WorldWideScience

Sample records for values derived form

  1. Solid state solvation effect and reduced amplified spontaneous emission threshold value of glass forming DCM derivative in PMMA films

    Energy Technology Data Exchange (ETDEWEB)

    Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV 1063 (Latvia); Zarins, Elmars; Kokars, Valdis [Institute of Applied Chemistry, Riga Technical University, 14/24 Azenes Street, Riga LV 1048 (Latvia)

    2015-02-15

    Molecule crystallization is one of the limitations for obtaining high-gain organic laser systems. One of the examples is well known red laser dye 4-(dicyanomethylene)-2-methyl-6-(p-dimethylaminostyryl)-4H-pyran (DCM). The lowest threshold value of amplified spontaneous emission was achieved by doping 2 wt% of DCM molecule in tris-(8-hydroxy quinoline) aluminum (Alq{sub 3}) matrix. Further increase of the DCM dye concentration makes the system less efficient as its threshold value increases. It is due to large intermolecular interaction, which induces photoluminescence quenching. Compounds with reduced intermolecular interaction could be prospective in organic laser systems due to higher possible doping. In this work photoluminescence and amplified spontaneous emission properties of modified DCM molecule in poly(methyl methacrylate) (PMMA) matrix were investigated. Bulky trityloxyethyl groups were attached to the donor part of DCM. These groups increase intermolecular distance wherewith reduce photoluminescence quenching. More than one order of magnitude lower excitation threshold energy of the amplified spontaneous emission was achieved in doped polymer films with investigated compound in comparison to doped polymer with DCM. It means that the investigated compound is more perspective as a laser material compared to the previously studied. In addition, amplified spontaneous emission maximum could be tuned within 15 nm by changing concentration from 0.1 wt% to 10 wt% DWK-1 in PMMA matrix due to solid state solvation effect. - Highlights: • Bulky groups attached to DCM dye reduce photoluminescence quenching. • Amplified spontaneous emission is in red spectral region. • Amplified spontaneous emission spectra were tuned by 15 nm. • Amplified spontaneous emission threshold value was reduced by one order of magnitude.

  2. Initial value formulation of higher derivative gravity

    International Nuclear Information System (INIS)

    Noakes, D.R.

    1983-01-01

    The initial value problem is considered for the conformally coupled scalar field and higher derivative gravity, by expressing the equations of each theory in harmonic coordinates. For each theory it is shown that the (vacuum) equations can take the form of a diagonal hyperbolic system with constraints on the initial data. Consequently these theories possess well-posed initial value formulations

  3. Forming a Perceived Franchise Value: Theoretical Insights

    OpenAIRE

    Levickaitė, Rasa; Reimeris, Ramojus

    2011-01-01

    The article is based on literature review, theoretical insights and deals with the topic of perceived franchise value. The objective of the paper is – what elements form the franchisee's perceived value in service business (comparing with alternative of own business model). The aim of the paper is to propose systematic value elements in the process of forming a value of a franchise business model perceived by the franchisee. In terms of practical meaning, this article should be relevant to en...

  4. 12 CFR 1805.501 - Comparability of form and value.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Comparability of form and value. 1805.501... Comparability of form and value. (a) Matching funds shall be at least comparable in form (e.g., equity investments, deposits, credit union shares, loans and grants) and value to financial assistance provided by...

  5. The position value for partition function form network games

    NARCIS (Netherlands)

    Nouweland, van den C.G.A.M.; Slikker, M.

    We use the axiomatization of the position value for network situations in van den Nouweland and Slikker (2012) to define a position value for partition function form network situations. We do this by generalizing the axioms to the partition function form value function setting as studied in Navarro

  6. What value do users derive from social networking applications?

    OpenAIRE

    Neale, Larry; Russell-Bennett, Rebekah

    2009-01-01

    Why do users of social networking sites recommend some applications to their friends while rejecting others? What value do they obtain from applications? This exploratory study investigates the value users derive from ‘cool’ Facebook applications, and explores the features that either encourage or discourage users to recommend applications to their friends. Our qualitative data reveal consumers derive a combination of functional value along with either social or emotional value from the app...

  7. MODERN INDICATORS DERIVED FROM VALUE CREATION AND DISCOUNTED

    Directory of Open Access Journals (Sweden)

    Cican Simona

    2013-07-01

    In this article, we will present the connection between discounted cash flow methods and the indicators derived from value creation, based on the business finance theory, which says that firm value will increase if projects with positive net present value are accepted, while it will be destroyed if projects with negative net present value are accepted.

  8. Derivatives, forms and vector fields on the κ-deformed Euclidean space

    International Nuclear Information System (INIS)

    Dimitrijevic, Marija; Moeller, Lutz; Tsouchnika, Efrossini

    2004-01-01

    The model of κ-deformed space is an interesting example of a noncommutative space, since it allows a deformed symmetry. In this paper, we present new results concerning different sets of derivatives on the coordinate algebra of κ-deformed Euclidean space. We introduce a differential calculus with two interesting sets of one-forms and higher-order forms. The transformation law of vector fields is constructed in accordance with the transformation behaviour of derivatives. The crucial property of the different derivatives, forms and vector fields is that in an n-dimensional spacetime there are always n of them. This is the key difference with respect to conventional approaches, in which the differential calculus is (n + 1)-dimensional. This work shows that derivative-valued quantities such as derivative-valued vector fields appear in a generic way on noncommutative spaces

  9. Derivation of economic values for production traits in aquaculture species

    NARCIS (Netherlands)

    Janssen, K.P.E.; Berentsen, P.B.M.; Besson, M.B.; Komen, J.

    2017-01-01

    Background:
    In breeding programs for aquaculture species, breeding goal traits are often weighted based on the desired gains but economic gain would be higher if economic values were used instead. The objectives of this study were: (1) to develop a bio-economic model to derive economic values

  10. Corporate derivatives use and firm value: Evidence from Turkey

    Directory of Open Access Journals (Sweden)

    Yusuf Ayturk

    2016-06-01

    Full Text Available This paper examines use of financial derivatives (currency, interest rate and commodity and its effect on firm value of non-financial Turkish firms for period of 2007–2013. Only 36.41% of companies in our sample use derivatives to hedge their currency, interest rate or commodity price risks. We have used Tobin's Q ratio analysis with panel data models, Fama-French three-factor time-series analysis and single sector analysis to investigate whether corporate derivatives use is value relevant or not. Except Tobin's Q ratio analysis with system GMM estimators, we cannot find significant hedging premium or discount for all Turkish non-financial firms. We find a positive relationship between derivatives use and firm value, only when we use Tobin's Q ratio analysis with system GMM estimators. We also test the effects of currency hedging, interest rate hedging and commodity price hedging separately and find similar results as in the case of general derivatives use. Overall, majority of our results imply that use of financial derivatives does not affect firm value in Turkish market.

  11. Proposal for derivation of limit values for skin contamination

    International Nuclear Information System (INIS)

    Schieferdecker, H.; Koelzer, W.; Henrichs, K.

    1985-04-01

    From the primary limit value for the skin dose secondary limit values are derived for skin contamination which can be used in practical radiation protection work. In analogy to the secondary limit value for the maximum permissible body burden in case of incorporation, limit values for the 'maximum permissible skin burden' are calculated with the help of dose factors for application in case of skin contamination. They can be derived from the skin dose limit values. Considering that the skin is exposed to contamination but temporarily, in analogy to the annual limit on intake in case of incorporation a 'limit value of skin contamination' is derived for immediately removable contaminations and for one day of exposure, whereas with respect to non-removable contamination and taking into account the renewal of the skin, a limit value of annual skin contamination is defined for non-removable skin contaminations. An investigation level for skin contamination is assumed as a threshold above which defined measures must be taken. Regarding these measures not more than three times appropriate washing is recommended with the subsequent procedure determined by the level of residual contamination. The respective limit values are indicated for some radionuclides selected as examples (C-14, Co-60, Sr-90, Y-90, I-131, Cs-137, Ce-141, Pu-239). (orig./HP) [de

  12. Forming value orientations on healthy lifestyle among students

    Directory of Open Access Journals (Sweden)

    Bugaeva I.O.

    2017-06-01

    Full Text Available This work contains the model of forming the students' value priorities on healthy lifestyle based on the following levels: influence of the government, influence of the educational institution, influence of surrounding community, and self-motivation. The analysis of government motivation system used in Russia is given as well as how this policy integrated into the activities of the educational institution (on example of Saratov State Medical University n.a. V. I. Razumovsky.

  13. Pricing a Collateralized Derivative Trade with a Funding Value Adjustment

    Directory of Open Access Journals (Sweden)

    Chadd B. Hunzinger

    2015-01-01

    Full Text Available The 2008 credit crisis changed the manner in which derivative trades are conducted. One of these changes is the posting of collateral in a trade to mitigate the counterparty credit risk. Another is the realization that banks are not risk-free and, as a result, cannot borrow at the risk-free rate any longer. The latter led banks to introduced the controversial adjustment to derivative prices, known as a funding value adjustment (FVA, which is interlinked with the posting of collateral. In this paper, we extend the Cox, Ross and Rubinstein (CRR discrete-time model to include collateral and FVA. We prove that this derived model is a discrete analogue of Piterbarg’s partial differential equation (PDE, which describes the price of a collateralized derivative. The fact that the two models coincide is also verified by numerical implementation of the results that we obtain.

  14. Photophysical properties of columnar phases formed by triphenylene derivatives

    International Nuclear Information System (INIS)

    Sigal, Herve

    1997-01-01

    This research thesis reports the study of the spectroscopic properties and of the migration of excitation energy in the singlet state in columnar phases formed by alkyloxy and alkylthio derivatives of triphenylene. First, the author studied the spectroscopic properties of chromophores in solutions, and characterized excited states by using computation codes (CS-INDO-CIPSI). Then, by using the excitonic theory in the case of the considered triphenylene derivatives, the author studied the influence of molecular movements and of the intra-columnar order on the spectroscopic properties. In some circumstances, the non-radiative transfer of excitation energy is governed by a mechanism displaying a random evolution. This stochastic movement is studied by using Monte Carlo simulations. The author shows that the energy migration is one-dimensional on short times, and then becomes three-dimensional. The evolution of excitation energy in space and in time is determined [fr

  15. The Forms of Value: Problems of Convertibility in Field Theory

    Directory of Open Access Journals (Sweden)

    Göran Bolin

    2012-01-01

    Full Text Available Media production in late capitalism is often measured in terms of economic value. If value is defined as the worth of a thing, a standard or measure, being the result of social praxis and negotiation between producers and consumers in various combinations, it follows that this worth can be of other kinds than the mere economic. This is, for example, the reasoning behind field theory (Bourdieu, where the generation of field-specific capital (value is deeply dependent on the belief shared by the competing agents within the field. The full extent of the consequences of such a theory of convertibility between fields of cultural production, centred on different forms of value, is, however yet to be explored. This is the task of this article. It especially focuses on how value is constructed differently depending on the relations of the valuing subject to the production process, something that becomes highly relevant in digital media environments, where users are increasingly drawn into the production process.

  16. Synthesis and complex forming property of phosphor acid derivatives

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from

  17. Derivation of an oral toxicity reference value for nickel.

    Science.gov (United States)

    Haber, Lynne T; Bates, Hudson K; Allen, Bruce C; Vincent, Melissa J; Oller, Adriana R

    2017-06-15

    Nickel (Ni) is in the earth's crust and can be found in environmental compartments such as water, soil, and air, as well as food. This paper presents an assessment of the oral nickel toxicity data in support of non-cancer health-based oral exposure limits or toxicity reference values (TRVs). This paper derives TRVs for three populations of interest: adults, toddlers, and people who have been dermally sensitized to nickel. The adult/lifetime TRV of 20 μg Ni/kg-day is based on post-implantation loss/perinatal mortality in a 2-generation reproductive study in rats. Several recent assessments by regulatory agencies have used the same study and endpoint, but the dose-response modeling conducted here was more appropriate for the study design. Toxicokinetic data from rats and humans indicate that the applied uncertainty factors are very conservative. Because the endpoint relates to fetal exposure and is not relevant to toddlers, a toddler TRV was derived based on decreased body weight in young rats; this TRV was also 20 μg Ni/kg-day. A separate TRV of 4 μg Ni/kg in addition to Ni in food was derived for protection of nickel-sensitized populations from flare-up of dermatitis, based on studies of single exposures in humans under conditions that maximize oral absorption. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Classification of subsurface objects using singular values derived from signal frames

    Science.gov (United States)

    Chambers, David H; Paglieroni, David W

    2014-05-06

    The classification system represents a detected object with a feature vector derived from the return signals acquired by an array of N transceivers operating in multistatic mode. The classification system generates the feature vector by transforming the real-valued return signals into complex-valued spectra, using, for example, a Fast Fourier Transform. The classification system then generates a feature vector of singular values for each user-designated spectral sub-band by applying a singular value decomposition (SVD) to the N.times.N square complex-valued matrix formed from sub-band samples associated with all possible transmitter-receiver pairs. The resulting feature vector of singular values may be transformed into a feature vector of singular value likelihoods and then subjected to a multi-category linear or neural network classifier for object classification.

  19. Nutritional value of milk and meat products derived from cloning.

    Science.gov (United States)

    Tomé, Daniel; Dubarry, Michel; Fromentin, Gilles

    2004-01-01

    The development and use of milk and meat products derived from cloning depends on their safety and on the nutritional advantages they can confer to the products as perceived by consumers. The development of such products thus implies (i) to demonstrate their safety and security, (ii) to show that their nutritional value is equivalent to the traditional products, and (iii) to identify the conditions under which cloning could allow additional nutritional and health benefit in comparison to traditional products for the consumers. Both milk and meat products are a source of high quality protein as determined from their protein content and essential amino acid profile. Milk is a source of calcium, phosphorus, zinc, magnesium and vitamin B2 and B12. Meat is a source of iron, zinc and vitamin B12. An important issue regarding the nutritional quality of meat and milk is the level and quality of fat which usually present a high content in saturated fat and some modification of the fat fraction could improve the nutritional quality of the products. The role of the dietary proteins as potential allergens has to be taken into account and an important aspect regarding this question is to evaluate whether the cloning does not produce the appearance of novel allergenic structures. The presence of bio-activities associated to specific components of milk (lactoferrin, immunoglobulins, growth factors, anti-microbial components) also represents a promising development. Preliminary results obtained in rats fed cow's milk or meat-based diets prepared from control animals or from animals derived from cloning did not show any difference between control and cloning-derived products.

  20. Badly approximable systems of linear forms in absolute value

    DEFF Research Database (Denmark)

    Hussain, M.; Kristensen, Simon

    In this paper we show that the set of mixed type badly approximable simultaneously small linear forms is of maximal dimension. As a consequence of this theorem we settle the conjecture stated in [9]....

  1. Modern approaches to forming value orientations of junior pupils nowadays

    Directory of Open Access Journals (Sweden)

    Liudmyla Matsuk

    2017-04-01

    Full Text Available A number of approaches to the formation of value orientations of primary school children today is outlined in the article. One of the most important tasks of the school in terms of national revival of Ukraine appears education of harmonious, spiritually rich and nationally conscious personality. Educating of the current generation needs serious updating of educational content, development of a wide spectrum of problems associated with the formation of ideological orientations of a personality, development and activity, independence, consciousness, self-consciousness. The solution of the abovementioned problem is possible subject to optimize management of process education through the humanization of education that will ensure the establishment of priority of human values in society.Key words: values, value orientations, training and education, junior pupils, patriotism, identity, dignity, courage, duty, responsibility, tolerance.

  2. Derivation of the extrinsic values of biological diversity from its intrinsic value and of both from the first principles of evolution.

    Science.gov (United States)

    White, Peter S

    2013-12-01

    Conservation ethics have been based on 2 philosophical value systems: extrinsic value (defined broadly to include all values that derive from something external to the thing valued) and intrinsic value. Valuing biological diversity on the basis of an extrinsic value system is problematic because measurement is often difficult; extrinsic value changes as spatial or temporal scales change; extrinsic value differs on the basis of external factors; some species have trivial or negative extrinsic values; and extrinsic value varies across human cultures and societies and with such factors as socioeconomic conditions, individual experiences, and educational backgrounds. Valuing biological diversity on the basis of an intrinsic value system also poses challenges because intrinsic value can be seen as a disguised form of human extrinsic value; intrinsic value is initially ambiguous as to which objects or characteristics of biological diversity are to being valued; all aspects of biological diversity (e.g., species and ecosystems) are transitory; species and ecosystems are not static concrete entities; and intrinsic value of one species is often in conflict with the intrinsic value of other species. Extrinsic and intrinsic value systems share a common origin, such that extrinsic values are always derived from intrinsic value and life mutely expresses both intrinsic and extrinsic values-these are derived from and are products of biological evolution. Probing the values that underlie conservation helps the community clearly articulate its aims. Derivación de los Valores Extrínsecos de la Biodiversidad a Partir de sus Valores Intrínsecos y de Ambos a Partir de los Primeros Principios de la Evolución. © 2013 Society for Conservation Biology.

  3. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    International Nuclear Information System (INIS)

    Zabadal, J.; Vilhena, M.T.; Segatto, C.F.; Pazos, R.P.Ruben Panta.

    2002-01-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations

  4. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    Energy Technology Data Exchange (ETDEWEB)

    Zabadal, J. E-mail: jorge.zabadal@ufrgs.br; Vilhena, M.T. E-mail: vilhena@mat.ufrgs.br; Segatto, C.F. E-mail: cynthia@mat.ufrgs.br; Pazos, R.P.Ruben Panta. E-mail: rpp@mat.pucrgs.br

    2002-07-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations.

  5. Phosphorylated derivatives of anabasine: synthesis, constitution and complex forming properties

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text: With the purpose of detection of new effective extra gents of metals from number of sulphur containing derivatives of acids of phosphorus with different functional groups, analysis of effect of the different factors on selectivity of allocation of metals, installation of optimum conditions of an extraction, the detections of effective extra gents of noble metals from industrial sewage waters, are synthesized phosphorylated derivatives of the anabasine - O-alkyl-O-(anaba-sinoisopropyl)- and O-alkyl-O-(anabasinobutyn-2-yl)phenyl phosphonates and O-(anabasinoisopropyl)- and O-(anabasinobutyn-2-yl)diphenyl phosphonates In an IR-spectrum about O-pentyl-O-[anabasinoisopropyl]phenylphosphonate There are absorption band of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR O-(anabasinobutyn-2-yl)phenylphosphonate in the field of a weak field apart from signals of two phenylic radicals the signals of a b-displaced pyridine, reference for a molecule anabasine are observed: Hαa-8,46 p.m., H α '-8,41 p.m., H γ -7,60 p.m. And H β -7,15 p.m. A double triplet at 4,70 p.m. And triplet at 3,05 p.m. Belong to signals OCH 2 and N-CH 2 of groups, accordingly, separated by acetylene bond. The signals of piperidine cycle of anabasine have the following chemical shifts: H 2a -3,27 p.m., H 6e -2,78 p.m., H 6a -2,45 p.m., and remaining protons (6H, m, CH 2 ) are in resonance in the field of 1,1-1,9 p.m. The analysis of mass-spectrometer decay of the synthesized connections has shown, that the mass-spectrometer fragmentation M * about - O-alkyl-O- (anabasinoisopropyl) phenylphosphonates flows past in different directions and is characterized, as against about O-alkyl-O-(anabasinobutyn-2-yl)phenyl-phosphonates, large number of phosphor containing ions; the availability of the second phenylic radical in molecules anabasincontaining derivatives of a diphenyl phosphinic acid essentially

  6. The Value in Comparing Organizational Fields and Forms

    DEFF Research Database (Denmark)

    Pinheiro, Rómulo; Ramirez, Francisco O.; Geschwind, Lars

    2016-01-01

    Following the spirit of an earlier volume in the series focusing on ‘Comparative Approaches to Organizational Research’, the mandate of the current volume is to provide a comparative account of dynamics across two organizational fields – health care and higher education – and, subsequently, two...... specific types of organizational forms – hospitals and universities. In so doing, we take a broader perspective encompassing various conceptual and theoretical points of departure emanating from, mostly, the institutional literature in the social sciences (and its various perspectives), but also from...... public policy and administration literatures – of relevance to scholars and the communities of practice working within either field. In this introductory paper to the volume, we provide a brief overview of developments across the two organizational fields and illuminate on the most important scholarly...

  7. Internalization of Conservation Values in Forming Green Consumption Attitude

    Directory of Open Access Journals (Sweden)

    Syamsu Hadi

    2017-06-01

    Full Text Available The research aims to know a friendly environmental governance system. One sector of economic governance can certainly be initiated through green consumption. The focus of the problem was the green consumption education. This research was conducted by using qualitative approach in order to reveal how the process of conservation education in the Faculty of Economics in fostering behaviors that tend to conserve the consumption behavior in this case the green consumption attitude. The collecting data of research used observation, documentation and interview. This research uncovers how the conservation education is able to shape and build the green consumption attitudes that exist among the students from planning process, implementation, and evaluation of conservation education on the aspects of green consumption. Internalization of conservation value performed by the educators (in this case the lecturers at the Faculty of Economics, Universitas Negeri Semarang runs well enough.

  8. EURRECA—Estimating Selenium Requirements for Deriving Dietary Reference Values

    NARCIS (Netherlands)

    Hurst, R.; Collings, R.; Harvey, L.J.; King, M.; Hooper, L.; Bouwman, J.; Gurinovic, M.; Fairweather-Tait, S.J.

    2013-01-01

    Current reference values for selenium, an essential micronutrient, are based on the intake of selenium that is required to achieve maximal glutathione peroxidase activity in plasma or erythrocytes. In order to assess the evidence of relevance to setting dietary reference values for selenium, the

  9. Extensions of vector-valued functions with preservation of derivatives

    Czech Academy of Sciences Publication Activity Database

    Koc, M.; Kolář, Jan

    2017-01-01

    Roč. 449, č. 1 (2017), s. 343-367 ISSN 0022-247X R&D Projects: GA ČR(CZ) GA14-07880S Institutional support: RVO:67985840 Keywords : vector-valued differentiable functions * extensions * strict differentiability * partitions of unity Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.064, year: 2016 http://www.sciencedirect.com/science/article/pii/S0022247X16307703

  10. A class of constitutive relations with internal variable derivatives. Derivation from homogenization and initial value problem

    International Nuclear Information System (INIS)

    Andrieux, S.; Joussemet, M.; Lorentz, E.

    1996-01-01

    A general framework for deriving and using a class of constitutive laws incorporating spatial gradients of internal variables is presented. It uses two basic ingredients: a derivation of such models by homogenization techniques and a reformulation of the evolution equation at the scale of the whole structure. (orig.)

  11. A generalized form of the Bernoulli Trial collision scheme in DSMC: Derivation and evaluation

    Science.gov (United States)

    Roohi, Ehsan; Stefanov, Stefan; Shoja-Sani, Ahmad; Ejraei, Hossein

    2018-02-01

    The impetus of this research is to present a generalized Bernoulli Trial collision scheme in the context of the direct simulation Monte Carlo (DSMC) method. Previously, a subsequent of several collision schemes have been put forward, which were mathematically based on the Kac stochastic model. These include Bernoulli Trial (BT), Ballot Box (BB), Simplified Bernoulli Trial (SBT) and Intelligent Simplified Bernoulli Trial (ISBT) schemes. The number of considered pairs for a possible collision in the above-mentioned schemes varies between N (l) (N (l) - 1) / 2 in BT, 1 in BB, and (N (l) - 1) in SBT or ISBT, where N (l) is the instantaneous number of particles in the lth cell. Here, we derive a generalized form of the Bernoulli Trial collision scheme (GBT) where the number of selected pairs is any desired value smaller than (N (l) - 1), i.e., Nsel < (N (l) - 1), keeping the same the collision frequency and accuracy of the solution as the original SBT and BT models. We derive two distinct formulas for the GBT scheme, where both formula recover BB and SBT limits if Nsel is set as 1 and N (l) - 1, respectively, and provide accurate solutions for a wide set of test cases. The present generalization further improves the computational efficiency of the BT-based collision models compared to the standard no time counter (NTC) and nearest neighbor (NN) collision models.

  12. Value distribution and the Lemma of the logarithmic derivative on polydiscs

    Directory of Open Access Journals (Sweden)

    Wilhelm Stoll

    1983-01-01

    Full Text Available Value distribution is developed on polydiscs with the special emphasis that the value distribution function depend on a vector variable. A Lemma of the logarithmic derivative for meromorphic functions on polydiscs is derived. Here the Bergman boundary of the polydiscs is approached along cones of any dimension and exceptional sets for such an approach are defined.

  13. Derivative spectrophotometric method for simultaneous determination of clindamycin phosphate and tretinoin in pharmaceutical dosage forms.

    Science.gov (United States)

    Barazandeh Tehrani, Maliheh; Namadchian, Melika; Fadaye Vatan, Sedigheh; Souri, Effat

    2013-04-10

    A derivative spectrophotometric method was proposed for the simultaneous determination of clindamycin and tretinoin in pharmaceutical dosage forms. The measurement was achieved using the first and second derivative signals of clindamycin at (1D) 251 nm and (2D) 239 nm and tretinoin at (1D) 364 nm and (2D) 387 nm.The proposed method showed excellent linearity at both first and second derivative order in the range of 60-1200 and 1.25-25 μg/ml for clindamycin phosphate and tretinoin respectively. The within-day and between-day precision and accuracy was in acceptable range (CVpharmaceutical dosage form.

  14. An Activity of Thioacyl Derivatives of 4-Aminoquinolinium Salts towards Biofilm Producing and Planktonic Forms of Coagulase-Negative Staphylococci

    Directory of Open Access Journals (Sweden)

    Robert D. Wojtyczka

    2015-01-01

    Full Text Available Microorganisms present in different environments have developed specific mechanisms of settling on various abiotic and biotic surfaces by forming a biofilm. It seems to be well justified to search for new compounds enabling biofilm reduction, which is highly resistant to antibiotics. This study was thus an initial assessment of the antibacterial activity of two new quinoline derivatives of a structure of 3-thioacyl 1-methyl 4-arylaminoquinolinium salts against coagulase-negative staphylococci (CoNS isolated from a hospital environment, in a form of both biofilms and in planktonic form. Thirty-three stains of CoNS isolated from the hospital environment (air, surfaces and seven reference strains from the ATCC collection were selected for the study. The mean MIC value for 1-methyl-3-benzoylthio-4-(4-chlorophenylaminoquinolinum chloride (4-chlorophenylamino derivative was 42.60 ± 19.91 μg/mL, and in the case of strains subjected to 1-methyl-3-benzoylthio-4-(4-fluorophenylaminoquinolinum chloride (4-fluorophenylamino derivative activity, the mean MIC value was 43.20 ± 14.30 μg/mL. The mean concentration of 4-chlorophenylamino derivative that inhibited biofilm formation was 86.18 ± 30.64 μg/mL. The mean concentration of 4-fluorophenylamino derivatives that inhibited biofilm formation was higher and amounted to 237.09 ± 160.57 μg/mL. Based on the results, both derivatives of the examined compounds exhibit high antimicrobial activity towards strains growing both in planktonic and biofilm form.

  15. A class of constitutive relations with internal variable derivatives: derivation from homogenization and initial value problem

    International Nuclear Information System (INIS)

    Andrieux, S.; Joussemet, M.; Lorentz, E.

    1996-01-01

    When they are subjected to excessive loads, some materials may exhibit a softening behaviour resulting from the deterioration of their mechanical properties. To idealize such behaviours, constitutive relations with softening are introduced, for which the size of the domain of reversibility in the stress-space decreases. These models feature a strain localization within the material, in agreement with experiments, but cannot predict the subsequent behaviour because they lead to shear bands the width of which is equal to zero, physically unacceptable and numerically troublesome. It has been proposed in the literature to overcome these difficulties by adding to the list of internal variable the spatial gradients of some of them. This procedure suffers from lack of firm methodological basis. Although, some quantitative justification have been advanced relying on some kind of microscopic analysis. Therefore, we propose to extend the classical (local) models by introducing the internal state variable first gradients. Given local model within the framework of standard generalized materials, consistent homogenization procedure is put forward to derive macroscopic free energy and dissipation potentials. The standard generalized character is preserved, with an extended set of state variables, containing not only the strain and the internal variables but also the internal variable derivatives. Nevertheless, when dealing with the whole structure, the independence between the new state variables is lost. We propose then to generalize the constitutive relations, leading to a new variational principle that ensures the Clausius-Duhem inequality at the structure scale. (authors)

  16. Theoretical foundations of forming value orientation of pupils by means of school sports abroad

    Directory of Open Access Journals (Sweden)

    I.Kh. Turchyk

    2014-06-01

    Full Text Available Purpose: to determine the theoretical basis for the formation of value orientations of pupils by means of school sports facilities abroad. Material: detailed analysis of 14 published sources. Results: found that in a foreign academic and journalistic literature dominates positive appreciation of cultural values of humanistic school sports in the formation of value orientations of pupils. Found that school sport abroad plays an important role not only as a means of forming the basic values - health, but also an important area of communication, the manifestations of social activity. As well as physical and mental form of organization and leisure facilities, excellent vehicle impacts on other values of human life: the authority and position in society, work, the structure of moral and volitional characteristics, aesthetic ideals and other value orientations. Conclusions: confirmed that the global experience of formation values pupil means school sports deserves attention and requires selective introduction into the domestic education system.

  17. Closed form solution to a second order boundary value problem and its application in fluid mechanics

    International Nuclear Information System (INIS)

    Eldabe, N.T.; Elghazy, E.M.; Ebaid, A.

    2007-01-01

    The Adomian decomposition method is used by many researchers to investigate several scientific models. In this Letter, the modified Adomian decomposition method is applied to construct a closed form solution for a second order boundary value problem with singularity

  18. New oxirane derivatives of 1,4-naphthoquinones and their evaluation against T. cruzi epimastigote forms.

    Science.gov (United States)

    Carneiro, Paula F; do Nascimento, Samara B; Pinto, Antonio V; Pinto, Maria do Carmo F R; Lechuga, Guilherme C; Santos, Dilvani O; dos Santos Júnior, Helvécio M; Resende, Jackson A L C; Bourguignon, Saulo C; Ferreira, Vitor F

    2012-08-15

    New oxirane derivatives were synthesized using six naphthoquinones as the starting materials. Our biological results showed that these oxiranes acted as trypanocidal agents against Trypanosoma cruzi with minimal cytotoxicity in the VERO cell line compared to naphthoquinones. In particular, oxirane derivative 14 showed low cytotoxicity in a mammalian cell line and exhibited better activity against epimastigote forms of T.cruzi than the current drug used to treat Chagas disease, benznidazole. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Value Forming Education of Prospective Primary School Teachers in Kazakhstan and Germany

    Science.gov (United States)

    Utyupova, Gulnara Ye.; Baiseitova, Zhanar B.; Mukhamadiyeva, Aizhan A.

    2016-01-01

    Value education is one of the most effective forms of education. However, this system is applied only in developed countries due to a number of factors. The purpose of this study is to develop a method for training primary school teachers capable of implementing the value education system in developing countries. Teachers not only conveys…

  20. SYNTHESIS METHODS OF ALGEBRAIC NORMAL FORM OF MANY-VALUED LOGIC FUNCTIONS

    Directory of Open Access Journals (Sweden)

    A. V. Sokolov

    2016-01-01

    Full Text Available The rapid development of methods of error-correcting coding, cryptography, and signal synthesis theory based on the principles of many-valued logic determines the need for a more detailed study of the forms of representation of functions of many-valued logic. In particular the algebraic normal form of Boolean functions, also known as Zhegalkin polynomial, that well describe many of the cryptographic properties of Boolean functions is widely used. In this article, we formalized the notion of algebraic normal form for many-valued logic functions. We developed a fast method of synthesis of algebraic normal form of 3-functions and 5-functions that work similarly to the Reed-Muller transform for Boolean functions: on the basis of recurrently synthesized transform matrices. We propose the hypothesis, which determines the rules of the synthesis of these matrices for the transformation from the truth table to the coefficients of the algebraic normal form and the inverse transform for any given number of variables of 3-functions or 5-functions. The article also introduces the definition of algebraic degree of nonlinearity of the functions of many-valued logic and the S-box, based on the principles of many-valued logic. Thus, the methods of synthesis of algebraic normal form of 3-functions applied to the known construction of recurrent synthesis of S-boxes of length N = 3k, whereby their algebraic degrees of nonlinearity are computed. The results could be the basis for further theoretical research and practical applications such as: the development of new cryptographic primitives, error-correcting codes, algorithms of data compression, signal structures, and algorithms of block and stream encryption, all based on the perspective principles of many-valued logic. In addition, the fast method of synthesis of algebraic normal form of many-valued logic functions is the basis for their software and hardware implementation.

  1. Tumor cell-derived microparticles: a new form of cancer vaccine.

    Science.gov (United States)

    Zhang, Huafeng; Huang, Bo

    2015-08-01

    For cancer vaccines, tumor antigen availability is currently not an issue due to technical advances. However, the generation of optimal immune stimulation during vaccination is challenging. We have recently demonstrated that tumor cell-derived microparticles (MP) can function as a new form of potent cancer vaccine by efficiently activating type I interferon pathway in a cGAS/STING dependent manner.

  2. Canonical multi-valued input Reed-Muller trees and forms

    Science.gov (United States)

    Perkowski, M. A.; Johnson, P. D.

    1991-01-01

    There is recently an increased interest in logic synthesis using EXOR gates. The paper introduces the fundamental concept of Orthogonal Expansion, which generalizes the ring form of the Shannon expansion to the logic with multiple-valued (mv) inputs. Based on this concept we are able to define a family of canonical tree circuits. Such circuits can be considered for binary and multiple-valued input cases. They can be multi-level (trees and DAG's) or flattened to two-level AND-EXOR circuits. Input decoders similar to those used in Sum of Products (SOP) PLA's are used in realizations of multiple-valued input functions. In the case of the binary logic the family of flattened AND-EXOR circuits includes several forms discussed by Davio and Green. For the case of the logic with multiple-valued inputs, the family of the flattened mv AND-EXOR circuits includes three expansions known from literature and two new expansions.

  3. A novel thiamine-derived pigment, pyrizepine, formed by the Maillard reaction.

    Science.gov (United States)

    Igoshi, Asuka; Noda, Kyoko; Murata, Masatsune

    2018-04-26

    To find a Maillard pigment derived from thiamine, a solution containing glucose and thiamine was heated and analyzed with high-performance liquid chromatography equipped with diode-array detection. As a result, a unique peak showing an absorption maximum at 380 nm was detected. This peak was then isolated from a reaction solution containing glucose, lysine and thiamine, and was identified as 1-(2-methyl-6,9-dihydro-5H-pyrimido[4,5-e][1,4]diazepin-7-yl)ethan-1-one using instrumental analyses. This compound, named pyrizepine, was a novel yellow pigment having a fused ring consisting of pyrimidine and diazepine. Pyrizepine was a major low-molecular-weight pigment in the reaction solution. The structure suggests that pyrizepine is formed by condensation reaction between a degradation product of thiamine and a tetrosone derivative formed from glucose by the Maillard reaction.

  4. Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.

    Science.gov (United States)

    Hotzel, Konrad; Heinze, Thomas

    2016-11-03

    An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Prospective Teachers' Reactions to "Right-or-Wrong" Tasks: The Case of Derivatives of Absolute Value Functions

    Science.gov (United States)

    Tsamir, Pessia; Rasslan, Shaker; Dreyfus, Tommy

    2006-01-01

    This paper illustrates the role of a "Thinking-about-Derivatives" task in identifying learners' derivative conceptions and for promoting their critical thinking about derivatives of absolute value functions. The task included three parts: "Define" the derivative of a function f(x) at x = x[subscript 0], "Solve-if-Possible" the derivative of f(x) =…

  6. Derivation of time dependent design-values for SNR 300 structural material

    International Nuclear Information System (INIS)

    Lorenz, H.; Breitling, H.; de Heesen, E.

    1976-01-01

    Time-dependent design values were derived from long-term creep rupture data for steel X 6 CrNi 1811 in the unwelded and welded condition. The design values had to satisfy the ASME CC 1592 criterea with respect to creep rupture strength, time to reach 1% strain and transition to tertiary creep as well as the requirement of German regulatory rules to properly account for weld bahaviour. For the evaluation and extrapolation 2 proven computer programmes were used. The design data derived under consideration of weld joints show relative good agreement with the values of ASME CC 1592. Consideration of welds leads to lower design values above 550 0 C and 5x10 3 h with the difference between rolled and weld material becoming larger with increasing time and temperature. (author)

  7. Human embryonic stem cell derived mesenchymal progenitors express cardiac markers but do not form contractile cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Christophe M Raynaud

    Full Text Available Mesenchymal progenitors or stromal cells have shown promise as a therapeutic strategy for a range of diseases including heart failure. In this context, we explored the growth and differentiation potential of mesenchymal progenitors (MPs derived in vitro from human embryonic stem cells (hESCs. Similar to MPs isolated from bone marrow, hESC derived MPs (hESC-MPs efficiently differentiated into archetypical mesenchymal derivatives such as chondrocytes and adipocytes. Upon treatment with 5-Azacytidine or TGF-β1, hESC-MPs modified their morphology and up-regulated expression of key cardiac transcription factors such as NKX2-5, MEF2C, HAND2 and MYOCD. Nevertheless, NKX2-5+ hESC-MP derivatives did not form contractile cardiomyocytes, raising questions concerning the suitability of these cells as a platform for cardiomyocyte replacement therapy. Gene profiling experiments revealed that, although hESC-MP derived cells expressed a suite of cardiac related genes, they lacked the complete repertoire of genes associated with bona fide cardiomyocytes. Our results suggest that whilst agents such as TGF-β1 and 5-Azacytidine can induce expression of cardiac related genes, but treated cells retain a mesenchymal like phenotype.

  8. Reference Values for Spirometry Derived Using Lambda, Mu, Sigma (LMS) Method in Korean Adults: in Comparison with Previous References.

    Science.gov (United States)

    Jo, Bum Seak; Myong, Jun Pyo; Rhee, Chin Kook; Yoon, Hyoung Kyu; Koo, Jung Wan; Kim, Hyoung Ryoul

    2018-01-15

    The present study aimed to update the prediction equations for spirometry and their lower limits of normal (LLN) by using the lambda, mu, sigma (LMS) method and to compare the outcomes with the values of previous spirometric reference equations. Spirometric data of 10,249 healthy non-smokers (8,776 females) were extracted from the fourth and fifth versions of the Korea National Health and Nutrition Examination Survey (KNHANES IV, 2007-2009; V, 2010-2012). Reference equations were derived using the LMS method which allows modeling skewness (lambda [L]), mean (mu [M]), and coefficient of variation (sigma [S]). The outcome equations were compared with previous reference values. Prediction equations were presented in the following form: predicted value = e{a + b × ln(height) + c × ln(age) + M - spline}. The new predicted values for spirometry and their LLN derived using the LMS method were shown to more accurately reflect transitions in pulmonary function in young adults than previous prediction equations derived using conventional regression analysis in 2013. There were partial discrepancies between the new reference values and the reference values from the Global Lung Function Initiative in 2012. The results should be interpreted with caution for young adults and elderly males, particularly in terms of the LLN for forced expiratory volume in one second/forced vital capacity in elderly males. Serial spirometry follow-up, together with correlations with other clinical findings, should be emphasized in evaluating the pulmonary function of individuals. Future studies are needed to improve the accuracy of reference data and to develop continuous reference values for spirometry across all ages. © 2018 The Korean Academy of Medical Sciences.

  9. Two forms of Vibrio cholerae O1 El Tor hemolysin derived from identical precursor protein.

    Science.gov (United States)

    Ikigai, H; Ono, T; Nakae, T; Otsuru, H; Shimamura, T

    1999-01-08

    Vibrio cholerae O1 grown in heart infusion broth produces two forms of El Tor hemolysin (ETH) monomers of 65 and 50 kDa. These monomers form several different sizes of mixed oligomers ranging from 180 to 280 kDa in the liposomal membranes. We found that the N-terminal amino acid sequences, NH2-Trp-Pro-Ala-Pro-Ala-Asn-Ser-Glu, of both the 65- and 50-kDa toxins were identical. We assumed, therefore, that the 65- and 50-kDa toxins were derivatives of the identical precursor protein and the 50-kDa protein was a truncated derivative of 65-kDa ETH. To substantiate this assumption, we treated the 260-kDa oligomer with trypsin and obtained a 190-kDa oligomer. This 190-kDa oligomer consisted of only the 50-kDa subunits. Both 260- and 190-kDa oligomers formed ion channels indistinguishable from each other in planar lipid bilayers. These results suggest that the essential part of the ETH in forming the membrane-damaging aggregate is a 50-kDa protein.

  10. When do derivatives add value in asset allocation problems for pension funds?

    NARCIS (Netherlands)

    Cui, J.; Oldenkamp, B.; Vellekoop, M.

    2013-01-01

    Recent surveys indicate that many pension-fund participants aim for higher retirement income security. We investigate the added value of including derivatives in the portfolio of pension funds to achieve this goal. To do so, we define preferences that incorporate specific features of pension funds,

  11. Pressurised combustion of biomass-derived, low calorific value, fuel gas

    Energy Technology Data Exchange (ETDEWEB)

    Andries, J.; Hoppesteyn, P.D.J.; Hein, K.R.G. [Lab. for Thermal Power Engineering, Dept. of Mechanical Engineering and Marine Technology, Delft Univ. of Technology (Netherlands)

    1996-12-31

    The Laboratory for Thermal Power Engineering of the Delft University of Technology is participating in an EU-funded, international R + D project which is designed to aid European industry in addressing issues regarding pressurised combustion of biomass-derived, low calorific flue fuel gas. The objects of the project are: To design, manufacture and test a pressurised, high temperature gas turbine combustor for biomass derived LCV fuel gas; to develop a steady-state and dynamic model describing a combustor using biomass-derived, low calorific value fuel gases; to gather reliable experimental data on the steady-state and dynamic characteristics of the combustor; to study the steady-state and dynamic plant behaviour using a plant layout wich incorporates a model of a gas turbine suitable for operation on low calorific value fuel gas. (orig)

  12. Pressurised combustion of biomass-derived, low calorific value, fuel gas

    Energy Technology Data Exchange (ETDEWEB)

    Andries, J; Hoppesteyn, P D.J.; Hein, K R.G. [Lab. for Thermal Power Engineering, Dept. of Mechanical Engineering and Marine Technology, Delft Univ. of Technology (Netherlands)

    1997-12-31

    The Laboratory for Thermal Power Engineering of the Delft University of Technology is participating in an EU-funded, international R + D project which is designed to aid European industry in addressing issues regarding pressurised combustion of biomass-derived, low calorific flue fuel gas. The objects of the project are: To design, manufacture and test a pressurised, high temperature gas turbine combustor for biomass derived LCV fuel gas; to develop a steady-state and dynamic model describing a combustor using biomass-derived, low calorific value fuel gases; to gather reliable experimental data on the steady-state and dynamic characteristics of the combustor; to study the steady-state and dynamic plant behaviour using a plant layout wich incorporates a model of a gas turbine suitable for operation on low calorific value fuel gas. (orig)

  13. Induced pluripotent stem cell-derived cardiac progenitors differentiate to cardiomyocytes and form biosynthetic tissues.

    Directory of Open Access Journals (Sweden)

    Nicolas Christoforou

    Full Text Available The mammalian heart has little capacity to regenerate, and following injury the myocardium is replaced by non-contractile scar tissue. Consequently, increased wall stress and workload on the remaining myocardium leads to chamber dilation, dysfunction, and heart failure. Cell-based therapy with an autologous, epigenetically reprogrammed, and cardiac-committed progenitor cell source could potentially reverse this process by replacing the damaged myocardium with functional tissue. However, it is unclear whether cardiac progenitor cell-derived cardiomyocytes are capable of attaining levels of structural and functional maturity comparable to that of terminally-fated cardiomyocytes. Here, we first describe the derivation of mouse induced pluripotent stem (iPS cells, which once differentiated allow for the enrichment of Nkx2-5(+ cardiac progenitors, and the cardiomyocyte-specific expression of the red fluorescent protein. We show that the cardiac progenitors are multipotent and capable of differentiating into endothelial cells, smooth muscle cells and cardiomyocytes. Moreover, cardiac progenitor selection corresponds to cKit(+ cell enrichment, while cardiomyocyte cell-lineage commitment is concomitant with dual expression of either cKit/Flk1 or cKit/Sca-1. We proceed to show that the cardiac progenitor-derived cardiomyocytes are capable of forming electrically and mechanically coupled large-scale 2D cell cultures with mature electrophysiological properties. Finally, we examine the cell progenitors' ability to form electromechanically coherent macroscopic tissues, using a physiologically relevant 3D culture model and demonstrate that following long-term culture the cardiomyocytes align, and form robust electromechanical connections throughout the volume of the biosynthetic tissue construct. We conclude that the iPS cell-derived cardiac progenitors are a robust cell source for tissue engineering applications and a 3D culture platform for pharmacological

  14. Assessment of ECISS draft standard for derivation of high temperature proof strength values

    Energy Technology Data Exchange (ETDEWEB)

    Linde, L.; Sandstroem, R.

    1996-03-01

    New European material standards are under development and modern data evaluation techniques must be able to supply these standards with accurate design values. A draft standard for the derivation of high temperature proof strength values has been proposed. This standard (EDS) has been used to calculate strength values for six steels; one unalloyed steel, one 12 % Cr steel and four austenitic stainless steels. Although large data sets were available, it was not possible to satisfy the requirement in the EDS of 80 % temperature coverage in the proof strength data for several steels. It suggests that temperature coverage specified in the EDS is unrealistically high. Due to the limited number of heats satisfying the temperature coverage requirements for each steel, the statistical error in the derived values exceeds 10-20 % which must be considered as unacceptably high. Instead it is recommended that the full data sets are used irrespective of temperature coverage. The variation of proof strength values represented by the analysed heats did not cover the corresponding variation in the larger data set available. This was the case even for the steel where 16 heats satisfied the temperature coverage requirement. Thus a limited number of heats can not be expected to be a good representation of more complete data sets. This has the consequence that absolute strength values can not be derived without access to a standardised proof strength at room temperature. Two derivation methods investigated in this report are both based on the ISO 2605/III procedure for proof strength assessments at elevated temperature. Method I and II use an essentially temperature independent and temperature dependent reduction term respectively. The methods have been assessed by the same data sets for the six steels. One or both methods gave satisfactory results for most of the investigated steels. Presented results are based on work carried out in ECISS TC22 WG1. 17 refs, 20 figs, 7 tabs.

  15. Differential calculus for Dirichlet forms: The measure-valued gradient preserved by image

    OpenAIRE

    Bouleau, Nicolas

    2005-01-01

    In order to develop a differential calculus for error propagation we study local Dirichlet forms on probability spaces with square field operator $\\Gamma$ -- i.e. error structures -- and we are looking for an object related to $\\Gamma$ which is linear and with a good behaviour by images. For this we introduce a new notion called the measure valued gradient which is a randomized square root of $\\Gamma$. The exposition begins with inspecting some natural notions candidate to solve the problem b...

  16. Characteristic values for the forming of the magnesium alloy AZ31

    International Nuclear Information System (INIS)

    Doege, E.; Janssen, S.; Wieser, J.

    2001-01-01

    The aim of investigation and development at the institute for metal forming and metal forming machine tools (IFUM) at the University of Hanover, Germany is to advance magnesium forming scientifically which has so far been based on experience and empirically determined process data only. Optimized process parameter with a sound material scientific and process control base have to be determined for the deformation of magnesium wrought alloys in order to broaden the technical use of such alloys. Aim of the investigations introduced in this paper is the determination of characteristic values as well-founded basis for the forming technological processing of magnesium wrought alloys in massive forming processes. The basic data for the description of the deformation ability in the form of friction factor and flow curve is to be detected, especially in connection with the integration into an FEM-simulation. In order to achieve such data for the magnesium wrought alloy AZ31 the flow curve at temperatures between 250 and 300 C and the deformation ratio 1, 10, 20 and 30 are presented. On the other hand a ring upsetting test for the determination of the friction factor at altitude reductions of 30, 50, 70%, a tool temperature of 200 C, a work piece temperature between 300 and 400 C and different lubricants are shown for the said alloy. (orig.)

  17. 10. Creativity and Innovation in Visual Arts through Form and Space Having Symbolic Value

    Directory of Open Access Journals (Sweden)

    Iaţeşen Mihai – Cosmin

    2017-03-01

    Full Text Available The numerous plastic approaches of form in the 20th century are characterized by creativity and innovation. Form, as expression of an artistic language, is the cause and effect for the cultural evolution of a particular spatial-temporal area. The invention of forms depending on the factors which will impose them in a particular socio-cultural context and location environment is not everything. The challenges of the act of creation are far more complex. For the art of the 20th century, the role of the type of expression in visual or gestural language proved much more convincing and meaningful as to the data or phenomena occurring in immediate reality. The personality of the artist, his cultural character, his media coverage and exterior influences of his inner world, his preceding experiences and receiver’s contacts in a specific area are the factors that influence the relation between the work of art and the audience against a particular spatial-temporal background. The psychological and sensory processes in works of plastic art are spatially configured in structures, which leads to self-confession. The artist filters the information and the elements of exterior reality through the vision of his imagination and power of expression specific to his inner self, and turns them into values through the involvement of his state of mind. Constantin Brâncuşi is the sculptor whose role was considered exponential as he revolutionized modern artistic vision by integrating and creating space-form relations through symbol. Throughout his complex work - the Group of Monumental Sculptures of Tg. Jiu, the artist renewed the language of the sculpture-specific means of expression, though archaic forms, by restoring traditional art. Archetypes often make reference to the initial and ideal form and they represent the primitive and native models composing it. Form attracts, polarizes and integrates the energy of the matter outside the human body, and art acquires

  18. Money, form and the determination of value Dinero, forma y determinación del valor

    Directory of Open Access Journals (Sweden)

    Benetti Carlo

    1998-06-01

    Full Text Available This article seriously considers the form of value as an essential part of Marx's critique of political economy. It shows that this critique is especially relevant with respect to the modern theory of general equilibrium. By not leaving space for processes of decentralized exchange (even in equilibrium, neo-Walrasian theory is unable to adequately model market prices. However, Marx was not successful in his attempt to unite the determination of value and the monetary form of value. The authors propose a tentative model in which monetary values are determined according to the Marxist principle of "the unity of production and circulation".Este artículo considera seriamente la forma del valor como una parte esencial de la crpitica de Marx a la economía política. Muestra que esa crítica es particularmente relevante con respecto a la teoría moderna del equilibrio general. Al no dar cabida a los procesos de intercambio descentralizados (aun en quilibrio, la teoría neo-walrasiana es incapaz de modelar adecuadamente los precios de mercado. Sin embargo, Marx no tuvo éxito en su intento de unir la determinación de valor y la forma monetaria del valor. Los autores proponen un modelo tentativo en el que los valores monetarios se determinan de acuerdo con el principio marxista de la "unidad de la producción y la circulación"

  19. Relations between elliptic multiple zeta values and a special derivation algebra

    International Nuclear Information System (INIS)

    Broedel, Johannes; Matthes, Nils; Schlotterer, Oliver

    2016-01-01

    We investigate relations between elliptic multiple zeta values (eMZVs) and describe a method to derive the number of indecomposable elements of given weight and length. Our method is based on representing eMZVs as iterated integrals over Eisenstein series and exploiting the connection with a special derivation algebra. Its commutator relations give rise to constraints on the iterated integrals over Eisenstein series relevant for eMZVs and thereby allow to count the indecomposable representatives. Conversely, the above connection suggests apparently new relations in the derivation algebra. Under https://tools.aei.mpg.de/emzv we provide relations for eMZVs over a wide range of weights and lengths. (paper)

  20. Reproductive value, sensitivity, and nonlinearity: Population-management heuristics derived from classical demography

    OpenAIRE

    Karsten R.; Teismann H.; Vogels A.

    2013-01-01

    In classical demographic theory, reproductive value and stable age distribution are proportional to the sensitivities of the asymptotic population size to changes in mortality and maternity, respectively. In this note we point out that analogous relationships hold if the maternity function is allowed to depend on the population density. The relevant formulae can essentially be obtained by replacing the growth rate ("Lotka'sr") with zero. These facts may be used to derive heuristics for popula...

  1. The Combined Effects of Financial Derivatives and Discretionary Accruals on the Value Relevance of Earnings and the Book Value of Equity

    Directory of Open Access Journals (Sweden)

    Etty Murwaningsari

    2015-08-01

    Full Text Available This study aimed to understand (1 the association between the use of discretionary accruals and financial derivatives, taking into consideration the implementation of revised PSAK 55 (1999, which was adopted from SFAS 133; (2 the combined effects of derivatives and discretionary accruals on the value relevance of earnings and equity. The analysis used panel data regressions and the Wald test over the period from 2001-2008. The results showed a positive or complementary association between derivatives and discretionary accruals. The positive association implied that managers tended to intensify the use of discretionary accruals to offset a higher use of derivatives. Price and return models demonstrated negative significant effects of derivatives on the value relevance of earnings. The return model showed negative significant effects of discretionary accruals on the value relevance of earnings but negative effects on the value relevance of equity with the price model.

  2. Extreme value predictions and critical wave episodes for marine structures by FORM

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher

    2007-01-01

    The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

  3. Extreme value predictions and critical wave episodes for marine structures by FORM

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher

    2008-01-01

    The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

  4. Measuring the value of groundwater and other forms of natural capital

    Science.gov (United States)

    Fenichel, Eli P.; Abbott, Joshua K.; Bayham, Jude; Boone, Whitney; Haacker, Erin M. K.; Pfeiffer, Lisa

    2016-01-01

    Valuing natural capital is fundamental to measuring sustainability. The United Nations Environment Programme, World Bank, and other agencies have called for inclusion of the value of natural capital in sustainability metrics, such as inclusive wealth. Much has been written about the importance of natural capital, but consistent, rigorous valuation approaches compatible with the pricing of traditional forms of capital have remained elusive. We present a guiding quantitative framework enabling natural capital valuation that is fully consistent with capital theory, accounts for biophysical and economic feedbacks, and can guide interdisciplinary efforts to measure sustainability. We illustrate this framework with an application to groundwater in the Kansas High Plains Aquifer, a rapidly depleting asset supporting significant food production. We develop a 10-y time series (1996−2005) of natural capital asset prices that accounts for technological, institutional, and physical changes. Kansas lost approximately $110 million per year (2005 US dollars) of capital value through groundwater withdrawal and changes in aquifer management during the decade spanning 1996–2005. This annual loss in wealth is approximately equal to the state’s 2005 budget surplus, and is substantially more than investments in schools over this period. Furthermore, real investment in agricultural capital also declined over this period. Although Kansas’ depletion of water wealth is substantial, it may be tractably managed through careful groundwater management and compensating investments in other natural and traditional assets. Measurement of natural capital value is required to inform management and ongoing investments in natural assets. PMID:26858431

  5. Measuring the value of groundwater and other forms of natural capital.

    Science.gov (United States)

    Fenichel, Eli P; Abbott, Joshua K; Bayham, Jude; Boone, Whitney; Haacker, Erin M K; Pfeiffer, Lisa

    2016-03-01

    Valuing natural capital is fundamental to measuring sustainability. The United Nations Environment Programme, World Bank, and other agencies have called for inclusion of the value of natural capital in sustainability metrics, such as inclusive wealth. Much has been written about the importance of natural capital, but consistent, rigorous valuation approaches compatible with the pricing of traditional forms of capital have remained elusive. We present a guiding quantitative framework enabling natural capital valuation that is fully consistent with capital theory, accounts for biophysical and economic feedbacks, and can guide interdisciplinary efforts to measure sustainability. We illustrate this framework with an application to groundwater in the Kansas High Plains Aquifer, a rapidly depleting asset supporting significant food production. We develop a 10-y time series (1996-2005) of natural capital asset prices that accounts for technological, institutional, and physical changes. Kansas lost approximately $110 million per year (2005 US dollars) of capital value through groundwater withdrawal and changes in aquifer management during the decade spanning 1996-2005. This annual loss in wealth is approximately equal to the state's 2005 budget surplus, and is substantially more than investments in schools over this period. Furthermore, real investment in agricultural capital also declined over this period. Although Kansas' depletion of water wealth is substantial, it may be tractably managed through careful groundwater management and compensating investments in other natural and traditional assets. Measurement of natural capital value is required to inform management and ongoing investments in natural assets.

  6. Safe handling of potential peroxide forming compounds and their corresponding peroxide yielded derivatives.

    Energy Technology Data Exchange (ETDEWEB)

    Sears, Jeremiah Matthew; Boyle, Timothy J.; Dean, Christopher J.

    2013-06-01

    This report addresses recent developments concerning the identification and handling of potential peroxide forming (PPF) and peroxide yielded derivative (PYD) chemicals. PPF chemicals are described in terms of labeling, shelf lives, and safe handling requirements as required at SNL. The general peroxide chemistry concerning formation, prevention, and identification is cursorily presented to give some perspective to the generation of peroxides. The procedure for determining peroxide concentrations and the proper disposal methods established by the Hazardous Waste Handling Facility are also provided. Techniques such as neutralization and dilution are provided for the safe handling of any PYD chemicals to allow for safe handling. The appendices are a collection of all available SNL documentation pertaining to PPF/PYD chemicals to serve as a single reference.

  7. Contrast reference values in panoramic radiographic images using an arch-form phantom stand

    International Nuclear Information System (INIS)

    Shin, Jae Myung; Lee, Che Na; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Won Jin; Heo, Min Suk; Choi, Soon Chul; Lee, Sam Sun

    2016-01-01

    The purpose of this study was to investigate appropriate contrast reference values (CRVs) by comparing the contrast in phantom and clinical images. Phantom contrast was measured using two methods: (1) counting the number of visible pits of different depths in an aluminum plate, and (2) obtaining the contrast-to-noise ratio (CNR) for 5 tissue-equivalent materials (porcelain, aluminum, polytetrafluoroethylene [PTFE], polyoxymethylene [POM], and polymethylmethacrylate [PMMA]). Four panoramic radiographs of the contrast phantom, embedded in the 4 different regions of the arch-form stand, and 1 real skull phantom image were obtained, post-processed, and compared. The clinical image quality evaluation chart was used to obtain the cut-off values of the phantom CRV corresponding to the criterion of being adequate for diagnosis. The CRVs were obtained using 4 aluminum pits in the incisor and premolar region, 5 aluminum pits in the molar region, and 2 aluminum pits in the temporomandibular joint (TMJ) region. The CRVs obtained based on the CNR measured in the anterior region were: porcelain, 13.95; aluminum, 9.68; PTFE, 6.71; and POM, 1.79. The corresponding values in the premolar region were: porcelain, 14.22; aluminum, 8.82; PTFE, 5.95; and POM, 2.30. In the molar region, the following values were obtained: porcelain, 7.40; aluminum, 3.68; PTFE, 1.27; and POM, - 0.18. The CRVs for the TMJ region were: porcelain, 3.60; aluminum, 2.04; PTFE, 0.48; and POM, - 0.43. CRVs were determined for each part of the jaw using the CNR value and the number of pits observed in phantom images

  8. Contrast reference values in panoramic radiographic images using an arch-form phantom stand

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jae Myung [Dept. of Oral and Maxillofacial Surgery, Ilsan Paik Hospital, Inje University College of Medicine, Goyang (Korea, Republic of); Lee, Che Na; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Won Jin; Heo, Min Suk; Choi, Soon Chul; Lee, Sam Sun [Dept. of Oral and Maxillofacial Radiology and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of)

    2016-09-15

    The purpose of this study was to investigate appropriate contrast reference values (CRVs) by comparing the contrast in phantom and clinical images. Phantom contrast was measured using two methods: (1) counting the number of visible pits of different depths in an aluminum plate, and (2) obtaining the contrast-to-noise ratio (CNR) for 5 tissue-equivalent materials (porcelain, aluminum, polytetrafluoroethylene [PTFE], polyoxymethylene [POM], and polymethylmethacrylate [PMMA]). Four panoramic radiographs of the contrast phantom, embedded in the 4 different regions of the arch-form stand, and 1 real skull phantom image were obtained, post-processed, and compared. The clinical image quality evaluation chart was used to obtain the cut-off values of the phantom CRV corresponding to the criterion of being adequate for diagnosis. The CRVs were obtained using 4 aluminum pits in the incisor and premolar region, 5 aluminum pits in the molar region, and 2 aluminum pits in the temporomandibular joint (TMJ) region. The CRVs obtained based on the CNR measured in the anterior region were: porcelain, 13.95; aluminum, 9.68; PTFE, 6.71; and POM, 1.79. The corresponding values in the premolar region were: porcelain, 14.22; aluminum, 8.82; PTFE, 5.95; and POM, 2.30. In the molar region, the following values were obtained: porcelain, 7.40; aluminum, 3.68; PTFE, 1.27; and POM, - 0.18. The CRVs for the TMJ region were: porcelain, 3.60; aluminum, 2.04; PTFE, 0.48; and POM, - 0.43. CRVs were determined for each part of the jaw using the CNR value and the number of pits observed in phantom images.

  9. Transmission FTIR derivative spectroscopy for estimation of furosemide in raw material and tablet dosage form

    Directory of Open Access Journals (Sweden)

    Máximo Gallignani

    2014-10-01

    Full Text Available A Fourier transform infrared derivative spectroscopy (FTIR-DS method has been developed for determining furosemide (FUR in pharmaceutical solid dosage form. The method involves the extraction of FUR from tablets with N,N-dimethylformamide by sonication and direct measurement in liquid phase mode using a reduced path length cell. In general, the spectra were measured in transmission mode and the equipment was configured to collect a spectrum at 4 cm−1 resolution and a 13 s collection time (10 scans co-added. The spectra were collected between 1400 cm−1 and 450 cm−1. Derivative spectroscopy was used for data processing and quantitative measurement using the peak area of the second order spectrum of the major spectral band found at 1165 cm−1 (SO2 stretching of FUR with baseline correction. The method fulfilled most validation requirements in the 2 mg/mL and 20 mg/mL range, with a 0.9998 coefficient of determination obtained by simple calibration model, and a general coefficient of variation <2%. The mean recovery for the proposed assay method resulted within the (100±3% over the 80%–120% range of the target concentration. The results agree with a pharmacopoeial method and, therefore, could be considered interchangeable.

  10. Theoretical derivation of a simplified form of the OTOR/GOT differential equation

    International Nuclear Information System (INIS)

    Lovedy Singh, L.; Gartia, R.K.

    2013-01-01

    A simplified form of the OTOR/GOT differential equation has been derived, which may be employed in the evaluation of TL curves for saturated (N = n o ) and non-saturated cases (N > n o ). The present eqn. is found to be theoretically correct and physically sound in comparison with empirical general order kinetics. It has been found that the TL curve evaluated using the present eqn. matches the TL curves evaluated using differential eqn. formalism, and spans the region from α = n o /(100N) to α = 0.999 (where α is the ratio of the retrapping probability to the recombination probability). The simulated curve resembles a first order kinetics curve when α = n o /(100N) and a second order kinetics curve when α = 0.999. However, comparison with general order kinetics for the intermediate range is not possible as a one- to-one correspondence between α and b cannot be made. Also, calculation in the saturated case is made simpler since only three unknown parameters (E, s and α) are required. -- Highlights: • Theoretically and physically sound general order equation has been derived. • Can be employed in the calculation of saturated and non-saturated cases. • It is found to match with those evaluated using differential equation formalism. • Calculation in the saturated case requires only three unknown parameter

  11. How to derive biological information from the value of the normalization constant in allometric equations.

    Science.gov (United States)

    Kaitaniemi, Pekka

    2008-04-09

    Allometric equations are widely used in many branches of biological science. The potential information content of the normalization constant b in allometric equations of the form Y = bX(a) has, however, remained largely neglected. To demonstrate the potential for utilizing this information, I generated a large number of artificial datasets that resembled those that are frequently encountered in biological studies, i.e., relatively small samples including measurement error or uncontrolled variation. The value of X was allowed to vary randomly within the limits describing different data ranges, and a was set to a fixed theoretical value. The constant b was set to a range of values describing the effect of a continuous environmental variable. In addition, a normally distributed random error was added to the values of both X and Y. Two different approaches were then used to model the data. The traditional approach estimated both a and b using a regression model, whereas an alternative approach set the exponent a at its theoretical value and only estimated the value of b. Both approaches produced virtually the same model fit with less than 0.3% difference in the coefficient of determination. Only the alternative approach was able to precisely reproduce the effect of the environmental variable, which was largely lost among noise variation when using the traditional approach. The results show how the value of b can be used as a source of valuable biological information if an appropriate regression model is selected.

  12. Upgrading of lignocellulosic biorefinery to value-added chemicals: Sustainability and economics of bioethanol-derivatives

    DEFF Research Database (Denmark)

    Cheali, Peam; Posada, John A.; Gernaey, Krist

    2015-01-01

    with a sustainability assessment method is used as evaluation tool. First, an existing superstructure representing the lignocellulosic biorefinery design network is extended to include the options for catalytic conversion of bioethanol to value-added derivatives. Second, the optimization problem for process upgrade...... of operating profit for biorefineries producing bioethanol-derived chemicals (247 MM$/a and 241 MM$/a for diethyl ether and 1,3-butadiene, respectively). Second, the optimal designs for upgrading bioethanol (i.e. production of 1,3-butadiene and diethyl ether) performed also better with respect...... to sustainability compared with the petroleum-based processes. In both cases, the effects of the market price uncertainties were also analyzed by performing quantitative economic risk analysis and presented a significant risk of investment for a lignocellulosic biorefinery (12 MM$/a and 92 MM$/a for diethyl ether...

  13. Valuing fire planning alternatives in forest restoration: using derived demand to integrate economics with ecological restoration.

    Science.gov (United States)

    Rideout, Douglas B; Ziesler, Pamela S; Kernohan, Nicole J

    2014-08-01

    Assessing the value of fire planning alternatives is challenging because fire affects a wide array of ecosystem, market, and social values. Wildland fire management is increasingly used to address forest restoration while pragmatic approaches to assessing the value of fire management have yet to be developed. Earlier approaches to assessing the value of forest management relied on connecting site valuation with management variables. While sound, such analysis is too narrow to account for a broad range of ecosystem services. The metric fire regime condition class (FRCC) was developed from ecosystem management philosophy, but it is entirely biophysical. Its lack of economic information cripples its utility to support decision-making. We present a means of defining and assessing the deviation of a landscape from its desired fire management condition by re-framing the fire management problem as one of derived demand. This valued deviation establishes a performance metric for wildland fire management. Using a case study, we display the deviation across a landscape and sum the deviations to produce a summary metric. This summary metric is used to assess the value of alternative fire management strategies on improving the fire management condition toward its desired state. It enables us to identify which sites are most valuable to restore, even when they are in the same fire regime condition class. The case study site exemplifies how a wide range of disparate values, such as watershed, wildlife, property and timber, can be incorporated into a single landscape assessment. The analysis presented here leverages previous research on environmental capital value and non-market valuation by integrating ecosystem management, restoration, and microeconomics. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Growth behavior of anodic oxide formed by aluminum anodizing in glutaric and its derivative acid electrolytes

    Science.gov (United States)

    Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.

    2014-12-01

    The growth behavior of anodic oxide films formed via anodizing in glutaric and its derivative acid solutions was investigated based on the acid dissociation constants of electrolytes. High-purity aluminum foils were anodized in glutaric, ketoglutaric, and acetonedicarboxylic acid solutions under various electrochemical conditions. A thin barrier anodic oxide film grew uniformly on the aluminum substrate by glutaric acid anodizing, and further anodizing caused the film to breakdown due to a high electric field. In contrast, an anodic porous alumina film with a submicrometer-scale cell diameter was successfully formed by ketoglutaric acid anodizing at 293 K. However, the increase and decrease in the temperature of the ketoglutaric acid resulted in non-uniform oxide growth and localized pitting corrosion of the aluminum substrate. An anodic porous alumina film could also be fabricated by acetonedicarboxylic acid anodizing due to the relatively low dissociation constants associated with the acid. Acid dissociation constants are an important factor for the fabrication of anodic porous alumina films.

  15. Reproductive value, sensitivity, and nonlinearity: population-management heuristics derived from classical demography.

    Science.gov (United States)

    Karsten, Richard; Teismann, Holger; Vogels, Angela

    2013-05-01

    In classical demographic theory, reproductive value and stable age distribution are proportional to the sensitivities of the asymptotic population size to changes in mortality and maternity, respectively. In this note we point out that analogous relationships hold if the maternity function is allowed to depend on the population density. The relevant formulae can essentially be obtained by replacing the growth rate ("Lotka's r") with zero. These facts may be used to derive heuristics for population management (pest control). Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Isolation and characterization of human umbilical cord-derived endothelial colony-forming cells

    Science.gov (United States)

    Zhang, Hao; Tao, Yanling; Ren, Saisai; Liu, Haihui; Zhou, Hui; Hu, Jiangwei; Tang, Yongyong; Zhang, Bin; Chen, Hu

    2017-01-01

    Endothelial colony-forming cells (ECFCs) are a population of endothelial progenitor cells (EPCs) that display robust proliferative potential and vessel-forming capability. Previous studies have demonstrated that a limited number of ECFCs may be obtained from adult bone marrow, peripheral blood and umbilical cord (UC) blood. The present study describes an effective method for isolating ECFCs from human UC. The ECFCs derived from human UC displayed the full properties of EPCs. Analysis of the growth kinetics, cell cycle and colony-forming ability of the isolated human UC-ECFCs indicated that the cells demonstrated properties of stem cells, including relative stability and rapid proliferation in vitro. Gene expression of Fms related tyrosine kinase 1, kinase insert domain receptor, vascular endothelial cadherin, cluster of differentiation (CD)31, CD34, epidermal growth factor homology domains-2, von Willebrand factor and endothelial nitric oxide synthase was assessed by reverse transcription-polymerase chain reaction. The cells were positive for CD34, CD31, CD73, CD105 and vascular endothelial growth factor receptor-2, and negative for CD45, CD90 and human leukocyte antigen-antigen D related protein according to flow cytometry. 1,1′-dioctadecyl-3,3,3′,3′-tetra-methyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein and fluorescein isothiocyanate-Ulex europaeus-l were used to verify the identity of the UC-ECFCs. Matrigel was used to investigate tube formation capability. The results demonstrated that the reported technique is a valuable method for isolating human UC-ECFCs, which have potential for use in vascular regeneration. PMID:29067104

  17. Synthesis, structure and complex forming ability of phosphorylated derivatives of heterocyclic compounds

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text: The derivatives of acids of phosphorus, due to variety of properties, are a subject of numerous researches. Now it is known, that the derivatives of acids of phosphorus apart from insect, neurotoxic, antienzym and other kinds of physiological activity have also complex forming properties. As extra gents of noble metals particularly are analyzed by the derivatives of dithio phosphor of acids although organ phosphorus compounds with one nuclear of sulfur make extraction properties. Therefore, with the purpose of detection of effective extra gents of ions of argentum the phosphorylated derivatives of heterogeneous ring compounds were synthesized: Ph(RO)P(O)Cl + HOCH(CH 3 )CH 2 -R ' -> Ph(RO)P(O)OCH(CH 3 )CH 2 -R ' + HCl. R C 2 H 5 - C 6 H 13 , R ' = a piperidine, morpholine, anabasine Structure of the obtained connections is confirmed by the results IR -, Pm- and mass- spectrometry. In an IR-spectrum O-hexyl-O - [piperidynoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1260, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In an IR-spectrum O-pentyl-[anabasinoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR about O-pentyl-[morpholyniisopropyl] phenylphosphonate in the field of a weak field (7, 18-7, 29 p.m.) the multiplet about tones of phenyl group is watched. Me tin proton resonate at 4,66 m.d.as multiplet The signals O-CH 2 of protons of morpholinic cycle appear at 3,58 m.d.. 4H) by the way of triplet. The protons N-CH 2 (6H) three methylene groups will derivate a composite multiple at 2, 10-2, 70 m.d.. The signal of metil group's protons (3H) is watched at 1,15m.d.as doublet. Final metal group resonates at 0, 87 p.m. Six of C-CH 2 of groups give a complex signal in the field of 1, 2-1, 8 m.d. The obtained connections

  18. Water saturation in shaly sands: logging parameters from log-derived values

    International Nuclear Information System (INIS)

    Miyairi, M.; Itoh, T.; Okabe, F.

    1976-01-01

    The methods are presented for determining the relation of porosity to formation factor and that of true resistivity of formation to water saturation, which were investigated through the log interpretation of one of the oil and gas fields of northern Japan Sea. The values of the coefficients ''a'' and ''m'' in porosity-formation factor relation are derived from cross-plot of porosity and resistivity of formation corrected by clay content. The saturation exponent ''n'' is determined from cross-plot of porosity and resistivity index on the assumption that the product of porosity and irreducible water saturation is constant. The relation of porosity to irreducible water saturation is also investigated from core analysis. The new logging parameters determined from the methods, a = 1, m = 2, n = 1.4, improved the values of water saturation by 6 percent in average, and made it easy to distinguish the points which belong to the productive zone and ones belonging to the nonproductive zone

  19. Prognostic and predictive value of intact and cleaved forms of the urokinase plasminogen activator receptor in metastatic prostate cancer

    DEFF Research Database (Denmark)

    Almasi, Charlotte E; Brasso, Klaus; Iversen, Peter

    2011-01-01

    The purpose of this study was to investigate the prognostic value of different forms of the urokinase receptor, uPAR, in serum from prostate cancer (PC) patients.......The purpose of this study was to investigate the prognostic value of different forms of the urokinase receptor, uPAR, in serum from prostate cancer (PC) patients....

  20. Cranial vasculature in zebrafish forms by angioblast cluster-derived angiogenesis.

    Science.gov (United States)

    Proulx, Kira; Lu, Annie; Sumanas, Saulius

    2010-12-01

    Formation of embryonic vasculature involves vasculogenesis as endothelial cells differentiate and aggregate into vascular cords and angiogenesis which includes branching from the existing vessels. In the zebrafish which has emerged as an advantageous model to study vasculogenesis, cranial vasculature is thought to originate by a combination of vasculogenesis and angiogenesis, but how these processes are coordinated is not well understood. To determine how angioblasts assemble into cranial vasculature, we generated an etsrp:GFP transgenic line in which GFP reporter is expressed under the promoter control of an early regulator of vascular and myeloid development, etsrp/etv2. By utilizing time-lapse imaging we show that cranial vessels originate by angiogenesis from angioblast clusters, which themselves form by the mechanism of vasculogenesis. The two major pairs of bilateral clusters include the rostral organizing center (ROC) which gives rise to the most rostral cranial vessels and the midbrain organizing center (MOC) which gives rise to the posterior cranial vessels and to the myeloid and endocardial lineages. In Etsrp knockdown embryos initial cranial vasculogenesis proceeds normally but endothelial and myeloid progenitors fail to initiate differentiation, migration and angiogenesis. Such angioblast cluster-derived angiogenesis is likely to be involved during vasculature formation in other vertebrate systems as well. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. [BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF): NEUROBIOLOGY AND MARKER VALUE IN NEUROPSYCHIATRY].

    Science.gov (United States)

    Levada, O A; Cherednichenko, N V

    2015-01-01

    In this review current publications about neurobiology and marker value of brain derived neurotrophic factor (BDNF) in neuropsychiatry are analyzed. It is shown that BDNF is an important member of the family of neurotrophins which widely represented in various structures of the CNS. In prenatal period BDNF is involved in all stages of neuronal networks formation, and in the postnatal period its main role is maintaining the normal brain architectonics, involvement in the processes of neurogenesis and realization of neuroprotective functions. BDNF plays an important role in learning and memory organization, food and motor behavior. BDNF brain expression decreases with age, as well as in degenerative and vascular dementias, affective, anxiety, and behavioral disorders. The reducing of BDNF serum, level reflects the decreasing of its cerebral expression and could be used as a neurobiological marker of these pathological processes but the rising of its concentration could indicate the therapy effectiveness.

  2. Lucky Belief in Science Education - Gettier Cases and the Value of Reliable Belief-Forming Processes

    Science.gov (United States)

    Brock, Richard

    2018-05-01

    The conceptualisation of knowledge as justified true belief has been shown to be, at the very least, an incomplete account. One challenge to the justified true belief model arises from the proposition of situations in which a person possesses a belief that is both justified and true which some philosophers intuit should not be classified as knowledge. Though situations of this type have been imagined by a number of writers, they have come to be labelled Gettier cases. Gettier cases arise when a fallible justification happens to lead to a true belief in one context, a case of `lucky belief'. In this article, it is argued that students studying science may make claims that resemble Gettier cases. In some contexts, a student may make a claim that is both justified and true but which arises from an alternative conception of a scientific concept. A number of instances of lucky belief in topics in science education are considered leading to an examination of the criteria teachers use to assess students' claims in different contexts. The possibility of lucky belief leads to the proposal that, in addition to the acquisition of justified true beliefs, the development of reliable belief-forming processes is a significant goal of science education. The pedagogic value of various kinds of claims is considered and, it is argued, the criteria used to judge claims may be adjusted to suit the context of assessment. It is suggested that teachers should be alert to instances of lucky belief that mask alternative conceptions.

  3. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    KAUST Repository

    Jin, Bangti; Lazarov, Raytcho; Lu, Xiliang; Zhou, Zhi

    2016-01-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  4. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    KAUST Repository

    Jin, Bangti

    2016-02-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  5. Global solutions to the initial-boundary value problem for the quasilinear viscoelastic equation with a derivative nonlinearity

    Directory of Open Access Journals (Sweden)

    Mitsuhiro Nakao

    2014-01-01

    Full Text Available We prove the existence and uniqueness of a global decaying solution to the initial boundary value problem for the quasilinear wave equation with Kelvin-Voigt dissipation and a derivative nonlinearity. To derive the required estimates of the solutions we employ a 'loan' method and use a difference inequality on the energy.

  6. PROCESS USING POTASSIUM LANTHANUM SULFATE FOR FORMING A CARRIER PRECIPITATE FOR PLUTONIUM VALUES

    Science.gov (United States)

    Angerman, A.A.

    1958-10-21

    A process is presented for recovering plutonium values in an oxidation state not greater than +4 from fluoride-soluble fission products. The process consists of adding to an aqueous acidic solution of such plutonium values a crystalline potassium lanthanum sulfate precipitate which carries the plutonium values from the solution.

  7. Intact and cleaved uPAR forms: diagnostic and prognostic value in cancer

    DEFF Research Database (Denmark)

    Rasch, M.G.; Lund, I.K.; Hoyer-Hansen, G.

    2008-01-01

    identified in tissue and body fluids. It is well-established, that the total amount of all uPAR forms is a strong prognostic marker in different types of cancer. Using immunoassays, measuring the individual uPAR forms, has revealed that the cleaved uPAR forms are even stronger prognostic markers and have...... diagnostic utility. This review will focus on the mechanism of uPAR cleavage and the functional consequences, as well as the clinical applicability of cleaved uPAR forms Udgivelsesdato: 2008...

  8. The derivation of the general form of kinematics with the universal reference system

    Science.gov (United States)

    Szostek, Karol; Szostek, Roman

    2018-03-01

    In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether - with any transverse contraction. The entire article contains only original research conducted by its authors.

  9. The derivation of the general form of kinematics with the universal reference system

    Directory of Open Access Journals (Sweden)

    Karol Szostek

    2018-03-01

    Full Text Available In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether – with any transverse contraction. The entire article contains only original research conducted by its authors. Keywords: Kinematics of bodies, Universal frame of reference, Transformation of time and position, One-way speed of light, Anisotropy of cosmic microwave background

  10. Predicting the calorific value of refuse derived fuel from the characteristics of municipal solid waste

    International Nuclear Information System (INIS)

    Sivapalan Kathiravale; Muhd Noor Muhd Yunus; Mohamad Puad Abu; Mohamad Azman Che Mat Isa; Mohd Fairus Abdul Farid; Norasalwa Zakaria; Khaironie Mohd Takip; Rohyiza Ba'an

    2006-01-01

    The Imposing need to manage the municipal solid waste generated by society in a proper manner has urged municipalities to look into new management methods, which are not only environmentally friendly but also economically profitable. One such way is by converting this waste material into fuel. Currently, Kajang in the State of Selangor, Malaysia, generates about 700 tons of Municipal Solid Waste (MSW) a day. Due to rapid development, lack of land area for new landfill and the environmental impact of raw landfills, the local municipal council has collaborated with a local company in the management of this waste. The company has proposed to convert the MSW to Refuse Derived Fuel (RDF). In view of this, a pilot plant to convert MSW to RDF was erected by the company and begun operation in January 2002. This pilot plant has the capability of converting 15 tons of MSW to 5 tons of RDF. At the same time studies, have been carried out to assess the plant performance, the flue gas analysis, and also the MSW and RDF characteristic. This paper will highlight the findings of the MSW and RDF characterization work carried out over the past year. Sampling and analysis was carried in accordance with ASTM standards. Results of the waste analysis showed that the calorific value of the resulting RDF could be predicted from the physical characteristics as well as the moisture content. Regression analysis on the available data has been used to create equations relating the proximate composition and moisture content of the incoming municipal solid waste to the calorific value of the RDF

  11. Determination and Interpretation of the Norm Values of Preschool Social Skills Rating Scale Teacher Form

    Science.gov (United States)

    Omeroglu, Esra; Buyukozturk, Sener; Aydogan, Yasemin; Cakan, Mehtap; Cakmak, Ebru Kilic; Ozyurek, Arzu; Akduman, Gulumser Gultekin; Gunindi, Yunus; Kutlu, Omer; Coban, Aysel; Yurt, Ozlem; Kogar, Hakan; Karayol, Seda

    2015-01-01

    This study aimed to determine and interpret norms of the Preschool Social Skills Rating Scale (PSSRS) teacher form. The sample included 224 independent preschools and 169 primary schools. The schools are distributed among 48 provinces and 3324 children were included. Data were obtained from the PSSRS teacher form. The validity and reliability…

  12. The study of biological value of peptone derived from secondary raw fish

    Directory of Open Access Journals (Sweden)

    Kuranova L. K.

    2016-09-01

    Full Text Available The possibility of using secondary fish raw materials in particular musculoskeletal waste from filleting the cod species of fish as raw material base for production of food peptones has been studied. The content of water, fat, protein substances, chloride sodium in the raw material and the product have been determined by standard methods. Amino-acid composition has been determined by high effective liquid chromatography. The biological value of peptone and the balance of essential amino acids have been calculated. It has been established that waste from the cod filleting (the humerus with excess flesh contains 18.95 % protein and a slight (0.15 % amount of fat. The models of peptone – fermentative fish hydrolyzate obtained from cod withdrawals – have been researched. Proteolytic activity used in the hydrolysis of enzyme (protosubtilin G3X has been defined as 560.77 mmol TYR/g. Peptone is an amorphous, fine powder of a light beige color. The product is hygroscopic, readily soluble in water. The chemical and biochemical quality characteristics of enzymatic peptone have been defined. Mass fraction of protein in the derived product is 92.27 %, mass fraction of water – 4.7 %, sodium chloride and 2.6 %, fat – 0.3 %. The total number of amino acids in the product is 94.7 %. Peptone in protein contains all the essential amino acids, the total content of which is 40.8 %. The biological value of the product has been estimated by calculation methods. It has been established that tryptophan is the only limiting amino acid in the protein of peptone, amino-acid score is 66.8 %, the rationality coefficient of the product is 0.42, which characterizes it as a fairly balanced protein product. Peptone obtained from secondary fish raw materials by protein content and its properties corresponds to the category of protein isolates and can be recommended for use in food as complete protein food additives and as protein content in sports nutrition products.

  13. The prognostic value of derived neutrophil to lymphocyte ratio in oesophageal cancer treated with definitive chemoradiotherapy.

    Science.gov (United States)

    Cox, Samantha; Hurt, Christopher; Grenader, Tal; Mukherjee, Somnath; Bridgewater, John; Crosby, Thomas

    2017-10-01

    The derived neutrophil-lymphocyte ratio (dNLR) is a validated prognostic biomarker for cancer survival but has not been extensively studied in locally-advanced oesophageal cancer treated with definitive chemoradiotherapy (dCRT). We aimed to identify the prognostic value of dNLR in patients recruited to the SCOPE1 trial. 258 patients were randomised to receive dCRT±cetuximab. Kaplan-Meier's curves and both univariable and multivariable Cox regression models were calculated for overall survival (OS), progression free survival (PFS), local PFS inside the radiation volume (LPFSi), local PFS outside the radiation volume (LPFSo), and distant PFS (DPFS). An elevated pre-treatment dNLR≥2 was significantly associated with decreased OS in univariable (HR 1.74 [95% CI 1.29-2.35], p<0.001) and multivariable analyses (HR 1.64 [1.17-2.29], p=0.004). Median OS was 36months (95% CI 27.8-42.4) if dNLR<2 and 18.4months (95% CI 14.1-24.9) if dNLR≥2. All measures of PFS were also significantly reduced with an elevated dNLR. dNLR was prognostic for OS in cases of squamous cell carcinoma with a non-significant trend for adenocarcinoma/undifferentiated tumours. An elevated pre-treatment dNLR may be an independent prognostic biomarker for OS and PFS in oesophageal cancer patients treated with definitive CRT. dNLR is a simple, inexpensive and readily available tool for risk-stratification and should be considered for use in future oesophageal cancer clinical trials. The SCOPE1 trial was an International Standard Randomised Controlled Trial [number 47718479]. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. VALUING BENEFITS FROM WATER QUALITY IMPROVEMENTS USING KUHN TUCKER MODEL - A COMPARATIVE ANALYSIS ON UTILITY FUNCTIONAL FORMS-

    Science.gov (United States)

    Okuyama, Tadahiro

    Kuhn-Tucker model, which has studied in recent years, is a benefit valuation technique using the revealed-preference data, and the feature is to treatvarious patterns of corner solutions flexibly. It is widely known for the benefit calculation using the revealed-preference data that a value of a benefit changes depending on a functional form. However, there are little studies which examine relationship between utility functions and values of benefits in Kuhn-Tucker model. The purpose of this study is to analysis an influence of the functional form to the value of a benefit. Six types of utility functions are employed for benefit calculations. The data of the recreational activity of 26 beaches of Miyagi Prefecture were employed. Calculation results indicated that Phaneuf and Siderelis (2003) and Whitehead et al.(2010)'s functional forms are useful for benefit calculations.

  15. Selective displacement of the tributylstannyl group to form [125I]phenylboronic acid derivatives

    International Nuclear Information System (INIS)

    Kinsey, B.M.; Kassis, A.I.

    1990-01-01

    Three radioiodinated phenylboronic acid derivatives (1a, 2a, 3a) were prepared at the no-carrier-added level by selective displacement of the corresponding tributylstannyl group. The tributylstannyl compounds 1b, 2b, and 3b were synthesized from the bromo derivatives 1c, 2c and 3c. Radioiodination was accomplished using Na 125 I and either Chloramine-T or peracetic acid to give 1a, 2a and 3a in radiochemical yields of 46, 26, and 67% respectively after HPLC purification. Compounds 1a, 2a and 3a were concentrated in vitro preferentially in HT-29 human colon carcinoma cells compared to V79 Chinese hamster lung fibroblasts, with 3a having the highest uptake

  16. New Forms of Quantum Value Indefiniteness Suggest That Incompatible Views on Contexts Are Epistemic

    Directory of Open Access Journals (Sweden)

    Karl Svozil

    2018-05-01

    Full Text Available Extensions of the Kochen–Specker theorem use quantum logics whose classical interpretation suggests a true-implies-value indefiniteness property. This can be interpreted as an indication that any view of a quantum state beyond a single context is epistemic. A remark by Gleason about the ad hoc construction of probability measures in Hilbert spaces as a result of the Pythagorean property of vector components is interpreted platonically. Unless there is a total match between preparation and measurement contexts, information about the former from the latter is not ontic, but epistemic. This is corroborated by configurations of observables and contexts with a truth-implies-value indefiniteness property.

  17. Identification of the products of the cleavage of the galactans of red seaweeds in the form of pyridylamino derivatives

    International Nuclear Information System (INIS)

    Usov, A.I.; Dobkina, I.M.

    1986-01-01

    It has been shown that pyridylamino derivatives are convenient for the identification of various products of the galactans of red algae. Reductive amination with 2-aminopyridine and sodium thiohydroborate has been investigated for the case of several monosaccharides that are common components of the polysaccharide fractions of red seaweeds and also for carrabiose, agarobiose, and oligosaccharides of the neoagarobiose series. Various forms of chromatography and high-voltage paper electrophoresis were used to separate the pyridylamino derivatives, and NMR spectroscopy and mass spectroscopy of the full acetates for structural characterization

  18. Functional neuromuscular junctions formed by embryonic stem cell-derived motor neurons.

    Directory of Open Access Journals (Sweden)

    Joy A Umbach

    Full Text Available A key objective of stem cell biology is to create physiologically relevant cells suitable for modeling disease pathologies in vitro. Much progress towards this goal has been made in the area of motor neuron (MN disease through the development of methods to direct spinal MN formation from both embryonic and induced pluripotent stem cells. Previous studies have characterized these neurons with respect to their molecular and intrinsic functional properties. However, the synaptic activity of stem cell-derived MNs remains less well defined. In this study, we report the development of low-density co-culture conditions that encourage the formation of active neuromuscular synapses between stem cell-derived MNs and muscle cells in vitro. Fluorescence microscopy reveals the expression of numerous synaptic proteins at these contacts, while dual patch clamp recording detects both spontaneous and multi-quantal evoked synaptic responses similar to those observed in vivo. Together, these findings demonstrate that stem cell-derived MNs innervate muscle cells in a functionally relevant manner. This dual recording approach further offers a sensitive and quantitative assay platform to probe disorders of synaptic dysfunction associated with MN disease.

  19. IMAGE - REPUTATION - BRAND: STRATEGY OF FORMING OF VALUE OF THE POWER

    Directory of Open Access Journals (Sweden)

    Н Н Розанова

    2017-12-01

    Full Text Available Article is devoted to consideration of process of forming of valuable symbolical space of the Russian power in the context of forming of the new model of development of society determined as one of the priority directions of the Concept of long-term social and economic development of the Russian Federation for the period till 2020. This vector of development of the relations of the state and society is determined by the author as strategy of forming of the valuable relation to the power - the purposeful, system, jointly performed activities of the power and society for creation of valuable space of the Russian power through transformation and consecutive transition each other of the following symbolical categories of the power: “identity” - “image” - “reputation” - “brand”. Content of the specified categories is opened, interpretation of measurements of the valuable field of a brand of the power on the basis of model of a four-dimensional brand of T. Ged is offered. The special attention is paid to process of forming of reputation of the power as to a subject of independent author research, on the example of studying of reputation of the regional power of the Smolensk region.

  20. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  1. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  2. The role of personal values, urban form, and auto availability in the analysis of walking for transportation.

    Science.gov (United States)

    Coogan, Matthew A; Karash, Karla H; Adler, Thomas; Sallis, James

    2007-01-01

    To examine the association of personal values, the built environment, and auto availability with walking for transportation. Participants were drawn from 11 U.S. metropolitan areas with good transit services. 865 adults who had recently made or were contemplating making a residential move. Respondents reported if walking was their primary mode for nine trip purposes. "Personal values" reflected ratings of 15 variables assessing attitudes about urban and environmental attributes, with high reliability (ot = 0.85). Neighborhood form was indicated by a three-item scale. Three binary variables were created to reflect (1) personal values, (2) neighborhood form, and (3) auto availability. The association with walking was reported for each of the three variables, each combination of two variables, and the combination of three variables. An analysis of covariance was applied, and a hierarchic linear regression model was developed. All three variables were associated with walking, and all three variables interacted. The standardized coefficients were 0.23for neighborhood form, 0.21 for autos per person, and 0.18 for personal values. Positive attitudes about urban attributes, living in a supportive neighborhood, and low automobile availability significantly predicted more walking for transportation. A framework for further research is proposed in which a factor representing the role of the automobile is examined explicitly in addition to personal values and urban form.

  3. Valuing call options on single stock futures: Does the put-call parity relationship hold in the South African derivatives market?

    Directory of Open Access Journals (Sweden)

    Biebuyck, A.

    2014-09-01

    Full Text Available Research has shown that violations of put-call parity do occur and that these violations present an investor with opportunities to profit from arbitrage deals. Mispricing may lead to significant superior returns and maximisation of shareholders’ wealth if found and acted upon in a timely manner. This study attempts to determine whether this mispricing of financial derivatives is present in the South African derivatives market. This will be achieved through the valuation of options on single stock futures using the put-call parity relationship. The theoretical fair values obtained, is compared to the actual market values over a period of three years, that is, from 2009 to 2011. The results show that arbitrage opportunities do present themselves for the chosen shares. Further research may involve more shares over a longer period to determine whether any pattern may exist which may form the basis of an arbitrage trading strategy

  4. Properties and potential of formed cokes derived from two Turkish lignites by carbonization of binderless briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Bayraktur, K.N.; Lawson, G.J.

    1984-09-01

    Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lowerrank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy.

  5. Properties and potential of formed cokes derived from two Turkish lignites by carbonization of binderless briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Bayraktar, K.N.; Lawson, G.J.

    1984-09-01

    Two high-sulphur Turkish lignites were briquetted at room temperature under pressures of 113 or 212 MPa and the briquettes were carbonized to 1158-1173 K over special heating cycles. The lower-rank lignite gave a formed coke of superior mechanical strength, lower porosity and higher sulphur content than typical blast furnace cokes. The formed coke produced from the higher-rank lignite briquettes had slightly poorer mechanical strength, lower porosity and much higher ash yield and sulphur content than conventional cokes. The products were considered attractive for use in non-ferrous metallurgy. 38 references.

  6. Semantic False Memories in the Form of Derived Relational Intrusions Following Training

    Science.gov (United States)

    Guinther, Paul M.; Dougher, Michael J.

    2010-01-01

    Contemporary behavior analytic research is making headway in characterizing memory phenomena that typically have been characterized by cognitive models, and the current study extends this development by producing "false memories" in the form of functional equivalence responding. A match-to-sample training procedure was administered in order to…

  7. Complex-valued derivative propagation method with approximate Bohmian trajectories: Application to electronic nonadiabatic dynamics

    Science.gov (United States)

    Wang, Yu; Chou, Chia-Chun

    2018-05-01

    The coupled complex quantum Hamilton-Jacobi equations for electronic nonadiabatic transitions are approximately solved by propagating individual quantum trajectories in real space. Equations of motion are derived through use of the derivative propagation method for the complex actions and their spatial derivatives for wave packets moving on each of the coupled electronic potential surfaces. These equations for two surfaces are converted into the moving frame with the same grid point velocities. Excellent wave functions can be obtained by making use of the superposition principle even when nodes develop in wave packet scattering.

  8. Prognostic value of MRI-derived masticator space involvement in IMRT-treated nasopharyngeal carcinoma patients

    International Nuclear Information System (INIS)

    Xiao, Youping; Pan, Jianji; Chen, Yunbin; Lin, Shaojun; Chen, Ying; Zong, Jingfeng; Fang, Yanhong; Guo, Qiaojuan; Chen, Bijuan; Tang, Linbo

    2015-01-01

    This retrospective study reassessed nasopharyngeal carcinoma (NPC) patients treated with intensity-modulated radiation therapy (IMRT), to determine the significance how magnetic resonance imaging (MRI)-derived masticator space involvement (MSI) affected patients’ prognosis. One thousand one hundred ninety seven NPC patients who had complete set of MRI and medical records were enrolled. Basing on their MRI findings, the T-categories of tumors were identified according to the seventh edition of American Joint Committee on Cancer staging system, which considers MSI a prognostic indicator for NPCs. Rates of overall survival (OS), local relapse-free survival (LRFS), regional relapse-free survival (RRFS) and distant metastasis-free survival (DMFS) were analyzed by the Kaplan-Meier method, and the Log-Rank test compared their differences. Cox regression analysis was employed to evaluate various prognostic factors systematically. Statistical analyses were conducted with SPSS 18.0 software, P value < 0.05 was considered statistically significant. Medial pterygoid muscle (MPM) was involved in 283 (23.64 %) cases, of which lateral pterygoid muscle (LPM) was concurrently affected in 181 (15.12 %) and infratemporal fossa (ITF) in 19 (1.59 %). Generally, MSI correlated with an OS, LRFS, and DMFS consistent with a T4-stage diagnosis (P > 0.05). Although different degrees of MSI presented a similar OS and DMFS (P > 0.1), tumors involving LPM had a relatively poorer LRFS than those affected the MPM only (P = 0.027), even for subgroup of patients composed of T3 and T4 classifications (P = 0.035). A tumor involving MPM brought an LRFS consistent with a T2 or T3-stage disease (P > 0.1). If the tumor affected LPM or ITF concurrently, the survival outcomes were more consistent with a T4-stage disease (P > 0.1). Nevertheless, compared to tumor infiltrating MPM, those invading LPM or ITF more frequently spread into other concurrent sites that earned higher T-staging categories. Moreover

  9. Changes of values and form on traditional architecture “Rumoh Aceh” in Pidie

    Science.gov (United States)

    Aiyub, H.; Loebis, M. N.; Pane, I. F.

    2018-03-01

    The Acehnese traditional house is a long process of cultural value extracted from the Acehnese community. The process starts from a notion that develops into a behavior and attitude determination that is hereditary and eventually builds a very characteristic residence that has a strong identity. However, along with the change in time and the cultural values of Acehnese community, the rumoh Aceh with the original spatial composition is rarely found nowadays. Because the rumoh Aceh that exist today has been modified by the owner. This research has been done in Blang Baroh Village, Pidie Regency, using the descriptive qualitative method. The conclusion from this research is that most parts of the aspects contained in rumoh Aceh in Pidie has been changed; namely, in socio-cultural values, spatial typology, spatial configuration and spatial function. The part of changed are found in the seuramoekeu (front porch), seuramoeteungoh (central porch), and seuramoelikoet (back porch). The factors that influence the changes in rumoh Aceh are the cultural shifts in Acehnese community so that some elements of rumoh Aceh are changed. These changes are by the Islamic Laws and today’s culture of the Acehnese community. They still support the community’s life culturally and aesthetically. Another factor that makes the changes is the better financial condition of the house owner.

  10. Einstein in matrix form. Exact derivation of the theory of special and general relativity without tensors

    Energy Technology Data Exchange (ETDEWEB)

    Ludyk, Guenter [Bremen Univ. (Germany). Physics and Electrical Engineering

    2013-11-01

    Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  11. Einstein in matrix form. Exact derivation of the theory of special and general relativity without tensors

    International Nuclear Information System (INIS)

    Ludyk, Guenter

    2013-01-01

    Derives the fundamental equations of Einstein's theory of special and general relativity using matrix calculus, without the help of tensors. Provides necessary mathematical tools in a user-friendly way, either directly in the text or in the appendices. Appendices contain an introduction to classical dynamics as a refresher of known fundamental physics. Rehearses vector and matrix calculus, differential geometry, and some special solutions of general relativity in the appendices. This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the ''Black Hole'' phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  12. Reference line-pair values of panoramic radiographs using an arch-form phantom stand to assess clinical image quality

    International Nuclear Information System (INIS)

    Choi, Da Hye; Choi, Bo Ram; Huh, Kyung Hoe; Heo, Min Suk; Choi, Soon Chul; Choi, Jin Woo; Yi, Won Jin; Lee, Sam Sun

    2013-01-01

    This study was performed to suggest reference line-pair values of panoramic images with clinically desirable qualities using an arch-form phantom stand. The line-pair test phantom was chosen. A real skull model was selected for setting the arch-form model of the phantom stand. The phantom stand had slits in four regions (incisor, premolar, molar, TMJ). Four raw images of the test phantom in each region and one raw image of the real skull were converted into 50 test phantom images and 50 skull phantom images with various line-pair values. 50 post-processed real skull phantom images were divided into 4 groups and were randomly submitted to 14 evaluators. Image quality was graded on a 4 point scale (1. good, 2. normal, 3. poor but interpretable, and 4. not interpretable). The reference line pair was determined as the first line-pair value scored less than 2 points. The mean scores tended to decrease as the line-pair values increased. The reference line-pair values were 3.19 LP/mm in the incisor, 2.32 LP/mm in the premolar and TMJ, and 1.88 LP/mm in the molar region. Image quality evaluation methods and criteria should be able to assess various regions considering the characteristics of panoramic systems. This study suggested overall and regional reference line-pair values and established a set of standard values for them.

  13. Reference line-pair values of panoramic radiographs using an arch-form phantom stand to assess clinical image quality

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Da Hye; Choi, Bo Ram; Huh, Kyung Hoe; Heo, Min Suk; Choi, Soon Chul [Dept. of Oral and Maxillofacial Radiology and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of); Choi, Jin Woo [Dept. of Oral and Maxillofacial Radiology, College of Dentistry, Dankook University, Cheonan (Korea, Republic of); Yi, Won Jin; Lee, Sam Sun [Dept. of Oral and Maxillofacial Radiology, BK21 Craniomaxillofacial Life Science, and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of)

    2013-03-15

    This study was performed to suggest reference line-pair values of panoramic images with clinically desirable qualities using an arch-form phantom stand. The line-pair test phantom was chosen. A real skull model was selected for setting the arch-form model of the phantom stand. The phantom stand had slits in four regions (incisor, premolar, molar, TMJ). Four raw images of the test phantom in each region and one raw image of the real skull were converted into 50 test phantom images and 50 skull phantom images with various line-pair values. 50 post-processed real skull phantom images were divided into 4 groups and were randomly submitted to 14 evaluators. Image quality was graded on a 4 point scale (1. good, 2. normal, 3. poor but interpretable, and 4. not interpretable). The reference line pair was determined as the first line-pair value scored less than 2 points. The mean scores tended to decrease as the line-pair values increased. The reference line-pair values were 3.19 LP/mm in the incisor, 2.32 LP/mm in the premolar and TMJ, and 1.88 LP/mm in the molar region. Image quality evaluation methods and criteria should be able to assess various regions considering the characteristics of panoramic systems. This study suggested overall and regional reference line-pair values and established a set of standard values for them.

  14. Role of Mesenchymal Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

    Science.gov (United States)

    2017-07-01

    Clinical Metastases PRINCIPAL INVESTIGATOR: Jeffrey Green CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017 TYPE...2016 - 14 June 2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical ...and/or select agents. Nothing to report. 6. PRODUCTS: • publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will

  15. Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

    Science.gov (United States)

    2017-07-01

    Clinical Metastases PRINCIPAL INVESTIGATOR: Rosandra Kaplan CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017...2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases 5a...PRODUCTS:  publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will present this work at the Annual

  16. Value Assessment of Artificial Wetland Derived from Mining Subsided Lake: A Case Study of Jiuli Lake Wetland in Xuzhou

    OpenAIRE

    Laijian Wang; Lachun Wang; Pengcheng Yin; Haiyang Cui; Longwu Liang; Zhenbo Wang

    2017-01-01

    Mining subsided lakes are major obstacles for ecological restoration and resource reuse in mining regions. Transforming mining subsided lakes into artificial wetlands is an ecological restoration approach that has been attempted in China in recent years, but a value assessment of the approach still needs systematic research. This paper considers Jiuli Lake wetland, an artificial wetland derived from restoration of a mining subsided lake in plain area, as a case study. A value assessment model...

  17. Secondary phases formed during nuclear waste glass-water interactions: Thermodynamic and derived properties

    International Nuclear Information System (INIS)

    McKenzie, W.F.

    1992-08-01

    The thermodynamic properties of secondary phases observed to form during nuclear waste glass-water interactions are of particular interest as it is with the application of these properties together with the thermodynamic properties of other solid phases, fluid phases, and aqueous species that one may predict the environmental consequences of introducing radionuclides contained in the glass into groundwater at a high-level nuclear waste repository. The validation of these predicted consequences can be obtained from laboratory experiments and field observations at natural analogue sites. The purpose of this report is to update and expand the previous compilation (McKenzie, 1991) of thermodynamic data retrieved from the literature and/or estimated for secondary phases observed to form (and candidate phases from observed chemical compositions) during nuclear waste glass-water interactions. In addition, this report includes provisionally recommended thermodynamic data of secondary phases

  18. Derivation of endogenous equivalent values to support risk assessment and risk management decisions for an endogenous carcinogen: Ethylene oxide.

    Science.gov (United States)

    Kirman, C R; Hays, S M

    2017-12-01

    An approach is presented for ethylene oxide (EO) to derive endogenous equivalent (EE) values, which are endogenous levels normally found within the body expressed in terms of exogenous exposures. EE values can be used to support risk assessment and risk management decisions for chemicals such as EO that have both endogenous and exogenous exposure pathways. EE values were derived using a meta-analysis of data from the published literature characterizing the distribution for an EO biomarker of exposure, hemoglobin N-(2-hydroxyethyl)-valine (HEV), in unexposed populations. These levels are compared to the those reported in exposed populations (smokers, workers). Correlation between the biomarker of exposure and external exposures of EO were applied to this distribution to determine corresponding EE values, which range from 0.13 to 6.9 ppb for EO in air. These values are orders of magnitude higher than risk-based concentration values derived for EO using default methods, and are provided as a pragmatic, data-driven alternative approach to managing the potential risks from exogenous exposures to EO. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Einstein in matrix form exact derivation of the theory of special and general relativity without tensors

    CERN Document Server

    Ludyk, Günter

    2013-01-01

    This book is an introduction to the theories of Special and General Relativity. The target audience are physicists, engineers and applied scientists who are looking for an understandable introduction to the topic - without too much new mathematics. The fundamental equations of Einsteins theory of Special and General Relativity are derived using matrix calculus, without the help of tensors. This feature makes the book special and a valuable tool for scientists and engineers with no experience in the field of tensor calculus. In part I the foundations of Special Relativity are developed, part II describes the structure and principle of General Relativity. Part III explains the Schwarzschild solution of spherical body gravity and examines the "Black Hole" phenomenon. Any necessary mathematical tools are user friendly provided, either directly in the text or in the appendices.

  20. Derivative spectrophotometric method for simultaneous determination of zofenopril and fluvastatin in mixtures and pharmaceutical dosage forms.

    Science.gov (United States)

    Stolarczyk, Mariusz; Maślanka, Anna; Apola, Anna; Rybak, Wojciech; Krzek, Jan

    2015-09-05

    Fast, accurate and precise method for the determination of zofenopril and fluvastatin was developed using spectrophotometry of the first (D1), second (D2), and third (D3) order derivatives in two-component mixtures and in pharmaceutical preparations. It was shown, that the developed method allows for the determination of the tested components in a direct manner, despite the apparent interference of the absorption spectra in the UV range. For quantitative determinations, "zero-crossing" method was chosen, appropriate wavelengths for zofenopril were: D1 λ=270.85 nm, D2 λ=286.38 nm, D3 λ=253.90 nm. Fluvastatin was determined at wavelengths: D1 λ=339.03 nm, D2 λ=252.57 nm, D3 λ=258.50 nm, respectively. The method was characterized by high sensitivity and accuracy, for zofenopril LOD was in the range of 0.19-0.87 μg mL(-1), for fluvastatin 0.51-1.18 μg mL(-1), depending on the class of derivative, and for zofenopril and fluvastatin LOQ was 0.57-2.64 μg mL(-1) and 1.56-3.57 μg mL(-1), respectively. The recovery of individual components was within the range of 100±5%. For zofenopril, the linearity range was estimated between 7.65 μg mL(-1) and 22.94 μg mL(-1), and for fluvastatin between 5.60 μg mL(-1) and 28.00 μg mL(-1). Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Norwegian reference values for the Short-Form Health Survey 36: development over time.

    Science.gov (United States)

    Jacobsen, Ellisiv L; Bye, Asta; Aass, Nina; Fosså, Sophie D; Grotmol, Kjersti S; Kaasa, Stein; Loge, Jon Håvard; Moum, Torbjørn; Hjermstad, Marianne J

    2018-05-01

    Reference values for patient-reported outcome measures are useful for interpretation of results from clinical trials. The study aims were to collect Norwegian SF-36 reference values and compare with data from 1996 to 2002. In 2015, SF-36 was sent by mail to a representative sample of the population (N = 6165). Time trends and associations between background variables and SF-36 scale scores were compared by linear regression models. The 2015 response rate was 36% (N = 2118) versus 67% (N = 2323) in 1996 and 56% (N = 5241) in 2002. Only 5% of the youngest (18-29 years) and 27% of the oldest (>70 years) responded in 2015. Age and educational level were significantly higher in 2015 relative to 1996/2002 (p 36 scores were relatively stable across surveys, controlled for background variables. In general, the most pronounced changes in 2015 were better scores on the role limitations emotional scale (7.4 points, p 70 years. Despite societal changes in Norway the past two decades, HRQoL has remained relatively stable.

  2. EDUCATION IN VIRTUES AND VALUES FORMING THE CHARACTER AND BUILDING FULL AND FREE CITIZENS

    Directory of Open Access Journals (Sweden)

    Domingo Alarcón Ortiz

    2015-04-01

    Full Text Available Education in virtues and values is the antidote in these times of decadence social, political and unfair distribution of economic wealth to rescue the concepts of dignity, responsibility and freedom in educational projects that Government should be implemented globally, in order to promote a series of tools for learners can pass through self-knowledge and self-confidence helping them build a personality that allows them to settle in their work, social and family environment and which also conducive to the development of ethical behavior that have social impact, and can contribute to change the reality of decline and corruption that we are living today, building to full and free citizens.

  3. The value of myocardial perfusion imaging in differentiating between idiopathic dilated cardiomyopathy from the ischemic form

    International Nuclear Information System (INIS)

    Fad, A.; Emami, F.; Eftekhari, M.; Saghari, M.; Fallahi, B.; Beiki, D.; Tkavar, A.

    2004-01-01

    Introduction: differentiating between ischemic cardiomyopathy and idiopathic dilated cardiomyopathy is important as coronary revascularization can improve prognosis in the ischemic subgroup. Due to inherent problems of coronary angiography in patients with depressed ejection fraction introducing a noninvasive tool to diagnose those who will benefit from angiography seems to be rewarding. We examined usefulness of myocardial perfusion scan in this group of patients. Materials and methods: study was performed on 64 patients (62 male and 2 female) aged 57.1 ± 6.7 y (mean ± SD) all with dilation of the left ventricular cavity and ejection fraction less than 40 % by echocardiography. Myocardial perfusion scan was performed in stress and rest phases. All the patients had coronary angiography which was used as the gold standard test. On each set of images, heart was arbitrary divided into 17 segments and perfusion abnormality in each segment was scored by a 5 grade scoring system (0-4). Summed stress Score was used as the scan criteria to differentiate dilated ischemic from idiopathic cardiomyopathy. Scores more than 17 were considered ischemic, and less than that, idiopathic. Results were compared with angiography. Results: from total 40 cases of ischemic cardiomyopathy (proved by angiography) 39 were correctly diagnosed by scan and only one case was mis categorized as idiopathic dilated cardiomyopathy . All 24 cases of idiopathic dilated cardiomyopathy were correctly diagnosed by scintigraphy. Sensitivity, specificity, positive predictive value, and negative predictive value of myocardial perfusion imaging for discrimination between ischemic and idiopathic dilated cardiomyopathy were 97.5 %, 100 %, 100 %, and 96 % respectively. Conclusion: Considering excellent accuracy of myocardial perfusion scan with scoring system in discrimination of ischemic dilated cardiomyopathy from idiopathic cardiomyopathy, this noninvasive test could be considered the main diagnostic test

  4. Solubilization of Phenol Derivatives in Polymer Micelles Formed by Cationic Block Copolymer

    Directory of Open Access Journals (Sweden)

    Irma Fuentes

    2017-01-01

    Full Text Available The aggregation of cationic block copolymers formed by polystyrene (PS and poly(ethyl-4-vinylpyridine (PS-b-PE4VP was studied in aqueous solution. Diblock copolymers of PS and poly(4-vinylpyridine were synthesized by sequential anionic polymerization using BuLi as initiator. Subsequently, the 4-vinylpyridine units were quaternized with ethyl bromide to obtain cationic PS-b-PE4VP block copolymers with different quaternization degree. The self-aggregation of cationic block copolymers was studied by fluorescence probing, whereas the morphology and size of polymer micelles were determined by transmission electronic microscopy. Results indicate that spherical micelles with sizes lower than 100 nm were formed, whereas their micropolarity decreases with increasing quaternization degree. The partition of phenols between the micellar and aqueous phase was studied by using the pseudo-phase model, and the results show that the partition coefficients increase with increasing length of the side alkyl chain and are larger for star micelles. These results are discussed in terms of three-region model.

  5. Relationship of soil potassium forms with maize potassium contents in soils derived from different parent materials

    Directory of Open Access Journals (Sweden)

    Rashid Mehmood Butt

    2017-06-01

    Full Text Available Understanding of soil potassium (K dynamics is essential for sustainable crop production. Bioavailability of K depends on forms and distribution within the soil profile. The objectives of this research were to determine which soil K forms control the maize (Zea mays K contents and compare the extracting capability of sodium tetraphenylborate (NaTPB with ammonium acetate (NH4OAc method. Nine soils representing three different parent materials, i.e. loess, sandstone and shale were sampled at three surface genetic horizons. Within each parent material, three soils at varying level of development were selected. Besides basic soil parameters, K was fractioned into water soluble K, exchangeable K, non-exchangeable K, and NaTPB-extracted K. The maize was sown in pots having 2 kg soil from each genetic horizon. Crop was harvested at seven weeks and plant was analysed for K contents. Results show that NaTPB-extracted K gave best correlation as compared to NH4OAc method. This conveys that a non-exchangeable K portion that becomes available to plants can be better estimated by NaTPB method than NH4OAc extraction.

  6. Polyp Removal of a Bloom Forming Jellyfish, Aurelia coerulea, in Korean Waters and Its Value Evaluation

    Science.gov (United States)

    Yoon, Wonduk; Chae, Jinho; Koh, Byoung-Seol; Han, Changhoon

    2018-04-01

    Aurelia coerulea is a bloom forming jellyfish that first appeared before 1980 in the western and southern Korean seas and which has been blamed for huge economical losses in all fields of marine activities. As a preventive measure to reduce economical losses, polyp removal was undertaken at Lake Shihwa, Lake Saemangeum, and Masan Bay, Korea. In the course of efforts during 2 years to remove polyps, polyps were surveyed, quantified, and removed. In these areas, the initial total polyp abundance was 5.04 × 109 and 46.25% of them were removed; Lake Shihwa the highest rates of removal and Lake Saemangeum the lowest. These efforts to remove polyps prevented the appearance of 1.20 × 109 medusae, corresponding to 78.28 × 106 kg. The cost of polyp removal was evaluated and compared with that of medusae removal. The ratio between the cost of polyp removal and that of medusae removal ranged between 0.78-3.14%, indicating large cost savings for polyp removal undertakings. However, the effect of polyp removal varied from positive to none, and we assumed that the cleared surface for polyp removal, quantity of removed polyp, and existence of polyps' hotspots in neighboring areas were the causes of the non-effectiveness of polyp removal undertakings.

  7. The computational form of craving is a selective multiplication of economic value.

    Science.gov (United States)

    Konova, Anna B; Louie, Kenway; Glimcher, Paul W

    2018-04-17

    Craving is thought to be a specific desire state that biases choice toward the desired object, be it chocolate or drugs. A vast majority of people report having experienced craving of some kind. In its pathological form craving contributes to health outcomes in addiction and obesity. Yet despite its ubiquity and clinical relevance we still lack a basic neurocomputational understanding of craving. Here, using an instantaneous measure of subjective valuation and selective cue exposure, we identify a behavioral signature of a food craving-like state and advance a computational framework for understanding how this state might transform valuation to bias choice. We find desire induced by exposure to a specific high-calorie, high-fat/sugar snack good is expressed in subjects' momentary willingness to pay for this good. This effect is selective but not exclusive to the exposed good; rather, we find it generalizes to nonexposed goods in proportion to their subjective attribute similarity to the exposed ones. A second manipulation of reward size (number of snack units available for purchase) further suggested that a multiplicative gain mechanism supports the transformation of valuation during laboratory craving. These findings help explain how real-world food craving can result in behaviors inconsistent with preferences expressed in the absence of craving and open a path for the computational modeling of craving-like phenomena using a simple and repeatable experimental tool for assessing subjective states in economic terms. Copyright © 2018 the Author(s). Published by PNAS.

  8. Derivation of economic values for veal, beef and milk production traits using profit equations.

    NARCIS (Netherlands)

    Bekman, H.; Arendonk, van J.A.M.

    1993-01-01

    In this study profit equations for milk, veal and beef bull production were developed to obtain economic values for different traits. Veal and beef production were described in terms of fat and protein daily gain. For categorical traits, dystocia and carcass quality traits, economic values were

  9. Containment of Angra 2 - control and correction of form derivative during the assembling

    International Nuclear Information System (INIS)

    Noack, B.J.A.; Leaes, J.

    1990-01-01

    The erection of the containment of Angra 2 has been concluded in JUN, 89. It is a 56m diameter shperical steel vessel, involves the primary circuit and has the purpose to isolate this from the environment. At its construction, besides the aspects of quality of the material and welds, its geometrical shape is relevant. This taking into account that at locations with abrupt changes of the shape may arise stress disturbances and buckling problems. Besides, an adequate shape is a primary condition to have a smooth development of the erection. In a general way, the shape deviations are limited to a value in the range of 50mm, which compared with the 56m diameter of the containment gives an idea about the precautions to be taken during erection. It will be presented the parameters and methods of shape control during erection, the detected shape deviations, the methods applied to correct excessive deviations and the results of complementary stress analysis. (author) [pt

  10. The hematopoietic chemokine CXCL12 promotes integration of human endothelial colony forming cell-derived cells into immature vessel networks.

    Science.gov (United States)

    Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M

    2014-11-15

    Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.

  11. Comparing group deliberation to other forms of preference aggregation in valuing ecosystem services

    Directory of Open Access Journals (Sweden)

    Mackenzie B. Murphy

    2017-12-01

    Full Text Available Deliberative methods for valuing ecosystem services are hypothesized to yield group preferences that differ systematically from those that would be obtained through calculative aggregation of the preferences of participating individuals. We tested this hypothesis by comparing the group consensus results of structured deliberations against a variety of aggregation methods applied to individual participant preferences that were elicited both before and after the deliberations. Participants were also asked about their perceptions of the deliberative process, which we used to assess their ability to detect preference changes and identify the causes of any changes. For five of the seven groups tested, the group consensus results could not have been predicted from individual predeliberation preferences using any of the aggregation rules. However, individual postdeliberation preferences could be used to reconstruct the group preferences using consensual and rank-based aggregation rules. These results imply that the preferences of participants changed over the course of the deliberation and that the group preferences reflected a broad consensus on overall rankings rather than simply the pairwise preferences of the majority. Changes in individual preferences seem to have gone largely unnoticed by participants, as most stated that they did not believe their preferences had substantially changed. Most participants were satisfied with the outcome of the deliberation, and their degree of satisfaction was correlated with the feeling that their opinion was heard and that they had an influence on the outcome. Based on our results, group deliberation shows promise as a means of generating ecosystem service valuations that reflect a consensus opinion rather than simply a collection of personal preferences.

  12. Characterization of Protein and Peptide Binding to Nanogels Formed by Differently Charged Chitosan Derivatives

    Directory of Open Access Journals (Sweden)

    Anastasia Zubareva

    2013-07-01

    Full Text Available Chitosan (Chi is a natural biodegradable cationic polymer with remarkable potency as a vehicle for drug or vaccine delivery. Chi possesses multiple groups, which can be used both for Chi derivatization and for particle formation. The aim of this work was to produce stable nanosized range Chi gels (nanogels, NGs with different charge and to study the driving forces of complex formation between Chi NGs and proteins or peptides. Positively charged NGs of 150 nm in diameter were prepared from hexanoyl chitosan (HC by the ionotropic gelation method while negatively charged NGs of 190 nm were obtained from succinoyl Chi (SC by a Ca2+ coacervation approach. NGs were loaded with a panel of proteins or peptides with different weights and charges. We show that NGs preferentially formed complexes with oppositely charged molecules, especially peptides, as was demonstrated by gel-electrophoresis, confocal microscopy and HPLC. Complex formation was accompanied by a change in zeta-potential and decrease in size. We concluded that complex formation between Chi NGs and peptide/proteins is mediated mostly by electrostatic interactions.

  13. Earthworm-Derived Pore-Forming Toxin Lysenin and Screening of Its Inhibitors

    Directory of Open Access Journals (Sweden)

    Neelanun Sukumwang

    2013-08-01

    Full Text Available Lysenin is a pore-forming toxin from the coelomic fluid of earthworm Eisenia foetida. This protein specifically binds to sphingomyelin and induces erythrocyte lysis. Lysenin consists of 297 amino acids with a molecular weight of 41 kDa. We screened for cellular signal transduction inhibitors of low molecular weight from microorganisms and plants. The purpose of the screening was to study the mechanism of diseases using the obtained inhibitors and to develop new chemotherapeutic agents acting in the new mechanism. Therefore, our aim was to screen for inhibitors of Lysenin-induced hemolysis from plant extracts and microbial culture filtrates. As a result, we isolated all-E-lutein from an extract of Dalbergia latifolia leaves. All-E-lutein is likely to inhibit the process of Lysenin-membrane binding and/or oligomer formation rather than pore formation. Additionally, we isolated tyrosylproline anhydride from the culture filtrate of Streptomyces as an inhibitor of Lysenin-induced hemolysis.

  14. Unipolar Endocardial Voltage Mapping in the Right Ventricle: Optimal Cutoff Values Correcting for Computed Tomography-Derived Epicardial Fat Thickness and Their Clinical Value for Substrate Delineation.

    Science.gov (United States)

    Venlet, Jeroen; Piers, Sebastiaan R D; Kapel, Gijsbert F L; de Riva, Marta; Pauli, Philippe F G; van der Geest, Rob J; Zeppenfeld, Katja

    2017-08-01

    Low endocardial unipolar voltage (UV) at sites with normal bipolar voltage (BV) may indicate epicardial scar. Currently applied UV cutoff values are based on studies that lacked epicardial fat information. This study aimed to define endocardial UV cutoff values using computed tomography-derived fat information and to analyze their clinical value for right ventricular substrate delineation. Thirty-three patients (50±14 years; 79% men) underwent combined endocardial-epicardial right ventricular electroanatomical mapping and ablation of right ventricular scar-related ventricular tachycardia with computed tomographic image integration, including computed tomography-derived fat thickness. Of 6889 endocardial-epicardial mapping point pairs, 547 (8%) pairs with distance 1.50 mV, the optimal endocardial UV cutoff for identification of epicardial BV the curve, 0.75; sensitivity, 60%; specificity, 79%) and cutoff for identification of abnormal epicardial electrogram was 3.7 mV (area under the curve, 0.88; sensitivity, 100%; specificity, 67%). The majority of abnormal electrograms (130 of 151) were associated with transmural scar. Eighty-six percent of abnormal epicardial electrograms had corresponding endocardial sites with BV the remaining could be identified by corresponding low endocardial UV right ventricular scar, an endocardial UV cutoff value of 3.9 mV is more accurate than previously reported cutoff values. Although the majority of epicardial abnormal electrograms are associated with transmural scar with low endocardial BV, the additional use of endocardial UV at normal BV sites improves the diagnostic accuracy resulting in identification of all epicardial abnormal electrograms at sites with <1.0 mm fat. © 2017 American Heart Association, Inc.

  15. Intramolecular carbenoid ylide forming reactions of 2-diazo-3-keto-4-phthalimidocarboxylic esters derived from methionine and cysteine

    Directory of Open Access Journals (Sweden)

    Marc Enßle

    2012-03-01

    Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.

  16. Efficient Closed Form Cut-Off Planes and Propagation Planes Characteristics for Dielectric Slab Loaded Boundary Value Problems

    OpenAIRE

    Zafar, Junaid

    2012-01-01

    The geometrical relationship between the cut-off and propagating planes of any waveguide system is a prerequisite for any design process. The characterization of cut-off planes and optimisation are challenging for numerical methods, closed-form solutions are always preferred. In this paper Maxwells coupled field equations are used to characterise twin E-plane and H-plane slab loaded boundary value problems. The single mode bandwidths and dispersion characteristics of these structures are pres...

  17. Efect of diferent rates of phosphorus and forms of application in the efficiency of triple superphosphate in a soil derived from volcanic ashes

    International Nuclear Information System (INIS)

    Pino, I.; Casas, L.

    1988-01-01

    Greenhouse experiments with a soil derived from volcanic ash were carried out in order to determine the efficiency of triple Superphosphate with different rates and forms of application. Oat (Avena Sativa L.) was used as reference crop. The P 32 labeled fertilizer was applied located 2,5 cm underneath the seeds. At the same time 500 mg P were applied located, mixed and in the surface of the soil. The P in the plant coming from the fertilizer was about 65%. This value was independent from the rates. The A value showed some fluctuations with the utmost rates of P. The fertilizer applied located and in the surface of the soil proved to be the most efficient form of application. The A value useful to compare the different treatments. The fertilizer efficiency was very low in both experiments, being the higher efficiency (5,9%) at the lowest rate which is not associated to a higher production. The best treatment was obtained with 500 mg of P located underneath the seed. (author)

  18. The Derivation of Job Compensation Index Values from the Position Analysis Questionnaire (PAQ). Report No. 6.

    Science.gov (United States)

    McCormick, Ernest J.; And Others

    The study deals with the job component method of establishing compensation rates. The basic job analysis questionnaire used in the study was the Position Analysis Questionnaire (PAQ) (Form B). On the basis of a principal components analysis of PAQ data for a large sample (2,688) of jobs, a number of principal components (job dimensions) were…

  19. COMMENT ON "DERIVATION OF NUMERICAL VALUES FOR THE WORLD HEALTH ORGANIZATION GUIDELINES FOR RECREATIONAL WATERS"

    Science.gov (United States)

    The subject paper describes a procedure for adjusting a risk model based upon a measure of personal exposure (the "UK personal exposure model") in order to attribute an expected rate of gastroenteritis among a group of swimmers to a mean recreational water quality value (enteroco...

  20. Locating tissue collections in tissue economies--deriving value from biomedical research

    DEFF Research Database (Denmark)

    Tupasela, Aaro Mikael

    2006-01-01

    sample collections are challenged by varying conceptions of value, as well as structural factors that relate to the combination of different public population information systems in the Finnish research system. Such challenges reflect a tension in the economic aspirations of the ideology of the knowledge...

  1. Plasma folic acid cutoff value, derived from its relationship with homocyst(e)ine

    NARCIS (Netherlands)

    Brouwer, D A; Welten, H T; Reijngoud, D J; van Doormaal, J J; Muskiet, F A

    We established the cutoff value for plasma folic acid, using plasma homocyst(e)ine as the functional marker. To do this, we investigated the relationship of the plasma folic acid of 103 apparently healthy adults with their fasting plasma homocyst(e)ine and with their plasma homocyst(e)ine 6 h after

  2. Plasma folic acid cutoff value, derived from its relationship with homocyst(e)ine.

    Science.gov (United States)

    Brouwer, D A; Welten, H T; Reijngoud, D J; van Doormaal, J J; Muskiet, F A

    1998-07-01

    We established the cutoff value for plasma folic acid, using plasma homocyst(e)ine as the functional marker. To do this, we investigated the relationship of the plasma folic acid of 103 apparently healthy adults with their fasting plasma homocyst(e)ine and with their plasma homocyst(e)ine 6 h after oral methionine challenge (100 mg/kg). We also studied the relationship of their plasma folic acid with the decline of fasting plasma homocyst(e)ine after 7 days of folic acid supplementation (5 mg/day). The three approaches suggested a cutoff value of 10 nmol/L. The chances of individuals to significantly (P ine after folic acid supplementation proved significantly higher at plasma folic acid concentrations < or = 10 nmol/L, as compared with folic acid concentrations above this value (odds ratio, 5.02; 95% confidence interval, 1.87-13.73). We suggest adopting a 10 nmo/L plasma folic acid cutoff value on functional grounds.

  3. The derivation and application of a risk related value for saving a statistical life

    International Nuclear Information System (INIS)

    Jackson, D.; Stone, D.; Butler, G.G.; Mcglynn, G.

    2004-01-01

    A risk related value of spend for saving a statistical life (VSSSL) is proposed for cost-benefit studies across the power generation sector, and the nuclear industry in particular. An upper bound on VSSSL is set based on the UK government standard of around pound 1 M or, in particular circumstances, pound 2 M and the observation that excessive spend (probably of the order of more than pound 5 M per statistical life) will actually cost lives. Above a risk of 10 -3 a -1 it is assumed that VSSSL approaches maximum sustainable value around pound 2 M, whereas below a risk of 10 -9 a -1 the value of further risk reduction approaches zero. At risks around 10 -6 a -1 it is proposed that an appropriate VSSL lies in the range pound 0.25 M to pound 1 M. With respect to radiological protection, it is suggested that where collective doses are dominated by average individual doses no more than a few μSv, the detriment arising from a man-Sv can be valued at about pound 15 k to pound 60 k. It is further suggested that for individual dose contributions below 0.01 μSv (representing a risk equivalent to less than 10 -9 ) a low residual VSSSL should be applied in cost-benefit analyses based on collective dose exposures. (author)

  4. Multiple Forms and Settings of Exposure to Violence and Values: Unique and Interactive Relationships With Antisocial Behavior in Adolescence.

    Science.gov (United States)

    Bacchini, Dario; Affuso, Gaetana; Aquilar, Serena

    2015-10-01

    The general purpose of this study was to investigate the relationships between multiple forms and settings of exposure to violence (ETV) as well as personal values and antisocial behavior (ASB) in adolescence. The association of ETV as witness or victim in different contexts (family, school, or neighborhood) and the association of the selected values of power, universalism, and conformity with ASB were analyzed. In addition, the role of ETV in moderating the relationship between values and ASB was tested. A total of 369 adolescents participated in the study. Hierarchical multiple regression analysis was performed. Results revealed that ASB was independently affected by exposure to family violence as a victim, exposure to school violence as a witness, exposure to neighborhood violence as a witness, and by all three selected values. The associations of ASB with universalism and conformity were negative. Conversely, the association of ASB with power was positive. One interaction had statistically significant effects. Results revealed that exposure to school violence as a witness moderates the relationship between universalism and ASB. The results highlight a high percentage of explained variance by ETV and values on ASB and suggest the importance of adopting a socio-ecological framework in interpreting adolescent behavior. © The Author(s) 2014.

  5. Derived air concentration for high exposure plutonium : revised values based on ICRP -30 recommendations

    International Nuclear Information System (INIS)

    Sharma, Lata; Janardhanan, S.; Krishnamurthi, T.N.

    1983-01-01

    Derived Air Concentration (DAC) limits for plutonium isotopic mixtures, as obtained from reprocessing of spent fuel heavy water reactors, are presented in this paper. DAC for the mixtures is expressed in terms of alpha activity of plutonium. Growth of 241 Am in the product is taken into consideration. Current recommedations on DAC limits for individual Pu isotopes, as laid down in ICRP-30 report, are used for estimating DAC for the mixture. DACsub(α) for high exposure plutonium is found to be less by a factor of 2-3, when compared with the limit for 239 Pu. As a result, detection and alarm limits for air monitoring instruments should be scaled down while handling high exposure plutonium. (author)

  6. Derived air concentration for high exposure plutonium : revised values based on ICRP -30 recommendations

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, L.; Janardhanan, S.; Krishnamurthi, T.N. (Bhabha Atomic Research Centre, Bombay (India). Health Physics Div.)

    Derived Air Concentration (DAC) limits for plutonium isotopic mixtures, as obtained from reprocessing of spent fuel heavy water reactors, are presented in this paper. DAC for the mixtures is expressed in terms of alpha activity of plutonium. Growth of /sup 241/Am in the product is taken into consideration. Current recommedations on DAC limits for individual Pu isotopes, as laid down in ICRP-30 report, are used for estimating DAC for the mixture. DACsub(..cap alpha..) for high exposure plutonium is found to be less by a factor of 2-3, when compared with the limit for /sup 239/Pu. As a result, detection and alarm limits for air monitoring instruments should be scaled down while handling high exposure plutonium.

  7. The prognostic value of temporal in vitro and in vivo derived hypoxia gene-expression signatures in breast cancer

    International Nuclear Information System (INIS)

    Starmans, Maud H.W.; Chu, Kenneth C.; Haider, Syed; Nguyen, Francis; Seigneuric, Renaud; Magagnin, Michael G.; Koritzinsky, Marianne; Kasprzyk, Arek; Boutros, Paul C.; Wouters, Bradly G.

    2012-01-01

    Background and purpose: Recent data suggest that in vitro and in vivo derived hypoxia gene-expression signatures have prognostic power in breast and possibly other cancers. However, both tumour hypoxia and the biological adaptation to this stress are highly dynamic. Assessment of time-dependent gene-expression changes in response to hypoxia may thus provide additional biological insights and assist in predicting the impact of hypoxia on patient prognosis. Materials and methods: Transcriptome profiling was performed for three cell lines derived from diverse tumour-types after hypoxic exposure at eight time-points, which include a normoxic time-point. Time-dependent sets of co-regulated genes were identified from these data. Subsequently, gene ontology (GO) and pathway analyses were performed. The prognostic power of these novel signatures was assessed in parallel with previous in vitro and in vivo derived hypoxia signatures in a large breast cancer microarray meta-dataset (n = 2312). Results: We identified seven recurrent temporal and two general hypoxia signatures. GO and pathway analyses revealed regulation of both common and unique underlying biological processes within these signatures. None of the new or previously published in vitro signatures consisting of hypoxia-induced genes were prognostic in the large breast cancer dataset. In contrast, signatures of repressed genes, as well as the in vivo derived signatures of hypoxia-induced genes showed clear prognostic power. Conclusions: Only a subset of hypoxia-induced genes in vitro demonstrates prognostic value when evaluated in a large clinical dataset. Despite clear evidence of temporal patterns of gene-expression in vitro, the subset of prognostic hypoxia regulated genes cannot be identified based on temporal pattern alone. In vivo derived signatures appear to identify the prognostic hypoxia induced genes. The prognostic value of hypoxia-repressed genes is likely a surrogate for the known importance of

  8. Effect of field-of-view size on gray values derived from cone-beam computed tomography compared with the Hounsfield unit values from multidetector computed tomography scans.

    Science.gov (United States)

    Shokri, Abbas; Ramezani, Leila; Bidgoli, Mohsen; Akbarzadeh, Mahdi; Ghazikhanlu-Sani, Karim; Fallahi-Sichani, Hamed

    2018-03-01

    This study aimed to evaluate the effect of field-of-view (FOV) size on the gray values derived from conebeam computed tomography (CBCT) compared with the Hounsfield unit values from multidetector computed tomography (MDCT) scans as the gold standard. A radiographic phantom was designed with 4 acrylic cylinders. One cylinder was filled with distilled water, and the other 3 were filled with 3 types of bone substitute: namely, Nanobone, Cenobone, and Cerabone. The phantom was scanned with 2 CBCT systems using 2 different FOV sizes, and 1 MDCT system was used as the gold standard. The mean gray values (MGVs) of each cylinder were calculated in each imaging protocol. In both CBCT systems, significant differences were noted in the MGVs of all materials between the 2 FOV sizes ( P <.05) except for Cerabone in the Cranex3D system. Significant differences were found in the MGVs of each material compared with the others in both FOV sizes for each CBCT system. No significant difference was seen between the Cranex3D CBCT system and the MDCT system in the MGVs of bone substitutes on images obtained with a small FOV. The size of the FOV significantly changed the MGVs of all bone substitutes, except for Cerabone in the Cranex3D system. Both CBCT systems had the ability to distinguish the 3 types of bone substitutes based on a comparison of their MGVs. The Cranex3D CBCT system used with a small FOV had a significant correlation with MDCT results.

  9. Combustion of biomass-derived, low caloric value, fuel gas in a gasturbine combustor

    Energy Technology Data Exchange (ETDEWEB)

    Andries, J; Hoppesteyn, P D.J.; Hein, K R.G. [Technische Univ. Delf (Netherlands)

    1998-09-01

    The use of biomass and biomass/coal mixtures to produce electricity and heat reduces the net emissions of CO{sub 2}, contributes to the restructuring of the agricultural sector, helps to reduce the waste problem and saves finite fossil fuel reserves. Pressurised fluidised bed gasification followed by an adequate gas cleaning system, a gas turbine and a steam turbine, is a potential attractive way to convert biomass and biomass/coal mixtures. To develop and validate mathematical models, which can be used to design and operate Biomass-fired Integrated Gasification Combined Cycle (BIGCC) systems, a Process Development Unit (PPDU) with a maximum thermal capacity of 1.5 MW{sub th}, located at the Laboratory for Thermal Power Engineering of the Delft University of Technology in The Netherlands is being used. The combustor forms an integral part of this facility. Recirculated flue gas is used to cool the wall of the combustor. (orig.)

  10. Value-Added Products Derived from Waste Activated Sludge: A Biorefinery Perspective

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2018-04-01

    Full Text Available Substantial research has been carried out on sustainable waste activated sludge (WAS management in the last decade. In addition to the traditional approach to reduce its production volume, considering WAS as a feedstock to produce bio-products such as amino acids, proteins, short chain fatty acids, enzymes, bio-pesticides, bio-plastics, bio-flocculants and bio-surfactants represents a key component in the transformation of wastewater treatment plants into biorefineries. The quality of these bio-products is a key factor with respect to the feasibility of non-conventional WAS-based production processes. This review provides a critical assessment of the production process routes of a wide range of value-added products from WAS, their current limitations, and recommendations for future research to help promote more sustainable management of this under-utilised and ever-growing waste stream.

  11. Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

    Science.gov (United States)

    Sasaki, Tomoyuki; Shoho, Takashi; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi

    2014-04-01

    A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

  12. Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

    Energy Technology Data Exchange (ETDEWEB)

    Sasaki, Tomoyuki, E-mail: sasaki-tomoy@vos.nagaokaut.ac.jp; Shoho, Takashi; Noda, Kohei; Ono, Hiroshi [Department of Electrical Engineering, Nagaoka University of Technology, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Kawatsuki, Nobuhiro [Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo 671-2280 (Japan)

    2014-04-21

    A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

  13. Leveraging Independent Management and Chief Engineer Hierarchy: Vertically and Horizontally-Derived Technical Authority Value

    Science.gov (United States)

    Barley, Bryan; Newhouse, Marilyn

    2012-01-01

    In the development of complex spacecraft missions, project management authority is usually extended hierarchically from NASA's highest agency levels down to the implementing institution's project team level, through both the center and the program. In parallel with management authority, NASA utilizes a complementary, but independent, hierarchy of technical authority (TA) that extends from the agency level to the project, again, through both the center and the program. The chief engineers (CEs) who serve in this technical authority capacity oversee and report on the technical status and ensure sound engineering practices, controls, and management of the projects and programs. At the lowest level, implementing institutions assign project CEs to technically engage projects, lead development teams, and ensure sound technical principles, processes, and issue resolution. At the middle level, programs and centers independently use CEs to ensure the technical success of their projects and programs. At the agency level, NASA's mission directorate CEs maintain technical cognizance over every program and project in their directorate and advise directorate management on the technical, cost, schedule, and programmatic health of each. As part of this vertically-extended CE team, a program level CE manages a continually varying balance between penetration depth and breadth across his or her assigned missions. Teamwork issues and information integration become critical for management at all levels to ensure value-added use of both the synergy available between CEs at the various agency levels, and the independence of the technical authority at each organization.

  14. Nutritive value of co-products derived from olivecake in rabbit feeding

    Directory of Open Access Journals (Sweden)

    J.C. de Blas

    2015-12-01

    Full Text Available Olive cake is one of the main agro-industrial co-products in the Mediterranean area of Spain, with high availability almost all year round. In addition, most of the product is dehydrated, which increases its interest in monogastric species such as rabbits. Nineteen samples from various Spanish oil mills using different processing methods were analysed for their chemical composition and in vitro digestibility. The average composition was [in dry matter (DM basis]: ash (9.64%, neutral detergent fibre (52.0%, acid detergent fibre (36.8%, acid detergent lignin (19.1%, crude protein (CP (11.3%, insoluble neutral (8.0% and acid detergent crude protein (5.15%, ether extract (10.9% and gross energy (21.9 MJ/kg. DM and CP in vitro digestibility were, on av., 53.4 and 41.4% respectively. High variability was observed among the samples for most of the traits studied. Fibrous fractions were highly correlated among them and negatively with ether extract content, whereas CP was little related to other feed components. A stepwise regression analysis allowed us to determine regression equations to predict DM and CP in vitro digestibilities from chemical composition (R2=0.80 and 0.91, respectively. As regards the current results, olive cake has potential use for rabbits as a source of insoluble fibre and lignin. Crude samples (not oil extracted combined with sieving to retain the smaller particles have an additional interest, because of their higher energy value and significant supply of high quality fat.

  15. Value Assessment of Artificial Wetland Derived from Mining Subsided Lake: A Case Study of Jiuli Lake Wetland in Xuzhou

    Directory of Open Access Journals (Sweden)

    Laijian Wang

    2017-10-01

    Full Text Available Mining subsided lakes are major obstacles for ecological restoration and resource reuse in mining regions. Transforming mining subsided lakes into artificial wetlands is an ecological restoration approach that has been attempted in China in recent years, but a value assessment of the approach still needs systematic research. This paper considers Jiuli Lake wetland, an artificial wetland derived from restoration of a mining subsided lake in plain area, as a case study. A value assessment model for the artificial wetland was established based on cost–benefit analysis by means of field monitoring, social surveys, GIS geostatistics, raster calculation methods, etc. Empirical analysis and calculations were performed on the case study region. The following conclusions were drawn: (1 after ecological restoration, ecosystem services of Jiuli Lake wetland which has become a national level wetland park yield positive values; (2 the improved environment of the Jiuli Lake wetland has a spillover effect on the price of surrounding land, resulting in land price appreciation; (3 using GIS geostatistics and raster calculation methods, the impact range, strength, and value of the spillover effect can be explicitly measured; (4 through the establishment of a value assessment model of the artificial wetland, incomes of the ecological restoration was found to be sufficient to cover the implementation costs, which provides a research foundation for economic feasibility of ecological restoration of mining subsided lakes.

  16. A global multicenter study on reference values: 1. Assessment of methods for derivation and comparison of reference intervals.

    Science.gov (United States)

    Ichihara, Kiyoshi; Ozarda, Yesim; Barth, Julian H; Klee, George; Qiu, Ling; Erasmus, Rajiv; Borai, Anwar; Evgina, Svetlana; Ashavaid, Tester; Khan, Dilshad; Schreier, Laura; Rolle, Reynan; Shimizu, Yoshihisa; Kimura, Shogo; Kawano, Reo; Armbruster, David; Mori, Kazuo; Yadav, Binod K

    2017-04-01

    The IFCC Committee on Reference Intervals and Decision Limits coordinated a global multicenter study on reference values (RVs) to explore rational and harmonizable procedures for derivation of reference intervals (RIs) and investigate the feasibility of sharing RIs through evaluation of sources of variation of RVs on a global scale. For the common protocol, rather lenient criteria for reference individuals were adopted to facilitate harmonized recruitment with planned use of the latent abnormal values exclusion (LAVE) method. As of July 2015, 12 countries had completed their study with total recruitment of 13,386 healthy adults. 25 analytes were measured chemically and 25 immunologically. A serum panel with assigned values was measured by all laboratories. RIs were derived by parametric and nonparametric methods. The effect of LAVE methods is prominent in analytes which reflect nutritional status, inflammation and muscular exertion, indicating that inappropriate results are frequent in any country. The validity of the parametric method was confirmed by the presence of analyte-specific distribution patterns and successful Gaussian transformation using the modified Box-Cox formula in all countries. After successful alignment of RVs based on the panel test results, nearly half the analytes showed variable degrees of between-country differences. This finding, however, requires confirmation after adjusting for BMI and other sources of variation. The results are reported in the second part of this paper. The collaborative study enabled us to evaluate rational methods for deriving RIs and comparing the RVs based on real-world datasets obtained in a harmonized manner. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Predictive value of cardiac magnetic resonance imaging-derived myocardial strain for poor outcomes in patients with acute myocarditis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Won; Jeong, Yeon Joo; Lee, Gee Won; Lee, Nam Kyung; Lee, Hye Won; Kim, Jin You [Pusan National University School of Medicine and Medical Research Institute, Pusan National University Hospital, Busan (Korea, Republic of); Choi, Bum Sung; Choo, Ki Seok [Pusan National University Yangsan Hospital, Yangsan (Korea, Republic of)

    2017-08-01

    To evaluate the utility of cardiovascular magnetic resonance (CMR)-derived myocardial strain measurement for the prediction of poor outcomes in patients with acute myocarditis We retrospectively analyzed data from 37 patients with acute myocarditis who underwent CMR. Left ventricular (LV) size, LV mass index, ejection fraction and presence of myocardial late gadolinium enhancement (LGE) were analyzed. LV circumferential strain (EccSAX), radial strain (ErrSAX) from mid-ventricular level short-axis cine views and LV longitudinal strain (EllLV), radial strain (ErrLax) measurements from 2-chamber long-axis views were obtained. In total, 31 of 37 patients (83.8%) underwent follow-up echocardiography. The primary outcome was major adverse cardiovascular event (MACE). Incomplete LV functional recovery was a secondary outcome. During an average follow-up of 41 months, 11 of 37 patients (29.7%) experienced MACE. Multivariable Cox proportional hazard regression analysis, which included LV mass index, LV ejection fraction, the presence of LGE, EccSAX, ErrSAX, EllLV, and ErrLax values, indicated that the presence of LGE (hazard ratio, 42.88; p = 0.014), together with ErrLax (hazard ratio, 0.77 per 1%, p = 0.004), was a significant predictor of MACE. Kaplan-Meier analysis demonstrated worse outcomes in patient with LGE and an ErrLax value ≤ 9.48%. Multivariable backward regression analysis revealed that ErrLax values were the only significant predictors of LV functional recovery (hazard ratio, 0.54 per 1%; p = 0.042). CMR-derived ErrLax values can predict poor outcomes, both MACE and incomplete LV functional recovery, in patients with acute myocarditis, while LGE is only a predictor of MACE.

  18. Investigation of Antileishmanial Activities of Acridines Derivatives against Promastigotes and Amastigotes Form of Parasites Using Quantitative Structure Activity Relationship Analysis

    Directory of Open Access Journals (Sweden)

    Samir Chtita

    2016-01-01

    Full Text Available In a search of newer and potent antileishmanial (against promastigotes and amastigotes form of parasites drug, a series of 60 variously substituted acridines derivatives were subjected to a quantitative structure activity relationship (QSAR analysis for studying, interpreting, and predicting activities and designing new compounds by using multiple linear regression and artificial neural network (ANN methods. The used descriptors were computed with Gaussian 03, ACD/ChemSketch, Marvin Sketch, and ChemOffice programs. The QSAR models developed were validated according to the principles set up by the Organisation for Economic Co-operation and Development (OECD. The principal component analysis (PCA has been used to select descriptors that show a high correlation with activities. The univariate partitioning (UP method was used to divide the dataset into training and test sets. The multiple linear regression (MLR method showed a correlation coefficient of 0.850 and 0.814 for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. Internal and external validations were used to determine the statistical quality of QSAR of the two MLR models. The artificial neural network (ANN method, considering the relevant descriptors obtained from the MLR, showed a correlation coefficient of 0.933 and 0.918 with 7-3-1 and 6-3-1 ANN models architecture for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outsides compounds. The effects of different descriptors in the activities were described and used to study and design new compounds with higher activities compared to the existing ones.

  19. Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

    Science.gov (United States)

    Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

    2014-05-06

    Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

  20. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    Science.gov (United States)

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  1. Cassava (Manihot esculenta Crantz) and Yam (Dioscorea spp.) Crops and Their Derived Foodstuffs: Safety, Security and Nutritional Value.

    Science.gov (United States)

    Ferraro, Vincenza; Piccirillo, Clara; Tomlins, Keith; Pintado, Manuela E

    2016-12-09

    Cassava (Manihot esculenta Crantz) and yam (Dioscorea spp.) are tropical crops consumed by ca. 2 billion people and represent the main source of carbohydrate and energy for the approximately 700 million people living in the tropical and sub-tropical areas. They are a guarantee of food security for developing countries. The production of these crops and the transformation into food-derived commodities is increasing, it represents a profitable business and farmers generate substantial income from their market. However, there are some important concerns related to the food safety and food security. The high post-harvest losses, mainly for yam, the contamination by endogenous toxic compounds, mainly for cassava, and the contamination by external agents (such as micotoxins, pesticides, and heavy metal) represent a depletion of economic value and income. The loss in the raw crops or the impossibility to market the derived foodstuffs, due to incompliance with food regulations, can seriously limit all yam tubers and the cassava roots processors, from farmers to household, from small-medium to large enterprises. One of the greatest challenges to overcome those concerns is the transformation of traditional or indigenous processing methods into modern industrial operations, from the crop storage to the adequate package of each derived foodstuff.

  2. Correction of conebeam CT values using a planning CT for derivation of the 'dose of the day'

    International Nuclear Information System (INIS)

    Zijtveld, Mathilda van; Dirkx, Maarten; Heijmen, Ben

    2007-01-01

    Background and purpose: Verification of the actually delivered 3D dose distribution during each treatment fraction ('dose of the day') is the most complete and clinical relevant 'in-vivo' check of an IMRT treatment. To do this, during patient treatment portal dose images are routinely acquired with our electronic portal imaging device to derive the delivered fluence map for each treatment field. In addition, a conebeam CT scan is acquired just prior to treatment to derive the patient geometry at the time of treatment. However, the use of conebeam CT scans for dose calculation is hampered by inaccuracies in the conversion of CT values to electron densities due to an enlarged scatter contribution. Materials and methods: In this work, a method is described for mapping of Hounsfield Units of the planning CT to the conebeam CT scan, while accounting for non-rigidity in the anatomy, e.g. related to weight loss, in an approximate way. The method was validated for head and neck cancer patients by comparing dose distributions calculated using adjusted Hounsfield Units with a golden standard. Results and conclusions: The observed dose differences were less than 1% in the majority of points, and in at least 96% of the points a 3D γ analysis resulted in γ values of less than 1 when applying a 2%/2 mm criterion, showing that this straightforward approach allows for an accurate dose calculation based on conebeam CT scans

  3. Characterization of film-forming solutions and films incorporating free and nanoencapsulated tea polyphenol prepared by gelatins with different Bloom values

    Science.gov (United States)

    Gelatin film-forming solutions and their films incorporating tea polyphenol (TP) and chitosan nanoparticles (CSNs) were prepared from gelatins with different Bloom values (100, 150 and 225). Blank gelatin film-forming solutions and films were prepared as controls. Gelatins with higher Bloom values h...

  4. The Role of Mythical Form of Thinking Embedded into Earlier and Recent Computer Games in Teaching Religious and Ethical Values

    Directory of Open Access Journals (Sweden)

    Hülya ALTUNYA

    2017-08-01

    Full Text Available In the world of eastern thought, narration of exemplary events is common through methods of mythical expression such as fairy tales, stories, myths etc. In these discourses, it is aimed at giving moral advice and thus educating the audience. It is stated in these discourses in which surreal events are told people who stand up against distress and difficulties retain their happiness. In such narrative texts, on one hand hope is being kept alive; on the other hand, such messages as patience, clinging to honesty under harsh times and possessing stamina are conveyed to the audience. Likewise, today, surreal events; namely, mythical fictions are animated in cartoons, animation and computer games. In these games, it is told that the most brutal battles are carried out through the most merciless weapons and only the most powerful one wins. These games, causing youth to grow up as aggressive, merciless and likely to try each way to seize power, should be examined in terms of education as well as that way of thinking. In this article, the form of thinking in the stories in which surreal events in the past were narrated is compared in terms of ethical values with the form of thinking in recent computer games in which surreal events are embedded.

  5. The additional value of bioelectrical impedance analysis-derived muscle mass as a screening tool in geriatric assessment for fall prevention.

    Science.gov (United States)

    Van Puyenbroeck, Karolien; Roelandts, Lieven; Van Deun, Thomas; Van Royen, Paul; Verhoeven, Veronique

    2012-01-01

    The decline in skeletal muscle in old age is a factor in the development of functional limitations. The objective of this study was to assess if there is a correlation between muscle mass based on bioelectrical impedance analysis (BIA) detection and the fall incidence in nursing home residents and to examine the risk factors for falling in nursing home residents. This prospective cohort study was part of a longitudinal study on nutritional issues in 52 nursing homes in Antwerp (Belgium) from October 2007 to April 2008. Two hundred and seventy-six people aged 65 years and older were included. Each subject was assessed with BIA, the timed get-up-and-go test, the Katz score, the Mini Nutritional Assessment - Short Form and the 36-Item Short Form Health Survey. The primary outcome parameter was fall incidence during the study. The prevalence of sarcopenia varied from 24.3 to 81.5% depending on which definition was used. No association was found between BIA-derived muscle mass and fall incidence. Logistic regression analysis showed that gait speed (odds ratio 1.029; p = 0.003) and mental health (odds ratio 0.981; p = 0.015) are significantly associated with fall incidence in nursing homes. A receiver operating characteristic curve showed that none of the BIA-derived muscle parameters are good predictors of the risk of falling. This study shows that there is no association between sarcopenia based on BIA and fall incidence and that BIA-derived muscle mass has no additional value in predicting fall incidents compared to the timed get-up-and-go test. Copyright © 2012 S. Karger AG, Basel.

  6. Simultaneous Estimation of Ibuprofen and Phenylephrine Hydrochloride in Bulk and Combined Dosage Form by First Derivative UV Spectrophotometry Method

    Directory of Open Access Journals (Sweden)

    Mehul Patel

    2013-01-01

    Full Text Available A simple, precise, rapid, and economic method was developed for the simultaneous determination of Ibuprofen and Phenylephrine HCl in bulk and combined dosage form. This method involves first-order derivative spectroscopy using 248 nm and 237 nm as zero crossing points for Ibuprofen and Phenylephrine HCl, respectively. For spectrophotometric method 0.1 N NaOH was used as a solvent. The linearity was established over the concentration range of 12–72 μg/mL and 1.5–22 μg/mL for Ibuprofen and Phenylephrine HCl with correlation coefficient (r2 of 0.9972 and 0.9981, respectively. The mean % recoveries were found to be in the range of 98.88% and 98.54% for Ibuprofen and Phenylephrine HCl, respectively. Interday and intraday studies showed repeatability of the method. The method was found to be specific and robust. The method was successfully applied to pharmaceutical formulation, with no interference from excipients as indicated by the recovery study. Results of analysis were validated statistically and by recovery studies.

  7. Cadmium risks to freshwater life: derivation and validation of low-effect criteria values using laboratory and field studies

    Science.gov (United States)

    Mebane, Christopher A.

    2006-01-01

    In 2001, the U.S. Environmental Protection Agency (EPA) released updated aquatic life criteria for cadmium. Since then, additional data on the effects of cadmium to aquatic life have become available from studies supported by the EPA, Idaho Department of Environmental Quality (IDEQ), and the U.S. Geological Survey, among other sources. Updated data on the effects of cadmium to aquatic life were compiled and reviewed and low-effect concentrations were estimated. Low-effect values were calculated using EPA's guidelines for deriving numerical national water-quality criteria for the protection of aquatic organisms and their uses. Data on the short-term (acute) effects of cadmium on North American freshwater species that were suitable for criteria derivation were located for 69 species representing 57 genera and 33 families. For longer-term (chronic) effects of cadmium on North American freshwater species, suitable data were located for 28 species representing 21 genera and 17 families. Both the acute and chronic toxicity of cadmium were dependent on the hardness of the test water. Hardness-toxicity regressions were developed for both acute and chronic datasets so that effects data from different tests could be adjusted to a common water hardness. Hardness-adjusted effects values were pooled to obtain species and genus mean acute and chronic values, which then were ranked by their sensitivity to cadmium. The four most sensitive genera to acute exposures were, in order of increasing cadmium resistance, Oncorhynchus (Pacific trout and salmon), Salvelinus ('char' trout), Salmo (Atlantic trout and salmon), and Cottus (sculpin). The four most sensitive genera to chronic exposures were Hyalella (amphipod), Cottus, Gammarus (amphipod), and Salvelinus. Using the updated datasets, hardness dependent criteria equations were calculated for acute and chronic exposures to cadmium. At a hardness of 50 mg/L as calcium carbonate, the criterion maximum concentration (CMC, or 'acute

  8. Best linear unbiased prediction of genomic breeding values using a trait-specific marker-derived relationship matrix.

    Directory of Open Access Journals (Sweden)

    Zhe Zhang

    2010-09-01

    Full Text Available With the availability of high density whole-genome single nucleotide polymorphism chips, genomic selection has become a promising method to estimate genetic merit with potentially high accuracy for animal, plant and aquaculture species of economic importance. With markers covering the entire genome, genetic merit of genotyped individuals can be predicted directly within the framework of mixed model equations, by using a matrix of relationships among individuals that is derived from the markers. Here we extend that approach by deriving a marker-based relationship matrix specifically for the trait of interest.In the framework of mixed model equations, a new best linear unbiased prediction (BLUP method including a trait-specific relationship matrix (TA was presented and termed TABLUP. The TA matrix was constructed on the basis of marker genotypes and their weights in relation to the trait of interest. A simulation study with 1,000 individuals as the training population and five successive generations as candidate population was carried out to validate the proposed method. The proposed TABLUP method outperformed the ridge regression BLUP (RRBLUP and BLUP with realized relationship matrix (GBLUP. It performed slightly worse than BayesB with an accuracy of 0.79 in the standard scenario.The proposed TABLUP method is an improvement of the RRBLUP and GBLUP method. It might be equivalent to the BayesB method but it has additional benefits like the calculation of accuracies for individual breeding values. The results also showed that the TA-matrix performs better in predicting ability than the classical numerator relationship matrix and the realized relationship matrix which are derived solely from pedigree or markers without regard to the trait. This is because the TA-matrix not only accounts for the Mendelian sampling term, but also puts the greater emphasis on those markers that explain more of the genetic variance in the trait.

  9. Value-added potential of expeller-pressed canola oil refining: characterization of sinapic acid derivatives and tocopherols from byproducts.

    Science.gov (United States)

    Chen, Yougui; Thiyam-Hollander, Usha; Barthet, Veronique J; Aachary, Ayyappan A

    2014-10-08

    Valuable phenolic antioxidants are lost during oil refining, but evaluation of their occurrence in refining byproducts is lacking. Rapeseed and canola oil are both rich sources of sinapic acid derivatives and tocopherols. The retention and loss of sinapic acid derivatives and tocopherols in commercially produced expeller-pressed canola oils subjected to various refining steps and the respective byproducts were investigated. Loss of canolol (3) and tocopherols were observed during bleaching (84.9%) and deodorization (37.6%), respectively. Sinapic acid (2) (42.9 μg/g), sinapine (1) (199 μg/g), and canolol (344 μg/g) were found in the refining byproducts, namely, soap stock, spent bleaching clay, and wash water, for the first time. Tocopherols (3.75 mg/g) and other nonidentified phenolic compounds (2.7 mg sinapic acid equivalent/g) were found in deodistillates, a byproduct of deodorization. DPPH radical scavenging confirmed the antioxidant potential of the byproducts. This study confirms the value-added potential of byproducts of refining as sources of endogenous phenolics.

  10. Spectral detector CT-derived virtual non-contrast images: comparison of attenuation values with unenhanced CT.

    Science.gov (United States)

    Ananthakrishnan, Lakshmi; Rajiah, Prabhakar; Ahn, Richard; Rassouli, Negin; Xi, Yin; Soesbe, Todd C; Lewis, Matthew A; Lenkinski, Robert E; Leyendecker, John R; Abbara, Suhny

    2017-03-01

    To assess virtual non-contrast (VNC) images obtained on a detection-based spectral detector CT scanner and determine how attenuation on VNC images derived from various phases of enhanced CT compare to those obtained from true unenhanced images. In this HIPAA compliant, IRB approved prospective multi-institutional study, 46 patients underwent pre- and post-contrast imaging on a prototype dual-layer spectral detector CT between October 2013 and November 2015, yielding 84 unenhanced and VNC pairs (25 arterial, 39 portal venous/nephrographic, 20 urographic). Mean attenuation was measured by one of three readers in the liver, spleen, kidneys, psoas muscle, abdominal aorta, and subcutaneous fat. Equivalence testing was used to determine if the mean difference between unenhanced and VNC attenuation was less than 5, 10, or 15 HU. VNC image quality was assessed on a 5 point scale. Mean difference between unenhanced and VNC attenuation was VNC attenuation were equivalent in all tissues except fat using a threshold of VNC overestimated the HU relative to unenhanced images. VNC image quality was rated as excellent or good in 84% of arterial phase and 85% of nephrographic phase cases, but only 40% of urographic phase. VNC images derived from novel dual layer spectral detector CT demonstrate attenuation values similar to unenhanced images in all tissues evaluated except for subcutaneous fat. Further study is needed to determine if attenuation thresholds currently used clinically for common pathology should be adjusted, particularly for lesions containing fat.

  11. A patient-derived mutant form of the Fanconi anemia protein, FANCA, is defective in nuclear accumulation.

    Science.gov (United States)

    Kupfer, G; Naf, D; Garcia-Higuera, I; Wasik, J; Cheng, A; Yamashita, T; Tipping, A; Morgan, N; Mathew, C G; D'Andrea, A D

    1999-04-01

    Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with at least eight complementation groups (A-H). Three FA genes, corresponding to complementation groups A, C, and G, have been cloned, but the function of the encoded FA proteins remains unknown. We recently demonstrated that the FANCA and FANCC proteins bind and form a nuclear complex. In the current study, we identified a homozygous mutation in the FANCA gene (3329A>C) in an Egyptian FA patient from a consanguineous family. This mutant FANCA allele is predicted to encode a mutant FANCA protein, FANCA(H1110P), in which histidine 1110 is changed to proline. Initially, we characterized the FANCA(H1110P) protein, expressed in an Epstein Barr virus (EBV)-immortalized lymphoblast line derived from the patient. Unlike wild-type FANCA protein expressed in normal lymphoblasts, FANCA(H1110P) was not phosphorylated and failed to bind to FANCC. To test directly the effect of this mutation on FANCA function, we used retroviral-mediated transduction to express either wild-type FANCA or FANCA(H1110P) protein in the FA-A fibroblast line, GM6914. Unlike wild-type FANCA, the mutant protein failed to complement the mitomycin C sensitivity of these cells. In addition, the FANCA(H1110P) protein was defective in nuclear accumulation in the transduced cells. The characteristics of this mutant protein underscore the importance of FANCA phosphorylation, FANCA/FANCC binding, and nuclear accumulation in the function of the FA pathway.

  12. INTERACTION BETWEEN DIFFERENT MOLECULAR FORMS OF IMMUNOGLOBULIN A AND RECOMBINANT DERIVATIVES POLYPEPTIDES OF BAC RECEPTOR PROTEINS FROM GROUP B STREPTOCOCCI

    Directory of Open Access Journals (Sweden)

    A. S. Korzhueva

    2008-01-01

    Full Text Available Abstract. The article concerns interactions between immunoglobulin A and recombinant P6, P7, P8 polypeptides, designed on the basis of externally localized Bac protein of the Group B streptococci, possessing IgA-binding activity.There is a current demand for immunochemical reagents that are strictly specific for IgA, in order to develop antigenic standards for detection of IgA levels in biological fluids, as well as for affinity purification of IgA and its fragments.To analyze an opportunity of the abovementioned application ways for these proteins, a special study was performed to assay an interaction capability of recombinant P6, P7, P8 polypeptides binding to Fc regions of different IgA forms (serum IgA, secretory IgA, subclasses of serum IgA – IgA1, IgA2. Selectivity of ligand binding was specially confirmed.It was found out that, among three presented polypeptides, the structure of recombinant P6 derivative proved to be optimal for IgA-binding ability of Bac protein.Structural features of IgA-binding fragments of Bac protein, i.e., binding site position on the IgA molecule (proximity to epitopes for three monoclonal antibodies, variability of the site structure, as well as resistance of binding site for P6, P7, P8 in IgA molecule against partial disulfide bonds reduction. (Med. Immunol., vol. 10, N 4-5, pp 327-336.

  13. Prognostic value of CT-derived left atrial and left ventricular measures in patients with acute chest pain

    Energy Technology Data Exchange (ETDEWEB)

    Takx, Richard A.P. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiology, University Medical Center Utrecht (Netherlands); Vliegenthart, Rozemarijn [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); University of Groningen/University Medical Center Groningen, Center for Medical Imaging − North East Netherlands, Department of Radiology, Groningen (Netherlands); Schoepf, U. Joseph, E-mail: schoepf@musc.edu [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); Nance, John W. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Bamberg, Fabian [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Diagnostic and Interventional Radiology, Eberhard-Karls University Tuebingen, Tuebingen (Germany); Abro, Joseph A. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Carr, Christine M. [Division of Emergency Medicine, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); Litwin, Sheldon E. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); and others

    2017-01-15

    Highlights: • LV mass and LA diameter are independent prognostic factor for composite MACE. • LV mass and LA diameter were not significant prognostic factors for MACE in African Americans. • Assessment of LV mass by CT may have a role in the management of patients. - Abstract: Purpose: To determine which left atrial (LA) and left ventricular (LV) parameters are associated with future major adverse cardiac event (MACE) and whether these measurements have independent prognostic value beyond risk factors and computed tomography (CT)-derived coronary artery disease measures. Materials and methods: This retrospective analysis was performed under an IRB waiver and in HIPAA compliance. Subjects underwent coronary CT angiography (CCTA) using a dual-source CT system for acute chest pain evaluation. LV mass, LV ejection fraction (EF), LV end-systolic volume (ESV) and LV end-diastolic volume (EDV), LA ESV and LA diameter, septal wall thickness and cardiac chamber diameters were measured. MACE was defined as cardiac death, non-fatal myocardial infarction, unstable angina, or late revascularization. The association between cardiac CT measures and the occurrence of MACE was quantified using Cox proportional hazard analysis. Results: 225 subjects (age, 56.2 ± 11.2; 140 males) were analyzed, of whom 42 (18.7%) experienced a MACE during a median follow-up of 13 months. LA diameter (HR:1.07, 95%CI:1.01–1.13 per mm) and LV mass (HR:1.05, 95%CI:1.00–1.10 per g) remained significant prognostic factor of MACE after controlling for Framingham risk score. LA diameter and LV mass were also found to have prognostic value independent of each other. The other morphologic and functional cardiac measures were no significant prognostic factors for MACE. Conclusion: CT-derived LA diameter and LV mass are associated with future MACE in patients undergoing evaluation for chest pain, and portend independent prognostic value beyond traditional risk factors, coronary calcium score, and

  14. Assessing Tax Form Distribution Costs: A Proposed Method for Computing the Dollar Value of Tax Form Distribution in a Public Library.

    Science.gov (United States)

    Casey, James B.

    1998-01-01

    Explains how a public library can compute the actual cost of distributing tax forms to the public by listing all direct and indirect costs and demonstrating the formulae and necessary computations. Supplies directions for calculating costs involved for all levels of staff as well as associated public relations efforts, space, and utility costs.…

  15. Modeling the Effect of Grain Size Mixing on Thermal Inertia Values Derived from Diurnal and Seasonal THEMIS Measurements

    Science.gov (United States)

    McCarty, C.; Moersch, J.

    2017-12-01

    Sedimentary processes have slowed over Mars' geologic history. Analysis of the surface today can provide insight into the processes that may have affected it over its history. Sub-resolved checkerboard mixtures of materials with different thermal inertias (and therefore different grain sizes) can lead to differences in thermal inertia values inferred from night and day radiance observations. Information about the grain size distribution of a surface can help determine the degree of sorting it has experienced or it's geologic maturity. Standard methods for deriving thermal inertia from measurements made with THEMIS can give values for the same location that vary by as much as 20% between scenes. Such methods make the assumption that each THEMIS pixel contains material that has uniform thermophysical properties. Here we propose that if a mixture of small and large particles is present within a pixel, the inferred thermal inertia will be strongly dominated by whichever particle is warmer at the time of the measurement because the power radiated by a surface is proportional (by the Stefan-Boltzmann law) to the fourth power of its temperature. This effect will result in a change in thermal inertia values inferred from measurements taken at different times of day and night. Therefore, we expect to see correlation between the magnitude of diurnal variations in inferred thermal inertia values and the degree of grain size mixing for a given pixel location. Preliminary work has shown that the magnitude of such diurnal variation in inferred thermal inertias is sufficient to detect geologically useful differences in grain size distributions. We hypothesize that at least some of the 20% variability in thermal inertias inferred from multiple scenes for a given location could be attributed to sub-pixel grain size mixing rather than uncertainty inherent to the experiment, as previously thought. Mapping the difference in inferred thermal inertias from day and night THEMIS

  16. Validation of the Long- and Short-Form of the Ethical Values Assessment (EVA): A Questionnaire Measuring the Three Ethics Approach to Moral Psychology

    Science.gov (United States)

    Padilla-Walker, Laura Maria; Jensen, Lene Arnett

    2016-01-01

    Moral psychology has been moving toward consideration of multiple kinds of moral concepts and values, such as the Ethics of Autonomy, Community, and Divinity. While these three ethics have commonly been measured qualitatively, the current study sought to validate the long and short forms of the Ethical Values Assessment (EVA), which is a…

  17. Nucleon axial form factors using Nf=2 twisted mass fermions with a physical value of the pion mass

    Science.gov (United States)

    Alexandrou, C.; Constantinou, M.; Hadjiyiannakou, K.; Jansen, K.; Kallidonis, C.; Koutsou, G.; Vaquero Aviles-Casco, A.

    2017-09-01

    We present results on the nucleon axial and induced pseudoscalar form factors using an ensemble of two degenerate twisted mass clover-improved fermions with mass yielding a pion mass of mπ=130 MeV . We evaluate the isovector and the isoscalar, as well as the strange and the charm axial form factors. The disconnected contributions are evaluated using recently developed methods that include deflation of the lower eigenstates, allowing us to extract the isoscalar, strange, and charm axial form factors. We find that the disconnected quark loop contributions are nonzero and particularly large for the induced pseudoscalar form factor.

  18. Prognostic value of circulating VEGFR2+ bone marrow-derived progenitor cells in patients with advanced cancer.

    Science.gov (United States)

    Massard, Christophe; Borget, Isabelle; Le Deley, Marie Cécile; Taylor, Melissa; Gomez-Roca, Carlos; Soria, Jean Charles; Farace, Françoise

    2012-06-01

    We hypothesised that host-related markers, possibly reflecting tumour aggressiveness, such as circulating endothelial cells (CEC) and circulating VEGFR2(+) bone marrow-derived (BMD) progenitor cells, could have prognostic value in patients with advanced cancer enrolled in early anticancer drug development trials. Baseline CECs (CD45(-)CD31(+)CD146(+)7AAD(-) cells) and circulating VEGFR2(+)-BMD progenitor cells (defined as CD45(dim)CD34(+)VEGFR2(+)7AAD(-) cells) were measured by flow-cytometry in 71 and 58 patients included in phase 1 trials testing novel anti-vascular or anti-angiogenic agents. Correlations between levels of CECs, circulating VEGFR2(+)-BMD progenitor cells, clinical and biological prognostic factors (i.e. the Royal Marsden Hospital (RMH) score), and overall survival (OS) were studied. The median value of CECs was 12 CEC/ml (range 0-154/ml). The median level of VEGFR2(+)-BMD progenitor cells was 1.3% (range 0-32.5%) of circulating BMD-CD34(+) progenitors. While OS was not correlated with CEC levels, it was significantly worse in patients with high VEGFR2(+)-BMD progenitor levels (>1%) (median OS 9.0 versus 17.0 months), and with a RMH prognostic score >0 (median OS 9.0 versus 24.2 months). The prognostic value of VEGFR2(+)-BMD progenitor levels remained significant (hazard ratio (HR) = 2.3, 95% confidence interval (CI), 1.1-4.6, p = 0.02) after multivariate analysis. A composite VEGFR2(+)-BMD progenitor level/RHM score ≥ 2 was significantly associated with an increased risk of death compared to scores of 0 or 1 (median OS 9.0 versus 18.4 months, HR = 2.6 (95%CI, 1.2-5.8, p = 0.02)). High circulating VEGFR2(+)-BMD progenitor levels are associated with poor prognostics and when combined to classical clinical and biological parameters could provide a new tool for patient selection in early anticancer drug trials. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Optimization of the culturing conditions of human umbilical cord blood-derived endothelial colony-forming cells under xeno-free conditions applying a transcriptomic approach

    NARCIS (Netherlands)

    Zeisberger, Steffen M.; Zoller, Stefan; Riegel, Mariluce; Chen, Shuhua; Krenning, Guido; Harmsen, Martin C.; Sachinidis, Agapios; Zisch, Andreas H.

    Establishment of fetal bovine serum (FBS)-free cell culture conditions is essential for transplantation therapies. Blood-derived endothelial colony-forming cells (ECFCs) are potential candidates for regenerative medicine applications. ECFCs were isolated from term umbilical cord blood units and

  20. Fecal concentrations of bacterially-derived vitamin K forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults

    Science.gov (United States)

    Background: Emerging evidence suggests novel roles for bacterially-derived vitamin K forms known as menaquinones (MKn) in health and disease which may be attributable in part to anti-inflammatory effects. However, the relevance of MKn produced by gut bacteria to vitamin K requirements and inflammati...

  1. Data Qualification Report: Calculated Porosity and Porosity-Derived Values for Lithostratigraphic Units for use on the Yucca Mountain Project

    Energy Technology Data Exchange (ETDEWEB)

    P. Sanchez

    2001-05-30

    report uses technical assessment and corroboration to evaluate the original subject DTN. Rael (1999) provides many technical details of the technical assessment and corroboration methods and partially satisfies the intent of the qualification plan for this analysis. Rael presents a modified method based on Nelson (1996) to recompute porosity and porosity-derived values and uses some of the same inputs. Rael's (1999) intended purpose was to document porosity output relatively free of biases introduced by differing computational methods or parameter selections used for different boreholes. The qualification report necessarily evaluates the soundness of the pre-Process Validation and Re-engineering (PVAR) analyses and methodology, as reported in Rael (1999).

  2. Data Qualification Report: Calculated Porosity and Porosity-Derived Values for Lithostratigraphic Units for use on the Yucca Mountain Project

    International Nuclear Information System (INIS)

    P. Sanchez

    2001-01-01

    technical assessment and corroboration to evaluate the original subject DTN. Rael (1999) provides many technical details of the technical assessment and corroboration methods and partially satisfies the intent of the qualification plan for this analysis. Rael presents a modified method based on Nelson (1996) to recompute porosity and porosity-derived values and uses some of the same inputs. Rael's (1999) intended purpose was to document porosity output relatively free of biases introduced by differing computational methods or parameter selections used for different boreholes. The qualification report necessarily evaluates the soundness of the pre-Process Validation and Re-engineering (PVAR) analyses and methodology, as reported in Rael (1999)

  3. Hydrolysis and rearrangement of phthalamic acid derivatives and assessment of their potential as prodrug forms for amines

    DEFF Research Database (Denmark)

    Bundgaard, Hans; Steffansen, Bente

    1990-01-01

    Although it is well-known that N-substituted phthalamic acid derivatives are readily hydrolyzed in acidic aqueous solution due to intramolecular catalysis by the neighbouring carboxy group, sparse information is available on the degradation behaviour in neutral solutions. A recent publication [5]...

  4. Can recent pan-tropical biomass maps be used to derive alternative Tier 1 values for reporting REDD+ activities under UNFCCC?

    International Nuclear Information System (INIS)

    Langner, Andreas; Achard, Frédéric; Grassi, Giacomo

    2014-01-01

    The IPCC Guidelines propose 3 Tier levels for greenhouse gas monitoring within the forest land category with a hierarchical order in terms of accuracy, data requirements and complexity. Due to missing data and/or capacities, many developing countries, potentially interested in the reducing emissions from deforestation and forest degradation scheme, have to rely on Tier 1 default values with highest uncertainties. A possible way to increase the credibility of uncertain estimates is to apply a conservative approach, for which standard statistical information is needed. However, such information is currently not available for the IPCC values. In our study we combine a recent global forest mask, an ecological zoning map and the pan-tropical AGB datasets of Saatchi and Baccini to derive mean forest AGB values per ecological zone and continent as well as their corresponding confidence intervals. Such analysis can be considered transparent as the datasets/methodologies are well documented. Our study leads to alternative Tier 1 values and allows the application of statistically-based conservative approaches. Our AGB estimates derived from Saatchi and Baccini datasets are 35% and 24% lower respectively than the IPCC values. When restricting the analysis to intact forest landscapes resulting ABG estimates derived from Saatchi and Baccini datasets get closer to the IPCC values with 13% and 1% differences respectively (underestimation). This suggests that the IPCC default values are mainly based on plots in mature forest stands. However, as tropical forests generally consist of a mixture of intact and degraded stands, the use of IPCC values may not properly reflect the reality. Finally, we propose to use the average composite of the Saatchi and Baccini datasets to produce improved alternative IPCC Tier 1 values. The values derived from such approach can easily be updated when newer and/or improved pan-tropical AGB maps will be available. (letter)

  5. Electrochemical oxidation of 3,5-di-tert-butylcatechol: Synthesis and characterization of the formed ortho-benzoquinhydrone derivative

    International Nuclear Information System (INIS)

    Nematollahi, D.; Shayani-Jam, H.

    2006-01-01

    Electrochemical oxidation of 3,5-di-tert-butylcatechol (1) has been studied in ethanol/water mixtures by means of cyclic voltammetry and controlled-potential coulometry. The results revealed that 3,5-di-tert-butyl-1,2-benenzoquinone (2) derived from oxidation of 3,5-di-tert-butylcatechol participate in noncovalently linked interactions with 1 converted to an ortho-benzoquinhydrone (3). The structure of 3 was characterized by MS, IR, 1 H NMR and 13 C NMR. The 1 H NMR studies reveal that the benzoquinhydrone complex 3 is stabilized by one H-bonding interaction. In this work we derived a novel ortho-bezoquinhydrone type complex (3) based on electrochemical oxidation of 3,5-di-tert-butylcatechol at carbon electrode in an undivided cell

  6. Determination of pKa values of benzoxa-, benzothia- and benzoselena-zolinone derivatives by capillary electrophoresis. Comparison with potentiometric titration and spectrometric data.

    Science.gov (United States)

    Foulon, C; Duhal, N; Lacroix-Callens, B; Vaccher, C; Bonte, J P; Goossens, J F

    2007-07-01

    Acidity constants of benzoxa-, benzothia- and benzoselena-zolinone derivatives were determined by capillary electrophoresis, potentiometry and spectrophotometry experiments. These three analytical techniques gave pK(a) results that were in good agreement. A convenient, accurate and precise method for the determination of pK(a) was developed to measure changes in acidity constants induced by heteroatom or 6-benzoyl substituted derivatives. pK(a) values were determined simultaneously for two compounds characterized by different electrophoretic mobility (micro(e)) and pK(a) value and in the presence of an analogous neutral marker.

  7. Forming limit prediction by an evolving non-quadratic yield criterion considering the anisotropic hardening and r-value evolution

    Science.gov (United States)

    Lian, Junhe; Shen, Fuhui; Liu, Wenqi; Münstermann, Sebastian

    2018-05-01

    The constitutive model development has been driven to a very accurate and fine-resolution description of the material behaviour responding to various environmental variable changes. The evolving features of the anisotropic behaviour during deformation, therefore, has drawn particular attention due to its possible impacts on the sheet metal forming industry. An evolving non-associated Hill48 (enHill48) model was recently proposed and applied to the forming limit prediction by coupling with the modified maximum force criterion. On the one hand, the study showed the significance to include the anisotropic evolution for accurate forming limit prediction. On the other hand, it also illustrated that the enHill48 model introduced an instability region that suddenly decreases the formability. Therefore, in this study, an alternative model that is based on the associated flow rule and provides similar anisotropic predictive capability is extended to chapter the evolving effects and further applied to the forming limit prediction. The final results are compared with experimental data as well as the results by enHill48 model.

  8. Improved prediction of hardwood tree biomass derived from wood density estimates and form factors for whole trees

    Science.gov (United States)

    David W. MacFarlane; Neil R. Ver Planck

    2012-01-01

    Data from hardwood trees in Michigan were analyzed to investigate how differences in whole-tree form and wood density between trees of different stem diameter relate to residual error in standard-type biomass equations. The results suggested that whole-tree wood density, measured at breast height, explained a significant proportion of residual error in standard-type...

  9. RAPID MULTICOMPONENT ANALYSIS OF HEMOGLOBIN DERIVATIVES FOR CONTROLLED ANTIDOTAL USE OF METHEMOGLOBIN-FORMING AGENTS IN CYANIDE POISONING

    NARCIS (Netherlands)

    ZIJLSTRA, WG

    When cyanide poisoning is treated with a methemoglobin-forming agent, oxidative metabolism is protected at the expense of the oxygen capacity of the blood.The affinity of methemoglobin for CN- is high enough to compete with cytochrome oxidase, which protects the latter from becoming blocked, but all

  10. Determination of UO2(II), and Ce(III) complexes formed with halogen and nitro derivatives of 8-hydroxyquinoline

    International Nuclear Information System (INIS)

    Teksoez, S.; Uenak, P.

    2001-01-01

    Proton-ligand stability constants for some iodo and nitro derivatives of 8-hydroxyquinoline were determined by Calvin Bjerrum potantiometrical method. The stability constants of the corresponding chelates with UO 2 (II), Th(IV) and Ce(III) were studied potentiometrically at 25 degree Celsius by applying Irving-Rossotti computing method. The complexes of the nitro-substituted ligands were less stable than the corresponding complexes of the unsubstituted ligands. The stability constants of metal-ligands depend on the ionic radii and ionic charge of metals and also they decrease with steric repulsions of the nitro groups

  11. Forming technology motivational-valued attitudes toward healthy appearance and lifestyle for students institutes of higher Ministry of internal affairs of Russia

    Directory of Open Access Journals (Sweden)

    Klimenko B.A.

    2010-10-01

    Full Text Available Directions of forming healthy lifestyle are considered for students. 62 students took part in experiment. New conception of the health physical training is grounded high-quality for students. Tests are developed as evaluated by the measure of formed of healthy lifestyle for students. Offered approach to the maintainance of professional health, level of physical preparedness at the change of appearance and lifestyle. It is set that the author program forms for students motivational-valued attitude toward the healthy lifestyle.

  12. High-performance liquid chromatography and derivative spectrophotometry for simultaneous determination of pravastatin and fenofibrate in the dosage form

    Directory of Open Access Journals (Sweden)

    Hefnawy Mohamed M.

    2014-12-01

    Full Text Available High performance liquid chromatography (HPLC and second-order derivative spectrophotometry have been used for simultaneous determination of pravastatin (PS and fenofibrate (FF in pharmaceutical formulations. HPLC separation was performed on a phenyl HYPERSIL C18 column (125 mm × 4.6 mm i.d., 5 μm particle diameter in the isocratic mode using a mobile phase acetonitrile/0.1 % diethyl amine (50:50, V/V, pH 4.5 pumped at a flow rate of 1.0 mL min-1. Measurement was made at 240 nm. Both drugs were well resolved on the stationary phase, with retention times of 2.15 and 5.79 min for PS and FF, respectively. Calibration curves were linear (R = 0.999 for PS and 0.996 for FF in the concentration range of 5-50 and 20-200 µg mL-1 for PS and FF, respectively. Pravastatin and fenofibrate were quantitated in combined preparations also using the second-order derivative response at 237.6 and 295.1 nm for PS and FF, respectively. Calibration curves were linear, with the correlation coefficient R = 0.999 for pravastatin and fenofibrate, in the concentration range of 5-20 and 3-20 µg mL-1 for PS and FF, respectively. Both methods were fully validated and compared, the results confirmed that they were highly suitable for their intended purpose.

  13. Clearing and settlement of exchange traded derivatives

    OpenAIRE

    John McPartland

    2009-01-01

    Derivatives are a class of financial instruments that derive their value from some underlying commodity, security, index, or other asset. Futures and options are common forms of derivatives. This article explains how clearing and settlement systems for exchange traded derivatives work.

  14. A stochastic model for the derivation of economic values and their standard deviations for production and functional traits in dairy cattle

    NARCIS (Netherlands)

    Nielsen, H.M.; Groen, A.F.; Ostergaard, S.; Berg, P.

    2006-01-01

    The objective of this paper was to present a model of a dairy cattle production system for the derivation of economic values and their standard deviations for both production and functional traits under Danish production circumstances. The stochastic model used is dynamic, and simulates production

  15. Genome-derived insights into the biology of the hepatotoxic bloom-forming cyanobacterium Anabaena sp. strain 90

    Directory of Open Access Journals (Sweden)

    Wang Hao

    2012-11-01

    Full Text Available Abstract Background Cyanobacteria can form massive toxic blooms in fresh and brackish bodies of water and are frequently responsible for the poisoning of animals and pose a health risk for humans. Anabaena is a genus of filamentous diazotrophic cyanobacteria commonly implicated as a toxin producer in blooms in aquatic ecosystems throughout the world. The biology of bloom-forming cyanobacteria is poorly understood at the genome level. Results Here, we report the complete sequence and comprehensive annotation of the bloom-forming Anabaena sp. strain 90 genome. It comprises two circular chromosomes and three plasmids with a total size of 5.3 Mb, encoding a total of 4,738 genes. The genome is replete with mobile genetic elements. Detailed manual annotation demonstrated that almost 5% of the gene repertoire consists of pseudogenes. A further 5% of the genome is dedicated to the synthesis of small peptides that are the products of both ribosomal and nonribosomal biosynthetic pathways. Inactivation of the hassallidin (an antifungal cyclic peptide biosynthetic gene cluster through a deletion event and a natural mutation of the buoyancy-permitting gvpG gas vesicle gene were documented. The genome contains a large number of genes encoding restriction-modification systems. Two novel excision elements were found in the nifH gene that is required for nitrogen fixation. Conclusions Genome analysis demonstrated that this strain invests heavily in the production of bioactive compounds and restriction-modification systems. This well-annotated genome provides a platform for future studies on the ecology and biology of these important bloom-forming cyanobacteria.

  16. Extreme Value Predictions for Wave- and Wind-induced Loads on Floating Offshore Wind Turbines using FORM

    DEFF Research Database (Denmark)

    Joensen, Sunvard; Jensen, Jørgen Juncher; Mansour, Alaa E.

    2007-01-01

    duration of the time domain simulations needed (typically 60-300s to cover the hy-drodynamic memory effects in the response) the calcu-lation of the mean out-crossing rates of a given response are very fast. Thus complicated non-linear effects can be included. The FORM analysis also identifies the most...... probable wave episodes leading to given re-sponses. As an example the motions of floating foundations for offshore wind turbines are analysed taking into consid-eration both the wave and wind induced loads and con-sidering different mooring systems. The possible large horizontal motions make it important...

  17. Novel Aminoglycoside Resistance Transposons and Transposon-Derived Circular Forms Detected in Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates

    Science.gov (United States)

    Dwibedi, Chinmay Kumar; Sjöström, Karin; Edquist, Petra; Wai, Sun Nyunt; Uhlin, Bernt Eric

    2016-01-01

    Acinetobacter baumannii has emerged as an important opportunistic pathogen equipped with a growing number of antibiotic resistance genes. Our study investigated the molecular epidemiology and antibiotic resistance features of 28 consecutive carbapenem-resistant clinical isolates of A. baumannii collected throughout Sweden in 2012 and 2013. The isolates mainly belonged to clonal complexes (CCs) with an extensive international distribution, such as CC2 (n = 16) and CC25 (n = 7). Resistance to carbapenems was related to blaOXA-23 (20 isolates), blaOXA-24/40-like (6 isolates), blaOXA-467 (1 isolate), and ISAba1-blaOXA-69 (1 isolate). Ceftazidime resistance was associated with blaPER-7 in the CC25 isolates. Two classical point mutations were responsible for resistance to quinolones in all the isolates. Isolates with high levels of resistance to aminoglycosides carried the 16S rRNA methylase armA gene. The isolates also carried a variety of genes encoding aminoglycoside-modifying enzymes. Several novel structures involved in aminoglycoside resistance were identified, including Tn6279, ΔTn6279, Ab-ST3-aadB, and different assemblies of Tn6020 and TnaphA6. Importantly, a number of circular forms related to the IS26 or ISAba125 composite transposons were detected. The frequent occurrence of these circular forms in the populations of several isolates indicates a potential role of these circular forms in the dissemination of antibiotic resistance genes. PMID:26824943

  18. A stochastic model for the derivation of economic values and their standard deviations for production and functional traits in dairy cattle

    DEFF Research Database (Denmark)

    Nielsen, Hanne-Marie; Groen, A F; Østergaard, Søren

    2006-01-01

    The objective of this paper was to present a model of a dairy cattle production system for the derivation of economic values and their standard deviations for both production and functional traits under Danish production circumstances. The stochastic model used is dynamic, and simulates production...... was -0.94 €/day per cow-year. Standard deviations of economic values expressing variation in realised profit of a farm before and after a genetic change were computed using a linear Taylor series expansion. Expressed as coefficient of variation, standard deviations of economic values based on 1000...

  19. Why Be a Shrub? A Basic Model and Hypotheses for the Adaptive Values of a Common Growth Form

    Science.gov (United States)

    Götmark, Frank; Götmark, Elin; Jensen, Anna M.

    2016-01-01

    Shrubs are multi-stemmed short woody plants, more widespread than trees, important in many ecosystems, neglected in ecology compared to herbs and trees, but currently in focus due to their global expansion. We present a novel model based on scaling relationships and four hypotheses to explain the adaptive significance of shrubs, including a review of the literature with a test of one hypothesis. Our model describes advantages for a small shrub compared to a small tree with the same above-ground woody volume, based on larger cross-sectional stem area, larger area of photosynthetic tissue in bark and stem, larger vascular cambium area, larger epidermis (bark) area, and larger area for sprouting, and faster production of twigs and canopy. These components form our Hypothesis 1 that predicts higher growth rate for a small shrub than a small tree. This prediction was supported by available relevant empirical studies (14 publications). Further, a shrub will produce seeds faster than a tree (Hypothesis 2), multiple stems in shrubs insure future survival and growth if one or more stems die (Hypothesis 3), and three structural traits of short shrub stems improve survival compared to tall tree stems (Hypothesis 4)—all hypotheses have some empirical support. Multi-stemmed trees may be distinguished from shrubs by more upright stems, reducing bending moment. Improved understanding of shrubs can clarify their recent expansion on savannas, grasslands, and alpine heaths. More experiments and other empirical studies, followed by more elaborate models, are needed to understand why the shrub growth form is successful in many habitats. PMID:27507981

  20. Geometric Least Square Models for Deriving [0,1]-Valued Interval Weights from Interval Fuzzy Preference Relations Based on Multiplicative Transitivity

    Directory of Open Access Journals (Sweden)

    Xuan Yang

    2015-01-01

    Full Text Available This paper presents a geometric least square framework for deriving [0,1]-valued interval weights from interval fuzzy preference relations. By analyzing the relationship among [0,1]-valued interval weights, multiplicatively consistent interval judgments, and planes, a geometric least square model is developed to derive a normalized [0,1]-valued interval weight vector from an interval fuzzy preference relation. Based on the difference ratio between two interval fuzzy preference relations, a geometric average difference ratio between one interval fuzzy preference relation and the others is defined and employed to determine the relative importance weights for individual interval fuzzy preference relations. A geometric least square based approach is further put forward for solving group decision making problems. An individual decision numerical example and a group decision making problem with the selection of enterprise resource planning software products are furnished to illustrate the effectiveness and applicability of the proposed models.

  1. EFSA Panel on Dietetic Products, Nutrition, and Allergies (NDA); Scientific Opinion on principles for deriving and applying Dietary Reference Values

    DEFF Research Database (Denmark)

    Tetens, Inge

    This Opinion of the EFSA Panel on Dietetic products, Nutrition, and Allergies (NDA) deals with the general principles for development and application of Dietary Reference Values (DRVs). These quantitative reference values for nutrient intakes for healthy individuals and populations are based...

  2. Early changes of placenta-derived messenger RNA in maternal plasma – potential value for preeclampsia prediction?

    Directory of Open Access Journals (Sweden)

    Surugiu Sebastian

    2015-12-01

    Full Text Available Objective: the pourpose of the study was to determine if there are any differences between placenta derived plasmatic levels of messenger RNA in normal and future preeclamptic pregnancies and if these placental transcripts can predict preeclampsia long before clinical onset

  3. Antifungal effect and pore-forming action of lactoferricin B like peptide derived from centipede Scolopendra subspinipes mutilans.

    Science.gov (United States)

    Choi, Hyemin; Hwang, Jae-Sam; Lee, Dong Gun

    2013-11-01

    The centipede Scolopendra subspinipes mutilans has been a medically important arthropod species by using it as a traditional medicine for the treatment of various diseases. In this study, we derived a novel lactoferricin B like peptide (LBLP) from the whole bodies of adult centipedes, S. s. mutilans, and investigated the antifungal effect of LBLP. LBLP exerted an antifungal and fungicidal activity without hemolysis. To investigate the antifungal mechanism of LBLP, a membrane study with propidium iodide was first conducted against Candida albicans. The result showed that LBLP caused fungal membrane permeabilization. The assays of the three dimensional flow cytometric contour plot and membrane potential further showed cell shrinkage and membrane depolarization by the membrane damage. Finally, we confirmed the membrane-active mechanism of LBLP by synthesizing model membranes, calcein and FITC-dextran loaded large unilamellar vesicles. These results showed that the antifungal effect of LBLP on membrane was due to the formation of pores with radii between 0.74nm and 1.4nm. In conclusion, this study suggests that LBLP exerts a potent antifungal activity by pore formation in the membrane, eventually leading to fungal cell death. © 2013.

  4. The role of visual and spatial working memory in forming mental models derived from survey and route descriptions.

    Science.gov (United States)

    Meneghetti, Chiara; Labate, Enia; Pazzaglia, Francesca; Hamilton, Colin; Gyselinck, Valérie

    2017-05-01

    This study examines the involvement of spatial and visual working memory (WM) in the construction of flexible spatial models derived from survey and route descriptions. Sixty young adults listened to environment descriptions, 30 from a survey perspective and the other 30 from a route perspective, while they performed spatial (spatial tapping [ST]) and visual (dynamic visual noise [DVN]) secondary tasks - believed to overload the spatial and visual working memory (WM) components, respectively - or no secondary task (control, C). Their mental representations of the environment were tested by free recall and a verification test with both route and survey statements. Results showed that, for both recall tasks, accuracy was worse in the ST than in the C or DVN conditions. In the verification test, the effect of both ST and DVN was a decreasing accuracy for sentences testing spatial relations from the opposite perspective to the one learnt than if the perspective was the same; only ST had a stronger interference effect than the C condition for sentences from the opposite perspective from the one learnt. Overall, these findings indicate that both visual and spatial WM, and especially the latter, are involved in the construction of perspective-flexible spatial models. © 2016 The British Psychological Society.

  5. Value Encounters - Modeling and Analyzing Co-creation of Value

    Science.gov (United States)

    Weigand, Hans

    Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value encounters are defined as interaction spaces where a group of actors meet and derive value by each one bringing in some of its own resources. They can be analyzed from multiple strategic perspectives, including knowledge management, social network management and operational management. Value encounter modeling can be instrumental in the context of service analysis and design.

  6. From waste to high-value product: Jackfruit peel derived pectin/apatite bionanocomposites for bone healing applications.

    Science.gov (United States)

    Govindaraj, Dharman; Rajan, Mariappan; Hatamleh, Ashraf A; Munusamy, Murugan A

    2018-01-01

    Public requirements encouraged by the current asset framework drive industry to expand its general effectiveness by enhancing existing procedures or finding new uses for waste. Thus, the aim of this study was the isolation, fabrication, and characterization of pectin derived from jackfruit (Artocarpus heterophyllus) peels and the generation of hybrid of pectin (P)/apatite (HA) (P/HA) bionanocomposites. In this process, the natural pectin polymer derived from the peel of jackfruits was used in different concentrations for the fabrication of HA bionanocomposites. Characterization of the isolated pectin and bionanocomposites samples was performed with 1 H NMR and 13 C NMR, FTIR, XRD, SEM-EDX, and HR-TEM. Cytocompatibility, ALP, fibroblast stem cells, anti-inflammatory and cell adhesion testing of the fabricated bionanocomposites was showed good biocompatibility. Our results signify that the fabricated bionanocomposites might be applicable as bone graft materials. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Symbolic regression via genetic programming for data driven derivation of confinement scaling laws without any assumption on their mathematical form

    International Nuclear Information System (INIS)

    Murari, A; Peluso, E; Gelfusa, M; Lupelli, I; Lungaroni, M; Gaudio, P

    2015-01-01

    Many measurements are required to control thermonuclear plasmas and to fully exploit them scientifically. In the last years JET has shown the potential to generate about 50 GB of data per shot. These amounts of data require more sophisticated data analysis methodologies to perform correct inference and various techniques have been recently developed in this respect. The present paper covers a new methodology to extract mathematical models directly from the data without any a priori assumption about their expression. The approach, based on symbolic regression via genetic programming, is exemplified using the data of the International Tokamak Physics Activity database for the energy confinement time. The best obtained scaling laws are not in power law form and suggest a revisiting of the extrapolation to ITER. Indeed the best non-power law scalings predict confinement times in ITER approximately between 2 and 3 s. On the other hand, more comprehensive and better databases are required to fully profit from the power of these new methods and to discriminate between the hundreds of thousands of models that they can generate. (paper)

  8. EQ-5D™-derived utility values for different levels of migraine severity from a UK sample of migraineurs

    Directory of Open Access Journals (Sweden)

    Stafford Megan R

    2012-06-01

    Full Text Available Abstract Background To estimate utility values for different levels of migraine pain severity from a United Kingdom (UK sample of migraineurs. Methods One hundred and six migraineurs completed the EQ-5D to evaluate their health status for mild, moderate and severe levels of migraine pain severity for a recent migraine attack, and for current health defined as health status within seven days post-migraine attack. Statistical tests were used to evaluate differences in mean utility scores by migraine severity. Results Utility scores for each health state were significantly different from 1.0 (no problems on any EQ-5D dimension (p  Conclusions Results indicate that all levels of migraine pain are associated with significantly reduced utility values. As severity worsened, utility decreased and severe migraine pain was considered a health state worse than death. Results can be used in cost-utility models examining the relative economic value of therapeutic strategies for migraine in the UK.

  9. Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow–Derived Cells for Large Osteochondral Defects in Rabbit Knees

    Science.gov (United States)

    Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

    2013-01-01

    Objective: The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells. Methods: Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow–derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O’Driscoll score). Results: The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O’Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. Conclusions: This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated. PMID:26069678

  10. Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow-Derived Cells for Large Osteochondral Defects in Rabbit Knees.

    Science.gov (United States)

    Yoshioka, Tomokazu; Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

    2013-10-01

    The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells. Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow-derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O'Driscoll score). The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O'Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated.

  11. Lean body mass-based standardized uptake value, derived from a predictive equation, might be misleading in PET studies

    International Nuclear Information System (INIS)

    Erselcan, Taner; Turgut, Bulent; Dogan, Derya; Ozdemir, Semra

    2002-01-01

    The standardized uptake value (SUV) has gained recognition in recent years as a semiquantitative evaluation parameter in positron emission tomography (PET) studies. However, there is as yet no consensus on the way in which this index should be determined. One of the confusing factors is the normalisation procedure. Among the proposed anthropometric parameters for normalisation is lean body mass (LBM); LBM has been determined by using a predictive equation in most if not all of the studies. In the present study, we assessed the degree of agreement of various LBM predictive equations with a reference method. Secondly, we evaluated the impact of predicted LBM values on a hypothetical value of 2.5 SUV, normalised to LBM (SUV LBM ), by using various equations. The study population consisted of 153 women, aged 32.3±11.8 years (mean±SD), with a height of 1.61±0.06 m, a weight of 71.1±17.5 kg, a body surface area of 1.77±0.22 m 2 and a body mass index of 27.6±6.9 kg/m 2 . LBM (44.2±6.6 kg) was measured by a dual-energy X-ray absorptiometry (DEXA) method. A total of nine equations from the literature were evaluated, four of them from recent PET studies. Although there was significant correlation between predicted and measured LBM values, 95% limits of agreement determined by the Bland and Altman method showed a wide range of variation in predicted LBM values as compared with DEXA, no matter which predictive equation was used. Moreover, only one predictive equation was not statistically different in the comparison of means (DEXA and predicted LBM values). It was also shown that the predictive equations used in this study yield a wide range of SUV LBM values from 1.78 to 5.16 (29% less or 107% more) for an SUV of 2.5. In conclusion, this study suggests that estimation of LBM by use of a predictive equation may cause substantial error for an individual, and that if LBM is chosen for the SUV normalisation procedure, it should be measured, not predicted. (orig.)

  12. Use of thermodynamic sorption models to derive radionuclide Kd values for performance assessment: Selected results and recommendations of the NEA sorption project

    Science.gov (United States)

    Ochs, M.; Davis, J.A.; Olin, M.; Payne, T.E.; Tweed, C.J.; Askarieh, M.M.; Altmann, S.

    2006-01-01

    For the safe final disposal and/or long-term storage of radioactive wastes, deep or near-surface underground repositories are being considered world-wide. A central safety feature is the prevention, or sufficient retardation, of radionuclide (RN) migration to the biosphere. To this end, radionuclide sorption is one of the most important processes. Decreasing the uncertainty in radionuclide sorption may contribute significantly to reducing the overall uncertainty of a performance assessment (PA). For PA, sorption is typically characterised by distribution coefficients (Kd values). The conditional nature of Kd requires different estimates of this parameter for each set of geochemical conditions of potential relevance in a RN's migration pathway. As it is not feasible to measure sorption for every set of conditions, the derivation of Kd for PA must rely on data derived from representative model systems. As a result, uncertainty in Kd is largely caused by the need to derive values for conditions not explicitly addressed in experiments. The recently concluded NEA Sorption Project [1] showed that thermodynamic sorption models (TSMs) are uniquely suited to derive K d as a function of conditions, because they allow a direct coupling of sorption with variable solution chemistry and mineralogy in a thermodynamic framework. The results of the project enable assessment of the suitability of various TSM approaches for PA-relevant applications as well as of the potential and limitations of TSMs to model RN sorption in complex systems. ?? by Oldenbourg Wissenschaftsverlag.

  13. The derivation and application of a risk related value of the spend for saving a statistical life

    International Nuclear Information System (INIS)

    Jackson, D; Stone, D; Butler, G G; McGlynn, G

    2004-01-01

    The concept of a risk related value of the spend for saving a statistical life (VSSSL) is advanced for use in cost-benefit studies across the power generation sector, and the nuclear industry in particular. For illustrative purposes, a best estimate VSSSL is set based on HSE guidance at Pounds 2 M. Above a risk of 10 -3 y -1 it is assumed that the VSSSL may approach this maximum sustainable value. As the risk reduces so does the VSSSL. At a risk level of 10 -6 y -1 a VSSSL of Pounds 0.5 M is applied. For risks below 10 -9 y -1 the value of further risk reduction approaches zero, although a nominal VSSSL of Pounds 10 k is applied as a pragmatic way forward in this study. The implications of adopting this concept as an aid to decision making in determining the spend on radiological dose reduction measures are illustrated through a worked example with a banded approach to estimating collective dose

  14. A zeta potential value determines the aggregate's size of penta-substituted [60]fullerene derivatives in aqueous suspension whereas positive charge is required for toxicity against bacterial cells.

    Science.gov (United States)

    Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E

    2015-08-08

    The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the

  15. Ongoing right ventricular hemodynamics in heart failure: clinical value of measurements derived from an implantable monitoring system.

    Science.gov (United States)

    Adamson, Philip B; Magalski, Anthony; Braunschweig, Frieder; Böhm, Michael; Reynolds, Dwight; Steinhaus, David; Luby, Allyson; Linde, Cecilia; Ryden, Lars; Cremers, Bodo; Takle, Teri; Bennett, Tom

    2003-02-19

    This study examined the characteristics of continuously measured right ventricular (RV) hemodynamic information derived from an implantable hemodynamic monitor (IHM) in heart failure patients. Hemodynamic monitoring might improve the day-to-day management of patients with chronic heart failure (CHF). Little is known about the characteristics of long-term hemodynamic information in patients with CHF or how such information relates to meaningful clinical events. Thirty-two patients with CHF received a permanent RV IHM system similar to a single-lead pacemaker. Right ventricular systolic and diastolic pressures, heart rate, and pressure derivatives were continuously measured for nine months without using the data for clinical decision-making or management of patients. Data were then made available to clinical providers, and the patients were followed up for 17 months. Pressure characteristics during optimal volume, clinically determined volume-overload exacerbations, and volume depletion events were examined. The effect of IHM on hospitalizations was examined using the patients' historical controls. Long-term RV pressure measurements had either marked variability or minimal time-related changes. During 36 volume-overload events, RV systolic pressures increased by 25 +/- 4% (p < 0.05) and heart rate increased by 11 +/- 2% (p < 0.05). Pressure increases occurred in 9 of 12 events 4 +/- 2 days before the exacerbations requiring hospitalization. Hospitalizations before using IHM data for clinical management averaged 1.08 per patient year and decreased to 0.47 per patient-year (57% reduction, p < 0.01) after hemodynamic data were used. Long-term ambulatory pressure measurements from an IHM may be helpful in guiding day-to-day clinical management, with a potentially favorable impact on CHF hospitalizations.

  16. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  17. Two dechlorinated chlordecone derivatives formed by in situ chemical reduction are devoid of genotoxicity and mutagenicity and have lower proangiogenic properties compared to the parent compound.

    Science.gov (United States)

    Legeay, Samuel; Billat, Pierre-André; Clere, Nicolas; Nesslany, Fabrice; Bristeau, Sébastien; Faure, Sébastien; Mouvet, Christophe

    2018-05-01

    Chlordecone (CLD) is a chlorinated hydrocarbon insecticide, now classified as a persistent organic pollutant. Several studies have previously reported that chronic exposure to CLD leads to hepatotoxicity, neurotoxicity, raises early child development and pregnancy complications, and increases the risk of liver and prostate cancer. In situ chemical reduction (ISCR) has been identified as a possible way for the remediation of soils contaminated by CLD. In the present study, the objectives were (i) to evaluate the genotoxicity and the mutagenicity of two CLD metabolites formed by ISCR, CLD-5a-hydro, or CLD-5-hydro (5a- or 5- according to CAS nomenclature; CLD-1Cl) and tri-hydroCLD (CLD-3Cl), and (ii) to explore the angiogenic properties of these molecules. Mutagenicity and genotoxicity were investigated using the Ames's technique on Salmonella typhimurium and the in vitro micronucleus micromethod with TK6 human lymphoblastoid cells. The proangiogenic properties were evaluated on the in vitro capillary network formation of human primary endothelial cells. Like CLD, the dechlorinated derivatives of CLD studied were devoid of genotoxic and mutagenic activity. In the assay targeting angiogenic properties, significantly lower microvessel lengths formed by endothelial cells were observed for the CLD-3Cl-treated cells compared to the CLD-treated cells for two of the three tested concentrations. These results suggest that dechlorinated CLD derivatives are devoid of mutagenicity and genotoxicity and have lower proangiogenic properties than CLD.

  18. THE DETERMINATION OF BUPROPION HYDROCHLORIDE IN PHARMACEUTICAL DOSAGE FORMS BY ORIGINAL UV- AND SECOND DERIVATIVE UV SPECTROPHOTOMETRY, POTENTIOMETRIC AND CONDUCTOMETRIC METHODS

    Directory of Open Access Journals (Sweden)

    Duygu YENİCELİ

    2010-08-01

    Full Text Available Spectrophotometric, potentiometric and conductometric methods are developed for the determination of bupropion hydrochloride (BLIP in pharmaceutical tablets. For the first method, original UV-spectrophotometry, 252 nm was determined as the optimum wavelength and used for the determinations. For the other method, second derivative UV spectrophotometry, the absorbances were measured at 217.4 and 221.8 nm and the distance between these extremum values was determined according to peak to peak method. Two spectrophotometric methods were validated over the concentration range of 5.72 - 20.03 ug/mL. The limit of detection and limit of quantitation values of original UV-spectrophotometry were 0.75 ug/mL and 2.28 jug/mL. Also, these parameters were determined as 0.23 ug/mL and 0.68 ug/mL respectively, for the second derivative UV spectrophotometry. Developed methods were fully validated and the applicability of the methods for the determination of BUP in pharmaceuticals were demonstrated. Also, simple potentiometric and conductometric methods were developed and the applicability of these methods were demonstrated. The results of four analytical methods were compared with ANOVA test and no significant difference was found statistically. As a result, the developed methods could be proposed to the rutin content analysis to be simple, cheap, accurate, and precise

  19. Valuing Essays: Essaying Values

    Science.gov (United States)

    Badley, Graham

    2010-01-01

    The essay regularly comes under attack. It is criticised for being rigidly linear rather than flexible and reflective. I first challenge this view by examining reasons why the essay should be valued as an important genre. Secondly, I propose that in using the essay form students and academics necessarily exemplify their own critical values. Essays…

  20. Participatory Resource Mapping for Livelihood Values Derived from the Forest in Ekondo-Titi Subregion, Cameroon: A Gender Analysis

    Directory of Open Access Journals (Sweden)

    Daniel B. Etongo

    2012-01-01

    Full Text Available Increasingly, the multiplicity of products, services, and values, and the diversity of interests from different resource users and groups, is being acknowledged as vital for sustainable use. This calls for a shift from protection to sustainable use and to resource-user focus. The aim of this study is to identify the spatial occurrence of livelihood values through participatory resource mapping, their changes over time and alternatives for sustainable management. A participatory resource mapping study was conducted with local community, including important stakeholders in Ekondo-Titi subregion of Cameroon. The research technique which focused on gender revealed different patterns of forest resources and changes on the landscape. The study concludes that the importance of resources varies between men and women in Ekondo-Titi subregion of Cameroon, implying that resources may have multipurpose functions, but its exact role depends on the needs of the user groups that utilize them. The divergence of opinion on certain resources is a clear indication of preferences that are gender motivated. The study also revealed that the greatest impact of land use change is the conversion of forest land into agriculture.

  1. Local survey of the distribution of industrial melanic forms in the moth Biston betularia and estimates of the selective values of these in an industrial environment

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, C A; Sheppard, P M

    1966-01-01

    A survey has shown that there is a rapid decline in the frequency of the industrial melanic carbonaria of the moth Biston betularia from a value of about 97% in Liverpool to less than 10% 50 miles to the west in North Wales. The decline in the frequency of the intermediate phenotype insularia in this area, controlled by an allelomorph at the same locus, is from about 14% on the Wirral (no reliable frequency is available for Liverpool) to about 4% 30 miles to the west. Experiments using dead moths placed in life-like positions on tree trunks at Caldy and in Liverpool confirmed that carbonaria is better camouflaged on the blackened tree trunks of industrial areas. Estimates of the selective disadvantage of the typical form in Liverpool, using data from the survey and these experiments, together with a variety of assumptions, indicate values of the order of 60%, which is somewhat higher than previous estimates. At Caldy the typical form appears to have been at a disadvantage of about 50% prior to the introduction of the smokeless zones and is now at about a 20% disadvantage, using assumptions similar to those in the Liverpool estimates. Although these estimates are subject to considerable error, there is little doubt that they reflect the correct order of magnitude of the relative selective values. 8 references, 1 figure, 4 tables.

  2. Poultry feed based on protein hydrolysate derived from chrome-tanned leather solid waste: creating value from waste.

    Science.gov (United States)

    Chaudhary, Rubina; Pati, Anupama

    2016-04-01

    Leather industry generates huge amount of chrome-containing leather solid waste which creates major environment problems to tanners worldwide. Chrome-tanned leather solid waste is primarily chromium complex of collagen protein. The presence of chromium limits its protein application in animal feed industry. The purified protein hydrolysate with zero chromium could be used in poultry feed. In this study, an attempt has been made to assess performance of poultry with purified protein hydrolysate as a feed derived from chrome-tanned leather waste as partial replacement of soyabean meal as a sole source of protein for growing broiler chickens. Growth study was conducted to evaluate the effect of feeding protein hydrolysate on performance and physiochemical characteristics of meat of broiler chickens. Two experimental diets containing various levels of protein hydrolysate (EI-20 % and EII-30 %) were evaluated. The comparative study was performed as control with soyabean meal. Daily feed intake, body weight gain and feed conversion ratio were measured from day 8 to day 35. At the end of the study, birds were randomly selected and slaughtered to evaluate for physiochemical characteristics of meat. Diet had significant effects on feed intake and body weight gain. Birds fed with 20 and 30 % protein hydrolysate consumed 9.5 and 17.5 % higher amount of feed and gained 6.5 and 16.6 % higher than soyabean meal-fed birds. The current study produced evidence that protein hydrolysate can replace up to 75 % of soyabean meal in broiler diets without affecting either growth performance or meat characteristics.

  3. Proposed method for assigning metric tons of heavy metal values to defense high-level waste forms to be disposed of in a geologic repository

    International Nuclear Information System (INIS)

    1987-08-01

    A proposed method is described for assigning an equivalent metric ton heavy metal (eMTHM) value to defense high-level waste forms to be disposed of in a geologic repository. This method for establishing a curie equivalency between defense high-level waste and irradiated commercial fuel is based on the ratio of defense fuel exposure to the typical commercial fuel exposure, MWd/MTHM. application of this technique to defense high-level wastes is described. Additionally, this proposed technique is compared to several alternate calculations for eMTHM. 15 refs., 2 figs., 10 tabs

  4. Il museo partecipativo sul web: forme di partecipazione dell’utente alla produzione culturale e alla creazione di valore culturale / The participatory museum on the Web: forms of user participation in cultural production and the creation of cultural value

    Directory of Open Access Journals (Sweden)

    Elisa Bonacini

    2012-05-01

    Full Text Available Obiettivo di questo lavoro è un inquadramento sia del nuovo rapporto fra il museo partecipativo e l’utenza che delle forme di partecipazione dell’utenza alla produzione culturale e alla creazione di valore culturale, alla luce delle potenzialità offerte dalle ICT, soprattutto dal web e dai vari social media. Questo nuovo rapporto, che ha le sue radici più profonde proprio nell’ampia adozione di tutte le piattaforme tecnologiche oggi in uso, consente anche una reinterpretazione del significato stesso di cultural value. Il quadro, che viene qui delineato ed arricchito da numerosi esempi soprattutto stranieri, chiarisce anche quanto l’aspetto partecipativo e l’utilizzo di tags, folksonomie e user generated contents possano incidere sulla fidelizzazione dell’utenza. Infine, in una tabella presentata a fine del contributo, si evidenziano le maggiori componenti che caratterizzano il definitivo passaggio dalla fase Museo 1.0 alla fase Museo 2.0. The aim of this paper is a framework both of the new relationship between the participatory museum and the audience and a framework of multiple forms of audience participation in cultural production and in the creation of cultural value, given the potential offered by ICTs, especially the web and various social media. This new relationship, which has its deepest roots just in the adoption of all technology platforms in use today, also allows for a reinterpretation of the meaning of cultural value. The framework, outlined here and enriched by numerous examples especially foreigners, also makes clear that participation and use of tags, folksonomies and user-generated contents may have an impact on users loyalty. Finally, presented in a table at the end of the paper, we highlight the most important features characterizing the transition from the Museum 1.0 phase to the Museum 2.0 one.

  5. Fractionalization of the complex-valued Brownian motion of order n using Riemann-Liouville derivative. Applications to mathematical finance and stochastic mechanics

    International Nuclear Information System (INIS)

    Jumarie, Guy

    2006-01-01

    The (complex-valued) Brownian motion of order n is defined as the limit of a random walk on the complex roots of the unity. Real-valued fractional noises are obtained as fractional derivatives of the Gaussian white noise (or order two). Here one combines these two approaches and one considers the new class of fractional noises obtained as fractional derivative of the complex-valued Brownian motion of order n. The key of the approach is the relation between differential and fractional differential provided by the fractional Taylor's series of analytic function f(z+h)=E α (h α D z α ).f(z), where E α is the Mittag-Leffler function on the one hand, and the generalized Maruyama's notation, on the other hand. Some questions are revisited such as the definition of fractional Brownian motion as integral w.r.t. (dt) α , and the exponential growth equation driven by fractional Brownian motion, to which a new solution is proposed. As a first illustrative example of application, in mathematical finance, one proposes a new approach to the optimal management of a stochastic portfolio of fractional order via the Lagrange variational technique applied to the state moment dynamical equations. In the second example, one deals with non-random Lagrangian mechanics of fractional order. The last example proposes a new approach to fractional stochastic mechanics, and the solution so obtained gives rise to the question as to whether physical systems would not have their own internal random times

  6. Deriving site-specific soil clean-up values for metals and metalloids: rationale for including protection of soil microbial processes.

    Science.gov (United States)

    Kuperman, Roman G; Siciliano, Steven D; Römbke, Jörg; Oorts, Koen

    2014-07-01

    Although it is widely recognized that microorganisms are essential for sustaining soil fertility, structure, nutrient cycling, groundwater purification, and other soil functions, soil microbial toxicity data were excluded from the derivation of Ecological Soil Screening Levels (Eco-SSL) in the United States. Among the reasons for such exclusion were claims that microbial toxicity tests were too difficult to interpret because of the high variability of microbial responses, uncertainty regarding the relevance of the various endpoints, and functional redundancy. Since the release of the first draft of the Eco-SSL Guidance document by the US Environmental Protection Agency in 2003, soil microbial toxicity testing and its use in ecological risk assessments have substantially improved. A wide range of standardized and nonstandardized methods became available for testing chemical toxicity to microbial functions in soil. Regulatory frameworks in the European Union and Australia have successfully incorporated microbial toxicity data into the derivation of soil threshold concentrations for ecological risk assessments. This article provides the 3-part rationale for including soil microbial processes in the development of soil clean-up values (SCVs): 1) presenting a brief overview of relevant test methods for assessing microbial functions in soil, 2) examining data sets for Cu, Ni, Zn, and Mo that incorporated soil microbial toxicity data into regulatory frameworks, and 3) offering recommendations on how to integrate the best available science into the method development for deriving site-specific SCVs that account for bioavailability of metals and metalloids in soil. Although the primary focus of this article is on the development of the approach for deriving SCVs for metals and metalloids in the United States, the recommendations provided in this article may also be applicable in other jurisdictions that aim at developing ecological soil threshold values for protection of

  7. Whole lesion histogram analysis of meningiomas derived from ADC values. Correlation with several cellularity parameters, proliferation index KI 67, nucleic content, and membrane permeability.

    Science.gov (United States)

    Surov, Alexey; Hamerla, Gordian; Meyer, Hans Jonas; Winter, Karsten; Schob, Stefan; Fiedler, Eckhard

    2018-09-01

    To analyze several histopathological features and their possible correlations with whole lesion histogram analysis derived from ADC maps in meningioma. The retrospective study involved 36 patients with primary meningiomas. For every tumor, the following histogram analysis parameters of apparent diffusion coefficient (ADC) were calculated: ADC mean , ADC max , ADC min , ADC median , ADC mode , ADC percentiles: P10, P25, P75, P90, as well kurtosis, skewness, and entropy. All measures were performed by two radiologists. Proliferation index KI 67, minimal, maximal and mean cell count, total nucleic area, and expression of water channel aquaporin 4 (AQP4) were estimated. Spearman's correlation coefficient was used to analyze associations between investigated parameters. A perfect interobserver agreement for all ADC values (0.84-0.97) was identified. All ADC values correlated inversely with tumor cellularity with the strongest correlation between P10, P25 and mean cell count (-0.558). KI 67 correlated inversely with all ADC values except ADC min . ADC parameters did not correlate with total nucleic area. All ADC values correlated statistically significant with expression of AQP4. ADC histogram analysis is a valid method with an excellent interobserver agreement. Cellularity parameters and proliferation potential are associated with different ADC values. Membrane permeability may play a greater role for water diffusion than cell count and proliferation activity. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. GAS PHASE STRUCTURE AND STABILITY OF COMPLEX FORMED BY H2O, NH3, H2S AND THEIR METHYL DERIVATIVES WITH THE CATION CO2+

    Directory of Open Access Journals (Sweden)

    Cahyorini Kusumawardani

    2010-06-01

    Full Text Available Ab initio molecular orbital calculations at the Hartree-Fock-Self Consistent Field (HF-SCF have been performed in order to determine the structure and gas phase energies of complex formed by the Lewis bases of H2O, NH3, H2S and their methyl derivatives with the cation Co2+. The relative basicities of the base studied depend on both the substituent. The gas-phase interaction energies computed by the SCF method including electron correlation Møller-Plesset 2 (MP2 dan Configuration Iteration (CI were comparable in accuracy. The binding energies computed by these two methods reach the targeted chemical accuracy.   Keywords: ab initio calculation, cobalt complex, structure stability

  9. Modified truncated randomized singular value decomposition (MTRSVD) algorithms for large scale discrete ill-posed problems with general-form regularization

    Science.gov (United States)

    Jia, Zhongxiao; Yang, Yanfei

    2018-05-01

    In this paper, we propose new randomization based algorithms for large scale linear discrete ill-posed problems with general-form regularization: subject to , where L is a regularization matrix. Our algorithms are inspired by the modified truncated singular value decomposition (MTSVD) method, which suits only for small to medium scale problems, and randomized SVD (RSVD) algorithms that generate good low rank approximations to A. We use rank-k truncated randomized SVD (TRSVD) approximations to A by truncating the rank- RSVD approximations to A, where q is an oversampling parameter. The resulting algorithms are called modified TRSVD (MTRSVD) methods. At every step, we use the LSQR algorithm to solve the resulting inner least squares problem, which is proved to become better conditioned as k increases so that LSQR converges faster. We present sharp bounds for the approximation accuracy of the RSVDs and TRSVDs for severely, moderately and mildly ill-posed problems, and substantially improve a known basic bound for TRSVD approximations. We prove how to choose the stopping tolerance for LSQR in order to guarantee that the computed and exact best regularized solutions have the same accuracy. Numerical experiments illustrate that the best regularized solutions by MTRSVD are as accurate as the ones by the truncated generalized singular value decomposition (TGSVD) algorithm, and at least as accurate as those by some existing truncated randomized generalized singular value decomposition (TRGSVD) algorithms. This work was supported in part by the National Science Foundation of China (Nos. 11771249 and 11371219).

  10. Diagnostic value of transmural perfusion ratio derived from dynamic CT-based myocardial perfusion imaging for the detection of haemodynamically relevant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Coenen, Adriaan; Lubbers, Marisa M.; Dedic, Admir; Chelu, Raluca G.; Geuns, Robert-Jan M. van; Nieman, Koen [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Erasmus University Medical Center, Department of Cardiology, Rotterdam (Netherlands); Kurata, Akira; Kono, Atsushi; Dijkshoorn, Marcel L. [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Rossi, Alexia [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Barts Health NHS Trust, NIHR Cardiovascular Biomedical Research Unit at Barts, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London and Department of Cardiology, London (United Kingdom)

    2017-06-15

    To investigate the additional value of transmural perfusion ratio (TPR) in dynamic CT myocardial perfusion imaging for detection of haemodynamically significant coronary artery disease compared with fractional flow reserve (FFR). Subjects with suspected or known coronary artery disease were prospectively included and underwent a CT-MPI examination. From the CT-MPI time-point data absolute myocardial blood flow (MBF) values were temporally resolved using a hybrid deconvolution model. An absolute MBF value was measured in the suspected perfusion defect. TPR was defined as the ratio between the subendocardial and subepicardial MBF. TPR and MBF results were compared with invasive FFR using a threshold of 0.80. Forty-three patients and 94 territories were analysed. The area under the receiver operator curve was larger for MBF (0.78) compared with TPR (0.65, P = 0.026). No significant differences were found in diagnostic classification between MBF and TPR with a territory-based accuracy of 77 % (67-86 %) for MBF compared with 70 % (60-81 %) for TPR. Combined MBF and TPR classification did not improve the diagnostic classification. Dynamic CT-MPI-based transmural perfusion ratio predicts haemodynamically significant coronary artery disease. However, diagnostic performance of dynamic CT-MPI-derived TPR is inferior to quantified MBF and has limited incremental value. (orig.)

  11. Biochemical characterization of CK2alpha and alpha' paralogues and their derived holoenzymes: evidence for the existence of a heterotrimeric CK2alpha'-holoenzyme forming trimeric complexes

    DEFF Research Database (Denmark)

    Olsen, Birgitte; Rasmussen, Tine; Niefind, Karsten

    2008-01-01

    Altogether 2 holoenzymes and 4 catalytic CK2 constructs were expressed and characterized i.e. CK2alpha (2) (1-335) beta(2); CK2alpha'-derived holoenzyme; CK2alpha(1-335); MBP-CK2alpha'; His-tagged CK2alpha and His-tagged CK2alpha'. The two His-tagged catalytic subunits were expressed in insect...... cells, all others in Escherichia coli. IC(50) studies involving the established CK2 inhibitors DMAT, TBBt, TBBz, apigenin and emodin were carried out and the K(i) values calculated. Although the differences in the K(i) values found were modest, there was a general tendency showing that the CK2...... holoenzymes were more sensitive towards the inhibitors than the free catalytic subunits. Thermal inactivation experiments involving the individual catalytic subunits showed an almost complete loss of activity after only 2 min at 45 degrees C. In the case of the two holoenzymes, the CK2alpha...

  12. Acute regulation of circulating parathyroid hormone (PTH) molecular forms by calcium: utility of PTH fragments/PTH(1-84) ratios derived from three generations of PTH assays.

    Science.gov (United States)

    D'Amour, Pierre; Räkel, Agnès; Brossard, Jean-Hugues; Rousseau, Louise; Albert, Caroline; Cantor, Tom

    2006-01-01

    The quantitative evaluation of circulating PTH peaks revealed by PTH assays after HPLC separation constitutes the best way to study the behavior of PTH molecular forms, but it is also impractical. The objective of the study was to investigate the regulation of circulating PTH molecular forms by calcium through the use of PTH fragments/PTH (1-84) ratios derived from PTH assays with different specificities before and after HPLC separation of circulating PTH. CaCl2 and Na citrate were infused in eight volunteers. PTH was measured in serum and HPLC fractions at different calcium concentrations in PTH assays reacting with regions 1-2 (CA), 12-18 (T), and 65-69 (C) of the PTH structure. From hypo- to hypercalcemia, the C/CA ratio had the highest range (1.92 to 9.75; P < 0.001), and the C/T ratio had a higher range (1.69 to 6.11; P < 0.01) than the T/CA ratio (1.15 to 1.86). Human (h) PTH (1-84) represented 32.7 and 4.3% of circulating PTH in hypo- and hypercalcemic HPLC profiles, respectively. These numbers were 5 and 0.9% for amino-terminal (N)-PTH, an amino-terminal form of PTH distinct from hPTH (1-84), 7.3 and 6.8% for non-(1-84) PTH or large C-PTH fragments with a partially preserved N structure, and 54.9 and 88.1% for C-PTH fragments missing a N structure. The HPLC C-PTH fragments to hPTH (1-84) ratio had the most extensive range (1.67 to 20.58). Despite their quantitative differences, all ratios identified identical behavior of PTH fragments relative to PTH (1-84). PTH assay ratios are an adequate tool to investigate the modulation of PTH molecular forms, even if all PTH assays show some undesirable cross-reactivity with certain circulating forms of PTH.

  13. Receptor theory and biological constraints on value.

    Science.gov (United States)

    Berns, Gregory S; Capra, C Monica; Noussair, Charles

    2007-05-01

    Modern economic theories of value derive from expected utility theory. Behavioral evidence points strongly toward departures from linear value weighting, which has given rise to alternative formulations that include prospect theory and rank-dependent utility theory. Many of the nonlinear forms for value assumed by these theories can be derived from the assumption that value is signaled by neurotransmitters in the brain, which obey simple laws of molecular movement. From the laws of mass action and receptor occupancy, we show how behaviorally observed forms of nonlinear value functions can arise.

  14. Monoclonal antibodies (MAb) made against insect-derived metacyclic trypomastigotes (IMT) of Trypanosoma cruzi (TC) cross-react with other parasite forms

    International Nuclear Information System (INIS)

    Kirchhoff, L.V.; Gilliam, F.C.

    1986-01-01

    Considerable information has been generated in recent years about stage-specific surface membrane antigens of a number of protozoa, and this phenomenon has been observed among several stages of TC as well. However, little is known about the surface antigens of IMT, the true infective stage of TC, because of the difficulty of obtaining sufficient numbers of these organisms for analysis. The Tulahuen strain of TC was maintained in the reduviid vector Dipetalogaster maximus by repeated feeding on mice with high parasitemias. IMT collected with insect urine were irradiated (150 krad) and used to immunize a BALB/c mouse for hybridoma production. Supernatants were screened by immunofluorescence assay for the presence of IgG MAb that react with methanol-fixed IMT, epimastogotes (EPI) and culture-derived metacyclic trypomastigoes (CMT). Of 41 MAb obtained, 40 reacted with IMT, 37 with EPI and 38 with CMT. Four MAb immunoprecipitated radioiodinated proteins or protein conjugates of M/sub r/ 80, 72, 45 and 45 from lysates of 125 I surface-labeled EPI. These results indicate that, at least at the epitopic level, there is considerable overlap among IMT, EPI and CMT surface antigens. This finding suggests that analysis of surface proteins of the latter 2 parasite forms may lead to identification of molecules useful for vaccine development

  15. 17 CFR 249.820 - Form 19b-4(e) for the listing and trading of new derivative securities products by self...

    Science.gov (United States)

    2010-04-01

    ... and trading of new derivative securities products by self-regulatory organizations that are not deemed... listing and trading of new derivative securities products by self-regulatory organizations that are not... self-regulatory organization's listing and trading of a new derivative securities product that is not...

  16. Fecal concentrations of bacterially derived vitamin K forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults.

    Science.gov (United States)

    Karl, J Philip; Meydani, Mohsen; Barnett, Junaidah B; Vanegas, Sally M; Barger, Kathryn; Fu, Xueyan; Goldin, Barry; Kane, Anne; Rasmussen, Helen; Vangay, Pajau; Knights, Dan; Jonnalagadda, Satya S; Saltzman, Edward; Roberts, Susan B; Meydani, Simin N; Booth, Sarah L

    2017-10-01

    Background: Emerging evidence suggests novel roles for bacterially derived vitamin K forms known as menaquinones in health and disease, which may be attributable in part to anti-inflammatory effects. However, the relevance of menaquinones produced by gut bacteria to vitamin K requirements and inflammation is undetermined. Objective: This study aimed to quantify fecal menaquinone concentrations and identify associations between fecal menaquinone concentrations and serum vitamin K concentrations, gut microbiota composition, and inflammation. Design: Fecal and serum menaquinone concentrations, fecal microbiota composition, and plasma and fecal cytokine concentrations were measured in 80 men and postmenopausal women (48 men, 32 women, age 40-65 y) enrolled in a randomized, parallel-arm, provided-food trial. After consuming a run-in diet for 2 wk, participants were randomly assigned to consume a whole grain-rich (WG) or a refined grain-based (RG) diet for 6 wk. Outcomes were measured at weeks 2 and 8. Results: The median total daily excretion of menaquinones in feces was 850 nmol/d but was highly variable (range: 64-5358 nmol/d). The total median (IQR) fecal concentrations of menaquinones decreased in the WG diet compared with the RG diet [-6.8 nmol/g (13.0 nmol/g) dry weight for WG compared with 1.8 nmol/g (12.3 nmol/g) dry weight for RG; P < 0.01)]. However, interindividual variability in fecal menaquinone concentrations partitioned individuals into 2 distinct groups based on interindividual differences in concentrations of different menaquinone forms rather than the diet group or the time point. The relative abundances of several gut bacteria taxa, Bacteroides and Prevotella in particular, differed between these groups, and 42% of identified genera were associated with ≥1 menaquinone form. Menaquinones were not detected in serum, and neither fecal concentrations of individual menaquinones nor the menaquinone group was associated with any marker of inflammation

  17. PSNO: Predicting Cysteine S-Nitrosylation Sites by Incorporating Various Sequence-Derived Features into the General Form of Chou’s PseAAC

    Directory of Open Access Journals (Sweden)

    Jian Zhang

    2014-06-01

    Full Text Available S-nitrosylation (SNO is one of the most universal reversible post-translational modifications involved in many biological processes. Malfunction or dysregulation of SNO leads to a series of severe diseases, such as developmental abnormalities and various diseases. Therefore, the identification of SNO sites (SNOs provides insights into disease progression and drug development. In this paper, a new bioinformatics tool, named PSNO, is proposed to identify SNOs from protein sequences. Firstly, we explore various promising sequence-derived discriminative features, including the evolutionary profile, the predicted secondary structure and the physicochemical properties. Secondly, rather than simply combining the features, which may bring about information redundancy and unwanted noise, we use the relative entropy selection and incremental feature selection approach to select the optimal feature subsets. Thirdly, we train our model by the technique of the k-nearest neighbor algorithm. Using both informative features and an elaborate feature selection scheme, our method, PSNO, achieves good prediction performance with a mean Mathews correlation coefficient (MCC value of about 0.5119 on the training dataset using 10-fold cross-validation. These results indicate that PSNO can be used as a competitive predictor among the state-of-the-art SNOs prediction tools. A web-server, named PSNO, which implements the proposed method, is freely available at http://59.73.198.144:8088/PSNO/.

  18. Brain perfusion ratios by 99mTc HMPAO SPECT utilizing a mean value of the visual cortex to the cerebellum ratio derived from normal subjects

    International Nuclear Information System (INIS)

    Sanchez Catasus, C.; Rodriguez, R.; Cisnero, M.; Palmero, R.; Diaz, O.; Aguila, A.

    2002-01-01

    Aim: Previous results shows that the cerebellum (CER) is the best reference to calculate relative indexes of perfusion (IP) by brain SPECT. However, it can not be used on patients with bilateral cerebellar hypoperfusion. In such cases visual cortex (VC) or an average of the whole brain activity is recommended (WB). VC and WB are less reliable than CER, making it difficult to compare SPECT scans that have been normalized with different values. Materials and Methods: To overcome this difficulty, we developed a method to calculate IP utilizing a reference value defined as (VC / ), where is the mean value of the VC/CER ratio derived from a normal database which was assumed to be constant. We called the value VC/ the 'Pseudocerebellum' (PCER). For clinical validation, we first tested statistically the VC/CER ratio on a group of 60 [ 99m Tc]-HMPAO SPECT scans of 20 normal subjects and 40 neurological patients with positive SPECT but without involvement of VC and CER. To demonstrate that IP PCER approx. IP CER , we calculated the mean value of the absolute differences CER - IP PCER vertical bar> on two groups of scans from subjects without involvement of VC and CER: 10 normal subjects (GI); and 40 patients (GII). Finally, using an indirect procedure the method was tested on a third group of SPECT scans of 30 patients with bilateral cerebellar hypoperfusion (G III). Results: The VC/CER ratio was approximately constant with gender and age at a 95% confidence level; CER - IP PCER vertical bar> was 1.22%±0.35 and 1.20%±0.42 for GI and GII, respectively. This is less than the within-subject replicability of the HMPAO SPECT studies; and thus demonstrated by an indirect approach that IP PCER is a valid procedure by which to evaluate relative perfusion on patients with bilateral cerebellar hypoperfusion and quantitatively comparable to using CER as reference region. Conclusion: The VC/CER ratio has very little inter-subject variability in individuals where these regions are not

  19. Contrast-enhanced magnetic resonance imaging of the breast: the value of pharmacokinetic parameters derived from fast dynamic imaging during initial enhancement in classifying lesions

    International Nuclear Information System (INIS)

    Veltman, J.; Stoutjesdijk, M.; Mann, R.; Huisman, H.J.; Barentsz, J.O.; Blickman, J.G.; Boetes, C.

    2008-01-01

    The value of pharmacokinetic parameters derived from fast dynamic imaging during initial enhancement in characterizing breast lesions on magnetic resonance imaging (MRI) was evaluated. Sixty-eight malignant and 34 benign lesions were included. In the scanning protocol, high temporal resolution imaging was combined with high spatial resolution imaging. The high temporal resolution images were recorded every 4.1 s during initial enhancement (fast dynamic analysis). The high spatial resolution images were recorded at a temporal resolution of 86 s (slow dynamic analysis). In the fast dynamic evaluation pharmacokinetic parameters (K trans , V e and k ep ) were evaluated. In the slow dynamic analysis, each lesion was scored according to the BI-RADS classification. Two readers evaluated all data prospectively. ROC and multivariate analysis were performed. The slow dynamic analysis resulted in an AUC of 0.85 and 0.83, respectively. The fast dynamic analysis resulted in an AUC of 0.83 in both readers. The combination of both the slow and fast dynamic analyses resulted in a significant improvement of diagnostic performance with an AUC of 0.93 and 0.90 (P = 0.02). The increased diagnostic performance found when combining both methods demonstrates the additional value of our method in further improving the diagnostic performance of breast MRI. (orig.)

  20. Valuing put options on single stock futures: Does the put-call parity relationship hold in the South African derivatives market?

    Directory of Open Access Journals (Sweden)

    A Biebuyck

    2014-12-01

    Full Text Available This study attempts to determine whether mispricing of options on single stock futures is present in the South African derivatives market. The valuation of options on single stock futures is considered through the put-call parity relationship. The theoretical fair values obtained, are compared to the actual market values over a period of three years, that is, from 2009 to 2011. Only put options are considered in this research.The results show that arbitrage put option opportunities do present themselves for the chosen shares. The actual put options were found to be underpriced in 5 out of 6 (83% of the cases considered over the evaluation periods chosen. The mispricing was significant for both the BHP Billiton options with 100% and in the case of Sasol options (66% of the time. Whether profitable arbitrage opportunities is possible, will depend on the magnitude of the mispricing and the transaction fees payable. Further, more extensive research may help identify tendencies which may be of use for the formulation of arbitrage strategies

  1. Interministerial decree of 10 February 1988 fixing the derived limits of the air concentration and the annual intake limit and the values of the quality factor and the neutron fluence rate

    International Nuclear Information System (INIS)

    1988-01-01

    This decree establishes the derived concentration limits in the air and annual inhalation limits for the radioisotopes and the values of the quality factors and the conversion factors fluence/dose equivalent for neutrons and protons

  2. Financial Derivatives

    DEFF Research Database (Denmark)

    Wigan, Duncan

    2013-01-01

    Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....

  3. Blue-emitting photoluminescence of rod-like and needle-like ZnO nanostructures formed by hot-water treatment of sol–gel derived coatings

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Wai Kian, E-mail: tanwaikian@cie.ignite.tut.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Kawamura, Go; Muto, Hiroyuki [Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Abdul Razak, Khairunisak; Lockman, Zainovia [School of Materials and Mineral Resources, Universiti Sains Malaysia, Engineering Campus, Nibong Tebal, Pulau Pinang 14300 Malaysia (Malaysia); Matsuda, Atsunori, E-mail: matsuda@tut.ee.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan)

    2015-02-15

    The morphological evolution of the zinc oxide (ZnO) nanostructures generated by hot-water treatment (HWT) of sol–gel derived coatings as a function of temperature from 30 to 90 °C was investigated. With increasing HWT temperature, the ZnO crystals evolved from nanoparticles to rod-like and needle-like nanostructures. High-resolution transmission electron microscope observations of rod-like and needle-like nanostructures generated at 60 and 90 °C indicated single crystal ZnO wurtzite structure was obtained. All the hot-water treated samples exhibited blue emission at approximately 440 nm in room temperature. The intensity of blue emission increased with higher HWT temperatures. The unique photoluminescence emission characteristic remained even after heat-treatment at 400 °C for 1 h. As the emission peak obtained in our work is approximately 440 nm (2.82 eV), the emission peak is corresponding to the electron transition from the interstitial Zn to the top of valence band. This facile formation of blue-emitting ZnO nanostructures at low-temperature can be utilized on substrate with low thermal stability for optoelectronic applications such as light emitting devices and biological fluorescence labeling. - Highlights: • Facile and novel formation of ZnO nanostructures by low temperature hot-water treatment. • No catalyst or inhibitor is used. • Evolution of ZnO nanostructures formation as a function of temperature is reported. • Dominant blue emissions are observed from the as-formed and annealed ZnO films. • Ultraviolet and visible emissions are observed for hot-water treated films.

  4. Use of In Vivo and In Vitro Data to Derive a Chronic Reference Value for Crotonaldehyde Based on Relative Potency to Acrolein.

    Science.gov (United States)

    Grant, Roberta L; Jenkins, Allison F

    2015-01-01

    The Texas Commission on Environmental Quality (TCEQ) conducted a chronic inhalation noncancer toxicity assessment for crotonaldehyde (CRO). Since there were limited toxicity data for CRO, a reference value (ReV) was derived using a relative potency factor (RPF) approach with acrolein as the index chemical. Both CRO and acrolein are α,β-unsaturated carbonyls and share common steps in their mode of action (MOA). Only studies that investigated the effects of CRO and acrolein in the same study were used to calculate a CRO:acrolein RPF. In vivo findings measuring both 50% respiratory depression in rats and two species of mice and subcutaneous 50% lethality in rats and mice were used to calculate an RPF of 3 (rounded to one significant figure). In vitro data were useful to compare the MOA of CRO and acrolein and to support the RPF determined using in vivo data. In vitro cell culture studies investigating cytotoxicity in normal human lung fibroblast cultures using the propidium iodide cytotoxicity assay and in mouse lymphocyte cultures using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cytotoxicity assay were used to calculate an in vitro RPF of 3, which supports the in vivo RPF. The chronic ReV for acrolein of 1.2 ppb derived by TCEQ was multiplied by the RPF of 3 to calculate the ReV for CRO of 3.6 ppb (10 μg/m(3)). The ReV for CRO was developed to protect the general public from adverse health effects from chronic exposure to CRO in ambient air.

  5. Ab initio random structure searching of organic molecular solids: assessment and validation against experimental data† †Electronic supplementary information (ESI) available: Results of similarity analysis between the 11 structures of lowest energy obtained in the AIRSS calculations and the reported structures of form III and form IV of m-ABA; unit cell parameters and volumes for all structures considered; comparison of 2θ values derived from the unit cell parameters of different structural models representing form III of m-ABA; Le Bail fitting of the experimental powder XRD pattern of form IV of m-ABA recorded at 70 K using, as the initial structural model, the reported crystal structure following geometry optimization; table of calculated (GIPAW) absolute isotropic NMR shieldings; simulated powder XRD data for the considered structures after precise geometry optimization; experimental 1H MAS NMR spectra of forms III and IV. (pdf) The calculated and experimental data for this study are provided as a supporting dataset from WRAP, the Warwick Research Archive Portal at http://wrap.warwick.ac.uk/91884. See DOI: 10.1039/c7cp04186a

    Science.gov (United States)

    Zilka, Miri; Dudenko, Dmytro V.; Hughes, Colan E.; Williams, P. Andrew; Sturniolo, Simone; Franks, W. Trent; Pickard, Chris J.

    2017-01-01

    This paper explores the capability of using the DFT-D ab initio random structure searching (AIRSS) method to generate crystal structures of organic molecular materials, focusing on a system (m-aminobenzoic acid; m-ABA) that is known from experimental studies to exhibit abundant polymorphism. Within the structural constraints selected for the AIRSS calculations (specifically, centrosymmetric structures with Z = 4 for zwitterionic m-ABA molecules), the method is shown to successfully generate the two known polymorphs of m-ABA (form III and form IV) that have these structural features. We highlight various issues that are encountered in comparing crystal structures generated by AIRSS to experimental powder X-ray diffraction (XRD) data and solid-state magic-angle spinning (MAS) NMR data, demonstrating successful fitting for some of the lowest energy structures from the AIRSS calculations against experimental low-temperature powder XRD data for known polymorphs of m-ABA, and showing that comparison of computed and experimental solid-state NMR parameters allows different hydrogen-bonding motifs to be discriminated. PMID:28944393

  6. Pretreatment with platelet derived growth factor-BB modulates the ability of costochondral resting zone chondrocytes incorporated into PLA/PGA scaffolds to form new cartilage in vivo.

    Science.gov (United States)

    Lohmann, C H; Schwartz, Z; Niederauer, G G; Carnes, D L; Dean, D D; Boyan, B D

    2000-01-01

    Optimal repair of chondral defects is likely to require both a suitable population of chondrogenic cells and a biodegradable matrix to provide a space-filling structural support during the early stages of cartilage formation. This study examined the ability of chondrocytes to support cartilage formation when incorporated into biodegradable scaffolds constructed from copolymers (PLG) of polylactic acid (PLA) and polyglycolic acid (PGA) and implanted in the calf muscle of nude mice. Scaffolds were fabricated to be more hydrophilic (PLG-H) or were reinforced with 10% PGA fibers (PLG-FR), increasing the stiffness of the implant by 20-fold. Confluent primary cultures of rat costochondral resting zone chondrocytes (RC) were loaded into PLG-H foams and implanted intramuscularly. To determine if growth factor pretreatment could modulate the ability of the cells to form new cartilage, RC cells were pretreated with recombinant human platelet derived growth factor-BB IPDGF-BB) for 4 or 24 h prior to implantation. To assess whether scaffold material properties could affect the ability of chondrogenic cells to form cartilage, RC cells were also loaded into PLG-FR scaffolds. To determine if the scaffolds or treatment with PDGF-BB affected the rate of chondrogenesis, tissue at the implant site was harvested at four and eight weeks post-operatively, fixed, decalcified and embedded in paraffin. Sections were obtained along the transverse plane of the lower leg, stained with haematoxylin and eosin, and then assessed by morphometric analysis for area of cartilage, area of residual implant, and area of fibrous connective tissue formation (fibrosis). Whether or not the cartilage contained hypertrophic cells was also assessed. The amount of residual implant did not change with time in any of the implanted tissues. The area occupied by PLG-FR implants was greater than that occupied by PLG-H implants at both time points. All implants were surrounded by fibrous connective tissue, whether

  7. Prognostic value of bone- and vascular-derived molecular biomarkers in hemodialysis and renal transplant patients: a systematic review and meta-analysis.

    Science.gov (United States)

    Pichler, Gernot; Haller, Maria C; Kainz, Alexander; Wolf, Myles; Redon, Josep; Oberbauer, Rainer

    2017-09-01

    Patients undergoing hemodialysis and kidney graft recipients are high-risk populations for cardiovascular and all-cause mortality. Fibroblast growth factor 23 (FGF23), osteoprotegerin (OPG), RANK ligand, osteopontin (OPN), Klotho protein and bone morphogenetic protein-7 (BMP-7) are bone- and vascular-derived molecular biomarkers that have been shown to be associated with cardiovascular surrogate end points; however, currently available data on the prognostic value of these biomarkers is inconsistent. The aim of the present study was to conduct a systematic review and meta-analysis in order to summarize the available evidence on the association of molecular biomarkers with mortality in individuals undergoing hemodialysis and renal transplant patients. Two databases (MEDLINE and Embase) were systematically searched. Studies were eligible if the association of biomarker and mortality was reported as time-to-event data [hazard Ratio (HR)] or as effect size with a fixed time of follow-up [odds Ratio (OR)]. Abstracted HRs were converted onto a standard scale of effect and combined using a random effects model. From a total of 1170 studies identified in initial searches, 21 met the inclusion criteria. In hemodialysis patients, comparing the lower third with the upper third of baseline FGF23 distribution, pooled HRs (95% confidence intervals) were 1.94 (1.47, 2.56) for all-cause mortality and 2.4 (1.64, 3.51) for cardiovascular mortality. For the same comparison of baseline OPG distribution, pooled HRs were 1.8 (0.95, 3.39) for all-cause mortality and 2.53 (1.29, 4.94) for cardiovascular mortality. Reported risk estimates of RANK ligand, OPN, Klotho protein and BMP-7 were not suitable for pooling; however, only Klotho protein was significantly related to mortality. For kidney graft recipients, four studies that investigated the relationship of FGF23 and OPG with mortality were identified, all of which reported a significant association. In hemodialysis patients, FGF23 is a

  8. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  9. Toxicity assessment strategies, data requirements, and risk assessment approaches to derive health based guidance values for non-relevant metabolites of plant protection products.

    Science.gov (United States)

    Dekant, Wolfgang; Melching-Kollmuss, Stephanie; Kalberlah, Fritz

    2010-03-01

    In Europe, limits for tolerable concentrations of "non-relevant metabolites" for active ingredients (AI) of plant protection products in drinking water between 0.1 and 10 microg/L are discussed depending on the toxicological information available. "Non-relevant metabolites" are degradation products of AIs, which do not or only partially retain the targeted toxicities of AIs. For "non-relevant metabolites" without genotoxicity (to be confirmed by testing in vitro), the application of the concept of "thresholds of toxicological concern" results in a health-based drinking water limit of 4.5 microg/L even for Cramer class III compounds, using the TTC threshold of 90 microg/person/day (divided by 10 and 2). Taking into account the thresholds derived from two reproduction toxicity data bases a drinking water limit of 3.0 microg/L is proposed. Therefore, for "non-relevant metabolites" whose drinking water concentration is below 3.0 microg/L, no toxicity testing is necessary. This work develops a toxicity assessment strategy as a basis to delineate health-based limits for "non-relevant metabolites" in ground and drinking water. Toxicological testing is recommended to investigate, whether the metabolites are relevant or not, based on the hazard properties of the parent AIs, as outlined in the SANCO Guidance document. Also, genotoxicity testing of the water metabolites is clearly recommended. In this publication, tiered testing strategies are proposed for non-relevant metabolites, when drinking water concentrations >3.0 microg/L will occur. Conclusions based on structure-activity relationships and the detailed toxicity database on the parent AI should be included. When testing in animals is required for risk assessment, key aspects are studies along OECD-testing guidelines with "enhanced" study designs addressing additional endpoints such as reproductive toxicity and a developmental screening test to derive health-based tolerable drinking water limits with a limited number

  10. Predictive value of [-2]propsa (p2psa and its derivatives for the prostate cancer detection in the 2.0 to 10.0ng/mL PSA range

    Directory of Open Access Journals (Sweden)

    I. Vukovic

    Full Text Available ABSTRACT Introduction To assess predictive value of new tumor markers, precursor of prostate specific antigen (p2PSA and its derivates-%p2PSA and prostate health index (PHI in detection of patients with indolent and aggressive prostate cancer (PC in a subcohort of man whose total PSA ranged from 2 to 10ng/mL. Materials and Methods This cross-sectional study included 129 consecutive male patients aged over 50 years, with no previous history of PC and with normal digital rectal examination findings, but with serum PSA in interval between 2 and 10ng/mL. All patients underwent standard transrectal ultrasonography guided prostate biopsy for the first time. For all patients, serum PSA, free PSA (fPSA and p2PSA were measured and PHI and %p2PSA were calculated. Results PHI and %p2PSA levels were significanlty higher in patients with PC compared to those without this malignancy. The same findings have been observed in group of patients with Gleason score ≥7 compared to those with Gleason score <7. ROC analysis reveled the highest area under the curve with these two markers. Multivariate logistic regression showed significant improvement in PC detection and its agressive form (assumed as Gleason score ≥7. Conclusions New markers, derivates of p2PSA (especially %p2PSA and PHI, represente potentially very important clinical tool for predicting presence of PC, and even more important, to discriminate patients with Gleason score <7 from those with Gleason score ≥7 with total PSA in range from 2 to 10ng/mL.

  11. Predictive value of [-2]propsa (p2psa) and its derivatives for the prostate cancer detection in the 2.0 to 10.0ng/mL PSA range.

    Science.gov (United States)

    Vukovic, I; Djordjevic, D; Bojanic, N; Babic, U; Soldatovic, I

    2017-01-01

    To assess predictive value of new tumor markers, precursor of prostate specific antigen (p2PSA) and its derivates-%p2PSA and prostate health index (PHI) in detection of patients with indolent and aggressive prostate cancer (PC) in a subcohort of man whose total PSA ranged from 2 to 10ng/mL. This cross-sectional study included 129 consecutive male patients aged over 50 years, with no previous history of PC and with normal digital rectal examination findings, but with serum PSA in interval between 2 and 10ng/mL. All patients underwent standard transrectal ultrasonography guided prostate biopsy for the first time. For all patients, serum PSA, free PSA (fPSA) and p2PSA were measured and PHI and %p2PSA were calculated. PHI and %p2PSA levels were significanlty higher in patients with PC compared to those without this malignancy. The same findings have been observed in group of patients with Gleason score ≥7 compared to those with Gleason score <7. ROC analysis reveled the highest area under the curve with these two markers. Multivariate logistic regression showed significant improvement in PC detection and its agressive form (assumed as Gleason score ≥7). New markers, derivates of p2PSA (especially %p2PSA and PHI), represente potentially very important clinical tool for predicting presence of PC, and even more important, to discriminate patients with Gleason score <7 from those with Gleason score ≥7 with total PSA in range from 2 to 10ng/mL. Copyright® by the International Brazilian Journal of Urology.

  12. The forms and fitness cost of senescence : Age-specific recapture, survival, reproduction, and reproductive value in a wild bird population

    NARCIS (Netherlands)

    Bouwhuis, Sandra; Choquet, Remi; Sheldon, Ben C.; Verhulst, Simon

    Longitudinal studies of senescence accumulate rapidly from natural populations. However, it is largely unknown whether different fitness components senesce in parallel, how reproductive and survival senescence contribute to declines in reproductive value, and how large the fitness cost of senescence

  13. Anomalous vacuum expectation values

    International Nuclear Information System (INIS)

    Suzuki, H.

    1986-01-01

    The anomalous vacuum expectation value is defined as the expectation value of a quantity that vanishes by means of the field equations. Although this value is expected to vanish in quantum systems, regularization in general produces a finite value of this quantity. Calculation of this anomalous vacuum expectation value can be carried out in the general framework of field theory. The result is derived by subtraction of divergences and by zeta-function regularization. Various anomalies are included in these anomalous vacuum expectation values. This method is useful for deriving not only the conformal, chiral, and gravitational anomalies but also the supercurrent anomaly. The supercurrent anomaly is obtained in the case of N = 1 supersymmetric Yang-Mills theory in four, six, and ten dimensions. The original form of the energy-momentum tensor and the supercurrent have anomalies in their conservation laws. But the modification of these quantities to be equivalent to the original one on-shell causes no anomaly in their conservation laws and gives rise to anomalous traces

  14. Whole-body adipose tissue and lean muscle volumes and their distribution across gender and age: MR-derived normative values in a normal-weight Swiss population.

    Science.gov (United States)

    Ulbrich, Erika J; Nanz, Daniel; Leinhard, Olof Dahlqvist; Marcon, Magda; Fischer, Michael A

    2018-01-01

    To determine age- and gender-dependent whole-body adipose tissue and muscle volumes in healthy Swiss volunteers in Dixon MRI in comparison with anthropometric and bioelectrical impedance (BIA) measurements. Fat-water-separated whole-body 3 Tesla MRI of 80 healthy volunteers (ages 20 to 62 years) with a body mass index (BMI) of 17.5 to 26.2 kg/m 2 (10 men, 10 women per decade). Age and gender-dependent volumes of total adipose tissue (TAT), visceral adipose tissue (VAT), total abdominal subcutaneous adipose tissue (ASAT) and total abdominal adipose tissue (TAAT), and the total lean muscle tissue (TLMT) normalized for body height were determined by semi-automatic segmentation, and correlated with anthropometric and BIA measurements as well as lifestyle parameters. The TAT, ASAT, VAT, and TLMT indexes (TATi, ASATi, VATi, and TLMTi, respectively) (L/m 2  ± standard deviation) for women/men were 6.4 ± 1.8/5.3 ± 1.7, 1.6 ± 0.7/1.2 ± 0.5, 0.4 ± 0.2/0.8 ± 0.5, and 5.6 ± 0.6/7.1 ± 0.7, respectively. The TATi correlated strongly with ASATi (r > 0.93), VATi, BMI and BIA (r > 0.70), and TAATi (r > 0.96), and weak with TLMTi for both genders (r > -0.34). The VAT was the only parameter showing an age dependency (r > 0.32). The BMI and BIA showed strong correlation with all MR-derived adipose tissue volumes. The TAT mass was estimated significantly lower from BIA than from MRI (both genders P muscle volumes might serve as normative values. The estimation of adipose tissue volumes was significantly lower from anthropometric and BIA measurements than from MRI. Magn Reson Med 79:449-458, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  15. Free radical derivatives formed from cyclooxygenase-catalyzed dihomo-γ-linolenic acid peroxidation can attenuate colon cancer cell growth and enhance 5-fluorouracil's cytotoxicity.

    Science.gov (United States)

    Xu, Yi; Qi, Jin; Yang, Xiaoyu; Wu, Erxi; Qian, Steven Y

    2014-01-01

    Dihomo-γ-linolenic acid (DGLA) and its downstream fatty acid arachidonic acid (AA) are both nutritionally important ω-6 polyunsaturated fatty acids (ω-6s). Evidence shows that, via COX-mediated peroxidation, DGLA and its metabolites (1-series prostaglandins) are associated with anti-tumor activity, while AA and its metabolites (2-series prostaglandins) could be tightly implicated in various cancer diseases. However, it still remains a mystery why DGLA and AA possess contrasting bioactivities. Our previous studies showed that DGLA could go through an exclusive C-8 oxygenation pathway during COX-catalyzed lipid peroxidation in addition to a C-15 oxygenation pathway shared by both DGLA and AA, and that the exclusive C-8 oxygenation could lead to the production of distinct DGLA׳s free radical derivatives that may be correlated with DGLA׳s anti-proliferation activity. In the present work, we further investigate the anti-cancer effect of DGLA׳s free radical derivatives and their associated molecular mechanisms. Our study shows that the exclusive DGLA׳s free radical derivatives from C-8 oxygenation lead to cell growth inhibition, cell cycle arrest and apoptosis in the human colon cancer cell line HCA-7 colony 29, probably by up-regulating the cancer suppressor p53 and the cell cycle inhibitor p27. In addition, these exclusive radical derivatives were also able to enhance the efficacy of 5-Fluorouracil (5-FU), a widely used chemo-drug for colon cancer. For the first time, we show how DGLA׳s radical pathway and metabolites are associated with DGLA׳s anti-cancer activities and able to sensitize colon cancer cells to chemo-drugs such as 5-FU. Our findings could be used to guide future development of a combined chemotherapy and dietary care strategy for colon cancer treatment.

  16. PROCEDURES FOR THE DERIVATION OF EQUILIBRIUM PARTITIONING SEDIMENT BENCHMARKS (ESBS) FOR THE PROTECTION OF BENTHIC ORGANISMS: COMPENDIUM OF TIER 2 VALUES FOR NONIONIC ORGANICS

    Science.gov (United States)

    This equilibrium partitioning sediment benchmark (ESB) document describes procedures to derive concentrations for 32 nonionic organic chemicals in sediment which are protective of the presence of freshwater and marine benthic organisms. The equilibrium partitioning (EqP) approach...

  17. Microstructure of hydroxyapatite- and octacalcium phosphate-coatings formed on magnesium by a hydrothermal treatment at various pH values

    International Nuclear Information System (INIS)

    Tomozawa, Masanari; Hiromoto, Sachiko

    2011-01-01

    Hydroxyapatite (HAp) coatings with and without octacalcium phosphate (OCP) were uniformly formed on pure magnesium by a hydrothermal treatment using a Ca-EDTA solution. The crystal structure, crystallographic orientation and lattice images were investigated using transmission electron microscopy (TEM) and high-resolution TEM. It was demonstrated that the crystal phase and microstructure of the calcium phosphate-coatings can vary with the pH of the treatment solution. In a weak acid treatment solution, a dual-layer structure was formed: an outer coarse layer consisting of plate-like OCP crystals and an inner dense layer consisting primarily of HAp crystals. One piece of the OCP plate corresponded to a single OCP crystal growing parallel to the (1 0 0) OCP . In a weak alkali treatment solution, a dual-layer structure was also formed: an outer coarse layer consisting of rod-like HAp crystals and an inner dense layer consisting of HAp crystals. One piece of the HAp rod corresponded to a single HAp crystal growing along [0 0 2] HAp . In a strong alkali treatment solution, needle-like HAp crystals were formed. No defect was observed in the lattice image of the OCP and HAp. The corrosion current density of pure magnesium in a 3.5 wt.% NaCl solution decreased with the HAp coating more significantly than the OCP + HAp coating. It is revealed that the degree of protection afforded by calcium phosphate-coatings varies with their crystal phase and microstructure.

  18. Differential bone-forming capacity of osteogenic cells from either embryonic stem cells or bone marrow-derived mesenchymal stem cells

    NARCIS (Netherlands)

    Both, Sanne Karijn; van Apeldoorn, Aart A.; Jukes, J.M.; Englund, Mikael C.O.; Hyllner, Johan; van Blitterswijk, Clemens; de Boer, Jan

    2011-01-01

    For more than a decade, human mesenchymal stem cells (hMSCs) have been used in bone tissue-engineering research. More recently some of the focus in this field has shifted towards the use of embryonic stem cells. While it is well known that hMSCs are able to form bone when implanted subcutaneously in

  19. Frequency of and Prognostic Significance of Cardiac Involvement at Presentation in Hereditary Transthyretin-Derived Amyloidosis and the Value of N-Terminal Pro-B-Type Natriuretic Peptide

    NARCIS (Netherlands)

    Klaassen, Sebastiaan H C; Tromp, Jasper; Nienhuis, Hans L A; van der Meer, Peter; van den Berg, Maarten P; Blokzijl, Hans; van Veldhuisen, Dirk J; Hazenberg, Bouke P C

    2018-01-01

    The aim of this study is to assess the prevalence of cardiac involvement in hereditary transthyretin-derived (ATTRm) amyloidosis at the time of diagnosis and to determine the diagnostic and clinical value of N-terminal pro-B-type natriuretic peptide (NT-proBNP). The University Medical Center

  20. The value of reliability

    DEFF Research Database (Denmark)

    Fosgerau, Mogens; Karlström, Anders

    2010-01-01

    We derive the value of reliability in the scheduling of an activity of random duration, such as travel under congested conditions. Using a simple formulation of scheduling utility, we show that the maximal expected utility is linear in the mean and standard deviation of trip duration, regardless...... of the form of the standardised distribution of trip durations. This insight provides a unification of the scheduling model and models that include the standard deviation of trip duration directly as an argument in the cost or utility function. The results generalise approximately to the case where the mean...

  1. Rapid Chondrocyte Isolation for Tissue Engineering Applications: The Effect of Enzyme Concentration and Temporal Exposure on the Matrix Forming Capacity of Nasal Derived Chondrocytes

    Directory of Open Access Journals (Sweden)

    Srujana Vedicherla

    2017-01-01

    Full Text Available Laboratory based processing and expansion to yield adequate cell numbers had been the standard in Autologous Disc Chondrocyte Transplantation (ADCT, Allogeneic Juvenile Chondrocyte Implantation (NuQu®, and Matrix-Induced Autologous Chondrocyte Implantation (MACI. Optimizing cell isolation is a key challenge in terms of obtaining adequate cell numbers while maintaining a vibrant cell population capable of subsequent proliferation and matrix elaboration. However, typical cell yields from a cartilage digest are highly variable between donors and based on user competency. The overall objective of this study was to optimize chondrocyte isolation from cartilaginous nasal tissue through modulation of enzyme concentration exposure (750 and 3000 U/ml and incubation time (1 and 12 h, combined with physical agitation cycles, and to assess subsequent cell viability and matrix forming capacity. Overall, increasing enzyme exposure time was found to be more detrimental than collagenase concentration for subsequent viability, proliferation, and matrix forming capacity (sGAG and collagen of these cells resulting in nonuniform cartilaginous matrix deposition. Taken together, consolidating a 3000 U/ml collagenase digest of 1 h at a ratio of 10 ml/g of cartilage tissue with physical agitation cycles can improve efficiency of chondrocyte isolation, yielding robust, more uniform matrix formation.

  2. Long-Term Expansion in Platelet Lysate Increases Growth of Peripheral Blood-Derived Endothelial-Colony Forming Cells and Their Growth Factor-Induced Sprouting Capacity.

    Science.gov (United States)

    Tasev, Dimitar; van Wijhe, Michiel H; Weijers, Ester M; van Hinsbergh, Victor W M; Koolwijk, Pieter

    2015-01-01

    Efficient implementation of peripheral blood-derived endothelial-colony cells (PB-ECFCs) as a therapeutical tool requires isolation and generation of a sufficient number of cells in ex vivo conditions devoid of animal-derived products. At present, little is known how the isolation and expansion procedure in xenogeneic-free conditions affects the therapeutical capacity of PB-ECFCs. The findings presented in this study indicate that human platelet lysate (PL) as a serum substitute yields twice more colonies per mL blood compared to the conventional isolation with fetal bovine serum (FBS). Isolated ECFCs displayed a higher proliferative ability in PL supplemented medium than cells in FBS medium during 30 days expansion. The cells at 18 cumulative population doubling levels (CPDL) retained their proliferative capacity, showed higher sprouting ability in fibrin matrices upon stimulation with FGF-2 and VEGF-A than the cells at 6 CPDL, and displayed low β-galactosidase activity. The increased sprouting of PB-ECFCs at 18 CPDL was accompanied by an intrinsic activation of the uPA/uPAR fibrinolytic system. Induced deficiency of uPA (urokinase-type plasminogen activator) or uPAR (uPA receptor) by siRNA technology completely abolished the angiogenic ability of PB-ECFCs in fibrin matrices. During the serial expansion, the gene induction of the markers associated with inflammatory activation such as VCAM-1 and ICAM-1 did not occur or only to limited extent. While further propagation up to 31 CPDL proceeded at a comparable rate, a marked upregulation of inflammatory markers occurred in all donors accompanied by a further increase of uPA/uPAR gene induction. The observed induction of inflammatory genes at later stages of long-term propagation of PB-ECFCs underpins the necessity to determine the right time-point for harvesting of sufficient number of cells with preserved therapeutical potential. The presented isolation method and subsequent cell expansion in platelet lysate

  3. Long-Term Expansion in Platelet Lysate Increases Growth of Peripheral Blood-Derived Endothelial-Colony Forming Cells and Their Growth Factor-Induced Sprouting Capacity.

    Directory of Open Access Journals (Sweden)

    Dimitar Tasev

    Full Text Available Efficient implementation of peripheral blood-derived endothelial-colony cells (PB-ECFCs as a therapeutical tool requires isolation and generation of a sufficient number of cells in ex vivo conditions devoid of animal-derived products. At present, little is known how the isolation and expansion procedure in xenogeneic-free conditions affects the therapeutical capacity of PB-ECFCs.The findings presented in this study indicate that human platelet lysate (PL as a serum substitute yields twice more colonies per mL blood compared to the conventional isolation with fetal bovine serum (FBS. Isolated ECFCs displayed a higher proliferative ability in PL supplemented medium than cells in FBS medium during 30 days expansion. The cells at 18 cumulative population doubling levels (CPDL retained their proliferative capacity, showed higher sprouting ability in fibrin matrices upon stimulation with FGF-2 and VEGF-A than the cells at 6 CPDL, and displayed low β-galactosidase activity. The increased sprouting of PB-ECFCs at 18 CPDL was accompanied by an intrinsic activation of the uPA/uPAR fibrinolytic system. Induced deficiency of uPA (urokinase-type plasminogen activator or uPAR (uPA receptor by siRNA technology completely abolished the angiogenic ability of PB-ECFCs in fibrin matrices. During the serial expansion, the gene induction of the markers associated with inflammatory activation such as VCAM-1 and ICAM-1 did not occur or only to limited extent. While further propagation up to 31 CPDL proceeded at a comparable rate, a marked upregulation of inflammatory markers occurred in all donors accompanied by a further increase of uPA/uPAR gene induction. The observed induction of inflammatory genes at later stages of long-term propagation of PB-ECFCs underpins the necessity to determine the right time-point for harvesting of sufficient number of cells with preserved therapeutical potential.The presented isolation method and subsequent cell expansion in platelet

  4. Buthalital and methitural – 5,5-substituted derivatives of 2-thiobarbituric acid forming the same type of hydrogen-bonded chain

    Directory of Open Access Journals (Sweden)

    Thomas Gelbrich

    2017-12-01

    Full Text Available The molecule of buthalital, (I [systematic name: 5-(2-methylpropyl-5-(prop-2-en-1-yl-2-sulfanylidene-1,3-diazinane-4,6-dione], C11H16N2O2S, exhibits a planar pyrimidine ring, whereas the pyrimidine ring of methitural, (II [systematic name: 5-(1-methylbutyl-5-[2-(methylsulfanylethyl]-2-sulfanylidene-1,3-diazinane-4,6-dione], C12H20N2O2S2, is slightly puckered. (I and (II contain the same hydrogen-bonded chain structure in which each molecule is connected, via four N—H...O=C hydrogen bonds, to two other molecules, resulting in a hydrogen-bonded chain displaying a sequence of R22(8 rings. The same type of N—H...O=C hydrogen-bonded chain has previously been found in several 5,5-disubstituted derivatives of barbituric acid which are chemically closely related to (I and (II.

  5. CD133-enriched Xeno-Free human embryonic-derived neural stem cells expand rapidly in culture and do not form teratomas in immunodeficient mice

    Directory of Open Access Journals (Sweden)

    Daniel L. Haus

    2014-09-01

    Full Text Available Common methods for the generation of human embryonic-derived neural stem cells (hNSCs result in cells with potentially compromised safety profiles due to maintenance of cells in conditions containing non-human proteins (e.g. in bovine serum or on mouse fibroblast feeders. Additionally, sufficient expansion of resulting hNSCs for scaling out or up in a clinically relevant time frame has proven to be difficult. Here, we report a strategy that produces hNSCs in completely “Xeno-Free” culture conditions. Furthermore, we have enriched the hNSCs for the cell surface marker CD133 via magnetic sorting, which has led to an increase in the expansion rate and neuronal fate specification of the hNSCs in vitro. Critically, we have also confirmed neural lineage specificity upon sorted hNSC transplantation into the immunodeficient NOD-scid mouse brain. The future use or adaptation of these protocols has the potential to better facilitate the advancement of pre-clinical strategies from the bench to the bedside.

  6. Guidelines and Criteria for the Search Strategy, Evaluation, Selection, and Documentation of Key Data and Supporting Data Used for the Derivation of AEGL Values

    Science.gov (United States)

    This is Section 2.3 of the Standing Operating Procedures for Developing Acute Exposure Guideline Levels (AEGLs) for Hazardous Chemicals. It discusses methodologies used to search for and select data for development of AEGL values.

  7. Comparative study of 5-fluorouracil and its derivative, N1-(2'-tetrahydrofuryl)-5-fluorouracil on endogenous colony forming units in spleens of mice

    International Nuclear Information System (INIS)

    Ueno, Yori

    1976-01-01

    The effect of intraperitoneal injection of N 1 -(2'-tetrahydrofuryl)-5-fluorouracil (FT-207) which is metabolized to 5-fluorouracil (5-FU) in vivo, on endogeneous colony forming units in the spleen (endogeneous CFU-s) was observed and compared with that of 5-FU. The 8 x 10 -4 m eqv of FT-207 injected in mice 20 minutes before x-rays irradiation of 450 rads suppressed the endogeneous CFU-s count to about 60% and about 5.5 x 10 -5 m eqv of 5-FU had the same effect. The suppression of FT-207 continued over 120 minutes and increased gradually. The effect of 5-FU was strong shortly after the injection but faded out for 120 minutes. FT-207 had almost no effect on the recovery constant (Blair) of endogeneous CFU-s for 3 days, whereas 5-FU reduced seriously, especially for the first 2 days. The differences in the effects of both compounds could not be explained on the base of the only differences in the metabolism of both compounds. (auth.)

  8. Determination of pKa values of new phenacyl-piperidine derivatives by potentiometric titration method in aqueous medium at room temperature (25±0.5oC).

    Science.gov (United States)

    Zafar, Shaista; Akhtar, Shamim; Tariq, Talat; Mushtaq, Noushin; Akram, Arfa; Ahmed, Ahsaan; Arif, Muhammad; Naeem, Sabahat; Anwar, Sana

    2014-07-01

    Dissociation constant (pKa) of ten novel phenacyl derivatives of piperidine were determined by potentiometric titration method in aqueous medium at room temperature (25 ±0.5°C). The sample solutions were prepared in deionized water with ionic strength 0.01M and titrated with 0.1M NaOH solution. In addition, ΔG values were also calculated. Different prediction software programs were used to calculate pKa values too and compared to the experimentally observed pKa values. The experimental and theoretical values were found in close agreement. The results obtained in this research would help to predict the good absorption of the studied compounds and can be selected as lead molecules for the synthesis of CNS active agents because of their lipophilic nature especially compound VII.

  9. Cu-catalyzed aerobic oxidative cyclizations of 3-N-hydroxyamino-1,2-propadienes with alcohols, thiols, and amines to form α-O-, S-, and N-substituted 4-methylquinoline derivatives.

    Science.gov (United States)

    Sharma, Pankaj; Liu, Rai-Shung

    2015-03-16

    A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Multiple Regression and Mediator Variables can be used to Avoid Double Counting when Economic Values are Derived using Stochastic Herd Simulation

    DEFF Research Database (Denmark)

    Østergaard, Søren; Ettema, Jehan Frans; Hjortø, Line

    Multiple regression and model building with mediator variables was addressed to avoid double counting when economic values are estimated from data simulated with herd simulation modeling (using the SimHerd model). The simulated incidence of metritis was analyzed statistically as the independent v...... in multiparous cows. The merit of using this approach was demonstrated since the economic value of metritis was estimated to be 81% higher when no mediator variables were included in the multiple regression analysis......Multiple regression and model building with mediator variables was addressed to avoid double counting when economic values are estimated from data simulated with herd simulation modeling (using the SimHerd model). The simulated incidence of metritis was analyzed statistically as the independent...... variable, while using the traits representing the direct effects of metritis on yield, fertility and occurrence of other diseases as mediator variables. The economic value of metritis was estimated to be €78 per 100 cow-years for each 1% increase of metritis in the period of 1-100 days in milk...

  11. Value of tissue Doppler-derived Tei index and two-dimensional speckle tracking imaging derived longitudinal strain on predicting outcome of patients with light-chain cardiac amyloidosis.

    Science.gov (United States)

    Liu, Dan; Hu, Kai; Herrmann, Sebastian; Cikes, Maja; Ertl, Georg; Weidemann, Frank; Störk, Stefan; Nordbeck, Peter

    2017-06-01

    Prognosis of patients with light-chain cardiac amyloidosis (AL-CA) is poor. Speckle tracking imaging (STI) derived longitudinal deformation parameters and Doppler-derived left ventricular (LV) Tei index are valuable predictors of outcome in patients with AL-CA. We estimated the prognostic utility of Tei index and deformation parameters in 58 comprehensively phenotyped patients with AL-CA after a median follow-up of 365 days (quartiles 121, 365 days). The primary end point was all-cause mortality. 19 (33%) patients died during follow-up. Tei index (0.89 ± 0.29 vs. 0.61 ± 0.16, p < 0.001) and E to global early diastolic strain rate ratio (E/GLSR dias ) were higher while global longitudinal systolic strain (GLS sys ) was lower in non-survivors than in survivors (all p < 0.05). Tei index, NYHA functional class, GLS sys and E/GLSR dias were independent predictors of all-cause mortality risk, and Tei index ≥0.9 (HR 7.01, 95% CI 2.43-20.21, p < 0.001) was the best predictor of poor outcome. Combining Tei index and GLS sys yielded the best results on predicting death within 1 year (100% with Tei index ≥0.9 and GLS sys ≤13%) or survival (95% with Tei index ≤0.9 and GLS sys ≥13%). We conclude that 1-year mortality risk in AL-CA patients can be reliably predicted using Tei index or deformation parameters, with combined analysis offering best performance.

  12. FULLY AUTOMATED GIS-BASED INDIVIDUAL TREE CROWN DELINEATION BASED ON CURVATURE VALUES FROM A LIDAR DERIVED CANOPY HEIGHT MODEL IN A CONIFEROUS PLANTATION

    Directory of Open Access Journals (Sweden)

    R. J. L. Argamosa

    2016-06-01

    Full Text Available The generation of high resolution canopy height model (CHM from LiDAR makes it possible to delineate individual tree crown by means of a fully-automated method using the CHM’s curvature through its slope. The local maxima are obtained by taking the maximum raster value in a 3 m x 3 m cell. These values are assumed as tree tops and therefore considered as individual trees. Based on the assumptions, thiessen polygons were generated to serve as buffers for the canopy extent. The negative profile curvature is then measured from the slope of the CHM. The results show that the aggregated points from a negative profile curvature raster provide the most realistic crown shape. The absence of field data regarding tree crown dimensions require accurate visual assessment after the appended delineated tree crown polygon was superimposed to the hill shaded CHM.

  13. An enhanced approach for the use of satellite-derived leaf area index values in dry deposition modeling in the Athabasca oil sands region.

    Science.gov (United States)

    Davies, Mervyn; Cho, Sunny; Spink, David; Pauls, Ron; Desilets, Michael; Shen, Yan; Bajwa, Kanwardeep; Person, Reid

    2016-12-15

    In the Athabasca oil sands region (AOSR) of Northern Alberta, the dry deposition of sulphur and nitrogen compounds represents a major fraction of total (wet plus dry) deposition due to oil sands emissions. The leaf area index (LAI) is a critical parameter that affects the dry deposition of these gaseous and particulate compounds to the surrounding boreal forest canopy. For this study, LAI values based on Moderate Resolution Imaging Spectroradiometer satellite imagery were obtained and compared to ground-based measurements, and two limitations with the satellite data were identified. The satellite LAI data firstly represents one-sided LAI values that do not account for the enhanced LAI associated with needle leaf geometry, and secondly, underestimates LAI in winter-time northern latitude regions. An approach for adjusting satellite LAI values for different boreal forest cover types, as a function of time of year, was developed to produce more representative LAI values that can be used by air quality sulphur and nitrogen deposition models. The application of the approach increases the AOSR average LAI for January from 0.19 to 1.40, which represents an increase of 637%. Based on the application of the CALMET/CALPUFF model system, this increases the predicted regional average dry deposition of sulphur and nitrogen compounds for January by factors of 1.40 to 1.30, respectively. The corresponding AOSR average LAI for July increased from 2.8 to 4.0, which represents an increase of 43%. This increases the predicted regional average dry deposition of sulphur and nitrogen compounds for July by factors of 1.28 to 1.22, respectively. These findings reinforce the importance of the LAI metric for predicting the dry deposition of sulphur and nitrogen compounds. While satellite data can provide enhanced spatial and temporal resolution, adjustments are identified to overcome associated limitations. This work is considered to have application for other deposition model studies where

  14. Original and Derived Judgment

    DEFF Research Database (Denmark)

    Foss, Kirsten; Foss, Nicolai Juul; Klein, Peter G.

    2007-01-01

    Recent work links entrepreneurship to the economic theory of the firm, using the concept of entrepreneurship as judgment introduced by Frank Knight. When judgment is complementary to other assets, it makes sense for entrepreneurs to hire labour and to own assets. The entrepreneur's role, then...... to subordinates, who exercise derived judgment. We call these employees `proxy-entrepreneurs', and ask how the firm's organizational structure - its formal and informal systems of rewards and punishments, rules for settling disputes and renegotiating agreements, means of evaluating performance and so on - can...... be designed to encourage forms of proxy entrepreneurship that increase firm value while discouraging actions that destroy value. Building on key ideas from the entrepreneurship literature, Austrian economics and the economic theory of the firm, we develop a framework for analysing the trade-off between...

  15. Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

    International Nuclear Information System (INIS)

    Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D.M.; Conway, Barbara R.; Timmins, Peter

    2007-01-01

    We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2 NC(CH 3 ) 3- n (CH 2 OH) n , with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family (n=0, 1, 2), but significantly contrasting structural properties for the member with n=3. - Graphical abstract: Structural properties of a family of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine are discussed and rationalized

  16. Prognostic value of the stromal cell-derived factor 1 3'A mutation in pediatric human immunodeficiency virus type 1 infection.

    Science.gov (United States)

    Tresoldi, Eleonora; Romiti, Maria Luisa; Boniotto, Michele; Crovella, Sergio; Salvatori, Francesca; Palomba, Elvia; Pastore, Angela; Cancrini, Caterina; de Martino, Maurizio; Plebani, Anna; Castelli, Guido; Rossi, Paolo; Tovo, Pier Angelo; Amoroso, Antonio; Scarlatti, Gabriella

    2002-03-01

    A mutation of the stromal cell-derived factor 1 gene (SDF-1 3'A) was shown to protect adults exposed to human immunodeficiency virus type 1 (HIV-1) from infection and to affect HIV disease progression in adults. The presence of this mutation in HIV-1-infected Kenyan children did not predict mother-to-child virus transmission. The SDF-1 3'A polymorphism was studied in 256 HIV-1-infected, 118 HIV-1-exposed but uninfected, and 170 unexposed and uninfected children of Italian origin, and the frequency of SDF-1 3'A heterozygosity and homozygosity in each of the 3 groups was similar. Of the 256 HIV-1-infected children, 194 were regularly followed up and were assigned to groups according to disease progression. The frequency of the SDF-1 3'A allele was substantially lower among children with long-term nonprogression than among children with rapid (P =.0329) or delayed (P =.0375) progression. We show that the presence of the SDF-1 3'A gene correlates with accelerated disease progression in HIV-1-infected children born to seropositive mothers but does not protect against mother-to-child HIV-1 transmission.

  17. Poster presentations: valuing all forms of evidence.

    Science.gov (United States)

    Halligan, Phil

    2008-01-01

    This paper aims to assist readers who are considering submitting a poster presentation to a conference to appreciate their true worth and demonstrate the important contribution they can make to nursing scholarship and secondly, to provide new insights to conference reviewers who have the task of selecting appropriate contributions for conferences. The author will argue that the use of poster presentations is an ideal opportunity to disseminate research findings and clinical innovations. It offers a new, interesting, and thought-provoking perspective on poster presentations, which includes appraisal of extant literature and reflections about the significance of poster presentations to nursing scholarship. It highlights the benefits of submitting a poster presentation and concludes with some key points for conference reviewers to consider when deciding to select the suitability of abstracts for poster presentations or concurrent sessions.

  18. Associated factors for higher lead and cadmium blood levels, and reference values derived from general population of São Paulo, Brazil

    International Nuclear Information System (INIS)

    Kira, Carmen Silvia; Sakuma, Alice Momoyo; De Capitani, Eduardo Mello; Umbelino de Freitas, Clarice; Cardoso, Maria Regina Alves; Gouveia, Nelson

    2016-01-01

    Human activities are associated with emissions of various metals into the environment, among which the heavy metals lead and cadmium stand out, as they pose a risk to human life even at low concentrations. Thus, accurate knowledge of the levels of these metals exhibited by the overall population, including children, is important. The aim of this study was to estimate the concentrations of lead and cadmium in the blood of adults, adolescents and children residing in the city of São Paulo, assess factors associated with higher lead and cadmium blood levels, and to establish reference values for this population. The study sample consisted of 669 adults over 20 years old, 264 adolescents aged 12 to 19 years old and 391 children under 11 years old from both genders. The samples were collected at the end of 2007 and during 2008 in different city zones. Higher blood lead concentration was significantly associated with gender, smoking, offal intake, area of residence and age. The blood cadmium concentration was significantly associated with gender, smoking, consumption of distilled beverages and age. The reference values of lead and cadmium established for adults above 20 years old were 33 μg/L and 0.6 μg/L, respectively, for adolescents (12 to 19 years old) were 31 μg/L and 0.6 μg/L, respectively and for children under 11 years old were 29 μg/L and 0.2 μg/L, respectively. The results of this study indicate that the exposure levels of the investigated population to lead and cadmium are low. - Highlights: • The exposure of population of São Paulo city to lead and cadmium is low. • Pb level was associated with gender, smoking, offal intake, area of residence, age. • Cd level was associated with gender, smoking, distilled beverages, age. • RV for Pb in blood for children and adolescents were 29 and 31 μg/L, respectively. • RV for Cd in blood for children and adolescents were 0.2 and 0.6 μg/L, respectively.

  19. Associated factors for higher lead and cadmium blood levels, and reference values derived from general population of São Paulo, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Kira, Carmen Silvia, E-mail: carmkira@ial.sp.gov.br [Instituto Adolfo Lutz, Centro de Materiais de Referência, Av. Dr. Arnaldo, 355, São Paulo, SP CEP 01246-000 (Brazil); Sakuma, Alice Momoyo [Instituto Adolfo Lutz, Centro de Materiais de Referência, Av. Dr. Arnaldo, 355, São Paulo, SP CEP 01246-000 (Brazil); De Capitani, Eduardo Mello [Universidade Estadual de Campinas — UNICAMP, Faculdade de Ciências Médicas, Departamento de Clínica Médica, Centro de Controle de Intoxicações (Brazil); Umbelino de Freitas, Clarice [Secretaria de Estado da Saúde/SP, Coordenadoria de Controle de Doenças (Brazil); Cardoso, Maria Regina Alves [Universidade de São Paulo, Faculdade de Saúde Pública, Departamento de Epidemiologia (Brazil); Gouveia, Nelson [Universidade de São Paulo — USP, Faculdade de Medicina, Departamento de Medicina Preventiva (Brazil)

    2016-02-01

    Human activities are associated with emissions of various metals into the environment, among which the heavy metals lead and cadmium stand out, as they pose a risk to human life even at low concentrations. Thus, accurate knowledge of the levels of these metals exhibited by the overall population, including children, is important. The aim of this study was to estimate the concentrations of lead and cadmium in the blood of adults, adolescents and children residing in the city of São Paulo, assess factors associated with higher lead and cadmium blood levels, and to establish reference values for this population. The study sample consisted of 669 adults over 20 years old, 264 adolescents aged 12 to 19 years old and 391 children under 11 years old from both genders. The samples were collected at the end of 2007 and during 2008 in different city zones. Higher blood lead concentration was significantly associated with gender, smoking, offal intake, area of residence and age. The blood cadmium concentration was significantly associated with gender, smoking, consumption of distilled beverages and age. The reference values of lead and cadmium established for adults above 20 years old were 33 μg/L and 0.6 μg/L, respectively, for adolescents (12 to 19 years old) were 31 μg/L and 0.6 μg/L, respectively and for children under 11 years old were 29 μg/L and 0.2 μg/L, respectively. The results of this study indicate that the exposure levels of the investigated population to lead and cadmium are low. - Highlights: • The exposure of population of São Paulo city to lead and cadmium is low. • Pb level was associated with gender, smoking, offal intake, area of residence, age. • Cd level was associated with gender, smoking, distilled beverages, age. • RV for Pb in blood for children and adolescents were 29 and 31 μg/L, respectively. • RV for Cd in blood for children and adolescents were 0.2 and 0.6 μg/L, respectively.

  20. Can the Discrepancy between Locally and Globally Derived Neutral Hydrogen Mass Functions be Explained by a Varying Value of M ⋆?

    Science.gov (United States)

    Minchin, Robert F.

    2017-09-01

    I investigate whether it is possible to reconcile the recent Arecibo Legacy Fast Arecibo L-band Feed Array (ALFALFA) observation that the neutral hydrogen mass function (HIMF) across different galactic densities has the same, non-flat, faint-end slope, with observations of isolated galaxies and many galaxy groups that show their HIMFs to have flat faint-end slopes. I find that a fairly simple model in which the position of the knee in the mass function of each individual group is allowed to vary is able to account for both of these observations. If this model reflects reality, the ALFALFA results point to an interesting “conspiracy” whereby the differing group HIMFs always sum up to form global HIMFs with the same faint-end slope in different environments. More generally, this result implies that global environmental HIMFs do not necessarily reflect the HIMFs in individual groups belonging to that environment and cannot be used to directly measure variations in group-specific HIMFs with environment.

  1. Can the Discrepancy between Locally and Globally Derived Neutral Hydrogen Mass Functions be Explained by a Varying Value of M {sup *}?

    Energy Technology Data Exchange (ETDEWEB)

    Minchin, Robert F., E-mail: rminchin@naic.edu [Arecibo Observatory, Universities Space Research Association, HC3 Box 53995, Arecibo, PR 00612 (United States)

    2017-09-20

    I investigate whether it is possible to reconcile the recent Arecibo Legacy Fast Arecibo L-band Feed Array (ALFALFA) observation that the neutral hydrogen mass function (HIMF) across different galactic densities has the same, non-flat, faint-end slope, with observations of isolated galaxies and many galaxy groups that show their HIMFs to have flat faint-end slopes. I find that a fairly simple model in which the position of the knee in the mass function of each individual group is allowed to vary is able to account for both of these observations. If this model reflects reality, the ALFALFA results point to an interesting “conspiracy” whereby the differing group HIMFs always sum up to form global HIMFs with the same faint-end slope in different environments. More generally, this result implies that global environmental HIMFs do not necessarily reflect the HIMFs in individual groups belonging to that environment and cannot be used to directly measure variations in group-specific HIMFs with environment.

  2. PowerForms

    DEFF Research Database (Denmark)

    Brabrand, Claus; Møller, Anders; Ricky, Mikkel

    2000-01-01

    All uses of HTML forms may benefit from validation of the specified input field values. Simple validation matches individual values against specified formats, while more advanced validation may involve interdependencies of form fields. There is currently no standard for specifying or implementing...

  3. Energy derivatives, experiences in derivative trading from the natural gas industry : back to basics

    International Nuclear Information System (INIS)

    Dittmer, G.; Coyle, T.

    1998-01-01

    Some basic facts regarding derivatives in the electric power industry were discussed based on experiences in the natural gas industry. Derivatives were described as financial instruments that have no value of their own but derive their value from other assets, such as commodities. Futures and Options are the two forms of derivatives. Electricity as a commodity was characterized, and a historical parallel was drawn between deregulation in the natural gas and electric power industry. Short term and long term factors impacting the market and market dynamics impacting derivatives were identified. The latter include: (1) volatility, (2) liquidity, (3) correlations, and (4) price discovery. In contrast to the natural gas market, the electricity market is considered as lacking liquidity and in need of moving farther along the maturity timeline. The question of natural gas/ electricity convergence was also addressed refs., tabs., figs

  4. Deriving the reference value from the circadian motor active patterns in the "non-dementia" population, compared to the "dementia" population: What is the amount of physical activity conducive to the good circadian rhythm.

    Science.gov (United States)

    Kodama, Ayuto; Kume, Yu; Tsugaruya, Megumi; Ishikawa, Takashi

    2016-01-01

    The circadian rhythm in older adults is commonly known to change with a decrease in physical activity. However, the association between circadian rhythm metrics and physical activity remains unclear. The objective of this study was to examine circadian activity patterns in older people with and without dementia and to determine the amount of physical activity conducive to a good circadian measurement. Circadian parameters were collected from 117 older community-dwelling people (66 subjects without dementia and 52 subjects with dementia); the parameters were measured continuously using actigraphy for 7 days. A receiver operating characteristic (ROC) curve was applied to determine reference values for the circadian rhythm parameters, consisting of interdaily stability (IS), intradaily variability (IV), and relative amplitude (RA), in older subjects. The ROC curve revealed reference values of 0.55 for IS, 1.10 for IV, and 0.82 for RA. In addition, as a result of the ROC curve in the moderate-to-vigorous physical Activity (MVPA) conducive to the reference value of the Non-parametric Circadian Rhythm Analysis per day, the optimal reference values were 51 minutes for IV and 55 minutes for RA. However, the IS had no classification accuracy. Our results demonstrated the reference values derived from the circadian parameters of older Japanese population with or without dementia. Also, we determined the MVPA conducive to a good circadian rest-active pattern. This reference value for physical activity conducive to a good circadian rhythm might be useful for developing a new index for health promotion in the older community-dwelling population.

  5. The Value of Value

    DEFF Research Database (Denmark)

    Sørensen, Asger

    parts of business ethics given prominence to especially one term, namely `value'. The question that interests me is the following: What does the articulation of ethics and morality in terms of values mean for ethics and morality as such. Or, to put the question in a more fashionably way: What......As a social scientist of ethics and morality, Luhmann has noticed the ethical wave that has recently swept across the western world, and states that this particular kind of wave seems to have a wavelength of about one hundred years (cf. Luhmann 1989: 9 ff.). Even though the frequency...... and the regularity of such a phenomenon is both hard to verify and, if true, difficult to explain, it seems fair to say that since the Enlightenment, an approaching fin-de-siecle has brought an increased interest in matters concerning morality and ethics.1 The present peak has in public-political discourse and some...

  6. Understanding the potential benefits of thyme and its derived products for food industry and consumer health: From extraction of value-added compounds to the evaluation of bioaccessibility, bioavailability, anti-inflammatory, and antimicrobial activities.

    Science.gov (United States)

    Lorenzo, Jose M; Mousavi Khaneghah, Amin; Gavahian, Mohsen; Marszałek, Krystian; Eş, Ismail; Munekata, Paulo E S; Ferreira, Isabel C F R; Barba, Francisco J

    2018-05-17

    Natural bioactive compounds isolated from several aromatic plants have been studied for centuries due to their unique characteristics that carry great importance in food, and pharmaceutical, and cosmetic industries. For instance, several beneficial activities have been attributed to some specific compounds found in Thymus such as anti-inflammatory, antioxidant, antimicrobial, and antiseptic properties. Moreover, these compounds are classified as Generally Recognized as Safe (GRAS) which means they can be used as an ingrident of may food producs. Conventional extraction processes of these compounds and their derived forms from thyme leaves are well established. Hoewever, they present some important drawbacks such as long extraction time, low yield, high solvent consumption and degradation thermolabile compounds. Therefore, innovative extraction techniques such as ultrasound, microwave, enzyme, ohmic and heat-assisted methods can be useful strategies to enhance the exytraction yield and to reduce processing temperature, extraction time, and energy and solvent consumption. Furthermore, bioaccessibility and bioavailability aspects of these bioactive compounds as well as their metabolic fates are crucial for developing novel functional foods. Additionally, immobilization methods to improve stability, solubility, and the overall bioavailability of these valuable compounds are necessary for their commercial applications. This review aims to give an overall perspective of innovative extraction techniques to extract the targeted compounds with anti-inflammatory and antimicrobial activities. Moreover, the bioaccessi-bility and bioavailability of these compounds before and after processing discussed. In addition, some of the most important characteristics of thyme and their derived products discussed in this paper.

  7. Equivalence, commensurability, value

    DEFF Research Database (Denmark)

    Albertsen, Niels

    2017-01-01

    Deriving value in Capital Marx uses three commensurability arguments (CA1-3). CA1 establishes equivalence in exchange as exchangeability with the same third commodity. CA2 establishes value as common denominator in commodities: embodied abstract labour. CA3 establishes value substance...... as commonality of labour: physiological labour. Tensions between these logics have permeated Marxist interpretations of value. Some have supported value as embodied labour (CA2, 3), others a monetary theory of value and value as ‘pure’ societal abstraction (ultimately CA1). They all are grounded in Marx....

  8. The effects of concentrate added to pineapple (Ananas comosus Linn. Mer.) waste silage in differing ratios to form complete diets, on digestion, excretion of urinary purine derivatives and blood metabolites in growing, male, Thai swamp buffaloes.

    Science.gov (United States)

    Jetana, T; Suthikrai, W; Usawang, S; Vongpipatana, C; Sophon, S; Liang, J B

    2009-04-01

    Four, male, growing Thai swamp buffaloes (197 +/- 5.3 kg and all 1 year old) were used to evaluate the effects of concentrate added to pineapple waste silage in differing ratios, to form a complete diet, studying in vivo digestion, the rate of passage, microbial protein synthesis and blood metabolites. Animals were fed ad libitum with 4 diets, using four combinations of pineapple waste silage (P) and concentrate (C), in the proportions (on a dry matter basis) of 0.8:0.2 (P80:C20), 0.6:0.4 (P60:C40), 0.4:0.6 (P40:C60) and 0.2:0.8 (P20:C80). The results showed that the intakes of dry matter (DM), organic matter (OM), nitrogen (N), the N-balance, urinary purine derivatives (PD) excretion, the ratios of allantoin to creatinine (CR), PD to CR, the plasma urea-N (PUN) and insulin increased in the animals, but the intake of neutral detergent fiber (NDF), the coefficient of whole tract, apparent digestibility of NDF, the transit time (TT) and the mean retention time (TMRT) decreased, when the proportion of concentrate in the diet increased. This study indicated that the proportion of P40:C60 in the diet produced the best efficiency of urinary PD excretion (mmol) per digestible OM intake (kg DOMI).

  9. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  10. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  11. Value encounters - Modeling and analyzing co-creation of value

    NARCIS (Netherlands)

    Weigand, H.; Godart, C.; Gronau, N.; Sharma, S.; Canals, G.

    2009-01-01

    Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value

  12. Value encounters : Modelling and analyzing co-creation of value

    NARCIS (Netherlands)

    Weigand, H.; Jayasinghe Arachchig, J.

    2009-01-01

    Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value

  13. TECHNO-ECONOMIC ANALYSIS IN A SUPERSTRUCTURE OF A MULTIPLE FLOORS BUILDING (THREE, FIVE, SEVEN AND NINE FLOORS IN REINFORCED CONCRETE AND RIBBED SLABS WITH RECTANGULAR FORM AND DIFFERENT COMPRESSIVE STRENGTH VALUES

    Directory of Open Access Journals (Sweden)

    E. F. S. Moraes

    2017-12-01

    Full Text Available Adapting “fck" values between 25 MPa to 40 MPa, in three, five, seven and nine floor buildings for places under winds of up to 30 m/s, this research calculated the cost and inputs of these variations. The results have as a goal to improve multiple floors building design in reinforced concrete and ribbed slabs, and to contribute to economic gains. The results were analysed in five stages. (I Architectural design definition in a 1:1 proportion, (II structural conception, (III structural design, (IV cost composition and (V techno economic parameters. To sum up, the results showed that lower “fck” has presented more viability to few flooring. In addition, with the increase of floors also the “fck” raised, causing higher cost around 16,54% in the beams and 11,16% in the slabs. Moreover, the pillars showed a saving of 28,89% in the cost, ranging by up to 11,93% in the average thickness and 6,29% in the concrete form expenditure per m³. Therefore, the research showed an economic achievement of 5,14% in the overall cost between the number of floor.

  14. Differentiation of mass-forming focal pancreatitis from pancreatic ductal adenocarcinoma: value of characterizing dynamic enhancement patterns on contrast-enhanced MR images by adding signal intensity color mapping

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mimi [Hanyang University College of Medicine, Department of Radiology, Hanyang Medical Center, Seoul (Korea, Republic of); Jang, Kyung Mi [Sungkyunkwan University School of Medicine, Department of Radiology, Samsung Medical Center, Seoul (Korea, Republic of); Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea, Republic of); Kim, Jae-Hun; Jeong, Woo Kyoung; Kim, Seong Hyun; Kang, Tae Wook; Kim, Young Kon; Cha, Dong Ik [Sungkyunkwan University School of Medicine, Department of Radiology, Samsung Medical Center, Seoul (Korea, Republic of); Kim, Kyunga [Samsung Medical Center, Biostatics and Clinical Epidemiology Center, Research Institute for Future Medicine, Seoul (Korea, Republic of)

    2017-04-15

    To evaluate the value of dynamic enhancement patterns on contrast-enhanced MR images by adding signal intensity colour mapping (SICM) to differentiate mass-forming focal pancreatitis (MFFP) from pancreatic ductal adenocarcinoma (PDAC). Forty-one clinicopathologically proven MFFPs and 144 surgically confirmed PDACs were enrolled. Laboratory and MR imaging parameters were used to differentiate MFFP from PDAC. In particular, enhancement patterns on MR images adding SICM were evaluated. By using classification tree analysis (CTA), we determined the predictors for the differentiation of MFFP from PDAC. In the CTA, with all parameters except enhancement pattern on SICM images, ductal obstruction grade and T1 hypointensity grade of the pancreatic lesion were the first and second splitting predictor for differentiation of MFFP from PDAC, in order. By adding an enhancement pattern on the SICM images to CTA, the enhancement pattern was the only splitting predictor to differentiate MFFP from PDAC. The CTA model including enhancement pattern on SICM images has sensitivity of 78.0 %, specificity of 99.3 %, and accuracy of 94.6 % for differentiating MFFP from PDAC. The characterization of enhancement pattern for pancreatic lesions on contrast-enhanced MR images adding SICM would be helpful to differentiate MFFP from PDAC. (orig.)

  15. Accounting for Fair Value Headging

    OpenAIRE

    Botea Elena Mihaela; Stanila Oana Georgiana; SSahlian Daniela Nicoleta

    2010-01-01

    The derivatives appearance was generated by the discovery of new ways to limit and manage current activity risks. Derivatives couldn’t hedge any type of risk. Derivative operations can be used to hedge: interest rate risks, foreign currency exchange rate risks, credit risks. Derivatives used to hedge these risks can be handled to cover fair value exposure, cash flow exposure and exposure to changes in the value of a net investment in a foreign operation. The hedging accounting roll is to prot...

  16. A 'simple' hybrid model for power derivatives

    International Nuclear Information System (INIS)

    Lyle, Matthew R.; Elliott, Robert J.

    2009-01-01

    This paper presents a method for valuing power derivatives using a supply-demand approach. Our method extends work in the field by incorporating randomness into the base load portion of the supply stack function and equating it with a noisy demand process. We obtain closed form solutions for European option prices written on average spot prices considering two different supply models: a mean-reverting model and a Markov chain model. The results are extensions of the classic Black-Scholes equation. The model provides a relatively simple approach to describe the complicated price behaviour observed in electricity spot markets and also allows for computationally efficient derivatives pricing. (author)

  17. The COS Method : An Efficient Fourier Method for Pricing Financial Derivatives

    NARCIS (Netherlands)

    Fang, F.

    2010-01-01

    When valuing and risk-managing financial derivatives, practitioners demand fast and accurate prices and sensitivities. Aside from the pricing of non-standard exotic financial derivatives, so-called plain vanilla European options form the basis for the calibration of financial models. As any pricing

  18. Taxation of Derivatives

    DEFF Research Database (Denmark)

    Dyppel, Katja Joo

    2013-01-01

    The main objective for this thesis is to analyse and systematise the Danish legislation on taxation of derivatives. According to financial terminology, a derivative is a financial instrument. Its value is derived from changes in the value of one or more underlying assets.The most common derivatives...... in the Danish tax legislation. However, contracts known as forwards (terminskontrakter) and options (aftaler om køberetter og salgsretter) are generally included in the term financials contracts covered by the Danish Act on Taxation of Gains and Losses on Claims and Debt. The main part of the analysis deals...... with the scope of sections 29-33 of the Danish Act on Taxation of Gains and Losses on Claims and Debt and the tax consequences for the covered financial contracts. In the analysis of taxation of derivatives, the fundamental issues of qualification and tax treatment of the instruments are dealt with....

  19. A comparison of observed extreme water levels at the German Bight elaborated through an extreme value analysis (EVA) with extremes derived from a regionally coupled ocean-atmospheric climate model (MPI-OM)

    Science.gov (United States)

    Möller, Jens; Heinrich, Hartmut

    2017-04-01

    As a consequence of climate change atmospheric and oceanographic extremes and their potential impacts on coastal regions are of growing concern for governmental authorities responsible for the transportation infrastructure. Highest risks for shipping as well as for rail and road traffic originate from combined effects of extremes of storm surges and heavy rainfall which sometimes lead to insufficient dewatering of inland waterways. The German Ministry of Transport and digital Infrastructure therefore has tasked its Network of Experts to investigate the possible evolutions of extreme threats for low lands and especially for Kiel Canal, which is an important shortcut for shipping between the North and Baltic Seas. In this study we present results of a comparison of an Extreme Value Analysis (EVA) carried out on gauge observations and values derived from a coupled Regional Ocean-Atmosphere Climate Model (MPI-OM). High water levels at the coasts of the North and Baltic Seas are one of the most important hazards which increase the risk of flooding of the low-lying land and prevents such areas from an adequate dewatering. In this study changes in the intensity (magnitude of the extremes) and duration of extreme water levels (above a selected threshold) are investigated for several gauge stations with data partly reaching back to 1843. Different methods are used for the extreme value statistics, (1) a stationary general Pareto distribution (GPD) model as well as (2) an instationary statistical model for better reproduction of the impact of climate change. Most gauge stations show an increase of the mean water level of about 1-2 mm/year, with a stronger increase of the highest water levels and a decrease (or lower increase) of the lowest water levels. Also, the duration of possible dewatering time intervals for the Kiel-Canal was analysed. The results for the historical gauge station observations are compared to the statistics of modelled water levels from the coupled

  20. Credit derivatives and risk management

    OpenAIRE

    Michael S. Gibson

    2007-01-01

    The striking growth of credit derivatives suggests that market participants find them to be useful tools for risk management. I illustrate the value of credit derivatives with three examples. A commercial bank can use credit derivatives to manage the risk of its loan portfolio. An investment bank can use credit derivatives to manage the risks it incurs when underwriting securities. An investor, such as an insurance company, asset manager, or hedge fund, can use credit derivatives to align its...

  1. 18 CFR 367.2440 - Account 244, Derivative instrument liabilities.

    Science.gov (United States)

    2010-04-01

    ..., Derivative instrument liabilities. This account must include the change in the fair value of all derivative instrument liabilities not designated as cash flow or fair value hedges. Account 426.5, Other deductions... the fair value of the derivative instrument. ...

  2. Public Values

    DEFF Research Database (Denmark)

    Beck Jørgensen, Torben; Rutgers, Mark R.

    2015-01-01

    administration is approached in terms of processes guided or restricted by public values and as public value creating: public management and public policy-making are both concerned with establishing, following and realizing public values. To study public values a broad perspective is needed. The article suggest......This article provides the introduction to a symposium on contemporary public values research. It is argued that the contribution to this symposium represent a Public Values Perspective, distinct from other specific lines of research that also use public value as a core concept. Public...... a research agenda for this encompasing kind of public values research. Finally the contributions to the symposium are introduced....

  3. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  4. Frequency of and Prognostic Significance of Cardiac Involvement at Presentation in Hereditary Transthyretin-Derived Amyloidosis and the Value of N-Terminal Pro-B-Type Natriuretic Peptide.

    Science.gov (United States)

    Klaassen, Sebastiaan H C; Tromp, Jasper; Nienhuis, Hans L A; van der Meer, Peter; van den Berg, Maarten P; Blokzijl, Hans; van Veldhuisen, Dirk J; Hazenberg, Bouke P C

    2018-01-01

    The aim of this study is to assess the prevalence of cardiac involvement in hereditary transthyretin-derived (ATTRm) amyloidosis at the time of diagnosis and to determine the diagnostic and clinical value of N-terminal pro-B-type natriuretic peptide (NT-proBNP). The University Medical Center Groningen is the national center of expertise for amyloidosis. All consecutive patients between 1994 and 2016 with ATTRm amyloidosis were followed prospectively. Baseline was set at the time of the first positive biopsy. All patients underwent a standard cardiac and neurologic work-up. Cardiac involvement was defined by otherwise unexplained left and/or right ventricular wall hypertrophy on cardiac ultrasound and/or advanced conduction disturbances. Seventy-seven patients had ATTRm amyloidosis and were included in the study. The TTR V30M mutation was present in 30 patients (39%). In both the V30M and the non-V30M groups, the neurologic presentation dominated (77% vs 51%), whereas cardiac presentation was infrequent (7% vs 15%). Clinical work-up showed that cardiac involvement was present at baseline in 51% of all patients irrespective of genotype and was associated with increased overall mortality (hazard ratio 5.95, 95% confidence interval 2.12 to 16.7), independent from clinical confounders. At a cutoff level of 125 ng/L, NT-proBNP had a sensitivity of 92% for establishing cardiac involvement. In conclusion, irrespective of the frequent noncardiac presentation of ATTRm amyloidosis, cardiac involvement is already present at diagnosis in half of the patients and is associated with increased mortality. NT-proBNP is a useful marker to determine cardiac involvement in this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Financial Derivatives

    OpenAIRE

    Janečková, Alena

    2011-01-01

    1 Abstract/ Financial derivatives The purpose of this thesis is to provide an introduction to financial derivatives which has been, from the legal perspective, described in a not satisfactory manner as quite little literature that can be found about this topic. The main objectives of this thesis are to define the term "financial derivatives" and its particular types and to analyse legal nature of these financial instruments. The last objective is to try to draft future law regulation of finan...

  6. Effects of variable transformations on errors in FORM results

    International Nuclear Information System (INIS)

    Qin Quan; Lin Daojin; Mei Gang; Chen Hao

    2006-01-01

    On the basis of studies on second partial derivatives of the variable transformation functions for nine different non-normal variables the paper comprehensively discusses the effects of the transformation on FORM results and shows that senses and values of the errors in FORM results depend on distributions of the basic variables, whether resistances or actions basic variables represent, and the design point locations in the standard normal space. The transformations of the exponential or Gamma resistance variables can generate +24% errors in the FORM failure probability, and the transformation of Frechet action variables could generate -31% errors

  7. Automorphic Forms

    DEFF Research Database (Denmark)

    von Essen, Flemming Brændgaard

    The Taylor coefficients of weight k Eisenstein series wrt. SL2(Z) are related to values of L-functions for Hecke characters in the point k. We show some congruences for Taylor coefficients of Eisenstein series of weight 4 and 6 and use them to establish congruences for values of L......-functions for Hecke characters in the points 4 and 6. It is well known, that all zeros of the Eisenstein series Ek wrt. SL2(Z) in the standard fundamental domain has modulus 1. We show that this is also true for #n Ek, where # is a certain differential operator. We then proceed to study logarithms of multiplier...

  8. 13C and 15N CP/MAS, 1H-15N SCT CP/MAS and FTIR spectroscopy as tools for qualitative detection of the presence of zwitterionic and non-ionic forms of ansa-macrolide 3-formylrifamycin SV and its derivatives in solid state.

    Science.gov (United States)

    Przybylski, Piotr; Pyta, Krystian; Klich, Katarzyna; Schilf, Wojciech; Kamieński, Bohdan

    2014-01-01

    (13)C, (15)N CP/MAS, including (1)H-(13)C and (1)H-(15)N short contact time CP/MAS experiments, and FTIR methods were applied for detailed structural characterization of ansa-macrolides as 3-formylrifamycin SV (1) and its derivatives (2-6) in crystal and in powder forms. Although HPLC chromatograms for 2/CH3 OH and 2/CH3 CCl3 were the same for rifampicin crystals dissolved in respective solvents, the UV-vis data recorded for them were different in 300-375 nm region. Detailed solid state (13)C and (15)N CP/MAS NMR and FTIR studies revealed that rifampicin (2), in contrast to 3-formylrifamycin SV (1) and its amino derivatives (3-6), can occur in pure non-ionic or zwitterionic forms in crystal and in pure these forms or a mixture of them in a powder. Multinuclear CP/MAS and FTIR studies demonstrated also that 3-6 derivatives were present exclusively in pure zwitterionic forms, both in powder and in crystal. On the basis of the solid state NMR and FTIR studies, two conformers of 3-formylrifamycin SV were detected in powder form due to the different orientations of carbonyl group of amide moiety. The PM6 molecular modeling at the semi-empirical level of theory, allowed visualization the most energetically favorable non-ionic and zwitterionic forms of 1-6 antibiotics, strongly stabilized via intramolecular H-bonds. FTIR studies indicated that the originally adopted forms of these type antibiotics in crystal or in powder are stable in standard laboratory conditions in time. The results presented point to the fact that because of a possible presence of two forms of rifampicin (compound 2), quantification of the content of this antibiotic in relevant pharmaceuticals needs caution. Copyright © 2013 John Wiley & Sons, Ltd.

  9. Values Research

    Science.gov (United States)

    2009-10-01

    that individualistic employees in individualistic organizations and collectivistic employees in collectivistic organizations show greater job...with Parsons’ causal assumption, in the nineties values were recognized on top of the cultural control –values control norms which in turn control...determines intention which may end in behavior. 7 Defining Human Values Cross- cultural theories on values emerged in the 80s developed by three main

  10. Effect of different form of mineral nitrogen fertilizer and organic fertilization with compost on yield and quality of various field-grown vegetable crops (radish, carrot, spinach and tubers celery). Quality investigation through electrochemical method and the determination of p-value

    International Nuclear Information System (INIS)

    El-Sherbiny, M.

    1998-10-01

    This study was conducted to determine the effect of nitrogen form (calcium-nitrate, nitramoncal, ammonsulfate and urea) and the compost fertilization on yield and quality of different vegetable crops, which were grown under field condition at the same nitrogen fertilizer levels. In addition to evaluate the yield, the nitrate contents and p-value have been tested to determine the quality. Following results have been found: yield: the mineral nitrogen form had no significant effect on yield by radish, carrot, and celery. Spinach is positive responded by a different form of nitrogen fertilizer. The same yield results were nearly obtained by the use of compost, compared to another nitrogen fertilizer. Nitrate content: the nitrate content is investigated in edible plant parts. The nitrogen forms have been effected nitrate contents on researched vegetable crops. Generally, the minimum nitrate content is found in control variant and by use of compost, and too by ammonsulfate or urea fertilizer. The maximum nitrate content is reached by use of calcium-nitrate and nitramoncal fertilizer. Spinach leaves had less nitrate contents than stalks. P-value: results of examination shows a major relation between nitrogen fertilizer form and p-value. With the exception of carrot, had compost and control variants of radish, spinach and celery the highest significant p-value in comparison with another nitrogen fertilizer. The lowest p-value is obtained by application of calcium-nitrate and nitramoncal fertilizer, also for a better quality. (author)

  11. WEATHER INDEX- THE BASIS OF WEATHER DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Botos Horia Mircea

    2011-07-01

    Full Text Available This paper approaches the subject of Weather Derivatives, more exactly their basic element the weather index. The weather index has two forms, the Heating Degree Day (HDD and the Cooling Degree Day (CDD. We will try to explain their origin, use and the relationship between the two forms of the index. In our research we started from the analysis of the weather derivatives and what they are based on. After finding out about weather index, we were interested in understanding exactly how they work and how they influence the value of the contract. On the national level the research in the field is scares, but foreign materials available. The study for this paper was based firstly on reading about Weather Derivative, and then going in the meteorogical field and determining the way by which the indices were determined. After this, we went to the field with interest in the indices, such as the energy and gas industries, and figured out how they determined the weather index. For the examples we obtained data from the weather index database, and calculated the value for the period. The study is made on a period of five years, in 8 cities of the European Union. The result of this research is that we can now understand better the importance of the way the indices work and how they influence the value of the Weather Derivatives. This research has an implication on the field of insurance, because of the fact that weather derivative are at the convergence point of the stock markets and the insurance market. The originality of the paper comes from the personal touch given to the theoretical aspect and through the analysis of the HDD and CDD index in order to show their general behaviour and relationship.

  12. Researching Values in Education.

    Science.gov (United States)

    Halliday, John

    2002-01-01

    Considers methodological issues that arise when values form the main focus of empirical educational research. Includes discussion of the idea that social science, in general, and educational research, in particular, are forms of moral inquiry. Outlines a methodology of educational research, drawing from work by Imre Lakatos, Alasdair MacIntyre,…

  13. Two Forms of Philosophical Argument or Critique

    Science.gov (United States)

    Marshall, James D.

    2004-01-01

    In this paper the author looks at two forms of philosophical argument or critique. These are derived by himself from the work of the late Kantian scholar, Stephan Korner who, in his book "What is Philosophy?" (1969), draws a number of distinctions between different forms of "philosophical" argument or critique. The two forms of derived argument,…

  14. Value Priorities and Behavior: Applying a Theory of Integrated Value Systems

    Directory of Open Access Journals (Sweden)

    Shalom Schwartz

    2016-02-01

    Full Text Available A major goal of research on values has been to relate individual differences in value priorities to differences in attitudes, behavior and background variables. Past research most commonly adopted one of two approaches. Much research has selected a few single target values whose priorities were postulated to associate with the attitude, behavior and background variable of interest and then examined empirical relationships. Other research has been more exploratory.It has related lists of values to various other variables and then discussed the significant associations that emerge. The focus on relationships with single values make both these approaches insatisfying. My work has sought to overcome those approaches.It has derived what may be a nearly comprehensive set of different motivational types of values, recognized across cultures. Each value type is represented by a number of single values that are combined to form relatively reliable indexes of values priorities. Value systems can be treated as integrated wholes in their relations with behaviors and, thereby, encourages researches to abandom the prevailing single-values approaches. 

  15. Optimal Mortgage Refinancing: A Closed Form Solution.

    Science.gov (United States)

    Agarwal, Sumit; Driscoll, John C; Laibson, David I

    2013-06-01

    We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least [Formula: see text] In this formula W (.) is the Lambert W -function, [Formula: see text] ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods.

  16. Optimal Mortgage Refinancing: A Closed Form Solution

    Science.gov (United States)

    Agarwal, Sumit; Driscoll, John C.; Laibson, David I.

    2013-01-01

    We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least 1ψ[ϕ+W(−exp(−ϕ))]. In this formula W(.) is the Lambert W-function, ψ=2(ρ+λ)σ,ϕ=1+ψ(ρ+λ)κ∕M(1−τ), ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods. PMID:25843977

  17. Recovery actinide values

    International Nuclear Information System (INIS)

    Horwitz, E.P.; Delphin, W.H.; Mason, G.W.

    1979-01-01

    A process is described for partitioning and recovering actinide values from acidic waste solutions resulting from reprocessing of irradiated nuclear fuels by adding hydroxylammonium nitrate and hydrazine to the waste solution to adjust the valence of the neptunium and plutonium values in the solution to the +4 oxidation state, thus forming a feed solution and contacting the feed solution with an extractant of di-hexoxyethyl phosphoric acid in an organic diluent whereby the actinide values, most of the rare earth values and some fission product values are taken up by the extractant. Separation is achieved by contacting the loaded extractant with two aqueous strip solutions, a nitric acid solution to selectively strip the americium, curium and rare earth values and an oxalate solution of tetramethylammonium hydrogen oxalate and oxalic acid or trimethylammonium hydrogen oxalate to selectively strip the neptunium, plutonium and fission product values. Uranium values remain in the extractant and may be recovered with a phosphoric acid strip. The neptunium and plutonium values are recovered from the oxalate by adding sufficient nitric acid to destroy the complexing ability of the oxalate, forming a second feed, and contacting the second feed with a second extractant of tricaprylmethylammonium nitrate in an inert diluent whereby the neptunium and plutonium values are selectively extracted. The values are recovered from the extractant with formic acid. (author)

  18. "Value"ing Children Differently? Migrant Children in Education

    Science.gov (United States)

    Devine, Dympna

    2013-01-01

    This paper considers dilemmas around "value" and the "valuing" of children and childhood(s) in schools. I argue that in neo-liberal contexts, processes of children's identity making become aligned with the idea of the corporate citizen--value and worth derived from the capacity to produce, excel, self-regulate as well as…

  19. Default values

    International Nuclear Information System (INIS)

    1987-08-01

    In making calculations for the purposes of radiation protection, numerical values for parameters used in the calculations are selected. In some cases, data directly applicable to the set of conditions for which the calculations are to be made are unavailable. Therefore, the selection of the values for these parameters may be based on more general data available from the literature or other sources. These values may be referred to as 'default values', that is, values used in default of those based on directly applicable data. The following policy will be applied by Atomic Energy Control Board (AECB) staff in reviewing the radiation protection aspects of submissions associated with licensing, in participating with other organizations in the development of codes and standards, and in any other work which relies to some extent on using default values

  20. Measurement of the pion form factor in the time-like region for q2 values between 0.1 (GeV/c)2 and 0.18 (GeV/c)2

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.

    1984-01-01

    The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)

  1. Polyphony and verb forms

    Directory of Open Access Journals (Sweden)

    Jelena Rajić

    2012-12-01

    Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.

  2. Deep Value

    DEFF Research Database (Denmark)

    Asness, Clifford S.; Liew, John M.; Pedersen, Lasse Heje

    premium. Following these episodes, the value strategy has (1) high average returns; (2) low market betas, but high betas to a global value factor; (3) deteriorating fundamentals; (4) negative news sentiment; (5) selling pressure; (6) increased limits to arbitrage; and (7) increased arbitrage activity...

  3. Forestland values.

    Science.gov (United States)

    John H. Beuter; Ralph J. Alig

    2004-01-01

    This issue of the journal of Forestry is devoted to articles about forestland values. Viewed broadly, natural resources and humans are our two basic resources. An expression of the importance of land as a foundation for forest ecosystems is forestland value. Our attitudes about land and the forest ecosystems that they support have changed considerably in recent years....

  4. "Domestic Violence" and Different Forms of Conciliation

    Directory of Open Access Journals (Sweden)

    Guita Grin Debert

    2008-01-01

    Full Text Available Alternative conflict resolution based on conciliation have been identified as a possible response to problems of access to courts deriving from the numbers, costs and length of proceedings in the Brazilian's judicial system. This paper focuses on these alternative forms of justice, regarding domestic violence. Using ethnographic studies of Women's Police Stations and at Small Claim Courts, we argue that conciliation can be very different in these two institutions of the judicial system. The contrasts between moral values and the symbols used in different forms by these two institutions offer elements that can further be our understanding of the context in which Maria da Penha Law was created on August 17th of 2006. With the promulgation of this law, cases of domestic violence against women were excluded from Small Claim Courts in Brazil.

  5. Derivative chameleons

    International Nuclear Information System (INIS)

    Noller, Johannes

    2012-01-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂ μ φ∂ μ φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂ μ φ∂ μ φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type

  6. Derivative chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Noller, Johannes, E-mail: johannes.noller08@imperial.ac.uk [Theoretical Physics, Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2BZ (United Kingdom)

    2012-07-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂{sub μ}φ∂{sup μ}φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂{sub μ}φ∂{sup μ}φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type.

  7. The Value of Value Sets

    DEFF Research Database (Denmark)

    Sløk-Madsen, Stefan Kirkegaard; Christensen, Jesper

    The world over classrooms in business schools are being taught that corporate values can impact performance. The argument is typically that culture matter more than strategy plans and culture can be influenced and indeed changed by a shared corporate value set. While the claim seems intuitively a...... a unique contribution to the effects of investment in shared company values, and to whether agent rationality can be fundamentally changed by committed organizational efforts....

  8. Form of prior for constrained thermodynamic processes with uncertainty

    Science.gov (United States)

    Aneja, Preety; Johal, Ramandeep S.

    2015-05-01

    We consider the quasi-static thermodynamic processes with constraints, but with additional uncertainty about the control parameters. Motivated by inductive reasoning, we assign prior distribution that provides a rational guess about likely values of the uncertain parameters. The priors are derived explicitly for both the entropy-conserving and the energy-conserving processes. The proposed form is useful when the constraint equation cannot be treated analytically. The inference is performed using spin-1/2 systems as models for heat reservoirs. Analytical results are derived in the high-temperatures limit. An agreement beyond linear response is found between the estimates of thermal quantities and their optimal values obtained from extremum principles. We also seek an intuitive interpretation for the prior and the estimated value of temperature obtained therefrom. We find that the prior over temperature becomes uniform over the quantity kept conserved in the process.

  9. Electricity derivatives

    CERN Document Server

    Aïd, René

    2015-01-01

    Offering a concise but complete survey of the common features of the microstructure of electricity markets, this book describes the state of the art in the different proposed electricity price models for pricing derivatives and in the numerical methods used to price and hedge the most prominent derivatives in electricity markets, namely power plants and swings. The mathematical content of the book has intentionally been made light in order to concentrate on the main subject matter, avoiding fastidious computations. Wherever possible, the models are illustrated by diagrams. The book should allow prospective researchers in the field of electricity derivatives to focus on the actual difficulties associated with the subject. It should also offer a brief but exhaustive overview of the latest techniques used by financial engineers in energy utilities and energy trading desks.

  10. The development of the architectural form of a tower derived from a traditional and philosophical symbol, realized by solutions of high-class technologies. The case of the Bitexco Financial Tower

    Science.gov (United States)

    Van Khai, Tran

    2018-03-01

    The Bitexco Financial Tower, majestically standing tall in the heart of Ho Chi Minh City, Vietnam, rejects the box-shaped, abstract forms of modernism, incorporating an innovative idea of contemporary architecture. Based on the inspiration from the Bitexco Group, a renowned architect designedthe tower that became an iconic landmark of the city in the form of a lotus bud, one of the most iconic symbols of Vietnamese culture since ancient times. High class structural system solution designed by top international professional teams enable the building to rise high with its graceful, statuesque design of the lotus flower shape. CNNGo recently ranked the Bitexco Financial Tower fifth in their listing of the world's 20 most-iconic skyscrapers.

  11. Value Representations

    DEFF Research Database (Denmark)

    Rasmussen, Majken Kirkegaard; Petersen, Marianne Graves

    2011-01-01

    Stereotypic presumptions about gender affect the design process, both in relation to how users are understood and how products are designed. As a way to decrease the influence of stereotypic presumptions in design process, we propose not to disregard the aspect of gender in the design process......, as the perspective brings valuable insights on different approaches to technology, but instead to view gender through a value lens. Contributing to this perspective, we have developed Value Representations as a design-oriented instrument for staging a reflective dialogue with users. Value Representations...

  12. Good neighbourly relations or family values?

    DEFF Research Database (Denmark)

    McQuaid, Sara Dybris

    Good neighbourly relations or family values? Assessing British Irish cooperation in a comparative perspective 1990-2010. This paper forms part of a larger comparative study, which charts the past 20 years development of British Irish cooperation and Nordic cooperation. It examines specifically...... associations lies in the legitimacy they derive from a historical narrative of a common social, cultural, economic and political fabric. Importantly, however, the impetus behind the cooperation is constructed from both associative and ascriptive components of collective identity; cooperation is motivated...

  13. On isochronous derivatives of the first and second order in space dynamics tasks

    Science.gov (United States)

    Bakshiyan, B. T.; Sukhanov, A. A.

    1979-01-01

    The first and second isochronous derivatives are calculated from the vector of state of dynamic system using its initial value. Use is made of the method of finding a fundamental solution of conjugate variational equations. This solution and the corresponding universal relationship for isochronous derivatives are found for the two-body problem in a form which is simple and suitable for computer programming. The form of these relationships was obtained for motion which differs from parabolic motion. Formulas are given for isochronous derivatives using the gravitational parameter in the two-body problem.

  14. Comparative study of the interaction of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP) in its free base and Fe derivative form with oligo(dA.dT)15 and oligo(dG.dC)15.

    Science.gov (United States)

    Bathaie, S Zahra; Ajloo, Davood; Daraie, Marzieh; Ghadamgahi, Maryam

    2015-01-01

    Interaction between a cationic porphyrin and its ferric derivative with oligo(dA.dT)15 and oligo(dG.dC)15 was studied by UV-vis spectroscopy, resonance light scattering (RLS), and circular dichroism (CD) at different ionic strengths; molecular docking and molecular dynamics simulation were also used for completion. Followings are the observed changes in the spectral properties of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP), as a free-base porphyrin with no axial ligand, and its Fe derivative (FeTMAP) upon interaction with oligo(dA.dT)15 and oligo(dG.dC)15: (1) the substantial red shift and hypochromicity at the Soret maximum in the UV-vis spectra; (2) the increased RLS intensity by increasing the ionic strength; and (3) an intense bisignate excitonic CD signal. All of them are the reasons for TMAP and FeTMAP binding to oligo(dA.dT)15 and oligo(dG.dC)15 with the outside binding mode, accompanied by the self-stacking of the ligands along the oligonucleotide helix. The CD results demonstrated a drastic change from excitonic in monomeric behavior at higher ionic strengths, which indicates the groove binding of the ligands with oligonucleotides. Molecular docking also confirmed the groove binding mode of the ligands and estimated the binding constants and energies of the interactions. Their interaction trend was further confirmed by molecular dynamics technique and structure parameters obtained from simulation. It showed that TMAP reduced the number of intermolecular hydrogen bonds and increased the solvent accessible surface area in the oligonucleotide. The self-aggregation of ligands at lower concentrations was also confirmed.

  15. Unravelling Value

    DEFF Research Database (Denmark)

    Walsh, Matthew

    Paper presented in the symposium “What’s It All Worth? Material Possessions and Value in Past Societies” at 22nd Annual Meeting of the European Association of Archaeologists, Vilnius, Lithuania.......Paper presented in the symposium “What’s It All Worth? Material Possessions and Value in Past Societies” at 22nd Annual Meeting of the European Association of Archaeologists, Vilnius, Lithuania....

  16. Making Benefit Transfers Work: Deriving and Testing Principles for Value Transfers for Similar and Dissimilar Sites Using a Case Study of the Non-Market Benefits of Water Quality Improvements Across Europe

    DEFF Research Database (Denmark)

    Bateman, Ian; Brouwer, Roy; Ferreri, Silvia

    2011-01-01

    We implement a controlled, multi-site experiment to develop and test guidance principles for benefits transfers. These argue that when transferring across relatively similar sites, simple mean value transfers are to be preferred but that when sites are relatively dissimilar then value function...... transfers will yield lower errors. The paper also provides guidance on the appropriate specification of transferable value functions arguing that these should be developed from theoretical rather than ad-hoc statistical approaches. These principles are tested via a common format valuation study of water...... quality improvements across five countries. While this provides an idealised tested, results support the above principles and suggest directions for future transfer studies....

  17. Contributor Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2014-09-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  18. Contributors Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2016-06-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  19. An Exact Soultion for the Investment and Market Value of a Firm Facing Uncertainty, Adjustment Costs, and Irreversibility

    OpenAIRE

    Andrew B. Abel; Janice C. Eberly

    1993-01-01

    This paper derives closed-form solutions for the investment and market value, under uncertainty, of competitive firms with constant returns to scale production and convex costs of adjustment. Solutions are derived for the case of irreversible investment as well as for reversible investment. Optimal investment is a non-decreasing function of q, the shadow value of capital. The conditions of optimality imply that q cannot contain a bubble; thus, optimal investment depends only on fundamentals. ...

  20. Dietary Reference Values for choline

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives Dietary Reference Values (DRVs) for choline. In this Opinion, the Panel considers dietary choline including choline compounds (e.g. glycerophosphocholine, phosphocholine...

  1. Forms of global governence

    Directory of Open Access Journals (Sweden)

    Maxim V. Kharkevich

    2014-01-01

    Full Text Available Global governance as a concept defines the meaning of contemporary world politics both as a discipline and as reality. Interdependent and globalized world requires governance, and a global government has not been formed yet. The theoretical possibility of global governance without global government is proved and justified. The purpose of this article is to analytically identify possible forms of global governance. Three such forms of global governance are identified: hierarchical, market and network. In a hierarchy the governance is due to the asymmetry of power between the parties. Market control happens via anonymous pricing mechanism. Network, in contrast to the market is characterized by a closer value link between the actors, but unlike the hierarchical relationship actors are free to leave the network. Global governance takes three forms and is being implemented by different actors. To determine the most efficient form of global governance is impossible. Efficiency depends on the match between a form and an object of government. It should be noted that meta governance is likely to remain a monopoly of institutionally strong states in global governance.

  2. Diffusion from cylindrical waste forms

    International Nuclear Information System (INIS)

    Thomas, G.F.

    1985-05-01

    The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

  3. Public Value: rethinking value creation

    OpenAIRE

    Meynhardt, Timo; Gomez, Peter; Strathoff, Pepe; Hermann, Carolin

    2014-01-01

    Managers might refute public criticism of their business as an attitude of taking everything for granted in a saturated society, but ignoring Public Value aspects can threaten the success of new products and even the survival of entire firms.

  4. Standard and Null Weak Values

    OpenAIRE

    Zilberberg, Oded; Romito, Alessandro; Gefen, Yuval

    2013-01-01

    Weak value (WV) is a quantum mechanical measurement protocol, proposed by Aharonov, Albert, and Vaidman. It consists of a weak measurement, which is weighed in, conditional on the outcome of a later, strong measurement. Here we define another two-step measurement protocol, null weak value (NVW), and point out its advantages as compared to WV. We present two alternative derivations of NWVs and compare them to the corresponding derivations of WVs.

  5. Semiclassical initial value approximation for Green's function.

    Science.gov (United States)

    Kay, Kenneth G

    2010-06-28

    A semiclassical initial value approximation is obtained for the energy-dependent Green's function. For a system with f degrees of freedom the Green's function expression has the form of a (2f-1)-dimensional integral over points on the energy surface and an integral over time along classical trajectories initiated from these points. This approximation is derived by requiring an integral ansatz for Green's function to reduce to Gutzwiller's semiclassical formula when the integrations are performed by the stationary phase method. A simpler approximation is also derived involving only an (f-1)-dimensional integral over momentum variables on a Poincare surface and an integral over time. The relationship between the present expressions and an earlier initial value approximation for energy eigenfunctions is explored. Numerical tests for two-dimensional systems indicate that good accuracy can be obtained from the initial value Green's function for calculations of autocorrelation spectra and time-independent wave functions. The relative advantages of initial value approximations for the energy-dependent Green's function and the time-dependent propagator are discussed.

  6. Changes in numbers and types of mast cell colony-forming cells in the peritoneal cavity of mice after injection of distilled water: evidence that mast cells suppress differentiation of bone marrow-derived precursors

    International Nuclear Information System (INIS)

    Kanakura, Y.; Kuriu, A.; Waki, N.; Nakano, T.; Asai, H.; Yonezawa, T.; Kitamura, Y.

    1988-01-01

    Two different types of cells in the peritoneal cavity of mice produce mast cell colonies in methylcellulose. Large mast cell colonies are produced by bone marrow-derived precursors resembling lymphoid cells by light microscopy (L-CFU-Mast), whereas medium and small mast cell colonies are produced by morphologically identifiable mast cells (M-CFU-Mast and S-CFU-Mast, respectively). In the present study we eradicated peritoneal mast cells by intraperitoneal (IP) injection of distilled water. The regeneration process was investigated to clarify the relationship between L-CFU-Mast, M-CFU-Mast, and S-CFU-Mast. After injection of distilled water, M-CFU-Mast and S-CFU-Mast disappeared, but L-CFU-Mast increased, and then M-CFU-Mast and S-CFU-Mast appeared, suggesting the presence of a hierarchic relationship. When purified peritoneal mast cells were injected two days after the water injection, the L-CFU-Mast did not increase. In the peritoneal cavity of WBB6F1-+/+ mice that had been lethally irradiated and rescued by bone marrow cells of C57BL/6-bgJ/bgJ (beige, Chediak-Higashi syndrome) mice, L-CFU-Mast were of bgJ/bgJ type, but M-CFU-Mast and S-CFU-Mast were of +/+ type. The injection of distilled water to the radiation chimeras resulted in the development of bgJ/bgJ-type M-CFU-Mast and then S-CFU-Mast. The presence of mast cells appeared to suppress the recruitment of L-CFU-Mast from the bloodstream and to inhibit the differentiation of L-CFU-Mast to M-CFU-Mast

  7. Generic clearance values

    International Nuclear Information System (INIS)

    Bossio, M.C.; Muniz, C.C.

    2009-01-01

    This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document 'Safety Reports Series Nr 44' of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (author)

  8. Generic Clearance Values

    International Nuclear Information System (INIS)

    Bossio, M.C.; Muniz, C.C.

    2010-01-01

    This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on the one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document Safety Reports Series 44 of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (authors) [es

  9. Small cell lymphocytic variant of marginal zone lymphoma: A distinct form of marginal zone lymphoma derived from naïve B cells as a cutaneous counterpart to the naïve marginal zone lymphoma of splenic origin.

    Science.gov (United States)

    Magro, Cynthia M; Olson, Luke C

    2018-02-21

    Primary cutaneous marginal zone lymphoma most commonly represents an indolent form of cutaneous B cell lymphoma. However, epidermotropic marginal zone lymphoma, blastic marginal zone lymphoma and B cell dominant variants without isotype switching can be associated with extracutaneous dissemination. The presumptive cell of origin is a post germinal center B cell with plasmacytic features. In the extracutaneous setting, however, a naïve B cell origin has been proposed for a subset of marginal zone lymphomas, notably splenic marginal zone lymphoma. The author encountered 11 cases of atypical lymphocytic infiltration of the skin primarily occurring in older individuals with an upper arm and head and neck localization; there was a reproducible pattern of diffuse and nodular infiltration by small monomorphic-appearing B cells. Phenotypically, the infiltrate was one predominated by B cells exhibiting CD23 and IgD positivity without immunoreactivity for CD38 and there were either no plasma cells or only a few without light chain restriction. In cases presenting with a solitary lesion complete excision and/or radiation led to successful disease remission in all cases without recurrence or metastatic disease. Of three cases with multiple initial lesions, evidence of extracutaneous disease was seen in two cases and recurrence occurred in one case. No patients have died of lymphoma. Longer term follows up and additional cases are needed to determine if this subset of marginal zone lymphoma is associated with a worse prognosis. Copyright © 2018. Published by Elsevier Inc.

  10. A general method for the derivation of the functional forms of the effective energy terms in coarse-grained energy functions of polymers. II. Backbone-local potentials of coarse-grained O 1 →4 -bonded polyglucose chains

    Science.gov (United States)

    Lubecka, Emilia A.; Liwo, Adam

    2017-09-01

    Based on the theory of the construction of coarse-grained force fields for polymer chains described in our recent work [A. K. Sieradzan et al., J. Chem. Phys. 146, 124106 (2017)], in this work effective coarse-grained potentials, to be used in the SUGRES-1P model of polysaccharides that is being developed in our laboratory, have been determined for the O ⋯O ⋯O virtual-bond angles (θ ) and for the dihedral angles for rotation about the O ⋯O virtual bonds (γ ) of 1 → 4 -linked glucosyl polysaccharides, for all possible combinations of [α ,β ]-[d,l]-glucose. The potentials of mean force corresponding to the virtual-bond angles and the virtual-bond dihedral angles were calculated from the free-energy surfaces of [α ,β ]-[d,l]-glucose pairs, determined by umbrella-sampling molecular-dynamics simulations with the AMBER12 force field, or combinations of the surfaces of two pairs sharing the overlapping residue, respectively, by integrating the respective Boltzmann factor over the dihedral angles λ for the rotation of the sugar units about the O ⋯O virtual bonds. Analytical expressions were subsequently fitted to the potentials of mean force. The virtual-bond-torsional potentials depend on both virtual-bond-dihedral angles and virtual-bond angles. The virtual-bond-angle potentials contain a single minimum at about θ =14 0° for all pairs except β -d-[α ,β ] -l-glucose, where the global minimum is shifted to θ =150° and a secondary minimum appears at θ =90°. The torsional potentials favor small negative γ angles for the α -d-glucose and extended negative angles γ for the β -d-glucose chains, as observed in the experimental structures of starch and cellulose, respectively. It was also demonstrated that the approximate expression derived based on Kubo's cluster-cumulant theory, whose coefficients depend on the identity of the disugar units comprising a trisugar unit that defines a torsional potential, fits simultaneously all

  11. Add Value

    DEFF Research Database (Denmark)

    Kobbelgaard, Cecilie Elisabeth

    2016-01-01

    "Add Value – kend din kunde" er et brætspil, som giver både offentlige og private virksomheder unikke muligheder for at forbedre deres service overfor kunderne. Spillet giver, på en alternativ og handlingsorienteret måde, mulighed for at blive skarpere på kundeoplevelsen – hvor er der værdi...... at hente, og hvor kan der spares på tid og ressourcer? Dette samtidig med, at kunderne får den oplevelse og service, de forventer. Når I spiller "Add Value – kend din kunde" sættes der fokus på Jeres kundeservice ud fra kundens perspektiv, og det er i alle Jeres kontaktflader med kunden. Lige fra kunden...

  12. Conservation Value

    OpenAIRE

    Tisdell, Clement A.

    2010-01-01

    This paper outlines the significance of the concept of conservation value and discusses ways in which it is determined paying attention to views stemming from utilitarian ethics and from deontological ethics. The importance of user costs in relation to economic decisions about the conservation and use of natural resources is emphasised. Particular attention is given to competing views about the importance of conserving natural resources in order to achieve economic sustainability. This then l...

  13. A Nova Forma de Pensar o Jogo, Seus Valores e Suas Possibilidades The one form of imagine the game, your values and your possibilities El un nova forma de figurase el juego, su valores y su azares

    Directory of Open Access Journals (Sweden)

    2007-09-01

    Full Text Available Os videogames são aparelhos de entretenimento, que servem apenas como descanso para os trabalhadores (ou estudantes e incutem valores da sociedade de consumo a estes, ou eles possuem verdadeira característica do jogo como utensílios de lazer educativo, que possam ajudar o indivíduo a se desenvolver? Buscamos neste ensaio dialogar com estas duas linhas de pensamento que respondem a esta pergunta, procurando perceber se estas se complementam ou se excluem mutuamente. Acreditamos que elas não se excluem, desde que bem trabalhadas e contextualizadas, podendo contribuir para o desenvolvimento do indivíduo, em uma educação para o lazer. PALAVRAS-CHAVE: jogo eletrônico – lazer – entretenimento. Are videogames entertaining devices that serve only for workers and students’ relaxation while inputting consumer society values in them? Or do they present real game characteristics such as educational and leisure instruments that can help to develop an individual? In this essay we have tried to communicate with the two lines of thinking that answer this question, in an attempt to understand if these two lines are complimentary or mutually exclusive. We believe they do not exclude one another, provided that they are well explored and contextualized, which could contribute to the development of an individual on an educational process that focuses on leisure. KEYWORDS: electronic games – leisure – entertainment. Los videojuegos son aparatos de entretenimiento que actúan apenas como forma de descanso para los trabajadores (o estudiantes y transmiten valores característicos de la sociedad de consumo, o poseen verdadera característica de juego como implemento del ocio educativo, que pueda ayudar al individuo a desarrollarse? Buscamos en este ensayo discutir estas dos líneas de pensamiento que responden a esta pregunta, procurando analizar si estas se complementan o se excluyen mutuamente. Creemos que ellas no se excluyen, desde que sean

  14. Finite volume form factors in the presence of integrable defects

    International Nuclear Information System (INIS)

    Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.

    2014-01-01

    We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee–Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee–Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found

  15. Disjoint forms in graphical user interfaces

    NARCIS (Netherlands)

    Evers, S.; Achten, P.M.; Plasmeijer, M.J.; Loidl, H.W.

    Forms are parts of a graphical user interface (GUI) that show a set of values and allow the user to update them. The declarative form construction library FunctionalForms is extended with disjoint form combinators to capture some common patterns in which the form structure expresses a choice. We

  16. SPONSORING, BRAND VALUE AND SOCIAL MEDIA

    Directory of Open Access Journals (Sweden)

    Alexander Zauner

    2012-10-01

    Full Text Available The increasing involvement of individuals in social media over the past decade has enabled firms to pursue new avenues in communication and sponsoring activities. Besides general research on either social media or sponsoring, questions regarding the consequences of a joint activity (sponsoring activities in social media remain unexplored. Hence, the present study analyses whether the perceived image of the brand and the celebrity endorser credibility of a top sports team influence the perceived brand value of the sponsoring firm in a social media setting. Moreover, these effects are compared between existing customers and non-customers of the sponsoring firm. Interestingly, perceived celebrity endorser credibility plays no role in forming brand value perceptions in the case of the existing customers. Implications for marketing theory and practice are derived.

  17. Value of travel time savings

    DEFF Research Database (Denmark)

    Le Masurier, P.; Polak, J.; Pawlak, Janet

    2015-01-01

    A team of specialist market researchers and Value of Time experts comprising members from SYSTRA, Imperial College London and the Technical University of Denmark has conducted a formal audit and peer review of research undertaken by Arup/ITS Leeds/Accent to derive Value of Travel Time Savings...... Preference (RP) models that were used to derive final Values of Travel Time (VTT). This report contains the findings of our audit and peer review of the procedures adopted by the research team during data collection of the three surveys (SP, RP and Employers Surveys); a peer review of the reported approach...

  18. Densified waste form and method for forming

    Science.gov (United States)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    2015-08-25

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  19. Development trends of the international derivatives market

    OpenAIRE

    Motorniuk, U.; Terebukh, M.; Kharchuk, V.

    2016-01-01

    The factors forming international derivatives market trends are researched in this article. The history of the formation of the global derivatives market was analyzed, in particular, events which have led to the growth of the derivatives market. Global derivatives market has revealed major changes in its trends and witnessed the gradual transformation of its structure, observed in recent years. Global derivatives market has revealed major changes in its trends and witnessed the gradual transf...

  20. Amphiphilic chitosan derivatives as carrier agents for rotenone

    Science.gov (United States)

    Kamari, Azlan; Aljafree, Nurul Farhana Ahmad

    2017-08-01

    In the present study, the feasibility of amphiphilic chitosan derivatives, namely oleoyl carboxymethyl chitosan (OCMCs), N,N-dimethylhexadecyl carboxymethyl chitosan (DCMCs) and deoxycholic acid carboxymethyl chitosan (DACMCs) as carrier agents for rotenone in water-insoluble pesticide formulations was investigated. Fourier Transform Infrared (FTIR) Spectrometer, CHN-O Elemental Analyser (CHN-O) and Transmission Electron Microscope (TEM) were used to characterise amphiphilic chitosan derivatives. The critical micelle concentration (CMC) of amphiphilic chitosan derivatives was determined using a Fluorescence Spectrometer. A High Performance Liquid Chromatography (HPLC) was used to determine the ability of OCMCs, DCMCs and DACMCs to load and release rotenone in an in vitro system. Based on TEM analysis, results have shown that amphiphilic chitosan derivatives formed self-assembly and exhibited spherical shape. The CMC values determined for OCMCs, DCMCs and DACMCs were 0.093, 0.098 and 0.468 mg/mL, respectively. The encapsulation efficiency (EE) values for the materials were more than 97.0%, meanwhile the loading capacity (LC) values were greater than 0.90%. OCMCs, DCMCs and DACMCs micelles exhibited an excellent ability to control the release of rotenone, of which 90.0% of rotenone was released within 40 to 52 h. In conclusion, OCMCs, DCMCs and DACMCs possess several key features to act as effective carrier agents for rotenone. Overall, amphiphilic chitosan derivatives produced in this study were successfully increased the solubility of rotenone by 49.0 times higher than free rotenone.

  1. Customer Value Controlling ¨C Combining Different Value Perspectives

    OpenAIRE

    Andreas Kramer; Thomas Burgartz

    2015-01-01

    The article begins by presenting a model for the structuring of customer data which can be used to demonstrate the value of data in different forms of aggregation. Since Customer Value plays a crucial role in this model the term is examined more closely. As part of a value-based customer relationship management critical parameters are customer benefits and customer profitability. Both perspectives are included in the term Customer Value. A segmentation approach is shown which integrates the k...

  2. Valuing hope.

    Science.gov (United States)

    McMillan, John; Walker, Simon; Hope, Tony

    2014-01-01

    This article argues that hope is of value in clinical ethics and that it can be important for clinicians to be sensitive to both the risks of false hope and the importance of retaining hope. However, this sensitivity requires an understanding of the complexity of hope and how it bears on different aspects of a well-functioning doctor-patient relationship. We discuss hopefulness and distinguish it, from three different kinds of hope, or 'hopes for', and then relate these distinctions back to differing accounts of autonomy. This analysis matters because it shows how an overly narrow view of the ethical obligations of a clinician to their patient, and autonomy, might lead to scenarios where patients regret the choices they make.

  3. Left-sided cardiac chamber evaluation using single-phase mid-diastolic coronary computed tomography angiography: derivation of normal values and comparison with conventional end-diastolic and end-systolic phases

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Jonathan R. [Technion-Israel Institute of Technology, Haifa (Israel); Abadi, Sobhi [Rambam Health Care Campus, Medical Imaging Department, Haifa (Israel); Solomonica, Amir [Rambam Health Care Campus, Cardiology Department, Haifa (Israel); Mutlak, Diab; Aronson, Doron; Agmon, Yoram; Lessick, Jonathan [Rambam Health Care Campus, Cardiology Department, Haifa (Israel); Technion-Israel Institute of Technology, Haifa (Israel)

    2016-10-15

    With increasing use of prospective scanning techniques for cardiac computed tomography (CT), meaningful evaluation of chamber volumes is no longer possible due to lack of normal values. We aimed to define normal values for mid-diastolic (MD) chamber volumes and to determine their significance in comparison to maximum volumes. Normal ranges at MD for left ventricular (LV) volume and mass and left atrial (LA) volume were determined from 101 normal controls. Thereafter, 109 consecutive CT scans, as well as 21 post-myocardial infarction patients, were analysed to determine the relationship between MD and maximum volumes. MD volumes correlated closely with maximal volumes (r = 0.99) for both LV and LA, and could estimate maximum volumes accurately. LV mass, measured at ED or MD, were very similar (r = 0.99). Abnormal MD volumes had excellent sensitivity and specificity to detect chamber enlargement based on maximal volumes (LV 86 %, 100 %, respectively; LA 100 %, 92 %, respectively). A single MD phase can identify patients with cardiomegaly or LV hypertrophy with a high degree of accuracy and MD volumes can give an accurate estimate of maximum LV and LA volumes. circle Traditionally, helical cardiac CT provided clinically important information from chamber volume analysis. (orig.)

  4. Synthesis and Determination of pKa Values of Some New 3,4-Disubstituted-4,5-Dihydro-1H-1,2,4-triazol-5-one Derivatives in Non-aqueous Solvents

    Directory of Open Access Journals (Sweden)

    Mustafa Özdemir

    2004-03-01

    Full Text Available 3-Alkyl(Aryl-4-amino-4,5-dihydro-1H-1,2,4-triazol-5-ones (2 reacted with 2-furoyl chloride and thiophene-2-carbonyl chloride to afford the corresponding 3- alkyl(aryl-4-(2-furoylamino-4,5-dihydro-1H-1,2,4-triazol-5-ones (3 and 3-alkyl(aryl- 4-(2-thienylcarbonylamino-4,5-dihydro-1H-1,2,4-triazol-5-ones (4, respectively. The new compounds synthesized were characterized by using IR, 1H-NMR, 13C-NMR and UV spectral data together with elemental analysis. In addition, to investigate the effects of solvents and molecular structure upon acidity, compounds 3 and 4 were titrated potentiometrically with tetrabutylammonium hydroxide in four non-aqueous solvents (isopropyl alcohol, tert-butyl alcohol, N,N-dimethylformamide and acetonitrile. The half-neutralization potential values and the corresponding pKa values were determined for all cases.

  5. Fair Value or Market Value?

    Directory of Open Access Journals (Sweden)

    Bogdan Cosmin Gomoi

    2014-12-01

    Full Text Available When taking into consideration the issue of defining the “fair value” concept, those less experimented in the area often fall in the “price trap”, which is considered as an equivalent of the fair value of financial structures. This valuation basis appears as a consequence of the trial to provide an “accurate image” by the financial statements and, also, as an opportunity for the premises offered by the activity continuing principle. The specialized literature generates ample controversies regarding the “fair value” concept and the “market value” concept. The paper aims to debate this issue, taking into account various opinions.

  6. Valuing vaccination.

    Science.gov (United States)

    Bärnighausen, Till; Bloom, David E; Cafiero-Fonseca, Elizabeth T; O'Brien, Jennifer Carroll

    2014-08-26

    Vaccination has led to remarkable health gains over the last century. However, large coverage gaps remain, which will require significant financial resources and political will to address. In recent years, a compelling line of inquiry has established the economic benefits of health, at both the individual and aggregate levels. Most existing economic evaluations of particular health interventions fail to account for this new research, leading to potentially sizable undervaluation of those interventions. In line with this new research, we set forth a framework for conceptualizing the full benefits of vaccination, including avoided medical care costs, outcome-related productivity gains, behavior-related productivity gains, community health externalities, community economic externalities, and the value of risk reduction and pure health gains. We also review literature highlighting the magnitude of these sources of benefit for different vaccinations. Finally, we outline the steps that need to be taken to implement a broad-approach economic evaluation and discuss the implications of this work for research, policy, and resource allocation for vaccine development and delivery.

  7. Radiological protection optimization using derivatives

    International Nuclear Information System (INIS)

    Freitas Acosta Perez, C. de; Sordi, G.M.A.A.

    2006-01-01

    The aim of this paper is to provide a different approach related to the integral cost-benefit and extended cost-benefit analysis used in the decision-aiding techniques. In the ICRP publication 55 the annual protection cost is envisaged as a set of points, each of them representing an option, linked by a straight line. The detriment cost function is considered a linear function whose angular coefficient is determined by the alpha value. In this paper the uranium mine example considered in the ICRP publication 55 was used. But the potential curve was introduced both in the integral cost benefit analysis and in the extended cost-benefit analysis, which the individual dose distribution attribute is added. The result was obtained using derivatives. The detriment cost, Y, is not necessary because the alpha value is known. The Y derivative dS/dY is the alpha value itself and so, the attention is directed to the derivative -dX/dS on the points that, along with the alpha value, present the optimum option. The results makes clear that the prevailing factor in the optimum option selection is the alpha value imputed, and those a single alpha value, as suggested now, probably as little efficiency on the optimization process. Obtaining a curve for the alpha value and using the derivative technique introduced in this paper, the analytical solution is more convenient and reliable compared to the one used now. (authors)

  8. New Forms of E-Business Based Value Creation?

    DEFF Research Database (Denmark)

    Henten, Anders; Skouby, Knud Erik

    It is two years ago since the burst of the dotcom bubble. The so-called new economy is in shambles. There is, however, nothing new in such manic and steep up- and down-turns in the economy. The tulip mania in the Netherlands in 1630s is an early example and the South American mining industry...

  9. Characterization of chars form biomass-derived materials: pectin chars

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, R.K.; Wooten, J.B.; Baliga, V.L.; Hajaligol, M.R. [Philip Morris USA, Richmond, VA (United States). Research Center

    2001-10-09

    The effect of pyrolysis conditions on the yield and composition of char from pectin was studied. The volatile product was analyzed by gas chromatography/mass spectrometry (GC/MS). The solid product, i.e. char, was characterised by solid-state {sup 13}C nuclear magnetic resonance (NMR) and Fourier-transform infrared (FTIR) spectrsocopy. The char was also analysed for its elemental composition and surface area. The surface morphology of the char was studied by scanning electron microscopy (SEM). The results were compared to those from chlorogenic acid (CA). For both pectin and CA, the char yield decreased with increasing temperature before levelling-off at ca.20% of the starting substrate in non-oxidative runs. In oxidative runs, the char yields from both substrates became negligible at 550{degree}C. NMR analysis indicated that the aromatic character of char increased as the pyrolysis temperature increased. The oxygen functionality was progressively lost and the resonance bands corresponding to carbonyl groups mostly disappeared above 350{degree}C. FTIR analysis also suggested the loss of hydroxyl and carbonyl groups from chars at high temperatures. The H/C and O/C ratios of chars decreased continuously with increasing temperature. The oxidative chars showed characteristics essentially similar to those of the non-oxidative chars. The surface area of char was negligible at low temperatures, but increased dramatically to a maximum of 70 m{sup 2}g{sup -1} at 450{degree}C before decreasing at 500{degree}C. SEM analysis indicated that the pyrolysis of pectin occurred via softening and melting of the substrate followed by bubble formation. At high temperatures, surface etching followed by the appearance of crystal

  10. Human Capital-Intensive Firms and Symbolic Value Creation

    Directory of Open Access Journals (Sweden)

    Cezanne Cécile

    2014-06-01

    Full Text Available The aim of this paper is to study the process of symbolic value creation of human capital-intensive firms. Human capital is a critical resource for firms’ activities. Nevertheless, this dimension is often obscured by industrial economists. In the light of critical resource theory, we analyze how taking into account the inalienable and inimitable nature of specific human capital entails a reconsideration of the role and boundaries of the firm. We show that the firm seeks to coordinate the specialization of its key partners within the frame of its economic boundaries to ensure the long-term optimization of its potential of value. Therefore, the value of the firm depends on all the resources that the firm coordinates. Then we focus on the way HCIF can create different values. We suggest that the firm builds its competitive advantage on different forms of values, in particular the symbolic value incorporated in human capital. Finally, on the basis of these considerations, we identify the wealth included in the critical resources of the firm and to bring to light the process of symbolic value creation associated with it. We suggest that the firm is the value creating entity and the customer both recognizes and derives the value created from whatever it is that the firm provides. We propose a definition of this value and a schema of its creation process based on management works attempts. We conclude by proposing paths of research that could fruitfully be explored to further develop this new subject.

  11. Designing neural networks that process mean values of random variables

    International Nuclear Information System (INIS)

    Barber, Michael J.; Clark, John W.

    2014-01-01

    We develop a class of neural networks derived from probabilistic models posed in the form of Bayesian networks. Making biologically and technically plausible assumptions about the nature of the probabilistic models to be represented in the networks, we derive neural networks exhibiting standard dynamics that require no training to determine the synaptic weights, that perform accurate calculation of the mean values of the relevant random variables, that can pool multiple sources of evidence, and that deal appropriately with ambivalent, inconsistent, or contradictory evidence. - Highlights: • High-level neural computations are specified by Bayesian belief networks of random variables. • Probability densities of random variables are encoded in activities of populations of neurons. • Top-down algorithm generates specific neural network implementation of given computation. • Resulting “neural belief networks” process mean values of random variables. • Such networks pool multiple sources of evidence and deal properly with inconsistent evidence

  12. Designing neural networks that process mean values of random variables

    Energy Technology Data Exchange (ETDEWEB)

    Barber, Michael J. [AIT Austrian Institute of Technology, Innovation Systems Department, 1220 Vienna (Austria); Clark, John W. [Department of Physics and McDonnell Center for the Space Sciences, Washington University, St. Louis, MO 63130 (United States); Centro de Ciências Matemáticas, Universidade de Madeira, 9000-390 Funchal (Portugal)

    2014-06-13

    We develop a class of neural networks derived from probabilistic models posed in the form of Bayesian networks. Making biologically and technically plausible assumptions about the nature of the probabilistic models to be represented in the networks, we derive neural networks exhibiting standard dynamics that require no training to determine the synaptic weights, that perform accurate calculation of the mean values of the relevant random variables, that can pool multiple sources of evidence, and that deal appropriately with ambivalent, inconsistent, or contradictory evidence. - Highlights: • High-level neural computations are specified by Bayesian belief networks of random variables. • Probability densities of random variables are encoded in activities of populations of neurons. • Top-down algorithm generates specific neural network implementation of given computation. • Resulting “neural belief networks” process mean values of random variables. • Such networks pool multiple sources of evidence and deal properly with inconsistent evidence.

  13. Derivatives Trading and Negative Voting

    OpenAIRE

    Spamann, Holger

    2012-01-01

    This paper exposits a model of parallel trading of corporate securities (shares, bonds) and derivatives in which a large trader can sometimes profitably acquire securities with their corporate control rights for the sole purpose of reducing the corporations value and gaining on a net short position created through off-setting derivatives. At other times, the large trader profitably takes a net long position. The large trader requires no private information beyond its own trades. The problem i...

  14. On heterotic vacua with fermionic expectation values

    Energy Technology Data Exchange (ETDEWEB)

    Minasian, Ruben [Institut de Physique Theorique, Universite Paris Saclay, CEA, CNRS, Gif-sur-Yvette (France); Petrini, Michela [Sorbonne Universites, CNRS, LPTHE, UPMC Paris 06, UMR 7589, Paris (France); Svanes, Eirik Eik [Sorbonne Universites, CNRS, LPTHE, UPMC Paris 06, UMR 7589, Paris (France); Sorbonne Universites, Institut Lagrange de Paris, Paris (France)

    2017-03-15

    We study heterotic backgrounds with non-trivial H-flux and non-vanishing expectation values of fermionic bilinears, often referred to as gaugino condensates. The gaugini appear in the low energy action via the gauge-invariant three-form bilinear Σ{sub MNP} = tr anti χΓ{sub MNP}χ. For Calabi-Yau compactifications to four dimensions, the gaugino condensate corresponds to an internal three-form Σ{sub mnp} that must be a singlet of the holonomy group. This condition does not hold anymore when an internal H-flux is turned on and O(α{sup '}) effects are included. In this paper we study flux compactifications to three and four-dimensions on G-structure manifolds. We derive the generic conditions for supersymmetric solutions. We use integrability conditions and Lichnerowicz type arguments to derive a set of constraints whose solution, together with supersymmetry, is sufficient for finding backgrounds with gaugino condensate. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  15. Densities, form factors, transitions and multipole moments in the s-d shell, with the Skyrme force

    International Nuclear Information System (INIS)

    Oliveira, D.R. de; Mizrahi, S.S.

    1977-09-01

    The nuclear densities, radii, multipole moments, form-factors and transition probabilities obtained for the A = 4n type of nuclei in the s-d shell are reported, using the Hartree-Fock wave functions calculated with the Skyrme force. Experimental data and theoretical values derived by others are shown for comparison [pt

  16. Feasibility of estimating generalized extreme-value distribution of floods

    International Nuclear Information System (INIS)

    Ferreira de Queiroz, Manoel Moises

    2004-01-01

    Flood frequency analysis by generalized extreme-value probability distribution (GEV) has found increased application in recent years, given its flexibility in dealing with the three asymptotic forms of extreme distribution derived from different initial probability distributions. Estimation of higher quantiles of floods is usually accomplished by extrapolating one of the three inverse forms of GEV distribution fitted to the experimental data for return periods much higher than those actually observed. This paper studies the feasibility of fitting GEV distribution by moments of linear combinations of higher order statistics (LH moments) using synthetic annual flood series with varying characteristics and lengths. As the hydrologic events in nature such as daily discharge occur with finite values, their annual maximums are expected to follow the asymptotic form of the limited GEV distribution. Synthetic annual flood series were thus obtained from the stochastic sequences of 365 daily discharges generated by Monte Carlo simulation on the basis of limited probability distribution underlying the limited GEV distribution. The results show that parameter estimation by LH moments of this distribution, fitted to annual flood samples of less than 100-year length derived from initial limited distribution, may indicate any form of extreme-value distribution, not just the limited form as expected, and with large uncertainty in fitted parameters. A frequency analysis, on the basis of GEV distribution and LH moments, of annual flood series of lengths varying between 13 and 73 years observed at 88 gauge stations on Parana River in Brazil, indicated all the three forms of GEV distribution.(Author)

  17. 18 CFR 367.1750 - Account 175, Derivative instrument assets.

    Science.gov (United States)

    2010-04-01

    ... the corresponding amount of the change in the fair value of the derivative instrument. ... instrument assets. This account must include the amounts paid for derivative instruments, and the change in the fair value of all derivative instrument assets not designated as cash flow or fair value hedges...

  18. Recurrence relations for the Epstein-Hubbell integral and its generalized forms

    International Nuclear Information System (INIS)

    Tezcan, Cevdet

    2005-01-01

    The generalized Epstein-Hubbell integral was recently considered by Lopez and Ferreira (IMA J. Appl. Math. 67 (2002) 301) for values of the variable k close to its upper limit k=1. Here different forms of the generalized Epstein-Hubbell integral Λ (λ,γ,μ) (α,β) (ρ,δ,k) proposed by Kalla and Tuan (Comput. Math. Appl. 32 (1996) 49) are considered for values of the variable k=1. The numerical values of S μ , R μ and P μ at k=1 are calculated by using the derived recurrence relations and are listed in tables

  19. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  20. The integral form of supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, L. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy); Catenacci, R. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); Gruppo Nazionale di Fisica Matematica, INdAM,P.le Aldo Moro 5, 00185 Roma (Italy); Grassi, P.A. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy)

    2016-10-11

    By using integral forms we derive the superspace action of D=3,N=1 supergravity as an integral on a supermanifold. The construction is based on target space picture changing operators, here playing the rôle of Poincaré duals to the lower-dimensional spacetime surfaces embedded into the supermanifold. We show how the group geometrical action based on the group manifold approach interpolates between the superspace and the component supergravity actions, thus providing another proof of their equivalence.

  1. The value of service reliability

    OpenAIRE

    Benezech , Vincent; Coulombel , Nicolas

    2013-01-01

    International audience; This paper studies the impact of service frequency and reliability on the choice of departure time and the travel cost of transit users. When the user has (α, β, γ) scheduling preferences, we show that the optimal head start decreases with service reliability, as expected. It does not necessarily decrease with service frequency, however. We derive the value of service headway (VoSH) and the value of service reliability (VoSR), which measure the marginal effect on the e...

  2. ARCHITECTURAL CONCEPTS FOR VALUE CHAINS

    OpenAIRE

    A.C. Janse van Rensburg

    2012-01-01

    ENGLISH ABSTRACT:The Porter Value Chain has been widely adopted by the business community as a mechanism to understand and comprehend complexity in business environments, with the ultimate goal of structuring the business to maximize its competitive advantage. Implementing the Value Chain is not easy: a number of organizations can testify to their failure to derive any benefits at all from this concept. To overcome this problem, an approach is presented to assist the organization in ...

  3. Forest ecosystem services: Cultural values

    Science.gov (United States)

    Melissa M. Kreye; Damian C. Adams; Ramesh Ghimire; Wayde Morse; Taylor Stein; J. M. Bowker

    2017-01-01

    How we define “culture” and societal well-being related to culture depends heavily on who is looking at it, but culture can be generally described as “the customs and beliefs of a particular group of people that are used to express their collectively held values” (Soulbury Commission 2012). In the context of forests, culturally derived norms, beliefs, and values help...

  4. Carnitine derivatives: clinical usefulness.

    Science.gov (United States)

    Malaguarnera, Mariano

    2012-03-01

    Carnitine and its derivatives are natural substances involved in both carbohydrate and lipid metabolism. This review summarizes the recent progress in the field in relation to the molecular mechanisms. The pool of different carnitine derivatives is formed by acetyl-L-carnitine (ALC), propionyl-L-carnitine (PLC), and isovaleryl-carnitine. ALC may have a preferential effect on the brain tissue. ALC represents a compound of great interest for its wide clinical application in various neurological disorders: it may be of benefit in treating Alzheimer's dementia, depression in the elderly, HIV infection, chronic fatigue syndrome, peripheral neuropathies, ischemia and reperfusion of the brain, and cognitive impairment associated with various conditions. PLC has been demonstrated to replenish the intermediates of the tricarboxylic acid cycle by the propionyl-CoA moiety, a greater affinity for the sarcolemmal carrier, peripheral vasodilator activity, a greater positive inotropism, and more rapid entry into myocytes. Most studies of the therapeutic use of PLC are focused on the prevention and treatment of ischemic heart disease, congestive heart failure, hypertrophic heart disease, and peripheral arterial disease. ALC and PLC are considered well tolerated without significant side-effects. A number of therapeutic effects possibly come from the interaction of carnitine and its derivatives with the elements of cellular membranes.

  5. On good ETOL forms

    DEFF Research Database (Denmark)

    Skyum, Sven

    1978-01-01

    This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....

  6. THE INFLUENCE OF ECONOMIC VALUE ADDED AND MARKET VALUE ADDED ON CORPORATE VALUE

    Directory of Open Access Journals (Sweden)

    Taslim F.A.

    2018-02-01

    Full Text Available This research aims to determine the influence of economic value added and market value added on corporate value of manufacturing companies on sector consumer goods industry listed in Indonesia Stock Exchanges of 2011-2014. The sample of this research was 10 manufacturing companies on sector consumer goods industry listed in Indonesia Stock Exchanges. The method used was purposive sampling technique. This research used confirmatory factor analysis to form a combined proxy of corporate value comprised price earning ratio, price to book value and Tobin's Q.

  7. Noncommutative differential forms on the kappa-deformed space

    International Nuclear Information System (INIS)

    Meljanac, Stjepan; Kresic-Juric, Sasa

    2009-01-01

    We construct a differential algebra of forms on the kappa-deformed space. For a given realization of noncommutative coordinates as formal power series in the Weyl algebra we find an infinite family of one-forms and nilpotent exterior derivatives. We derive explicit expressions for the exterior derivative and one-forms in covariant and noncovariant realizations. We also introduce higher order forms and show that the exterior derivative satisfies the graded Leibniz rule. The differential forms are generally not graded commutative, but they satisfy the graded Jacobi identity. We also consider the star-product of classical differential forms. The star-product is well defined if the commutator between the noncommutative coordinates and one-forms is closed in the space of one-forms alone. In addition, we show that in certain realizations the exterior derivative acting on the star-product satisfies the undeformed Leibniz rule.

  8. Value Creation in International Business

    DEFF Research Database (Denmark)

    The edited collection brings into focus the meanings, interpretations and the process of value creation in international business. Exploring value creation in the context of emerging and developed economies, Volume 2 takes the perspective of small and medium sized enterprises and examines various...... approaches to value creation in the process of firm internationalization. Providing theoretical and practical insights, the authors open an intellectual debate into what value is, and how it is created through the internationalization activities of firms. Value Creation in International Business...... is a pioneering two volume work intended to provoke theoretical and empirical development in International Business research. Moreover, it is intended as a bridge between concepts derived from general business firm-level research agendas such as value creation and business model, and internationalization...

  9. Deviations of the lepton mapping matrix form the harrison-perkins-scott form

    International Nuclear Information System (INIS)

    Friedberg, R.; Lee, T.D.

    2010-01-01

    We propose a simple set of hypotheses governing the deviations of the leptonic mapping matrix from the Harrison-Perkins-Scott (HPS) form. These deviations are supposed to arise entirely from a perturbation of the mass matrix in the charged lepton sector. The perturbing matrix is assumed to be purely imaginary (thus maximally T-violating) and to have a strength in energy scale no greater (but perhaps smaller) than the muon mass. As we shall show,it then follows that the absolute value of the mapping matrix elements pertaining to the tau lepton deviate by no more than O((m μ /m τ ) 2 ) ≅ 3.5 x 10 -3 from their HPS values. Assuming that(m μ /m τ ) 2 can be neglected, we derive two simple constraints on the four parameters θ12, θ23, θ31, and δ of the mapping matrix. These constraints are independent of the details of the imaginary T-violating perturbation of the charged lepton mass matrix. We also show that the e and μ parts of the mapping matrix have a definite form governed by two parameters α and β; any deviation of order m μ /m τ can be accommodated by adjusting these two parameters. (authors)

  10. Radiology's value chain.

    Science.gov (United States)

    Enzmann, Dieter R

    2012-04-01

    A diagnostic radiology value chain is constructed to define its main components, all of which are vulnerable to change, because digitization has caused disaggregation of the chain. Some components afford opportunities to improve productivity, some add value, while some face outsourcing to lower labor cost and to information technology substitutes, raising commoditization risks. Digital image information, because it can be competitive at smaller economies of scale, allows faster, differential rates of technological innovation of components, initiating a centralization-to-decentralization technology trend. Digitization, having triggered disaggregation of radiology's professional service model, may soon usher in an information business model. This means moving from a mind-set of "reading images" to an orientation of creating and organizing information for greater accuracy, faster speed, and lower cost in medical decision making. Information businesses view value chain investments differently than do small professional services. In the former model, producing a better business product will extend image interpretation beyond a radiologist's personal fund of knowledge to encompass expanding external imaging databases. A follow-on expansion with integration of image and molecular information into a report will offer new value in medical decision making. Improved interpretation plus new integration will enrich and diversify radiology's key service products, the report and consultation. A more robust, information-rich report derived from a "systems" and "computational" radiology approach will be facilitated by a transition from a professional service to an information business. Under health care reform, radiology will transition its emphasis from volume to greater value. Radiology's future brightens with the adoption of a philosophy of offering information rather than "reads" for decision making. Staunchly defending the status quo via turf wars is unlikely to constitute a

  11. Dietary reference values for riboflavin

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2017-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for riboflavin. The Panel considers that the inflection point in the urinary riboflavin excretion curve in relation to riboflavin intake...

  12. Dietary reference values for potassium

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for potassium. The Panel decides to set DRVs on the basis of the relationships between potassium intake and blood pressure and stroke...

  13. Do planets remember how they formed?

    Science.gov (United States)

    Kipping, David

    2018-01-01

    One of the most directly observable features of a transiting multiplanet system is their size-ordering when ranked in orbital separation. Kepler has revealed a rich diversity of outcomes, from perfectly ordered systems, like Kepler-80, to ostensibly disordered systems, like Kepler-20. Under the hypothesis that systems are born via preferred formation pathways, one might reasonably expect non-random size-orderings reflecting these processes. However, subsequent dynamical evolution, often chaotic and turbulent in nature, may erode this information and so here we ask - do systems remember how they formed? To address this, we devise a model to define the entropy of a planetary system's size-ordering, by first comparing differences between neighbouring planets and then extending to accommodate differences across the chain. We derive closed-form solutions for many of the microstate occupancies and provide public code with look-up tables to compute entropy for up to 10-planet systems. All three proposed entropy definitions exhibit the expected property that their credible interval increases with respect to a proxy for time. We find that the observed Kepler multis display a highly significant deficit in entropy compared to a randomly generated population. Incorporating a filter for systems deemed likely to be dynamically packed, we show that this result is robust against the possibility of missing planets too. Put together, our work establishes that Kepler systems do indeed remember something of their younger years and highlights the value of information theory for exoplanetary science.

  14. Value addition to lignocellulosics and biomass-derived sugars

    Indian Academy of Sciences (India)

    For the synthesis of important platform chemicals such as sugars (xylose and arabinose) and furans (furfural and 5-hydroxymethylfurfural (HMF)) from carbohydrates (hemicellulose and fructose) solid acid catalysts are employed. Similarly, over solid acid catalysts, conversion of lignin into aromatic monomers is performed.

  15. Value addition to lignocellulosics and biomass-derived sugars: An ...

    Indian Academy of Sciences (India)

    .59 HMF is mainly produced from fructose ... Sn–W oxide catalyst was evaluated in this reaction and it yielded 48% of ... Catalytic cracking of bio-oils is also known over. HZSM-5 ≥ 340 ...... Kim S B and Lee Y Y 1985 Biotechnol. Bioeng. Symp.

  16. How energy derivatives can add value for municipal electrical utilities

    International Nuclear Information System (INIS)

    Tamplen, B.

    1998-01-01

    The challenges that municipal electric utilities (MEUs) face in the new deregulated power market in North America were discussed. This presentation also highlighted the factors that affected the risk that companies in the U.S. Mid-West were exposed to in June 1998. During that time, MEUs had to deal with financial fallouts and price spikes as a result of very high temperatures, generation outages, and transmission line relief. The focus is on price risk and credit risk and how a strong risk management team can be instrumental in avoiding price spikes like those that occurred in June 1998

  17. A Preference-Free Formula to Value Commodity Derivatives

    NARCIS (Netherlands)

    Rodriguez, J.C.

    2007-01-01

    This paper studies a new model of commodity prices in which the stochastic convenience yield is an affine function of past commodity returns. While preserving market completeness, the model exhibits price nonstationarity and mean reversion under the martingale measure, and, as a consequence, it is

  18. Second derivative spectrophotometric determination of ...

    African Journals Online (AJOL)

    A new, simple, rapid, wide applicable range and reliable second derivative spectrophotometric method has been developed for determination of cyclophosphamide (CP) in bulk and pharmaceutical dosage forms. Calibration graph is linear in the concentration range of 25 - 200 μg/ml of CP with 10 μg/ml of detection limit and ...

  19. Flexibility and Project Value: Interactions and Multiple Real Options

    Science.gov (United States)

    Čulík, Miroslav

    2010-06-01

    This paper is focused on a project valuation with embedded portfolio of real options including their interactions. Valuation is based on the criterion of Net Present Value on the simulation basis. Portfolio includes selected types of European-type real options: option to expand, contract, abandon and temporarily shut down and restart a project. Due to the fact, that in reality most of the managerial flexibility takes the form of portfolio of real options, selected types of options are valued not only individually, but also in combination. The paper is structured as follows: first, diffusion models for forecasting of output prices and variable costs are derived. Second, project value is estimated on the assumption, that no real options are present. Next, project value is calculated with the presence of selected European-type options; these options and their impact on project value are valued first in isolation and consequently in different combinations. Moreover, intrinsic value evolution of given real options with respect to the time of exercising is analysed. In the end, results are presented graphically; selected statistics and risk measures (Value at Risk, Expected Shortfall) of the NPV's distributions are calculated and commented.

  20. Value Creation in International Business

    DEFF Research Database (Denmark)

    is a pioneering two volume work intended to provoke theoretical and empirical development in International Business research. Moreover, it is intended as a bridge between concepts derived from general business firm-level research agendas such as value creation and business model, and internationalization......The edited collection brings into focus the meanings, interpretations and the process of value creation in international business. Exploring value creation in the context of emerging and developed economies, Volume 2 takes the perspective of small and medium sized enterprises and examines various...

  1. Controls of oxygen isotope ratios of nitrate formed during nitrification in soils

    International Nuclear Information System (INIS)

    Mayer, B.; Bollwerk, S.M.; Vorhoff, B.; Mansfeldt, T.; Veizer, J.

    1999-01-01

    The isotopic composition of nitrate is increasingly used to determine sources and transformations of nitrogen in terrestrial and aquatic ecosystems. Oxygen isotope ratios of nitrate appear to be particularly useful, since they allow the differentiation between nitrate from atmospheric deposition (δ 18 O nitrate between +25 and +70 per mille), nitrate from fertilizers (δ 18 O nitrate +23 per mille), and nitrate derived from nitrification processes in soils (δ 18 O nitrate 3 molecule derive from H 2 O (with negative δ 18 O values dependent upon location) and one oxygen derives from atmospheric O 2 (δ 18 O = +23.5 per mille).. The objective of this study was to experimentally determine the extent to which water oxygen controls the δ 18 O value of nitrate, which is formed during nitrification in soils

  2. Higher order alchemical derivatives from coupled perturbed self-consistent field theory.

    Science.gov (United States)

    Lesiuk, Michał; Balawender, Robert; Zachara, Janusz

    2012-01-21

    We present an analytical approach to treat higher order derivatives of Hartree-Fock (HF) and Kohn-Sham (KS) density functional theory energy in the Born-Oppenheimer approximation with respect to the nuclear charge distribution (so-called alchemical derivatives). Modified coupled perturbed self-consistent field theory is used to calculate molecular systems response to the applied perturbation. Working equations for the second and the third derivatives of HF/KS energy are derived. Similarly, analytical forms of the first and second derivatives of orbital energies are reported. The second derivative of Kohn-Sham energy and up to the third derivative of Hartree-Fock energy with respect to the nuclear charge distribution were calculated. Some issues of practical calculations, in particular the dependence of the basis set and Becke weighting functions on the perturbation, are considered. For selected series of isoelectronic molecules values of available alchemical derivatives were computed and Taylor series expansion was used to predict energies of the "surrounding" molecules. Predicted values of energies are in unexpectedly good agreement with the ones computed using HF/KS methods. Presented method allows one to predict orbital energies with the error less than 1% or even smaller for valence orbitals. © 2012 American Institute of Physics

  3. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  4. Values beyond value? Is anything beyond the logic of capital?

    Science.gov (United States)

    Skeggs, Bev

    2014-03-01

    We are living in a time when it is frequently assumed that the logic of capital has subsumed every single aspect of our lives, intervening in the organization of our intimate relations as well as the control of our time, including investments in the future (e.g. via debt). The theories that document the incursion of this logic (often through the terms of neoliberalism and/or governmentality) assume that this logic is internalized, works and organizes everything including our subjectivity. These theories performatively reproduce the very conditions they describe, shrinking the domain of values and making it subject to capital's logic. All values are reduced to value. Yet values and value are always dialogic, dependent and co-constituting. In this paper I chart the history by which value eclipses values and how this shrinks our sociological imagination. By outlining the historical processes that institutionalized different organizations of the population through political economy and the social contract, producing ideas of proper personhood premised on propriety, I detail how forms of raced, gendered and classed personhood was formed. The gaps between the proper and improper generate significant contradictions that offer both opportunities to and limits on capitals' lines of flight. It is the lacks, the residues, and the excess that cannot be captured by capital's mechanisms of valuation that will be explored in order to think beyond the logic of capital and show how values will always haunt value. © London School of Economics and Political Science 2014.

  5. The Constitutive Values of Science

    Directory of Open Access Journals (Sweden)

    Hugh Lacey

    1997-06-01

    Full Text Available Cognitive values are the characteristics that are constitutive of good theories, the criteria to which we appeal when choosing among competing theories. I argue that, in order to count as a cognitive value, a characteristic must be needed to explain actually made theory choices, and its cognitive significance must be well defended especially in view of considerations derived from the objective of science. A number of proposed objectives of science are entertained, and it is argued that adopting a par-ticular objective is dialectically intertwined with commitment to certain social values.Then, the ways in which science is, and is not value free is explored briefly, leading to the identification of a level of analysis where values may influence theory choice without causing paradox or threatening the impartiality of soundly-made scientific judgments.

  6. Advancing Material Models for Automotive Forming Simulations

    International Nuclear Information System (INIS)

    Vegter, H.; An, Y.; Horn, C.H.L.J. ten; Atzema, E.H.; Roelofsen, M.E.

    2005-01-01

    Simulations in automotive industry need more advanced material models to achieve highly reliable forming and springback predictions. Conventional material models implemented in the FEM-simulation models are not capable to describe the plastic material behaviour during monotonic strain paths with sufficient accuracy. Recently, ESI and Corus co-operate on the implementation of an advanced material model in the FEM-code PAMSTAMP 2G. This applies to the strain hardening model, the influence of strain rate, and the description of the yield locus in these models. A subsequent challenge is the description of the material after a change of strain path.The use of advanced high strength steels in the automotive industry requires a description of plastic material behaviour of multiphase steels. The simplest variant is dual phase steel consisting of a ferritic and a martensitic phase. Multiphase materials also contain a bainitic phase in addition to the ferritic and martensitic phase. More physical descriptions of strain hardening than simple fitted Ludwik/Nadai curves are necessary.Methods to predict plastic behaviour of single-phase materials use a simple dislocation interaction model based on the formed cells structures only. At Corus, a new method is proposed to predict plastic behaviour of multiphase materials have to take hard phases into account, which deform less easily. The resulting deformation gradients create geometrically necessary dislocations. Additional micro-structural information such as morphology and size of hard phase particles or grains is necessary to derive the strain hardening models for this type of materials.Measurements available from the Numisheet benchmarks allow these models to be validated. At Corus, additional measured values are available from cross-die tests. This laboratory test can attain critical deformations by large variations in blank size and processing conditions. The tests are a powerful tool in optimising forming simulations prior

  7. Adaptive municipal electronic forms

    NARCIS (Netherlands)

    Kuiper, Pieternel; van Dijk, Elisabeth M.A.G.; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Guiderdoni-Jourdain, Karine; Oiry, Ewan

    Adaptation of electronic forms (e-forms) seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer e-forms online that can be used by citizens to request a municipal product or service or by municipal employees to place a request on behalf of a

  8. Image forming apparatus

    DEFF Research Database (Denmark)

    2005-01-01

    An image H(x, y) for displaying a target image G(x, y) is displayed on a liquid-crystal display panel and illumination light from an illumination light source is made to pass therethrough to form an image on a PALSLM. Read light hv is radiated to the PALSLM and a phase-modulated light image alpha...... (x, y) read out of the PALSLM is subjected to Fourier transform by a lens. A phase contrast filter gives a predetermined phase shift to only the zero-order light component of Fourier light image alpha f(x, y). The phase-shifted light image is subjected to inverse Fourier transform by a lens...... to project an output image O(x, y) to an output plane. A light image O'(x, y) branched by a beam sampler is picked up by a pickup device and an evaluation value calculating unit evaluates conformity between the image O(x, y) and the image G(x, y).; A control unit performs feedback control of optical...

  9. Functional self-assembled lipidic systems derived from renewable resources.

    Science.gov (United States)

    Silverman, Julian R; Samateh, Malick; John, George

    2016-01-01

    Self-assembled lipidic amphiphile systems can create a variety of multi-functional soft materials with value-added properties. When employing natural reagents and following biocatalytic syntheses, self-assembling monomers may be inherently designed for degradation, making them potential alternatives to conventional and persistent polymers. By using non-covalent forces, self-assembled amphiphiles can form nanotubes, fibers, and other stimuli responsive architectures prime for further applied research and incorporation into commercial products. By viewing these lipid derivatives under a lens of green principles, there is the hope that in developing a structure-function relationship and functional smart materials that research may remain safe, economic, and efficient.

  10. The value of diversity

    International Nuclear Information System (INIS)

    Jones, P.M.S.

    1994-01-01

    Although the adoption of a range of fuels employing different technologies incurs extra cost, diversity can provide a measure of security against supply disruption, fuel price escalation and environmental regulatory changes. Attempts to set a value to diversity in the United Kingdom are reviewed. Most of these have explored the economic impact of different mixes of fuels and/or technologies against a series of postulated fuel price and energy demand scenarios. They depend on the reliability of the cost and technical performance inputs, and subjective judgements about future price and demand developments; these factors undermine confidence in quantitative outputs of such methods. The novel approach of Stirling is presented. This seeks to derive an optimum plant/fuel mix using generation costs for a wide range of options and a marginal value for incremental changes in diversity, based on a specified diversity index. Stirling's approach could be argued to support the maintenance or expansion of the existing nuclear component of United Kingdom power supplies and an increase in the contribution from renewables. However, problems within the method which is still under development limits the weight that can be attached to its findings at present. Given the closely comparable financial costs, a reasonable balance at this time would seem to consist of the available level of low cost renewables and roughly equal tranches of gas, nuclear and coal. A smaller coal-fired component would be appropriate if environmental costs are taken into account. (19 references). (UK)

  11. Measuring value sensitivity in medicine.

    Science.gov (United States)

    Ineichen, Christian; Christen, Markus; Tanner, Carmen

    2017-01-28

    Value sensitivity - the ability to recognize value-related issues when they arise in practice - is an indispensable competence for medical practitioners to enter decision-making processes related to ethical questions. However, the psychological competence of value sensitivity is seldom an explicit subject in the training of medical professionals. In this contribution, we outline the traditional concept of moral sensitivity in medicine and its revised form conceptualized as value sensitivity and we propose an instrument that measures value sensitivity. We developed an instrument for assessing the sensitivity for three value groups (moral-related values, values related to the principles of biomedical ethics, strategy-related values) in a four step procedure: 1) value identification (n = 317); 2) value representation (n = 317); 3) vignette construction and quality evaluation (n = 37); and 4) instrument validation by comparing nursing professionals with hospital managers (n = 48). We find that nursing professionals recognize and ascribe importance to principle-related issues more than professionals from hospital management. The latter are more likely to recognize and ascribe importance to strategy-related issues. These hypothesis-driven results demonstrate the discriminatory power of our newly developed instrument, which makes it useful not only for health care professionals in practice but for students and people working in the clinical context as well.

  12. Use value, exchange value, and resource scarcity

    International Nuclear Information System (INIS)

    Stern, D.I.

    1999-01-01

    The literature on natural resource scarcity indicators is reviewed. Scarcity indicators can be classified by what is being measured: value of the resource stock or value of extracted resource commodities; whose value is considered: social vs. private scarcity; and by the mode of valuation considered: exchange value and use value. Prices and rents are common measures of exchange value or indicators of ''exchange scarcity'' and unit costs can be seen as use value indicators or indicators of u se scarcity . The major aim of this paper is to demonstrate the links between productivity indicators such as unit costs and the classical concept of use value. The two classes of indicator relate to John Commons' discussions of scarcity and efficiency, and a marginal vs. a non-marginal approach to value and scarcity. The classical use value concept also has wider relevance for issues of valuation in energy, resource, and environmental policy. (author)

  13. A PC program for estimating organ dose and effective dose values in computed tomography

    International Nuclear Information System (INIS)

    Kalender, W.A.; Schmidt, B.; Schmidt, M.; Zankl, M.

    1999-01-01

    Dose values in CT are specified by the manufacturers for all CT systems and operating conditions in phantoms. It is not trivial, however, to derive dose values in patients from this information. Therefore, we have developed a PC-based program which calculates organ dose and effective dose values for arbitrary scan parameters and anatomical ranges. Values for primary radiation are derived from measurements or manufacturer specifications; values for scattered radiation are derived from Monte Carlo calculations tabulated for standard anthropomorphic phantoms. Based on these values, organ doses can be computed by the program for arbitrary scan protocols in conventional and in spiral CT. Effective dose values are also provided, both with ICRP 26 and ICRP 60 tissue-weighting coefficients. Results for several standard CT protocols are presented in tabular form in this paper. In addition, potential for dose reduction is demonstrated, for example, in spiral CT and in quantitative CT. Providing realistic patient dose estimates for arbitrary CT protocols is relevant both for the physician and the patient, and it is particularly useful for educational and training purposes. The program, called WinDose, is now in use at the Erlangen University hospitals (Germany) as an information tool for radiologists and patients. Further extensions are planned. (orig.)

  14. Bounded Densities and Their Derivatives

    DEFF Research Database (Denmark)

    Kozine, Igor; Krymsky, V.

    2009-01-01

    This paper describes how one can compute interval-valued statistical measures given limited information about the underlying distribution. The particular focus is on a bounded derivative of a probability density function and its combination with other available statistical evidence for computing ...... quantities of interest. To be able to utilise the evidence about the derivative it is suggested to adapt the ‘conventional’ problem statement to variational calculus and the way to do so is demonstrated. A number of examples are given throughout the paper....

  15. 76 FR 4751 - Position Limits for Derivatives

    Science.gov (United States)

    2011-01-26

    ... saleable by long traders at its market value in normal cash marketing channels at the derivative contract's... Association, Futures Industry Association, GDF Suez Energy, Morgan Stanley, and NextEra Energy Power Marketing...

  16. A Study on Market Efficiency of Selected Commodity Derivatives Traded on NCDEX During 2011

    Science.gov (United States)

    Sajipriya, N.

    2012-10-01

    The study aims at testing the weak form of Efficient Market Hypothesis in the context of an emerging commodity market - National Commodity Derivatives Exchange (NCDEX), which is considered as the prime commodity derivatives market in India. The study considered daily spot and futures prices of five selected commodities traded on NCDEX over 12 month period (the futures contracts originating and expiring during the period January 2011 to December 2011) The five commodities chosen are Pepper, Crude palm Oil, steel silver and Chana as they account for almost two-thirds of the value of agricultural commodity derivatives traded on NCDEX. The results of Run test indicate that both spot and futures prices are weak form efficient

  17. Interest rate derivatives

    DEFF Research Database (Denmark)

    Svenstrup, Mikkel

    This Ph.D. thesis consists of four self-contained essays on valuation of interest rate derivatives. In particular derivatives related to management of interest rate risk care are considered.......This Ph.D. thesis consists of four self-contained essays on valuation of interest rate derivatives. In particular derivatives related to management of interest rate risk care are considered....

  18. Star-forming Filament Models

    International Nuclear Information System (INIS)

    Myers, Philip C.

    2017-01-01

    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  19. Star-forming Filament Models

    Energy Technology Data Exchange (ETDEWEB)

    Myers, Philip C., E-mail: pmyers@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2017-03-20

    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  20. Against Logical Form

    Directory of Open Access Journals (Sweden)

    P N Johnson-Laird

    2010-10-01

    Full Text Available An old view in logic going back to Aristotle is that an inference is valid in virtue of its logical form. Many psychologists have adopted the same point of view about human reasoning: the first step is to recover the logical form of an inference, and the second step is to apply rules of inference that match these forms in order to prove that the conclusion follows from the premises. The present paper argues against this idea. The logical form of an inference transcends the grammatical forms of the sentences used to express it, because logical form also depends on context. Context is not readily expressed in additional premises. And the recovery of logical form leads ineluctably to the need for infinitely many axioms to capture the logical properties of relations. An alternative theory is that reasoning depends on mental models, and this theory obviates the need to recover logical form.

  1. Forms of Arthritis

    Science.gov (United States)

    ... this page please turn Javascript on. Forms of Arthritis Past Issues / Fall 2006 Table of Contents Today, ... of Linda Saisselin Osteoarthritis (OA) — the form of arthritis typically occurring during middle or old age, this ...

  2. Forms Management Policy

    Science.gov (United States)

    To establish EPA’s Forms Management Program; to describe the requisite roles, responsibilities, and procedures necessary for the successful management of EPA forms; and to more clearly fulfill EPA’s obligations in this regard.

  3. Dietary reference values for thiamin

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derived dietary reference values (DRVs) for thiamin (vitamin B1). The Panel considers that data from depletion–repletion studies in adults on the amount of dietary thiamin intake...... were measured. Results from other depletion–repletion studies are in agreement with this value. The Panel agrees on the coefficient of variation of 20% used by the SCF to cover uncertainties related to distribution of thiamin requirements in the general population, and endorses the population reference...

  4. Value Creation in Knowledge Networks

    DEFF Research Database (Denmark)

    Hansen, Magnus Rotvit Perlt; Pries-Heje, Jan

    2017-01-01

    Knowledge networks enable businesses to enhance their levels of innovation and market competitiveness. In this paper, we propose five principles for designing IT tools that can support the facilitation and improvement of knowledge networks. We also introduce a new value proposition that constitutes...... a nascent design theory in the domain of knowledge network improvement. The design principles are derived from an iterative process applied in three different case settings. In each case, we apply and evaluate the network nexus tool to determine whether the knowledge network provides value to its...

  5. On computing Laplace's coefficients and their derivatives.

    Science.gov (United States)

    Gerasimov, I. A.; Vinnikov, E. L.

    The algorithm of computing Laplace's coefficients and their derivatives is proposed with application of recurrent relations. The A.G.M.-method is used for the calculation of values L0(0), L0(1). The FORTRAN-program corresponding to the algorithm is given. The precision control was provided with numerical integrating by Simpsons method. The behavior of Laplace's coefficients and their third derivatives whith varying indices K, n for fixed values of the α-parameter is presented graphically.

  6. THE VALUE-BASED MANAGEMENT APPROACH: FROM THE SHAREHOLDER VALUE TO THE STAKEHOLDER VALUE

    OpenAIRE

    VALENTIN MUNTEANU; DOINA DANAIATA; LUMINITA HURBEAN; ALICE BERGLER

    2012-01-01

    The ongoing discussion about the adequate management form and the purpose of organizations in the contemporary postmodern society have once again gained in importance and interest after the financial crises of 2008. Different management concepts have been developed throughout the time, which propose objectives for organizations and thus managerial goals, activities and decision making. Considering the value based management approach and the stakeholder theory, we propose a shift in the value ...

  7. FORMS OF YOUTH TRAVEL

    OpenAIRE

    Moisã Claudia Olimpia; Moisã Claudia Olimpia

    2011-01-01

    Taking into account the suite of motivation that youth has when practicing tourism, it can be said that the youth travel takes highly diverse forms. These forms are educational tourism, volunteer programs and “work and travel”, cultural exchanges or sports tourism and adventure travel. In this article, we identified and analyzed in detail the main forms of youth travel both internationally and in Romania. We also illustrated for each form of tourism the specific tourism products targeting you...

  8. Mean value-based power allocation and ratio selection for MIMO cognitive radio systems

    KAUST Repository

    Tourki, Kamel; Qaraqe, Khalid A.; Alouini, Mohamed-Slim

    2013-01-01

    In this paper, we consider a spectrum sharing cognitive radio system with ratio selection using a mean value-based power allocation strategy. We first provide the exact statistics in terms of probability density function and cumulative density function of the secondary channel gain as well as of the interference channel gain. These statistics are then used to derive exact closed form expression of the secondary outage probability. Furthermore, asymptotical analysis is derived and generalized diversity gain is deduced. We validate our analysis with simulation results in a Rayleigh fading environment. © 2013 IEEE.

  9. Mean value-based power allocation and ratio selection for MIMO cognitive radio systems

    KAUST Repository

    Tourki, Kamel

    2013-06-01

    In this paper, we consider a spectrum sharing cognitive radio system with ratio selection using a mean value-based power allocation strategy. We first provide the exact statistics in terms of probability density function and cumulative density function of the secondary channel gain as well as of the interference channel gain. These statistics are then used to derive exact closed form expression of the secondary outage probability. Furthermore, asymptotical analysis is derived and generalized diversity gain is deduced. We validate our analysis with simulation results in a Rayleigh fading environment. © 2013 IEEE.

  10. Semiclassical initial value treatment of wave functions

    International Nuclear Information System (INIS)

    Kay, Kenneth G.

    2010-01-01

    A semiclassical initial value approximation for time-independent wave functions, previously derived for integrable systems, is rederived in a form which allows it to be applied to more general systems. The wave function is expressed as an integral over a Lagrangian manifold that is constructed by propagating trajectories from an initial manifold formed on a Poincare surface. Even in the case of bound, integrable systems, it is unnecessary to identify action-angle variables or construct quantizing tori. The approximation is numerically tested for separable and highly chaotic two-dimensional quartic oscillator systems. For the separable (but highly anharmonic) system, the accuracy of the approximation is found to be excellent: overlaps of the semiclassical wave functions with the corresponding quantum wave functions exceed 0.999. For the chaotic system, semiclassical-quantum overlaps are found to range from 0.989 to 0.994, indicating accuracy that is still very good, despite the short classical trajectories used in the calculations.

  11. On the Fractional Mean Value

    OpenAIRE

    Hosseinabadi, Abdolali Neamaty; Nategh, Mehdi

    2014-01-01

    This work, dealt with the classical mean value theorem and took advantage of it in the fractional calculus. The concept of a fractional critical point is introduced. Some sufficient conditions for the existence of a critical point is studied and an illustrative example rele- vant to the concept of the time dilation effect is given. The present paper also includes, some connections between convexity (and monotonicity) with fractional derivative in the Riemann-Liouville sense.

  12. Unified form language

    DEFF Research Database (Denmark)

    Alnæs, Martin S.; Logg, Anders; Ølgaard, Kristian Breum

    2014-01-01

    We present the Unied Form Language (UFL), which is a domain-specic language for representing weak formulations of partial dierential equations with a view to numerical approximation. Features of UFL include support for variational forms and functionals, automatic dierentiation of forms and expres...... libraries to generate concrete low-level implementations. Some application examples are presented and libraries that support UFL are highlighted....

  13. Method for forming ammonia

    Science.gov (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.

    2008-08-19

    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  14. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  15. Sol-gel derived sorbents

    Science.gov (United States)

    Sigman, Michael E.; Dindal, Amy B.

    2003-11-11

    Described is a method for producing copolymerized sol-gel derived sorbent particles for the production of copolymerized sol-gel derived sorbent material. The method for producing copolymerized sol-gel derived sorbent particles comprises adding a basic solution to an aqueous metal alkoxide mixture for a pH.ltoreq.8 to hydrolyze the metal alkoxides. Then, allowing the mixture to react at room temperature for a precalculated period of time for the mixture to undergo an increased in viscosity to obtain a desired pore size and surface area. The copolymerized mixture is then added to an immiscible, nonpolar solvent that has been heated to a sufficient temperature wherein the copolymerized mixture forms a solid upon the addition. The solid is recovered from the mixture, and is ready for use in an active sampling trap or activated for use in a passive sampling trap.

  16. Network connectivity value.

    Science.gov (United States)

    Dragicevic, Arnaud; Boulanger, Vincent; Bruciamacchie, Max; Chauchard, Sandrine; Dupouey, Jean-Luc; Stenger, Anne

    2017-04-21

    In order to unveil the value of network connectivity, we formalize the construction of ecological networks in forest environments as an optimal control dynamic graph-theoretic problem. The network is based on a set of bioreserves and patches linked by ecological corridors. The node dynamics, built upon the consensus protocol, form a time evolutive Mahalanobis distance weighted by the opportunity costs of timber production. We consider a case of complete graph, where the ecological network is fully connected, and a case of incomplete graph, where the ecological network is partially connected. The results show that the network equilibrium depends on the size of the reception zone, while the network connectivity depends on the environmental compatibility between the ecological areas. Through shadow prices, we find that securing connectivity in partially connected networks is more expensive than in fully connected networks, but should be undertaken when the opportunity costs are significant. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Developing a closed-form cost expression for an (R, s, nQ) policy where the demand process is compound generalized Erlang

    DEFF Research Database (Denmark)

    Larsen, Christian; Kiesmüller, G.P

    2007-01-01

    We derive a closed-form cost expression for an (R,s,nQ) inventory control policy where all replenishment orders have a constant lead-time, unfilled demand is back-logged and inter-arrival times of order requests are generalized Erlang distributed. For given values of Q and R we show how to compute...

  18. Reconstructing weak values without weak measurements

    International Nuclear Information System (INIS)

    Johansen, Lars M.

    2007-01-01

    I propose a scheme for reconstructing the weak value of an observable without the need for weak measurements. The post-selection in weak measurements is replaced by an initial projector measurement. The observable can be measured using any form of interaction, including projective measurements. The reconstruction is effected by measuring the change in the expectation value of the observable due to the projector measurement. The weak value may take nonclassical values if the projector measurement disturbs the expectation value of the observable

  19. Anisotropic inflation with derivative couplings

    Science.gov (United States)

    Holland, Jonathan; Kanno, Sugumi; Zavala, Ivonne

    2018-05-01

    We study anisotropic power-law inflationary solutions when the inflaton and its derivative couple to a vector field. This type of coupling is motivated by D-brane inflationary models, in which the inflaton, and a vector field living on the D-brane, couple disformally (derivatively). We start by studying a phenomenological model where we show the existence of anisotropic solutions and demonstrate their stability via a dynamical system analysis. Compared to the case without a derivative coupling, the anisotropy is reduced and thus can be made consistent with current limits, while the value of the slow-roll parameter remains almost unchanged. We also discuss solutions for more general cases, including D-brane-like couplings.

  20. Polythiophenes and fullerene derivatives based donor-acceptor system: topography by atomic force microscopy

    International Nuclear Information System (INIS)

    Marcakova, M. L.; Repovsky, D.; Cik, G.; Velic, D.

    2017-01-01

    The goal of this work is to examine the surface of a polythiophene/fullerene film in order to understand the structure. In this work polythiophene is used as electron donor and fullerene-derivative is used as electron acceptor. Atomic force microscopy (AFM), is an ideal method to study surfaces and nanostructures. Surfaces of fullerene C60 , fullerene-derivates PCBM, polythiophene P12 and a mixture of P12 and PCBM are characterized. In all samples, the average roughness, the arithmetical value of divergence from the high of the surface, is determined concluding that P12 and PCBM mix together well and form a film with specific topography. (authors)

  1. Superiority in value and the repugnant conclusion

    DEFF Research Database (Denmark)

    Jensen, Karsten Klint

    2007-01-01

    superiority does not amount to a radical value difference at all. I then spell out the consequences of these results for different interpretations of Griffin's suggestion regarding population ethics. None of them comes out very successful, but perhaps they nevertheless retain some interest.......James Griffin has considered a weak form of superiority in value a possible remedy to the Repugnant Conclusion. In this paper, I demonstrate that, in a context where value is additive, this weaker form collapses into a stronger form of superiority. And in a context where value is non-additive, weak...

  2. Facilities Management and Added Value

    DEFF Research Database (Denmark)

    Jensen, Per Anker

    2010-01-01

    Aim: This paper aims to present different models of the concept of the added value of Facilities Management (FM), including the FM Value Map, which forms the basis of research group in EuroFM, and to present some of the results of this research collaboration. Approach and methodology: The paper...... is based on literature reviews of the most influential journals within the academic fields of FM, Corporate Real Estate Management and Business to Business Marketing and discussions between participants of the research group working on a further exploration and testing of the FM Value Map. Conclusions......: The research shows a number of different definitions and focus points of Added Value of FM, dependent on the academic field and the area of application. The different research perspectives explored a holistic view on the added value of FM by the integration of an external market based view (with a focus...

  3. Projects as value constellations

    DEFF Research Database (Denmark)

    Laursen, Markus

    Creating value has been outlined as very central to projects applying the organizational perspective to projects. It has been suggested that value is created in value constellations or project networks, where actors work together to create value. However, research on the value creation process...... in value constellations is scarce, and through an exploratory study of two project networks in a cultural setting we investigate how value is created in value constellations. We outline how each project may be a distinct type of value constellation, one project creates value for the partners of the network...... as a consortium, and the project creates value primarily for others as a facilitator....

  4. Value-based pricing

    OpenAIRE

    Netseva-Porcheva Tatyana

    2010-01-01

    The main aim of the paper is to present the value-based pricing. Therefore, the comparison between two approaches of pricing is made - cost-based pricing and value-based pricing. The 'Price sensitively meter' is presented. The other topic of the paper is the perceived value - meaning of the perceived value, the components of perceived value, the determination of perceived value and the increasing of perceived value. In addition, the best company strategies in matrix 'value-cost' are outlined. .

  5. Evaluation of satellite derived spectral diffuse attenuation coefficients

    Digital Repository Service at National Institute of Oceanography (India)

    Suresh, T.; Talaulikar, M.; Desa, E.; Mascarenhas, A.A.M.Q.; Matondkar, S.G.P.

    , 443, 490, 510, 555 and 670 nm derived from the ocean color satellite sensor, SeaWiFS with the in-situ measured values from the Arabian Sea is compared. The satellite derived values are found to be comparable to the measured values in the lower...

  6. Derivation of Hamiltonians for accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Symon, K.R.

    1997-09-12

    In this report various forms of the Hamiltonian for particle motion in an accelerator will be derived. Except where noted, the treatment will apply generally to linear and circular accelerators, storage rings, and beamlines. The generic term accelerator will be used to refer to any of these devices. The author will use the usual accelerator coordinate system, which will be introduced first, along with a list of handy formulas. He then starts from the general Hamiltonian for a particle in an electromagnetic field, using the accelerator coordinate system, with time t as independent variable. He switches to a form more convenient for most purposes using the distance s along the reference orbit as independent variable. In section 2, formulas will be derived for the vector potentials that describe the various lattice components. In sections 3, 4, and 5, special forms of the Hamiltonian will be derived for transverse horizontal and vertical motion, for longitudinal motion, and for synchrobetatron coupling of horizontal and longitudinal motions. Hamiltonians will be expanded to fourth order in the variables.

  7. Derived ERLs for inhalation of alpha-emitting aerorols

    International Nuclear Information System (INIS)

    Macdonald, H.F.

    1977-01-01

    Derived alpha action levels are expressed as dpm/m 3 and give the airborne concentration of an assumed mixture of α-emitters which if inhaled for a period of 4 hours would result in a dose commitment to members of the critical group in the exposed population equal to the emergency reference levels (ERLs) of dose recommended by the Medical Research Council (1975). The period of 4 hours is chosen as a realistic time during which an assessment of the severity of a release may be made and appropriate countermeasures instituted. The derived α ERLs are set with reference to the potential range of isotopic releases for a specific reactor system and in the case of gas-cooled magnox reactors, a value of 10 3 dpm/m 3 (170 Bqm -3 ) has been used. This level was based upon the lung and GI tract models originally recommended by ICRP 2 (1959:1964) and revised ERLs for the inhalation of α-emitters consequent upon the improved metabolic models subsequently proposed by the ICRP (1966:1972) are evaluated. It is shown that the derived α ERLs for irradiated magnox and AGR fuels are largely independent of the physico-chemical forms of the released material, while variations with cooling time of fuel are also discussed. In addition, the special limits imposed by the chemical toxicity of uranium when inhaled in a soluble, low enriched form are briefly outlined

  8. Forms of Life, Forms of Reality

    Directory of Open Access Journals (Sweden)

    Piergiorgio Donatelli

    2015-10-01

    Full Text Available The article explores aspects of the notion of forms of life in the Wittgensteinian tradition especially following Iris Murdoch’s lead. On the one hand, the notion signals the hardness and inexhaustible character of reality, as the background needed in order to make sense of our lives in various ways. On the other, the hardness of reality is the object of a moral work of apprehension and deepening to the point at which its distinctive character dissolves into the family of connections we have gained for ourselves. The two movements of thought are connected and necessary.

  9. Indigenous environmental values as human values

    Directory of Open Access Journals (Sweden)

    Monica Gratani

    2016-12-01

    Full Text Available The claim that in natural resource management (NRM a change from anthropocentric values and ethics to eco-centric ones is necessary to achieve sustainability leads to the search for eco-centric models of relationship with the environment. Indigenous cultures can provide such models; hence, there is the need for multicultural societies to further include their values in NRM. In this article, we investigate the environmental values placed on a freshwater environment of the Wet Tropics by a community of indigenous Australians. We discuss their environmental values as human values, and so as beliefs that guide communities’ understanding of how the natural world should be viewed and treated by humans. This perspective represents a step forward in our understanding of indigenous environmental values, and a way to overcome the paradigm of indigenous values as valued biophysical attributes of the environment or processes happening in landscapes. Our results show that the participant community holds biospheric values. Restoring these values in the NRM of the Wet Tropics could contribute to sustainability and environmental justice in the area.

  10. Micro metal forming

    CERN Document Server

    2013-01-01

    Micro Metal Forming, i. e. forming of parts and features with dimensions below 1 mm, is a young area of research in the wide field of metal forming technologies, expanding the limits for applying metal forming towards micro technology. The essential challenges arise from the reduced geometrical size and the increased lot size. In order to enable potential users to apply micro metal forming in production, information about the following topics are given: tribological behavior: friction between tool and work piece as well as tool wear mechanical behavior: strength and formability of the work piece material, durability of the work pieces size effects: basic description of effects occurring due to the fact, that the quantitative relation between different features changes with decreasing size process windows and limits for forming processes tool making methods numerical modeling of processes and process chains quality assurance and metrology All topics are discussed with respect to the questions relevant to micro...

  11. The value of innovation under value-based pricing

    Science.gov (United States)

    Moreno, Santiago G.; Ray, Joshua A.

    2016-01-01

    Objective The role of cost-effectiveness analysis (CEA) in incentivizing innovation is controversial. Critics of CEA argue that its use for pricing purposes disregards the ‘value of innovation’ reflected in new drug development, whereas supporters of CEA highlight that the value of innovation is already accounted for. Our objective in this article is to outline the limitations of the conventional CEA approach, while proposing an alternative method of evaluation that captures the value of innovation more accurately. Method The adoption of a new drug benefits present and future patients (with cost implications) for as long as the drug is part of clinical practice. Incidence patients and off-patent prices are identified as two key missing features preventing the conventional CEA approach from capturing 1) benefit to future patients and 2) future savings from off-patent prices. The proposed CEA approach incorporates these two features to derive the total lifetime value of an innovative drug (i.e., the value of innovation). Results The conventional CEA approach tends to underestimate the value of innovative drugs by disregarding the benefit to future patients and savings from off-patent prices. As a result, innovative drugs are underpriced, only allowing manufacturers to capture approximately 15% of the total value of innovation during the patent protection period. In addition to including the incidence population and off-patent price, the alternative approach proposes pricing new drugs by first negotiating the share of value of innovation to be appropriated by the manufacturer (>15%?) and payer (price that satisfies this condition. Conclusion We argue for a modification to the conventional CEA approach that integrates the total lifetime value of innovative drugs into CEA, by taking into account off-patent pricing and future patients. The proposed approach derives a price that allows manufacturers to capture an agreed share of this value, thereby incentivizing

  12. The value of innovation under value-based pricing.

    Science.gov (United States)

    Moreno, Santiago G; Ray, Joshua A

    2016-01-01

    The role of cost-effectiveness analysis (CEA) in incentivizing innovation is controversial. Critics of CEA argue that its use for pricing purposes disregards the 'value of innovation' reflected in new drug development, whereas supporters of CEA highlight that the value of innovation is already accounted for. Our objective in this article is to outline the limitations of the conventional CEA approach, while proposing an alternative method of evaluation that captures the value of innovation more accurately. The adoption of a new drug benefits present and future patients (with cost implications) for as long as the drug is part of clinical practice. Incidence patients and off-patent prices are identified as two key missing features preventing the conventional CEA approach from capturing 1) benefit to future patients and 2) future savings from off-patent prices. The proposed CEA approach incorporates these two features to derive the total lifetime value of an innovative drug (i.e., the value of innovation). The conventional CEA approach tends to underestimate the value of innovative drugs by disregarding the benefit to future patients and savings from off-patent prices. As a result, innovative drugs are underpriced, only allowing manufacturers to capture approximately 15% of the total value of innovation during the patent protection period. In addition to including the incidence population and off-patent price, the alternative approach proposes pricing new drugs by first negotiating the share of value of innovation to be appropriated by the manufacturer (>15%?) and payer (price that satisfies this condition. We argue for a modification to the conventional CEA approach that integrates the total lifetime value of innovative drugs into CEA, by taking into account off-patent pricing and future patients. The proposed approach derives a price that allows manufacturers to capture an agreed share of this value, thereby incentivizing innovation, while supporting health

  13. Gravitation and quadratic forms

    International Nuclear Information System (INIS)

    Ananth, Sudarshan; Brink, Lars; Majumdar, Sucheta; Mali, Mahendra; Shah, Nabha

    2017-01-01

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  14. Three forms of relativity

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1992-01-01

    The physical sense of three forms of the relativity is discussed. The first - instant from - respects in fact the traditional approach based on the concept of instant distance. The normal form corresponds the radar formulation which is based on the light or retarded distances. The front form in the special case is characterized by 'observable' variables, and the known method of k-coefficient is its obvious expression. 16 refs

  15. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  16. Gravitation and quadratic forms

    Energy Technology Data Exchange (ETDEWEB)

    Ananth, Sudarshan [Indian Institute of Science Education and Research,Pune 411008 (India); Brink, Lars [Department of Physics, Chalmers University of Technology,S-41296 Göteborg (Sweden); Institute of Advanced Studies and Department of Physics & Applied Physics,Nanyang Technological University,Singapore 637371 (Singapore); Majumdar, Sucheta [Indian Institute of Science Education and Research,Pune 411008 (India); Mali, Mahendra [School of Physics, Indian Institute of Science Education and Research,Thiruvananthapuram, Trivandrum 695016 (India); Shah, Nabha [Indian Institute of Science Education and Research,Pune 411008 (India)

    2017-03-31

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  17. Electronic Capitalization Asset Form -

    Data.gov (United States)

    Department of Transportation — National Automated Capitalization Authorization Form used by ATO Engineering Services, Logistics, Accounting for the purpose of identifying and capturing FAA project...

  18. Forming of superplastic ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Lesuer, D.R.; Wadsworth, J.; Nieh, T.G.

    1994-05-01

    Superplasticity in ceramics has now advanced to the stage that technologically viable superplastic deformation processing can be performed. In this paper, examples of superplastic forming and diffusion bonding of ceramic components are given. Recent work in biaxial gas-pressure forming of several ceramics is provided. These include yttria-stabilized, tetragonal zirconia (YTZP), a 20% alumina/YTZP composite, and silicon. In addition, the concurrent superplastic forming and diffusion bonding of a hybrid ceramic-metal structure are presented. These forming processes offer technological advantages of greater dimensional control and increased variety and complexity of shapes than is possible with conventional ceramic shaping technology.

  19. Cooperative Station History Forms

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  20. Testing of the derivative method and Kruskal-Wallis technique for sensitivity analysis of SYVAC

    International Nuclear Information System (INIS)

    Prust, J.O.; Edwards, H.H.

    1985-04-01

    The Kruskal-Wallis method of one-way analysis of variance by ranks has proved successful in identifying input parameters which have an important influence on dose. This technique was extended to test for first order interactions between parameters. In view of a number of practical difficulties and the computing resources required to carry out a large number of runs, this test is not recommended for detecting interactions between parameters. The derivative method of sensitivity analysis examines the partial derivative values of each input parameter with dose at various points across the parameter range. Important input parameters are associated with high derivatives and the results agreed well with previous sensitivity studies. The derivative values also provided information on the data generation distributions to be used for the input parameters in order to concentrate sampling in the high dose region of the parameter space to improve the sampling efficiency. Furthermore, the derivative values provided information on parameter interactions, the feasibility of developing a high dose algorithm and formed the basis for developing a regression equation. (author)

  1. 18 CFR 367.2450 - Account 245, Derivative instrument liabilities-Hedges

    Science.gov (United States)

    2010-04-01

    ..., Derivative instrument liabilities—Hedges (a) This account must include the change in the fair value of... service company must record the change in the fair value of a derivative instrument liability related to a... change in the fair value of a derivative instrument liability related to a fair value hedge in this...

  2. The forecaster's added value

    Science.gov (United States)

    Turco, M.; Milelli, M.

    2009-09-01

    To the authors' knowledge there are relatively few studies that try to answer this topic: "Are humans able to add value to computer-generated forecasts and warnings ?". Moreover, the answers are not always positive. In particular some postprocessing method is competitive or superior to human forecast (see for instance Baars et al., 2005, Charba et al., 2002, Doswell C., 2003, Roebber et al., 1996, Sanders F., 1986). Within the alert system of ARPA Piemonte it is possible to study in an objective manner if the human forecaster is able to add value with respect to computer-generated forecasts. Every day the meteorology group of the Centro Funzionale of Regione Piemonte produces the HQPF (Human QPF) in terms of an areal average for each of the 13 regional warning areas, which have been created according to meteo-hydrological criteria. This allows the decision makers to produce an evaluation of the expected effects by comparing these HQPFs with predefined rainfall thresholds. Another important ingredient in this study is the very dense non-GTS network of rain gauges available that makes possible a high resolution verification. In this context the most useful verification approach is the measure of the QPF and HQPF skills by first converting precipitation expressed as continuous amounts into ‘‘exceedance'' categories (yes-no statements indicating whether precipitation equals or exceeds selected thresholds) and then computing the performances for each threshold. In particular in this work we compare the performances of the latest three years of QPF derived from two meteorological models COSMO-I7 (the Italian version of the COSMO Model, a mesoscale model developed in the framework of the COSMO Consortium) and IFS (the ECMWF global model) with the HQPF. In this analysis it is possible to introduce the hypothesis test developed by Hamill (1999), in which a confidence interval is calculated with the bootstrap method in order to establish the real difference between the

  3. Employing Sensitivity Derivatives for Robust Optimization under Uncertainty in CFD

    Science.gov (United States)

    Newman, Perry A.; Putko, Michele M.; Taylor, Arthur C., III

    2004-01-01

    A robust optimization is demonstrated on a two-dimensional inviscid airfoil problem in subsonic flow. Given uncertainties in statistically independent, random, normally distributed flow parameters (input variables), an approximate first-order statistical moment method is employed to represent the Computational Fluid Dynamics (CFD) code outputs as expected values with variances. These output quantities are used to form the objective function and constraints. The constraints are cast in probabilistic terms; that is, the probability that a constraint is satisfied is greater than or equal to some desired target probability. Gradient-based robust optimization of this stochastic problem is accomplished through use of both first and second-order sensitivity derivatives. For each robust optimization, the effect of increasing both input standard deviations and target probability of constraint satisfaction are demonstrated. This method provides a means for incorporating uncertainty when considering small deviations from input mean values.

  4. The multiple zeta value data mine

    International Nuclear Information System (INIS)

    Buemlein, J.; Broadhurst, D.J.

    2009-07-01

    We provide a data mine of proven results for multiple zeta values (MZVs) of the form ζ(s 1 ,s 2 ,..,s k ) = sum ∞ n 1 >n 2 >...>n k >0 {1/(n 1 s 1 ..n k s k )} with weight w = sum K i=1 s i and depth k and for Euler sums of the form sum ∞ n 1 >n 2 >...>n k >0 {(ε 1 n 1 ..ε 1 n k )/(n 1 s 1 ..n k s k )} with signs ε i = ± 1. Notably, we achieve explicit proven reductions of all MZVs with weights w≤22, and all Euler sums with weights w≤12, to bases whose dimensions, bigraded by weight and depth, have sizes in precise agreement with the Broadhurst. Kreimer and Broadhurst conjectures. Moreover, we lend further support to these conjectures by studying even greater weights (w≤30), using modular arithmetic. To obtain these results we derive a new type of relation for Euler sums, the Generalized Doubling Relations. We elucidate the ''pushdown'' mechanism, whereby the ornate enumeration of primitive MZVs, by weight and depth, is reconciled with the far simpler enumeration of primitive Euler sums. There is some evidence that this pushdown mechanism finds its origin in doubling relations. We hope that our data mine, obtained by exploiting the unique power of the computer algebra language FORM, will enable the study of many more such consequences of the double-shuffle algebra of MZVs, and their Euler cousins, which are already the subject of keen interest, to practitioners of quantum field theory, and to mathematicians alike. (orig.)

  5. The anti-tumor efficacy of nanoparticulate form of ICD-85 versus free form

    Directory of Open Access Journals (Sweden)

    Zare Mirakabadi, A.

    2015-04-01

    Full Text Available Biodegradable polymeric nanoparticles (NPs have been intensively studied as a possible way to enhance anti-tumor efficacy while reducing side effects. ICD-85, derived from the venom of two separate species of venomous animals, has been shown to exhibit anti-cancer activity. In this report polymer based sodium alginate nanoparticles of ICD-85 was used to enhance its therapeutic effects and reduce its side effects. The inhibitory effect was evaluated by MTT assay. The necrotic effect was assessed using LDH assay. The induction of apoptosis was analyzed by caspase-8 colorimetric assay kit. Cytotoxicity assay in HeLa cells demonstrated enhanced efficacy of ICD-85 loaded NPs compared to the free ICD-85. The IC50 values obtained in HeLa cells after 48 h, for free ICD-85 and ICD-85 loaded NPs were 26±2.9μg ml-1 and 18±2.5μg ml-1, respectively. While it was observed that free ICD-85 exhibits mild cytotoxicity towards normal MRC-5 cells (IC50>60μg ml-1, ICD-85 loaded NPs was found to have higher efficacy in anti-proliferative activity on HeLa cells in vitro without any significant cytotoxic effect on normal MRC-5 cells. The apoptosis-induction mechanism by both form of ICD-85 on HeLa cells was found to be through activation of caspase-8 with approximately 2 fold greater of ICD-85 loaded NPs as compared to free ICD-85. Our work reveals that although ICD-85 in free form is relatively selective to inhibit the growth of cancer cells via apoptosis as compared to normal cells, but nanoparticulate form increases its selectivity towards cancer cells.

  6. Derivatives in emerging markets

    OpenAIRE

    Dubravko Mihaljek; Frank Packer

    2010-01-01

    Turnover of derivatives has grown more rapidly in emerging markets than in developed countries. Foreign exchange derivatives are the most commonly traded of all risk categories, with increasingly frequent turnover in emerging market currencies and a growing share of cross-border transactions. As the global reach of the financial centres in emerging Asia has expanded, the offshore trading of many emerging market currency derivatives has risen as well. Growth in derivatives turnover is positive...

  7. Usefulness Of Derivative Instruments In Emerging Markets: Turkish Experience

    OpenAIRE

    Cem Saatcioglu; Iskender Karagul; Ara G. Volkan

    2011-01-01

    This article presents an overview of derivative markets, definitions of derivative investment instruments, development of global derivative markets and the applicability of derivative markets in Turkey, given their economic value added to the Turkish economy. Readers will acquire insight into investing in various investment instruments and hedging against risk. Turkish derivative markets will be described, supportive statistical data will be presented, and readers will be introduced to the de...

  8. Maslow and Values Education

    Science.gov (United States)

    Farmer, Rodney

    1978-01-01

    Identifies major value bases which have been used to teach values in the classroom and outlines a values education program which stresses teaching about values without indoctrination. Based upon the hierarchy of human needs developed by psychologist Abraham Maslow, the program is based upon universal values, basic human needs, and recognition of…

  9. Giro form reading machine

    Science.gov (United States)

    Minh Ha, Thien; Niggeler, Dieter; Bunke, Horst; Clarinval, Jose

    1995-08-01

    Although giro forms are used by many people in daily life for money remittance in Switzerland, the processing of these forms at banks and post offices is only partly automated. We describe an ongoing project for building an automatic system that is able to recognize various items printed or written on a giro form. The system comprises three main components, namely, an automatic form feeder, a camera system, and a computer. These components are connected in such a way that the system is able to process a bunch of forms without any human interactions. We present two real applications of our system in the field of payment services, which require the reading of both machine printed and handwritten information that may appear on a giro form. One particular feature of giro forms is their flexible layout, i.e., information items are located differently from one form to another, thus requiring an additional analysis step to localize them before recognition. A commercial optical character recognition software package is used for recognition of machine-printed information, whereas handwritten information is read by our own algorithms, the details of which are presented. The system is implemented by using a client/server architecture providing a high degree of flexibility to change. Preliminary results are reported supporting our claim that the system is usable in practice.

  10. Mastering HTML5 forms

    CERN Document Server

    Gupta, Gaurav

    2013-01-01

    This tutorial will show you how to create stylish forms, not only visually appealing, but interactive and customized, in order to gather valuable user inputs and information.Enhance your skills in building responsive and dynamic web forms using HTML5, CSS3, and related technologies. All you need is a basic understanding of HTML and PHP.

  11. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  12. Value function in economic growth model

    Science.gov (United States)

    Bagno, Alexander; Tarasyev, Alexandr A.; Tarasyev, Alexander M.

    2017-11-01

    Properties of the value function are examined in an infinite horizon optimal control problem with an unlimited integrand index appearing in the quality functional with a discount factor. Optimal control problems of such type describe solutions in models of economic growth. Necessary and sufficient conditions are derived to ensure that the value function satisfies the infinitesimal stability properties. It is proved that value function coincides with the minimax solution of the Hamilton-Jacobi equation. Description of the growth asymptotic behavior for the value function is provided for the logarithmic, power and exponential quality functionals and an example is given to illustrate construction of the value function in economic growth models.

  13. Localization of bulk form fields on dilatonic domain walls

    International Nuclear Information System (INIS)

    Youm, Donam

    2001-06-01

    We study the localization properties of bulk form potentials on dilatonic domain walls. We find that bulk form potentials of any ranks can be localized as form potentials of the same ranks or one lower ranks, for any values of the dilaton coupling parameter. For large enough values of the dilaton coupling parameter, bulk form potentials of any ranks can be localized as form potentials of both the same ranks and one lower ranks. (author)

  14. Method for forming materials

    Science.gov (United States)

    Tolle, Charles R [Idaho Falls, ID; Clark, Denis E [Idaho Falls, ID; Smartt, Herschel B [Idaho Falls, ID; Miller, Karen S [Idaho Falls, ID

    2009-10-06

    A material-forming tool and a method for forming a material are described including a shank portion; a shoulder portion that releasably engages the shank portion; a pin that releasably engages the shoulder portion, wherein the pin defines a passageway; and a source of a material coupled in material flowing relation relative to the pin and wherein the material-forming tool is utilized in methodology that includes providing a first material; providing a second material, and placing the second material into contact with the first material; and locally plastically deforming the first material with the material-forming tool so as mix the first material and second material together to form a resulting material having characteristics different from the respective first and second materials.

  15. Weather Derivatives – Origin, Types and Application

    Directory of Open Access Journals (Sweden)

    Piotr Binkowski

    2008-01-01

    Full Text Available The number of companies that are exposed to the revenues loss risk caused by weather variability is still increasing. The businesses that are mostly exposed to weather risk are following: energy, agriculture, constructions and transport. That situation has initiated dynamic growth of weather derivatives markets as well as the awareness of the weather risk among the market participants. Presently, the weather derivatives markets evaluate rapidly in all the mature economies: USA, Asia and Europe. Constructing weather derivatives relies on qu- antifying climate factors in the form of indexes, what is quite simple task, more difficultly can be gathering precise historical data of required climate factors. Taking into consideration so far development of derivatives especially the financial derivatives based on different types of indexes financial market has at disposal wide range of different types of proved derivatives (futures, forward, options, swaps, which can be successfully utilised on the weather-driven markets both for hedging weather risk and speculating.

  16. Meteorite Dichotomy Implies that Jupiter Formed Early

    Science.gov (United States)

    Kruijer, T. S.; Burkhardt, C.; Budde, G.; Kleine, T.

    2018-05-01

    Meteorites derive from two distinct nebular reservoirs that co-existed and remained spatially separated between 1 and 3–4 Ma after CAIs. This can most easily be explained if Jupiter acted as a barrier and formed early, within less than 1 Ma.

  17. Parametric form of QCD travelling waves

    OpenAIRE

    Peschanski, R.

    2005-01-01

    We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.

  18. In Search of Public Value

    DEFF Research Database (Denmark)

    Pedersen, Dorthe

    This paper takes it point of departure in the vision of educating public leaders and managers with the ability to create public value in networked governance structure. The purpose of the paper it to revise this vision by unpacking the notion of public value in contemporary governance and discuss...... the implications for the public leadership and public leadership programs. Drawing on insights from sociology of law and governmentality a set of key tensions inherent in public value discourse are identified as the diagnostic impetus to consider the somewhat excessive leadership figure put forward...... in the literature. The paper shows that the notion of public value is rather contested and that it imply a certain kind of hybridization of public administration into opposing identity spheres. Instead of forming af 'whole system' as suggested in the literature, the hybridization implicate an ongoing suspension...

  19. Value system for distruptive innovation

    DEFF Research Database (Denmark)

    Li, Jizhen; Zhang, Si; Hu, Yimei

    After reviewing the theory of disruptive innovation, this paper forms a new framework for analyzing disruptive innovation from the perspective of value system, which suggests that the technology per se is the value source, industrial Ecosystem is the carrier, business model is the instrument...... and the market trajectory is the terminal, through the coordination of the elements in the value system the success of firms in disruptive innovation could be obtained and sustained. In other words, with the understanding of how value system works in disruptive innovation, the failure of incumbent firms may...... hopefully find its root. According to the framework, it summarizes different types of disruption that LED brings to traditional lighting industry in Guangdong Province, and proposes policy recommendations to accelerate the development of LED lighting industry in Guangdong Province....

  20. The Global Value Chain

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull

    The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool......The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool...

  1. Calculation and validation of heat transfer coefficient for warm forming operations

    Science.gov (United States)

    Omer, Kaab; Butcher, Clifford; Worswick, Michael

    2017-10-01

    In an effort to reduce the weight of their products, the automotive industry is exploring various hot forming and warm forming technologies. One critical aspect in these technologies is understanding and quantifying the heat transfer between the blank and the tooling. The purpose of the current study is twofold. First, an experimental procedure to obtain the heat transfer coefficient (HTC) as a function of pressure for the purposes of a metal forming simulation is devised. The experimental approach was used in conjunction with finite element models to obtain HTC values as a function of die pressure. The materials that were characterized were AA5182-O and AA7075-T6. Both the heating operation and warm forming deep draw were modelled using the LS-DYNA commercial finite element code. Temperature-time measurements were obtained from both applications. The results of the finite element model showed that the experimentally derived HTC values were able to predict the temperature-time history to within a 2% of the measured response. It is intended that the HTC values presented herein can be used in warm forming models in order to accurately capture the heat transfer characteristics of the operation.

  2. Geochemical characteristics of Carboniferous-Permian coal-formed gas in Bohai Bay Basin

    Energy Technology Data Exchange (ETDEWEB)

    Shipeng Huang; Fengrong Liao; Xiaoqi Wu [PetroChina, Beijing (China). Research Institute of Petroleum Exploration & Development

    2010-03-15

    Coal-formed gas reservoirs have been found in several depressions in Bohai Bay Basin. The gas was mainly generated by the Carboniferous-Permian coal measures, which are good source rocks. The exploration of coal-formed gas has a broad prospect. The main reservoirs of the coal-formed gas are Ordovician, Carboniferous-Permian, and Paleogene stratum. Coal-formed gas in the Bohai Bay Basin is chiefly composed of hydrocarbon gases. The percentage content of carbon dioxide is more than that of the nitrogen gas. The stable carbon isotope values of the hydrocarbon gases of different depressions and different reservoirs usually reversed. The reversed values of gas samples account for 52.1% of all the samples. Reversion values of the carbon isotope are mainly because of the mixing of gases from same source rocks but with different maturity. Among the three main reservoirs, coal-formed gas preserved in Paleogene stratum has the heaviest carbon isotope, the second is the gas in Carboniferous-Permian stratum, and the Ordovician gas possesses the lightest carbon isotope. Based on the analysis of the characteristics of carbon isotope of hydrocarbon gases in well Qishen-1 and the distribution of the Carboniferous-Permian coal measures, the gas of the well is derived from the high-matured Carboniferous-Permian coal measures.

  3. Value-based pricing

    Directory of Open Access Journals (Sweden)

    Netseva-Porcheva Tatyana

    2010-01-01

    Full Text Available The main aim of the paper is to present the value-based pricing. Therefore, the comparison between two approaches of pricing is made - cost-based pricing and value-based pricing. The 'Price sensitively meter' is presented. The other topic of the paper is the perceived value - meaning of the perceived value, the components of perceived value, the determination of perceived value and the increasing of perceived value. In addition, the best company strategies in matrix 'value-cost' are outlined. .

  4. Nitrogen fractionation in high-mass star-forming cores across the Galaxy

    Science.gov (United States)

    Colzi, L.; Fontani, F.; Rivilla, V. M.; Sánchez-Monge, A.; Testi, L.; Beltrán, M. T.; Caselli, P.

    2018-04-01

    The fractionation of nitrogen (N) in star-forming regions is a poorly understood process. To put more stringent observational constraints on the N-fractionation, we have observed with the IRAM-30m telescope a large sample of 66 cores in massive star-forming regions. We targeted the (1-0) rotational transition of HN13C, HC15N, H13CN and HC15N, and derived the 14N/15N ratio for both HCN and HNC. We have completed this sample with that already observed by Colzi et al. (2018), and thus analysed a total sample of 87 sources. The 14N/15N ratios are distributed around the Proto-Solar Nebula value with a lower limit near the terrestrial atmosphere value (˜272). We have also derived the 14N/15N ratio as a function of the Galactocentric distance and deduced a linear trend based on unprecedented statistics. The Galactocentric dependences that we have found are consistent, in the slope, with past works but we have found a new local 14N/15N value of ˜400, i.e. closer to the Prosolar Nebula value. A second analysis was done, and a parabolic Galactocentric trend was found. Comparison with Galactic chemical evolution models shows that the slope until 8 kpc is consistent with the linear analysis, while the flattening trend above 8 kpc is well reproduced by the parabolic analysis.

  5. Valuing future citizens' values regarding risk

    International Nuclear Information System (INIS)

    Fleming, Patricia

    2006-01-01

    Valuing present citizen's values regarding the risks they face is an important aspect of risk assessment and risk acceptability. Conferences like VALDOR are held for this reason. Governments like Sweden have national referendums on various risk-prone enterprises. The results of these referendums can determine the future of these programs. In the United States, when guidelines are set for determining acceptable levels of risk, the relevant federal agencies are often required to provide a comment period regarding proposed guidelines in order to ascertain the judgments, including the weights place on certain values, of individual members of society as well as stakeholder groups. After the comment period ends, the agency decides on the acceptable level of risk, taking into account the comments from present citizens. Do we also have a duty to value the not-yet-existing values of future citizens, especially if the risks created by the activities of present citizens extend into the future to citizens not yet living? If so, are there any circumstances which entitle us to de-value those not-yet-existing values. In this paper, I ground my discussion of the question of valuing future citizens' values in one of the areas of focus of the VALDOR conference: nuclear waste management and specifically the question facing the United States' program regarding an acceptable dose standard associated with the release of radioactivity into the biosphere from an underground repository. The underlying conference theme to which this discussion may be attached is community environmental justice as it applies to future citizens. I focus on the role that uncertainty plays is providing justice between present and future citizens

  6. Valuing future citizens' values regarding risk

    Energy Technology Data Exchange (ETDEWEB)

    Fleming, Patricia [Creighton Univ., Omaha (United States). College of Arts and Sciences/Philosophy

    2006-09-15

    Valuing present citizen's values regarding the risks they face is an important aspect of risk assessment and risk acceptability. Conferences like VALDOR are held for this reason. Governments like Sweden have national referendums on various risk-prone enterprises. The results of these referendums can determine the future of these programs. In the United States, when guidelines are set for determining acceptable levels of risk, the relevant federal agencies are often required to provide a comment period regarding proposed guidelines in order to ascertain the judgments, including the weights place on certain values, of individual members of society as well as stakeholder groups. After the comment period ends, the agency decides on the acceptable level of risk, taking into account the comments from present citizens. Do we also have a duty to value the not-yet-existing values of future citizens, especially if the risks created by the activities of present citizens extend into the future to citizens not yet living? If so, are there any circumstances which entitle us to de-value those not-yet-existing values. In this paper, I ground my discussion of the question of valuing future citizens' values in one of the areas of focus of the VALDOR conference: nuclear waste management and specifically the question facing the United States' program regarding an acceptable dose standard associated with the release of radioactivity into the biosphere from an underground repository. The underlying conference theme to which this discussion may be attached is community environmental justice as it applies to future citizens. I focus on the role that uncertainty plays is providing justice between present and future citizens.

  7. Value representations: a value based dialogue tool

    DEFF Research Database (Denmark)

    Petersen, Marianne Graves; Rasmussen, Majken Kirkegaard

    2011-01-01

    Stereotypic presumptions about gender affect the design process, both in relation to how users are understood and how products are designed. As a way to decrease the influence of stereotypic presumptions in design process, we propose not to disregard the aspect of gender in the design process......, as the perspective brings valuable insights on different approaches to technology, but instead to view gender through a value lens. Contributing to this perspective, we have developed Value Representations as a design-oriented instrument for staging a reflective dialogue with users. Value Representations...

  8. Package materials, waste form

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The schedules for waste package development for the various host rocks were presented. The waste form subtask activities were reviewed, with the papers focusing on high-level waste, transuranic waste, and spent fuel. The following ten papers were presented: (1) Waste Package Development Approach; (2) Borosilicate Glass as a Matrix for Savannah River Plant Waste; (3) Development of Alternative High-Level Waste Forms; (4) Overview of the Transuranic Waste Management Program; (5) Assessment of the Impacts of Spent Fuel Disassembly - Alternatives on the Nuclear Waste Isolation System; (6) Reactions of Spent Fuel and Reprocessing Waste Forms with Water in the Presence of Basalt; (7) Spent Fuel Stabilizer Screening Studies; (8) Chemical Interactions of Shale Rock, Prototype Waste Forms, and Prototype Canister Metals in a Simulated Wet Repository Environment; (9) Impact of Fission Gas and Volatiles on Spent Fuel During Geologic Disposal; and (10) Spent Fuel Assembly Decay Heat Measurement and Analysis

  9. Getting in-formed

    DEFF Research Database (Denmark)

    Hansbøl, Mikala

    det vi undersøger på form gennem vores beskrivelser. Paperet tager afsæt i empiriske eksempler fra et postdoc projekt om et såkaldt 'serious game' - Mingoville. Projektet følger circuleringer og etableringer af Mingoville 'på en global markedsplads'. I paperet diskuteres hvordan vi som forskere samler....../performer de fænomener vi forsker i. Aktør-Netværks-Teoretiker Bruno Latour (2005) pointerer at enhver beskrivelse også er en form for forklaring. En form for forklaring, der putter ting ind i et skript og dermed også putter ting på form. Paperet diskuterer to tilgange til at gøre serious games og derved skabe viden om...... engagementer med disse fænomener i serious games forskning: experimentel og etnografisk....

  10. NOAA Form 370 Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The data set contains information from submitted NOAA Form 370s, also known as the Fisheries Certificate of Origin, for imported shipments of frozen and/or processed...

  11. MAPS Appraisal Report Form

    CERN Multimedia

    HR Department

    2005-01-01

    As announced in Weekly Bulletin 48/2004, from now onwards, the paper MAPS appraisal report form has been replaced by an electronic form, which is available via EDH (on the EDH desktop under Other Tasks / HR & Training) No changes have been made to the contents of the form. Practical information will be available on the web page http://cern.ch/ais/projs/forms/maps/info.htm, and information meetings will be held on the following dates: 18 January 2005: MAIN AUDITORIUM (500-1-001) from 14:00 to 15:30. 20 January 2005: AB AUDITORIUM II (864-1-D02) from14:00 to 15:30. 24 January 2005: AT AUDITORIUM (30-7-018) from 10:00 to 11:30. Human Resources Department Tel. 73566

  12. VMS forms Output Tables

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These output tables contain parsed and format validated data from the various VMS forms that are sent from any given vessel, while at sea, from the VMS devices on...

  13. Science on form

    International Nuclear Information System (INIS)

    Ishizaka, Shozo; Kato, Yoshihiro; Takaki, Ryuji; Toriwaki, Jun-ichiro

    1987-01-01

    The purpose of the Symposium was to discuss interdisciplinal science aspects of form. 'Form' depends on the material and the changes. But, it is the form that appears evident at once and endures. Form is absorbed from every field as media of information. One part of the work covers the description of non-periodic phenomena, morphogenesis or evolution. Irreducible stubborn facts as diseases or social problems, or whatever else that could not be analyzed are integrally challenged to be systematized by computer simulation. The other part covers the finding of laws for determining how systems behave. Attention should be paid to pattern recognition, image processing and pattern formation. The Symposium proceeded with no parallel sessions, and participants from various fields made exciting discussions in an interdisciplinal atmosphere. (Auth.)

  14. Human rights values or cultural values? Pursuing values to maintain ...

    African Journals Online (AJOL)

    We argue that positive discipline in multicultural school environments needs to be based in part on human rights values that are neither solely universally interpreted nor particularistically interpreted. We report on the data generated at a research workshop held as the final dissemination process of a four-year international ...

  15. Access Customized Forms

    OpenAIRE

    Cosma Emil; Jeflea Victor

    2010-01-01

    By using Word, Excel or PowerPoint one can automate routine operations using the VBA language (Visual Basic for Applications). This language is also used in Access, allowing access to data stored in tables or queries. Thus, Access and VBA resources can be used together. Access is designed for programming forms and reports (among other things), so there won’t be found any of the VBA editor’s specific forms.

  16. Two forms for 3-uniform states of eight-qubits

    Science.gov (United States)

    Zha, Xinwei; Da, Zhang; Ahmed, Irfan; Zhang, Yanpeng

    2018-05-01

    In this paper, we study the relations between average bipartite entanglement and the n-tangle of eight-qubits. We have derived two forms for 3-uniform states of eight-qubits. One form has the n-tangle equal to zero; the other form has the n-tangle equal to unity.

  17. Interpreting two state instruments for intermediary values

    International Nuclear Information System (INIS)

    Good, R.R.

    1979-01-01

    Interpolating data from instruments which produce only two distinct binary outputs is discussed. The problem of determining void fraction, given an instrument which produces only a liquid or a no-liquid output, is used to demonstrate three different methods of data interpolation. The three methods involve a form of time averaging. The methods are signal amplitude histogram, signal derivative, and signal derivative discriminator. The advantages, disadvantages, and accuracies of each method are described

  18. Nucleon form factors in dispersively improved chiral effective field theory. II. Electromagnetic form factors

    Science.gov (United States)

    Alarcón, J. M.; Weiss, C.

    2018-05-01

    We study the nucleon electromagnetic form factors (EM FFs) using a recently developed method combining chiral effective field theory (χ EFT ) and dispersion analysis. The spectral functions on the two-pion cut at t >4 Mπ2 are constructed using the elastic unitarity relation and an N /D representation. χ EFT is used to calculate the real functions J±1(t ) =f±1(t ) /Fπ(t ) (ratios of the complex π π →N N ¯ partial-wave amplitudes and the timelike pion FF), which are free of π π rescattering. Rescattering effects are included through the empirical timelike pion FF | Fπ(t) | 2 . The method allows us to compute the isovector EM spectral functions up to t ˜1 GeV2 with controlled accuracy (leading order, next-to-leading order, and partial next-to-next-to-leading order). With the spectral functions we calculate the isovector nucleon EM FFs and their derivatives at t =0 (EM radii, moments) using subtracted dispersion relations. We predict the values of higher FF derivatives, which are not affected by higher-order chiral corrections and are obtained almost parameter-free in our approach, and explain their collective behavior. We estimate the individual proton and neutron FFs by adding an empirical parametrization of the isoscalar sector. Excellent agreement with the present low-Q2 FF data is achieved up to ˜0.5 GeV2 for GE, and up to ˜0.2 GeV2 for GM. Our results can be used to guide the analysis of low-Q2 elastic scattering data and the extraction of the proton charge radius.

  19. Hunters' motivations and values:

    DEFF Research Database (Denmark)

    Radder, Laetitia; Bech-Larsen, Tino

    2008-01-01

    This article examines the values and motivations of South African biltong hunters. A hierarchical value map of associations between attributes, consequences and values resulted from laddering interviews with 34 hunters. The Means-End Chain approach proved useful in identifying: (a) personal value...

  20. Five Values of Giftedness

    Science.gov (United States)

    Besjes-de Bock, Karin M.; de Ruyter, Doret J.

    2011-01-01

    This article describes five values attributed to giftedness. The ascription of values to this phenomenon resembles values attached to gifts in gift-giving processes. Whereas gift-giving often includes expectations of reciprocity, each gift possesses a numerical, utility, social, personal, and intrinsic value. Developmental models of giftedness and…