical contained) function in the vectors of state variables X ∈ ℝn and parameters A ∈ ℝm. We are looking for stability domains in both spaces, i.e. (a) domain ℙ ⊂ ℝm such that for any parameter vector specialization A ∈ ℙ, there exists a stable equilibrium for the dynamical system, and (b) domain 𝕊 ⊂ ℝn such that any point X* ∈ 𝕊 could be made a stable equilibrium by a suitable specialization of the parameter vector A.
DEFF Research Database (Denmark)
Mouritsen, Ole G.; Praestgaard, Eigil
1988-01-01
obeys dynamical scaling and the shape of the dynamical scaling function pertaining to the structure factor is found to depend on P. Specifically, this function is described by a Porod-law behavior, q-ω, where ω increases with the wall softness. The kinetic exponent, which describes how the linear domain...... infinite to zero temperature as well as to nonzero temperatures below the ordering transition. The continuous nature of the spin variables causes the domain walls to be ‘‘soft’’ and characterized by a finite thickness. The steady-state thickness of the walls can be varied by a model parameter, P. At zero...... size varies with time, R(t)∼tn, is for both models at zero temperature determined to be n≃0.25, independent of P. At finite temperatures, the growth kinetics is found to cross over to the Lifshitz-Allen-Cahn law characterized by n≃0.50. The results support the idea of two separate zero...
Gazica, Michele W; Spector, Paul E
2016-01-01
Safety climate, violence prevention climate, and civility climate were independently developed and linked to domain-specific workplace hazards, although all three were designed to promote the physical and psychological safety of workers. To test domain specificity between conceptually related workplace climates and relevant workplace hazards. Data were collected from 368 persons employed in various industries and descriptive statistics were calculated for all study variables. Correlational and relative weights analyses were used to test for domain specificity. The three climate domains were similarly predictive of most workplace hazards, regardless of domain specificity. This study suggests that the three climate domains share a common higher order construct that may predict relevant workplace hazards better than any of the scales alone.
Tremblay, Line; Roy-Vaillancourt, Mélina; Chebbi, Brahim; Bouchard, Stéphane; Daoust, Michael; Dénommée, Jessica; Thorpe, Moriah
2016-02-01
It is well documented that anti-fat attitudes influence the interactions individuals have with overweight people. However, testing attitudes through self-report measures is challenging. In the present study, we explore the use of a haptic virtual reality environment to physically interact with overweight virtual human (VH). We verify the hypothesis that duration and strength of virtual touch vary according to the characteristics of VH in ways similar to those encountered from interaction with real people in anti-fat attitude studies. A group of 61 participants were randomly assigned to one of the experimental conditions involving giving a virtual hug to a female or a male VH of either normal or overweight. We found significant associations between body image satisfaction and anti-fat attitudes and sex differences on these measures. We also found a significant interaction effect of the sex of the participants, sex of the VH, and the body size of the VH. Female participants hugged longer the overweight female VH than overweight male VH. Male participants hugged longer the normal-weight VH than the overweight VH. We conclude that virtual touch is a promising method of measuring attitudes, emotion and social interactions.
Magnetic domain structure of MnAs thin films as a function of temperature
International Nuclear Information System (INIS)
Mizuguchi, Masaki; Manago, Takashi; Akinaga, Hiroyuki; Kuramochi, Hiromi; Okabayashi, Jun
2003-01-01
We have investigate magnetic domain structures of MnAs thin films grown on GaAs substrates by a magnetic force microscope. We observed, by an atomic force microscope, rectangular defects along GaAs [110] direction which disperse randomly on the surface of MnAs/GaAs(001). The Curie temperature of MnAs is 45degC, and it is successfully confirmed directly by the variable temperature magnetic force microscope observation. We also investigated magnetic domain structures of MnAs/GaAs(111)B, and no apparent relation was observed between the topographic structure and the magnetic domain structure. (author)
The BRCT domain is a phospho-protein binding domain.
Yu, Xiaochun; Chini, Claudia Christiano Silva; He, Miao; Mer, Georges; Chen, Junjie
2003-10-24
The carboxyl-terminal domain (BRCT) of the Breast Cancer Gene 1 (BRCA1) protein is an evolutionarily conserved module that exists in a large number of proteins from prokaryotes to eukaryotes. Although most BRCT domain-containing proteins participate in DNA-damage checkpoint or DNA-repair pathways, or both, the function of the BRCT domain is not fully understood. We show that the BRCA1 BRCT domain directly interacts with phosphorylated BRCA1-Associated Carboxyl-terminal Helicase (BACH1). This specific interaction between BRCA1 and phosphorylated BACH1 is cell cycle regulated and is required for DNA damage-induced checkpoint control during the transition from G2 to M phase of the cell cycle. Further, we show that two other BRCT domains interact with their respective physiological partners in a phosphorylation-dependent manner. Thirteen additional BRCT domains also preferentially bind phospho-peptides rather than nonphosphorylated control peptides. These data imply that the BRCT domain is a phospho-protein binding domain involved in cell cycle control.
Directory of Open Access Journals (Sweden)
Hajime Matsui
2017-12-01
Full Text Available In this study, we consider codes over Euclidean domains modulo their ideals. In the first half of the study, we deal with arbitrary Euclidean domains. We show that the product of generator matrices of codes over the rings mod a and mod b produces generator matrices of all codes over the ring mod a b , i.e., this correspondence is onto. Moreover, we show that if a and b are coprime, then this correspondence is one-to-one, i.e., there exist unique codes over the rings mod a and mod b that produce any given code over the ring mod a b through the product of their generator matrices. In the second half of the study, we focus on the typical Euclidean domains such as the rational integer ring, one-variable polynomial rings, rings of Gaussian and Eisenstein integers, p-adic integer rings and rings of one-variable formal power series. We define the reduced generator matrices of codes over Euclidean domains modulo their ideals and show their uniqueness. Finally, we apply our theory of reduced generator matrices to the Hecke rings of matrices over these Euclidean domains.
Robinson, Athena H.; Adler, Sarah; Stevens, Helen B.; Darcy, Alison M.; Morton, John M.; Safer, Debra L.
2014-01-01
Background Prior evidence indicates that predictors of weight loss outcomes after gastric bypass surgery fall within 5 domains: 1) presurgical factors; 2) postsurgical psychosocial variables (e.g., support group attendance); 3) postsurgical eating patterns; 4) postsurgical physical activity; and 5) follow-up at postsurgical clinic. However, little data exist on which specific behavioral predictors are most associated with successful outcomes (e.g., ≥50% excess weight loss) when considering the 5 domains simultaneously. Objectives Specify the behavioral variables, and their respective cutoff points, most associated with successful weight loss outcomes. Setting On-line survey. Methods Signal Detection Analysis evaluated associations between 84 pre-and postsurgical behavioral variables (within the 5 domains) and successful weight loss at ≥1 year in 274 post-gastric bypass surgery patients. Results Successful weight loss was highest (92.6%) among those reporting dietary adherence of >3 on a 9 point scale (median=5) who grazed no more than once-per-day. Among participants reporting dietary adherence <3 and grazing daily or less, success rates more than doubled when highest lifetime Body Mass Index was <53.7 kg/m2. Success rates also doubled for participants with dietary adherence =3 if attending support groups. No variables from the physical activity or postsurgical follow-up domains were significant, nor were years since surgery. The overall model’s sensitivity =.62, specificity =.92. Conclusions To our knowledge, this is the first study to simultaneously consider the relative contribution of behavioral variables within 5 domains and offer clinicians an assessment algorithm identifying cut-off points for behaviors most associated with successful postsurgical weight loss. Such data may inform prospective study designs and postsurgical interventions. PMID:24913590
Regional climate model sensitivity to domain size
Leduc, Martin; Laprise, René
2009-05-01
Regional climate models are increasingly used to add small-scale features that are not present in their lateral boundary conditions (LBC). It is well known that the limited area over which a model is integrated must be large enough to allow the full development of small-scale features. On the other hand, integrations on very large domains have shown important departures from the driving data, unless large scale nudging is applied. The issue of domain size is studied here by using the “perfect model” approach. This method consists first of generating a high-resolution climatic simulation, nicknamed big brother (BB), over a large domain of integration. The next step is to degrade this dataset with a low-pass filter emulating the usual coarse-resolution LBC. The filtered nesting data (FBB) are hence used to drive a set of four simulations (LBs for Little Brothers), with the same model, but on progressively smaller domain sizes. The LB statistics for a climate sample of four winter months are compared with BB over a common region. The time average (stationary) and transient-eddy standard deviation patterns of the LB atmospheric fields generally improve in terms of spatial correlation with the reference (BB) when domain gets smaller. The extraction of the small-scale features by using a spectral filter allows detecting important underestimations of the transient-eddy variability in the vicinity of the inflow boundary, which can penalize the use of small domains (less than 100 × 100 grid points). The permanent “spatial spin-up” corresponds to the characteristic distance that the large-scale flow needs to travel before developing small-scale features. The spin-up distance tends to grow in size at higher levels in the atmosphere.
Regional climate model sensitivity to domain size
Energy Technology Data Exchange (ETDEWEB)
Leduc, Martin [Universite du Quebec a Montreal, Canadian Regional Climate Modelling and Diagnostics (CRCMD) Network, ESCER Centre, Montreal (Canada); UQAM/Ouranos, Montreal, QC (Canada); Laprise, Rene [Universite du Quebec a Montreal, Canadian Regional Climate Modelling and Diagnostics (CRCMD) Network, ESCER Centre, Montreal (Canada)
2009-05-15
Regional climate models are increasingly used to add small-scale features that are not present in their lateral boundary conditions (LBC). It is well known that the limited area over which a model is integrated must be large enough to allow the full development of small-scale features. On the other hand, integrations on very large domains have shown important departures from the driving data, unless large scale nudging is applied. The issue of domain size is studied here by using the ''perfect model'' approach. This method consists first of generating a high-resolution climatic simulation, nicknamed big brother (BB), over a large domain of integration. The next step is to degrade this dataset with a low-pass filter emulating the usual coarse-resolution LBC. The filtered nesting data (FBB) are hence used to drive a set of four simulations (LBs for Little Brothers), with the same model, but on progressively smaller domain sizes. The LB statistics for a climate sample of four winter months are compared with BB over a common region. The time average (stationary) and transient-eddy standard deviation patterns of the LB atmospheric fields generally improve in terms of spatial correlation with the reference (BB) when domain gets smaller. The extraction of the small-scale features by using a spectral filter allows detecting important underestimations of the transient-eddy variability in the vicinity of the inflow boundary, which can penalize the use of small domains (less than 100 x 100 grid points). The permanent ''spatial spin-up'' corresponds to the characteristic distance that the large-scale flow needs to travel before developing small-scale features. The spin-up distance tends to grow in size at higher levels in the atmosphere. (orig.)
Individual negative symptoms and domains - Relevance for assessment, pathomechanisms and treatment.
Kaiser, Stefan; Lyne, John; Agartz, Ingrid; Clarke, Mary; Mørch-Johnsen, Lynn; Faerden, Ann
2017-08-01
The negative symptoms of schizophrenia can be divided into two domains. Avolition/apathy includes the individual symptoms of avolition, asociality and anhedonia. Diminished expression includes blunted affect and alogia. Until now, causes and treatment of negative symptoms have remained a major challenge, which is partially related to the focus on negative symptoms as a broad entity. Here, we propose that negative symptoms may become more tractable when the different domains and individual symptoms are taken into account. There is now increasing evidence that the relationship with clinical variables - in particular outcome - differs between the domains of avolition/apathy and diminished expression. Regarding models of negative symptom formation, those relevant to avolition/apathy are now converging on processes underlying goal-directed behavior and dysfunctions of the reward system. In contrast, models of the diminished expression domains are only beginning to emerge. The aim of this article is to review the specific clinical, behavioral and neural correlates of individual symptoms and domains as a better understanding of these areas may facilitate specific treatment approaches. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hjørland, Birger
2017-01-01
The domain-analytic approach to knowledge organization (KO) (and to the broader field of library and information science, LIS) is outlined. The article reviews the discussions and proposals on the definition of domains, and provides an example of a domain-analytic study in the field of art studies....... Varieties of domain analysis as well as criticism and controversies are presented and discussed....
Miyabara, Renata; Berg, Karsten; Kraemer, Jan F; Baltatu, Ovidiu C; Wessel, Niels; Campos, Luciana A
2017-01-01
Objective: The aim of this study was to identify the most sensitive heart rate and blood pressure variability (HRV and BPV) parameters from a given set of well-known methods for the quantification of cardiovascular autonomic function after several autonomic blockades. Methods: Cardiovascular sympathetic and parasympathetic functions were studied in freely moving rats following peripheral muscarinic (methylatropine), β1-adrenergic (metoprolol), muscarinic + β1-adrenergic, α1-adrenergic (prazosin), and ganglionic (hexamethonium) blockades. Time domain, frequency domain and symbolic dynamics measures for each of HRV and BPV were classified through paired Wilcoxon test for all autonomic drugs separately. In order to select those variables that have a high relevance to, and stable influence on our target measurements (HRV, BPV) we used Fisher's Method to combine the p -value of multiple tests. Results: This analysis led to the following best set of cardiovascular variability parameters: The mean normal beat-to-beat-interval/value (HRV/BPV: meanNN), the coefficient of variation (cvNN = standard deviation over meanNN) and the root mean square differences of successive (RMSSD) of the time domain analysis. In frequency domain analysis the very-low-frequency (VLF) component was selected. From symbolic dynamics Shannon entropy of the word distribution (FWSHANNON) as well as POLVAR3, the non-linear parameter to detect intermittently decreased variability, showed the best ability to discriminate between the different autonomic blockades. Conclusion: Throughout a complex comparative analysis of HRV and BPV measures altered by a set of autonomic drugs, we identified the most sensitive set of informative cardiovascular variability indexes able to pick up the modifications imposed by the autonomic challenges. These indexes may help to increase our understanding of cardiovascular sympathetic and parasympathetic functions in translational studies of experimental diseases.
Estimation of Poisson noise in spatial domain
Švihlík, Jan; Fliegel, Karel; Vítek, Stanislav; Kukal, Jaromír.; Krbcová, Zuzana
2017-09-01
This paper deals with modeling of astronomical images in the spatial domain. We consider astronomical light images contaminated by the dark current which is modeled by Poisson random process. Dark frame image maps the thermally generated charge of the CCD sensor. In this paper, we solve the problem of an addition of two Poisson random variables. At first, the noise analysis of images obtained from the astronomical camera is performed. It allows estimating parameters of the Poisson probability mass functions in every pixel of the acquired dark frame. Then the resulting distributions of the light image can be found. If the distributions of the light image pixels are identified, then the denoising algorithm can be applied. The performance of the Bayesian approach in the spatial domain is compared with the direct approach based on the method of moments and the dark frame subtraction.
Inferring domain-domain interactions from protein-protein interactions with formal concept analysis.
Directory of Open Access Journals (Sweden)
Susan Khor
Full Text Available Identifying reliable domain-domain interactions will increase our ability to predict novel protein-protein interactions, to unravel interactions in protein complexes, and thus gain more information about the function and behavior of genes. One of the challenges of identifying reliable domain-domain interactions is domain promiscuity. Promiscuous domains are domains that can occur in many domain architectures and are therefore found in many proteins. This becomes a problem for a method where the score of a domain-pair is the ratio between observed and expected frequencies because the protein-protein interaction network is sparse. As such, many protein-pairs will be non-interacting and domain-pairs with promiscuous domains will be penalized. This domain promiscuity challenge to the problem of inferring reliable domain-domain interactions from protein-protein interactions has been recognized, and a number of work-arounds have been proposed. This paper reports on an application of Formal Concept Analysis to this problem. It is found that the relationship between formal concepts provides a natural way for rare domains to elevate the rank of promiscuous domain-pairs and enrich highly ranked domain-pairs with reliable domain-domain interactions. This piggybacking of promiscuous domain-pairs onto less promiscuous domain-pairs is possible only with concept lattices whose attribute-labels are not reduced and is enhanced by the presence of proteins that comprise both promiscuous and rare domains.
Inferring Domain-Domain Interactions from Protein-Protein Interactions with Formal Concept Analysis
Khor, Susan
2014-01-01
Identifying reliable domain-domain interactions will increase our ability to predict novel protein-protein interactions, to unravel interactions in protein complexes, and thus gain more information about the function and behavior of genes. One of the challenges of identifying reliable domain-domain interactions is domain promiscuity. Promiscuous domains are domains that can occur in many domain architectures and are therefore found in many proteins. This becomes a problem for a method where the score of a domain-pair is the ratio between observed and expected frequencies because the protein-protein interaction network is sparse. As such, many protein-pairs will be non-interacting and domain-pairs with promiscuous domains will be penalized. This domain promiscuity challenge to the problem of inferring reliable domain-domain interactions from protein-protein interactions has been recognized, and a number of work-arounds have been proposed. This paper reports on an application of Formal Concept Analysis to this problem. It is found that the relationship between formal concepts provides a natural way for rare domains to elevate the rank of promiscuous domain-pairs and enrich highly ranked domain-pairs with reliable domain-domain interactions. This piggybacking of promiscuous domain-pairs onto less promiscuous domain-pairs is possible only with concept lattices whose attribute-labels are not reduced and is enhanced by the presence of proteins that comprise both promiscuous and rare domains. PMID:24586450
Lemetre, Christophe; Maniko, Jeffrey; Charlop-Powers, Zachary; Sparrow, Ben; Lowe, Andrew J; Brady, Sean F
2017-10-31
Although bacterial bioactive metabolites have been one of the most prolific sources of lead structures for the development of small-molecule therapeutics, very little is known about the environmental factors associated with changes in secondary metabolism across natural environments. Large-scale sequencing of environmental microbiomes has the potential to shed light on the richness of bacterial biosynthetic diversity hidden in the environment, how it varies from one environment to the next, and what environmental factors correlate with changes in biosynthetic diversity. In this study, the sequencing of PCR amplicons generated using primers targeting either ketosynthase domains from polyketide biosynthesis or adenylation domains from nonribosomal peptide biosynthesis was used to assess biosynthetic domain composition and richness in soils collected across the Australian continent. Using environmental variables collected at each soil site, we looked for environmental factors that correlated with either high overall domain richness or changes in the domain composition. Among the environmental variables we measured, changes in biosynthetic domain composition correlate most closely with changes in latitude and to a lesser extent changes in pH. Although it is unclear at this time the exact mix of factors that may drive the relationship between biosynthetic domain composition and latitude, from a practical perspective the identification of a latitudinal basis for differences in soil metagenome biosynthetic domain compositions should help guide future natural product discovery efforts. Published under the PNAS license.
Levels and domains in personality: an introduction.
Emmons, R A
1995-09-01
This special issue is centered around the problem of levels and domains in personality functioning. What kind of constructs--and at what levels and in what domains--are needed to understand what a person is like? To account for the complexity and scope of human lives, personality psychologists have traditionally put forth lists and taxonomies of factors, features, and variables that must be taken into consideration in formulating an adequate psychological portrait of the whole person. The five-factor model of personality traits has recently been offered as a comprehensive framework; however, critical analyses of the trait concept have revealed the limitations of a trait-based model of personality. Recognizing that the concept of trait is indispensable to a vital psychology of personality, this special issue aims to (a) communicate recent developments and organizational frameworks for understanding the person at multiple levels and in varied domains, and (b) articulate and elaborate units of analysis that, when combined with trait assessments, yield a psychology of personality that is commensurate with the complexity of individual functioning and that offers greater potential for the attainment of the original goals of the discipline.
The frequency-domain approach for apparent density mapping
Tong, T.; Guo, L.
2017-12-01
Apparent density mapping is a technique to estimate density distribution in the subsurface layer from the observed gravity data. It has been widely applied for geologic mapping, tectonic study and mineral exploration for decades. Apparent density mapping usually models the density layer as a collection of vertical, juxtaposed prisms in both horizontal directions, whose top and bottom surfaces are assumed to be horizontal or variable-depth, and then inverts or deconvolves the gravity anomalies to determine the density of each prism. Conventionally, the frequency-domain approach, which assumes that both top and bottom surfaces of the layer are horizontal, is usually utilized for fast density mapping. However, such assumption is not always valid in the real world, since either the top surface or the bottom surface may be variable-depth. Here, we presented a frequency-domain approach for apparent density mapping, which permits both the top and bottom surfaces of the layer to be variable-depth. We first derived the formula for forward calculation of gravity anomalies caused by the density layer, whose top and bottom surfaces are variable-depth, and the formula for inversion of gravity anomalies for the density distribution. Then we proposed the procedure for density mapping based on both the formulas of inversion and forward calculation. We tested the approach on the synthetic data, which verified its effectiveness. We also tested the approach on the real Bouguer gravity anomalies data from the central South China. The top surface was assumed to be flat and was on the sea level, and the bottom surface was considered as the Moho surface. The result presented the crustal density distribution, which was coinciding well with the basic tectonic features in the study area.
A novel square-root domain realization of first order all-pass filter
ÖLMEZ, Sinem; ÇAM, Uğur
2010-01-01
In this paper, a new square-root domain, first order, all-pass filter based on the MOSFET square law is presented. The proposed filter is designed by using nonlinear mapping on the state variables of a state space description of the transfer function. To the best knowledge of the authors, the filter is the first square-root domain first order all-pass structure designed by using state space synthesis method in the literature. The center frequency of the all-pass filter is not only a...
Analysis, Test and Verification in The Presence of Variability (Dagstuhl Seminar 13091)
DEFF Research Database (Denmark)
2014-01-01
-aware tool chains. We brought together 46 key researchers from three continents, working on quality assurance challenges that arise from introducing variability, and some who do not work with variability, but that are experts in their respective areas in the broader domain of software analysis or testing...
The YARHG domain: an extracellular domain in search of a function.
Directory of Open Access Journals (Sweden)
Penny Coggill
Full Text Available We have identified a new bacterial protein domain that we hypothesise binds to peptidoglycan. This domain is called the YARHG domain after the most highly conserved sequence-segment. The domain is found in the extracellular space and is likely to be composed of four alpha-helices. The domain is found associated with protein kinase domains, suggesting it is associated with signalling in some bacteria. The domain is also found associated with three different families of peptidases. The large number of different domains that are found associated with YARHG suggests that it is a useful functional module that nature has recombined multiple times.
Tu, Bailin; Tieman, Bryan; Moore, Jeffrey; Pan, You; Muerhoff, A Scott
2017-06-01
Monoclonal antibodies are widely used as the capture and detection reagents in diagnostic immunoassays. In the past, myeloma fusion partners expressing endogenous heavy and/or light chains were often used to generate hybridoma cell lines. As a result, mixed populations of antibodies were produced that can cause inaccurate test results, poor antibody stability, and significant lot-to-lot variability. We describe one such scenario where the P3U1 (P3X63Ag8U.1) myeloma fusion partner was used in the generation of a hybridoma producing protein induced vitamin K absence/antagonist-II (PIVKA II) antibody. The hybridoma produces three subpopulations of immunoglobulin as determined by ion exchange (IEx) chromatography that exhibit varying degrees of immunoreactivity (0%, 50%, or 100%) to the target antigen as determined by Surface Plasmon Resonance. To produce an antibody with the highest possible sensitivity and specificity, the antigen-specific heavy and light chain variable domains (VH and VL) were cloned from the hybridoma and tethered to murine IgG1 and kappa scaffolds. The resulting recombinant antibody was expressed in Chinese hamster ovary cells and is compatible for use in a diagnostic immunoassay.
General Services Administration — This dataset offers the list of all .gov domains, including state, local, and tribal .gov domains. It does not include .mil domains, or other federal domains outside...
Yamamoto, Masanori; Takano, Masamichi; Okamatsu, Kentaro; Murakami, Daisuke; Inami, Shigenobu; Xie, Yong; Seimiya, Koji; Ohba, Takayoshi; Seino, Yoshihiko; Mizuno, Kyoichi
2009-03-01
Thin cap fibroatheroma (TCFA) is considered to be a vulnerable plaque. Virtual Histology-intravascular ultrasound (VH-IVUS) can precisely identify TCFA in vivo. Intense yellow plaque on angioscopy determined by quantitative colorimetry with L a b color space corresponds with histological TCFA; in particular, a plaque of color b value >23 indicates an atheroma with a fibrous cap thickness colorimetry was investigated. Fifty-seven culprit plaques in 57 patients were evaluated by VH-IVUS and angioscopy. VH-TCFA was defined as a plaque with a necrotic core >10% of plaque area without overlying fibrous tissue, and angioscopic TCFA was a plaque with b value >23. The frequency of angioscopic TCFA was higher in the VH-TCFA group than in the VH-non-TCFA group (74% vs 23%, P=0.0002). Moreover, yellow color intensity (b value) significantly correlated with plaque classification on VH-IVUS. When TCFA detected with angioscopy was used as the gold standard, the sensitivity, specificity, and accuracy for TCFA with VH-IVUS was 68%, 81%, and 75%, respectively. VH-TCFA strongly correlated with angioscopic TCFA determined by a quantitative analysis with colorimetry.
N-linked glycosylation of the immunoglobulin variable region
van de Bovenkamp, Fleur S.; Derksen, Ninotska I. L.; Ooijevaar-de Heer, Pleuni; van Schie, Karin A.; Kruithof, Simone; Berkowska, Magdalena A.; van der Schoot, C. Ellen; Ijspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E. M.; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S. Marieke; Vidarsson, Gestur; Rispens, Theo
2018-01-01
N-glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we
DEFF Research Database (Denmark)
Lee, D; Oh, E S; Woods, A
1998-01-01
Syndecan-4, a transmembrane heparan sulfate proteoglycan, is a coreceptor with integrins in cell adhesion. It has been suggested to form a ternary signaling complex with protein kinase Calpha and phosphatidylinositol 4,5-bisphosphate (PIP2). Syndecans each have a unique, central, and variable (V......) region in their cytoplasmic domains, and that of syndecan-4 is critical to its interaction with protein kinase C and PIP2. Two oligopeptides corresponding to the variable region (4V) and whole domain (4L) of syndecan-4 cytoplasmic domain were synthesized for nuclear magnetic resonance (NMR) studies. Data...... and dynamical simulated annealing calculations. The 4V peptide in the presence of PIP2 formed a compact dimer with two twisted strands packed parallel to each other and the exposed surface of the dimer consisted of highly charged and polar residues. The overall three-dimensional structure in solution exhibits...
Analysis and Prediction of Micromilling Stability with Variable Tool Geometry
Directory of Open Access Journals (Sweden)
Ziyang Cao
2014-11-01
Full Text Available Micromilling can fabricate miniaturized components using micro-end mill at high rotational speeds. The analysis of machining stability in micromilling plays an important role in characterizing the cutting process, estimating the tool life, and optimizing the process. A numerical analysis and experimental method are presented to investigate the chatter stability in micro-end milling process with variable milling tool geometry. The schematic model of micromilling process is constructed and the calculation formula to predict cutting force and displacements is derived. This is followed by a detailed numerical analysis on micromilling forces between helical ball and square end mills through time domain and frequency domain method and the results are compared. Furthermore, a detailed time domain simulation for micro end milling with straight teeth and helical teeth end mill is conducted based on the machine-tool system frequency response function obtained through modal experiment. The forces and displacements are predicted and the simulation result between variable cutter geometry is deeply compared. The simulation results have important significance for the actual milling process.
Recombinant norovirus-specific scFv inhibit virus-like particle binding to cellular ligands
Directory of Open Access Journals (Sweden)
Hardy Michele E
2008-01-01
Full Text Available Abstract Background Noroviruses cause epidemic outbreaks of gastrointestinal illness in all age-groups. The rapid onset and ease of person-to-person transmission suggest that inhibitors of the initial steps of virus binding to susceptible cells have value in limiting spread and outbreak persistence. We previously generated a monoclonal antibody (mAb 54.6 that blocks binding of recombinant norovirus-like particles (VLP to Caco-2 intestinal cells and inhibits VLP-mediated hemagglutination. In this study, we engineered the antigen binding domains of mAb 54.6 into a single chain variable fragment (scFv and tested whether these scFv could function as cell binding inhibitors, similar to the parent mAb. Results The scFv54.6 construct was engineered to encode the light (VL and heavy (VH variable domains of mAb 54.6 separated by a flexible peptide linker, and this recombinant protein was expressed in Pichia pastoris. Purified scFv54.6 recognized native VLPs by immunoblot, inhibited VLP-mediated hemagglutination, and blocked VLP binding to H carbohydrate antigen expressed on the surface of a CHO cell line stably transfected to express α 1,2-fucosyltransferase. Conclusion scFv54.6 retained the functional properties of the parent mAb with respect to inhibiting norovirus particle interactions with cells. With further engineering into a form deliverable to the gut mucosa, norovirus neutralizing antibodies represent a prophylactic strategy that would be valuable in outbreak settings.
Analytic regularity and collocation approximation for elliptic PDEs with random domain deformations
Castrillon, Julio; Nobile, Fabio; Tempone, Raul
2016-01-01
In this work we consider the problem of approximating the statistics of a given Quantity of Interest (QoI) that depends on the solution of a linear elliptic PDE defined over a random domain parameterized by N random variables. The elliptic problem
Variable Kernel Density Estimation
Terrell, George R.; Scott, David W.
1992-01-01
We investigate some of the possibilities for improvement of univariate and multivariate kernel density estimates by varying the window over the domain of estimation, pointwise and globally. Two general approaches are to vary the window width by the point of estimation and by point of the sample observation. The first possibility is shown to be of little efficacy in one variable. In particular, nearest-neighbor estimators in all versions perform poorly in one and two dimensions, but begin to b...
Wu, D D; Li, S H; Jin, L Y; Jin, Y; Cui, Y Y; Zhao, H; Liu, H J; Ma, X X; Su, W; Chen, H B
2016-04-05
To investigate the prevalence and influencing factors of visual hallucinations in patients with Parkinson's disease(PD), and to analyze the relationship between visual hallucinations and sleep disorders. We recruited 187 patients with PD(H-Y Ⅰ-Ⅲ) from outpatient department in Beijing Hospital. The patients were investigated for general information and the use of medicine. The patients were divided into visual hallucination(VH) group and non-hallucination(non-VH) group. A comparison study was conducted between two groups. We investigated the sleep disorders of PD patients according to Non Motor Symptom Quest(NMSquest) and Parkinson's disease sleep scale(PDSS). Logistic stepwise multiple regression procedures were used to determine the best predictive model of visual hallucinations in patients with PD. (1) 42 cases(22.5%) of PD patients were accompanied by visual hallucinations; (2) the VH group and non-VH group had no difference in age, sex, duration of illness, the scores of Minimum Mental State Examination(MMSE) and levodopa equivalent doses (LED). The scores of Unified Parkinson's Disease Rating Scale(UPDRS) Ⅰ, the Hamilton Rating Scale for Anxiety(HAMA) and the Hamilton Rating Scale for Depression(HAMD) in VH group were significantly higher than those in non-VH group[3.5(2, 5) vs 2 (1, 3); 10(6.75, 15) vs 8(5, 11); 11(7.75, 17) vs 9(5, 13); Psleep behavior disorder(RBD) in VH group were significantly higher than those in non-VH group(61.9% vs 40.7%, 71.4% vs 47.6%, P0.05). The score of PDSS in VH group was significantly lower than that in non-VH group[111(92.75, 128.25) vs 123(109, 135), Psleep disorder are independently associated with VH in PD.
Vishwanath, Sneha; de Brevern, Alexandre G; Srinivasan, Narayanaswamy
2018-02-01
The majority of the proteins encoded in the genomes of eukaryotes contain more than one domain. Reasons for high prevalence of multi-domain proteins in various organisms have been attributed to higher stability and functional and folding advantages over single-domain proteins. Despite these advantages, many proteins are composed of only one domain while their homologous domains are part of multi-domain proteins. In the study presented here, differences in the properties of protein domains in single-domain and multi-domain systems and their influence on functions are discussed. We studied 20 pairs of identical protein domains, which were crystallized in two forms (a) tethered to other proteins domains and (b) tethered to fewer protein domains than (a) or not tethered to any protein domain. Results suggest that tethering of domains in multi-domain proteins influences the structural, dynamic and energetic properties of the constituent protein domains. 50% of the protein domain pairs show significant structural deviations while 90% of the protein domain pairs show differences in dynamics and 12% of the residues show differences in the energetics. To gain further insights on the influence of tethering on the function of the domains, 4 pairs of homologous protein domains, where one of them is a full-length single-domain protein and the other protein domain is a part of a multi-domain protein, were studied. Analyses showed that identical and structurally equivalent functional residues show differential dynamics in homologous protein domains; though comparable dynamics between in-silico generated chimera protein and multi-domain proteins were observed. From these observations, the differences observed in the functions of homologous proteins could be attributed to the presence of tethered domain. Overall, we conclude that tethered domains in multi-domain proteins not only provide stability or folding advantages but also influence pathways resulting in differences in
Directory of Open Access Journals (Sweden)
Christoph Helma
2018-04-01
Full Text Available This study compares the accuracy of (QSAR/read-across predictions with the experimental variability of chronic lowest-observed-adverse-effect levels (LOAELs from in vivo experiments. We could demonstrate that predictions of the lazy structure-activity relationships (lazar algorithm within the applicability domain of the training data have the same variability as the experimental training data. Predictions with a lower similarity threshold (i.e., a larger distance from the applicability domain are also significantly better than random guessing, but the errors to be expected are higher and a manual inspection of prediction results is highly recommended.
Social Information-Processing Patterns of Maltreated Children in Two Social Domains
Keil, Vivien; Price, Joseph M.
2009-01-01
This study examined relations among social information-processing (SIP) variables in the domains of peer provocation and peer group entry. Using Crick and Dodge's [Crick, N. R., & Dodge, K. A. (1994). "A review and reformulation of social information-processing mechanisms in children's social adjustment." "Psychological Bulletin," 115, 74-101]…
Xiuyuan, Zhang; Zhihong, Huang; Lixia, Wang; Xiaonan, Liu
2015-05-01
Carbaryl is a low molecular weight insecticide that inhibits cholinesterase. Residues of carbaryl in food and the environment have damaged human health. A high-specificity scFv that can identify carbaryl is still lacking. In the present study, an anti-carbaryl scFv gene was prepared by cloning VL and VH genes from hybridoma cells secreting monoclonal antibody, then VH and VL were fused together using splicing by overlap extension (SOE) PCR with a flexible polypeptide linker connector (Gly4Ser)3, and then the scFv-pET-26b recombinant plasmid was constructed and transformed into E. coli BL21 for expression using IPTG as an inducer. The expressed recombinant protein was identified by SDS-PAGE and ELISA. The three-dimensional structure of the anti-carbaryl scFv was constructed by computer modeling, and carbaryl was docked to the scFv model to obtain the structure of the binding complex. The binding site was composed of Ala51, Ser52, Ile51, Gly54, Ser56, Arg98, and Gly100. This helps to understand the mechanism of interaction between anti-carbaryl antibody and antigen. Furthermore, it provides guidance for in vitro affinity maturation of anti-carbaryl antibody.
Accumulating Data to Optimally Predict Obesity Treatment (ADOPT) Core Measures: Behavioral Domain.
Lytle, Leslie A; Nicastro, Holly L; Roberts, Susan B; Evans, Mary; Jakicic, John M; Laposky, Aaron D; Loria, Catherine M
2018-04-01
The ability to identify and measure behaviors that are related to weight loss and the prevention of weight regain is crucial to understanding the variability in response to obesity treatment and the development of tailored treatments. The overarching goal of the Accumulating Data to Optimally Predict obesity Treatment (ADOPT) Core Measures Project is to provide obesity researchers with guidance on a set of constructs and measures that are related to weight control and that span and integrate obesity-related behavioral, biological, environmental, and psychosocial domains. This article describes how the behavioral domain subgroup identified the initial list of high-priority constructs and measures to be included, and it describes practical considerations for assessing the following four behavioral areas: eating, activity, sleep, and self-monitoring of weight. Challenges and considerations for advancing the science related to weight loss and maintenance behaviors are also discussed. Assessing a set of core behavioral measures in combination with those from other ADOPT domains is critical to improve our understanding of individual variability in response to adult obesity treatment. The selection of behavioral measures is based on the current science, although there continues to be much work needed in this field. © 2018 The Obesity Society.
Sensitivity of simulated regional Arctic climate to the choice of coupled model domain
Directory of Open Access Journals (Sweden)
Dmitry V. Sein
2014-07-01
Full Text Available The climate over the Arctic has undergone changes in recent decades. In order to evaluate the coupled response of the Arctic system to external and internal forcing, our study focuses on the estimation of regional climate variability and its dependence on large-scale atmospheric and regional ocean circulations. A global ocean–sea ice model with regionally high horizontal resolution is coupled to an atmospheric regional model and global terrestrial hydrology model. This way of coupling divides the global ocean model setup into two different domains: one coupled, where the ocean and the atmosphere are interacting, and one uncoupled, where the ocean model is driven by prescribed atmospheric forcing and runs in a so-called stand-alone mode. Therefore, selecting a specific area for the regional atmosphere implies that the ocean–atmosphere system can develop ‘freely’ in that area, whereas for the rest of the global ocean, the circulation is driven by prescribed atmospheric forcing without any feedbacks. Five different coupled setups are chosen for ensemble simulations. The choice of the coupled domains was done to estimate the influences of the Subtropical Atlantic, Eurasian and North Pacific regions on northern North Atlantic and Arctic climate. Our simulations show that the regional coupled ocean–atmosphere model is sensitive to the choice of the modelled area. The different model configurations reproduce differently both the mean climate and its variability. Only two out of five model setups were able to reproduce the Arctic climate as observed under recent climate conditions (ERA-40 Reanalysis. Evidence is found that the main source of uncertainty for Arctic climate variability and its predictability is the North Pacific. The prescription of North Pacific conditions in the regional model leads to significant correlation with observations, even if the whole North Atlantic is within the coupled model domain. However, the inclusion of the
Gender differences of heart rate variability in healthy volunteers
International Nuclear Information System (INIS)
Saleem, S.; Majeed, S.M.I.; Khan, M.A.
2012-01-01
Objective: To identify the basic values of heart rate variability in Pakistani population and to verify our hypothesis that there are gender differences in cardiovascular autonomic modulation. Methods: The descriptive cross sectional study based on convenience probability sampling was conducted at Armed Forces Institute of Cardiology/National Institute of Heart Diseases (AFIC/NIHD) Pakistan. The duration of the study was from December 2009 to July 2010. It involved 24-hour holter monitoring of 45 healthy individuals using holter electrocardiography (ECG) recorder. Heart rate variability was analysed in time (SDNN, SDANN, SDNNi, rMSSD, pNN50) and frequency domains (power, VLF, LF, and HF). Results: The time domain indices; SDNN (male=140 +- 36 ms vs. females=122 +- 33 ms; p =0.09), SDANN (male=123 +- 34 ms vs. females=111+- 34 ms; P= 0.23), SDNNi (male=64 +-19 ms vs. females=52 +- 14 ms; P= 0.03), and pNN50 (male=14 +- 10 ms vs. females=12 +- 7 ms; P= 0.43) were decreased in female volunteers when compared with males. Comparison of frequency domain indices; Total power (male=4041 +- 3150 ms/sup 2/ vs. females=2750 +- 1439 ms/sup 2/; P= 0.07), VLF (male=291 2675 ms/sup 2/ vs. females=1843 +- 928 ms/sup 2/; P= 0.06), LF (male=788 +- 397 ms/sup 2/ vs. females=556 +- 346 ms/sup 2/; P= 0.04) and HF (male=318 +- 251 ms/sup 2/ vs. females=31 277 ms/sup 2/; P= 0.94) amongst males and females showed attenuated heart rate variability in females. Of all the observed values, SDNNi and LF were found significantly (p <0.05) decreased in women. Conclusion: In healthy population, heart rate variability is low in women than men. It reflects sympathetic dominance in women in our population. (author)
Time Domain Partitioning of Electricity Production Cost Simulations
Energy Technology Data Exchange (ETDEWEB)
Barrows, C. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hummon, M. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Jones, W. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hale, E. [National Renewable Energy Lab. (NREL), Golden, CO (United States)
2014-01-01
Production cost models are often used for planning by simulating power system operations over long time horizons. The simulation of a day-ahead energy market can take several weeks to compute. Tractability improvements are often made through model simplifications, such as: reductions in transmission modeling detail, relaxation of commitment variable integrality, reductions in cost modeling detail, etc. One common simplification is to partition the simulation horizon so that weekly or monthly horizons can be simulated in parallel. However, horizon partitions are often executed with overlap periods of arbitrary and sometimes zero length. We calculate the time domain persistence of historical unit commitment decisions to inform time domain partitioning of production cost models. The results are implemented using PLEXOS production cost modeling software in an HPC environment to improve the computation time of simulations while maintaining solution integrity.
The critical domain size of stochastic population models.
Reimer, Jody R; Bonsall, Michael B; Maini, Philip K
2017-02-01
Identifying the critical domain size necessary for a population to persist is an important question in ecology. Both demographic and environmental stochasticity impact a population's ability to persist. Here we explore ways of including this variability. We study populations with distinct dispersal and sedentary stages, which have traditionally been modelled using a deterministic integrodifference equation (IDE) framework. Individual-based models (IBMs) are the most intuitive stochastic analogues to IDEs but yield few analytic insights. We explore two alternate approaches; one is a scaling up to the population level using the Central Limit Theorem, and the other a variation on both Galton-Watson branching processes and branching processes in random environments. These branching process models closely approximate the IBM and yield insight into the factors determining the critical domain size for a given population subject to stochasticity.
Testing for Granger Causality in the Frequency Domain: A Phase Resampling Method.
Liu, Siwei; Molenaar, Peter
2016-01-01
This article introduces phase resampling, an existing but rarely used surrogate data method for making statistical inferences of Granger causality in frequency domain time series analysis. Granger causality testing is essential for establishing causal relations among variables in multivariate dynamic processes. However, testing for Granger causality in the frequency domain is challenging due to the nonlinear relation between frequency domain measures (e.g., partial directed coherence, generalized partial directed coherence) and time domain data. Through a simulation study, we demonstrate that phase resampling is a general and robust method for making statistical inferences even with short time series. With Gaussian data, phase resampling yields satisfactory type I and type II error rates in all but one condition we examine: when a small effect size is combined with an insufficient number of data points. Violations of normality lead to slightly higher error rates but are mostly within acceptable ranges. We illustrate the utility of phase resampling with two empirical examples involving multivariate electroencephalography (EEG) and skin conductance data.
Kirshner, Julia; Thulien, Kyle J; Kriangkum, Jitra; Motz, Sarah; Belch, Andrew R; Pilarski, Linda M
2011-02-01
A small percentage of cases of Waldenstrom macroglobulinemia (WM) present with biclonality, defined here as the rearrangement of two distinct VDJ gene segments. Here we investigated the expansion of two clones from a patient with WM expressing molecularly detectable clonotypic gene rearrangements, one V(H)3 and one V(H)4. Biclonality was determined in blood and bone marrow mononuclear cells using real-time quantitative PCR (RQ-PCR). V(H)4 expressing cells but not V(H)3 expressing cells underwent clonal expansion in 3-D culture of reconstructed WM bone marrow. After 3-D culture, secondary culture in a colony forming unit assay, and RQ-PCR, only the V(H)4 clone was shown to harbor a subpopulation with characteristics of cancer stem cells, including proliferative quiescence, self-regeneration, and the ability to generate clonotypic progeny, suggesting that the V(H)4, but not the V(H)3, clone is clinically significant. Enrichment of potential WM stem cells in 3-D cultures holds promise for monitoring their response to treatment and for testing new therapies.
Optimal Control of Heterogeneous Systems with Endogenous Domain of Heterogeneity
International Nuclear Information System (INIS)
Belyakov, Anton O.; Tsachev, Tsvetomir; Veliov, Vladimir M.
2011-01-01
The paper deals with optimal control of heterogeneous systems, that is, families of controlled ODEs parameterized by a parameter running over a domain called domain of heterogeneity. The main novelty in the paper is that the domain of heterogeneity is endogenous: it may depend on the control and on the state of the system. This extension is crucial for several economic applications and turns out to rise interesting mathematical problems. A necessary optimality condition is derived, where one of the adjoint variables satisfies a differential inclusion (instead of equation) and the maximization of the Hamiltonian takes the form of “min-max”. As a consequence, a Pontryagin-type maximum principle is obtained under certain regularity conditions for the optimal control. A formula for the derivative of the objective function with respect to the control from L ∞ is presented together with a sufficient condition for its existence. A stylized economic example is investigated analytically and numerically.
Smart platform for the time since death determination from vitreous humor cystine.
Ansari, Niha; Lodha, Anand; Menon, Shobhana K
2016-12-15
In this work, we report the smart application of AgNPs based sensors for determination of time since death (TSD) via recognition and quantification of vitreous humor (VH) cystine as well as provide the portability for on spot determination of TSD. The lower detection limit was found to be 7.0ng/ml with prominent selectivity. It was found that there is a linear correlation between the VH cystine concentration and TSD as the concentration of cystine increases up to 96h±3.9h. Further for the first time TSD determination is given a smart approach and it proves to have a great utility up to 24h±2.6h. The linear regression equation between TSD (the dependent variable), RGB intensity of cystine concentration till 24h (the independent variable) was found to be TSD=26.69+-0.05*x. The proposed method gives the smart detection, portability, rapidity, sensitivity, selectivity as well as cost effectiveness for determination of time since death. Copyright © 2016 Elsevier B.V. All rights reserved.
Quality Assurance in the Presence of Variability
Lauenroth, Kim; Metzger, Andreas; Pohl, Klaus
Software Product Line Engineering (SPLE) is a reuse-driven development paradigm that has been applied successfully in information system engineering and other domains. Quality assurance of the reusable artifacts of the product line (e.g. requirements, design, and code artifacts) is essential for successful product line engineering. As those artifacts are reused in several products, a defect in a reusable artifact can affect several products of the product line. A central challenge for quality assurance in product line engineering is how to consider product line variability. Since the reusable artifacts contain variability, quality assurance techniques from single-system engineering cannot directly be applied to those artifacts. Therefore, different strategies and techniques have been developed for quality assurance in the presence of variability. In this chapter, we describe those strategies and discuss in more detail one of those strategies, the so called comprehensive strategy. The comprehensive strategy aims at checking the quality of all possible products of the product line and thus offers the highest benefits, since it is able to uncover defects in all possible products of the product line. However, the central challenge for applying the comprehensive strategy is the complexity that results from the product line variability and the large number of potential products of a product line. In this chapter, we present one concrete technique that we have developed to implement the comprehensive strategy that addresses this challenge. The technique is based on model checking technology and allows for a comprehensive verification of domain artifacts against temporal logic properties.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHD492 (Link to dictyBase) - - - Contig-U15308-1 - (Link to Original site) - - VHD492...Z 675 - - - - Show VHD492 Library VH (Link to library) Clone ID VHD492 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHD4-D/VHD492Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492Q.Seq.d/ XXXXXXXXXXCTTCATC...xkiipink Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492
Botulinum Neurotoxins and Botulism: A Novel Therapeutic Approach
Directory of Open Access Journals (Sweden)
Wanpen Chaicumpa
2011-05-01
Full Text Available Specific treatment is not available for human botulism. Current remedial mainstay is the passive administration of polyclonal antibody to botulinum neurotoxin (BoNT derived from heterologous species (immunized animal or mouse hybridoma together with supportive and symptomatic management. The antibody works extracellularly, probably by blocking the binding of receptor binding (R domain to the neuronal receptors; thus inhibiting cellular entry of the holo-BoNT. The antibody cannot neutralize the intracellular toxin. Moreover, a conventional antibody with relatively large molecular size (150 kDa is not accessible to the enzymatic groove and, thus, cannot directly inhibit the BoNT zinc metalloprotease activity. Recently, a 15–20 kDa single domain antibody (VHH that binds specifically to light chain of BoNT serotype A was produced from a humanized-camel VH/VHH phage display library. The VHH has high sequence homology (>80% to the human VH and could block the enzymatic activity of the BoNT. Molecular docking revealed not only the interface binding between the VHH and the toxin but also an insertion of the VHH CDR3 into the toxin enzymatic pocket. It is envisaged that, by molecular linking the VHH to a cell penetrating peptide (CPP, the CPP-VHH fusion protein would be able to traverse the hydrophobic cell membrane into the cytoplasm and inhibit the intracellular BoNT. This presents a novel and safe immunotherapeutic strategy for botulism by using a cell penetrating, humanized-single domain antibody that inhibits the BoNT by means of a direct blockade of the groove of the menace enzyme.
Bjørner, Dines
Before software can be designed we must know its requirements. Before requirements can be expressed we must understand the domain. So it follows, from our dogma, that we must first establish precise descriptions of domains; then, from such descriptions, “derive” at least domain and interface requirements; and from those and machine requirements design the software, or, more generally, the computing systems.
Single-Domain Antibodies As Versatile Affinity Reagents for Analytical and Diagnostic Applications
Directory of Open Access Journals (Sweden)
Gualberto Gonzalez-Sapienza
2017-08-01
Full Text Available With just three CDRs in their variable domains, the antigen-binding site of camelid heavy-chain-only antibodies (HcAbs has a more limited structural diversity than that of conventional antibodies. Even so, this does not seem to limit their specificity and high affinity as HcAbs against a broad range of structurally diverse antigens have been reported. The recombinant form of their variable domain [nanobody (Nb] has outstanding properties that make Nbs, not just an alternative option to conventional antibodies, but in many cases, these properties allow them to reach analytical or diagnostic performances that cannot be accomplished with conventional antibodies. These attributes include comprehensive representation of the immune specificity in display libraries, easy adaptation to high-throughput screening, exceptional stability, minimal size, and versatility as affinity building block. Here, we critically reviewed each of these properties and highlight their relevance with regard to recent developments in different fields of immunosensing applications.
Comparison of learning models based on mathematics logical intelligence in affective domain
Widayanto, Arif; Pratiwi, Hasih; Mardiyana
2018-04-01
The purpose of this study was to examine the presence or absence of different effects of multiple treatments (used learning models and logical-mathematical intelligence) on the dependent variable (affective domain of mathematics). This research was quasi experimental using 3x3 of factorial design. The population of this research was VIII grade students of junior high school in Karanganyar under the academic year 2017/2018. Data collected in this research was analyzed by two ways analysis of variance with unequal cells using 5% of significance level. The result of the research were as follows: (1) Teaching and learning with model TS lead to better achievement in affective domain than QSH, teaching and learning with model QSH lead to better achievement in affective domain than using DI; (2) Students with high mathematics logical intelligence have better achievement in affective domain than students with low mathematics logical intelligence have; (3) In teaching and learning mathematics using learning model TS, students with moderate mathematics logical intelligence have better achievement in affective domain than using DI; and (4) In teaching and learning mathematics using learning model TS, students with low mathematics logical intelligence have better achievement in affective domain than using QSH and DI.
Alpha-contingent EEG feedback reduces SPECT rCBF variability
DEFF Research Database (Denmark)
McLaughlin, Thomas; Steinberg, Bruce; Mulholland, Thomas
2005-01-01
EEG feedback methods, which link the occurrence of alpha to the presentation of repeated visual stimuli, reduce the relative variability of subsequent, alpha-blocking event durations. The temporal association between electro-cortical field activation and regional cerebral blood flow (rCBF) led us...... to investigate whether the reduced variability of alpha-blocking durations with feedback is associated with a reduction in rCBF variability. Reduced variability in the rCBF response domain under EEG feedback control might have methodological implications for future brain-imaging studies. Visual stimuli were...... to quantify the variance-reducing effects of ACS across multiple, distributed areas of the brain. Both EEG and rCBF measures demonstrated decreased variability under ACS. This improved control was seen for localized as well as anatomically distributed rCBF measures....
Domain decomposition method for solving elliptic problems in unbounded domains
International Nuclear Information System (INIS)
Khoromskij, B.N.; Mazurkevich, G.E.; Zhidkov, E.P.
1991-01-01
Computational aspects of the box domain decomposition (DD) method for solving boundary value problems in an unbounded domain are discussed. A new variant of the DD-method for elliptic problems in unbounded domains is suggested. It is based on the partitioning of an unbounded domain adapted to the given asymptotic decay of an unknown function at infinity. The comparison of computational expenditures is given for boundary integral method and the suggested DD-algorithm. 29 refs.; 2 figs.; 2 tabs
Heart rate variability in newborns.
Javorka, K; Lehotska, Z; Kozar, M; Uhrikova, Z; Kolarovszki, B; Javorka, M; Zibolen, M
2017-09-22
Heart rate (HR) and heart rate variability (HRV) in newborns is influenced by genetic determinants, gestational and postnatal age, and other variables. Premature infants have a reduced HRV. In neonatal HRV evaluated by spectral analysis, a dominant activity can be found in low frequency (LF) band (combined parasympathetic and sympathetic component). During the first postnatal days the activity in the high frequency (HF) band (parasympathetic component) rises, together with an increase in LF band and total HRV. Hypotrophy in newborn can cause less mature autonomic cardiac control with a higher contribution of sympathetic activity to HRV as demonstrated by sequence plot analysis. During quiet sleep (QS) in newborns HF oscillations increase - a phenomenon less expressed or missing in premature infants. In active sleep (AS), HRV is enhanced in contrast to reduced activity in HF band due to the rise of spectral activity in LF band. Comparison of the HR and HRV in newborns born by physiological vaginal delivery, without (VD) and with epidural anesthesia (EDA) and via sectio cesarea (SC) showed no significant differences in HR and in HRV time domain parameters. Analysis in the frequency domain revealed, that the lowest sympathetic activity in chronotropic cardiac chronotropic regulation is in the VD group. Different neonatal pathological states can be associated with a reduction of HRV and an improvement in the health conditions is followed by changes in HRV what can be use as a possible prognostic marker. Examination of heart rate variability in neonatology can provide information on the maturity of the cardiac chronotropic regulation in early postnatal life, on postnatal adaptation and in pathological conditions about the potential dysregulation of cardiac function in newborns, especially in preterm infants.
Directory of Open Access Journals (Sweden)
Yew Margaret
2007-03-01
Full Text Available Abstract Background Natural antibodies directed at carbohydrates reject porcine xenografts. They are initially expressed in germline configuration and are encoded by a small number of structurally-related germline progenitors. The transplantation of genetically-modified pig organs prevents hyperacute rejection, but delayed graft rejection still occurs, partly due to humoral responses. IgVH genes encoding induced xenoantibodies are predominantly, not exclusively, derived from germline progenitors in the VH3 family. We have previously identified the immunoglobulin heavy chain genes encoding VH3 xenoantibodies in patients and primates. In this manuscript, we complete the structural analysis of induced xenoantibodies by identifying the IgVH genes encoding the small proportion of VH4 xenoantibodies and the germline progenitors encoding xenoantibody light chains. This information has been used to define the xenoantibody/carbohydrate binding site using computer-simulated modeling. Results The VH4-59 gene encodes antibodies in the VH4 family that are induced in human patients mounting active xenoantibody responses. The light chain of xenoantibodies is encoded by DPK5 and HSIGKV134. The structural information obtained by sequencing analysis was used to create computer-simulated models. Key contact sites for xenoantibody/carbohydrate interaction for VH3 family xenoantibodies include amino acids in sites 31, 33, 50, 57, 58 and the CDR3 region of the IgVH gene. Site-directed mutagenesis indicates that mutations in predicted contact sites alter binding to carbohydrate xenoantigens. Computer-simulated modeling suggests that the CDR3 region directly influences binding. Conclusion Xenoantibodies induced during early and delayed xenograft responses are predominantly encoded by genes in the VH3 family, with a small proportion encoded by VH4 germline progenitors. This restricted group can be identified by the unique canonical structure of the light chain, heavy
Time and frequency domain analyses of the Hualien Large-Scale Seismic Test
International Nuclear Information System (INIS)
Kabanda, John; Kwon, Oh-Sung; Kwon, Gunup
2015-01-01
Highlights: • Time- and frequency-domain analysis methods are verified against each other. • The two analysis methods are validated against Hualien LSST. • The nonlinear time domain (NLTD) analysis resulted in more realistic response. • The frequency domain (FD) analysis shows amplification at resonant frequencies. • The NLTD analysis requires significant modeling and computing time. - Abstract: In the nuclear industry, the equivalent-linear frequency domain analysis method has been the de facto standard procedure primarily due to the method's computational efficiency. This study explores the feasibility of applying the nonlinear time domain analysis method for the soil–structure-interaction analysis of nuclear power facilities. As a first step, the equivalency of the time and frequency domain analysis methods is verified through a site response analysis of one-dimensional soil, a dynamic impedance analysis of soil–foundation system, and a seismic response analysis of the entire soil–structure system. For the verifications, an idealized elastic soil–structure system is used to minimize variables in the comparison of the two methods. Then, the verified analysis methods are used to develop time and frequency domain models of Hualien Large-Scale Seismic Test. The predicted structural responses are compared against field measurements. The models are also analyzed with an amplified ground motion to evaluate discrepancies of the time and frequency domain analysis methods when the soil–structure system behaves beyond the elastic range. The analysis results show that the equivalent-linear frequency domain analysis method amplifies certain frequency bands and tends to result in higher structural acceleration than the nonlinear time domain analysis method. A comparison with field measurements shows that the nonlinear time domain analysis method better captures the frequency distribution of recorded structural responses than the frequency domain
Energy Technology Data Exchange (ETDEWEB)
Liu, J S [School of Materials Science and Engineering, Southwest University of Science and Technology, Mianyang City (China); Zeng, H Z [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Kholkin, A L [Department of Ceramic and Glass Engineering and CICECO, University of Aveiro, Aveiro 3810-193 (Portugal)
2007-11-21
Ferroelectric domains have been investigated on the cross-section of Pb(Zr{sub 0.55}Ti{sub 0.45})O{sub 3} (PZT) thin film capacitors by scanning probe microscopy. The static domain images on the cross-section were obtained by the lateral piezoresponse force microscopy (LPFM) method, in which the ac voltage used to induce the converse piezoelectric effect was applied between the conductive tip and the bottom electrode. The polarization component normal to the substrate could be characterized via both d{sub 33} and d{sub 15} piezoelectric coefficients, which resulted in a high resolution of LPFM images. After a variable dc bias was applied between the top and the bottom electrodes, the variations of domain image on the cross-section were recorded by the LPFM immediately. Upon the application of low bias, new domain sites appeared near the PZT/Pt interface opposite to the initial polarization. Forward stretch of new domains was facilitated under the dc field approaching the coercive field E{sub c}. Under a very high field (about three times of the E{sub c}), the sidewise expansion of columnar domains was observed. However, the domains were only partially switched even though a very high field was applied. The observed domain growth process indicated a lower energy barrier for nucleation compared with that of domain wall motion. Possible reasons for the incomplete switching are the substantial influences of the interface and depolarization in thin film capacitors.
Matheron, Eric; Kapoula, Zoï
2015-01-01
Vertical heterophoria (VH) is the latent vertical misalignment of the eyes when the retinal images are dissociated, vertical orthophoria (VO) when there is no misalignment. Studies on postural control, during binocular vision in upright stance, reported that healthy subjects with small VH vs. VO are less stable, but the experimental cancellation of VH with an appropriate prism improves postural stability. The same behavior was recorded in nonspecific chronic back pain subjects, all with VH. It was hypothesized that, without refraction problems, VH indicates a perturbation of the somaesthetic cues required in the sensorimotor loops involved in postural control and the capacity of the CNS to optimally integrate these cues, suggesting prevention possibilities. Sensorimotor conflict can induce pain and modify sensory perception in some healthy subjects; some nonspecific pain or chronic pain could result from such prolonged conflict in which VH could be a sign, with new theoretical and clinical implications.
The SHOCT domain: a widespread domain under-represented in model organisms.
Directory of Open Access Journals (Sweden)
Ruth Y Eberhardt
Full Text Available We have identified a new protein domain, which we have named the SHOCT domain (Short C-terminal domain. This domain is widespread in bacteria with over a thousand examples. But we found it is missing from the most commonly studied model organisms, despite being present in closely related species. It's predominantly C-terminal location, co-occurrence with numerous other domains and short size is reminiscent of the Gram-positive anchor motif, however it is present in a much wider range of species. We suggest several hypotheses about the function of SHOCT, including oligomerisation and nucleic acid binding. Our initial experiments do not support its role as an oligomerisation domain.
Directory of Open Access Journals (Sweden)
Mehdi Granhemat
2017-04-01
Full Text Available This study examined the relationships between gender, ethnicity, ethnic identity, and language choices of Malaysian multilingual youths in the family domain of language use. Five hundred undergraduate students who belonged to different Malaysian ethnic groups were selected as participants of the study. The participant aged between 17 to 25 years old. To select the participants, a random proportional stratified sampling strategy was developed. A self administered questionnaire survey comprising three sections was used for gathering information about participants’ demographic profiles, their language choices in the family domain, and the concepts of their ethnic identity. To make analyses about the most used languages of the participants and the relationships between variables, SPSS software was run. Descriptive statistics was used to describe the participants’ profiles as well as participants’ used languages in the family domain of language use. Inferential statistics was used to examine relationships between variables. According to results of the study, in the family domain five codes were mostly used by the participants. These five codes were respectively, the Malay language, mixed use of Malay and English, Chinese, Mixed use of Chinese and English, and English. Furthermore, in the family domain, gender did not exert any influence on the choice of language of the multilingual participants, but ethnicity was found to be a determinant of language choice. Ethnic identity was found to influence the language choices of the Malays as well, but it did not affect the Chinese and Indian participants’ language choices in this domain of language use.
Domain-to-domain coupling in voltage-sensing phosphatase.
Sakata, Souhei; Matsuda, Makoto; Kawanabe, Akira; Okamura, Yasushi
2017-01-01
Voltage-sensing phosphatase (VSP) consists of a transmembrane voltage sensor and a cytoplasmic enzyme region. The enzyme region contains the phosphatase and C2 domains, is structurally similar to the tumor suppressor phosphatase PTEN, and catalyzes the dephosphorylation of phosphoinositides. The transmembrane voltage sensor is connected to the phosphatase through a short linker region, and phosphatase activity is induced upon membrane depolarization. Although the detailed molecular characteristics of the voltage sensor domain and the enzyme region have been revealed, little is known how these two regions are coupled. In addition, it is important to know whether mechanism for coupling between the voltage sensor domain and downstream effector function is shared among other voltage sensor domain-containing proteins. Recent studies in which specific amino acid sites were genetically labeled using a fluorescent unnatural amino acid have enabled detection of the local structural changes in the cytoplasmic region of Ciona intestinalis VSP that occur with a change in membrane potential. The results of those studies provide novel insight into how the enzyme activity of the cytoplasmic region of VSP is regulated by the voltage sensor domain.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK246 (Link to dictyBase) - - - Contig-U16440-1 VHK246P (Link to Original site) VHK2...46F 617 VHK246Z 760 VHK246P 1357 - - Show VHK246 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-B/VHK246Q.Seq.d/ Representative seq. ID VHK2...46P (Link to Original site) Representative DNA sequence >VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2
MIT domain of Vps4 is a Ca2+-dependent phosphoinositide-binding domain.
Iwaya, Naoko; Takasu, Hirotoshi; Goda, Natsuko; Shirakawa, Masahiro; Tanaka, Toshiki; Hamada, Daizo; Hiroaki, Hidekazu
2013-05-01
The microtubule interacting and trafficking (MIT) domain is a small protein module that is conserved in proteins of diverged function, such as Vps4, spastin and sorting nexin 15 (SNX15). The molecular function of the MIT domain is protein-protein interaction, in which the domain recognizes peptides containing MIT-interacting motifs. Recently, we identified an evolutionarily related domain, 'variant' MIT domain at the N-terminal region of the microtubule severing enzyme katanin p60. We found that the domain was responsible for binding to microtubules and Ca(2+). Here, we have examined whether the authentic MIT domains also bind Ca(2+). We found that the loop between the first and second α-helices of the MIT domain binds a Ca(2+) ion. Furthermore, the MIT domains derived from Vps4b and SNX15a showed phosphoinositide-binding activities in a Ca(2+)-dependent manner. We propose that the MIT domain is a novel membrane-associating domain involved in endosomal trafficking.
A Cartesian Grid Embedded Boundary Method for Poisson's Equation on Irregular Domains
Johansen, Hans; Colella, Phillip
1998-11-01
We present a numerical method for solving Poisson's equation, with variable coefficients and Dirichlet boundary conditions, on two-dimensional regions. The approach uses a finite-volume discretization, which embeds the domain in a regular Cartesian grid. We treat the solution as a cell-centered quantity, even when those centers are outside the domain. Cells that contain a portion of the domain boundary use conservative differencing of second-order accurate fluxes on each cell volume. The calculation of the boundary flux ensures that the conditioning of the matrix is relatively unaffected by small cell volumes. This allows us to use multigrid iterations with a simple point relaxation strategy. We have combined this with an adaptive mesh refinement (AMR) procedure. We provide evidence that the algorithm is second-order accurate on various exact solutions and compare the adaptive and nonadaptive calculations.
Conversion of Dielectric Data from the Time Domain to the Frequency Domain
Directory of Open Access Journals (Sweden)
Vladimir Durman
2005-01-01
Full Text Available Polarisation and conduction processes in dielectric systems can be identified by the time domain or the frequency domain measurements. If the systems is a linear one, the results of the time domain measurements can be transformed into the frequency domain, and vice versa. Commonly, the time domain data of the absorption conductivity are transformed into the frequency domain data of the dielectric susceptibility. In practice, the relaxation are mainly evaluated by the frequency domain data. In the time domain, the absorption current measurement were prefered up to now. Recent methods are based on the recovery voltage measurements. In this paper a new method of the recovery data conversion from the time the frequency domain is proposed. The method is based on the analysis of the recovery voltage transient based on the Maxwell equation for the current density in a dielectric. Unlike the previous published solutions, the Laplace fransform was used to derive a formula suitable for practical purposes. the proposed procedure allows also calculating of the insulation resistance and separating the polarisation and conduction losses.
Predicting detection performance with model observers: Fourier domain or spatial domain?
Chen, Baiyu; Yu, Lifeng; Leng, Shuai; Kofler, James; Favazza, Christopher; Vrieze, Thomas; McCollough, Cynthia
2016-02-27
The use of Fourier domain model observer is challenged by iterative reconstruction (IR), because IR algorithms are nonlinear and IR images have noise texture different from that of FBP. A modified Fourier domain model observer, which incorporates nonlinear noise and resolution properties, has been proposed for IR and needs to be validated with human detection performance. On the other hand, the spatial domain model observer is theoretically applicable to IR, but more computationally intensive than the Fourier domain method. The purpose of this study is to compare the modified Fourier domain model observer to the spatial domain model observer with both FBP and IR images, using human detection performance as the gold standard. A phantom with inserts of various low contrast levels and sizes was repeatedly scanned 100 times on a third-generation, dual-source CT scanner at 5 dose levels and reconstructed using FBP and IR algorithms. The human detection performance of the inserts was measured via a 2-alternative-forced-choice (2AFC) test. In addition, two model observer performances were calculated, including a Fourier domain non-prewhitening model observer and a spatial domain channelized Hotelling observer. The performance of these two mode observers was compared in terms of how well they correlated with human observer performance. Our results demonstrated that the spatial domain model observer correlated well with human observers across various dose levels, object contrast levels, and object sizes. The Fourier domain observer correlated well with human observers using FBP images, but overestimated the detection performance using IR images.
An Overview of Heart Rate Variability Metrics and Norms
Directory of Open Access Journals (Sweden)
Fred Shaffer
2017-09-01
Full Text Available Healthy biological systems exhibit complex patterns of variability that can be described by mathematical chaos. Heart rate variability (HRV consists of changes in the time intervals between consecutive heartbeats called interbeat intervals (IBIs. A healthy heart is not a metronome. The oscillations of a healthy heart are complex and constantly changing, which allow the cardiovascular system to rapidly adjust to sudden physical and psychological challenges to homeostasis. This article briefly reviews current perspectives on the mechanisms that generate 24 h, short-term (~5 min, and ultra-short-term (<5 min HRV, the importance of HRV, and its implications for health and performance. The authors provide an overview of widely-used HRV time-domain, frequency-domain, and non-linear metrics. Time-domain indices quantify the amount of HRV observed during monitoring periods that may range from ~2 min to 24 h. Frequency-domain values calculate the absolute or relative amount of signal energy within component bands. Non-linear measurements quantify the unpredictability and complexity of a series of IBIs. The authors survey published normative values for clinical, healthy, and optimal performance populations. They stress the importance of measurement context, including recording period length, subject age, and sex, on baseline HRV values. They caution that 24 h, short-term, and ultra-short-term normative values are not interchangeable. They encourage professionals to supplement published norms with findings from their own specialized populations. Finally, the authors provide an overview of HRV assessment strategies for clinical and optimal performance interventions.
Heart rate variability - a historical perspective.
Billman, George E
2011-01-01
Heart rate variability (HRV), the beat-to-beat variation in either heart rate or the duration of the R-R interval - the heart period, has become a popular clinical and investigational tool. The temporal fluctuations in heart rate exhibit a marked synchrony with respiration (increasing during inspiration and decreasing during expiration - the so called respiratory sinus arrhythmia, RSA) and are widely believed to reflect changes in cardiac autonomic regulation. Although the exact contributions of the parasympathetic and the sympathetic divisions of the autonomic nervous system to this variability are controversial and remain the subject of active investigation and debate, a number of time and frequency domain techniques have been developed to provide insight into cardiac autonomic regulation in both health and disease. It is the purpose of this essay to provide an historical overview of the evolution in the concept of HRV. Briefly, pulse rate was first measured by ancient Greek physicians and scientists. However, it was not until the invention of the "Physician's Pulse Watch" (a watch with a second hand that could be stopped) in 1707 that changes in pulse rate could be accurately assessed. The Rev. Stephen Hales (1733) was the first to note that pulse varied with respiration and in 1847 Carl Ludwig was the first to record RSA. With the measurement of the ECG (1895) and advent of digital signal processing techniques in the 1960s, investigation of HRV and its relationship to health and disease has exploded. This essay will conclude with a brief description of time domain, frequency domain, and non-linear dynamic analysis techniques (and their limitations) that are commonly used to measure HRV.
Characterizing Functional Domains for TIM-Mediated Enveloped Virus Entry
Moller-Tank, Sven; Albritton, Lorraine M.; Rennert, Paul D.
2014-01-01
ABSTRACT T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members were recently identified as phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance entry of Ebola virus (EBOV) and other viruses by binding PtdSer on the viral envelope, concentrating virus on the cell surface, and promoting subsequent internalization. The PtdSer-binding activity of the immunoglobulin-like variable (IgV) domain is essential for both virus binding and internalization by TIM-1. However, TIM-3, whose IgV domain also binds PtdSer, does not effectively enhance virus entry, indicating that other domains of TIM proteins are functionally important. Here, we investigate the domains supporting enhancement of enveloped virus entry, thereby defining the features necessary for a functional PVEER. Using a variety of chimeras and deletion mutants, we found that in addition to a functional PtdSer-binding domain PVEERs require a stalk domain of sufficient length, containing sequences that promote an extended structure. Neither the cytoplasmic nor the transmembrane domain of TIM-1 is essential for enhancing virus entry, provided the protein is still plasma membrane bound. Based on these defined characteristics, we generated a mimic lacking TIM sequences and composed of annexin V, the mucin-like domain of α-dystroglycan, and a glycophosphatidylinositol anchor that functioned as a PVEER to enhance transduction of virions displaying Ebola, Chikungunya, Ross River, or Sindbis virus glycoproteins. This identification of the key features necessary for PtdSer-mediated enhancement of virus entry provides a basis for more effective recognition of unknown PVEERs. IMPORTANCE T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members are recently identified phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance virus entry by binding the phospholipid, PtdSer, present on the viral
Ommen, van Marouska; van Beilen, M; Cornelissen, F W; Smid, H.G.O.M.; Knegtering, H; Aleman, A; van Laar, T
Background. Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing.
Left-right functional asymmetry of ventral hippocampus depends on aversiveness of situations.
Sakaguchi, Yukitoshi; Sakurai, Yoshio
2017-05-15
Many studies suggest that animals exhibit lateralized behaviors during aversive situations, and almost all animals exhibit right hemisphere-dominant behaviors associated with fear or anxiety. However, which brain structure in each hemisphere underlies such lateralized function is unclear. In this study, we focused on the hippocampus and investigated the effects of bilateral and unilateral lesions of the ventral hippocampus (VH) on anxiety-like behavior using the successive alleys test. We also examined the expression of c-fos in the VH, which was induced by an aversive situation. Results revealed that consistent right VH dominance trended with the anxiety level. Weaker anxiety induced both right and left VH functions, whereas stronger anxiety induced right VH function. From these results, we conclude that animals are able to adaptively regulate their behaviors to avoid aversive stimuli by changing the functional dominance of their left and right VH. Copyright © 2017 Elsevier B.V. All rights reserved.
Unstable lysogeny and pseudolysogeny in Vibrio harveyi siphovirus-like phage 1.
Khemayan, Krit; Pasharawipas, Tirasak; Puiprom, Orapim; Sriurairatana, Siriporn; Suthienkul, Orasa; Flegel, Timothy W
2006-02-01
Exposure of Vibrio harveyi (strain VH1114) to V. harveyi siphovirus-like phage 1 (VHS1) resulted in the production of a low percentage of lysogenized clones of variable stability. These were retrieved most easily as small colonies within dot plaques. Analysis revealed that VHS1 prophage was most likely carried by VH1114 as an episome rather than integrated into the host chromosome. In the late exponential growth phase, lysogenized VH1114 continuously produced VHS1 but also gave rise to a large number of cured progeny. The absence of phage DNA in the cured progeny was confirmed by the absence of VHS1 DNA in Southern blot and PCR assays. Curiously, these very stable, cured subclones did not show the parental phenotype of clear plaques with VHS1 but instead showed turbid plaques, both in overlaid lawns and in dot plaque assays. This phenotypic difference from the original parental isolate suggested that transient lysogeny by VHS1 had resulted in a stable genetic change in the cured clones. Such clones may be called pseudolysogens (i.e., false lysogens), since they have undergone transient lysogeny and have retained some resistance to full lytic phage development, despite the loss of viable or detectable prophage.
Validity of (Ultra-)Short Recordings for Heart Rate Variability Measurements
Muñoz Venegas, Loretto; van Roon, Arie; Riese, Harriette; Thio, Chris; Oostenbroek, Emma; Westrik, Iris; de Geus, Eco J. C.; Gansevoort, Ron; Lefrandt, Joop; Nolte, Ilja M.; Snieder, Harold
2015-01-01
Objectives In order to investigate the applicability of routine 10s electrocardiogram (ECG) recordings for time-domain heart rate variability (HRV) calculation we explored to what extent these (ultra-)short recordings capture the "actual" HRV. Methods The standard deviation of normal-to-normal
On Association Measures for Continuous Variables and Correction for Chance
Warrens, Matthijs J.
2015-01-01
This paper studies correction for chance for association measures for continuous variables. The set of linear transformations of Pearson's product-moment correlation is used as the domain of the correction for chance function. Examples of measures in this set are Tucker's congruence coefficient,
Neutron transport solver parallelization using a Domain Decomposition method
International Nuclear Information System (INIS)
Van Criekingen, S.; Nataf, F.; Have, P.
2008-01-01
A domain decomposition (DD) method is investigated for the parallel solution of the second-order even-parity form of the time-independent Boltzmann transport equation. The spatial discretization is performed using finite elements, and the angular discretization using spherical harmonic expansions (P N method). The main idea developed here is due to P.L. Lions. It consists in having sub-domains exchanging not only interface point flux values, but also interface flux 'derivative' values. (The word 'derivative' is here used with quotes, because in the case considered here, it in fact consists in the Ω.∇ operator, with Ω the angular variable vector and ∇ the spatial gradient operator.) A parameter α is introduced, as proportionality coefficient between point flux and 'derivative' values. This parameter can be tuned - so far heuristically - to optimize the method. (authors)
Nackerdien, Zeena E; Keynan, Alexander; Bassler, Bonnie L; Lederberg, Joshua; Thaler, David S
2008-02-27
The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy. The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh) strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp) strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants. The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.
Directory of Open Access Journals (Sweden)
Zeena E Nackerdien
2008-02-01
Full Text Available The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy.The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants.The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.
Kahn, G.; Plotkin, G.D.
1993-01-01
This paper introduces the theory of a particular kind of computation domains called concrete domains. The purpose of this theory is to find a satisfactory framework for the notions of coroutine computation and sequentiality of evaluation.
Yeh, Kuang-Hui; Bedford, Olwen; Yang, Yung-Jui
2009-06-01
The consensus definition of autonomy in the psychological literature emphasizes self-governance through free volition, not separation or independence from others. Since the concept of self may differ cross-culturally, several researchers have tried to incorporate types of self into the notion of autonomy; however, only the dual model of autonomy has been able to do this while retaining an emphasis on volition. The dual model describes two distinct forms of autonomy-individuating and relating-each with superior function in a specific domain of individual functioning. Individuating autonomy represents a volitional capacity to act against social constraints and offers a route to achieve an independent self-identity by expressing individualistic attributes and distinctions. Relating autonomy represents a volitional capacity to act by emphasizing the harmony of self-in-relation-to-others, the quality of interpersonal relationships, and self-transcendence. These two forms of autonomy have been shown to coexist at the individual level in a Taiwanese sample. This study takes the next step, with a cross-cultural test of the coexistence and domain superiority hypotheses of individuating and relating autonomy. Participants included 306 college students from Taiwan and 183 college students from the United States. Structural equation modelling by multigroup analyses confirmed the cross-cultural equivalence of the two-factor individuating autonomy and relating autonomy measurement model. Across both samples the two forms of autonomy were shown to be mutually inclusive and not exclusive or independent. The domain-superior function of each form of autonomy was also confirmed cross-culturally; each form of autonomy has a dominant, but not necessarily exclusive, domain of functioning. Specifically, individuating autonomy was more associated with intrapersonal than interpersonal domain dependent variables, while relating autonomy was more associated with interpersonal than
A Logic for Inclusion of Administrative Domains and Administrators in Multi-domain Authorization
Iranmanesh, Zeinab; Amini, Morteza; Jalili, Rasool
Authorization policies for an administrative domain or a composition of multiple domains in multi-domain environments are determined by either one administrator or multiple administrators' cooperation. Several logic-based models for multi-domain environments' authorization have been proposed; however, they have not considered administrators and administrative domains in policies' representation. In this paper, we propose the syntax, proof theory, and semantics of a logic for multi-domain authorization policies including administrators and administrative domains. Considering administrators in policies provides the possibility of presenting composite administration having applicability in many collaborative applications. Indeed, administrators and administrative domains stated in policies can be used in authorization. The presented logic is based on modal logic and utilizes two calculi named the calculus of administrative domains and the calculus of administrators. It is also proved that the logic is sound. A case study is presented signifying the logic application in practical projects.
DEFF Research Database (Denmark)
Pedersen, Kristine B.; Lejon, Tore; Ottosen, Lisbeth M.
2015-01-01
Using multivariate design and modelling, the optimal conditions for electrodialytic remediation (EDR) of heavy metals were determined for polluted harbour sediments from Hammerfest harbour located in the geographic Arctic region of Norway. The comparative importance of the variables, current......) was computed and variable importance in the projection was used to assess the influence of the experimental variables. Current density and remediation time proved to have the highest influence on the remediation of the heavy metals Cr, Cu, Ni, Pb and Zn in the studied experimental domain. In addition......, it was shown that excluding the acidification time improved the PLS model, indicating the importance of applying a limited experimental domain that covers the removal phases of each heavy metal in the specific sediment. Based on PLS modelling, the optimal conditions for remediating the Hammerfest sediment were...
International Nuclear Information System (INIS)
Schiffer, M.; Ainsworth, C.; Xu, Z.B.; Carperos, W.; Olsen, K.; Solomon, A.; Stevens, F.J.; Chang, C.H.
1989-01-01
The authors have determined the structure of the immunoglobulin light-chain dimer Loc in a second crystal form that was grown from distilled water. The crystal structure was determined to 2.8-angstrom resolution; the R factor is 0.22. The two variable domains are related by local 2-fold axes and form an antigen binding pocket. The variable domain-variable domain interaction observed in this crystal form differs from the one exhibited by the protein when crystallized from ammonium sulfate in which the two variable domains formed a protrusion. The structure attained in the distilled water crystals is similar to, but not identical with, the one observed for the Mcg light-chain dimer in crystals grown from ammonium sulfate. Thus, two strikingly different structures were attained by this multisubunit protein in crystals grown under two different, commonly used, crystallization techniques. The quaternary interactions exhibited by the protein in the two crystal forms are sufficiently different to suggest fundamentally different interpretations of the structural basis for the function of this protein. This observation may have general implications regarding the use of single crystallographic determinations for detailed identification of structural and functional relationships. On the other hand, proteins whose structures can be altered by manipulation of crystallization conditions may provide useful systems for study of fundamental structural chemistry
Local coexpression domains of two to four genes in the genome of Arabidopsis
Ren, X.Y.; Fiers, M.W.E.J.; Stiekema, W.J.; Nap, J.P.H.
2005-01-01
Expression of genes in eukaryotic genomes is known to cluster, but cluster size is generally loosely defined and highly variable. We have here taken a very strict definition of cluster as sets of physically adjacent genes that are highly coexpressed and form so-called local coexpression domains. The
Feature-level domain adaptation
DEFF Research Database (Denmark)
Kouw, Wouter M.; Van Der Maaten, Laurens J P; Krijthe, Jesse H.
2016-01-01
-level domain adaptation (flda), that models the dependence between the two domains by means of a feature-level transfer model that is trained to describe the transfer from source to target domain. Subsequently, we train a domain-adapted classifier by minimizing the expected loss under the resulting transfer...... modeled via a dropout distribution, which allows the classiffier to adapt to differences in the marginal probability of features in the source and the target domain. Our experiments on several real-world problems show that flda performs on par with state-of-the-art domainadaptation techniques.......Domain adaptation is the supervised learning setting in which the training and test data are sampled from different distributions: training data is sampled from a source domain, whilst test data is sampled from a target domain. This paper proposes and studies an approach, called feature...
From Microscopic to Macroscopic Descriptions of Cell Migration on Growing Domains
Baker, Ruth E.
2009-10-28
Cell migration and growth are essential components of the development of multicellular organisms. The role of various cues in directing cell migration is widespread, in particular, the role of signals in the environment in the control of cell motility and directional guidance. In many cases, especially in developmental biology, growth of the domain also plays a large role in the distribution of cells and, in some cases, cell or signal distribution may actually drive domain growth. There is an almost ubiquitous use of partial differential equations (PDEs) for modelling the time evolution of cellular density and environmental cues. In the last 20 years, a lot of attention has been devoted to connecting macroscopic PDEs with more detailed microscopic models of cellular motility, including models of directional sensing and signal transduction pathways. However, domain growth is largely omitted in the literature. In this paper, individual-based models describing cell movement and domain growth are studied, and correspondence with a macroscopic-level PDE describing the evolution of cell density is demonstrated. The individual-based models are formulated in terms of random walkers on a lattice. Domain growth provides an extra mathematical challenge by making the lattice size variable over time. A reaction-diffusion master equation formalism is generalised to the case of growing lattices and used in the derivation of the macroscopic PDEs. © 2009 Society for Mathematical Biology.
Fine-grained semantic categorization across the abstract and concrete domains.
Directory of Open Access Journals (Sweden)
Marta Ghio
Full Text Available A consolidated approach to the study of the mental representation of word meanings has consisted in contrasting different domains of knowledge, broadly reflecting the abstract-concrete dichotomy. More fine-grained semantic distinctions have emerged in neuropsychological and cognitive neuroscience work, reflecting semantic category specificity, but almost exclusively within the concrete domain. Theoretical advances, particularly within the area of embodied cognition, have more recently put forward the idea that distributed neural representations tied to the kinds of experience maintained with the concepts' referents might distinguish conceptual meanings with a high degree of specificity, including those within the abstract domain. Here we report the results of two psycholinguistic rating studies incorporating such theoretical advances with two main objectives: first, to provide empirical evidence of fine-grained distinctions within both the abstract and the concrete semantic domains with respect to relevant psycholinguistic dimensions; second, to develop a carefully controlled linguistic stimulus set that may be used for auditory as well as visual neuroimaging studies focusing on the parametrization of the semantic space beyond the abstract-concrete dichotomy. Ninety-six participants rated a set of 210 sentences across pre-selected concrete (mouth, hand, or leg action-related and abstract (mental state-, emotion-, mathematics-related categories, with respect either to different semantic domain-related scales (rating study 1, or to concreteness, familiarity, and context availability (rating study 2. Inferential statistics and correspondence analyses highlighted distinguishing semantic and psycholinguistic traits for each of the pre-selected categories, indicating that a simple abstract-concrete dichotomy is not sufficient to account for the entire semantic variability within either domains.
A recurrent neural network for classification of unevenly sampled variable stars
Naul, Brett; Bloom, Joshua S.; Pérez, Fernando; van der Walt, Stéfan
2018-02-01
Astronomical surveys of celestial sources produce streams of noisy time series measuring flux versus time (`light curves'). Unlike in many other physical domains, however, large (and source-specific) temporal gaps in data arise naturally due to intranight cadence choices as well as diurnal and seasonal constraints1-5. With nightly observations of millions of variable stars and transients from upcoming surveys4,6, efficient and accurate discovery and classification techniques on noisy, irregularly sampled data must be employed with minimal human-in-the-loop involvement. Machine learning for inference tasks on such data traditionally requires the laborious hand-coding of domain-specific numerical summaries of raw data (`features')7. Here, we present a novel unsupervised autoencoding recurrent neural network8 that makes explicit use of sampling times and known heteroskedastic noise properties. When trained on optical variable star catalogues, this network produces supervised classification models that rival other best-in-class approaches. We find that autoencoded features learned in one time-domain survey perform nearly as well when applied to another survey. These networks can continue to learn from new unlabelled observations and may be used in other unsupervised tasks, such as forecasting and anomaly detection.
Directory of Open Access Journals (Sweden)
Yen-Hsiu Yang
2012-01-01
Full Text Available We propose a generic spatial domain control scheme for a class of nonlinear rotary systems of variable speeds and subject to spatially periodic disturbances. The nonlinear model of the rotary system in time domain is transformed into one in spatial domain employing a coordinate transformation with respect to angular displacement. Under the circumstances that measurement of the system states is not available, a nonlinear state observer is established for providing the estimated states. A two-degree-of-freedom spatial domain control configuration is then proposed to stabilize the system and improve the tracking performance. The first control module applies adaptive backstepping with projected parametric update and concentrates on robust stabilization of the closed-loop system. The second control module introduces an internal model of the periodic disturbances cascaded with a loop-shaping filter, which not only further reduces the tracking error but also improves parametric adaptation. The overall spatial domain output feedback adaptive control system is robust to model uncertainties and state estimated error and capable of rejecting spatially periodic disturbances under varying system speeds. Stability proof of the overall system is given. A design example with simulation demonstrates the applicability of the proposed design.
Parametric evaluation of an SMR design domain
International Nuclear Information System (INIS)
Al Rashdan, Ahmad; Tsvetkov, Pavel
2015-01-01
Highlights: • The design of nuclear reactors involves a large set of highly coupled variables. • The effects of 14 variables on 6 SMR performance characteristics was researched. • Screening and sensitivity analyses were applied to decouple the variables’ effects. • Significantly simpler system models were generated, enabling simple optimization. - Abstract: The complex and coupled behavior of the variables that affect the currently developing generation IV reactors and the increase of interest in Small Modular Reactors are major incentives to seek efficient design methods. Instead of the brute force design methodology, often applied to the analysis of nuclear reactors, other more economical and systematic methods should be applied. In a complex system with a high number of variables, it often is necessary to develop models to describe the behavior of each performance characteristic with respect to a set of variables and their interactions. If expensive experiments are needed to develop these models, the number of experiments should be minimized. This can be achieved by designing the experiments to be performed. Once the system’s models are developed, they can be used to decouple the variables’ effects on the performance characteristics and simplify the optimization process. In this article, three screening and sensitivity analysis methods are applied to decouple and understand the effects of fourteen variables on six performance characteristics of a Small Modular Reactor’s design, based on the Advanced Passive (AP-1000) reactor. The application of these methods facilitated the determination of the most important parameters of each performance characteristic, and resulted in several distinctive findings. These findings are applicable to any Light Water Small Modular Reactor that falls within the variables’ design domain
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
PREFACE: Domain wall dynamics in nanostructures Domain wall dynamics in nanostructures
Marrows, C. H.; Meier, G.
2012-01-01
Domain structures in magnetic materials are ubiquitous and have been studied for decades. The walls that separate them are topological defects in the magnetic order parameter and have a wide variety of complex forms. In general, their investigation is difficult in bulk materials since only the domain structure on the surface of a specimen is visible. Cutting the sample to reveal the interior causes a rearrangement of the domains into a new form. As with many other areas of magnetism, the study of domain wall physics has been revitalised by the advent of nanotechnology. The ability to fabricate nanoscale structures has permitted the formation of simplified and controlled domain patterns; the development of advanced microscopy methods has permitted them to be imaged and then modelled; subjecting them to ultrashort field and current pulses has permitted their dynamics to be explored. The latest results from all of these advances are described in this special issue. Not only has this led to results of great scientific beauty, but also to concepts of great applicability to future information technologies. In this issue the reader will find the latest results for these domain wall dynamics and the high-speed processes of topological structures such as domain walls and magnetic vortices. These dynamics can be driven by the application of magnetic fields, or by flowing currents through spintronic devices using the novel physics of spin-transfer torque. This complexity has been studied using a wide variety of experimental techniques at the edge of the spatial and temporal resolution currently available, and can be described using sophisticated analytical theory and computational modelling. As a result, the dynamics can be engineered to give rise to finely controlled memory and logic devices with new functionality. Moreover, the field is moving to study not only the conventional transition metal ferromagnets, but also complex heterostructures, novel magnets and even other
Time-domain modeling of electromagnetic diffusion with a frequency-domain code
Mulder, W.A.; Wirianto, M.; Slob, E.C.
2007-01-01
We modeled time-domain EM measurements of induction currents for marine and land applications with a frequency-domain code. An analysis of the computational complexity of a number of numerical methods shows that frequency-domain modeling followed by a Fourier transform is an attractive choice if a
Correlates of institutionalized senior veterans' quality of life in Taiwan
Directory of Open Access Journals (Sweden)
Hwang Shinn-Jang
2010-07-01
Full Text Available Abstract Background Senior veterans living in government sponsored, long-term care (LTC facilities, known as veterans' homes (VHs, are a special minority group in Taiwan. These seniors came from different provinces of mainland China during their teenage years at the end of civil wars in 1945. The situation of institutionalized senior veterans shares many characteristics with the concept of "total institution". Very little quality of life (QOL research has involved senior veterans. This study aimed to explore the QOL and related factors of VH-dwelling senior veterans in Taiwan. Methods Chronic conditions and socio-demographic characteristics of 260 male VH residents were recorded. The Brief Form of the World Health Organization's Quality of Life Questionnaire (WHOQOL-BREF, Taiwanese version; Short-Form 36; Inventory of Socially Supportive Behavior questionnaire; Geriatric Depression Scale-short form; Barthel Index; and instrumental activities of daily living were used. Data analyses including descriptive and inferred statistics were performed using SPSS, version 17. Results WHOQOL-BREF showed acceptable reliability in this study. Compared to Taiwanese male norms, WHOQOL-BREF physical, psychological, and social relationship domain scores were around the 25th percentile, and the environment domain was about the 75th percentile. Our participants scored low in all concepts of SF-36. Although these residents rated the social support of their children, relatives, friends, social and medical staff as low, they gave high satisfaction ratings to their social supports. On multiple stepwise linear regression analysis, depressive symptoms, number of chronic conditions, retired military rank, and relatives' support correlated with QOL in both the physical and psychological domains. Friends' support and depressive symptoms correlated with the social relationships domain. Friends' support and instrumental activities of daily living correlated with the
Separated matter and antimatter domains with vanishing domain walls
Energy Technology Data Exchange (ETDEWEB)
Dolgov, A.D.; Godunov, S.I.; Rudenko, A.S.; Tkachev, I.I., E-mail: dolgov@fe.infn.it, E-mail: sgodunov@itep.ru, E-mail: a.s.rudenko@inp.nsk.su, E-mail: tkachev@ms2.inr.ac.ru [Physics Department and Laboratory of Cosmology and Elementary Particle Physics, Novosibirsk State University, Pirogova st. 2, Novosibirsk, 630090 (Russian Federation)
2015-10-01
We present a model of spontaneous (or dynamical) C and CP violation where it is possible to generate domains of matter and antimatter separated by cosmologically large distances. Such C(CP) violation existed only in the early universe and later it disappeared with the only trace of generated baryonic and/or antibaryonic domains. So the problem of domain walls in this model does not exist. These features are achieved through a postulated form of interaction between inflaton and a new scalar field, realizing short time C(CP) violation.
Several complex variables and Banach algebras
International Nuclear Information System (INIS)
Allan, G.R.
1976-01-01
This paper aims to present certain applications of the theory of holomorphic functions of several complex variables to the study of commutative Banach algebras. The material falls into the following sections: (A) Introcution to Banach algebras (this will not presuppose any knowledge of the subject); (B) Groups of differential forms (mainly concerned with setting up a useful language); (C) Polynomially convex domains. (D) Holomorphic functional calculus for Banach algebras; (E) Some applications of the functional calculus. (author)
Wang, Gong-Wu; Liu, Jian; Wang, Xiao-Qin
2017-01-01
The ventral hippocampus (VH) and the basolateral amygdala (BLA) are both crucial in inhibitory avoidance (IA) memory. However, the exact role of the VH-BLA circuit in IA memory consolidation is unclear. This study investigated the effect of post-training reversible disconnection of the VH-BLA circuit in IA memory consolidation. Male Wistar rats…
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-03-01
By utilizing the phenomenon that the antigen induces association of VH and VL, which are the antigen-recognizing fragments of antibody, develop a novel rapid immunoassay technology which will eliminate the defects of conventional immunoassays, such as long measuring time and requirement of expensive large automated apparatus. In addition, develop a methodology to make Fvs with low VH-VL affinity but that associate tightly in the presence of antigen. Using a model anti-hen egg lysozyme antibody HyHEL-10 Fv and BlAcore, we have clarified the kinetic basis of the Fv stabilization by HEL. By labeling HyHEL-10 VH, VL with succinimide esters of fluorescein and tetramethylrhodamin, respectively, at their N-termini, we could successfully detect VH-VL association by the increment of fluorescence resonance energy transfer. As a result, 1 {mu} g/ml of antigen could be detected homogeneously in less than 5 minutes. Some VH-VL association measurement systems were made by utilizing M13 phage display of VH fragments of HyHEL-10, anti-nitrophenacetyl, anti-digoxin antibodies. (NEDO)
Domain Walls and Matter-Antimatter Domains in the Early Universe
Directory of Open Access Journals (Sweden)
Dolgov A.D.
2017-01-01
Full Text Available We suggest a scenario of spontaneous (or dynamical C and CP violation according to which it is possible to generate domains of matter and antimatter separated by cosmologically large distances. Such C(CP violation existed only in the early universe and later it disappeared with the only trace of generated matter and antimatter domains. So this scenario does not suffer from the problem of domain walls. According to this scenario the width of the domain wall should grow exponentially to prevent annihilation at the domain boundaries. Though there is a classical result obtained by Basu and Vilenkin that the width of the wall tends to the one of the stationary solution (constant physical width. That is why we considered thick domain walls in a de Sitter universe following paper by Basu and Vilenkin. However, we were interested not only in stationary solutions found therein, but also investigated the general case of domain wall evolution with time. When the wall thickness parameter, δ0 , is smaller than H−1/2 where H is the Hubble parameter in de Sitter space-time, then the stationary solutions exist, and initial field configurations tend with time to the stationary ones. However, there are no stationary solutions for δ0>H−1/2 We have calculated numerically the rate of the wall expansion in this case and have found that the width of the wall grows exponentially fast for δ0≫H−1 An explanation for the critical value δ0c=H−1/2 is also proposed.
Separating variables in two-way diffusion equations
International Nuclear Information System (INIS)
Fisch, N.J.; Kruskal, M.D.
1979-10-01
It is shown that solutions to a class of diffusion equations of the two-way type may be found by a method akin to separation of variables. The difficulty with such equations is that the boundary data must be specified partly as initial and partly as final conditions. In contrast to the one-way diffusion equation, where the solution separates only into decaying eigenfunctions, the two-way equations separate into both decaying and growing eigenfunctions. Criteria are set forth for the existence of linear eigenfunctions, which may not be found directly by separating variables. A speculation with interesting ramifications is that the growing and decaying eigenfunctions are separately complete in an appropriate half of the problem domain
Heart rate variability in normal-weight patients with polycystic ovary syndrome.
Kilit, Celal; Paşalı Kilit, Türkan
2017-05-01
Polycystic ovary syndrome (PCOS) is an endocrine disease closely related to several risk factors of cardiovascular disease. Obese women with PCOS show altered autonomic modulation. The results of studies investigating cardiac autonomic functions of normal-weight women with PCOS are conflicting. The aim of the study was to assess the reactivity of cardiac sympathovagal balance in normal-weight women with PCOS by heart rate variability analysis. We examined the heart rate variability in 60 normal-weight women with PCOS and compared them with that in 60 age-matched healthy women having a similar metabolic profile. Time and frequency domain parameters of heart rate variability were analyzed based on 5-min-long continuous electrocardiography recordings for the following 3 periods: (1) during rest in supine position, (2) during controlled breathing, and (3) during isometric handgrip exercise. Time and frequency domain parameters of heart rate variability for the 3 periods assessed were similar in the two groups. Although modified Ferriman-Gallwey score and serum testosterone and luteinizing hormone levels were significantly higher in women with PCOS, homeostatic model assessment-insulin resistance (HOMA-IR) was not different the between the PCOS and control groups. There were no significant correlations between serum testosterone levels and heart rate variability parameters among the study population. The findings of this study suggest that the reactivity of cardiac sympathovagal balance is not altered in normal-weight women with PCOS having a normal HOMA-IR.
Ayat, Hoda; Burrone, Oscar R; Sadghizadeh, Majid; Jahanzad, Eissa; Rastgou, Nasrin; Moghadasi, Sarrira; Arbabi, Mehdi
2013-11-01
Tumor cells expressing HER-2/neu and CEA antigens are potentially ideal targets for antibody-targeted therapy. In this study, two large human combinatorial libraries have been generated from the lymph nodes of breast cancer patients that express HER2 and CEA antigens in their tumors. These 'immune' libraries have been constructed in two different formats of scFv, differing in the length of the peptide linker connecting the two variable VH and VL domains. Libraries derived from these patients may contain a larger pool of anti-tumor antigen antibodies and are useful repertoire for isolating scFvs against any tumor markers. The results of this study showed that we were successful in obtaining human scFvs against HER-2/neu and CEA. For HER-2, cell-panning strategy was performed and resulted in two scFv binders that detected the complete HER-2 receptor on the cell membrane and internalized to the cells. Also, preliminary ELISA data showed that several anti-CEA scFv binders were isolated by panning. Copyright © 2013 The International Alliance for Biological Standardization. All rights reserved.
Directory of Open Access Journals (Sweden)
Emre Sinan Güngör
2017-09-01
Full Text Available Aim: To evaluate and compare the results and complications of tension-free vaginal tape (TVT when performed alone or with vaginal hysterectomy (VH and to evaluate the mid-term success rates of TVT for both groups. Methods: A retrospective study was performed on 179 patients who had TVT alone for stress urinary incontinance (SUI or TVT with VH for SUI and vaginal prolapse. Demographic, outcome and complication data were obtained from medical records. The main outcome measures were postoperative SUI and voiding dysfunction. Results: The mean age of the patients who underwent TVT and TVT+VH were 50.2±6.8 and 52.2±8.1, respectively (p>0.05 and the mean parity was 4±2.07 and 4.15±2.02, respectively (p>0.05. The success rate was significantly higher in TVT alone group than in TVT+VH group (93.6% vs. 84.5%, p0.05. Overall complication rate was higher in TVT+VH group (4.2% vs. 9.5%, p<0.05. Postoperative residuel urine volumes were significantly higher than preoperative residuel urine volumes in both groups (p=0.001. Due to mesh rejection, second surgery was performed in one patient from both groups to reomove the mesh. Conclusion: Midterm success rates were significantly higher in TVT group than in TVT+VH group, but success rates in TVT+VH were acceptable. Overall complication rates were higher in TVT+VH group; requirement for a second surgery was similar for both groups.
Individual Importance Weighting of Domain Satisfaction Ratings does Not Increase Validity
Rohrer, Julia M.; Schmukle, Stefan C.
2018-01-01
Bottom-up models of life satisfaction are based on the assumption that individuals judge the overall quality of their lives by aggregating information across various life domains, such as health, family, and income. This aggregation supposedly involves a weighting procedure because individuals care about different parts of their lives to varying degrees. Thus, composite measures of well-being should be more accurate if domain satisfaction scores are weighted by the importance that respondents assign to the respective domains. Previous studies have arrived at mixed conclusions about whether such a procedure actually works. In the present study, importance weighting was investigated in the Panel Study of Income Dynamics (PSID; N = 5,049). Both weighted composite scores and moderated regression analyses converged in producing the conclusion that individual importance weights did not result in higher correlations with the outcome variable, a global measure of life satisfaction. By contrast, using weights that vary normatively across domains (e.g., assigning a larger weight to family satisfaction than to housing satisfaction for all respondents) significantly increased the correlation with global life satisfaction (although incremental validity was rather humble). These results converge with findings from other fields such as self-concept research, where evidence for individual importance weighting seems elusive as best. PMID:29652406
Individual Importance Weighting of Domain Satisfaction Ratings does Not Increase Validity.
Rohrer, Julia M; Schmukle, Stefan C
2018-01-01
Bottom-up models of life satisfaction are based on the assumption that individuals judge the overall quality of their lives by aggregating information across various life domains, such as health, family, and income. This aggregation supposedly involves a weighting procedure because individuals care about different parts of their lives to varying degrees. Thus, composite measures of well-being should be more accurate if domain satisfaction scores are weighted by the importance that respondents assign to the respective domains. Previous studies have arrived at mixed conclusions about whether such a procedure actually works. In the present study, importance weighting was investigated in the Panel Study of Income Dynamics (PSID; N = 5,049). Both weighted composite scores and moderated regression analyses converged in producing the conclusion that individual importance weights did not result in higher correlations with the outcome variable, a global measure of life satisfaction. By contrast, using weights that vary normatively across domains (e.g., assigning a larger weight to family satisfaction than to housing satisfaction for all respondents) significantly increased the correlation with global life satisfaction (although incremental validity was rather humble). These results converge with findings from other fields such as self-concept research, where evidence for individual importance weighting seems elusive as best.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK273 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...73F 620 - - - - - - Show VHK273 Library VH (Link to library) Clone ID VHK273 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK273Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK273 (VHK273Q) /CSM/VH/VHK2-D/VHK273Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK256 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...56F 620 - - - - - - Show VHK256 Library VH (Link to library) Clone ID VHK256 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK256Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK256 (VHK256Q) /CSM/VH/VHK2-C/VHK256Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787
1987-09-01
and Sponheuer, W. 1969. Scale of Seismic Intensity: Proc. Fourth World Conf. on Earthquake Engineering, Santiago, Chile . Murphy, J. R., and O’Brien, L...Predom V/H el, V/I Vel V/H Displ V/H sec VIH Period Period Predom Accel cm/sec Vel cm Disp .05 Dur sec sec Period S11 2 0.48 MODIFIED MERCALLI INTENSITY...0.1 0. 0.16 142.20 Long. Vert Hor Vert Ratio Ratio Vert Ratio Vert r io Du r atio Predom Predom VIH Acce V/H Vel V /H Dspi V H sec 1, H Period Period
Restoration of variable density film soundtracks
Hassaïne , Abdelâali; Decencière , Etienne; Besserer , Bernard
2009-01-01
Full text available at http://www.eurasip.org/Proceedings/Eusipco/Eusipco2009/contents/papers/1569192297.pdf; International audience; The restoration of motion picture films has been an active research field for many years. The restoration of the soundtrack however has mainly been performed at the audio domain in spite of the fast that it is recorded as a continuous image on the film stock. In this paper, we propose a new restoration method for variable density soundtracks. The method first d...
Directory of Open Access Journals (Sweden)
Gil Luiz HS
2010-11-01
Full Text Available Abstract Background Plasmodium vivax malaria is a major public health challenge in Latin America, Asia and Oceania, with 130-435 million clinical cases per year worldwide. Invasion of host blood cells by P. vivax mainly depends on a type I membrane protein called Duffy binding protein (PvDBP. The erythrocyte-binding motif of PvDBP is a 170 amino-acid stretch located in its cysteine-rich region II (PvDBPII, which is the most variable segment of the protein. Methods To test whether diversifying natural selection has shaped the nucleotide diversity of PvDBPII in Brazilian populations, this region was sequenced in 122 isolates from six different geographic areas. A Bayesian method was applied to test for the action of natural selection under a population genetic model that incorporates recombination. The analysis was integrated with a structural model of PvDBPII, and T- and B-cell epitopes were localized on the 3-D structure. Results The results suggest that: (i recombination plays an important role in determining the haplotype structure of PvDBPII, and (ii PvDBPII appears to contain neutrally evolving codons as well as codons evolving under natural selection. Diversifying selection preferentially acts on sites identified as epitopes, particularly on amino acid residues 417, 419, and 424, which show strong linkage disequilibrium. Conclusions This study shows that some polymorphisms of PvDBPII are present near the erythrocyte-binding domain and might serve to elude antibodies that inhibit cell invasion. Therefore, these polymorphisms should be taken into account when designing vaccines aimed at eliciting antibodies to inhibit erythrocyte invasion.
The conserved Tarp actin binding domain is important for chlamydial invasion.
Directory of Open Access Journals (Sweden)
Travis J Jewett
2010-07-01
Full Text Available The translocated actin recruiting phosphoprotein (Tarp is conserved among all pathogenic chlamydial species. Previous reports identified single C. trachomatis Tarp actin binding and proline rich domains required for Tarp mediated actin nucleation. A peptide antiserum specific for the Tarp actin binding domain was generated and inhibited actin polymerization in vitro and C. trachomatis entry in vivo, indicating an essential role for Tarp in chlamydial pathogenesis. Sequence analysis of Tarp orthologs from additional chlamydial species and C. trachomatis serovars indicated multiple putative actin binding sites. In order to determine whether the identified actin binding domains are functionally conserved, GST-Tarp fusions from multiple chlamydial species were examined for their ability to bind and nucleate actin. Chlamydial Tarps harbored variable numbers of actin binding sites and promoted actin nucleation as determined by in vitro polymerization assays. Our findings indicate that Tarp mediated actin binding and nucleation is a conserved feature among diverse chlamydial species and this function plays a critical role in bacterial invasion of host cells.
Articulatory variability in cluttering.
Hartinger, Mariam; Mooshammer, Christine
2008-01-01
In order to investigate the articulatory processes of the hasty and mumbled speech in cluttering, the kinematic variability was analysed by means of electromagnetic midsagittal articulography. In contrast to persons with stuttering, those with cluttering improve their intelligibility by concentrating on their speech task. Variability has always been an important criterion in comparable studies of stuttering and is discussed in terms of the stability of the speech motor system. The aim of the current study was to analyse the spatial and temporal variability in the speech of three persons with cluttering (PWC) and three control speakers. All participants were native speakers of German. The speech material consisted of repetitive CV syllables and loan words such as 'emotionalisieren', because PWC have the severest problems with long words with a complex syllable structure. The results showed a significantly higher coefficient of variation for PWC in loan word production, both in the temporal and in the spatial domain, whereas the means of displacements and durations did not differ between groups. These findings were discussed in terms of the effects of the linguistic complexity, since for the syllable repetition task, no significant differences between PWC and controls were found. Copyright 2008 S. Karger AG, Basel.
Surfing wave climate variability
Espejo, Antonio; Losada, Iñigo J.; Méndez, Fernando J.
2014-10-01
International surfing destinations are highly dependent on specific combinations of wind-wave formation, thermal conditions and local bathymetry. Surf quality depends on a vast number of geophysical variables, and analyses of surf quality require the consideration of the seasonal, interannual and long-term variability of surf conditions on a global scale. A multivariable standardized index based on expert judgment is proposed for this purpose. This index makes it possible to analyze surf conditions objectively over a global domain. A summary of global surf resources based on a new index integrating existing wave, wind, tides and sea surface temperature databases is presented. According to general atmospheric circulation and swell propagation patterns, results show that west-facing low to middle-latitude coasts are more suitable for surfing, especially those in the Southern Hemisphere. Month-to-month analysis reveals strong seasonal variations in the occurrence of surfable events, enhancing the frequency of such events in the North Atlantic and the North Pacific. Interannual variability was investigated by comparing occurrence values with global and regional modes of low-frequency climate variability such as El Niño and the North Atlantic Oscillation, revealing their strong influence at both the global and the regional scale. Results of the long-term trends demonstrate an increase in the probability of surfable events on west-facing coasts around the world in recent years. The resulting maps provide useful information for surfers, the surf tourism industry and surf-related coastal planners and stakeholders.
Domain Decomposition Solvers for Frequency-Domain Finite Element Equations
Copeland, Dylan
2010-10-05
The paper is devoted to fast iterative solvers for frequency-domain finite element equations approximating linear and nonlinear parabolic initial boundary value problems with time-harmonic excitations. Switching from the time domain to the frequency domain allows us to replace the expensive time-integration procedure by the solution of a simple linear elliptic system for the amplitudes belonging to the sine- and to the cosine-excitation or a large nonlinear elliptic system for the Fourier coefficients in the linear and nonlinear case, respectively. The fast solution of the corresponding linear and nonlinear system of finite element equations is crucial for the competitiveness of this method. © 2011 Springer-Verlag Berlin Heidelberg.
Domain Decomposition Solvers for Frequency-Domain Finite Element Equations
Copeland, Dylan; Kolmbauer, Michael; Langer, Ulrich
2010-01-01
The paper is devoted to fast iterative solvers for frequency-domain finite element equations approximating linear and nonlinear parabolic initial boundary value problems with time-harmonic excitations. Switching from the time domain to the frequency domain allows us to replace the expensive time-integration procedure by the solution of a simple linear elliptic system for the amplitudes belonging to the sine- and to the cosine-excitation or a large nonlinear elliptic system for the Fourier coefficients in the linear and nonlinear case, respectively. The fast solution of the corresponding linear and nonlinear system of finite element equations is crucial for the competitiveness of this method. © 2011 Springer-Verlag Berlin Heidelberg.
The Environmental Domain of Quality of Life in Patients with Chronic Respiratory Diseases.
Kurpas, Donata; Szwamel, Katarzyna; Mroczek, Bożena
2016-01-01
The literature lacks reports on the role played by the Environmental domain of quality of life (QoL) in care for patients with chronic respiratory diseases. Such information has a high potential for implementation in modern medicine based on a 'tailor-made' holistic healthcare model. The purpose of this study was to determine the components that shape the Environmental domain of QoL in patients with chronic respiratory diseases. The study group consisted of 305 adult patients (median age 65 years) with at least one chronic respiratory disease. The greatest contribution to a high value of QoL in the Environmental domain among patients with chronic respiratory diseases was made by the coexistence of high QoL levels in other domains and in satisfaction with QoL. Programs for preventing a decline in QoL in the Environmental domain should include patients with low scores for the above variables as well as those with a low level of education, those who have not shown an improvement in their psychological well-being in the past 12 months, those with a low level of positive mental attitudes or healthy eating habits, a low Camberwell index, and low levels of overall pro-health behavior.
Geometric theory of functions of a complex variable
Goluzin, G M
1969-01-01
This book is based on lectures on geometric function theory given by the author at Leningrad State University. It studies univalent conformal mapping of simply and multiply connected domains, conformal mapping of multiply connected domains onto a disk, applications of conformal mapping to the study of interior and boundary properties of analytic functions, and general questions of a geometric nature dealing with analytic functions. The second Russian edition upon which this English translation is based differs from the first mainly in the expansion of two chapters and in the addition of a long survey of more recent developments. The book is intended for readers who are already familiar with the basics of the theory of functions of one complex variable.
Domain shape instabilities and dendrite domain growth in uniaxial ferroelectrics
Shur, Vladimir Ya.; Akhmatkhanov, Andrey R.
2018-01-01
The effects of domain wall shape instabilities and the formation of nanodomains in front of moving walls obtained in various uniaxial ferroelectrics are discussed. Special attention is paid to the formation of self-assembled nanoscale and dendrite domain structures under highly non-equilibrium switching conditions. All obtained results are considered in the framework of the unified kinetic approach to domain structure evolution based on the analogy with first-order phase transformation. This article is part of the theme issue `From atomistic interfaces to dendritic patterns'.
Bielak, Allison A M; Hultsch, David F; Strauss, Esther; MacDonald, Stuart W S; Hunter, Michael A
2010-09-01
In this study, the authors addressed the longitudinal nature of intraindividual variability over 3 years. A sample of 304 community-dwelling older adults, initially between the ages of 64 and 92 years, completed 4 waves of annual testing on a battery of accuracy- and latency-based tests covering a wide range of cognitive complexity. Increases in response-time inconsistency on moderately and highly complex tasks were associated with increasing age, but there were significant individual differences in change across the entire sample. The time-varying covariation between cognition and inconsistency was significant across the 1-year intervals and remained stable across both time and age. On occasions when intraindividual variability was high, participants' cognitive performance was correspondingly low. The strength of the coupling relationship was greater for more fluid cognitive domains such as memory, reasoning, and processing speed than for more crystallized domains such as verbal ability. Variability based on moderately and highly complex tasks provided the strongest prediction. These results suggest that intraindividual variability is highly sensitive to even subtle changes in cognitive ability. (c) 2010 APA, all rights reserved.
McCord, David M; Achee, Margaret C; Cannon, Elissa M; Harrop, Tiffany M; Poynter, William D
2017-01-01
The National Institute of Mental Health has proposed a paradigm shift in the conceptualization of psychopathology, abandoning the traditional categorical model in favor of one based on hierarchically organized dimensional constructs (Insel et al., 2010 ). One explicit goal of this initiative, the Research Domain Criteria (RDoC) project, is to facilitate the incorporation of newly available neurobiologic variables into research on psychopathology. The Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Ben-Porath & Tellegen, 2008/2011 ) represents a similar paradigm shift, also adopting a hierarchical arrangement of dimensional constructs. This study examined associations between MMPI-2-RF measures of psychopathology and eye-movement metrics. Participants were college students (n = 270) who completed the MMPI-2-RF and then viewed a sequence of 30-s video clips. Results show a pattern of positive correlations between pupil size and emotional/internalizing dysfunction scales when viewing video eliciting negative emotional reactions, reflecting greater arousability in individuals with higher scores on these measures. In contrast, when viewing stimuli depicting angry, threatening material, a clear pattern of negative correlations was found between pupil size and behavioral/externalizing trait measures. These data add to the construct validity of the MMPI-2-RF and support the use of the RDoC matrix as a framework for research on psychopathology.
Jahn-teller domains and magnetic domains in Mn2FeO4
Kub, J.; Brabers, V.A.M.; Novák, P.; Gemperle, R.; Simsova, J.
2000-01-01
Elastic (Jahn–Teller) domains and magnetic domains in the tetragonal spinel Mn2FeO4 were studied using X-ray double-crystal topography, X-ray diffractometry and the colloid-SEM method. The Jahn–Teller domains of the measured samples are tetragonal with the [0 0 1] c-axis alternating perpendicularly
Energy Technology Data Exchange (ETDEWEB)
Aarao, J; Bradshaw-Hajek, B H; Miklavcic, S J; Ward, D A, E-mail: Stan.Miklavcic@unisa.edu.a [School of Mathematics and Statistics, University of South Australia, Mawson Lakes, SA 5095 (Australia)
2010-05-07
Standard analytical solutions to elliptic boundary value problems on asymmetric domains are rarely, if ever, obtainable. In this paper, we propose a solution technique wherein we embed the original domain into one with simple boundaries where the classical eigenfunction solution approach can be used. The solution in the larger domain, when restricted to the original domain, is then the solution of the original boundary value problem. We call this the extended-domain-eigenfunction method. To illustrate the method's strength and scope, we apply it to Laplace's equation on an annular-like domain.
Directory of Open Access Journals (Sweden)
Thomas eGoetz
2014-10-01
Full Text Available With the aim to deepen our understanding of the between-domain relations of academic emotions, a series of three studies was conducted. We theorized that between-domain relations of trait (i.e., habitual emotions reflected students’ judgments of domain similarities, whereas between-domain relations of state (i.e., momentary emotions did not. This supposition was based on the accessibility model of emotional self-report, according to which individuals’ beliefs tend to strongly impact trait, but not state emotions. The aim of Study 1 (interviews; N = 40; 8th and 11th graders was to gather salient characteristics of academic domains from students’ perspective. In Study 2 (N=1709; 8th and 11th graders the 13 characteristics identified in Study 1 were assessed along with academic emotions in four different domains (mathematics, physics, German, and English using a questionnaire-based trait assessment. With respect to the same domains, state emotions were assessed in Study 3 (N = 121; 8th and 11th graders by employing an experience sampling approach. In line with our initial assumptions, between-domain relations of trait but not state academic emotions reflected between-domain relations of domain characteristics. Implications for research and practice are discussed.
Goetz, Thomas; Haag, Ludwig; Lipnevich, Anastasiya A.; Keller, Melanie M.; Frenzel, Anne C.; Collier, Antonie P. M.
2014-01-01
With the aim to deepen our understanding of the between-domain relations of academic emotions, a series of three studies was conducted. We theorized that between-domain relations of trait (i.e., habitual) emotions reflected students' judgments of domain similarities, whereas between-domain relations of state (i.e., momentary) emotions did not. This supposition was based on the accessibility model of emotional self-report, according to which individuals' beliefs tend to strongly impact trait, but not state emotions. The aim of Study 1 (interviews; N = 40; 8th and 11th graders) was to gather salient characteristics of academic domains from students' perspective. In Study 2 (N = 1709; 8th and 11th graders) the 13 characteristics identified in Study 1 were assessed along with academic emotions in four different domains (mathematics, physics, German, and English) using a questionnaire-based trait assessment. With respect to the same domains, state emotions were assessed in Study 3 (N = 121; 8th and 11th graders) by employing an experience sampling approach. In line with our initial assumptions, between-domain relations of trait but not state academic emotions reflected between-domain relations of domain characteristics. Implications for research and practice are discussed. PMID:25374547
Expansion of protein domain repeats.
Directory of Open Access Journals (Sweden)
Asa K Björklund
2006-08-01
Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.
Directory of Open Access Journals (Sweden)
Andrea Maria Kälin
2014-07-01
Full Text Available Recent studies have shown that increased cognitive intraindividual variability (IIV across accuracy scores from tests representing different cognitive domains (across-domain IIV might indicate prodromal Alzheimer’s disease (AD. Although IIV has been proposed to index cognitive control processes, IIV across accuracy scores from cognitive control tasks (within-domain IIV has not been examined in healthy controls subjects (HCS, mild cognitive impairment (MCI and AD patients in a single comparative study. This study examines the discriminative properties of within-domain IIV, and across-domain IIV in 149 HCS, 31 MCI and 26 AD. Three tasks representing different cognitive domains were identified to calculate across-domain IIV. Three other tasks representing cognitive control were identified to calculate within-domain IIV. The intraindividual standard deviation (ISD was calculated across accuracy scores. To compare IIV between groups, ANCOVAs with the covariates age, gender, education, and mean performance were computed. IIV scores in general were higher in AD vs. HCS (p< 0.01. Only across-domain IIV was higher in AD vs. MCI (p=0.001, and only within-domain IIV was higher in MCI vs. HCS (p=0.05. Within-domain IIV may constitute a cognitive marker for the detection of prodromal AD at the MCI stage, whereas across-domain IIV may detect beginning AD at the MCI stage.
Diniz, Cassiano R A F; Casarotto, Plínio C; Joca, Sâmia R L
2016-07-01
Hodological and genetic differences between dorsal (DH) and ventral (VH) hippocampus may convey distinct behavioral roles. DH is responsible for mediating cognitive process, such as learning and memory, while VH modulates neuroendocrine and emotional-motivational responses to stress. Manipulating glutamatergic NMDA receptors and nitric oxide (NO) systems of the hippocampus induces important changes in behavioral responses to stress. Nevertheless, there is no study concerning functional differences between DH and VH in the modulation of behavioral responses induced by stress models predictive of antidepressant effects. Thus, this study showed that reversible blockade of the DH or VH of animals submitted to the forced swimming test (FST), by using cobalt chloride (calcium-dependent synaptic neurotransmission blocker), was not able to change immobility time. Afterwards, the NMDA-NO system was evaluated in the FST by means of intra-DH or intra-VH administration of NMDA receptor antagonist (AP7), NOS1 and sGC inhibitors (N-PLA and ODQ, respectively). Bilateral intra-DH injections after pretest or before test were able to induce antidepressant-like effects in the FST. On the other hand, bilateral VH administration of AP-7, N-PLA and ODQ induced antidepressant-like effects only when injected before the test. Administration of NO scavenger (C-PTIO) intra-DH, after pretest and before test, or intra-VH before test induced similar results. Increased NOS1 levels was associated to stress exposure in the DH. These results suggest that the glutamatergic-NO system of the DH and VH are both able to modulate behavioral responses in the FST, albeit with differential participation along time after stress exposure. Copyright © 2016 Elsevier B.V. All rights reserved.
Full-length RNA structure prediction of the HIV-1 genome reveals a conserved core domain
DEFF Research Database (Denmark)
Sükösd, Zsuzsanna; Andersen, Ebbe Sloth; Seemann, Ernst Stefan
2015-01-01
of the HIV-1 genome is highly variable in most regions, with a limited number of stable and conserved RNA secondary structures. Most interesting, a set of long distance interactions form a core organizing structure (COS) that organize the genome into three major structural domains. Despite overlapping...
Time Domain Filtering of Resolved Images of Sgr A{sup ∗}
Energy Technology Data Exchange (ETDEWEB)
Shiokawa, Hotaka; Doeleman, Sheperd S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Gammie, Charles F. [Department of Physics, University of Illinois, 1110 West Green Street, Urbana, IL 61801 (United States)
2017-09-01
The goal of the Event Horizon Telescope (EHT) is to provide spatially resolved images of Sgr A*, the source associated with the Galactic Center black hole. Because Sgr A* varies on timescales that are short compared to an EHT observing campaign, it is interesting to ask whether variability contains information about the structure and dynamics of the accretion flow. In this paper, we introduce “time-domain filtering,” a technique to filter time fluctuating images with specific temporal frequency ranges and to demonstrate the power and usage of the technique by applying it to mock millimeter wavelength images of Sgr A*. The mock image data is generated from the General Relativistic Magnetohydrodynamic (GRMHD) simulation and the general relativistic ray-tracing method. We show that the variability on each line of sight is tightly correlated with a typical radius of emission. This is because disk emissivity fluctuates on a timescale of the order of the local orbital period. Time-domain filtered images therefore reflect the model dependent emission radius distribution, which is not accessible in time-averaged images. We show that, in principle, filtered data have the power to distinguish between models with different black-hole spins, different disk viewing angles, and different disk orientations in the sky.
DEFF Research Database (Denmark)
Reynolds, Chandra A; Gatz, Margaret; Christensen, Kaare
2016-01-01
mass index (BMI), depressive symptoms, and cognition (verbal, spatial, attention, working memory, perceptual speed) in twin studies from four countries. We also evaluated whether APOE is a 'variability gene' across these measures and whether it partly represents the 'G' in G×E effects. In all three...... domains, G×E effects were pervasive across country and gender, with small-to-moderate effects. Age-cohort trends were generally stable for BMI and depressive symptoms; however, they were variable-with both increasing and decreasing age-cohort trends-for different cognitive measures. Results also suggested...... that APOE may represent a 'variability gene' for depressive symptoms and spatial reasoning, but not for BMI or other cognitive measures. Hence, additional genes are salient beyond APOE....
Development and evaluation of single domain antibodies for vaccinia and the L1 antigen.
Directory of Open Access Journals (Sweden)
Scott A Walper
Full Text Available There is ongoing interest to develop high affinity, thermal stable recognition elements to replace conventional antibodies in biothreat detection assays. As part of this effort, single domain antibodies that target vaccinia virus were developed. Two llamas were immunized with killed viral particles followed by boosts with the recombinant membrane protein, L1, to stimulate the immune response for envelope and membrane proteins of the virus. The variable domains of the induced heavy chain antibodies were selected from M13 phage display libraries developed from isolated RNA. Selection via biopanning on the L1 antigen produced single domain antibodies that were specific and had affinities ranging from 4×10(-9 M to 7.0×10(-10 M, as determined by surface plasmon resonance. Several showed good ability to refold after heat denaturation. These L1-binding single domain antibodies, however, failed to recognize the killed vaccinia antigen. Useful vaccinia binding single domain antibodies were isolated by a second selection using the killed virus as the target. The virus binding single domain antibodies were incorporated in sandwich assays as both capture and tracer using the MAGPIX system yielding limits of detection down to 4×10(5 pfu/ml, a four-fold improvement over the limit obtained using conventional antibodies. This work demonstrates the development of anti-vaccinia single domain antibodies and their incorporation into sandwich assays for viral detection. It also highlights the properties of high affinity and thermal stability that are hallmarks of single domain antibodies.
Vitreous humor analysis for the detection of xenobiotics in forensic toxicology: a review.
Bévalot, Fabien; Cartiser, Nathalie; Bottinelli, Charline; Fanton, Laurent; Guitton, Jérôme
2016-01-01
Vitreous humor (VH) is a gelatinous substance contained in the posterior chamber of the eye, playing a mechanical role in the eyeball. It has been the subject of numerous studies in various forensic applications, primarily for the assessment of postmortem interval and for postmortem chemical analysis. Since most of the xenobiotics present in the bloodstream are detected in VH after crossing the selective blood-retinal barrier, VH is an alternative matrix useful for forensic toxicology. VH analysis offers particular advantages over other biological matrices: it is less prone to postmortem redistribution, is easy to collect, has relatively few interfering compounds for the analytical process, and shows sample stability over time after death. The present study is an overview of VH physiology, drug transport and elimination. Collection, storage, analytical techniques and interpretation of results from qualitative and quantitative points of view are dealt with. The distribution of xenobiotics in VH samples is thus discussed and illustrated by a table reporting the concentrations of 106 drugs from more than 300 case reports. For this purpose, a survey was conducted of publications found in the MEDLINE database from 1969 through April 30, 2015.
Natural Language Search Interfaces: Health Data Needs Single-Field Variable Search.
Jay, Caroline; Harper, Simon; Dunlop, Ian; Smith, Sam; Sufi, Shoaib; Goble, Carole; Buchan, Iain
2016-01-14
Data discovery, particularly the discovery of key variables and their inter-relationships, is key to secondary data analysis, and in-turn, the evolving field of data science. Interface designers have presumed that their users are domain experts, and so they have provided complex interfaces to support these "experts." Such interfaces hark back to a time when searches needed to be accurate first time as there was a high computational cost associated with each search. Our work is part of a governmental research initiative between the medical and social research funding bodies to improve the use of social data in medical research. The cross-disciplinary nature of data science can make no assumptions regarding the domain expertise of a particular scientist, whose interests may intersect multiple domains. Here we consider the common requirement for scientists to seek archived data for secondary analysis. This has more in common with search needs of the "Google generation" than with their single-domain, single-tool forebears. Our study compares a Google-like interface with traditional ways of searching for noncomplex health data in a data archive. Two user interfaces are evaluated for the same set of tasks in extracting data from surveys stored in the UK Data Archive (UKDA). One interface, Web search, is "Google-like," enabling users to browse, search for, and view metadata about study variables, whereas the other, traditional search, has standard multioption user interface. Using a comprehensive set of tasks with 20 volunteers, we found that the Web search interface met data discovery needs and expectations better than the traditional search. A task × interface repeated measures analysis showed a main effect indicating that answers found through the Web search interface were more likely to be correct (F1,19=37.3, Pnatural language search interfaces for variable search supporting in particular: query reformulation; data browsing; faceted search; surrogates; relevance
Autonomic Differentiation Map: A Novel Statistical Tool for Interpretation of Heart Rate Variability
Directory of Open Access Journals (Sweden)
Daniela Lucini
2018-04-01
Full Text Available In spite of the large body of evidence suggesting Heart Rate Variability (HRV alone or combined with blood pressure variability (providing an estimate of baroreflex gain as a useful technique to assess the autonomic regulation of the cardiovascular system, there is still an ongoing debate about methodology, interpretation, and clinical applications. In the present investigation, we hypothesize that non-parametric and multivariate exploratory statistical manipulation of HRV data could provide a novel informational tool useful to differentiate normal controls from clinical groups, such as athletes, or subjects affected by obesity, hypertension, or stress. With a data-driven protocol in 1,352 ambulant subjects, we compute HRV and baroreflex indices from short-term data series as proxies of autonomic (ANS regulation. We apply a three-step statistical procedure, by first removing age and gender effects. Subsequently, by factor analysis, we extract four ANS latent domains that detain the large majority of information (86.94%, subdivided in oscillatory (40.84%, amplitude (18.04%, pressure (16.48%, and pulse domains (11.58%. Finally, we test the overall capacity to differentiate clinical groups vs. control. To give more practical value and improve readability, statistical results concerning individual discriminant ANS proxies and ANS differentiation profiles are displayed through peculiar graphical tools, i.e., significance diagram and ANS differentiation map, respectively. This approach, which simultaneously uses all available information about the system, shows what domains make up the difference in ANS discrimination. e.g., athletes differ from controls in all domains, but with a graded strength: maximal in the (normalized oscillatory and in the pulse domains, slightly less in the pressure domain and minimal in the amplitude domain. The application of multiple (non-parametric and exploratory statistical and graphical tools to ANS proxies defines
The Ventasso Horse: genetic characterization by microsatellites markers
Directory of Open Access Journals (Sweden)
M. Blasi
2010-04-01
Full Text Available The genetic structure of Ventasso Horse (VH was investigated using 12 microsatellites. The analyses were carried out on 117 VH individuals and the results were compared with those obtained analysing 11 other breeds reared in Italy. All microsatellites were polymorphic in VH and in the other breeds. A total of 124 alleles (from 6 to 19 alleles per microsatellite were detected. Average heterozygosity was 0.743 in VH and ranged from 0.613 to 0.759 in the other breeds. The mean FST value had an average value of 0.0932. Genetic distances were calculated using Nei’s standard genetic distance (Ds. The smallest Ds values were found between VH and Anglo-Arab, Thoroughbred, Maremmano and Lipizzan horse breeds. Phylogenetic trees constructed using neighbour-joining method showed two clear separate clusters: the first includes Bardigiano, Haflinger and Italian Heavy Draught Horse, the second contains the other 9 breeds.
Tesfaye, Kindie; Jaleta, Moti; Jena, Pradyot; Mutenje, Munyaradzi
2015-02-01
Conservation agriculture (CA) is being promoted as an option for reducing soil degradation, conserving water, enhancing crop productivity, and maintaining yield stability. However, CA is a knowledge- and technology-intensive practice, and may not be feasible or may not perform better than conventional agriculture under all conditions and farming systems. Using high resolution (≈1 km2) biophysical and socioeconomic geospatial data, this study identified potential recommendation domains (RDs) for CA in Ethiopia, Kenya, and Malawi. The biophysical variables used were soil texture, surface slope, and rainfall while the socioeconomic variables were market access and human and livestock population densities. Based on feasibility and comparative performance of CA over conventional agriculture, the biophysical and socioeconomic factors were first used to classify cultivated areas into three biophysical and three socioeconomic potential domains, respectively. Combinations of biophysical and socioeconomic domains were then used to develop potential RDs for CA based on adoption potential within the cultivated areas. About 39, 12, and 5 % of the cultivated areas showed high biophysical and socioeconomic potential while 50, 39, and 21 % of the cultivated areas showed high biophysical and medium socioeconomic potential for CA in Malawi, Kenya, and Ethiopia, respectively. The results indicate considerable acreages of land with high CA adoption potential in the mixed crop-livestock systems of the studied countries. However, there are large differences among countries depending on biophysical and socio-economic conditions. The information generated in this study could be used for targeting CA and prioritizing CA-related agricultural research and investment priorities in the three countries.
Interoperable domain models : The ISO land administration domain model LADM and its external classes
Lemmen, C.H.J.; Van Oosterom, P.J.M.; Uitermark, H.T.; Zevenbergen, J.A.; Cooper, A.K.
2011-01-01
This paper provides a brief overview of one of the first spatial domain standards: a standard for the domain of Land Administration (LA). This standard is in the draft stage of development now (May 2011). The development of domain standards is a logical follow up after domain-independent standards,
Heads, James T; Adams, Ralph; D'Hooghe, Lena E; Page, Matt J T; Humphreys, David P; Popplewell, Andrew G; Lawson, Alastair D; Henry, Alistair J
2012-01-01
The stability of therapeutic antibodies is a prime pharmaceutical concern. In this work we examined thermal stability differences between human IgG1 and IgG4 Fab domains containing the same variable regions using the thermofluor assay. It was found that the IgG1 Fab domain is up to 11°C more stable than the IgG4 Fab domain containing the same variable region. We investigated the cause of this difference with the aim of developing a molecule with the enhanced stability of the IgG1 Fab and the biological properties of an IgG4 Fc. We found that replacing the seven residues, which differ between IgG1 CH1 and IgG4 CH1 domains, while retaining the native IgG1 light-heavy interchain disulfide (L–H) bond, did not affect thermal stability. Introducing the IgG1 type L–H interchain disulfide bond (DSB) into the IgG4 Fab resulted in an increase in thermal stability to levels observed in the IgG1 Fab with the same variable region. Conversely, replacement of the IgG1 L–H interchain DSB with the IgG4 type L–H interchain DSB reduced the thermal stability. We utilized the increased stability of the IgG1 Fab and designed a hybrid antibody with an IgG1 CH1 linked to an IgG4 Fc via an IgG1 hinge. This construct has the expected biophysical properties of both the IgG4 Fc and IgG1 Fab domains and may therefore be a pharmaceutically relevant format. PMID:22761163
Review and classification of variability analysis techniques with clinical applications
2011-01-01
Analysis of patterns of variation of time-series, termed variability analysis, represents a rapidly evolving discipline with increasing applications in different fields of science. In medicine and in particular critical care, efforts have focussed on evaluating the clinical utility of variability. However, the growth and complexity of techniques applicable to this field have made interpretation and understanding of variability more challenging. Our objective is to provide an updated review of variability analysis techniques suitable for clinical applications. We review more than 70 variability techniques, providing for each technique a brief description of the underlying theory and assumptions, together with a summary of clinical applications. We propose a revised classification for the domains of variability techniques, which include statistical, geometric, energetic, informational, and invariant. We discuss the process of calculation, often necessitating a mathematical transform of the time-series. Our aims are to summarize a broad literature, promote a shared vocabulary that would improve the exchange of ideas, and the analyses of the results between different studies. We conclude with challenges for the evolving science of variability analysis. PMID:21985357
Review and classification of variability analysis techniques with clinical applications.
Bravi, Andrea; Longtin, André; Seely, Andrew J E
2011-10-10
Analysis of patterns of variation of time-series, termed variability analysis, represents a rapidly evolving discipline with increasing applications in different fields of science. In medicine and in particular critical care, efforts have focussed on evaluating the clinical utility of variability. However, the growth and complexity of techniques applicable to this field have made interpretation and understanding of variability more challenging. Our objective is to provide an updated review of variability analysis techniques suitable for clinical applications. We review more than 70 variability techniques, providing for each technique a brief description of the underlying theory and assumptions, together with a summary of clinical applications. We propose a revised classification for the domains of variability techniques, which include statistical, geometric, energetic, informational, and invariant. We discuss the process of calculation, often necessitating a mathematical transform of the time-series. Our aims are to summarize a broad literature, promote a shared vocabulary that would improve the exchange of ideas, and the analyses of the results between different studies. We conclude with challenges for the evolving science of variability analysis.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK209 (Link to dictyBase) - - - Contig-U16260-1 VHK209P (Link to Original site) VHK2...09F 573 VHK209Z 765 VHK209P 1318 - - Show VHK209 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK209Q.Seq.d/ Representative seq. ID VHK2...09P (Link to Original site) Representative DNA sequence >VHK209 (VHK209Q) /CSM/VH/VHK2-A/VHK2...Sequences producing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k2
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK221 (Link to dictyBase) - - - - VHK221P (Link to Original site) VHK221F 603 VHK2...21Z 724 VHK221P 1307 - - Show VHK221 Library VH (Link to library) Clone ID VHK221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK221Q.Seq.d/ Representative seq. ID VHK221P (Link to... Original site) Representative DNA sequence >VHK221 (VHK221Q) /CSM/VH/VHK2-A/VHK221Q.Seq.d/ AACTCTCGAGTGCAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK207 (Link to dictyBase) - - - Contig-U16260-1 VHK207P (Link to Original site) VHK2...07F 371 VHK207Z 713 VHK207P 1064 - - Show VHK207 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK207Q.Seq.d/ Representative seq. ID VHK2...07P (Link to Original site) Representative DNA sequence >VHK207 (VHK207Q) /CSM/VH/VHK2-A/VHK2...ducing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3'
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK211 (Link to dictyBase) - - - - VHK211P (Link to Original site) VHK211F 605 VHK2...11Z 118 VHK211P 703 - - Show VHK211 Library VH (Link to library) Clone ID VHK211 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK211Q.Seq.d/ Representative seq. ID VHK211P (Link to ...Original site) Representative DNA sequence >VHK211 (VHK211Q) /CSM/VH/VHK2-A/VHK211Q.Seq.d/ AACTCTCGAGTGCAAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK279 (Link to dictyBase) - - - - VHK279P (Link to Original site) VHK279F 619 VHK2...79Z 149 VHK279P 748 - - Show VHK279 Library VH (Link to library) Clone ID VHK279 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-D/VHK279Q.Seq.d/ Representative seq. ID VHK279P (Link to ...Original site) Representative DNA sequence >VHK279 (VHK279Q) /CSM/VH/VHK2-D/VHK279Q.Seq.d/ AACTCTCGAGTGCAAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK278 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...78F 533 - - - - - - Show VHK278 Library VH (Link to library) Clone ID VHK278 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK278Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK278 (VHK278Q) /CSM/VH/VHK2-D/VHK278Q.Seq.d/ AACTCTCGAGTGCAAAA...BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 997 0.0 1 ( BJ427874 ) Dictyostelium discoideum cDNA clone:ddv63k2
Indian monsoon variability on millennial-orbital timescales.
Kathayat, Gayatri; Cheng, Hai; Sinha, Ashish; Spötl, Christoph; Edwards, R Lawrence; Zhang, Haiwei; Li, Xianglei; Yi, Liang; Ning, Youfeng; Cai, Yanjun; Lui, Weiguo Lui; Breitenbach, Sebastian F M
2016-04-13
The Indian summer monsoon (ISM) monsoon is critical to billions of people living in the region. Yet, significant debates remain on primary ISM drivers on millennial-orbital timescales. Here, we use speleothem oxygen isotope (δ(18)O) data from Bittoo cave, Northern India to reconstruct ISM variability over the past 280,000 years. We find strong coherence between North Indian and Chinese speleothem δ(18)O records from the East Asian monsoon domain, suggesting that both Asian monsoon subsystems exhibit a coupled response to changes in Northern Hemisphere summer insolation (NHSI) without significant temporal lags, supporting the view that the tropical-subtropical monsoon variability is driven directly by precession-induced changes in NHSI. Comparisons of the North Indian record with both Antarctic ice core and sea-surface temperature records from the southern Indian Ocean over the last glacial period do not suggest a dominant role of Southern Hemisphere climate processes in regulating the ISM variability on millennial-orbital timescales.
A One-Layer Recurrent Neural Network for Constrained Complex-Variable Convex Optimization.
Qin, Sitian; Feng, Jiqiang; Song, Jiahui; Wen, Xingnan; Xu, Chen
2018-03-01
In this paper, based on calculus and penalty method, a one-layer recurrent neural network is proposed for solving constrained complex-variable convex optimization. It is proved that for any initial point from a given domain, the state of the proposed neural network reaches the feasible region in finite time and converges to an optimal solution of the constrained complex-variable convex optimization finally. In contrast to existing neural networks for complex-variable convex optimization, the proposed neural network has a lower model complexity and better convergence. Some numerical examples and application are presented to substantiate the effectiveness of the proposed neural network.
Short- and long-term variations in non-linear dynamics of heart rate variability
DEFF Research Database (Denmark)
Kanters, J K; Højgaard, M V; Agner, E
1996-01-01
OBJECTIVES: The purpose of the study was to investigate the short- and long-term variations in the non-linear dynamics of heart rate variability, and to determine the relationships between conventional time and frequency domain methods and the newer non-linear methods of characterizing heart rate...... rate and describes mainly linear correlations. Non-linear predictability is correlated with heart rate variability measured as the standard deviation of the R-R intervals and the respiratory activity expressed as power of the high-frequency band. The dynamics of heart rate variability changes suddenly...
Domain architecture conservation in orthologs
2011-01-01
Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the
International Nuclear Information System (INIS)
Sato, S.; Kumagai, S.; Sugita, R.
2015-01-01
In this paper, in order to confirm the sub-domain structure in stacked media demagnetized with in-plane field, initial magnetization curves and magnetic domain size distribution were investigated. Both experimental and simulation results showed that an initial magnetization curve for the medium demagnetized with in-plane field (MDI) initially rose faster than that for the medium demagnetized with perpendicular field (MDP). It is inferred that this is because the MDI has a larger number of domain walls than the MDP due to the existence of the sub-domains, resulting in an increase in the probability of domain wall motion. Dispersion of domain size for the MDI was larger than that for the MDP. This is because sub-domains are formed not only inside the domain but also at the domain boundary region, and they change the position of the domain boundary to affect the domain size. - Highlights: • An initial magnetization curve for MDI initially rose faster than that for MDP. • Dispersion of domain size for the MDI was larger than that for the MDP. • Experimental and simulation results can be explained by existence of sub-domains
Stability and Variability in Aesthetic Experience: A Review
Jacobsen, Thomas; Beudt, Susan
2017-01-01
Based on psychophysics’ pragmatic dualism, we trace the cognitive neuroscience of stability and variability in aesthetic experience. With regard to different domains of aesthetic processing, we touch upon the relevance of cognitive schemata for aesthetic preference. Attitudes and preferences are explored in detail. Evolutionary constraints on attitude formation or schema generation are elucidated, just as the often seemingly arbitrary influences of social, societal, and cultural nature are. A...
A Review of Domain Modelling and Domain Imaging Techniques in Ferroelectric Crystals
Directory of Open Access Journals (Sweden)
John E. Huber
2011-02-01
Full Text Available The present paper reviews models of domain structure in ferroelectric crystals, thin films and bulk materials. Common crystal structures in ferroelectric materials are described and the theory of compatible domain patterns is introduced. Applications to multi-rank laminates are presented. Alternative models employing phase-field and related techniques are reviewed. The paper then presents methods of observing ferroelectric domain structure, including optical, polarized light, scanning electron microscopy, X-ray and neutron diffraction, atomic force microscopy and piezo-force microscopy. Use of more than one technique for unambiguous identification of the domain structure is also described.
Chemical Shift Assignments of the C-terminal Eps15 Homology Domain-3 EH Domain*
Caplan, Steve; Sorgen, Paul L.
2013-01-01
The C-terminal Eps15 homology (EH) domain 3 (EHD3) belongs to a eukaryotic family of endocytic regulatory proteins and is involved in the recycling of various receptors from the early endosome to the endocytic recycling compartment or in retrograde transport from the endosomes to the Golgi. EH domains are highly conserved in the EHD family and function as protein-protein interaction units that bind to Asn-Pro-Phe (NPF) motif-containing proteins. The EH domain of EHD1 was the first C-terminal EH domain from the EHD family to be solved by NMR. The differences observed between this domain and proteins with N-terminal EH domains helped describe a mechanism for the differential binding of NPF-containing proteins. Here, structural studies were expanded to include the EHD3 EH domain. While the EHD1 and EHD3 EH domains are highly homologous, they have different protein partners. A comparison of these structures will help determine the selectivity in protein binding between the EHD family members and lead to a better understanding of their unique roles in endocytic regulation. PMID:23754701
Simplicity and Specificity in Language: Domain-General Biases Have Domain-Specific Effects
Culbertson, Jennifer; Kirby, Simon
2016-01-01
The extent to which the linguistic system—its architecture, the representations it operates on, the constraints it is subject to—is specific to language has broad implications for cognitive science and its relation to evolutionary biology. Importantly, a given property of the linguistic system can be “specific” to the domain of language in several ways. For example, if the property evolved by natural selection under the pressure of the linguistic function it serves then the property is domain-specific in the sense that its design is tailored for language. Equally though, if that property evolved to serve a different function or if that property is domain-general, it may nevertheless interact with the linguistic system in a way that is unique. This gives a second sense in which a property can be thought of as specific to language. An evolutionary approach to the language faculty might at first blush appear to favor domain-specificity in the first sense, with individual properties of the language faculty being specifically linguistic adaptations. However, we argue that interactions between learning, culture, and biological evolution mean any domain-specific adaptations that evolve will take the form of weak biases rather than hard constraints. Turning to the latter sense of domain-specificity, we highlight a very general bias, simplicity, which operates widely in cognition and yet interacts with linguistic representations in domain-specific ways. PMID:26793132
Directory of Open Access Journals (Sweden)
Roselyn Kahindi
2017-12-01
Full Text Available Two 14-day experiments, each with 90 (Duroc × [Yorkshire × Landrace]; 7.3 ± 0.6 kg piglets, were conducted to determine the optimum sulfur amino acid (SAA to lysine (Lys ratio (SAA:Lys for piglets when reared under clean or unclean sanitary conditions using performance and non-performance response criteria. Piglets were randomly assigned to the following dietary treatments. The basal diet contained 1.18% standardized ileal digestible (SID Lys, and the SAA:Lys was 52%. In diets 2 to 5, the basal diet was supplemented with 4 graded levels of dl-Met to make SAA:Lys of 56%, 60%, 64% and 68%. In Exp. 1, piglets were housed in disinfected clean room. In Exp. 2, piglets were housed in a room previously occupied by other pigs and was not disinfected. On the last day, blood was collected to measure plasma urea nitrogen (PUN and one pig per pen was euthanized to collect jejunal tissue to measure villus height (VH, crypt depth (CD, and VH:CD. In Exp. 1, increasing SAA:Lys linearly and quadratically increased VH and VH:CD (P < 0.05. In Exp. 2, increasing SAA:Lys linearly increased (P < 0.05 VH and VH:CD and linearly and quadratically decreased PUN (P < 0.05. Estimated PUN and VH-based optimum SAA:Lys requirements for clean and unclean sanitary condition were 60%, 63% and 66%, respectively.
Wilson, Rea; Collerton, Daniel; Freeston, Mark; Christodoulides, Thomas; Dudley, Robert
2016-07-01
People with psychosis often report distressing visual hallucinations (VH). In contrast to auditory hallucinations, there is little empirical evidence on effective interventions. The effectiveness of a novel-focused cognitive-behavioural therapy (CBT) intervention for VH was explored using a multiple baseline single case design with four participants. Change to individual appraisals, emotional and behavioural responses to VH were measured with daily diaries kept throughout the baseline and intervention phase lasting up to 16 sessions. Maintenance of change was tracked during a follow-up period of one month. Changes in appraisals, distress and response in accordance with the theory was evident in two out of four of the cases. However, change occurred within the baseline phase that limited the conclusions that change could be attributed to CBT alone. There was some evidence of clinically significant change and reliable change for two out of four of the cases at follow-up on one of the standardized psychiatric assessments. The research reported here has theoretical and clinical implications for refinement of the model and interventions for distressing VH. Copyright © 2015 John Wiley & Sons, Ltd. Distressing visual hallucinations (VH) are a relatively common symptom of psychosis. Visual hallucinations seem to be associated with greater impairment and disability. We have no specific treatment for VH. The appraisal of the visual experience and the behavioural response is important in maintaining the distress. Cognitive-behavioural therapy for VH at present has limited value. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Ali Riazi
Full Text Available Campylobacter jejuni is the leading cause of bacterial foodborne illness in the world, with symptoms ranging from acute diarrhea to severe neurological disorders. Contaminated poultry meat is a major source of C. jejuni infection, and therefore, strategies to reduce this organism in poultry, are expected to reduce the incidence of Campylobacter-associated diseases. We have investigated whether oral administration of C. jejuni-specific single-domain antibodies would reduce bacterial colonization levels in chickens. Llama single-domain antibodies specific for C. jejuni were isolated from a phage display library generated from the heavy chain IgG variable domain repertoire of a llama immunized with C. jejuni flagella. Two flagella-specific single-domain antibodies were pentamerized to yield high avidity antibodies capable of multivalent binding to the target antigen. When administered orally to C. jejuni-infected two-day old chicks, the pentabodies significantly reduced C. jejuni colonization in the ceca. In vitro, the motility of the bacteria was also reduced in the presence of the flagella-specific pentabodies, suggesting the mechanism of action is through either direct interference with flagellar motility or antibody-mediated aggregation. Fluorescent microscopy and Western blot analyses revealed specific binding of the anti-flagella pentabodies to the C. jejuni flagellin.
Towards a minimal generic set of domains of functioning and health.
Cieza, Alarcos; Oberhauser, Cornelia; Bickenbach, Jerome; Chatterji, Somnath; Stucki, Gerold
2014-03-03
The World Health Organization (WHO) has argued that functioning, and, more concretely, functioning domains constitute the operationalization that best captures our intuitive notion of health. Functioning is, therefore, a major public-health goal. A great deal of data about functioning is already available. Nonetheless, it is not possible to compare and optimally utilize this information. One potential approach to address this challenge is to propose a generic and minimal set of functioning domains that captures the experience of individuals and populations with respect to functioning and health. The objective of this investigation was to identify a minimal generic set of ICF domains suitable for describing functioning in adults at both the individual and population levels. We performed a psychometric study using data from: 1) the German National Health Interview and Examination Survey 1998, 2) the United States National Health and Nutrition Examination Survey 2007/2008, and 3) the ICF Core Set studies. Random Forests and Group Lasso regression were applied using one self-reported general-health question as a dependent variable. The domains selected were compared to those of the World Health Survey (WHS) developed by the WHO. Seven domains of the International Classification of Functioning, Disability and Health (ICF) are proposed as a minimal generic set of functioning and health: energy and drive functions, emotional functions, sensation of pain, carrying out daily routine, walking, moving around, and remunerative employment. The WHS domains of self-care, cognition, interpersonal activities, and vision were not included in our selection. The minimal generic set proposed in this study is the starting point to address one of the most important challenges in health measurement--the comparability of data across studies and countries. It also represents the first step in developing a common metric of health to link information from the general population to information
Isolation of highly active monoclonal antibodies against multiresistant gram-positive bacteria.
Directory of Open Access Journals (Sweden)
Friederike S Rossmann
Full Text Available Multiresistant nosocomial pathogens often cause life-threatening infections that are sometimes untreatable with currently available antibiotics. Staphylococci and enterococci are the predominant Gram-positive species associated with hospital-acquired infections. These infections often lead to extended hospital stay and excess mortality. In this study, a panel of fully human monoclonal antibodies was isolated from a healthy individual by selection of B-cells producing antibodies with high opsonic killing against E. faecalis 12030. Variable domains (VH and VL of these immunoglobulin genes were amplified by PCR and cloned into an eukaryotic expression vector containing the constant domains of a human IgG1 molecule and the human lambda constant domain. These constructs were transfected into CHO cells and culture supernatants were collected and tested by opsonophagocytic assay against E. faecalis and S. aureus strains (including MRSA. At concentrations of 600 pg/ml, opsonic killing was between 40% and 70% against all strains tested. Monoclonal antibodies were also evaluated in a mouse sepsis model (using S. aureus LAC and E. faecium, a mouse peritonitis model (using S. aureus Newman and LAC and a rat endocarditis model (using E. faecalis 12030 and were shown to provide protection in all models at a concentration of 4 μg/kg per animal. Here we present a method to produce fully human IgG1 monoclonal antibodies that are opsonic in vitro and protective in vivo against several multiresistant Gram-positive bacteria. The monoclonal antibodies presented in this study are significantly more effective compared to another monoclonal antibody currently in clinical trials.
SH2-catalytic domain linker heterogeneity influences allosteric coupling across the SFK family.
Register, A C; Leonard, Stephen E; Maly, Dustin J
2014-11-11
Src-family kinases (SFKs) make up a family of nine homologous multidomain tyrosine kinases whose misregulation is responsible for human disease (cancer, diabetes, inflammation, etc.). Despite overall sequence homology and identical domain architecture, differences in SH3 and SH2 regulatory domain accessibility and ability to allosterically autoinhibit the ATP-binding site have been observed for the prototypical SFKs Src and Hck. Biochemical and structural studies indicate that the SH2-catalytic domain (SH2-CD) linker, the intramolecular binding epitope for SFK SH3 domains, is responsible for allosterically coupling SH3 domain engagement to autoinhibition of the ATP-binding site through the conformation of the αC helix. As a relatively unconserved region between SFK family members, SH2-CD linker sequence variability across the SFK family is likely a source of nonredundant cellular functions between individual SFKs via its effect on the availability of SH3 and SH2 domains for intermolecular interactions and post-translational modification. Using a combination of SFKs engineered with enhanced or weakened regulatory domain intramolecular interactions and conformation-selective inhibitors that report αC helix conformation, this study explores how SH2-CD sequence heterogeneity affects allosteric coupling across the SFK family by examining Lyn, Fyn1, and Fyn2. Analyses of Fyn1 and Fyn2, isoforms that are identical but for a 50-residue sequence spanning the SH2-CD linker, demonstrate that SH2-CD linker sequence differences can have profound effects on allosteric coupling between otherwise identical kinases. Most notably, a dampened allosteric connection between the SH3 domain and αC helix leads to greater autoinhibitory phosphorylation by Csk, illustrating the complex effects of SH2-CD linker sequence on cellular function.
The framing of scientific domains
DEFF Research Database (Denmark)
Dam Christensen, Hans
2014-01-01
domains, and UNISIST helps understanding this navigation. Design/methodology/approach The UNISIST models are tentatively applied to the domain of art history at three stages, respectively two modern, partially overlapping domains, as well as an outline of an art historical domain anno c1820...
Protein domain organisation: adding order.
Kummerfeld, Sarah K; Teichmann, Sarah A
2009-01-29
Domains are the building blocks of proteins. During evolution, they have been duplicated, fused and recombined, to produce proteins with novel structures and functions. Structural and genome-scale studies have shown that pairs or groups of domains observed together in a protein are almost always found in only one N to C terminal order and are the result of a single recombination event that has been propagated by duplication of the multi-domain unit. Previous studies of domain organisation have used graph theory to represent the co-occurrence of domains within proteins. We build on this approach by adding directionality to the graphs and connecting nodes based on their relative order in the protein. Most of the time, the linear order of domains is conserved. However, using the directed graph representation we have identified non-linear features of domain organization that are over-represented in genomes. Recognising these patterns and unravelling how they have arisen may allow us to understand the functional relationships between domains and understand how the protein repertoire has evolved. We identify groups of domains that are not linearly conserved, but instead have been shuffled during evolution so that they occur in multiple different orders. We consider 192 genomes across all three kingdoms of life and use domain and protein annotation to understand their functional significance. To identify these features and assess their statistical significance, we represent the linear order of domains in proteins as a directed graph and apply graph theoretical methods. We describe two higher-order patterns of domain organisation: clusters and bi-directionally associated domain pairs and explore their functional importance and phylogenetic conservation. Taking into account the order of domains, we have derived a novel picture of global protein organization. We found that all genomes have a higher than expected degree of clustering and more domain pairs in forward and
Protein domain organisation: adding order
Directory of Open Access Journals (Sweden)
Kummerfeld Sarah K
2009-01-01
Full Text Available Abstract Background Domains are the building blocks of proteins. During evolution, they have been duplicated, fused and recombined, to produce proteins with novel structures and functions. Structural and genome-scale studies have shown that pairs or groups of domains observed together in a protein are almost always found in only one N to C terminal order and are the result of a single recombination event that has been propagated by duplication of the multi-domain unit. Previous studies of domain organisation have used graph theory to represent the co-occurrence of domains within proteins. We build on this approach by adding directionality to the graphs and connecting nodes based on their relative order in the protein. Most of the time, the linear order of domains is conserved. However, using the directed graph representation we have identified non-linear features of domain organization that are over-represented in genomes. Recognising these patterns and unravelling how they have arisen may allow us to understand the functional relationships between domains and understand how the protein repertoire has evolved. Results We identify groups of domains that are not linearly conserved, but instead have been shuffled during evolution so that they occur in multiple different orders. We consider 192 genomes across all three kingdoms of life and use domain and protein annotation to understand their functional significance. To identify these features and assess their statistical significance, we represent the linear order of domains in proteins as a directed graph and apply graph theoretical methods. We describe two higher-order patterns of domain organisation: clusters and bi-directionally associated domain pairs and explore their functional importance and phylogenetic conservation. Conclusion Taking into account the order of domains, we have derived a novel picture of global protein organization. We found that all genomes have a higher than expected
The Rapamycin-Binding Domain of the Protein Kinase mTOR is a Destabilizing Domain*
Edwards, Sarah R.; Wandless, Thomas J.
2013-01-01
Rapamycin is an immunosuppressive drug that binds simultaneously to the 12-kDa FK506- and rapamycin-binding protein (FKBP12, or FKBP) and the FKBP-rapamycin binding domain (FRB) of the mammalian target of rapamycin (mTOR) kinase. The resulting ternary complex has been used to conditionally perturb protein function, and one such method involves perturbation of a protein of interest through its mislocalization. We synthesized two rapamycin derivatives that possess large substituents at the C16 position within the FRB-binding interface, and these derivatives were screened against a library of FRB mutants using a three-hybrid assay in Saccharomyces cerevisiae. Several FRB mutants responded to one of the rapamycin derivatives, and twenty of these mutants were further characterized in mammalian cells. The mutants most responsive to the ligand were fused to yellow fluorescent protein, and fluorescence levels in the presence and absence of the ligand were measured to determine stability of the fusion proteins. Wild-type and mutant FRB domains were expressed at low levels in the absence of the rapamycin derivative, and expression levels rose up to ten-fold upon treatment with ligand. The synthetic rapamycin derivatives were further analyzed using quantitative mass spectrometry, and one of the compounds was found to contain contaminating rapamycin. Furthermore, uncontaminated analogs retain the ability to inhibit mTOR, albeit with diminished potency relative to rapamycin. The ligand-dependent stability displayed by wildtype FRB and FRB mutants as well as the inhibitory potential and purity of the rapamycin derivatives should be considered as potentially confounding experimental variables when using these systems. PMID:17350953
Laparoscopic and vaginal approaches to hysterectomy in the obese.
Bogani, Giorgio; Cromi, Antonella; Serati, Maurizio; Di Naro, Edoardo; Casarin, Jvan; Pinelli, Ciro; Uccella, Stefano; Leone Roberti Maggiore, Umberto; Marconi, Nicola; Ghezzi, Fabio
2015-06-01
The aim of the study was to compare surgery-related outcomes between laparoscopic (LH) and vaginal (VH) hysterectomy, performed for benign uterine disease (other than pelvic organs prolapse) in obese women. Data of consecutive obese (BMI≥30) patients undergoing LH and VH, between 2000 and 2013, were compared using a propensity-matched analysis. One hundred propensity-matched patient pairs (200 patients) undergoing LH (n=100) and VH (n=100) represented the study group. Baseline demographic characteristics were similar between groups. Patients undergoing LH experienced similar operative time (87.5 (25-360) vs. 85 (25-240)min; p=0.28), slightly lower blood loss (100 (10-3200) vs. 150 (10-800)ml; p=0.006) and shorter length of hospital stay (1 (1-5) vs. 2 (1-5) days; p<0.001) than women undergoing VH. There was no statistically significant difference between LH and VH in complication rate (3% for VH vs. 10% for LH; OR: 3.4; 95%CI: 0.95-13.5; p=0.08). At multivariable analysis complication rates increased as BMI increase (OR: 1.01 (1.00-1.02) for 1-unit increase in BMI; p=0.05). Independently, LH correlated with reduced hospital stay (OR: 0.63 (95%CI: 0.49-0.82); p=0.001) and complication rates (OR: 0.91 (95%CI: 0.85-0.97); p=0.01). In obese women affected by benign uterine disease LH and VH should not be denied on the basis of the mere BMI, per se. In this setting, LH upholds effectiveness of VH, improving postoperative outcomes. However, complication rate increases as BMI increase, regardless surgical route. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Tolstrup, Cæcilie Krogsgaard; Husby, Karen Ruben; Lose, Gunnar; Kopp, Tine Iskov; Viborg, Petra Hall; Kesmodel, Ulrik Schiøler; Klarskov, Niels
2018-03-01
This study compares vaginal hysterectomy with uterosacral ligament suspension (VH) with the Manchester-Fothergill procedure (MP) for treating pelvic organ prolapse (POP) in the apical compartment. Our matched historical cohort study is based on data from four Danish databases and the corresponding electronic medical records. Patients with POP surgically treated with VH (n = 295) or the MP (n = 295) in between 2010 and 2014 were matched for age and preoperative POP stage in the apical compartment. The main outcome was recurrent or de novo POP in any compartment. Secondary outcomes were recurrent or de novo POP in each compartment and complications. The risk of recurrent or de novo POP in any compartment was higher after VH (18.3%) compared with the MP (7.8%) (Hazard ratio, HR = 2.5, 95% confidence interval (CI): 1.3-4.8). Recurrence in the apical compartment occurred in 5.1% after VH vs. 0.3% after the MP (hazard ratio (HR) = 10.0, 95% confidence interval (CI) 1.3-78.1). In the anterior compartment, rates of recurrent or de novo POP were 11.2% after VH vs. 4.1% after the MP (HR = 3.5, 95% CI 1.4-8.7) and in the posterior compartment 12.9% vs. 4.7% (HR = 2.6, 95% CI 1.3-5.4), respectively. There were more perioperative complications (2.7 vs. 0%, p = 0.007) and postoperative intra-abdominal bleeding (2 vs. 0%, p = 0.03) after VH. This study shows that the MP is superior to VH; if there is no other indication for hysterectomy, the MP should be preferred to VH for surgical treatment of POP in the apical compartment.
Insights into function of PSI domains from structure of the Met receptor PSI domain
International Nuclear Information System (INIS)
Kozlov, Guennadi; Perreault, Audrey; Schrag, Joseph D.; Park, Morag; Cygler, Miroslaw; Gehring, Kalle; Ekiel, Irena
2004-01-01
PSI domains are cysteine-rich modules found in extracellular fragments of hundreds of signaling proteins, including plexins, semaphorins, integrins, and attractins. Here, we report the solution structure of the PSI domain from the human Met receptor, a receptor tyrosine kinase critical for proliferation, motility, and differentiation. The structure represents a cysteine knot with short regions of secondary structure including a three-stranded antiparallel β-sheet and two α-helices. All eight cysteines are involved in disulfide bonds with the pattern consistent with that for the PSI domain from Sema4D. Comparison with the Sema4D structure identifies a structurally conserved core comprising the N-terminal half of the PSI domain. Interestingly, this part links adjacent SEMA and immunoglobulin domains in the Sema4D structure, suggesting that the PSI domain serves as a wedge between propeller and immunoglobulin domains and is responsible for the correct positioning of the ligand-binding site of the receptor
Resource Unavailability (RU) Per Domain Behavior
Karagiannis, Georgios; Westberg, L.; Bader, A.; Tschofenig, Hannes; Tschofenig, H.
2006-01-01
This draft specifies a Per Domain Behavior that provides the ability to Diffserv nodes located outside Diffserv domain(s), e.g., receiver or other Diffserv enabled router to detect when the resources provided by the Diffserv domain(s) are not available. The unavailability of resources in the domain
Efficient visibility-driven medical image visualisation via adaptive binned visibility histogram.
Jung, Younhyun; Kim, Jinman; Kumar, Ashnil; Feng, David Dagan; Fulham, Michael
2016-07-01
'Visibility' is a fundamental optical property that represents the observable, by users, proportion of the voxels in a volume during interactive volume rendering. The manipulation of this 'visibility' improves the volume rendering processes; for instance by ensuring the visibility of regions of interest (ROIs) or by guiding the identification of an optimal rendering view-point. The construction of visibility histograms (VHs), which represent the distribution of all the visibility of all voxels in the rendered volume, enables users to explore the volume with real-time feedback about occlusion patterns among spatially related structures during volume rendering manipulations. Volume rendered medical images have been a primary beneficiary of VH given the need to ensure that specific ROIs are visible relative to the surrounding structures, e.g. the visualisation of tumours that may otherwise be occluded by neighbouring structures. VH construction and its subsequent manipulations, however, are computationally expensive due to the histogram binning of the visibilities. This limits the real-time application of VH to medical images that have large intensity ranges and volume dimensions and require a large number of histogram bins. In this study, we introduce an efficient adaptive binned visibility histogram (AB-VH) in which a smaller number of histogram bins are used to represent the visibility distribution of the full VH. We adaptively bin medical images by using a cluster analysis algorithm that groups the voxels according to their intensity similarities into a smaller subset of bins while preserving the distribution of the intensity range of the original images. We increase efficiency by exploiting the parallel computation and multiple render targets (MRT) extension of the modern graphical processing units (GPUs) and this enables efficient computation of the histogram. We show the application of our method to single-modality computed tomography (CT), magnetic resonance
International Nuclear Information System (INIS)
Hood, D.M.; Pitzer, R.M.; Schaefer III, H.F.
1979-01-01
Ab initio molecular electronic structure theory has been applied to the family of transition metal tetrahydrides TiH 4 through NiH 4 . For the TiH 4 molecule a wide range of contracted Gaussian basis sets has been tested at the self-consistent-field (SCF) level of theory. The largest basis, labeled M(14s 11p 6d/10s 8p 3d), H(5s 1p/3s 1p), was used for all members of the series and should yield wave functions approaching true Hartree-Fock quality. Predicted SCF dissociation energies (relative to M+4H) and M--H bond distances are TiH 4 132 kcal, 1.70 A; VH 4 86 kcal, 1.64 A; CrH 4 65 kcal, 1.59 A; MnH 4 -- 36 kcal, 1.58 A; FeH 4 0 kcal, 1.58 A; CoH 4 27 kcal, 1.61 A; and NiH 4 18 kcal, 1.75 A. It should be noted immediately that each of these SCF dissociation energies will be increased by electron correlation effects by perhaps as much as 90 kcal. For all of these molecules except TiH 4 excited states have also been studied. One of the most interesting trends seen for these excited states is the shortening of the M--H bond as electrons are transferred from the antibonding 4t 2 orbital to the nonbonding 1e orbitals
Topic Correlation Analysis for Bearing Fault Diagnosis Under Variable Operating Conditions
Chen, Chao; Shen, Fei; Yan, Ruqiang
2017-05-01
This paper presents a Topic Correlation Analysis (TCA) based approach for bearing fault diagnosis. In TCA, Joint Mixture Model (JMM), a model which adapts Probability Latent Semantic Analysis (PLSA), is constructed first. Then, JMM models the shared and domain-specific topics using “fault vocabulary” . After that, the correlations between two kinds of topics are computed and used to build a mapping matrix. Furthermore, a new shared space spanned by the shared and mapped domain-specific topics is set up where the distribution gap between different domains is reduced. Finally, a classifier is trained with mapped features which follow a different distribution and then the trained classifier is tested on target bearing data. Experimental results justify the superiority of the proposed approach over the stat-of-the-art baselines and it can diagnose bearing fault efficiently and effectively under variable operating conditions.
Scalable domain decomposition solvers for stochastic PDEs in high performance computing
International Nuclear Information System (INIS)
Desai, Ajit; Pettit, Chris; Poirel, Dominique; Sarkar, Abhijit
2017-01-01
Stochastic spectral finite element models of practical engineering systems may involve solutions of linear systems or linearized systems for non-linear problems with billions of unknowns. For stochastic modeling, it is therefore essential to design robust, parallel and scalable algorithms that can efficiently utilize high-performance computing to tackle such large-scale systems. Domain decomposition based iterative solvers can handle such systems. And though these algorithms exhibit excellent scalabilities, significant algorithmic and implementational challenges exist to extend them to solve extreme-scale stochastic systems using emerging computing platforms. Intrusive polynomial chaos expansion based domain decomposition algorithms are extended here to concurrently handle high resolution in both spatial and stochastic domains using an in-house implementation. Sparse iterative solvers with efficient preconditioners are employed to solve the resulting global and subdomain level local systems through multi-level iterative solvers. We also use parallel sparse matrix–vector operations to reduce the floating-point operations and memory requirements. Numerical and parallel scalabilities of these algorithms are presented for the diffusion equation having spatially varying diffusion coefficient modeled by a non-Gaussian stochastic process. Scalability of the solvers with respect to the number of random variables is also investigated.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK294 (Link to dictyBase) - - - Contig-U15304-1 VHK294P (Link to Original site) VHK2...94F 611 VHK294Z 780 VHK294P 1371 - - Show VHK294 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK294Q.Seq.d/ Representative seq. ID VHK2...94P (Link to Original site) Representative DNA sequence >VHK294 (VHK294Q) /CSM/VH/VHK2-D/VHK2...yscfyw ns*i*ngsgyf**tfttti Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK294 (VHK2
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK296 (Link to dictyBase) - - - Contig-U16260-1 VHK296P (Link to Original site) VHK2...96F 531 VHK296Z 314 VHK296P 825 - - Show VHK296 Library VH (Link to library) Clone ID VHK2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK296Q.Seq.d/ Representative seq. ID VHK2...96P (Link to Original site) Representative DNA sequence >VHK296 (VHK296Q) /CSM/VH/VHK2-D/VHK2... 5' ... 993 0.0 1 ( BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 993 0.0 1 ( BJ427874 ) D
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK202 (Link to dictyBase) - - - Contig-U16260-1 VHK202P (Link to Original site) VHK2...02F 618 VHK202Z 741 VHK202P 1339 - - Show VHK202 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK202Q.Seq.d/ Representative seq. ID VHK2...02P (Link to Original site) Representative DNA sequence >VHK202 (VHK202Q) /CSM/VH/VHK2-A/VHK2...446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1449 0.0 1 ( BJ446732 ) Dictyostelium discoide
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK254 (Link to dictyBase) - - - Contig-U16260-1 VHK254P (Link to Original site) VHK2...54F 616 VHK254Z 744 VHK254P 1340 - - Show VHK254 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK254Q.Seq.d/ Representative seq. ID VHK2...54P (Link to Original site) Representative DNA sequence >VHK254 (VHK254Q) /CSM/VH/VHK2-C/VHK2...BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1455 0.0 1 ( BJ446732 ) Dictyostelium discoi
Directory of Open Access Journals (Sweden)
Amin R Mazloom
2011-12-01
Full Text Available Coregulator proteins (CoRegs are part of multi-protein complexes that transiently assemble with transcription factors and chromatin modifiers to regulate gene expression. In this study we analyzed data from 3,290 immuno-precipitations (IP followed by mass spectrometry (MS applied to human cell lines aimed at identifying CoRegs complexes. Using the semi-quantitative spectral counts, we scored binary protein-protein and domain-domain associations with several equations. Unlike previous applications, our methods scored prey-prey protein-protein interactions regardless of the baits used. We also predicted domain-domain interactions underlying predicted protein-protein interactions. The quality of predicted protein-protein and domain-domain interactions was evaluated using known binary interactions from the literature, whereas one protein-protein interaction, between STRN and CTTNBP2NL, was validated experimentally; and one domain-domain interaction, between the HEAT domain of PPP2R1A and the Pkinase domain of STK25, was validated using molecular docking simulations. The scoring schemes presented here recovered known, and predicted many new, complexes, protein-protein, and domain-domain interactions. The networks that resulted from the predictions are provided as a web-based interactive application at http://maayanlab.net/HT-IP-MS-2-PPI-DDI/.
Energy Technology Data Exchange (ETDEWEB)
Gaiffe, St
2000-03-23
In this thesis, we are interested in the modeling of fluid flow through porous media with 2-D and 3-D unstructured meshes, and in the use of domain decomposition methods. The behavior of flow through porous media is strongly influenced by heterogeneities: either large-scale lithological discontinuities or quite localized phenomena such as fluid flow in the neighbourhood of wells. In these two typical cases, an accurate consideration of the singularities requires the use of adapted meshes. After having shown the limits of classic meshes we present the future prospects offered by hybrid and flexible meshes. Next, we consider the generalization possibilities of the numerical schemes traditionally used in reservoir simulation and we draw two available approaches: mixed finite elements and U-finite volumes. The investigated phenomena being also characterized by different time-scales, special treatments in terms of time discretization on various parts of the domain are required. We think that the combination of domain decomposition methods with operator splitting techniques may provide a promising approach to obtain high flexibility for a local tune-steps management. Consequently, we develop a new numerical scheme for linear parabolic equations which allows to get a higher flexibility in the local space and time steps management. To conclude, a priori estimates and error estimates on the two variables of interest, namely the pressure and the velocity are proposed. (author)
Full waveform inversion in the frequency domain using classified time-domain residual wavefields
Son, Woohyun; Koo, Nam-Hyung; Kim, Byoung-Yeop; Lee, Ho-Young; Joo, Yonghwan
2017-04-01
We perform the acoustic full waveform inversion in the frequency domain using residual wavefields that have been separated in the time domain. We sort the residual wavefields in the time domain according to the order of absolute amplitudes. Then, the residual wavefields are separated into several groups in the time domain. To analyze the characteristics of the residual wavefields, we compare the residual wavefields of conventional method with those of our residual separation method. From the residual analysis, the amplitude spectrum obtained from the trace before separation appears to have little energy at the lower frequency bands. However, the amplitude spectrum obtained from our strategy is regularized by the separation process, which means that the low-frequency components are emphasized. Therefore, our method helps to emphasize low-frequency components of residual wavefields. Then, we generate the frequency-domain residual wavefields by taking the Fourier transform of the separated time-domain residual wavefields. With these wavefields, we perform the gradient-based full waveform inversion in the frequency domain using back-propagation technique. Through a comparison of gradient directions, we confirm that our separation method can better describe the sub-salt image than the conventional approach. The proposed method is tested on the SEG/EAGE salt-dome model. The inversion results show that our algorithm is better than the conventional gradient based waveform inversion in the frequency domain, especially for deeper parts of the velocity model.
Apoplastic domains and sub-domains in the shoots of etiolated corn seedlings
Epel, B. L.; Bandurski, R. S.
1990-01-01
Light Green, an apoplastic probe, was applied to the cut mesocotyl base or to the cut coleoptile apex of etiolated seedlings of Zea mays L. cv. Silver Queen. Probe transport was measured and its tissue distribution determined. In the mesocotyl, there is an apoplastic barrier between cortex and stele. This barrier creates two apoplastic domains which are non-communicating. A kinetic barrier exists between the apoplast of the mesocotyl stele and that of the coleoptile. This kinetic barrier is not absolute and there is limited communication between the apoplasts of the two regions. This kinetic barrier effectively creates two sub-domains. In the coleoptile, there is communication between the apoplast of the vascular strands and that of the surrounding cortical tissue. No apoplastic communication was observed between the coleoptile cortex and the mesocotyl cortex. Thus, the apoplastic space of the coleoptile cortex is a sub-domain of the integrated coleoptile domain and is separate from that of the apoplastic domain of the mesocotyl cortex.
DIMA 3.0: Domain Interaction Map.
Luo, Qibin; Pagel, Philipp; Vilne, Baiba; Frishman, Dmitrij
2011-01-01
Domain Interaction MAp (DIMA, available at http://webclu.bio.wzw.tum.de/dima) is a database of predicted and known interactions between protein domains. It integrates 5807 structurally known interactions imported from the iPfam and 3did databases and 46,900 domain interactions predicted by four computational methods: domain phylogenetic profiling, domain pair exclusion algorithm correlated mutations and domain interaction prediction in a discriminative way. Additionally predictions are filtered to exclude those domain pairs that are reported as non-interacting by the Negatome database. The DIMA Web site allows to calculate domain interaction networks either for a domain of interest or for entire organisms, and to explore them interactively using the Flash-based Cytoscape Web software.
A NEW TECHNIQUE BASED ON CHAOTIC STEGANOGRAPHY AND ENCRYPTION TEXT IN DCT DOMAIN FOR COLOR IMAGE
Directory of Open Access Journals (Sweden)
MELAD J. SAEED
2013-10-01
Full Text Available Image steganography is the art of hiding information into a cover image. This paper presents a new technique based on chaotic steganography and encryption text in DCT domain for color image, where DCT is used to transform original image (cover image from spatial domain to frequency domain. This technique used chaotic function in two phases; firstly; for encryption secret message, second; for embedding in DCT cover image. With this new technique, good results are obtained through satisfying the important properties of steganography such as: imperceptibility; improved by having mean square error (MSE, peak signal to noise ratio (PSNR and normalized correlation (NC, to phase and capacity; improved by encoding the secret message characters with variable length codes and embedding the secret message in one level of color image only.
Domain fusion analysis by applying relational algebra to protein sequence and domain databases.
Truong, Kevin; Ikura, Mitsuhiko
2003-05-06
Domain fusion analysis is a useful method to predict functionally linked proteins that may be involved in direct protein-protein interactions or in the same metabolic or signaling pathway. As separate domain databases like BLOCKS, PROSITE, Pfam, SMART, PRINTS-S, ProDom, TIGRFAMs, and amalgamated domain databases like InterPro continue to grow in size and quality, a computational method to perform domain fusion analysis that leverages on these efforts will become increasingly powerful. This paper proposes a computational method employing relational algebra to find domain fusions in protein sequence databases. The feasibility of this method was illustrated on the SWISS-PROT+TrEMBL sequence database using domain predictions from the Pfam HMM (hidden Markov model) database. We identified 235 and 189 putative functionally linked protein partners in H. sapiens and S. cerevisiae, respectively. From scientific literature, we were able to confirm many of these functional linkages, while the remainder offer testable experimental hypothesis. Results can be viewed at http://calcium.uhnres.utoronto.ca/pi. As the analysis can be computed quickly on any relational database that supports standard SQL (structured query language), it can be dynamically updated along with the sequence and domain databases, thereby improving the quality of predictions over time.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.
Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei
2016-11-21
Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.
The C-terminal domain of the Bloom syndrome DNA helicase is essential for genomic stability
Directory of Open Access Journals (Sweden)
Noonan James P
2001-07-01
Full Text Available Abstract Background Bloom syndrome is a rare cancer-prone disorder in which the cells of affected persons have a high frequency of somatic mutation and genomic instability. Bloom syndrome cells have a distinctive high frequency of sister chromatid exchange and quadriradial formation. BLM, the protein altered in BS, is a member of the RecQ DNA helicase family, whose members share an average of 40% identity in the helicase domain and have divergent N-terminal and C-terminal flanking regions of variable lengths. The BLM DNA helicase has been shown to localize to the ND10 (nuclear domain 10 or PML (promyelocytic leukemia nuclear bodies, where it associates with TOPIIIα, and to the nucleolus. Results This report demonstrates that the N-terminal domain of BLM is responsible for localization of the protein to the nuclear bodies, while the C-terminal domain directs the protein to the nucleolus. Deletions of the N-terminal domain of BLM have little effect on sister chromatid exchange frequency and chromosome stability as compared to helicase and C-terminal mutations which can increase SCE frequency and chromosome abnormalities. Conclusion The helicase activity and the C-terminal domain of BLM are critical for maintaining genomic stability as measured by the sister chromatid exchange assay. The localization of BLM into the nucleolus by the C-terminal domain appears to be more important to genomic stability than localization in the nuclear bodies.
Girard, Tanya; Gaucher, Denis; El-Far, Mohamed; Breton, Gaëlle; Sékaly, Rafick-Pierre
2014-09-01
CD86 and CD80, the ligands for the co-stimulatory molecules CD28 and CTLA-4, are members of the Ig superfamily. Their structure includes Ig variable-like (IgV) domains, Ig constant-like (IgC) domains and intracellular domains. Although crystallographic studies have clearly identified the IgV domain to be responsible for receptor interactions, earlier studies suggested that both Ig domains are required for full co-signaling function. Herein, we have used deletion and chimeric human CD80 and CD86 molecules in co-stimulation assays to study the impact of the multimeric state of IgV and IgC domains on receptor binding properties and on co-stimulatory function in a peptide-specific T cell activation model. We report for the first time the presence of CD80 dimers and CD86 monomers in living cells. Moreover, we show that the IgC domain of both molecules inhibits multimer formation and greatly affects binding to the co-receptors CD28 and CTLA-4. Finally, both IgC and intracellular domains are required for full co-signaling function. These findings reveal the distinct but complementary roles of CD80 and CD86 IgV and IgC domains in T cell activation. Copyright © 2014 Elsevier B.V. All rights reserved.
Dashper, Stuart G; Mitchell, Helen L; Seers, Christine A; Gladman, Simon L; Seemann, Torsten; Bulach, Dieter M; Chandry, P Scott; Cross, Keith J; Cleal, Steven M; Reynolds, Eric C
2017-01-01
Porphyromonas gingivalis is a keystone pathogen of chronic periodontitis. The virulence of P. gingivalis is reported to be strain related and there are currently a number of strain typing schemes based on variation in capsular polysaccharide, the major and minor fimbriae and adhesin domains of Lys-gingipain (Kgp), amongst other surface proteins. P. gingivalis can exchange chromosomal DNA between strains by natural competence and conjugation. The aim of this study was to determine the genetic variability of P. gingivalis strains sourced from international locations over a 25-year period and to determine if variability in surface virulence factors has a phylogenetic basis. Whole genome sequencing was performed on 13 strains and comparison made to 10 previously sequenced strains. A single nucleotide polymorphism-based phylogenetic analysis demonstrated a shallow tri-lobed phylogeny. There was a high level of reticulation in the phylogenetic network, demonstrating extensive horizontal gene transfer between the strains. Two highly conserved variants of the catalytic domain of the major virulence factor the Kgp proteinase (Kgp cat I and Kgp cat II) were found. There were three variants of the fourth Kgp C-terminal cleaved adhesin domain. Specific variants of the cell surface proteins FimA, FimCDE, MfaI, RagAB, Tpr, and PrtT were also identified. The occurrence of all these variants in the P. gingivalis strains formed a mosaic that was not related to the SNP-based phylogeny. In conclusion P. gingivalis uses domain rearrangements and genetic exchange to generate diversity in specific surface virulence factors.
Directory of Open Access Journals (Sweden)
Zhongquan Li
2017-10-01
Full Text Available Emotion plays an important role in moral judgment, and people always use emotion regulation strategies to modulate emotion, consciously or unconsciously. Previous studies had investigated only the relationship between emotion regulation strategies and moral judgment in the Harm domain, and revealed divergent results. Based on Moral Foundations Theory, the present study extended the investigation into moral judgment in all five moral domains and used a set of standardized moral vignettes. Two hundred and six college students filled in the Emotion Regulation Questionnaire and completed emotional ratings and moral judgment on moral vignettes from Moral Foundations Vignettes. Correlation analysis indicated that habitual cognitive reappraisal was negatively related to immorality rating in Harm, Fairness, and Loyalty domains. Regression analysis revealed that after controlling the effect of other variables, cognitive reappraisal negatively predicted immorality ratings in the Harm and Fairness domains. Further mediation analysis showed that emotional valence only partially explained the association between cognitive reappraisal and moral judgment in Harm area. Some other factors beyond emotional valence were suggested for future studies.
Li, Zhongquan; Wu, Xiaoyuan; Zhang, Lisong; Zhang, Ziyuan
2017-01-01
Emotion plays an important role in moral judgment, and people always use emotion regulation strategies to modulate emotion, consciously or unconsciously. Previous studies had investigated only the relationship between emotion regulation strategies and moral judgment in the Harm domain, and revealed divergent results. Based on Moral Foundations Theory, the present study extended the investigation into moral judgment in all five moral domains and used a set of standardized moral vignettes. Two hundred and six college students filled in the Emotion Regulation Questionnaire and completed emotional ratings and moral judgment on moral vignettes from Moral Foundations Vignettes. Correlation analysis indicated that habitual cognitive reappraisal was negatively related to immorality rating in Harm, Fairness, and Loyalty domains. Regression analysis revealed that after controlling the effect of other variables, cognitive reappraisal negatively predicted immorality ratings in the Harm and Fairness domains. Further mediation analysis showed that emotional valence only partially explained the association between cognitive reappraisal and moral judgment in Harm area. Some other factors beyond emotional valence were suggested for future studies.
Optimization and in Vivo Validation of Peptide Vectors Targeting the LDL Receptor.
Jacquot, Guillaume; Lécorché, Pascaline; Malcor, Jean-Daniel; Laurencin, Mathieu; Smirnova, Maria; Varini, Karine; Malicet, Cédric; Gassiot, Fanny; Abouzid, Karima; Faucon, Aude; David, Marion; Gaudin, Nicolas; Masse, Maxime; Ferracci, Géraldine; Dive, Vincent; Cisternino, Salvatore; Khrestchatisky, Michel
2016-12-05
Active targeting and delivery to pathophysiological organs of interest is of paramount importance to increase specific accumulation of therapeutic drugs or imaging agents while avoiding systemic side effects. We recently developed a family of new peptide ligands of the human and rodent LDL receptor (LDLR), an attractive cell-surface receptor with high uptake activity and local enrichment in several normal or pathological tissues (Malcor et al., J. Med. Chem. 2012, 55 (5), 2227). Initial chemical optimization of the 15-mer, all natural amino acid compound 1/VH411 (DSGL[CMPRLRGC] c DPR) and structure-activity relationship (SAR) investigation led to the cyclic 8 amino acid analogue compound 22/VH445 ([cMPRLRGC] c ) which specifically binds hLDLR with a K D of 76 nM and has an in vitro blood half-life of ∼3 h. Further introduction of non-natural amino acids led to the identification of compound 60/VH4106 ([(d)-"Pen"M"Thz"RLRGC] c ), which showed the highest K D value of 9 nM. However, this latter analogue displayed the lowest in vitro blood half-life (∼1.9 h). In the present study, we designed a new set of peptide analogues, namely, VH4127 to VH4131, with further improved biological properties. Detailed analysis of the hLDLR-binding kinetics of previous and new analogues showed that the latter all displayed very high on-rates, in the 10 6 s -1. M -1 range, and off-rates varying from the low 10 -2 s -1 to the 10 -1 s -1 range. Furthermore, all these new analogues showed increased blood half-lives in vitro, reaching ∼7 and 10 h for VH4129 and VH4131, respectively. Interestingly, we demonstrate in cell-based assays using both VH445 and the most balanced optimized analogue VH4127 ([cM"Thz"RLRG"Pen"] c ), showing a K D of 18 nM and a blood half-life of ∼4.3 h, that its higher on-rate correlated with a significant increase in both the extent of cell-surface binding to hLDLR and the endocytosis potential. Finally, intravenous injection of tritium-radiolabeled 3 H-VH
Single-domain versus two-domain configuration in thin ferromagnetic prisms
International Nuclear Information System (INIS)
Pini, Maria Gloria; Politi, Paolo
2007-01-01
Thin ferromagnetic elements in the form of rectangular prisms are theoretically investigated in order to study the transition from single-domain to two-domain state, with changing the in-plane aspect ratio p. We address two main questions: first, how general is the transition; second, how the critical value p c depends on the physical parameters. We use two complementary methods: discrete-lattice calculations and a micromagnetic continuum approach. Ultrathin films do not appear to split in two domains. Instead, thicker films may undergo the above transition. We have used the continuum approach to analyze recent magnetic force microscopy observations in 30nm-thick patterned permalloy elements, finding a good agreement for p c
Topological domain walls in helimagnets
Schoenherr, P.; Müller, J.; Köhler, L.; Rosch, A.; Kanazawa, N.; Tokura, Y.; Garst, M.; Meier, D.
2018-05-01
Domain walls naturally arise whenever a symmetry is spontaneously broken. They interconnect regions with different realizations of the broken symmetry, promoting structure formation from cosmological length scales to the atomic level1,2. In ferroelectric and ferromagnetic materials, domain walls with unique functionalities emerge, holding great promise for nanoelectronics and spintronics applications3-5. These walls are usually of Ising, Bloch or Néel type and separate homogeneously ordered domains. Here we demonstrate that a wide variety of new domain walls occurs in the presence of spatially modulated domain states. Using magnetic force microscopy and micromagnetic simulations, we show three fundamental classes of domain walls to arise in the near-room-temperature helimagnet iron germanium. In contrast to conventional ferroics, the domain walls exhibit a well-defined inner structure, which—analogous to cholesteric liquid crystals—consists of topological disclination and dislocation defects. Similar to the magnetic skyrmions that form in the same material6,7, the domain walls can carry a finite topological charge, permitting an efficient coupling to spin currents and contributions to a topological Hall effect. Our study establishes a new family of magnetic nano-objects with non-trivial topology, opening the door to innovative device concepts based on helimagnetic domain walls.
Li, Dan; Yu, Ai-Qing; Li, Xue-Jie; Zhu, You-Ting; Jin, Xing-Kun; Li, Wei-Wei; Wang, Qun
2015-12-01
Down syndrome cell adhesion molecule (Dscam) mediates innate immunity against pathogens in arthropods. Here, a novel Dscam from red claw crayfish Cherax quadricarinatus (CqDscam) was isolated. The CqDscam protein contains one signal peptide, ten immunoglobulin domains, six fibronectin type III domains, one transmembrane domain and cytoplasmic tail. CqDscam phylogenetically clustered with other invertebrate Dscams. Variable regions of CqDscam in N-terminal halves of Ig2 and Ig3 domains, complete Ig7 domain and TM domain can be reshuffled after transcription to produce a deluge of >37,620 potential alternative splice forms. CqDscam was detected in all tissues tested and abundantly expressed in immune system and nerve system. Upon lipopolysaccharides (LPS) and b-1, 3-glucans (Glu) challenged, the expression of CqDscam was up-regulated, while no response in expression occurred after injection with peptidoglycans (PG). Membrane-bound and secreted types of CqDscam were separated on the protein level, and were both extensively induced post LPS challenge. Membrane-bound CqDscam protein was not detected in the serum, but localized to the hemocyte surface by immuno-localization assay. In the antimicrobial assays, the recombinant LPS-induced isoform of CqDscam protein displayed bacterial binding and growth inhibitory activities, especially with Escherichia coli. These results suggested that CqDscam, as one of pattern-recognition receptors (PRRs), involved in innate immune recognition and defense mechanisms in C. quadricarinatus, possibly through alternative splicing. Copyright © 2015 Elsevier Ltd. All rights reserved.
Prediction Reweighting for Domain Adaptation.
Shuang Li; Shiji Song; Gao Huang
2017-07-01
There are plenty of classification methods that perform well when training and testing data are drawn from the same distribution. However, in real applications, this condition may be violated, which causes degradation of classification accuracy. Domain adaptation is an effective approach to address this problem. In this paper, we propose a general domain adaptation framework from the perspective of prediction reweighting, from which a novel approach is derived. Different from the major domain adaptation methods, our idea is to reweight predictions of the training classifier on testing data according to their signed distance to the domain separator, which is a classifier that distinguishes training data (from source domain) and testing data (from target domain). We then propagate the labels of target instances with larger weights to ones with smaller weights by introducing a manifold regularization method. It can be proved that our reweighting scheme effectively brings the source and target domains closer to each other in an appropriate sense, such that classification in target domain becomes easier. The proposed method can be implemented efficiently by a simple two-stage algorithm, and the target classifier has a closed-form solution. The effectiveness of our approach is verified by the experiments on artificial datasets and two standard benchmarks, a visual object recognition task and a cross-domain sentiment analysis of text. Experimental results demonstrate that our method is competitive with the state-of-the-art domain adaptation algorithms.
Domain configuration and magnetization switching in arrays of permalloy nanostripes
International Nuclear Information System (INIS)
Iglesias-Freire, Ó.; Jaafar, M.; Pérez, L.; Abril, O. de; Vázquez, M.; Asenjo, A.
2014-01-01
The proximity effect in the collective behavior of arrays of magnetic nanostripes is currently a subject of intensive research. The imperative of reducing the size and distances between elements in order to achieve higher storage capacity, faster access to the information as well as low energy consumption, brings consequences about the isolated behavior of the elements and devices. Parallel to each other permalloy nanostripes with high aspect ratio have been prepared by the nanolithography technique. The evolution of the closure domains and the magnetization direction in individual nanostructures has been imaged under applied magnetic fields using Variable Field Magnetic Force Microscopy. Moreover, the magnetostatic interactions between neighboring elements and the proximity effects in arrays of such nanostructures have been quantitatively analyzed by Magnetic Force Microscopy and micromagnetic simulations. The agreement between simulations and the experimental results allows us to conclude the relevance of those interactions depending on the geometry characteristics. In particular, results suggest that the magnetostatic coupling between adjacent nanostripes vanishes for separation distances higher than 500 nm. - Highlights: • A shape anisotropy-induced single domain remanent state is present in the stripes. Closure domains are formed under external fields. • Separation distances between neighboring stripes (500 nm) are enough to overcome the magnetostatic coupling and avoid a multi-stripe character. • Micromagnetic simulations predict critical distances of around 500 nm for the onset of magnetostatic coupling between neighboring elements. • Simulations predict stripes with a small longitudinal separation to behave as single elements, with domain walls “jumping” between them
Domain configuration and magnetization switching in arrays of permalloy nanostripes
Energy Technology Data Exchange (ETDEWEB)
Iglesias-Freire, Ó., E-mail: aasenjo@icmm.csic.es [Instituto de Ciencia de Materiales de Madrid, CSIC, Sor Juana Inés de la Cruz 3, Madrid 28049 (Spain); Jaafar, M. [Instituto de Ciencia de Materiales de Madrid, CSIC, Sor Juana Inés de la Cruz 3, Madrid 28049 (Spain); Dpto. Física de la Materia Condensada, Universidad Autónoma de Madrid, Cantoblanco 28049 (Spain); Pérez, L. [Dpto. Física de Materiales, Universidad Complutense de Madrid, Madrid 28040 (Spain); Abril, O. de [Dpto. Física e Instalaciones Aplicadas a la Edificación, al Medio Ambiente y al Urbanismo, Universidad Politécnica de Madrid, Madrid 28040 (Spain); Vázquez, M.; Asenjo, A. [Instituto de Ciencia de Materiales de Madrid, CSIC, Sor Juana Inés de la Cruz 3, Madrid 28049 (Spain)
2014-04-15
The proximity effect in the collective behavior of arrays of magnetic nanostripes is currently a subject of intensive research. The imperative of reducing the size and distances between elements in order to achieve higher storage capacity, faster access to the information as well as low energy consumption, brings consequences about the isolated behavior of the elements and devices. Parallel to each other permalloy nanostripes with high aspect ratio have been prepared by the nanolithography technique. The evolution of the closure domains and the magnetization direction in individual nanostructures has been imaged under applied magnetic fields using Variable Field Magnetic Force Microscopy. Moreover, the magnetostatic interactions between neighboring elements and the proximity effects in arrays of such nanostructures have been quantitatively analyzed by Magnetic Force Microscopy and micromagnetic simulations. The agreement between simulations and the experimental results allows us to conclude the relevance of those interactions depending on the geometry characteristics. In particular, results suggest that the magnetostatic coupling between adjacent nanostripes vanishes for separation distances higher than 500 nm. - Highlights: • A shape anisotropy-induced single domain remanent state is present in the stripes. Closure domains are formed under external fields. • Separation distances between neighboring stripes (500 nm) are enough to overcome the magnetostatic coupling and avoid a multi-stripe character. • Micromagnetic simulations predict critical distances of around 500 nm for the onset of magnetostatic coupling between neighboring elements. • Simulations predict stripes with a small longitudinal separation to behave as single elements, with domain walls “jumping” between them.
A localized interaction surface for voltage-sensing domains on the pore domain of a K+ channel.
Li-Smerin, Y; Hackos, D H; Swartz, K J
2000-02-01
Voltage-gated K+ channels contain a central pore domain and four surrounding voltage-sensing domains. How and where changes in the structure of the voltage-sensing domains couple to the pore domain so as to gate ion conduction is not understood. The crystal structure of KcsA, a bacterial K+ channel homologous to the pore domain of voltage-gated K+ channels, provides a starting point for addressing this question. Guided by this structure, we used tryptophan-scanning mutagenesis on the transmembrane shell of the pore domain in the Shaker voltage-gated K+ channel to localize potential protein-protein and protein-lipid interfaces. Some mutants cause only minor changes in gating and when mapped onto the KcsA structure cluster away from the interface between pore domain subunits. In contrast, mutants producing large changes in gating tend to cluster near this interface. These results imply that voltage-sensing domains interact with localized regions near the interface between adjacent pore domain subunits.
Simulation and Domain Identification of Sea Ice Thermodynamic System
Directory of Open Access Journals (Sweden)
Bing Tan
2012-01-01
Full Text Available Based on the measured data and characteristics of sea ice temperature distribution in space and time, this study is intended to consider a parabolic partial differential equation of the thermodynamic field of sea ice (coupled by snow, ice, and sea water layers with a time-dependent domain and its parameter identification problem. An optimal model with state constraints is presented with the thicknesses of snow and sea ice as parametric variables and the deviation between the calculated and measured sea ice temperatures as the performance criterion. The unique existence of the weak solution of the thermodynamic system is proved. The properties of the identification problem and the existence of the optimal parameter are discussed, and the one-order necessary condition is derived. Finally, based on the nonoverlapping domain decomposition method and semi-implicit difference scheme, an optimization algorithm is proposed for the numerical simulation. Results show that the simulated temperature of sea ice fit well with the measured data, and the better fit is corresponding to the deeper sea ice.
Bergshoeff, Eric A.; Kleinschmidt, Axel; Riccioni, Fabio
2012-01-01
We classify the half-supersymmetric "domain walls," i.e., branes of codimension one, in toroidally compactified IIA/IIB string theory and show to which gauged supergravity theory each of these domain walls belong. We use as input the requirement of supersymmetric Wess-Zumino terms, the properties of
Alquicer, Glenda; Silva-Gómez, Adriana B; Peralta, Fernando; Flores, Gonzalo
2004-04-01
The neonatal ventral Hippocampus (nVH) lesion in rats has been used as a model to test the hypothesis that early neurodevelopmental abnormalities lead to behavioral changes putatively linked to schizophrenia. The schizophrenic patients tend to social isolation. In addition, considerable evidence from behavioral and neurochemistry studies strongly implicate the dopamine (DA) system and the medial part of the prefrontal cortex (mPFC) in the pathophysiology of the social isolation syndrome. In order to assess effects of the postweaning social isolation (pwSI) on the DA system of the nVH lesions, we investigated the DA content and its metabolite, DOPAC in different limbic subregions in rats postpubertally at postnatal day (P) 78 following nVH lesions at P7 with and without pwSI for 8 weeks. The DA and DOPAC were measured by HPLC with electrochemical detection. The nVH lesion induces increase in the DA content in the hippocampus with no effect in the mPFC, nucleus accumbens and caudate-putamen, while the pwSI induces major increase in the DA content in limbic subregions such as the mPFC, nucleus accumbens and hipocampus with opposite effect in the caudate-putamen. These results suggest that while pwSI has an effect in the postpubertal content of DA in both sham and nVH lesions in rats, the nVH-lesioned rats appear to be affected to a greater extent than the sham animals underscoring the influence of pwSI differences in the development of behaviors in the nVH-lesioned animals.
Existence of solutions to Burgers equations in domains that can be transformed into rectangles
Directory of Open Access Journals (Sweden)
Yassine Benia
2016-06-01
Full Text Available This work is concerned with Burgers equation $\\partial _{t}u+u\\partial_x u-\\partial _x^2u=f$ (with Dirichlet boundary conditions in the non rectangular domain $\\Omega =\\{(t,x\\in R^2;\\ 0
Multi-parameter Analysis and Inversion for Anisotropic Media Using the Scattering Integral Method
Djebbi, Ramzi
2017-10-24
The main goal in seismic exploration is to identify locations of hydrocarbons reservoirs and give insights on where to drill new wells. Therefore, estimating an Earth model that represents the right physics of the Earth\\'s subsurface is crucial in identifying these targets. Recent seismic data, with long offsets and wide azimuth features, are more sensitive to anisotropy. Accordingly, multiple anisotropic parameters need to be extracted from the recorded data on the surface to properly describe the model. I study the prospect of applying a scattering integral approach for multi-parameter inversion for a transversely isotropic model with a vertical axis of symmetry. I mainly analyze the sensitivity kernels to understand the sensitivity of seismic data to anisotropy parameters. Then, I use a frequency domain scattering integral approach to invert for the optimal parameterization. The scattering integral approach is based on the explicit computation of the sensitivity kernels. I present a new method to compute the traveltime sensitivity kernels for wave equation tomography using the unwrapped phase. I show that the new kernels are a better alternative to conventional cross-correlation/Rytov kernels. I also derive and analyze the sensitivity kernels for a transversely isotropic model with a vertical axis of symmetry. The kernels structure, for various opening/scattering angles, highlights the trade-off regions between the parameters. For a surface recorded data, I show that the normal move-out velocity vn, ƞ and δ parameterization is suitable for a simultaneous inversion of diving waves and reflections. Moreover, when seismic data is inverted hierarchically, the horizontal velocity vh, ƞ and ϵ is the parameterization with the least trade-off. In the frequency domain, the hierarchical inversion approach is naturally implemented using frequency continuation, which makes vh, ƞ and ϵ parameterization attractive. I formulate the multi-parameter inversion using the
Heart Rate Variability: Effect of Exercise Intensity on Postexercise Response
James, David V. B.; Munson, Steven C.; Maldonado-Martin, Sara; De Ste Croix, Mark B. A.
2012-01-01
The purpose of the present study was to investigate the influence of two exercise intensities (moderate and severe) on heart rate variability (HRV) response in 16 runners 1 hr prior to (-1 hr) and at +1 hr, +24 hr, +48 hr, and +72 hr following each exercise session. Time domain indexes and a high frequency component showed a significant decrease…
DEFF Research Database (Denmark)
Høst-Madsen, Anders; Shah, Peter Jivan; Hansen, Torben
1987-01-01
Computer-simulation techniques are used to study the domain-growth kinetics of (2×1) ordering in a two-dimensional Ising model with nonconserved order parameter and with variable ratio α of next-nearest- and nearest-neighbor interactions. At zero temperature, persistent growth characterized...
CALCULATION OF CONTROL CIRCUITS IN FREQUENCY DOMAIN USING SCILAB ENVIRONEMNT
Directory of Open Access Journals (Sweden)
Chioncel Petru
2014-10-01
Full Text Available The paper presents the computing of control circuits in the frequency domain, starting from the mathematical model of the frequency response H(jw obtained from the transfer function H(s where the operational variable keeps just the image part. For PT1 and PT2 elements, using Scilab, the geometrical place is illustrated and the frequency diagrams are determinate for different duping constants (PT2. The logarithmic frequency diagrams (Bode, determine the amplitude and phase reserve for a control circuits with three PT1 elements.
Effects of fumonisin B1 on selected biological responses and performance of broiler chickens
Directory of Open Access Journals (Sweden)
Ricardo H. Rauber
2013-09-01
Full Text Available The objective of this study was to determine the effects of three doses of fumonisin B1 (0, 100, and 200mg/kg of feed on biological variables (relative weight of liver [RWL], total plasma protein [TPP], albumin [Alb], calcium [Ca], phosphorus [P], uric acid [UA], alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma glutamyltransferase [GGT], alkaline phosphatase [AP], total cholesterol [Chol], triglycerides [Tri], sphinganine-to-sphingosine ratio [SA:SO], and C-reactive protein [CRP], morphological evaluation of the small intestine (villus height [VH], crypt depth [CD], and villus-to-crypt ratio [V:C], histological evaluation, and on performance (body weight [BW], feed intake [FI], and feed conversion rate [FCR] of broiler chickens. Significant effects of FB were observed on BW and FI (reduced, on RWL, TPP, Ca, ALT, AST, GGT, Chol, and Tri (increased at both 14 and 28 days evaluations. In addition, significant increase was observed on FCR, Alb, P, SA:SO, and CRP and significant reduction in UA, VH, and V:C only at the 28 days evaluation. Significant histological lesions were observed on liver and kidney of FB inoculated broilers at 14 and 28 days. Those results show that FB has a significant effect on biological and histological variables and on performance of broiler chickens.
Current-induced domain wall motion in magnetic nanowires with spatial variation
International Nuclear Information System (INIS)
Ieda, Jun'ichi; Sugishita, Hiroki; Maekawa, Sadamichi
2010-01-01
We model current-induced domain wall motion in magnetic nanowires with the variable width. Employing the collective coordinate method we trace the wall dynamics. The effect of the width modulation is implemented by spatial dependence of an effective magnetic field. The wall destination in the potential energy landscape due to the magnetic anisotropy and the spatial nonuniformity is obtained as a function of the current density. For a nanowire of a periodically modulated width, we identify three (pinned, nonlinear, and linear) current density regimes for current-induced wall motion. The threshold current densities depend on the pulse duration as well as the magnitude of wire modulation. In the nonlinear regime, application of ns order current pulses results in wall displacement which opposes or exceeds the prediction of the spin transfer mechanism. The finding explains stochastic nature of the domain wall displacement observed in recent experiments.
Interoperable domain models: the ISO land administration domain model LADM and its external classes
CSIR Research Space (South Africa)
Lemmen, CHJ
2011-09-01
Full Text Available This paper provides a brief overview of one of the first spatial domain standards: a standard for the domain of Land Administration (LA). This standard is in the draft stage of development now (May 2011). The development of domain standards is a...
Simulation of two-phase flows by domain decomposition
International Nuclear Information System (INIS)
Dao, T.H.
2013-01-01
This thesis deals with numerical simulations of compressible fluid flows by implicit finite volume methods. Firstly, we studied and implemented an implicit version of the Roe scheme for compressible single-phase and two-phase flows. Thanks to Newton method for solving nonlinear systems, our schemes are conservative. Unfortunately, the resolution of nonlinear systems is very expensive. It is therefore essential to use an efficient algorithm to solve these systems. For large size matrices, we often use iterative methods whose convergence depends on the spectrum. We have studied the spectrum of the linear system and proposed a strategy, called Scaling, to improve the condition number of the matrix. Combined with the classical ILU pre-conditioner, our strategy has reduced significantly the GMRES iterations for local systems and the computation time. We also show some satisfactory results for low Mach-number flows using the implicit centered scheme. We then studied and implemented a domain decomposition method for compressible fluid flows. We have proposed a new interface variable which makes the Schur complement method easy to build and allows us to treat diffusion terms. Using GMRES iterative solver rather than Richardson for the interface system also provides a better performance compared to other methods. We can also decompose the computational domain into any number of sub-domains. Moreover, the Scaling strategy for the interface system has improved the condition number of the matrix and reduced the number of GMRES iterations. In comparison with the classical distributed computing, we have shown that our method is more robust and efficient. (author) [fr
Kalron, Alon; Aloni, Roy; Dolev, Mark; Frid, Lior; Givon, Uri; Menascu, Shay
2018-01-19
The objective of the study was to determine if cognitive function is associated with step time variability in people with multiple sclerosis (PwMS). The study included 355 PwMS (218 women), average age 41.1 (SD = 13.5), disease duration 5.9 (SD = 7.3) years, and a median expanded disability status scale score of 2.5. We separately analyzed the sample group of fallers and non-fallers based on their fall history. Gait variability was measured by an electronic walkway and all participants completed a computerized cognitive test battery designed to evaluate multiple cognitive domains. Fallers (43.7%) demonstrated elevated step time variability (%CV), 5.0 (SD = 3.4) vs. 3.5 (SD = 1.6), P < 0.001 compared to the non-faller subjects. According to the regression analysis in the non-fallers' group, step time variability was found significantly associated with the global cognitive score (P = 0.001), executive function subcategory (P = 0.038), and motor skills subcategory (P < 0.001). No relationship between step time variability and any cognitive domain was demonstrated in the faller group. This study illustrated that the association between gait variability and cognition occurs only in PwMS without a fall history. From a clinical standpoint, these findings might help medical professionals to create improved assessment tests and rehabilitation strategies in the MS population.
Multifunctionalities driven by ferroic domains
Yang, J. C.; Huang, Y. L.; He, Q.; Chu, Y. H.
2014-08-01
Considerable attention has been paid to ferroic systems in pursuit of advanced applications in past decades. Most recently, the emergence and development of multiferroics, which exhibit the coexistence of different ferroic natures, has offered a new route to create functionalities in the system. In this manuscript, we step from domain engineering to explore a roadmap for discovering intriguing phenomena and multifunctionalities driven by periodic domain patters. As-grown periodic domains, offering exotic order parameters, periodic local perturbations and the capability of tailoring local spin, charge, orbital and lattice degrees of freedom, are introduced as modeling templates for fundamental studies and novel applications. We discuss related significant findings on ferroic domain, nanoscopic domain walls, and conjunct heterostructures based on the well-organized domain patterns, and end with future prospects and challenges in the field.
The WFCAM multiwavelength Variable Star Catalog
Ferreira Lopes, C. E.; Dékány, I.; Catelan, M.; Cross, N. J. G.; Angeloni, R.; Leão, I. C.; De Medeiros, J. R.
2015-01-01
Context. Stellar variability in the near-infrared (NIR) remains largely unexplored. The exploitation of public science archives with data-mining methods offers a perspective for a time-domain exploration of the NIR sky. Aims: We perform a comprehensive search for stellar variability using the optical-NIR multiband photometric data in the public Calibration Database of the WFCAM Science Archive (WSA), with the aim of contributing to the general census of variable stars and of extending the current scarce inventory of accurate NIR light curves for a number of variable star classes. Methods: Standard data-mining methods were applied to extract and fine-tune time-series data from the WSA. We introduced new variability indices designed for multiband data with correlated sampling, and applied them for preselecting variable star candidates, i.e., light curves that are dominated by correlated variations, from noise-dominated ones. Preselection criteria were established by robust numerical tests for evaluating the response of variability indices to the colored noise characteristic of the data. We performed a period search using the string-length minimization method on an initial catalog of 6551 variable star candidates preselected by variability indices. Further frequency analysis was performed on positive candidates using three additional methods in combination, in order to cope with aliasing. Results: We find 275 periodic variable stars and an additional 44 objects with suspected variability with uncertain periods or apparently aperiodic variation. Only 44 of these objects had been previously known, including 11 RR Lyrae stars on the outskirts of the globular cluster M 3 (NGC 5272). We provide a preliminary classification of the new variable stars that have well-measured light curves, but the variability types of a large number of objects remain ambiguous. We classify most of the new variables as contact binary stars, but we also find several pulsating stars, among which
Zhang, Jing; Rabbitts, Terence H
2014-11-01
Many proteins of interest in basic biology, translational research studies and for clinical targeting in diseases reside inside the cell and function by interacting with other macromolecules. Protein complexes control basic processes such as development and cell division but also abnormal cell growth when mutations occur such as found in cancer. Interfering with protein-protein interactions is an important aspiration in both basic and disease biology but small molecule inhibitors have been difficult and expensive to isolate. Recently, we have adapted molecular biology techniques to develop a simple set of protocols for isolation of high affinity antibody fragments (in the form of single VH domains) that function within the reducing environment of higher organism cells and can bind to their target molecules. The method called Intracellular Antibody Capture (IAC) has been used to develop inhibitory anti-RAS and anti-LMO2 single domains that have been used for target validation of these antigens in pre-clinical cancer models and illustrate the efficacy of the IAC approach to generation of drug surrogates. Future use of inhibitory VH antibody fragments as drugs in their own right (we term these macrodrugs to distinguish them from small molecule drugs) requires their delivery to target cells in vivo but they can also be templates for small molecule drug development that emulate the binding sites of the antibody fragments. This article is part of a Special Issue entitled: Recent advances in molecular engineering of antibody. Copyright © 2014 Elsevier B.V. All rights reserved.
Text Processing of Domain-Related Information for Individuals with High and Low Domain Knowledge.
Spilich, George J.; And Others
1979-01-01
The way in which previously acquired knowledge affects the processing on new domain-related information was investigated. Text processing was studied in two groups differing in knowledge of the domain of baseball. A knowledge structure for the domain was constructed, and text propositions were classified. (SW)
Energy decay of a variable-coefficient wave equation with nonlinear time-dependent localized damping
Directory of Open Access Journals (Sweden)
Jieqiong Wu
2015-09-01
Full Text Available We study the energy decay for the Cauchy problem of the wave equation with nonlinear time-dependent and space-dependent damping. The damping is localized in a bounded domain and near infinity, and the principal part of the wave equation has a variable-coefficient. We apply the multiplier method for variable-coefficient equations, and obtain an energy decay that depends on the property of the coefficient of the damping term.
Visual Hallucinations in PD and Lewy Body Dementias: Old and New Hypotheses
Directory of Open Access Journals (Sweden)
M. Onofrj
2013-01-01
Full Text Available Visual Hallucinations (VH are a common non-motor symptom of Parkinson’s Disease (PD and the Lewy body dementias (LBD of Parkinson's disease with dementia (PDD and Dementia with Lewy Bodies (DLB. The origin of VH in PD and LBD is debated: earlier studies considered a number of different possible mechanisms underlying VH including visual disorders, Rapid Eye Movement (REM Sleep Intrusions, dysfunctions of top down or bottom up visual pathways, and neurotransmitter imbalance.
Functional interchangeability of late domains, late domain cofactors and ubiquitin in viral budding.
Directory of Open Access Journals (Sweden)
Maria Zhadina
2010-10-01
Full Text Available The membrane scission event that separates nascent enveloped virions from host cell membranes often requires the ESCRT pathway, which can be engaged through the action of peptide motifs, termed late (L- domains, in viral proteins. Viral PTAP and YPDL-like L-domains bind directly to the ESCRT-I and ALIX components of the ESCRT pathway, while PPxY motifs bind Nedd4-like, HECT-domain containing, ubiquitin ligases (e.g. WWP1. It has been unclear precisely how ubiquitin ligase recruitment ultimately leads to particle release. Here, using a lysine-free viral Gag protein derived from the prototypic foamy virus (PFV, where attachment of ubiquitin to Gag can be controlled, we show that several different HECT domains can replace the WWP1 HECT domain in chimeric ubiquitin ligases and drive budding. Moreover, artificial recruitment of isolated HECT domains to Gag is sufficient to stimulate budding. Conversely, the HECT domain becomes dispensable if the other domains of WWP1 are directly fused to an ESCRT-1 protein. In each case where budding is driven by a HECT domain, its catalytic activity is essential, but Gag ubiquitination is dispensable, suggesting that ubiquitin ligation to trans-acting proteins drives budding. Paradoxically, however, we also demonstrate that direct fusion of a ubiquitin moiety to the C-terminus of PFV Gag can also promote budding, suggesting that ubiquitination of Gag can substitute for ubiquitination of trans-acting proteins. Depletion of Tsg101 and ALIX inhibits budding that is dependent on ubiquitin that is fused to Gag, or ligated to trans-acting proteins through the action of a PPxY motif. These studies underscore the flexibility in the ways that the ESCRT pathway can be engaged, and suggest a model in which the identity of the protein to which ubiquitin is attached is not critical for subsequent recruitment of ubiquitin-binding components of the ESCRT pathway and viral budding to proceed.
International Nuclear Information System (INIS)
Wen Junhai; Liang Zhengrong
2006-01-01
Inverting the exponential Radon transform has a potential use for SPECT (single photon emission computed tomography) imaging in cases where a uniform attenuation can be approximated, such as in brain and abdominal imaging. Tretiak and Metz derived in the frequency domain an explicit inversion formula for the exponential Radon transform in two dimensions for parallel-beam collimator geometry. Progress has been made to extend the inversion formula for fan-beam and varying focal-length fan-beam (VFF) collimator geometries. These previous fan-beam and VFF inversion formulas require a spatially variant filtering operation, which complicates the implementation and imposes a heavy computing burden. In this paper, we present an explicit inversion formula, in which a spatially invariant filter is involved. The formula is derived and implemented in the spatial domain for VFF geometry (where parallel-beam and fan-beam geometries are two special cases). Phantom simulations mimicking SPECT studies demonstrate its accuracy in reconstructing the phantom images and efficiency in computation for the considered collimator geometries
KEJAHATAN NAMA DOMAIN BERKAITAN DENGAN MEREK
Directory of Open Access Journals (Sweden)
Muhammad Nizar
2018-02-01
Full Text Available Indonesia already has an ITE Law governing domain names in general terms and on certain provisions in chapter VI, but the regulation of domain name crimes is not regulated in the ITE Law as mandated in the academic draft of the ITE Bill. The absence of regulation of domain name norm in the ITE Law creates problems with registrant of domain name (registrant which deliberately register the domain name is bad faith. The characteristic of a crime in a domain name relating to the mark is that the registered domain name has an equation in essence with another party’s well-known brand, the act of doing so by exploiting a reputation for well-known or previously commercially valuable names as domain names for addresses for sites (websites it manages. The Prosecutor may include articles of the KUHP in filing his indictment before the Court during the absence of special regulatory provisions concerning domain name crime.
DEFF Research Database (Denmark)
Chi, Celestine N.; Bach, Anders; Strømgaard, Kristian
2012-01-01
, for example, are particularly rich in these domains. The general function of PDZ domains is to bring proteins together within the appropriate cellular compartment, thereby facilitating scaffolding, signaling, and trafficking events. The many functions of PDZ domains under normal physiological as well...... as pathological conditions have been reviewed recently. In this review, we focus on the molecular details of how PDZ domains bind their protein ligands and their potential as drug targets in this context....
Navy-Wide Personnel Survey (NPS) 2008: Summary of Survey Results
2009-11-01
1313–1336. Vroom , V.H. (1982). Work and Motivation . Malabar, FL: Robert E. Krieger Publishing Company. Whittam, K. P., Janega, J. B., Olmsted, M...Bray, Vincus & Bann, 2004; Vroom , 1982). As it is such an important work life variable, it has been tracked on the NPS since its inception...conveyed to over 300,000 Sailors. Effective communication is known to have positive effects upon organizational members by motivating them to work
Resting and postexercise heart rate variability in professional handball players.
Kayacan, Yildirim; Yildiz, Sedat
2016-03-01
The aim of this study was to evaluate heart rate variability (HRV) in professional handball players during rest and following a 5 min mild jogging exercise. For that purpose, electrocardiogram (ECG) of male handball players (N.=12, mean age 25±3.95 years) and sedentary controls (N.=14, mean age 23.5±2.95 years) were recorded for 5 min at rest and just after 5 min of mild jogging. ECGs were recorded and following HRV parameters were calculated: time-domain variables such as heart rate (HR), average normal-to-normal RR intervals, standard deviation of normal-to-normal RR intervals, square root of the mean of the squares of differences between adjacent NN intervals, percentage of differences between adjacent NN intervals that are greater than 50 milliseconds (pNN50), and frequency-domain variables such as very low frequency, low (LF) and high frequency (HF) of the power and LF/HF ratio. Unpaired t-test was used to find out differences among groups while paired t-test was used for comparison of each group for pre- and postjogging HRV. Pearson correlations were carried out to find out the relationships between the parameters. Blood pressures were not different between handball players and sedentary controls but exercise increased systolic blood pressure (Phandball players (Phandball players (Phandball players in response to a mild, short-time (5 min) jogging exercise. However, in sedentary subjects, either the sympathetic regulation of the autonomous nervous system increased or vagal withdrawal occurred.
Descriptive epidemiology of domain-specific sitting in working adults: the Stormont Study.
Clemes, Stacy A; Houdmont, Jonathan; Munir, Fehmidah; Wilson, Kelly; Kerr, Robert; Addley, Ken
2016-03-01
Given links between sedentary behaviour and unfavourable health outcomes, there is a need to understand the influence of socio-demographic factors on sedentary behaviour to inform effective interventions. This study examined domain-specific sitting times reported across socio-demographic groups of office workers. The analyses are cross-sectional and based on a survey conducted within the Stormont Study, which is tracking employees in the Northern Ireland Civil Service. Participants self-reported their daily sitting times across multiple domains (work, TV, travel, PC use and leisure) on workdays and non-workdays, along with their physical activity and socio-demographic variables (sex, age, marital status, BMI, educational attainment and work pattern). Total and domain-specific sitting on workdays and non-workdays were compared across socio-demographic groups using multivariate analyses of covariance. Completed responses were obtained from 4436 participants. For the whole sample, total daily sitting times were higher on workdays in comparison to non-workdays (625 ± 168 versus 469 ± 210 min/day, P leisure-time sitting. © The Author 2015. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Young-Doo Kwon
2013-01-01
Full Text Available This study examined the characteristics of a variable three-point Gauss quadrature using a variable set of weighting factors and corresponding optimal sampling points. The major findings were as follows. The one-point, two-point, and three-point Gauss quadratures that adopt the Legendre sampling points and the well-known Simpson’s 1/3 rule were found to be special cases of the variable three-point Gauss quadrature. In addition, the three-point Gauss quadrature may have out-of-domain sampling points beyond the domain end points. By applying the quadratically extrapolated integrals and nonlinearity index, the accuracy of the integration could be increased significantly for evenly acquired data, which is popular with modern sophisticated digital data acquisition systems, without using higher-order extrapolation polynomials.
Conners, Rebecca; Konarev, Alexander V; Forsyth, Jane; Lovegrove, Alison; Marsh, Justin; Joseph-Horne, Timothy; Shewry, Peter; Brady, R Leo
2007-09-21
The storage tissues of many plants contain protease inhibitors that are believed to play an important role in defending the plant from invasion by pests and pathogens. These proteinaceous inhibitor molecules belong to a number of structurally distinct families. We describe here the isolation, purification, initial inhibitory properties, and three-dimensional structure of a novel trypsin inhibitor from seeds of Veronica hederifolia (VhTI). The VhTI peptide inhibits trypsin with a submicromolar apparent K(i) and is expected to be specific for trypsin-like serine proteases. VhTI differs dramatically in structure from all previously described families of trypsin inhibitors, consisting of a helix-turn-helix motif, with the two alpha helices tightly associated by two disulfide bonds. Unusually, the crystallized complex is in the form of a stabilized acyl-enzyme intermediate with the scissile bond of the VhTI inhibitor cleaved and the resulting N-terminal portion of the inhibitor remaining attached to the trypsin catalytic serine 195 by an ester bond. A synthetic, truncated version of the VhTI peptide has also been produced and co-crystallized with trypsin but, surprisingly, is seen to be uncleaved and consequently forms a noncovalent complex with trypsin. The VhTI peptide shows that effective enzyme inhibitors can be constructed from simple helical motifs and provides a new scaffold on which to base the design of novel serine protease inhibitors.
Lead bioaccessibility in topsoils from lead mineralisation and urban domains, UK
International Nuclear Information System (INIS)
Appleton, J.D.; Cave, M.R.; Palumbo-Roe, B.; Wragg, J.
2013-01-01
Predictive linear regression (LR) modelling indicates that total Pb is the only highly significant independent variable for estimating Pb bioaccessibility in “mineralisation domains” located in limestone (high pH) and partly peat covered (low pH) shale-sandstone terrains in England. Manganese is a significant minor predictor in the limestone terrain, whilst organic matter and sulphur explain 0.5% and 2% of the variance of bioaccessible Pb in the peat-shale-sandstone terrain, compared with 93% explained by total Pb. Bootstrap resampling shows that LR confidence limits overlap for the two mineralised terrains but the limestone terrain has a significantly lower bioaccessible Pb to total Pb slope than the urban domain. A comparison of the absolute values of stomach and combined stomach-intestine bioaccessibility provides some insight into the geochemical controls on bioaccessibility in the contrasting soil types. -- Highlights: •Total Pb is the only highly significant predictor for bioaccessible Pb in lead mineralisation domains. •Manganese is a significant minor predictor in limestone terrain. •Organic matter and sulphur are minor predictors in peat-shale-sandstone terrain. •Results can be used for initial risk assessment in Pb mineralisation domain. -- Total Pb is the major predictor for bioaccessible Pb in topsoils from two lead mineralised areas in England
A domain-decomposed multi-model plasma simulation of collisionless magnetic reconnection
Datta, I. A. M.; Shumlak, U.; Ho, A.; Miller, S. T.
2017-10-01
Collisionless magnetic reconnection is a process relevant to many areas of plasma physics in which energy stored in magnetic fields within highly conductive plasmas is rapidly converted into kinetic and thermal energy. Both in natural phenomena such as solar flares and terrestrial aurora as well as in magnetic confinement fusion experiments, the reconnection process is observed on timescales much shorter than those predicted by a resistive MHD model. As a result, this topic is an active area of research in which plasma models with varying fidelity have been tested in order to understand the proper physics explaining the reconnection process. In this research, a hybrid multi-model simulation employing the Hall-MHD and two-fluid plasma models on a decomposed domain is used to study this problem. The simulation is set up using the WARPXM code developed at the University of Washington, which uses a discontinuous Galerkin Runge-Kutta finite element algorithm and implements boundary conditions between models in the domain to couple their variable sets. The goal of the current work is to determine the parameter regimes most appropriate for each model to maintain sufficient physical fidelity over the whole domain while minimizing computational expense. This work is supported by a Grant from US AFOSR.
Polar Domain Discovery with Sparkler
Duerr, R.; Khalsa, S. J. S.; Mattmann, C. A.; Ottilingam, N. K.; Singh, K.; Lopez, L. A.
2017-12-01
The scientific web is vast and ever growing. It encompasses millions of textual, scientific and multimedia documents describing research in a multitude of scientific streams. Most of these documents are hidden behind forms which require user action to retrieve and thus can't be directly accessed by content crawlers. These documents are hosted on web servers across the world, most often on outdated hardware and network infrastructure. Hence it is difficult and time-consuming to aggregate documents from the scientific web, especially those relevant to a specific domain. Thus generating meaningful domain-specific insights is currently difficult. We present an automated discovery system (Figure 1) using Sparkler, an open-source, extensible, horizontally scalable crawler which facilitates high throughput and focused crawling of documents pertinent to a particular domain such as information about polar regions. With this set of highly domain relevant documents, we show that it is possible to answer analytical questions about that domain. Our domain discovery algorithm leverages prior domain knowledge to reach out to commercial/scientific search engines to generate seed URLs. Subject matter experts then annotate these seed URLs manually on a scale from highly relevant to irrelevant. We leverage this annotated dataset to train a machine learning model which predicts the `domain relevance' of a given document. We extend Sparkler with this model to focus crawling on documents relevant to that domain. Sparkler avoids disruption of service by 1) partitioning URLs by hostname such that every node gets a different host to crawl and by 2) inserting delays between subsequent requests. With an NSF-funded supercomputer Wrangler, we scaled our domain discovery pipeline to crawl about 200k polar specific documents from the scientific web, within a day.
Directory of Open Access Journals (Sweden)
Ashley Lisa
2010-05-01
Full Text Available Abstract Background Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h integration of policy and practice in order to be maximally effective. Discussion This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Summary Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.
Maclean, Lynne M; Clinton, Kathryn; Edwards, Nancy; Garrard, Michael; Ashley, Lisa; Hansen-Ketchum, Patti; Walsh, Audrey
2010-05-17
Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h) integration of policy and practice in order to be maximally effective. This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.
Improving the pharmacokinetic properties of biologics by fusion to an anti-HSA shark VNAR domain
Müller, Mischa R.; Saunders, Kenneth; Grace, Christopher; Jin, Macy; Piche-Nicholas, Nicole; Steven, John; O’Dwyer, Ronan; Wu, Leeying; Khetemenee, Lam; Vugmeyster, Yulia; Hickling, Timothy P.; Tchistiakova, Lioudmila; Olland, Stephane; Gill, Davinder; Jensen, Allan; Barelle, Caroline J.
2012-01-01
Advances in recombinant antibody technology and protein engineering have provided the opportunity to reduce antibodies to their smallest binding domain components and have concomitantly driven the requirement for devising strategies to increase serum half-life to optimise drug exposure, thereby increasing therapeutic efficacy. In this study, we adopted an immunization route to raise picomolar affinity shark immunoglobulin new antigen receptors (IgNARs) to target human serum albumin (HSA). From our model shark species, Squalus acanthias, a phage display library encompassing the variable binding domain of IgNAR (VNAR) was constructed, screened against target, and positive clones were characterized for affinity and specificity. N-terminal and C-terminal molecular fusions of our lead hit in complex with a naïve VNAR domain were expressed, purified and exhibited the retention of high affinity binding to HSA, but also cross-selectivity to mouse, rat and monkey serum albumin both in vitro and in vivo. Furthermore, the naïve VNAR had enhanced pharmacokinetic (PK) characteristics in both N- and C-terminal orientations and when tested as a three domain construct with naïve VNAR flanking the HSA binding domain at both the N and C termini. Molecules derived from this platform technology also demonstrated the potential for clinical utility by being available via the subcutaneous route of delivery. This study thus demonstrates the first in vivo functional efficacy of a VNAR binding domain with the ability to enhance PK properties and support delivery of multifunctional therapies. PMID:23676205
He, Xian-hui; Xu, Li-hui; Liu, Yi
2005-04-01
To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.
Blocking-resistant communication through domain fronting
Directory of Open Access Journals (Sweden)
Fifield David
2015-06-01
Full Text Available We describe “domain fronting,” a versatile censorship circumvention technique that hides the remote endpoint of a communication. Domain fronting works at the application layer, using HTTPS, to communicate with a forbidden host while appearing to communicate with some other host, permitted by the censor. The key idea is the use of different domain names at different layers of communication. One domain appears on the “outside” of an HTTPS request—in the DNS request and TLS Server Name Indication—while another domain appears on the “inside”—in the HTTP Host header, invisible to the censor under HTTPS encryption. A censor, unable to distinguish fronted and nonfronted traffic to a domain, must choose between allowing circumvention traffic and blocking the domain entirely, which results in expensive collateral damage. Domain fronting is easy to deploy and use and does not require special cooperation by network intermediaries. We identify a number of hard-to-block web services, such as content delivery networks, that support domain-fronted connections and are useful for censorship circumvention. Domain fronting, in various forms, is now a circumvention workhorse. We describe several months of deployment experience in the Tor, Lantern, and Psiphon circumvention systems, whose domain-fronting transports now connect thousands of users daily and transfer many terabytes per month.
Directory of Open Access Journals (Sweden)
Guetterman TC
2017-07-01
Full Text Available Timothy C Guetterman,1 Frederick W Kron,1 Toby C Campbell,2 Mark W Scerbo,3 Amy B Zelenski,4 James F Cleary,5 Michael D Fetters1 1Department of Family Medicine, University of Michigan, Ann Arbor, MI, 2Department of Medicine, University of Wisconsin–Madison, Madison, WI, 3Department of Psychology, Old Dominion University, Norfolk, VA, 4Department of General Internal Medicine, University of Wisconsin–Madison, University of Wisconsin Medical Foundation, 5Department of Medicine, School of Medicine and Public Health, University of Wisconsin–Madison, Clinical Science Center, Madison, WI, USA Background: Despite interest in using virtual humans (VHs for assessing health care communication, evidence of validity is limited. We evaluated the validity of a VH application, MPathic-VR, for assessing performance-based competence in breaking bad news (BBN to a VH patient.Methods: We used a two-group quasi-experimental design, with residents participating in a 3-hour seminar on BBN. Group A (n=15 completed the VH simulation before and after the seminar, and Group B (n=12 completed the VH simulation only after the BBN seminar to avoid the possibility that testing alone affected performance. Pre- and postseminar differences for Group A were analyzed with a paired t-test, and comparisons between Groups A and B were analyzed with an independent t-test.Results: Compared to the preseminar result, Group A’s postseminar scores improved significantly, indicating that the VH program was sensitive to differences in assessing performance-based competence in BBN. Postseminar scores of Group A and Group B were not significantly different, indicating that both groups performed similarly on the VH program.Conclusion: Improved pre–post scores demonstrate acquisition of skills in BBN to a VH patient. Pretest sensitization did not appear to influence posttest assessment. These results provide initial construct validity evidence that the VH program is effective for
SH3 Domains Differentially Stimulate Distinct Dynamin I Assembly Modes and G Domain Activity.
Directory of Open Access Journals (Sweden)
Sai Krishnan
Full Text Available Dynamin I is a highly regulated GTPase enzyme enriched in nerve terminals which mediates vesicle fission during synaptic vesicle endocytosis. One regulatory mechanism involves its interactions with proteins containing Src homology 3 (SH3 domains. At least 30 SH3 domain-containing proteins bind dynamin at its proline-rich domain (PRD. Those that stimulate dynamin activity act by promoting its oligomerisation. We undertook a systematic parallel screening of 13 glutathione-S-transferase (GST-tagged endocytosis-related SH3 domains on dynamin binding, GTPase activity and oligomerisation. No correlation was found between dynamin binding and their potency to stimulate GTPase activity. There was limited correlation between the extent of their ability to stimulate dynamin activity and the level of oligomerisation, indicating an as yet uncharacterised allosteric coupling of the PRD and G domain. We examined the two variants, dynamin Iab and Ibb, which differ in the alternately splice middle domain α2 helix. They responded differently to the panel of SH3s, with the extent of stimulation between the splice variants varying greatly between the SH3s. This study reveals that SH3 binding can act as a heterotropic allosteric regulator of the G domain via the middle domain α2 helix, suggesting an involvement of this helix in communicating the PRD-mediated allostery. This indicates that SH3 binding both stabilises multiple conformations of the tetrameric building block of dynamin, and promotes assembly of dynamin-SH3 complexes with distinct rates of GTP hydrolysis.
An ontological approach to domain engineering
Falbo, R.A.; Guizzardi, G.; Duarte, K.
2002-01-01
Domain engineering aims to support systematic reuse, focusing on modeling common knowledge in a problem domain. Ontologies have also been pointed as holding great promise for software reuse. In this paper, we present ODE (Ontology-based Domain Engineering), an ontological approach for domain
Ferroelectric negative capacitance domain dynamics
Hoffmann, Michael; Khan, Asif Islam; Serrao, Claudy; Lu, Zhongyuan; Salahuddin, Sayeef; Pešić, Milan; Slesazeck, Stefan; Schroeder, Uwe; Mikolajick, Thomas
2018-05-01
Transient negative capacitance effects in epitaxial ferroelectric Pb(Zr0.2Ti0.8)O3 capacitors are investigated with a focus on the dynamical switching behavior governed by domain nucleation and growth. Voltage pulses are applied to a series connection of the ferroelectric capacitor and a resistor to directly measure the ferroelectric negative capacitance during switching. A time-dependent Ginzburg-Landau approach is used to investigate the underlying domain dynamics. The transient negative capacitance is shown to originate from reverse domain nucleation and unrestricted domain growth. However, with the onset of domain coalescence, the capacitance becomes positive again. The persistence of the negative capacitance state is therefore limited by the speed of domain wall motion. By changing the applied electric field, capacitor area or external resistance, this domain wall velocity can be varied predictably over several orders of magnitude. Additionally, detailed insights into the intrinsic material properties of the ferroelectric are obtainable through these measurements. A new method for reliable extraction of the average negative capacitance of the ferroelectric is presented. Furthermore, a simple analytical model is developed, which accurately describes the negative capacitance transient time as a function of the material properties and the experimental boundary conditions.
Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.
1997-01-01
A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.
Summarization by domain ontology navigation
DEFF Research Database (Denmark)
Andreasen, Troels; Bulskov, Henrik
2013-01-01
of the subject. In between these two extremes, conceptual summaries encompass selected concepts derived using background knowledge. We address in this paper an approach where conceptual summaries are provided through a conceptualization as given by an ontology. The ontology guiding the summarization can...... be a simple taxonomy or a generative domain ontology. A domain ontology can be provided by a preanalysis of a domain corpus and can be used to condense improved summaries that better reflects the conceptualization of a given domain....
A Particle Swarm Optimization Variant with an Inner Variable Learning Strategy
Directory of Open Access Journals (Sweden)
Guohua Wu
2014-01-01
Full Text Available Although Particle Swarm Optimization (PSO has demonstrated competitive performance in solving global optimization problems, it exhibits some limitations when dealing with optimization problems with high dimensionality and complex landscape. In this paper, we integrate some problem-oriented knowledge into the design of a certain PSO variant. The resulting novel PSO algorithm with an inner variable learning strategy (PSO-IVL is particularly efficient for optimizing functions with symmetric variables. Symmetric variables of the optimized function have to satisfy a certain quantitative relation. Based on this knowledge, the inner variable learning (IVL strategy helps the particle to inspect the relation among its inner variables, determine the exemplar variable for all other variables, and then make each variable learn from the exemplar variable in terms of their quantitative relations. In addition, we design a new trap detection and jumping out strategy to help particles escape from local optima. The trap detection operation is employed at the level of individual particles whereas the trap jumping out strategy is adaptive in its nature. Experimental simulations completed for some representative optimization functions demonstrate the excellent performance of PSO-IVL. The effectiveness of the PSO-IVL stresses a usefulness of augmenting evolutionary algorithms by problem-oriented domain knowledge.
Ferroelectric domain continuity over grain boundaries
DEFF Research Database (Denmark)
Mantri, Sukriti; Oddershede, Jette; Damjanovic, Dragan
2017-01-01
Formation and mobility of domain walls in ferroelectric materials is responsible for many of their electrical and mechanical properties. Domain wall continuity across grain boundaries has been observed since the 1950's and is speculated to affect the grain boundary-domain interactions, thereby...... impacting macroscopic ferroelectric properties in polycrystalline systems. However detailed studies of such correlated domain structures across grain boundaries are limited. In this work, we have developed the mathematical requirements for domain wall plane matching at grain boundaries of any given...... orientation. We have also incorporated the effect of grain boundary ferroelectric polarization charge created when any two domains meet at the grain boundary plane. The probability of domain wall continuity for three specific grain misorientations is studied. Use of this knowledge to optimize processing...
Domain-specific languages in perspective
J. Heering (Jan); M. Mernik (Marjan)
2007-01-01
textabstractDomain-specific languages (DSLs) are languages tailored to a specific application domain. They offer substantial gains in expressiveness and ease of use compared with general-purpose languages in their domain of application. Although the use of DSLs is by no means new, it is receiving
Dhir, Somdutta; Pacurar, Mircea; Franklin, Dino; Gáspári, Zoltán; Kertész-Farkas, Attila; Kocsor, András; Eisenhaber, Frank; Pongor, Sándor
2010-11-01
SBASE is a project initiated to detect known domain types and predicting domain architectures using sequence similarity searching (Simon et al., Protein Seq Data Anal, 5: 39-42, 1992, Pongor et al, Nucl. Acids. Res. 21:3111-3115, 1992). The current approach uses a curated collection of domain sequences - the SBASE domain library - and standard similarity search algorithms, followed by postprocessing which is based on a simple statistics of the domain similarity network (http://hydra.icgeb.trieste.it/sbase/). It is especially useful in detecting rare, atypical examples of known domain types which are sometimes missed even by more sophisticated methodologies. This approach does not require multiple alignment or machine learning techniques, and can be a useful complement to other domain detection methodologies. This article gives an overview of the project history as well as of the concepts and principles developed within this the project.
Energy Technology Data Exchange (ETDEWEB)
Kieken, Fabien; Jovic, Marko; Naslavsky, Naava; Caplan, Steve, E-mail: scaplan@unmc.edu; Sorgen, Paul L. [University of Nebraska Medical Center, Department of Biochemistry and Molecular Biology and Eppley Cancer Center (United States)], E-mail: psorgen@unmc.edu
2007-12-15
EHD1 is a member of the mammalian C-terminal Eps15 homology domain (EH) containing protein family, and regulates the recycling of various receptors from the endocytic recycling compartment to the plasma membrane. The EH domain of EHD1 binds to proteins containing either an Asn-Pro-Phe or Asp-Pro-Phe motif, and plays an important role in the subcellular localization and function of EHD1. Thus far, the structures of five N-terminal EH domains from other proteins have been solved, but to date, the structure of the EH domains from the four C-terminal EHD family paralogs remains unknown. In this study, we have assigned the 133 C-terminal residues of EHD1, which includes the EH domain, and solved its solution structure. While the overall structure resembles that of the second of the three N-terminal Eps15 EH domains, potentially significant differences in surface charge and the structure of the tripeptide-binding pocket are discussed.
International Nuclear Information System (INIS)
Kieken, Fabien; Jovic, Marko; Naslavsky, Naava; Caplan, Steve; Sorgen, Paul L.
2007-01-01
EHD1 is a member of the mammalian C-terminal Eps15 homology domain (EH) containing protein family, and regulates the recycling of various receptors from the endocytic recycling compartment to the plasma membrane. The EH domain of EHD1 binds to proteins containing either an Asn-Pro-Phe or Asp-Pro-Phe motif, and plays an important role in the subcellular localization and function of EHD1. Thus far, the structures of five N-terminal EH domains from other proteins have been solved, but to date, the structure of the EH domains from the four C-terminal EHD family paralogs remains unknown. In this study, we have assigned the 133 C-terminal residues of EHD1, which includes the EH domain, and solved its solution structure. While the overall structure resembles that of the second of the three N-terminal Eps15 EH domains, potentially significant differences in surface charge and the structure of the tripeptide-binding pocket are discussed
Impact of spectral nudging and domain size in studies of RCM response to parameter modification
Energy Technology Data Exchange (ETDEWEB)
Separovic, Leo; Laprise, Rene [Universite du Quebec a Montreal, Centre pour l' Etude et la Simulation du Climat a l' Echelle Regionale (ESCER), Montreal, QC (Canada); Universite du Quebec a Montreal (UQAM), Montreal, QC (Canada); Elia, Ramon de [Universite du Quebec a Montreal, Centre pour l' Etude et la Simulation du Climat a l' Echelle Regionale (ESCER), Montreal, QC (Canada); Consortium Ouranos, Montreal, QC (Canada)
2012-04-15
The paper aims at finding an RCM configuration that facilitates studies devoted to quantifying RCM response to parameter modification. When using short integration times, the response of the time-averaged variables to RCM modification tend to be blurred by the noise originating in the lack of predictability of the instantaneous atmospheric states. Two ways of enhancing the signal-to-noise ratio are studied in this work: spectral nudging and reduction of the computational domain size. The approach followed consists in the analysis of the sensitivity of RCM-simulated seasonal averages to perturbations of two parameters controlling deep convection and stratiform condensation, perturbed one at a time. Sensitivity is analyzed within different simulation configurations obtained by varying domain size and using the spectral nudging option. For each combination of these factors multiple members of identical simulations that differ exclusively in initial conditions are also generated to provide robust estimates of the sensitivities (the signal) and sample the noise. Results show that the noise magnitude is decreased both by reduction of domain size and the spectral nudging. However, the reduction of domain size alters some sensitivity signals. When spectral nudging is used significant alterations of the signal are not found. (orig.)
Area-averaged surface fluxes and their time-space variability over the FIFE experimental domain
Smith, E. A.; Hsu, A. Y.; Crosson, W. L.; Field, R. T.; Fritschen, L. J.; Gurney, R. J.; Kanemasu, E. T.; Kustas, W. P.; Nie, D.; Shuttleworth, W. J.
1992-01-01
The underlying mean and variance properties of surface net radiation, sensible-latent heat fluxes and soil heat flux are studied over the densely instrumented grassland region encompassing FIFE. Flux variability is discussed together with the problem of scaling up to area-averaged fluxes. Results are compared and contrasted for cloudy and clear situations and examined for the influence of surface-induced biophysical controls (burn and grazing treatments) and topographic controls (aspect ratios and slope factors).
Stanger, Frédéric V; de Beer, Tjaart A P; Dranow, David M; Schirmer, Tilman; Phan, Isabelle; Dehio, Christoph
2017-01-03
The BID (Bep intracellular delivery) domain functions as secretion signal in a subfamily of protein substrates of bacterial type IV secretion (T4S) systems. It mediates transfer of (1) relaxases and the attached DNA during bacterial conjugation, and (2) numerous Bartonella effector proteins (Beps) during protein transfer into host cells infected by pathogenic Bartonella species. Furthermore, BID domains of Beps have often evolved secondary effector functions within host cells. Here, we provide crystal structures for three representative BID domains and describe a novel conserved fold characterized by a compact, antiparallel four-helix bundle topped with a hook. The conserved hydrophobic core provides a rigid scaffold to a surface that, despite a few conserved exposed residues and similarities in charge distribution, displays significant variability. We propose that the genuine function of BID domains as T4S signal may primarily depend on their rigid structure, while the plasticity of their surface may facilitate adaptation to secondary effector functions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Computed tear film and osmolarity dynamics on an eye-shaped domain
Li, Longfei; Braun, Richard J.; Driscoll, Tobin A.; Henshaw, William D.; Banks, Jeffrey W.; King-Smith, P. Ewen
2016-01-01
The concentration of ions, or osmolarity, in the tear film is a key variable in understanding dry eye symptoms and disease. In this manuscript, we derive a mathematical model that couples osmolarity (treated as a single solute) and fluid dynamics within the tear film on a 2D eye-shaped domain. The model includes the physical effects of evaporation, surface tension, viscosity, ocular surface wettability, osmolarity, osmosis and tear fluid supply and drainage. The governing system of coupled non-linear partial differential equations is solved using the Overture computational framework, together with a hybrid time-stepping scheme, using a variable step backward differentiation formula and a Runge–Kutta–Chebyshev method that were added to the framework. The results of our numerical simulations provide new insight into the osmolarity distribution over the ocular surface during the interblink. PMID:25883248
Edwards, Sarah R; Wandless, Thomas J
2007-05-04
Rapamycin is an immunosuppressive drug that binds simultaneously to the 12-kDa FK506- and rapamycin-binding protein (FKBP12, or FKBP) and the FKBP-rapamycin binding (FRB) domain of the mammalian target of rapamycin (mTOR) kinase. The resulting ternary complex has been used to conditionally perturb protein function, and one such method involves perturbation of a protein of interest through its mislocalization. We synthesized two rapamycin derivatives that possess large substituents at the C-16 position within the FRB-binding interface, and these derivatives were screened against a library of FRB mutants using a three-hybrid assay in Saccharomyces cerevisiae. Several FRB mutants responded to one of the rapamycin derivatives, and twenty of these mutants were further characterized in mammalian cells. The mutants most responsive to the ligand were fused to yellow fluorescent protein, and fluorescence levels in the presence and absence of the ligand were measured to determine stability of the fusion proteins. Wild-type and mutant FRB domains were expressed at low levels in the absence of the rapamycin derivative, and expression levels rose up to 10-fold upon treatment with ligand. The synthetic rapamycin derivatives were further analyzed using quantitative mass spectrometry, and one of the compounds was found to contain contaminating rapamycin. Furthermore, uncontaminated analogs retained the ability to inhibit mTOR, although with diminished potency relative to rapamycin. The ligand-dependent stability displayed by wild-type FRB and FRB mutants as well as the inhibitory potential and purity of the rapamycin derivatives should be considered as potentially confounding experimental variables when using these systems.
Interoperability challenges in river discharge modelling: A cross domain application scenario
Santoro, Mattia; Andres, Volker; Jirka, Simon; Koike, Toshio; Looser, Ulrich; Nativi, Stefano; Pappenberger, Florian; Schlummer, Manuela; Strauch, Adrian; Utech, Michael; Zsoter, Ervin
2018-06-01
River discharge is a critical water cycle variable, as it integrates all the processes (e.g. runoff and evapotranspiration) occurring within a river basin and provides a hydrological output variable that can be readily measured. Its prediction is of invaluable help for many water-related tasks including water resources assessment and management, flood protection, and disaster mitigation. Observations of river discharge are important to calibrate and validate hydrological or coupled land, atmosphere and ocean models. This requires using datasets from different scientific domains (Water, Weather, etc.). Typically, such datasets are provided using different technological solutions. This complicates the integration of new hydrological data sources into application systems. Therefore, a considerable effort is often spent on data access issues instead of the actual scientific question. This paper describes the work performed to address multidisciplinary interoperability challenges related to river discharge modeling and validation. This includes definition and standardization of domain specific interoperability standards for hydrological data sharing and their support in global frameworks such as the Global Earth Observation System of Systems (GEOSS). The research was developed in the context of the EU FP7-funded project GEOWOW (GEOSS Interoperability for Weather, Ocean and Water), which implemented a "River Discharge" application scenario. This scenario demonstrates the combination of river discharge observations data from the Global Runoff Data Centre (GRDC) database and model outputs produced by the European Centre for Medium-Range Weather Forecasts (ECMWF) predicting river discharge based on weather forecast information in the context of the GEOSS.
Directory of Open Access Journals (Sweden)
Zhao-Qing Wang
2014-01-01
Full Text Available Embedding the irregular doubly connected domain into an annular regular region, the unknown functions can be approximated by the barycentric Lagrange interpolation in the regular region. A highly accurate regular domain collocation method is proposed for solving potential problems on the irregular doubly connected domain in polar coordinate system. The formulations of regular domain collocation method are constructed by using barycentric Lagrange interpolation collocation method on the regular domain in polar coordinate system. The boundary conditions are discretized by barycentric Lagrange interpolation within the regular domain. An additional method is used to impose the boundary conditions. The least square method can be used to solve the overconstrained equations. The function values of points in the irregular doubly connected domain can be calculated by barycentric Lagrange interpolation within the regular domain. Some numerical examples demonstrate the effectiveness and accuracy of the presented method.
Santos, W B; Matoso, J M D; Maltez, M; Gonçalves, T; Casanova, M; Moreira, I F H; Lourenço, R A; Monteiro, W D; Farinatti, P T V; Soares, P P; Oigman, W; Neves, M F T; Correia, M L G
2015-08-01
Systolic hypertension is associated with cognitive decline in the elderly. Altered blood pressure (BP) variability is a possible mechanism of reduced cognitive performance in elderly hypertensives. We hypothesized that altered beat-to-beat systolic BP variability is associated with reduced global cognitive performance in elderly hypertensive subjects. In exploratory analyses, we also studied the correlation between diverse discrete cognitive domains and indices of systolic BP and heart rate variability. Disproving our initial hypothesis, we have shown that hypertension and low education, but not indices of systolic BP and heart rate variability, were independent predictors of lower global cognitive performance. However, exploratory analyses showed that the systolic BP variability in semi-upright position was an independent predictor of matrix reasoning (B = 0.08 ± .03, P-value = 0.005), whereas heart rate variability in semi-upright position was an independent predictor of the executive function score (B = -6.36 ± 2.55, P-value = 0.02). We conclude that myogenic vascular and sympathetic modulation of systolic BP do not contribute to reduced global cognitive performance in treated hypertensive subjects. Nevertheless, our results suggest that both systolic BP and heart rate variability might be associated with modulation of frontal lobe cognitive domains, such as executive function and matrix reasoning.
Civera, Concepcion; Simon, Bernd; Stier, Gunter; Sattler, Michael; Macias, Maria J
2005-02-01
Pleckstrin1 is a major substrate for protein kinase C in platelets and leukocytes, and comprises a central DEP (disheveled, Egl-10, pleckstrin) domain, which is flanked by two PH (pleckstrin homology) domains. DEP domains display a unique alpha/beta fold and have been implicated in membrane binding utilizing different mechanisms. Using multiple sequence alignments and phylogenetic tree reconstructions, we find that 6 subfamilies of the DEP domain exist, of which pleckstrin represents a novel and distinct subfamily. To clarify structural determinants of the DEP fold and to gain further insight into the role of the DEP domain, we determined the three-dimensional structure of the pleckstrin DEP domain using heteronuclear NMR spectroscopy. Pleckstrin DEP shares main structural features with the DEP domains of disheveled and Epac, which belong to different DEP subfamilies. However, the pleckstrin DEP fold is distinct from these structures and contains an additional, short helix alpha4 inserted in the beta4-beta5 loop that exhibits increased backbone mobility as judged by NMR relaxation measurements. Based on sequence conservation, the helix alpha4 may also be present in the DEP domains of regulator of G-protein signaling (RGS) proteins, which are members of the same DEP subfamily. In pleckstrin, the DEP domain is surrounded by two PH domains. Structural analysis and charge complementarity suggest that the DEP domain may interact with the N-terminal PH domain in pleckstrin. Phosphorylation of the PH-DEP linker, which is required for pleckstrin function, could regulate such an intramolecular interaction. This suggests a role of the pleckstrin DEP domain in intramolecular domain interactions, which is distinct from the functions of other DEP domain subfamilies found so far.
Paas, Fred G.W.C.; van Merrienboer, Jeroen J.G.; van Merrienboer, J.J.G.
1994-01-01
Four computer-based training strategies for geometrical problem solving in the domain of computer numerically controlled machinery programming were studied with regard to their effects on training performance, transfer performance, and cognitive load. A low- and a high-variability conventional
Directory of Open Access Journals (Sweden)
Jennifer H Stuart
2016-12-01
Full Text Available The type I interferon (IFN response is a crucial innate immune signalling pathway required for defense against viral infection. Accordingly, the great majority of mammalian viruses possess means to inhibit this important host immune response. Here we show that vaccinia virus (VACV strain Western Reserve protein C6, is a dual function protein that inhibits the cellular response to type I IFNs in addition to its published function as an inhibitor of IRF-3 activation, thereby restricting type I IFN production from infected cells. Ectopic expression of C6 inhibits the induction of interferon stimulated genes (ISGs in response to IFNα treatment at both the mRNA and protein level. C6 inhibits the IFNα-induced Janus kinase/signal transducer and activator of transcription (JAK/STAT signalling pathway at a late stage, downstream of STAT1 and STAT2 phosphorylation, nuclear translocation and binding of the interferon stimulated gene factor 3 (ISGF3 complex to the interferon stimulated response element (ISRE. Mechanistically, C6 associates with the transactivation domain of STAT2 and this might explain how C6 inhibits the type I IFN signalling very late in the pathway. During virus infection C6 reduces ISRE-dependent gene expression despite the presence of the viral protein phosphatase VH1 that dephosphorylates STAT1 and STAT2. The ability of a cytoplasmic replicating virus to dampen the immune response within the nucleus, and the ability of viral immunomodulators such as C6 to inhibit multiple stages of the innate immune response by distinct mechanisms, emphasizes the intricacies of host-pathogen interactions and viral immune evasion.
Ferromagnetic and twin domains in LCMO manganites
International Nuclear Information System (INIS)
Jung, G.; Markovich, V.; Mogilyanski, D.; Beek, C. van der; Mukovskii, Y.M.
2005-01-01
Ferromagnetic and twin domains in lightly Ca-doped La 1-x Ca x MnO 3 single crystals have been visualized and investigated by means of the magneto-optical technique. Both types of domains became visible below the Curie temperature. The dominant structures seen in applied magnetic field are associated with magneto-crystalline anisotropy and twin domains. In a marked difference to the twin domains which appear only in applied magnetic field, ferromagnetic domains show up in zero applied field and are characterized by oppositely oriented spontaneous magnetization in adjacent domains. Ferromagnetic domains take form of almost periodic, corrugated strip-like structures. The corrugation of the ferromagnetic domain pattern is enforced by the underlying twin domains
International Nuclear Information System (INIS)
Zhao Yangping; Gao Huahun; Fu Longzhou
1991-01-01
A state-of-the-art multi-variable frequency-domain model has been developed for analysis of instabilities of nuclear-coupled density-wave in BWR core. The characteristic locus method is used for analysing the stability of BWR. A computer code-NUCTHIA has been derived. The model has been tested against the existing experimental data and compared with results of past single-variable analyses. By using the NUCTHIA code, the investigations of effects of main system parameters on BWW core stability have also been made. All the results are consistent with the experimental data
Milinski, S.; Bader, J.; Jungclaus, J. H.; Marotzke, J.
2017-12-01
There is some consensus on mean state changes of rainfall under global warming; changes of the internal variability, on the other hand, are more difficult to analyse and have not been discussed as much despite their importance for understanding changes in extreme events, such as droughts or floodings. We analyse changes in the rainfall variability in the tropical Atlantic region. We use a 100-member ensemble of historical (1850-2005) model simulations with the Max Planck Institute for Meteorology Earth System Model (MPI-ESM1) to identify changes of internal rainfall variability. To investigate the effects of global warming on the internal variability, we employ an additional ensemble of model simulations with stronger external forcing (1% CO2-increase per year, same integration length as the historical simulations) with 68 ensemble members. The focus of our study is on the oceanic Atlantic ITCZ. We find that the internal variability of rainfall over the tropical Atlantic does change due to global warming and that these changes in variability are larger than changes in the mean state in some regions. From splitting the total variance into patterns of variability, we see that the variability on the southern flank of the ITCZ becomes more dominant, i.e. explaining a larger fraction of the total variance in a warmer climate. In agreement with previous studies, we find that changes in the mean state show an increase and narrowing of the ITCZ. The large ensembles allow us to do a statistically robust differentiation between the changes in variability that can be explained by internal variability and those that can be attributed to the external forcing. Furthermore, we argue that internal variability in a transient climate is only well defined in the ensemble domain and not in the temporal domain, which requires the use of a large ensemble.
Bryksa, Brian C; Grahame, Douglas A; Yada, Rickey Y
2017-05-01
The present study characterized the aspartic protease saposin-like domains of four plant species, Solanum tuberosum (potato), Hordeum vulgare L. (barley), Cynara cardunculus L. (cardoon; artichoke thistle) and Arabidopsis thaliana, in terms of bilayer disruption and fusion, and structure pH-dependence. Comparison of the recombinant saposin-like domains revealed that each induced leakage of bilayer vesicles composed of a simple phospholipid mixture with relative rates Arabidopsis>barley>cardoon>potato. When compared for leakage of bilayer composed of a vacuole-like phospholipid mixture, leakage was approximately five times higher for potato saposin-like domain compared to the others. In terms of fusogenic activity, distinctions between particle size profiles were noted among the four proteins, particularly for potato saposin-like domain. Bilayer fusion assays in reducing conditions resulted in altered fusion profiles except in the case of cardoon saposin-like domain which was virtually unchanged. Secondary structure profiles were similar across all four proteins under different pH conditions, although cardoon saposin-like domain appeared to have higher overall helix structure. Furthermore, increases in Trp emission upon protein-bilayer interactions suggested that protein structure rearrangements equilibrated with half-times ranging from 52 to 120s, with cardoon saposin-like domain significantly slower than the other three species. Overall, the present findings serve as a foundation for future studies seeking to delineate protein structural features and motifs in protein-bilayer interactions based upon variability in plant aspartic protease saposin-like domain structures. Copyright © 2017 Elsevier B.V. All rights reserved.
Fractal analysis of heart rate variability and mortality after an acute myocardial infarction
DEFF Research Database (Denmark)
Tapanainen, Jari M; Thomsen, Poul Erik Bloch; Køber, Lars
2002-01-01
The recently developed fractal analysis of heart rate (HR) variability has been suggested to provide prognostic information about patients with heart failure. This prospective multicenter study was designed to assess the prognostic significance of fractal and traditional HR variability parameters...... in a large, consecutive series of survivors of an acute myocardial infarction (AMI). A consecutive series of 697 patients were recruited to participate 2 to 7 days after an AMI in 3 Nordic university hospitals. The conventional time-domain and spectral parameters and the newer fractal scaling indexes of HR...... variability were analyzed from 24-hour RR interval recordings. During the mean follow-up of 18.4 +/- 6.5 months, 49 patients (7.0%) died. Of all the risk variables, a reduced short-term fractal scaling exponent (alpha(1)
Domain-Specific Control of Selective Attention
Lin, Szu-Hung; Yeh, Yei-Yu
2014-01-01
Previous research has shown that loading information on working memory affects selective attention. However, whether the load effect on selective attention is domain-general or domain-specific remains unresolved. The domain-general effect refers to the findings that load in one content (e.g. phonological) domain in working memory influences processing in another content (e.g., visuospatial) domain. Attentional control supervises selection regardless of information domain. The domain-specific effect refers to the constraint of influence only when maintenance and processing operate in the same domain. Selective attention operates in a specific content domain. This study is designed to resolve this controversy. Across three experiments, we manipulated the type of representation maintained in working memory and the type of representation upon which the participants must exert control to resolve conflict and select a target into the focus of attention. In Experiments 1a and 1b, participants maintained digits and nonverbalized objects, respectively, in working memory while selecting a target in a letter array. In Experiment 2, we presented auditory digits with a letter flanker task to exclude the involvement of resource competition within the same input modality. In Experiments 3a and 3b, we replaced the letter flanker task with an object flanker task while manipulating the memory load on object and digit representation, respectively. The results consistently showed that memory load modulated distractibility only when the stimuli of the two tasks were represented in the same domain. The magnitude of distractor interference was larger under high load than under low load, reflecting a lower efficacy of information prioritization. When the stimuli of the two tasks were represented in different domains, memory load did not modulate distractibility. Control of processing priority in selective attention demands domain-specific resources. PMID:24866977
Jacobs, Janis E; Lanza, Stephanie; Osgood, D Wayne; Eccles, Jacquelynne S; Wigfield, Allan
2002-01-01
This study extended previous research on changes in children's self-beliefs by documenting domain-specific growth trajectories for 761 children across grades 1 through 12 in a longitudinal study of perceptions of self-competence and task values. Hierarchical Linear Modeling was used to (1) describe changes in beliefs across childhood and adolescence within the domains of mathematics, language arts, and sports; (2) examine the impact of changes in competence beliefs on changes in values over time in the same domains; and (3) describe gender differences in mean levels and trajectories of change in competence beliefs and values. The most striking finding across all domains was that self-perceptions of competence and subjective task values declined as children got older, although the extent and rate of decline varied across domains. For example, in language arts, competence beliefs declined rapidly during the elementary school years, but then leveled off or increased to some extent; whereas the decline in self-competence beliefs in sports accelerated during the high school years. Significant gender differences in beliefs were found in most domains; however, the gender differences in developmental trajectories appeared to be domain specific rather than global. Importantly, the gender differences between boys and girls did not systematically increase with age, as predicted by some socialization perspectives. Adding competence beliefs as an explanatory variable to the model for task values revealed that changes in competence beliefs accounted for much of the age-related decline in task values. In addition, competence beliefs accounted for most of the gender differences in task values for language arts and sports.
Domain wall engineering through exchange bias
International Nuclear Information System (INIS)
Albisetti, E.; Petti, D.
2016-01-01
The control of the structure and position of magnetic domain walls is at the basis of the development of different magnetic devices and architectures. Several nanofabrication techniques have been proposed to geometrically confine and shape domain wall structures; however, a fine tuning of the position and micromagnetic configuration is hardly achieved, especially in continuous films. This work shows that, by controlling the unidirectional anisotropy of a continuous ferromagnetic film through exchange bias, domain walls whose spin arrangement is generally not favored by dipolar and exchange interactions can be created. Micromagnetic simulations reveal that the domain wall width, position and profile can be tuned by establishing an abrupt change in the direction and magnitude of the exchange bias field set in the system. - Highlights: • Micromagnetic simulations study domain walls in exchange biased thin films. • Novel domain wall configurations can be stabilized via exchange bias. • Domain walls nucleate at the boundary of regions with different exchange bias. • Domain wall width and spin profile are controlled by tuning the exchange bias.
Frequency Domain Image Filtering Using CUDA
Directory of Open Access Journals (Sweden)
Muhammad Awais Rajput
2014-10-01
Full Text Available In this paper, we investigate the implementation of image filtering in frequency domain using NVIDIA?s CUDA (Compute Unified Device Architecture. In contrast to signal and image filtering in spatial domain which uses convolution operations and hence is more compute-intensive for filters having larger spatial extent, the frequency domain filtering uses FFT (Fast Fourier Transform which is much faster and significantly reduces the computational complexity of the filtering. We implement the frequency domain filtering on CPU and GPU respectively and analyze the speed-up obtained from the CUDA?s parallel processing paradigm. In order to demonstrate the efficiency of frequency domain filtering on CUDA, we implement three frequency domain filters, i.e., Butterworth, low-pass and Gaussian for processing different sizes of images on CPU and GPU respectively and perform the GPU vs. CPU benchmarks. The results presented in this paper show that the frequency domain filtering with CUDA achieves significant speed-up over the CPU processing in frequency domain with the same level of (output image quality on both the processing architectures
Frequency domain image filtering using cuda
International Nuclear Information System (INIS)
Rajput, M.A.; Khan, U.A.
2014-01-01
In this paper, we investigate the implementation of image filtering in frequency domain using NVIDIA's CUDA (Compute Unified Device Architecture). In contrast to signal and image filtering in spatial domain which uses convolution operations and hence is more compute-intensive for filters having larger spatial extent, the frequency domain filtering uses FFT (Fast Fourier Transform) which is much faster and significantly reduces the computational complexity of the filtering. We implement the frequency domain filtering on CPU and GPU respectively and analyze the speed-up obtained from the CUDA's parallel processing paradigm. In order to demonstrate the efficiency of frequency domain filtering on CUDA, we implement three frequency domain filters, i.e., Butter worth, low-pass and Gaussian for processing different sizes of images on CPU and GPU respectively and perform the GPU vs. CPU benchmarks. The results presented in this paper show that the frequency domain filtering with CUDA achieves significant speed-up over the CPU processing in frequency domain with the same level of (output) image quality on both the processing architectures. (author)
Graham, Jesse; Nosek, Brian A.; Haidt, Jonathan; Iyer, Ravi; Koleva, Spassena; Ditto, Peter H.
2010-01-01
The moral domain is broader than the empathy and justice concerns assessed by existing measures of moral competence, and it is not just a subset of the values assessed by value inventories. To fill the need for reliable and theoretically-grounded measurement of the full range of moral concerns, we developed the Moral Foundations Questionnaire (MFQ) based on a theoretical model of five universally available (but variably developed) sets of moral intuitions: Harm/care, Fairness/reciprocity, Ingroup/loyalty, Authority/respect, and Purity/sanctity. We present evidence for the internal and external validity of the scale and the model, and in doing so present new findings about morality: 1. Comparative model fitting of confirmatory factor analyses provides empirical justification for a five-factor structure of moral concerns. 2. Convergent/discriminant validity evidence suggests that moral concerns predict personality features and social group attitudes not previously considered morally relevant. 3. We establish pragmatic validity of the measure in providing new knowledge and research opportunities concerning demographic and cultural differences in moral intuitions. These analyses provide evidence for the usefulness of Moral Foundations Theory in simultaneously increasing the scope and sharpening the resolution of psychological views of morality. PMID:21244182
Critical variables of business failure: a review and classification framework
Directory of Open Access Journals (Sweden)
Marius Pretorius
2011-08-01
Full Text Available Failure is a phenomenon that ventures face during all stages of the life cycle and requires insight into its causes before it can be reversed. The scientific literature on failure is, however, spread over multiple disciplines. This study’s line of enquiry firstly reviews the documented research (both theoretical and empirical encompassing the phenomenon ‘business failure’ on a multi-disciplinary basis. A conceptual framework is then proposed for categorising variables into four sub-domains namely: signs and prediction; causes and preconditions; recovery; and cognition and learning. Better understanding of the failure phenomenon is achieved. The methodology applied is fundamentally based on grounded theory interpretation with a focus on classifying the identified relevant variables.
Directory of Open Access Journals (Sweden)
Zsolt Mártonfalvi
Full Text Available Titin is a giant elastomeric protein responsible for the generation of passive muscle force. Mechanical force unfolds titin's globular domains, but the exact structure of the overstretched titin molecule is not known. Here we analyzed, by using high-resolution atomic force microscopy, the structure of titin molecules overstretched with receding meniscus. The axial contour of the molecules was interrupted by topographical gaps with a mean width of 27.7 nm that corresponds well to the length of an unfolded globular (immunoglobulin and fibronectin domain. The wide gap-width distribution suggests, however, that additional mechanisms such as partial domain unfolding and the unfolding of neighboring domain multimers may also be present. In the folded regions we resolved globules with an average spacing of 5.9 nm, which is consistent with a titin chain composed globular domains with extended interdomain linker regions. Topographical analysis allowed us to allocate the most distal unfolded titin region to the kinase domain, suggesting that this domain systematically unfolds when the molecule is exposed to overstretching forces. The observations support the prediction that upon the action of stretching forces the N-terminal ß-sheet of the titin kinase unfolds, thus exposing the enzyme's ATP-binding site and hence contributing to the molecule's mechanosensory function.
Quantifying information transfer by protein domains: Analysis of the Fyn SH2 domain structure
Directory of Open Access Journals (Sweden)
Serrano Luis
2008-10-01
Full Text Available Abstract Background Efficient communication between distant sites within a protein is essential for cooperative biological response. Although often associated with large allosteric movements, more subtle changes in protein dynamics can also induce long-range correlations. However, an appropriate formalism that directly relates protein structural dynamics to information exchange between functional sites is still lacking. Results Here we introduce a method to analyze protein dynamics within the framework of information theory and show that signal transduction within proteins can be considered as a particular instance of communication over a noisy channel. In particular, we analyze the conformational correlations between protein residues and apply the concept of mutual information to quantify information exchange. Mapping out changes of mutual information on the protein structure then allows visualizing how distal communication is achieved. We illustrate the approach by analyzing information transfer by the SH2 domain of Fyn tyrosine kinase, obtained from Monte Carlo dynamics simulations. Our analysis reveals that the Fyn SH2 domain forms a noisy communication channel that couples residues located in the phosphopeptide and specificity binding sites and a number of residues at the other side of the domain near the linkers that connect the SH2 domain to the SH3 and kinase domains. We find that for this particular domain, communication is affected by a series of contiguous residues that connect distal sites by crossing the core of the SH2 domain. Conclusion As a result, our method provides a means to directly map the exchange of biological information on the structure of protein domains, making it clear how binding triggers conformational changes in the protein structure. As such it provides a structural road, next to the existing attempts at sequence level, to predict long-range interactions within protein structures.
Resolving the Origin of Pseudo-Single Domain Magnetic Behavior
Roberts, Andrew P.; Almeida, Trevor P.; Church, Nathan S.; Harrison, Richard J.; Heslop, David; Li, Yiliang; Li, Jinhua; Muxworthy, Adrian R.; Williams, Wyn; Zhao, Xiang
2017-12-01
The term "pseudo-single domain" (PSD) has been used to describe the transitional state in rock magnetism that spans the particle size range between the single domain (SD) and multidomain (MD) states. The particle size range for the stable SD state in the most commonly occurring terrestrial magnetic mineral, magnetite, is so narrow ( 20-75 nm) that it is widely considered that much of the paleomagnetic record of interest is carried by PSD rather than stable SD particles. The PSD concept has, thus, become the dominant explanation for the magnetization associated with a major fraction of particles that record paleomagnetic signals throughout geological time. In this paper, we argue that in contrast to the SD and MD states, the term PSD does not describe the relevant physical processes, which have been documented extensively using three-dimensional micromagnetic modeling and by parallel research in material science and solid-state physics. We also argue that features attributed to PSD behavior can be explained by nucleation of a single magnetic vortex immediately above the maximum stable SD transition size. With increasing particle size, multiple vortices, antivortices, and domain walls can nucleate, which produce variable cancellation of magnetic moments and a gradual transition into the MD state. Thus, while the term PSD describes a well-known transitional state, it fails to describe adequately the physics of the relevant processes. We recommend that use of this term should be discontinued in favor of "vortex state," which spans a range of behaviors associated with magnetic vortices.
Phylogeny of the TRAF/MATH domain.
Zapata, Juan M; Martínez-García, Vanesa; Lefebvre, Sophie
2007-01-01
The TNF-receptor associated factor (TRAF) domain (TD), also known as the meprin and TRAF-C homology (MATH) domain is a fold of seven anti-parallel p-helices that participates in protein-protein interactions. This fold is broadly represented among eukaryotes, where it is found associated with a discrete set of protein-domains. Virtually all protein families encompassing a TRAF/MATH domain seem to be involved in the regulation of protein processing and ubiquitination, strongly suggesting a parallel evolution of the TRAF/MATH domain and certain proteolysis pathways in eukaryotes. The restricted number of living organisms for which we have information of their genetic and protein make-up limits the scope and analysis of the MATH domain in evolution. However, the available information allows us to get a glimpse on the origins, distribution and evolution of the TRAF/MATH domain, which will be overviewed in this chapter.
Neonatal exposure to phenobarbital potentiates schizophrenia-like behavioral outcomes in the rat.
Bhardwaj, S K; Forcelli, P A; Palchik, G; Gale, K; Srivastava, L K; Kondratyev, A
2012-06-01
Previous work has indicated an association between seizures early in life and increased risk of psychiatric disorders, including schizophrenia. However, because early-life seizures are commonly treated with antiepileptic drugs (AEDs) such as phenobarbital, the possibility that drug treatment may affect later-life psychiatric outcomes needs to be evaluated. We therefore tested the hypothesis that phenobarbital exposure in the neonatal rat increases the risk of schizophrenia-like behavioral abnormalities in adulthood. Thus, in this study, we examined the effects of a single acute neonatal exposure to phenobarbital on adult behavioral outcomes in the rat neonatal ventral hippocampal (nVH) lesion model of schizophrenia. We compared these outcomes to those in rats a) without nVH lesions and b) with nVH lesions, without phenobarbital. The tasks used for behavioral evaluation were: amphetamine-induced locomotion, prepulse inhibition, elevated plus-maze, and novel object recognition task. We found that neonatal phenobarbital treatment (in the absence of nVH lesions) was sufficient to disrupt sensorimotor gating (as tested by prepulse inhibition) in adulthood to an extent equivalent to nVH lesions. Additionally, neonatal phenobarbital exposure enhanced the locomotor response to amphetamine in adult animals with and without nVH lesions. Our findings suggest that neonatal exposure to phenobarbital can predispose to schizophrenia-like behavioral abnormalities. Our findings underscore the importance of examining AED exposure early in life as a potential risk factor for later-life neuropsychiatric abnormalities in clinical populations. Copyright © 2012 Elsevier Ltd. All rights reserved.
A micromagnetic study of domain structure modeling
International Nuclear Information System (INIS)
Matsuo, Tetsuji; Mimuro, Naoki; Shimasaki, Masaaki
2008-01-01
To develop a mesoscopic model for magnetic-domain behavior, a domain structure model (DSM) was examined and compared with a micromagnetic simulation. The domain structure of this model is given by several domains with uniform magnetization vectors and domain walls. The directions of magnetization vectors and the locations of domain walls are determined so as to minimize the magnetic total energy of the magnetic material. The DSM was modified to improve its representation capability for domain behavior. The domain wall energy is multiplied by a vanishing factor to represent the disappearance of magnetic domain. The sequential quadratic programming procedure is divided into two steps to improve an energy minimization process. A comparison with micromagnetic simulation shows that the modified DSM improves the representation accuracy of the magnetization process
Texture of lipid bilayer domains
DEFF Research Database (Denmark)
Jensen, Uffe Bernchou; Brewer, Jonathan R.; Midtiby, Henrik Skov
2009-01-01
We investigate the texture of gel (g) domains in binary lipid membranes composed of the phospholipids DPPC and DOPC. Lateral organization of lipid bilayer membranes is a topic of fundamental and biological importance. Whereas questions related to size and composition of fluid membrane domain...... are well studied, the possibility of texture in gel domains has so far not been examined. When using polarized light for two-photon excitation of the fluorescent lipid probe Laurdan, the emission intensity is highly sensitive to the angle between the polarization and the tilt orientation of lipid acyl...... chains. By imaging the intensity variations as a function of the polarization angle, we map the lateral variations of the lipid tilt within domains. Results reveal that gel domains are composed of subdomains with different lipid tilt directions. We have applied a Fourier decomposition method...
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
International Nuclear Information System (INIS)
Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.
1987-01-01
The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond
On the structure of order domains
DEFF Research Database (Denmark)
Geil, Olav; Pellikaan, Ruud
2002-01-01
The notion of an order domain is generalized. The behaviour of an order domain by taking a subalgebra, the extension of scalars, and the tensor product is studied. The relation of an order domain with valuation theory, Gröbner algebras, and graded structures is given. The theory of Gröbner bases...... for order domains is developed and used to show that the factor ring theorem and its converse, the presentation theorem, hold. The dimension of an order domain is related to the rank of its value semigroup....
A proof-of-principle for frequency-domain vibration analysis
International Nuclear Information System (INIS)
Mobley, R.K.
1987-01-01
The economic and regulatory pressures on operating utilities to improve efficiency, availability, and reliability and to extend the effective operating life of existing electric power generating plants have created a real need for instrumentation, systems, and programs that can monitor, analyze, and provide the means to correct incipient machine and process problems. Predictive maintenance programs, properly utilized, can be one key to achieving these goals. Recent developments in microprocessor technology have provided the ability to routinely monitor the actual mechanical condition of all rotating and reciprocating machinery and process variables (i.e., pressure, temperature, flow, etc.) of other process equipment within an operating electric power generating plant. This direct correlation between frequency-domain vibration and actual mechanical condition of machinery and trending process variables of nonrotating equipment can provide the key to improving availability, reliability, and thermal efficiency and can provide the baseline information necessary for developing a realistic plan for extending the useful life of power plants. The premise of utilizing microprocessor-based predictive maintenance to improve power plant operation has been proven by a number of utilities
Chen, Veronica M; Foilb, Allison R; Christianson, John P
2016-01-01
The ventral hippocampus (VH) is involved in the both the acquisition and recall of conditioned fear. Here, we tested the role of VH in acquisition and recall of a conditioned fear discrimination. Intra-VH vehicle or muscimol injections were made 1h prior to a CS+/CS- conditioning or prior to later recall. Vehicle treated rats exhibited discrimination with significantly greater freezing to the CS+ than to the CS- whereas muscimol treated rats did not freeze. Injections made before recall had no effect as both treatment groups displayed equal freezing in response to the CS+, and discrimination. While these results are consistent with several reports, the failure to influence fear discrimination upon recall appears to contrast with the hypothesized role of VH in recall of extinguished conditioned fear cues. Copyright © 2015 Elsevier B.V. All rights reserved.
Peculiarities of low-frequency dielectric spectra and domain wall motion in gadolinium molybdate
International Nuclear Information System (INIS)
Galiyarova, N.M.; Gorin, S.V.; Dontsova, L.I.; Shil'nikov, A.V.; Shuvalov, L.A.
1994-01-01
Low-frequency Debye dispersion of dielectric permeability in GMO with the low values of high-frequency limit ε ∞ was investigated in a wide temperature range as well as in fields of variable amplitude. The features of domain boundaries motion were studied at the partial repolarization in monopolar P-pulsed fields. The model of cooperationrelaxation motion brifing in parallel with positive to negative contribution to polarization that explained the low values of ε ∞ was suggested
DEFF Research Database (Denmark)
Hansen, Tina Østergaard; Lange, Anders Blaabjerg; Barington, Torben
2015-01-01
Rearrangement of the Ig locus occurs in two steps. First, a JH gene is rearranged to a D gene followed by a VH gene rearranging to the DJH rearrangement. By next generation sequencing, we analyzed 9969 unique DJH rearrangements and 5919 unique VHDJH rearrangements obtained from peripheral blood B...... frequently than JH locus distal D genes, whereas VH locus proximal D genes were observed more frequently in nonproductive VHDJH rearrangements. We further demonstrate that the distance between VH, D, and JH gene segments influence their ability to rearrange within the human Ig locus....
Linear verrucous hemangioma-a rare case and dermoscopic clues to diagnosis.
Dhanta, Aditi; Chauhan, Payal; Meena, Dilip; Hazarika, Neirita
2018-01-01
Verrucous hemangioma (VH) is a rare, congenital and localized vascular malformation, which usually presents as warty, bluish, vascular papules, plaques, or nodules, mainly on the lower extremities. Linear presentation of the disease is rare. A deep biopsy is necessary to confirm the clinical diagnosis by histopathological examination, with dermoscopy acting as a useful tool for evaluating the precise vascular structure. Here, we report on a 13-year-old female child with linear VH presenting over her foot since infancy and dermoscopic findings of VH along with the clinical-pathologic features.
M. Banach (Maciej); C. Serban (Corina); A. Sahebkar (Amirhossein); D.P. Mikhailidis (Dimitri P.); S. Ursoniu (Sorin); K.K. Ray (Kausik K.); J. Rysz (Jacek); P.P. Toth (Peter); P. Muntner (Paul); S. Mosteoru (Svetlana); H.M. Garcia-Garcia (Hector); G.K. Hovingh (Kees); J.J.P. Kastelein (John); P.W.J.C. Serruys (Patrick)
2015-01-01
textabstractBackground: Virtual histology intravascular ultrasound (VH-IVUS) imaging is an innovative tool for the morphological evaluation of coronary atherosclerosis. Evidence for the effects of statin therapy on VH-IVUS parameters have been inconclusive. Consequently, we performed a systematic
Wang, Xu; Gao, Zhensen; Kataoka, Nobuyuki; Wada, Naoya
2010-05-10
A novel scheme using single phase modulator for simultaneous time domain spectral phase encoding (SPE) signal generation and DPSK data modulation is proposed and experimentally demonstrated. Array- Waveguide-Grating and Variable-Bandwidth-Spectrum-Shaper based devices can be used for decoding the signal directly in spectral domain. The effects of fiber dispersion, light pulse width and timing error on the coding performance have been investigated by simulation and verified in experiment. In the experiment, SPE signal with 8-chip, 20GHz/chip optical code patterns has been generated and modulated with 2.5 Gbps DPSK data using single modulator. Transmission of the 2.5 Gbps data over 34km fiber with BEROCDMA) and secure optical communication applications. (c) 2010 Optical Society of America.
A time domain inverse dynamic method for the end point tracking control of a flexible manipulator
Kwon, Dong-Soo; Book, Wayne J.
1991-01-01
The inverse dynamic equation of a flexible manipulator was solved in the time domain. By dividing the inverse system equation into the causal part and the anticausal part, we calculated the torque and the trajectories of all state variables for a given end point trajectory. The interpretation of this method in the frequency domain was explained in detail using the two-sided Laplace transform and the convolution integral. The open loop control of the inverse dynamic method shows an excellent result in simulation. For real applications, a practical control strategy is proposed by adding a feedback tracking control loop to the inverse dynamic feedforward control, and its good experimental performance is presented.
Pelat, M; Verwaerde, P; Lazartiques, E; Cabrol, P; Galitzky, J; Berlan, M; Montastruc, J L; Senard, J M
1998-08-01
Modifications of heart rate (HR) and systolic blood pressure (SBP) variabilities (V) have been reported in the human syndrome arterial hypertension plus insulin-resistance. The aim of this study was to characterize the 24 h SBPV and HRV in both time and frequency domains during weight increase in dogs fed ad libitum with a high fat diet. Implantable transmitter units for measurement of blood pressure and heart rate were surgically implanted in five beagle male dogs. BP and HR were continuously recorded using telemetric measurements during 24 hours, before and after 6 and 9 weeks of hypercaloric diet in quiet animals submitted to a 12h light-dark cycle. To study nychtemeral cycle of SBP and HR, two periods were chosen: day (from 6.00 h to 19.00 h) and night (from 23.00 h to 6.00 h). Spontaneous baroreflex efficiency was measured using the sequence method. Spectral variability of HR and SBP was analyzed using a fast Fourier transformation on 512 consecutive values and normalized units of low (LF: 50-150 mHz, reflecting sympathetic activity) and high (HF: respiratory rate +/- 50 mHz, reflecting parasympathetic activity) frequency bands were calculated. The energy of total spectrum (from 0.004 to 1 Hz) was also studied. Body weight (12.4 +/- 0.9 vs 14.9 +/- 0.9 kg, p vs 147 +/- 1 mmHg, p vs night: 71 +/- 1 bpm) but not after 9 weeks (day: 91 +/- 4 bpm ; night: 86 +/- 2 bpm). Concomitantly, the efficiency of spontaneous baroreflex decreased at 6 weeks (36 +/- 1 vs 42 +/- 2 mmHg/ms, p energy of HRV was found after 6 but not after 9 weeks. LF energy of SBPV was increased at 6 but not at 9 weeks (table). [table: see text] In conclusion, this study shows that an hyperlipidic and hypercaloric diet induces transient variations in autonomic nervous system activity which could be the physiopathological link between obesity, insulin-resistance and arterial hypertension.
Multiple graph regularized protein domain ranking.
Wang, Jim Jing-Yan; Bensmail, Halima; Gao, Xin
2012-11-19
Protein domain ranking is a fundamental task in structural biology. Most protein domain ranking methods rely on the pairwise comparison of protein domains while neglecting the global manifold structure of the protein domain database. Recently, graph regularized ranking that exploits the global structure of the graph defined by the pairwise similarities has been proposed. However, the existing graph regularized ranking methods are very sensitive to the choice of the graph model and parameters, and this remains a difficult problem for most of the protein domain ranking methods. To tackle this problem, we have developed the Multiple Graph regularized Ranking algorithm, MultiG-Rank. Instead of using a single graph to regularize the ranking scores, MultiG-Rank approximates the intrinsic manifold of protein domain distribution by combining multiple initial graphs for the regularization. Graph weights are learned with ranking scores jointly and automatically, by alternately minimizing an objective function in an iterative algorithm. Experimental results on a subset of the ASTRAL SCOP protein domain database demonstrate that MultiG-Rank achieves a better ranking performance than single graph regularized ranking methods and pairwise similarity based ranking methods. The problem of graph model and parameter selection in graph regularized protein domain ranking can be solved effectively by combining multiple graphs. This aspect of generalization introduces a new frontier in applying multiple graphs to solving protein domain ranking applications.
Natural Language Search Interfaces: Health Data Needs Single-Field Variable Search
Smith, Sam; Sufi, Shoaib; Goble, Carole; Buchan, Iain
2016-01-01
Background Data discovery, particularly the discovery of key variables and their inter-relationships, is key to secondary data analysis, and in-turn, the evolving field of data science. Interface designers have presumed that their users are domain experts, and so they have provided complex interfaces to support these “experts.” Such interfaces hark back to a time when searches needed to be accurate first time as there was a high computational cost associated with each search. Our work is part of a governmental research initiative between the medical and social research funding bodies to improve the use of social data in medical research. Objective The cross-disciplinary nature of data science can make no assumptions regarding the domain expertise of a particular scientist, whose interests may intersect multiple domains. Here we consider the common requirement for scientists to seek archived data for secondary analysis. This has more in common with search needs of the “Google generation” than with their single-domain, single-tool forebears. Our study compares a Google-like interface with traditional ways of searching for noncomplex health data in a data archive. Methods Two user interfaces are evaluated for the same set of tasks in extracting data from surveys stored in the UK Data Archive (UKDA). One interface, Web search, is “Google-like,” enabling users to browse, search for, and view metadata about study variables, whereas the other, traditional search, has standard multioption user interface. Results Using a comprehensive set of tasks with 20 volunteers, we found that the Web search interface met data discovery needs and expectations better than the traditional search. A task × interface repeated measures analysis showed a main effect indicating that answers found through the Web search interface were more likely to be correct (F 1,19=37.3, Peffect of task (F 3,57=6.3, Pinterface (F 1,19=18.0, Peffect of task (F 2,38=4.1, P=.025, Greenhouse
Maussang, David; Mujić-Delić, Azra; Descamps, Francis J; Stortelers, Catelijne; Vanlandschoot, Peter; Stigter-van Walsum, Marijke; Vischer, Henry F; van Roy, Maarten; Vosjan, Maria; Gonzalez-Pajuelo, Maria; van Dongen, Guus A M S; Merchiers, Pascal; van Rompaey, Philippe; Smit, Martine J
2013-10-11
The chemokine receptor CXCR7, belonging to the membrane-bound G protein-coupled receptor superfamily, is expressed in several tumor types. Inhibition of CXCR7 with either small molecules or small interference (si)RNA has shown promising therapeutic benefits in several tumor models. With the increased interest and effectiveness of biologicals inhibiting membrane-bound receptors we made use of the "Nanobody platform" to target CXCR7. Previously we showed that Nanobodies, i.e. immunoglobulin single variable domains derived from naturally occurring heavy chain-only camelids antibodies, represent new biological tools to efficiently tackle difficult drug targets such as G protein-coupled receptors. In this study we developed and characterized highly selective and potent Nanobodies against CXCR7. Interestingly, the CXCR7-targeting Nanobodies displayed antagonistic properties in contrast with previously reported CXCR7-targeting agents. Several high affinity CXCR7-specific Nanobodies potently inhibited CXCL12-induced β-arrestin2 recruitment in vitro. A wide variety of tumor biopsies was profiled, showing for the first time high expression of CXCR7 in head and neck cancer. Using a patient-derived CXCR7-expressing head and neck cancer xenograft model in nude mice, tumor growth was inhibited by CXCR7-targeting Nanobody therapy. Mechanistically, CXCR7-targeting Nanobodies did not inhibit cell cycle progression but instead reduced secretion of the angiogenic chemokine CXCL1 from head and neck cancer cells in vitro, thus acting here as inverse agonists, and subsequent angiogenesis in vivo. Hence, with this novel class of CXCR7 inhibitors, we further substantiate the therapeutic relevance of targeting CXCR7 in head and neck cancer.
Retarded potentials and time domain boundary integral equations a road map
Sayas, Francisco-Javier
2016-01-01
This book offers a thorough and self-contained exposition of the mathematics of time-domain boundary integral equations associated to the wave equation, including applications to scattering of acoustic and elastic waves. The book offers two different approaches for the analysis of these integral equations, including a systematic treatment of their numerical discretization using Galerkin (Boundary Element) methods in the space variables and Convolution Quadrature in the time variable. The first approach follows classical work started in the late eighties, based on Laplace transforms estimates. This approach has been refined and made more accessible by tailoring the necessary mathematical tools, avoiding an excess of generality. A second approach contains a novel point of view that the author and some of his collaborators have been developing in recent years, using the semigroup theory of evolution equations to obtain improved results. The extension to electromagnetic waves is explained in one of the appendices...
Diagrammatic Representations in Domain-Specific Languages
Tourlas, Konstantinos
2002-01-01
One emerging approach to reducing the labour and costs of software development favours the specialisation of techniques to particular application domains. The rationale is that programs within a given domain often share enough common features and assumptions to enable the incorporation of substantial support mechanisms into domain-specific programming languages and associated tools. Instead of being machine-oriented, algorithmic implementations, programs in many domain-speci...
Domain wall networks on solitons
International Nuclear Information System (INIS)
Sutcliffe, Paul
2003-01-01
Domain wall networks on the surface of a soliton are studied in a simple theory. It consists of two complex scalar fields, in 3+1 dimensions, with a global U(1)xZ n symmetry, where n>2. Solutions are computed numerically in which one of the fields forms a Q ball and the other field forms a network of domain walls localized on the surface of the Q ball. Examples are presented in which the domain walls lie along the edges of a spherical polyhedron, forming junctions at its vertices. It is explained why only a small restricted class of polyhedra can arise as domain wall networks
Banach, Maciej; Serban, Corina; Sahebkar, Amirhossein; Mikhailidis, Dimitri P.; Ursoniu, Sorin; Ray, Kausik K.; Rysz, Jacek; Toth, Peter P.; Muntner, Paul; Mosteoru, Svetlana; García-García, Hector M.; Hovingh, G. Kees; Kastelein, John J. P.; Serruys, Patrick W.
2015-01-01
Virtual histology intravascular ultrasound (VH-IVUS) imaging is an innovative tool for the morphological evaluation of coronary atherosclerosis. Evidence for the effects of statin therapy on VH-IVUS parameters have been inconclusive. Consequently, we performed a systematic review and meta-analysis
NIRS and IVUS for characterization of atherosclerosis in patients undergoing coronary angiography
Brugaletta, Salvatore; Garcia-Garcia, Hector M.; Serruys, Patrick W.; de Boer, Sanneke; Ligthart, Jurgen; Gomez-Lara, Josep; Witberg, Karen; Diletti, Roberto; Wykrzykowska, Joanna; van Geuns, Robert-Jan; Schultz, Carl; Regar, Evelyn; Duckers, Henricus J.; van Mieghem, Nicolas; de Jaegere, Peter; Madden, Sean P.; Muller, James E.; van der Steen, Antonius F. W.; van der Giessen, Wim J.; Boersma, Eric
2011-01-01
The aim of this study was to compare the findings of near-infrared spectroscopy (NIRS), intravascular ultrasound (IVUS) virtual histology (VH), and grayscale IVUS obtained in matched coronary vessel segments of patients undergoing coronary angiography. Intravascular ultrasound VH has been developed
Burton, Catherine L; Hultsch, David F; Strauss, Esther; Hunter, Michael A
2002-08-01
Recent research has shown that individuals with certain neurological conditions demonstrate greater intraindividual variability on cognitive tasks compared to healthy controls. The present study investigated intraindividual variability in the domains of physical functioning and affect/stress in three groups: adults with mild head injuries, adults with moderate/severe head injuries, and healthy adults. Participants were assessed on 10 occasions and results indicated that (a) individuals with head injuries demonstrated greater variability in dominant finger dexterity and right grip strength than the healthy controls; (b) increased variability tended to be associated with poorer performance/report both within and across tasks; and (c) increased variability on one task was associated with increased variability on other tasks. The findings suggest that increased variability in physical function, as well as cognitive function, represents an indicator of neurological compromise.
Towards Domain-specific Flow-based Languages
DEFF Research Database (Denmark)
Zarrin, Bahram; Baumeister, Hubert; Sarjoughian, Hessam S.
2018-01-01
describe their problems and solutions, instead of using general purpose programming languages. The goal of these languages is to improve the productivity and efficiency of the development and simulation of concurrent scientific models and systems. Moreover, they help to expose parallelism and to specify...... the concurrency within a component or across different independent components. In this paper, we introduce the concept of domain-specific flowbased languages which allows domain experts to use flow-based languages adapted to a particular problem domain. Flow-based programming is used to support concurrency, while......Due to the significant growth of the demand for data-intensive computing, in addition to the emergence of new parallel and distributed computing technologies, scientists and domain experts are leveraging languages specialized for their problem domain, i.e., domain-specific languages, to help them...
Directory of Open Access Journals (Sweden)
Xin Chai
2017-05-01
Full Text Available Electroencephalography (EEG-based emotion recognition is an important element in psychiatric health diagnosis for patients. However, the underlying EEG sensor signals are always non-stationary if they are sampled from different experimental sessions or subjects. This results in the deterioration of the classification performance. Domain adaptation methods offer an effective way to reduce the discrepancy of marginal distribution. However, for EEG sensor signals, both marginal and conditional distributions may be mismatched. In addition, the existing domain adaptation strategies always require a high level of additional computation. To address this problem, a novel strategy named adaptive subspace feature matching (ASFM is proposed in this paper in order to integrate both the marginal and conditional distributions within a unified framework (without any labeled samples from target subjects. Specifically, we develop a linear transformation function which matches the marginal distributions of the source and target subspaces without a regularization term. This significantly decreases the time complexity of our domain adaptation procedure. As a result, both marginal and conditional distribution discrepancies between the source domain and unlabeled target domain can be reduced, and logistic regression (LR can be applied to the new source domain in order to train a classifier for use in the target domain, since the aligned source domain follows a distribution which is similar to that of the target domain. We compare our ASFM method with six typical approaches using a public EEG dataset with three affective states: positive, neutral, and negative. Both offline and online evaluations were performed. The subject-to-subject offline experimental results demonstrate that our component achieves a mean accuracy and standard deviation of 80.46% and 6.84%, respectively, as compared with a state-of-the-art method, the subspace alignment auto-encoder (SAAE, which
Measures of Quantum Synchronization in Continuous Variable Systems
Mari, A.; Farace, A.; Didier, N.; Giovannetti, V.; Fazio, R.
2013-09-01
We introduce and characterize two different measures which quantify the level of synchronization of coupled continuous variable quantum systems. The two measures allow us to extend to the quantum domain the notions of complete and phase synchronization. The Heisenberg principle sets a universal bound to complete synchronization. The measure of phase synchronization is, in principle, unbounded; however, in the absence of quantum resources (e.g., squeezing) the synchronization level is bounded below a certain threshold. We elucidate some interesting connections between entanglement and synchronization and, finally, discuss an application based on quantum optomechanical systems.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Improving the Effectiveness of Speaker Verification Domain Adaptation With Inadequate In-Domain Data
2017-08-20
M speakers. We seek a probabilistic solution to domain adap- tation, and so we encode knowledge of the out-of-domain data in prior distributions...the VB solution from (16)-(21) becomes: µ =αȳ + (1− α)µout, (24) Σa =α ( 1 NT NT∑ n=1 〈ynyTn 〉 − ȳȳT ) + (1− α) Σouta (25) + α (1− α) ( ȳ − µout...non- English languages and from unseen channels. An inadequate in-domain set was provided, which consisted of 2272 samples from 1164 speakers, and
Yahashiri, Atsushi; Jorgenson, Matthew A; Weiss, David S
2017-07-15
Sporulation-related repeat (SPOR) domains are small peptidoglycan (PG) binding domains found in thousands of bacterial proteins. The name "SPOR domain" stems from the fact that several early examples came from proteins involved in sporulation, but SPOR domain proteins are quite diverse and contribute to a variety of processes that involve remodeling of the PG sacculus, especially with respect to cell division. SPOR domains target proteins to the division site by binding to regions of PG devoid of stem peptides ("denuded" glycans), which in turn are enriched in septal PG by the intense, localized activity of cell wall amidases involved in daughter cell separation. This targeting mechanism sets SPOR domain proteins apart from most other septal ring proteins, which localize via protein-protein interactions. In addition to SPOR domains, bacteria contain several other PG-binding domains that can exploit features of the cell wall to target proteins to specific subcellular sites. Copyright © 2017 American Society for Microbiology.
Interaction between Tropical Atlantic Variability and El Niño-Southern Oscillation.
Saravanan, R.; Chang, Ping
2000-07-01
The interaction between tropical Atlantic variability and El Niño-Southern Oscillation (ENSO) is investigated using three ensembles of atmospheric general circulation model integrations. The integrations are forced by specifying observed sea surface temperature (SST) variability over a forcing domain. The forcing domain is the global ocean for the first ensemble, limited to the tropical ocean for the second ensemble, and further limited to the tropical Atlantic region for the third ensemble. The ensemble integrations show that extratropical SST anomalies have little impact on tropical variability, but the effect of ENSO is pervasive in the Tropics. Consistent with previous studies, the most significant influence of ENSO is found during the boreal spring season and is associated with an anomalous Walker circulation. Two important aspects of ENSO's influence on tropical Atlantic variability are noted. First, the ENSO signal contributes significantly to the `dipole' correlation structure between tropical Atlantic SST and rainfall in the Nordeste Brazil region. In the absence of the ENSO signal, the correlations are dominated by SST variability in the southern tropical Atlantic, resulting in less of a dipole structure. Second, the remote influence of ENSO also contributes to positive correlations between SST anomalies and downward surface heat flux in the tropical Atlantic during the boreal spring season. However, even when ENSO forcing is absent, the model integrations provide evidence for a positive surface heat flux feedback in the deep Tropics, which is analyzed in a companion study by Chang et al. The analysis of model simulations shows that interannual atmospheric variability in the tropical Pacific-Atlantic system is dominated by the interaction between two distinct sources of tropical heating: (i) an equatorial heat source in the eastern Pacific associated with ENSO and (ii) an off-equatorial heat source associated with SST anomalies near the Caribbean
Groenendijk, Talita; Janssen, Tanja; Rijlaarsdam, Gert; van den Bergh, Huub
2013-03-01
Previous research has shown that observation can be effective for learning in various domains, for example, argumentative writing and mathematics. The question in this paper is whether observational learning can also be beneficial when learning to perform creative tasks in visual and verbal arts. We hypothesized that observation has a positive effect on performance, process, and motivation. We expected similarity in competence between the model and the observer to influence the effectiveness of observation. Sample. A total of 131 Dutch students (10(th) grade, 15 years old) participated. Two experiments were carried out (one for visual and one for verbal arts). Participants were randomly assigned to one of three conditions; two observational learning conditions and a control condition (learning by practising). The observational learning conditions differed in instructional focus (on the weaker or the more competent model of a pair to be observed). We found positive effects of observation on creative products, creative processes, and motivation in the visual domain. In the verbal domain, observation seemed to affect the creative process, but not the other variables. The model similarity hypothesis was not confirmed. Results suggest that observation may foster learning in creative domains, especially in the visual arts. © 2011 The British Psychological Society.
Enhanced spin transfer torque effect for transverse domain walls in cylindrical nanowires
Franchin, Matteo; Knittel, Andreas; Albert, Maximilian; Chernyshenko, Dmitri S.; Fischbacher, Thomas; Prabhakar, Anil; Fangohr, Hans
2011-09-01
Recent studies have predicted extraordinary properties for transverse domain walls in cylindrical nanowires: zero depinning current, the absence of the Walker breakdown, and applications as domain wall oscillators. In order to reliably control the domain wall motion, it is important to understand how they interact with pinning centers, which may be engineered, for example, through modulations in the nanowire geometry (such as notches or extrusions) or in the magnetic properties of the material. In this paper we study the motion and depinning of transverse domain walls through pinning centers in ferromagnetic cylindrical nanowires. We use (i) magnetic fields and (ii) spin-polarized currents to drive the domain walls along the wire. The pinning centers are modelled as a section of the nanowire which exhibits a uniaxial crystal anisotropy where the anisotropy easy axis and the wire axis enclose a variable angle θP. Using (i) magnetic fields, we find that the minimum and the maximum fields required to push the domain wall through the pinning center differ by 30%. On the contrary, using (ii) spin-polarized currents, we find variations of a factor 130 between the minimum value of the depinning current density (observed for θP=0∘, i.e., anisotropy axis pointing parallel to the wire axis) and the maximum value (for θP=90∘, i.e., anisotropy axis perpendicular to the wire axis). We study the depinning current density as a function of the height of the energy barrier of the pinning center using numerical and analytical methods. We find that for an industry standard energy barrier of 40kBT, a depinning current of about 5μA (corresponding to a current density of 6×1010A/m2 in a nanowire of 10nm diameter) is sufficient to depin the domain wall. We reveal and explain the mechanism that leads to these unusually low depinning currents. One requirement for this depinning mechanism is for the domain wall to be able to rotate around its own axis. With the right barrier design
International Nuclear Information System (INIS)
Duan Zhisheng; Wang Jinzhi; Yang Ying; Huang Lin
2009-01-01
This paper surveys frequency-domain and time-domain methods for feedback nonlinear systems and their possible applications to chaos control, coupled systems and complex dynamical networks. The absolute stability of Lur'e systems with single equilibrium and global properties of a class of pendulum-like systems with multi-equilibria are discussed. Time-domain and frequency-domain criteria for the convergence of solutions are presented. Some latest results on analysis and control of nonlinear systems with multiple equilibria and applications to chaos control are reviewed. Finally, new chaotic oscillating phenomena are shown in a pendulum-like system and a new nonlinear system with an attraction/repulsion function.
Multiple graph regularized protein domain ranking
Wang, Jim Jing-Yan
2012-11-19
Background: Protein domain ranking is a fundamental task in structural biology. Most protein domain ranking methods rely on the pairwise comparison of protein domains while neglecting the global manifold structure of the protein domain database. Recently, graph regularized ranking that exploits the global structure of the graph defined by the pairwise similarities has been proposed. However, the existing graph regularized ranking methods are very sensitive to the choice of the graph model and parameters, and this remains a difficult problem for most of the protein domain ranking methods.Results: To tackle this problem, we have developed the Multiple Graph regularized Ranking algorithm, MultiG-Rank. Instead of using a single graph to regularize the ranking scores, MultiG-Rank approximates the intrinsic manifold of protein domain distribution by combining multiple initial graphs for the regularization. Graph weights are learned with ranking scores jointly and automatically, by alternately minimizing an objective function in an iterative algorithm. Experimental results on a subset of the ASTRAL SCOP protein domain database demonstrate that MultiG-Rank achieves a better ranking performance than single graph regularized ranking methods and pairwise similarity based ranking methods.Conclusion: The problem of graph model and parameter selection in graph regularized protein domain ranking can be solved effectively by combining multiple graphs. This aspect of generalization introduces a new frontier in applying multiple graphs to solving protein domain ranking applications. 2012 Wang et al; licensee BioMed Central Ltd.
Multiple graph regularized protein domain ranking
Wang, Jim Jing-Yan; Bensmail, Halima; Gao, Xin
2012-01-01
Background: Protein domain ranking is a fundamental task in structural biology. Most protein domain ranking methods rely on the pairwise comparison of protein domains while neglecting the global manifold structure of the protein domain database. Recently, graph regularized ranking that exploits the global structure of the graph defined by the pairwise similarities has been proposed. However, the existing graph regularized ranking methods are very sensitive to the choice of the graph model and parameters, and this remains a difficult problem for most of the protein domain ranking methods.Results: To tackle this problem, we have developed the Multiple Graph regularized Ranking algorithm, MultiG-Rank. Instead of using a single graph to regularize the ranking scores, MultiG-Rank approximates the intrinsic manifold of protein domain distribution by combining multiple initial graphs for the regularization. Graph weights are learned with ranking scores jointly and automatically, by alternately minimizing an objective function in an iterative algorithm. Experimental results on a subset of the ASTRAL SCOP protein domain database demonstrate that MultiG-Rank achieves a better ranking performance than single graph regularized ranking methods and pairwise similarity based ranking methods.Conclusion: The problem of graph model and parameter selection in graph regularized protein domain ranking can be solved effectively by combining multiple graphs. This aspect of generalization introduces a new frontier in applying multiple graphs to solving protein domain ranking applications. 2012 Wang et al; licensee BioMed Central Ltd.
Multiple graph regularized protein domain ranking
Directory of Open Access Journals (Sweden)
Wang Jim
2012-11-01
Full Text Available Abstract Background Protein domain ranking is a fundamental task in structural biology. Most protein domain ranking methods rely on the pairwise comparison of protein domains while neglecting the global manifold structure of the protein domain database. Recently, graph regularized ranking that exploits the global structure of the graph defined by the pairwise similarities has been proposed. However, the existing graph regularized ranking methods are very sensitive to the choice of the graph model and parameters, and this remains a difficult problem for most of the protein domain ranking methods. Results To tackle this problem, we have developed the Multiple Graph regularized Ranking algorithm, MultiG-Rank. Instead of using a single graph to regularize the ranking scores, MultiG-Rank approximates the intrinsic manifold of protein domain distribution by combining multiple initial graphs for the regularization. Graph weights are learned with ranking scores jointly and automatically, by alternately minimizing an objective function in an iterative algorithm. Experimental results on a subset of the ASTRAL SCOP protein domain database demonstrate that MultiG-Rank achieves a better ranking performance than single graph regularized ranking methods and pairwise similarity based ranking methods. Conclusion The problem of graph model and parameter selection in graph regularized protein domain ranking can be solved effectively by combining multiple graphs. This aspect of generalization introduces a new frontier in applying multiple graphs to solving protein domain ranking applications.
Directory of Open Access Journals (Sweden)
Juha Hyyppä
2010-01-01
Full Text Available In this study we compared the accuracy of low-pulse airborne laser scanning (ALS data, multi-temporal high-resolution noninterferometric TerraSAR-X radar data and a combined feature set derived from these data in the estimation of forest variables at plot level. The TerraSAR-X data set consisted of seven dual-polarized (HH/HV or VH/VV Stripmap mode images from all seasons of the year. We were especially interested in distinguishing between the tree species. The dependent variables estimated included mean volume, basal area, mean height, mean diameter and tree species-specific mean volumes. Selection of best possible feature set was based on a genetic algorithm (GA. The nonparametric k-nearest neighbour (k-NN algorithm was applied to the estimation. The research material consisted of 124 circular plots measured at tree level and located in the vicinity of Espoo, Finland. There are large variations in the elevation and forest structure in the study area, making it demanding for image interpretation. The best feature set contained 12 features, nine of them originating from the ALS data and three from the TerraSAR-X data. The relative RMSEs for the best performing feature set were 34.7% (mean volume, 28.1% (basal area, 14.3% (mean height, 21.4% (mean diameter, 99.9% (mean volume of Scots pine, 61.6% (mean volume of Norway spruce and 91.6% (mean volume of deciduous tree species. The combined feature set outperformed an ALS-based feature set marginally; in fact, the latter was better in the case of species-specific volumes. Features from TerraSAR-X alone performed poorly. However, due to favorable temporal resolution, satellite-borne radar imaging is a promising data source for updating large-area forest inventories based on low-pulse ALS.
Anisotropy of domain wall resistance
Viret; Samson; Warin; Marty; Ott; Sondergard; Klein; Fermon
2000-10-30
The resistive effect of domain walls in FePd films with perpendicular anisotropy was studied experimentally as a function of field and temperature. The films were grown directly on MgO substrates, which induces an unusual virgin magnetic configuration composed of 60 nm wide parallel stripe domains. This allowed us to carry out the first measurements of the anisotropy of domain wall resistivity in the two configurations of current perpendicular and parallel to the walls. At 18 K, we find 8.2% and 1.3% for the domain wall magnetoresistance normalized to the wall width (8 nm) in these two respective configurations. These values are consistent with the predictions of Levy and Zhang.
Modelling above Ground Biomass of Mangrove Forest Using SENTINEL-1 Imagery
Labadisos Argamosa, Reginald Jay; Conferido Blanco, Ariel; Balidoy Baloloy, Alvin; Gumbao Candido, Christian; Lovern Caboboy Dumalag, John Bart; Carandang Dimapilis, Lee, , Lady; Camero Paringit, Enrico
2018-04-01
Many studies have been conducted in the estimation of forest above ground biomass (AGB) using features from synthetic aperture radar (SAR). Specifically, L-band ALOS/PALSAR (wavelength 23 cm) data is often used. However, few studies have been made on the use of shorter wavelengths (e.g., C-band, 3.75 cm to 7.5 cm) for forest mapping especially in tropical forests since higher attenuation is observed for volumetric objects where energy propagated is absorbed. This study aims to model AGB estimates of mangrove forest using information derived from Sentinel-1 C-band SAR data. Combinations of polarisations (VV, VH), its derivatives, grey level co-occurrence matrix (GLCM), and its principal components were used as features for modelling AGB. Five models were tested with varying combinations of features; a) sigma nought polarisations and its derivatives; b) GLCM textures; c) the first five principal components; d) combination of models a-c; and e) the identified important features by Random Forest variable importance algorithm. Random Forest was used as regressor to compute for the AGB estimates to avoid over fitting caused by the introduction of too many features in the model. Model e obtained the highest r2 of 0.79 and an RMSE of 0.44 Mg using only four features, namely, σ°VH GLCM variance, σ°VH GLCM contrast, PC1, and PC2. This study shows that Sentinel-1 C-band SAR data could be used to produce acceptable AGB estimates in mangrove forest to compensate for the unavailability of longer wavelength SAR.
Adams, Rebecca L C; Cheung, Catherine; Banh, Raymond; Saal, Russell; Cross, Donna; Gill, Devinder; Self, Marlene; Klein, Kerenaftali; Mollee, Peter
2014-03-01
Chronic lymphocytic leukemia (CLL) is a disorder in which the tempo of disease progression is highly variable, and prognostic markers that can be utilized at diagnosis are regarded as clinically important. Currently, there are several prognostic factors, such as immunoglobulin heavy chain (IgVH) mutational status, and ZAP-70 protein expression in neoplastic B-cells, that have demonstrated significant discriminative power in the prognostication of CLL. They are, however, largely unavailable in the routine diagnostic laboratory setting. In this study, we characterized the IgVH status and ZAP-70 expression by molecular techniques in a cohort of 108 patients with CLL, and correlated these results with three different methods of ZAP-70 expression by flow cytometry. We then assessed the results of these methods in terms of prognostic power as characterized by time to first treatment (TTFT). By comparing three different flow cytometry methods using receiver–operator curve (ROC) analysis, we identified that by utilizing a corrected mean fluorescence intensity (CorrMFI) algorithm for assessing ZAP-70 expression, there was good correlation with both IgVH mutational status, and ZAP-70 expression as assessed by qPCR. We were also able to show that ZAP-70 expression, as assessed by both qPCR and the CorrMFI method, was prognostic of TTFT. While confirmation in a larger patient cohort, with longer follow-up is required, we believe that the CorrMFI represents the most promising method currently available in a routine diagnostic setting for the assessment of ZAP-70 expression in CLL patients. © 2013 International Clinical Cytometry Society.