Receptor theory and biological constraints on value.

Science.gov (United States)

Berns, Gregory S; Capra, C Monica; Noussair, Charles

2007-05-01

Modern economic theories of value derive from expected utility theory. Behavioral evidence points strongly toward departures from linear value weighting, which has given rise to alternative formulations that include prospect theory and rank-dependent utility theory. Many of the nonlinear forms for value assumed by these theories can be derived from the assumption that value is signaled by neurotransmitters in the brain, which obey simple laws of molecular movement. From the laws of mass action and receptor occupancy, we show how behaviorally observed forms of nonlinear value functions can arise.

Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

International Nuclear Information System (INIS)

Zabadal, J.; Vilhena, M.T.; Segatto, C.F.; Pazos, R.P.Ruben Panta.

2002-01-01

In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations

Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

Energy Technology Data Exchange (ETDEWEB)

Zabadal, J. E-mail: jorge.zabadal@ufrgs.br; Vilhena, M.T. E-mail: vilhena@mat.ufrgs.br; Segatto, C.F. E-mail: cynthia@mat.ufrgs.br; Pazos, R.P.Ruben Panta. E-mail: rpp@mat.pucrgs.br

2002-07-01

In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations.

Reference Values for Spirometry Derived Using Lambda, Mu, Sigma (LMS) Method in Korean Adults: in Comparison with Previous References.

Science.gov (United States)

Jo, Bum Seak; Myong, Jun Pyo; Rhee, Chin Kook; Yoon, Hyoung Kyu; Koo, Jung Wan; Kim, Hyoung Ryoul

2018-01-15

The present study aimed to update the prediction equations for spirometry and their lower limits of normal (LLN) by using the lambda, mu, sigma (LMS) method and to compare the outcomes with the values of previous spirometric reference equations. Spirometric data of 10,249 healthy non-smokers (8,776 females) were extracted from the fourth and fifth versions of the Korea National Health and Nutrition Examination Survey (KNHANES IV, 2007-2009; V, 2010-2012). Reference equations were derived using the LMS method which allows modeling skewness (lambda [L]), mean (mu [M]), and coefficient of variation (sigma [S]). The outcome equations were compared with previous reference values. Prediction equations were presented in the following form: predicted value = e{a + b × ln(height) + c × ln(age) + M - spline}. The new predicted values for spirometry and their LLN derived using the LMS method were shown to more accurately reflect transitions in pulmonary function in young adults than previous prediction equations derived using conventional regression analysis in 2013. There were partial discrepancies between the new reference values and the reference values from the Global Lung Function Initiative in 2012. The results should be interpreted with caution for young adults and elderly males, particularly in terms of the LLN for forced expiratory volume in one second/forced vital capacity in elderly males. Serial spirometry follow-up, together with correlations with other clinical findings, should be emphasized in evaluating the pulmonary function of individuals. Future studies are needed to improve the accuracy of reference data and to develop continuous reference values for spirometry across all ages. © 2018 The Korean Academy of Medical Sciences.

A novel thiamine-derived pigment, pyrizepine, formed by the Maillard reaction.

Science.gov (United States)

Igoshi, Asuka; Noda, Kyoko; Murata, Masatsune

2018-04-26

To find a Maillard pigment derived from thiamine, a solution containing glucose and thiamine was heated and analyzed with high-performance liquid chromatography equipped with diode-array detection. As a result, a unique peak showing an absorption maximum at 380 nm was detected. This peak was then isolated from a reaction solution containing glucose, lysine and thiamine, and was identified as 1-(2-methyl-6,9-dihydro-5H-pyrimido[4,5-e][1,4]diazepin-7-yl)ethan-1-one using instrumental analyses. This compound, named pyrizepine, was a novel yellow pigment having a fused ring consisting of pyrimidine and diazepine. Pyrizepine was a major low-molecular-weight pigment in the reaction solution. The structure suggests that pyrizepine is formed by condensation reaction between a degradation product of thiamine and a tetrosone derivative formed from glucose by the Maillard reaction.

Clearing and settlement of exchange traded derivatives

OpenAIRE

John McPartland

2009-01-01

Derivatives are a class of financial instruments that derive their value from some underlying commodity, security, index, or other asset. Futures and options are common forms of derivatives. This article explains how clearing and settlement systems for exchange traded derivatives work.

Pricing a Collateralized Derivative Trade with a Funding Value Adjustment

Directory of Open Access Journals (Sweden)

Chadd B. Hunzinger

2015-01-01

Full Text Available The 2008 credit crisis changed the manner in which derivative trades are conducted. One of these changes is the posting of collateral in a trade to mitigate the counterparty credit risk. Another is the realization that banks are not risk-free and, as a result, cannot borrow at the risk-free rate any longer. The latter led banks to introduced the controversial adjustment to derivative prices, known as a funding value adjustment (FVA, which is interlinked with the posting of collateral. In this paper, we extend the Cox, Ross and Rubinstein (CRR discrete-time model to include collateral and FVA. We prove that this derived model is a discrete analogue of Piterbarg’s partial differential equation (PDE, which describes the price of a collateralized derivative. The fact that the two models coincide is also verified by numerical implementation of the results that we obtain.

Value Encounters - Modeling and Analyzing Co-creation of Value

Science.gov (United States)

Weigand, Hans

Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value encounters are defined as interaction spaces where a group of actors meet and derive value by each one bringing in some of its own resources. They can be analyzed from multiple strategic perspectives, including knowledge management, social network management and operational management. Value encounter modeling can be instrumental in the context of service analysis and design.

Relations between elliptic multiple zeta values and a special derivation algebra

International Nuclear Information System (INIS)

Broedel, Johannes; Matthes, Nils; Schlotterer, Oliver

2016-01-01

We investigate relations between elliptic multiple zeta values (eMZVs) and describe a method to derive the number of indecomposable elements of given weight and length. Our method is based on representing eMZVs as iterated integrals over Eisenstein series and exploiting the connection with a special derivation algebra. Its commutator relations give rise to constraints on the iterated integrals over Eisenstein series relevant for eMZVs and thereby allow to count the indecomposable representatives. Conversely, the above connection suggests apparently new relations in the derivation algebra. Under https://tools.aei.mpg.de/emzv we provide relations for eMZVs over a wide range of weights and lengths. (paper)

Valuing call options on single stock futures: Does the put-call parity relationship hold in the South African derivatives market?

Directory of Open Access Journals (Sweden)

Biebuyck, A.

2014-09-01

Full Text Available Research has shown that violations of put-call parity do occur and that these violations present an investor with opportunities to profit from arbitrage deals. Mispricing may lead to significant superior returns and maximisation of shareholders’ wealth if found and acted upon in a timely manner. This study attempts to determine whether this mispricing of financial derivatives is present in the South African derivatives market. This will be achieved through the valuation of options on single stock futures using the put-call parity relationship. The theoretical fair values obtained, is compared to the actual market values over a period of three years, that is, from 2009 to 2011. The results show that arbitrage opportunities do present themselves for the chosen shares. Further research may involve more shares over a longer period to determine whether any pattern may exist which may form the basis of an arbitrage trading strategy

Tumor cell-derived microparticles: a new form of cancer vaccine.

Science.gov (United States)

Zhang, Huafeng; Huang, Bo

2015-08-01

For cancer vaccines, tumor antigen availability is currently not an issue due to technical advances. However, the generation of optimal immune stimulation during vaccination is challenging. We have recently demonstrated that tumor cell-derived microparticles (MP) can function as a new form of potent cancer vaccine by efficiently activating type I interferon pathway in a cGAS/STING dependent manner.

Derivative spectrophotometric method for simultaneous determination of clindamycin phosphate and tretinoin in pharmaceutical dosage forms.

Science.gov (United States)

Barazandeh Tehrani, Maliheh; Namadchian, Melika; Fadaye Vatan, Sedigheh; Souri, Effat

2013-04-10

A derivative spectrophotometric method was proposed for the simultaneous determination of clindamycin and tretinoin in pharmaceutical dosage forms. The measurement was achieved using the first and second derivative signals of clindamycin at (1D) 251 nm and (2D) 239 nm and tretinoin at (1D) 364 nm and (2D) 387 nm.The proposed method showed excellent linearity at both first and second derivative order in the range of 60-1200 and 1.25-25 μg/ml for clindamycin phosphate and tretinoin respectively. The within-day and between-day precision and accuracy was in acceptable range (CVpharmaceutical dosage form.

Photophysical properties of columnar phases formed by triphenylene derivatives

International Nuclear Information System (INIS)

Sigal, Herve

1997-01-01

This research thesis reports the study of the spectroscopic properties and of the migration of excitation energy in the singlet state in columnar phases formed by alkyloxy and alkylthio derivatives of triphenylene. First, the author studied the spectroscopic properties of chromophores in solutions, and characterized excited states by using computation codes (CS-INDO-CIPSI). Then, by using the excitonic theory in the case of the considered triphenylene derivatives, the author studied the influence of molecular movements and of the intra-columnar order on the spectroscopic properties. In some circumstances, the non-radiative transfer of excitation energy is governed by a mechanism displaying a random evolution. This stochastic movement is studied by using Monte Carlo simulations. The author shows that the energy migration is one-dimensional on short times, and then becomes three-dimensional. The evolution of excitation energy in space and in time is determined [fr

Forming value orientations on healthy lifestyle among students

Directory of Open Access Journals (Sweden)

Bugaeva I.O.

2017-06-01

Full Text Available This work contains the model of forming the students' value priorities on healthy lifestyle based on the following levels: influence of the government, influence of the educational institution, influence of surrounding community, and self-motivation. The analysis of government motivation system used in Russia is given as well as how this policy integrated into the activities of the educational institution (on example of Saratov State Medical University n.a. V. I. Razumovsky.

Assessment of ECISS draft standard for derivation of high temperature proof strength values

Energy Technology Data Exchange (ETDEWEB)

Linde, L.; Sandstroem, R.

1996-03-01

New European material standards are under development and modern data evaluation techniques must be able to supply these standards with accurate design values. A draft standard for the derivation of high temperature proof strength values has been proposed. This standard (EDS) has been used to calculate strength values for six steels; one unalloyed steel, one 12 % Cr steel and four austenitic stainless steels. Although large data sets were available, it was not possible to satisfy the requirement in the EDS of 80 % temperature coverage in the proof strength data for several steels. It suggests that temperature coverage specified in the EDS is unrealistically high. Due to the limited number of heats satisfying the temperature coverage requirements for each steel, the statistical error in the derived values exceeds 10-20 % which must be considered as unacceptably high. Instead it is recommended that the full data sets are used irrespective of temperature coverage. The variation of proof strength values represented by the analysed heats did not cover the corresponding variation in the larger data set available. This was the case even for the steel where 16 heats satisfied the temperature coverage requirement. Thus a limited number of heats can not be expected to be a good representation of more complete data sets. This has the consequence that absolute strength values can not be derived without access to a standardised proof strength at room temperature. Two derivation methods investigated in this report are both based on the ISO 2605/III procedure for proof strength assessments at elevated temperature. Method I and II use an essentially temperature independent and temperature dependent reduction term respectively. The methods have been assessed by the same data sets for the six steels. One or both methods gave satisfactory results for most of the investigated steels. Presented results are based on work carried out in ECISS TC22 WG1. 17 refs, 20 figs, 7 tabs.

Prospective Teachers' Reactions to "Right-or-Wrong" Tasks: The Case of Derivatives of Absolute Value Functions

Science.gov (United States)

Tsamir, Pessia; Rasslan, Shaker; Dreyfus, Tommy

2006-01-01

This paper illustrates the role of a "Thinking-about-Derivatives" task in identifying learners' derivative conceptions and for promoting their critical thinking about derivatives of absolute value functions. The task included three parts: "Define" the derivative of a function f(x) at x = x[subscript 0], "Solve-if-Possible" the derivative of f(x) =…

The Forms of Value: Problems of Convertibility in Field Theory

Directory of Open Access Journals (Sweden)

Göran Bolin

2012-01-01

Full Text Available Media production in late capitalism is often measured in terms of economic value. If value is defined as the worth of a thing, a standard or measure, being the result of social praxis and negotiation between producers and consumers in various combinations, it follows that this worth can be of other kinds than the mere economic. This is, for example, the reasoning behind field theory (Bourdieu, where the generation of field-specific capital (value is deeply dependent on the belief shared by the competing agents within the field. The full extent of the consequences of such a theory of convertibility between fields of cultural production, centred on different forms of value, is, however yet to be explored. This is the task of this article. It especially focuses on how value is constructed differently depending on the relations of the valuing subject to the production process, something that becomes highly relevant in digital media environments, where users are increasingly drawn into the production process.

Synthesis and complex forming property of phosphor acid derivatives

International Nuclear Information System (INIS)

Babaev, B.N.

2004-01-01

Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from

Energy derivatives, experiences in derivative trading from the natural gas industry : back to basics

International Nuclear Information System (INIS)

Dittmer, G.; Coyle, T.

1998-01-01

Some basic facts regarding derivatives in the electric power industry were discussed based on experiences in the natural gas industry. Derivatives were described as financial instruments that have no value of their own but derive their value from other assets, such as commodities. Futures and Options are the two forms of derivatives. Electricity as a commodity was characterized, and a historical parallel was drawn between deregulation in the natural gas and electric power industry. Short term and long term factors impacting the market and market dynamics impacting derivatives were identified. The latter include: (1) volatility, (2) liquidity, (3) correlations, and (4) price discovery. In contrast to the natural gas market, the electricity market is considered as lacking liquidity and in need of moving farther along the maturity timeline. The question of natural gas/ electricity convergence was also addressed refs., tabs., figs

A generalized form of the Bernoulli Trial collision scheme in DSMC: Derivation and evaluation

Science.gov (United States)

Roohi, Ehsan; Stefanov, Stefan; Shoja-Sani, Ahmad; Ejraei, Hossein

2018-02-01

The impetus of this research is to present a generalized Bernoulli Trial collision scheme in the context of the direct simulation Monte Carlo (DSMC) method. Previously, a subsequent of several collision schemes have been put forward, which were mathematically based on the Kac stochastic model. These include Bernoulli Trial (BT), Ballot Box (BB), Simplified Bernoulli Trial (SBT) and Intelligent Simplified Bernoulli Trial (ISBT) schemes. The number of considered pairs for a possible collision in the above-mentioned schemes varies between N (l) (N (l) - 1) / 2 in BT, 1 in BB, and (N (l) - 1) in SBT or ISBT, where N (l) is the instantaneous number of particles in the lth cell. Here, we derive a generalized form of the Bernoulli Trial collision scheme (GBT) where the number of selected pairs is any desired value smaller than (N (l) - 1), i.e., Nsel < (N (l) - 1), keeping the same the collision frequency and accuracy of the solution as the original SBT and BT models. We derive two distinct formulas for the GBT scheme, where both formula recover BB and SBT limits if Nsel is set as 1 and N (l) - 1, respectively, and provide accurate solutions for a wide set of test cases. The present generalization further improves the computational efficiency of the BT-based collision models compared to the standard no time counter (NTC) and nearest neighbor (NN) collision models.

Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.

Science.gov (United States)

Hotzel, Konrad; Heinze, Thomas

2016-11-03

An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

When do derivatives add value in asset allocation problems for pension funds?

NARCIS (Netherlands)

Cui, J.; Oldenkamp, B.; Vellekoop, M.

2013-01-01

Recent surveys indicate that many pension-fund participants aim for higher retirement income security. We investigate the added value of including derivatives in the portfolio of pension funds to achieve this goal. To do so, we define preferences that incorporate specific features of pension funds,

Value Forming Education of Prospective Primary School Teachers in Kazakhstan and Germany

Science.gov (United States)

Utyupova, Gulnara Ye.; Baiseitova, Zhanar B.; Mukhamadiyeva, Aizhan A.

2016-01-01

Value education is one of the most effective forms of education. However, this system is applied only in developed countries due to a number of factors. The purpose of this study is to develop a method for training primary school teachers capable of implementing the value education system in developing countries. Teachers not only conveys…

Efect of diferent rates of phosphorus and forms of application in the efficiency of triple superphosphate in a soil derived from volcanic ashes

International Nuclear Information System (INIS)

Pino, I.; Casas, L.

1988-01-01

Greenhouse experiments with a soil derived from volcanic ash were carried out in order to determine the efficiency of triple Superphosphate with different rates and forms of application. Oat (Avena Sativa L.) was used as reference crop. The P 32 labeled fertilizer was applied located 2,5 cm underneath the seeds. At the same time 500 mg P were applied located, mixed and in the surface of the soil. The P in the plant coming from the fertilizer was about 65%. This value was independent from the rates. The A value showed some fluctuations with the utmost rates of P. The fertilizer applied located and in the surface of the soil proved to be the most efficient form of application. The A value useful to compare the different treatments. The fertilizer efficiency was very low in both experiments, being the higher efficiency (5,9%) at the lowest rate which is not associated to a higher production. The best treatment was obtained with 500 mg of P located underneath the seed. (author)

The comparison of physical properties derived from gas and dust in a massive star-forming region

Energy Technology Data Exchange (ETDEWEB)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

2014-05-10

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

The comparison of physical properties derived from gas and dust in a massive star-forming region

International Nuclear Information System (INIS)

Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

2014-01-01

We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

Theoretical foundations of forming value orientation of pupils by means of school sports abroad

Directory of Open Access Journals (Sweden)

I.Kh. Turchyk

2014-06-01

Full Text Available Purpose: to determine the theoretical basis for the formation of value orientations of pupils by means of school sports facilities abroad. Material: detailed analysis of 14 published sources. Results: found that in a foreign academic and journalistic literature dominates positive appreciation of cultural values of humanistic school sports in the formation of value orientations of pupils. Found that school sport abroad plays an important role not only as a means of forming the basic values - health, but also an important area of communication, the manifestations of social activity. As well as physical and mental form of organization and leisure facilities, excellent vehicle impacts on other values of human life: the authority and position in society, work, the structure of moral and volitional characteristics, aesthetic ideals and other value orientations. Conclusions: confirmed that the global experience of formation values pupil means school sports deserves attention and requires selective introduction into the domestic education system.

Two forms of Vibrio cholerae O1 El Tor hemolysin derived from identical precursor protein.

Science.gov (United States)

Ikigai, H; Ono, T; Nakae, T; Otsuru, H; Shimamura, T

1999-01-08

Vibrio cholerae O1 grown in heart infusion broth produces two forms of El Tor hemolysin (ETH) monomers of 65 and 50 kDa. These monomers form several different sizes of mixed oligomers ranging from 180 to 280 kDa in the liposomal membranes. We found that the N-terminal amino acid sequences, NH2-Trp-Pro-Ala-Pro-Ala-Asn-Ser-Glu, of both the 65- and 50-kDa toxins were identical. We assumed, therefore, that the 65- and 50-kDa toxins were derivatives of the identical precursor protein and the 50-kDa protein was a truncated derivative of 65-kDa ETH. To substantiate this assumption, we treated the 260-kDa oligomer with trypsin and obtained a 190-kDa oligomer. This 190-kDa oligomer consisted of only the 50-kDa subunits. Both 260- and 190-kDa oligomers formed ion channels indistinguishable from each other in planar lipid bilayers. These results suggest that the essential part of the ETH in forming the membrane-damaging aggregate is a 50-kDa protein.

Derivation of an oral toxicity reference value for nickel.

Science.gov (United States)

Haber, Lynne T; Bates, Hudson K; Allen, Bruce C; Vincent, Melissa J; Oller, Adriana R

2017-06-15

Nickel (Ni) is in the earth's crust and can be found in environmental compartments such as water, soil, and air, as well as food. This paper presents an assessment of the oral nickel toxicity data in support of non-cancer health-based oral exposure limits or toxicity reference values (TRVs). This paper derives TRVs for three populations of interest: adults, toddlers, and people who have been dermally sensitized to nickel. The adult/lifetime TRV of 20 μg Ni/kg-day is based on post-implantation loss/perinatal mortality in a 2-generation reproductive study in rats. Several recent assessments by regulatory agencies have used the same study and endpoint, but the dose-response modeling conducted here was more appropriate for the study design. Toxicokinetic data from rats and humans indicate that the applied uncertainty factors are very conservative. Because the endpoint relates to fetal exposure and is not relevant to toddlers, a toddler TRV was derived based on decreased body weight in young rats; this TRV was also 20 μg Ni/kg-day. A separate TRV of 4 μg Ni/kg in addition to Ni in food was derived for protection of nickel-sensitized populations from flare-up of dermatitis, based on studies of single exposures in humans under conditions that maximize oral absorption. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Induced pluripotent stem cell-derived cardiac progenitors differentiate to cardiomyocytes and form biosynthetic tissues.

Directory of Open Access Journals (Sweden)

Nicolas Christoforou

Full Text Available The mammalian heart has little capacity to regenerate, and following injury the myocardium is replaced by non-contractile scar tissue. Consequently, increased wall stress and workload on the remaining myocardium leads to chamber dilation, dysfunction, and heart failure. Cell-based therapy with an autologous, epigenetically reprogrammed, and cardiac-committed progenitor cell source could potentially reverse this process by replacing the damaged myocardium with functional tissue. However, it is unclear whether cardiac progenitor cell-derived cardiomyocytes are capable of attaining levels of structural and functional maturity comparable to that of terminally-fated cardiomyocytes. Here, we first describe the derivation of mouse induced pluripotent stem (iPS cells, which once differentiated allow for the enrichment of Nkx2-5(+ cardiac progenitors, and the cardiomyocyte-specific expression of the red fluorescent protein. We show that the cardiac progenitors are multipotent and capable of differentiating into endothelial cells, smooth muscle cells and cardiomyocytes. Moreover, cardiac progenitor selection corresponds to cKit(+ cell enrichment, while cardiomyocyte cell-lineage commitment is concomitant with dual expression of either cKit/Flk1 or cKit/Sca-1. We proceed to show that the cardiac progenitor-derived cardiomyocytes are capable of forming electrically and mechanically coupled large-scale 2D cell cultures with mature electrophysiological properties. Finally, we examine the cell progenitors' ability to form electromechanically coherent macroscopic tissues, using a physiologically relevant 3D culture model and demonstrate that following long-term culture the cardiomyocytes align, and form robust electromechanical connections throughout the volume of the biosynthetic tissue construct. We conclude that the iPS cell-derived cardiac progenitors are a robust cell source for tissue engineering applications and a 3D culture platform for pharmacological

Anomalous vacuum expectation values

International Nuclear Information System (INIS)

Suzuki, H.

1986-01-01

The anomalous vacuum expectation value is defined as the expectation value of a quantity that vanishes by means of the field equations. Although this value is expected to vanish in quantum systems, regularization in general produces a finite value of this quantity. Calculation of this anomalous vacuum expectation value can be carried out in the general framework of field theory. The result is derived by subtraction of divergences and by zeta-function regularization. Various anomalies are included in these anomalous vacuum expectation values. This method is useful for deriving not only the conformal, chiral, and gravitational anomalies but also the supercurrent anomaly. The supercurrent anomaly is obtained in the case of N = 1 supersymmetric Yang-Mills theory in four, six, and ten dimensions. The original form of the energy-momentum tensor and the supercurrent have anomalies in their conservation laws. But the modification of these quantities to be equivalent to the original one on-shell causes no anomaly in their conservation laws and gives rise to anomalous traces

New oxirane derivatives of 1,4-naphthoquinones and their evaluation against T. cruzi epimastigote forms.

Science.gov (United States)

Carneiro, Paula F; do Nascimento, Samara B; Pinto, Antonio V; Pinto, Maria do Carmo F R; Lechuga, Guilherme C; Santos, Dilvani O; dos Santos Júnior, Helvécio M; Resende, Jackson A L C; Bourguignon, Saulo C; Ferreira, Vitor F

2012-08-15

New oxirane derivatives were synthesized using six naphthoquinones as the starting materials. Our biological results showed that these oxiranes acted as trypanocidal agents against Trypanosoma cruzi with minimal cytotoxicity in the VERO cell line compared to naphthoquinones. In particular, oxirane derivative 14 showed low cytotoxicity in a mammalian cell line and exhibited better activity against epimastigote forms of T.cruzi than the current drug used to treat Chagas disease, benznidazole. Copyright © 2012 Elsevier Ltd. All rights reserved.

Derivation of endogenous equivalent values to support risk assessment and risk management decisions for an endogenous carcinogen: Ethylene oxide.

Science.gov (United States)

Kirman, C R; Hays, S M

2017-12-01

An approach is presented for ethylene oxide (EO) to derive endogenous equivalent (EE) values, which are endogenous levels normally found within the body expressed in terms of exogenous exposures. EE values can be used to support risk assessment and risk management decisions for chemicals such as EO that have both endogenous and exogenous exposure pathways. EE values were derived using a meta-analysis of data from the published literature characterizing the distribution for an EO biomarker of exposure, hemoglobin N-(2-hydroxyethyl)-valine (HEV), in unexposed populations. These levels are compared to the those reported in exposed populations (smokers, workers). Correlation between the biomarker of exposure and external exposures of EO were applied to this distribution to determine corresponding EE values, which range from 0.13 to 6.9 ppb for EO in air. These values are orders of magnitude higher than risk-based concentration values derived for EO using default methods, and are provided as a pragmatic, data-driven alternative approach to managing the potential risks from exogenous exposures to EO. Copyright © 2017 Elsevier Inc. All rights reserved.

Characteristic values for the forming of the magnesium alloy AZ31

International Nuclear Information System (INIS)

Doege, E.; Janssen, S.; Wieser, J.

2001-01-01

The aim of investigation and development at the institute for metal forming and metal forming machine tools (IFUM) at the University of Hanover, Germany is to advance magnesium forming scientifically which has so far been based on experience and empirically determined process data only. Optimized process parameter with a sound material scientific and process control base have to be determined for the deformation of magnesium wrought alloys in order to broaden the technical use of such alloys. Aim of the investigations introduced in this paper is the determination of characteristic values as well-founded basis for the forming technological processing of magnesium wrought alloys in massive forming processes. The basic data for the description of the deformation ability in the form of friction factor and flow curve is to be detected, especially in connection with the integration into an FEM-simulation. In order to achieve such data for the magnesium wrought alloy AZ31 the flow curve at temperatures between 250 and 300 C and the deformation ratio 1, 10, 20 and 30 are presented. On the other hand a ring upsetting test for the determination of the friction factor at altitude reductions of 30, 50, 70%, a tool temperature of 200 C, a work piece temperature between 300 and 400 C and different lubricants are shown for the said alloy. (orig.)

Reproductive value, sensitivity, and nonlinearity: Population-management heuristics derived from classical demography

OpenAIRE

Karsten R.; Teismann H.; Vogels A.

2013-01-01

In classical demographic theory, reproductive value and stable age distribution are proportional to the sensitivities of the asymptotic population size to changes in mortality and maternity, respectively. In this note we point out that analogous relationships hold if the maternity function is allowed to depend on the population density. The relevant formulae can essentially be obtained by replacing the growth rate ("Lotka'sr") with zero. These facts may be used to derive heuristics for popula...

The additional value of bioelectrical impedance analysis-derived muscle mass as a screening tool in geriatric assessment for fall prevention.

Science.gov (United States)

Van Puyenbroeck, Karolien; Roelandts, Lieven; Van Deun, Thomas; Van Royen, Paul; Verhoeven, Veronique

2012-01-01

The decline in skeletal muscle in old age is a factor in the development of functional limitations. The objective of this study was to assess if there is a correlation between muscle mass based on bioelectrical impedance analysis (BIA) detection and the fall incidence in nursing home residents and to examine the risk factors for falling in nursing home residents. This prospective cohort study was part of a longitudinal study on nutritional issues in 52 nursing homes in Antwerp (Belgium) from October 2007 to April 2008. Two hundred and seventy-six people aged 65 years and older were included. Each subject was assessed with BIA, the timed get-up-and-go test, the Katz score, the Mini Nutritional Assessment - Short Form and the 36-Item Short Form Health Survey. The primary outcome parameter was fall incidence during the study. The prevalence of sarcopenia varied from 24.3 to 81.5% depending on which definition was used. No association was found between BIA-derived muscle mass and fall incidence. Logistic regression analysis showed that gait speed (odds ratio 1.029; p = 0.003) and mental health (odds ratio 0.981; p = 0.015) are significantly associated with fall incidence in nursing homes. A receiver operating characteristic curve showed that none of the BIA-derived muscle parameters are good predictors of the risk of falling. This study shows that there is no association between sarcopenia based on BIA and fall incidence and that BIA-derived muscle mass has no additional value in predicting fall incidents compared to the timed get-up-and-go test. Copyright © 2012 S. Karger AG, Basel.

The COS Method : An Efficient Fourier Method for Pricing Financial Derivatives

NARCIS (Netherlands)

Fang, F.

2010-01-01

When valuing and risk-managing financial derivatives, practitioners demand fast and accurate prices and sensitivities. Aside from the pricing of non-standard exotic financial derivatives, so-called plain vanilla European options form the basis for the calibration of financial models. As any pricing

Global solutions to the initial-boundary value problem for the quasilinear viscoelastic equation with a derivative nonlinearity

Directory of Open Access Journals (Sweden)

Mitsuhiro Nakao

2014-01-01

Full Text Available We prove the existence and uniqueness of a global decaying solution to the initial boundary value problem for the quasilinear wave equation with Kelvin-Voigt dissipation and a derivative nonlinearity. To derive the required estimates of the solutions we employ a 'loan' method and use a difference inequality on the energy.

Value Priorities and Behavior: Applying a Theory of Integrated Value Systems

Directory of Open Access Journals (Sweden)

Shalom Schwartz

2016-02-01

Full Text Available A major goal of research on values has been to relate individual differences in value priorities to differences in attitudes, behavior and background variables. Past research most commonly adopted one of two approaches. Much research has selected a few single target values whose priorities were postulated to associate with the attitude, behavior and background variable of interest and then examined empirical relationships. Other research has been more exploratory.It has related lists of values to various other variables and then discussed the significant associations that emerge. The focus on relationships with single values make both these approaches insatisfying. My work has sought to overcome those approaches.It has derived what may be a nearly comprehensive set of different motivational types of values, recognized across cultures. Each value type is represented by a number of single values that are combined to form relatively reliable indexes of values priorities. Value systems can be treated as integrated wholes in their relations with behaviors and, thereby, encourages researches to abandom the prevailing single-values approaches. 

Can recent pan-tropical biomass maps be used to derive alternative Tier 1 values for reporting REDD+ activities under UNFCCC?

International Nuclear Information System (INIS)

Langner, Andreas; Achard, Frédéric; Grassi, Giacomo

2014-01-01

The IPCC Guidelines propose 3 Tier levels for greenhouse gas monitoring within the forest land category with a hierarchical order in terms of accuracy, data requirements and complexity. Due to missing data and/or capacities, many developing countries, potentially interested in the reducing emissions from deforestation and forest degradation scheme, have to rely on Tier 1 default values with highest uncertainties. A possible way to increase the credibility of uncertain estimates is to apply a conservative approach, for which standard statistical information is needed. However, such information is currently not available for the IPCC values. In our study we combine a recent global forest mask, an ecological zoning map and the pan-tropical AGB datasets of Saatchi and Baccini to derive mean forest AGB values per ecological zone and continent as well as their corresponding confidence intervals. Such analysis can be considered transparent as the datasets/methodologies are well documented. Our study leads to alternative Tier 1 values and allows the application of statistically-based conservative approaches. Our AGB estimates derived from Saatchi and Baccini datasets are 35% and 24% lower respectively than the IPCC values. When restricting the analysis to intact forest landscapes resulting ABG estimates derived from Saatchi and Baccini datasets get closer to the IPCC values with 13% and 1% differences respectively (underestimation). This suggests that the IPCC default values are mainly based on plots in mature forest stands. However, as tropical forests generally consist of a mixture of intact and degraded stands, the use of IPCC values may not properly reflect the reality. Finally, we propose to use the average composite of the Saatchi and Baccini datasets to produce improved alternative IPCC Tier 1 values. The values derived from such approach can easily be updated when newer and/or improved pan-tropical AGB maps will be available. (letter)

Water saturation in shaly sands: logging parameters from log-derived values

International Nuclear Information System (INIS)

Miyairi, M.; Itoh, T.; Okabe, F.

1976-01-01

The methods are presented for determining the relation of porosity to formation factor and that of true resistivity of formation to water saturation, which were investigated through the log interpretation of one of the oil and gas fields of northern Japan Sea. The values of the coefficients ''a'' and ''m'' in porosity-formation factor relation are derived from cross-plot of porosity and resistivity of formation corrected by clay content. The saturation exponent ''n'' is determined from cross-plot of porosity and resistivity index on the assumption that the product of porosity and irreducible water saturation is constant. The relation of porosity to irreducible water saturation is also investigated from core analysis. The new logging parameters determined from the methods, a = 1, m = 2, n = 1.4, improved the values of water saturation by 6 percent in average, and made it easy to distinguish the points which belong to the productive zone and ones belonging to the nonproductive zone

Nutritional value of milk and meat products derived from cloning.

Science.gov (United States)

Tomé, Daniel; Dubarry, Michel; Fromentin, Gilles

2004-01-01

The development and use of milk and meat products derived from cloning depends on their safety and on the nutritional advantages they can confer to the products as perceived by consumers. The development of such products thus implies (i) to demonstrate their safety and security, (ii) to show that their nutritional value is equivalent to the traditional products, and (iii) to identify the conditions under which cloning could allow additional nutritional and health benefit in comparison to traditional products for the consumers. Both milk and meat products are a source of high quality protein as determined from their protein content and essential amino acid profile. Milk is a source of calcium, phosphorus, zinc, magnesium and vitamin B2 and B12. Meat is a source of iron, zinc and vitamin B12. An important issue regarding the nutritional quality of meat and milk is the level and quality of fat which usually present a high content in saturated fat and some modification of the fat fraction could improve the nutritional quality of the products. The role of the dietary proteins as potential allergens has to be taken into account and an important aspect regarding this question is to evaluate whether the cloning does not produce the appearance of novel allergenic structures. The presence of bio-activities associated to specific components of milk (lactoferrin, immunoglobulins, growth factors, anti-microbial components) also represents a promising development. Preliminary results obtained in rats fed cow's milk or meat-based diets prepared from control animals or from animals derived from cloning did not show any difference between control and cloning-derived products.

The role of personal values, urban form, and auto availability in the analysis of walking for transportation.

Science.gov (United States)

Coogan, Matthew A; Karash, Karla H; Adler, Thomas; Sallis, James

2007-01-01

To examine the association of personal values, the built environment, and auto availability with walking for transportation. Participants were drawn from 11 U.S. metropolitan areas with good transit services. 865 adults who had recently made or were contemplating making a residential move. Respondents reported if walking was their primary mode for nine trip purposes. "Personal values" reflected ratings of 15 variables assessing attitudes about urban and environmental attributes, with high reliability (ot = 0.85). Neighborhood form was indicated by a three-item scale. Three binary variables were created to reflect (1) personal values, (2) neighborhood form, and (3) auto availability. The association with walking was reported for each of the three variables, each combination of two variables, and the combination of three variables. An analysis of covariance was applied, and a hierarchic linear regression model was developed. All three variables were associated with walking, and all three variables interacted. The standardized coefficients were 0.23for neighborhood form, 0.21 for autos per person, and 0.18 for personal values. Positive attitudes about urban attributes, living in a supportive neighborhood, and low automobile availability significantly predicted more walking for transportation. A framework for further research is proposed in which a factor representing the role of the automobile is examined explicitly in addition to personal values and urban form.

Reproductive value, sensitivity, and nonlinearity: population-management heuristics derived from classical demography.

Science.gov (United States)

Karsten, Richard; Teismann, Holger; Vogels, Angela

2013-05-01

In classical demographic theory, reproductive value and stable age distribution are proportional to the sensitivities of the asymptotic population size to changes in mortality and maternity, respectively. In this note we point out that analogous relationships hold if the maternity function is allowed to depend on the population density. The relevant formulae can essentially be obtained by replacing the growth rate ("Lotka's r") with zero. These facts may be used to derive heuristics for population management (pest control). Copyright © 2013 Elsevier Inc. All rights reserved.

VALUING BENEFITS FROM WATER QUALITY IMPROVEMENTS USING KUHN TUCKER MODEL - A COMPARATIVE ANALYSIS ON UTILITY FUNCTIONAL FORMS-

Science.gov (United States)

Okuyama, Tadahiro

Kuhn-Tucker model, which has studied in recent years, is a benefit valuation technique using the revealed-preference data, and the feature is to treatvarious patterns of corner solutions flexibly. It is widely known for the benefit calculation using the revealed-preference data that a value of a benefit changes depending on a functional form. However, there are little studies which examine relationship between utility functions and values of benefits in Kuhn-Tucker model. The purpose of this study is to analysis an influence of the functional form to the value of a benefit. Six types of utility functions are employed for benefit calculations. The data of the recreational activity of 26 beaches of Miyagi Prefecture were employed. Calculation results indicated that Phaneuf and Siderelis (2003) and Whitehead et al.(2010)'s functional forms are useful for benefit calculations.

WEATHER INDEX- THE BASIS OF WEATHER DERIVATIVES

Directory of Open Access Journals (Sweden)

Botos Horia Mircea

2011-07-01

Full Text Available This paper approaches the subject of Weather Derivatives, more exactly their basic element the weather index. The weather index has two forms, the Heating Degree Day (HDD and the Cooling Degree Day (CDD. We will try to explain their origin, use and the relationship between the two forms of the index. In our research we started from the analysis of the weather derivatives and what they are based on. After finding out about weather index, we were interested in understanding exactly how they work and how they influence the value of the contract. On the national level the research in the field is scares, but foreign materials available. The study for this paper was based firstly on reading about Weather Derivative, and then going in the meteorogical field and determining the way by which the indices were determined. After this, we went to the field with interest in the indices, such as the energy and gas industries, and figured out how they determined the weather index. For the examples we obtained data from the weather index database, and calculated the value for the period. The study is made on a period of five years, in 8 cities of the European Union. The result of this research is that we can now understand better the importance of the way the indices work and how they influence the value of the Weather Derivatives. This research has an implication on the field of insurance, because of the fact that weather derivative are at the convergence point of the stock markets and the insurance market. The originality of the paper comes from the personal touch given to the theoretical aspect and through the analysis of the HDD and CDD index in order to show their general behaviour and relationship.

On isochronous derivatives of the first and second order in space dynamics tasks

Science.gov (United States)

Bakshiyan, B. T.; Sukhanov, A. A.

1979-01-01

The first and second isochronous derivatives are calculated from the vector of state of dynamic system using its initial value. Use is made of the method of finding a fundamental solution of conjugate variational equations. This solution and the corresponding universal relationship for isochronous derivatives are found for the two-body problem in a form which is simple and suitable for computer programming. The form of these relationships was obtained for motion which differs from parabolic motion. Formulas are given for isochronous derivatives using the gravitational parameter in the two-body problem.

Human embryonic stem cell derived mesenchymal progenitors express cardiac markers but do not form contractile cardiomyocytes.

Directory of Open Access Journals (Sweden)

Christophe M Raynaud

Full Text Available Mesenchymal progenitors or stromal cells have shown promise as a therapeutic strategy for a range of diseases including heart failure. In this context, we explored the growth and differentiation potential of mesenchymal progenitors (MPs derived in vitro from human embryonic stem cells (hESCs. Similar to MPs isolated from bone marrow, hESC derived MPs (hESC-MPs efficiently differentiated into archetypical mesenchymal derivatives such as chondrocytes and adipocytes. Upon treatment with 5-Azacytidine or TGF-β1, hESC-MPs modified their morphology and up-regulated expression of key cardiac transcription factors such as NKX2-5, MEF2C, HAND2 and MYOCD. Nevertheless, NKX2-5+ hESC-MP derivatives did not form contractile cardiomyocytes, raising questions concerning the suitability of these cells as a platform for cardiomyocyte replacement therapy. Gene profiling experiments revealed that, although hESC-MP derived cells expressed a suite of cardiac related genes, they lacked the complete repertoire of genes associated with bona fide cardiomyocytes. Our results suggest that whilst agents such as TGF-β1 and 5-Azacytidine can induce expression of cardiac related genes, but treated cells retain a mesenchymal like phenotype.

Feasibility of estimating generalized extreme-value distribution of floods

International Nuclear Information System (INIS)

Ferreira de Queiroz, Manoel Moises

2004-01-01

Flood frequency analysis by generalized extreme-value probability distribution (GEV) has found increased application in recent years, given its flexibility in dealing with the three asymptotic forms of extreme distribution derived from different initial probability distributions. Estimation of higher quantiles of floods is usually accomplished by extrapolating one of the three inverse forms of GEV distribution fitted to the experimental data for return periods much higher than those actually observed. This paper studies the feasibility of fitting GEV distribution by moments of linear combinations of higher order statistics (LH moments) using synthetic annual flood series with varying characteristics and lengths. As the hydrologic events in nature such as daily discharge occur with finite values, their annual maximums are expected to follow the asymptotic form of the limited GEV distribution. Synthetic annual flood series were thus obtained from the stochastic sequences of 365 daily discharges generated by Monte Carlo simulation on the basis of limited probability distribution underlying the limited GEV distribution. The results show that parameter estimation by LH moments of this distribution, fitted to annual flood samples of less than 100-year length derived from initial limited distribution, may indicate any form of extreme-value distribution, not just the limited form as expected, and with large uncertainty in fitted parameters. A frequency analysis, on the basis of GEV distribution and LH moments, of annual flood series of lengths varying between 13 and 73 years observed at 88 gauge stations on Parana River in Brazil, indicated all the three forms of GEV distribution.(Author)

Measuring the value of groundwater and other forms of natural capital.

Science.gov (United States)

Fenichel, Eli P; Abbott, Joshua K; Bayham, Jude; Boone, Whitney; Haacker, Erin M K; Pfeiffer, Lisa

2016-03-01

Valuing natural capital is fundamental to measuring sustainability. The United Nations Environment Programme, World Bank, and other agencies have called for inclusion of the value of natural capital in sustainability metrics, such as inclusive wealth. Much has been written about the importance of natural capital, but consistent, rigorous valuation approaches compatible with the pricing of traditional forms of capital have remained elusive. We present a guiding quantitative framework enabling natural capital valuation that is fully consistent with capital theory, accounts for biophysical and economic feedbacks, and can guide interdisciplinary efforts to measure sustainability. We illustrate this framework with an application to groundwater in the Kansas High Plains Aquifer, a rapidly depleting asset supporting significant food production. We develop a 10-y time series (1996-2005) of natural capital asset prices that accounts for technological, institutional, and physical changes. Kansas lost approximately $110 million per year (2005 US dollars) of capital value through groundwater withdrawal and changes in aquifer management during the decade spanning 1996-2005. This annual loss in wealth is approximately equal to the state's 2005 budget surplus, and is substantially more than investments in schools over this period. Furthermore, real investment in agricultural capital also declined over this period. Although Kansas' depletion of water wealth is substantial, it may be tractably managed through careful groundwater management and compensating investments in other natural and traditional assets. Measurement of natural capital value is required to inform management and ongoing investments in natural assets.

Prognostic and predictive value of intact and cleaved forms of the urokinase plasminogen activator receptor in metastatic prostate cancer

DEFF Research Database (Denmark)

Almasi, Charlotte E; Brasso, Klaus; Iversen, Peter

2011-01-01

The purpose of this study was to investigate the prognostic value of different forms of the urokinase receptor, uPAR, in serum from prostate cancer (PC) patients.......The purpose of this study was to investigate the prognostic value of different forms of the urokinase receptor, uPAR, in serum from prostate cancer (PC) patients....

Characterization of film-forming solutions and films incorporating free and nanoencapsulated tea polyphenol prepared by gelatins with different Bloom values

Science.gov (United States)

Gelatin film-forming solutions and their films incorporating tea polyphenol (TP) and chitosan nanoparticles (CSNs) were prepared from gelatins with different Bloom values (100, 150 and 225). Blank gelatin film-forming solutions and films were prepared as controls. Gelatins with higher Bloom values h...

10. Creativity and Innovation in Visual Arts through Form and Space Having Symbolic Value

Directory of Open Access Journals (Sweden)

Iaţeşen Mihai – Cosmin

2017-03-01

Full Text Available The numerous plastic approaches of form in the 20th century are characterized by creativity and innovation. Form, as expression of an artistic language, is the cause and effect for the cultural evolution of a particular spatial-temporal area. The invention of forms depending on the factors which will impose them in a particular socio-cultural context and location environment is not everything. The challenges of the act of creation are far more complex. For the art of the 20th century, the role of the type of expression in visual or gestural language proved much more convincing and meaningful as to the data or phenomena occurring in immediate reality. The personality of the artist, his cultural character, his media coverage and exterior influences of his inner world, his preceding experiences and receiver’s contacts in a specific area are the factors that influence the relation between the work of art and the audience against a particular spatial-temporal background. The psychological and sensory processes in works of plastic art are spatially configured in structures, which leads to self-confession. The artist filters the information and the elements of exterior reality through the vision of his imagination and power of expression specific to his inner self, and turns them into values through the involvement of his state of mind. Constantin Brâncuşi is the sculptor whose role was considered exponential as he revolutionized modern artistic vision by integrating and creating space-form relations through symbol. Throughout his complex work - the Group of Monumental Sculptures of Tg. Jiu, the artist renewed the language of the sculpture-specific means of expression, though archaic forms, by restoring traditional art. Archetypes often make reference to the initial and ideal form and they represent the primitive and native models composing it. Form attracts, polarizes and integrates the energy of the matter outside the human body, and art acquires

Differential calculus for Dirichlet forms: The measure-valued gradient preserved by image

OpenAIRE

Bouleau, Nicolas

2005-01-01

In order to develop a differential calculus for error propagation we study local Dirichlet forms on probability spaces with square field operator $\\Gamma$ -- i.e. error structures -- and we are looking for an object related to $\\Gamma$ which is linear and with a good behaviour by images. For this we introduce a new notion called the measure valued gradient which is a randomized square root of $\\Gamma$. The exposition begins with inspecting some natural notions candidate to solve the problem b...

Form of prior for constrained thermodynamic processes with uncertainty

Science.gov (United States)

Aneja, Preety; Johal, Ramandeep S.

2015-05-01

We consider the quasi-static thermodynamic processes with constraints, but with additional uncertainty about the control parameters. Motivated by inductive reasoning, we assign prior distribution that provides a rational guess about likely values of the uncertain parameters. The priors are derived explicitly for both the entropy-conserving and the energy-conserving processes. The proposed form is useful when the constraint equation cannot be treated analytically. The inference is performed using spin-1/2 systems as models for heat reservoirs. Analytical results are derived in the high-temperatures limit. An agreement beyond linear response is found between the estimates of thermal quantities and their optimal values obtained from extremum principles. We also seek an intuitive interpretation for the prior and the estimated value of temperature obtained therefrom. We find that the prior over temperature becomes uniform over the quantity kept conserved in the process.

Measuring the value of groundwater and other forms of natural capital

Science.gov (United States)

Fenichel, Eli P.; Abbott, Joshua K.; Bayham, Jude; Boone, Whitney; Haacker, Erin M. K.; Pfeiffer, Lisa

2016-01-01

Valuing natural capital is fundamental to measuring sustainability. The United Nations Environment Programme, World Bank, and other agencies have called for inclusion of the value of natural capital in sustainability metrics, such as inclusive wealth. Much has been written about the importance of natural capital, but consistent, rigorous valuation approaches compatible with the pricing of traditional forms of capital have remained elusive. We present a guiding quantitative framework enabling natural capital valuation that is fully consistent with capital theory, accounts for biophysical and economic feedbacks, and can guide interdisciplinary efforts to measure sustainability. We illustrate this framework with an application to groundwater in the Kansas High Plains Aquifer, a rapidly depleting asset supporting significant food production. We develop a 10-y time series (1996−2005) of natural capital asset prices that accounts for technological, institutional, and physical changes. Kansas lost approximately $110 million per year (2005 US dollars) of capital value through groundwater withdrawal and changes in aquifer management during the decade spanning 1996–2005. This annual loss in wealth is approximately equal to the state’s 2005 budget surplus, and is substantially more than investments in schools over this period. Furthermore, real investment in agricultural capital also declined over this period. Although Kansas’ depletion of water wealth is substantial, it may be tractably managed through careful groundwater management and compensating investments in other natural and traditional assets. Measurement of natural capital value is required to inform management and ongoing investments in natural assets. PMID:26858431

Extreme value predictions and critical wave episodes for marine structures by FORM

DEFF Research Database (Denmark)

Jensen, Jørgen Juncher

2007-01-01

The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

Extreme value predictions and critical wave episodes for marine structures by FORM

DEFF Research Database (Denmark)

Jensen, Jørgen Juncher

2008-01-01

The aim of the present paper is to advocate for a very effective stochastic procedure, based on the First Order Reliability Method (FORM), for extreme value predictions related to wave induced loads. Three different applications will be illustrated. The first deals with a jack-up rig where second...... order stochastic waves are included in the analysis. The second application is parametric roll motions of ships. Finally, the motion of a TLP floating foundation for an offshore wind turbine is analysed taking into account large motions....

Upgrading of lignocellulosic biorefinery to value-added chemicals: Sustainability and economics of bioethanol-derivatives

DEFF Research Database (Denmark)

Cheali, Peam; Posada, John A.; Gernaey, Krist

2015-01-01

with a sustainability assessment method is used as evaluation tool. First, an existing superstructure representing the lignocellulosic biorefinery design network is extended to include the options for catalytic conversion of bioethanol to value-added derivatives. Second, the optimization problem for process upgrade...... of operating profit for biorefineries producing bioethanol-derived chemicals (247 MM$/a and 241 MM$/a for diethyl ether and 1,3-butadiene, respectively). Second, the optimal designs for upgrading bioethanol (i.e. production of 1,3-butadiene and diethyl ether) performed also better with respect...... to sustainability compared with the petroleum-based processes. In both cases, the effects of the market price uncertainties were also analyzed by performing quantitative economic risk analysis and presented a significant risk of investment for a lignocellulosic biorefinery (12 MM$/a and 92 MM$/a for diethyl ether...

Semiclassical initial value approximation for Green's function.

Science.gov (United States)

Kay, Kenneth G

2010-06-28

A semiclassical initial value approximation is obtained for the energy-dependent Green's function. For a system with f degrees of freedom the Green's function expression has the form of a (2f-1)-dimensional integral over points on the energy surface and an integral over time along classical trajectories initiated from these points. This approximation is derived by requiring an integral ansatz for Green's function to reduce to Gutzwiller's semiclassical formula when the integrations are performed by the stationary phase method. A simpler approximation is also derived involving only an (f-1)-dimensional integral over momentum variables on a Poincare surface and an integral over time. The relationship between the present expressions and an earlier initial value approximation for energy eigenfunctions is explored. Numerical tests for two-dimensional systems indicate that good accuracy can be obtained from the initial value Green's function for calculations of autocorrelation spectra and time-independent wave functions. The relative advantages of initial value approximations for the energy-dependent Green's function and the time-dependent propagator are discussed.

Optimal Mortgage Refinancing: A Closed Form Solution.

Science.gov (United States)

Agarwal, Sumit; Driscoll, John C; Laibson, David I

2013-06-01

We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least [Formula: see text] In this formula W (.) is the Lambert W -function, [Formula: see text] ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods.

Unipolar Endocardial Voltage Mapping in the Right Ventricle: Optimal Cutoff Values Correcting for Computed Tomography-Derived Epicardial Fat Thickness and Their Clinical Value for Substrate Delineation.

Science.gov (United States)

Venlet, Jeroen; Piers, Sebastiaan R D; Kapel, Gijsbert F L; de Riva, Marta; Pauli, Philippe F G; van der Geest, Rob J; Zeppenfeld, Katja

2017-08-01

Low endocardial unipolar voltage (UV) at sites with normal bipolar voltage (BV) may indicate epicardial scar. Currently applied UV cutoff values are based on studies that lacked epicardial fat information. This study aimed to define endocardial UV cutoff values using computed tomography-derived fat information and to analyze their clinical value for right ventricular substrate delineation. Thirty-three patients (50±14 years; 79% men) underwent combined endocardial-epicardial right ventricular electroanatomical mapping and ablation of right ventricular scar-related ventricular tachycardia with computed tomographic image integration, including computed tomography-derived fat thickness. Of 6889 endocardial-epicardial mapping point pairs, 547 (8%) pairs with distance 1.50 mV, the optimal endocardial UV cutoff for identification of epicardial BV the curve, 0.75; sensitivity, 60%; specificity, 79%) and cutoff for identification of abnormal epicardial electrogram was 3.7 mV (area under the curve, 0.88; sensitivity, 100%; specificity, 67%). The majority of abnormal electrograms (130 of 151) were associated with transmural scar. Eighty-six percent of abnormal epicardial electrograms had corresponding endocardial sites with BV the remaining could be identified by corresponding low endocardial UV right ventricular scar, an endocardial UV cutoff value of 3.9 mV is more accurate than previously reported cutoff values. Although the majority of epicardial abnormal electrograms are associated with transmural scar with low endocardial BV, the additional use of endocardial UV at normal BV sites improves the diagnostic accuracy resulting in identification of all epicardial abnormal electrograms at sites with <1.0 mm fat. © 2017 American Heart Association, Inc.

Synthesis, structure and complex forming ability of phosphorylated derivatives of heterocyclic compounds

International Nuclear Information System (INIS)

Babaev, B.N.

2004-01-01

Full text: The derivatives of acids of phosphorus, due to variety of properties, are a subject of numerous researches. Now it is known, that the derivatives of acids of phosphorus apart from insect, neurotoxic, antienzym and other kinds of physiological activity have also complex forming properties. As extra gents of noble metals particularly are analyzed by the derivatives of dithio phosphor of acids although organ phosphorus compounds with one nuclear of sulfur make extraction properties. Therefore, with the purpose of detection of effective extra gents of ions of argentum the phosphorylated derivatives of heterogeneous ring compounds were synthesized: Ph(RO)P(O)Cl + HOCH(CH 3 )CH 2 -R ' -> Ph(RO)P(O)OCH(CH 3 )CH 2 -R ' + HCl. R C 2 H 5 - C 6 H 13 , R ' = a piperidine, morpholine, anabasine Structure of the obtained connections is confirmed by the results IR -, Pm- and mass- spectrometry. In an IR-spectrum O-hexyl-O - [piperidynoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1260, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In an IR-spectrum O-pentyl-[anabasinoisopropyl] phenylphosphonate has lines of absorption bands of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR about O-pentyl-[morpholyniisopropyl] phenylphosphonate in the field of a weak field (7, 18-7, 29 p.m.) the multiplet about tones of phenyl group is watched. Me tin proton resonate at 4,66 m.d.as multiplet The signals O-CH 2 of protons of morpholinic cycle appear at 3,58 m.d.. 4H) by the way of triplet. The protons N-CH 2 (6H) three methylene groups will derivate a composite multiple at 2, 10-2, 70 m.d.. The signal of metil group's protons (3H) is watched at 1,15m.d.as doublet. Final metal group resonates at 0, 87 p.m. Six of C-CH 2 of groups give a complex signal in the field of 1, 2-1, 8 m.d. The obtained connections

Effects of variable transformations on errors in FORM results

International Nuclear Information System (INIS)

Qin Quan; Lin Daojin; Mei Gang; Chen Hao

2006-01-01

On the basis of studies on second partial derivatives of the variable transformation functions for nine different non-normal variables the paper comprehensively discusses the effects of the transformation on FORM results and shows that senses and values of the errors in FORM results depend on distributions of the basic variables, whether resistances or actions basic variables represent, and the design point locations in the standard normal space. The transformations of the exponential or Gamma resistance variables can generate +24% errors in the FORM failure probability, and the transformation of Frechet action variables could generate -31% errors

Isolation and characterization of human umbilical cord-derived endothelial colony-forming cells

Science.gov (United States)

Zhang, Hao; Tao, Yanling; Ren, Saisai; Liu, Haihui; Zhou, Hui; Hu, Jiangwei; Tang, Yongyong; Zhang, Bin; Chen, Hu

2017-01-01

Endothelial colony-forming cells (ECFCs) are a population of endothelial progenitor cells (EPCs) that display robust proliferative potential and vessel-forming capability. Previous studies have demonstrated that a limited number of ECFCs may be obtained from adult bone marrow, peripheral blood and umbilical cord (UC) blood. The present study describes an effective method for isolating ECFCs from human UC. The ECFCs derived from human UC displayed the full properties of EPCs. Analysis of the growth kinetics, cell cycle and colony-forming ability of the isolated human UC-ECFCs indicated that the cells demonstrated properties of stem cells, including relative stability and rapid proliferation in vitro. Gene expression of Fms related tyrosine kinase 1, kinase insert domain receptor, vascular endothelial cadherin, cluster of differentiation (CD)31, CD34, epidermal growth factor homology domains-2, von Willebrand factor and endothelial nitric oxide synthase was assessed by reverse transcription-polymerase chain reaction. The cells were positive for CD34, CD31, CD73, CD105 and vascular endothelial growth factor receptor-2, and negative for CD45, CD90 and human leukocyte antigen-antigen D related protein according to flow cytometry. 1,1′-dioctadecyl-3,3,3′,3′-tetra-methyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein and fluorescein isothiocyanate-Ulex europaeus-l were used to verify the identity of the UC-ECFCs. Matrigel was used to investigate tube formation capability. The results demonstrated that the reported technique is a valuable method for isolating human UC-ECFCs, which have potential for use in vascular regeneration. PMID:29067104

Theoretical derivation of a simplified form of the OTOR/GOT differential equation

International Nuclear Information System (INIS)

Lovedy Singh, L.; Gartia, R.K.

2013-01-01

A simplified form of the OTOR/GOT differential equation has been derived, which may be employed in the evaluation of TL curves for saturated (N = n o ) and non-saturated cases (N > n o ). The present eqn. is found to be theoretically correct and physically sound in comparison with empirical general order kinetics. It has been found that the TL curve evaluated using the present eqn. matches the TL curves evaluated using differential eqn. formalism, and spans the region from α = n o /(100N) to α = 0.999 (where α is the ratio of the retrapping probability to the recombination probability). The simulated curve resembles a first order kinetics curve when α = n o /(100N) and a second order kinetics curve when α = 0.999. However, comparison with general order kinetics for the intermediate range is not possible as a one- to-one correspondence between α and b cannot be made. Also, calculation in the saturated case is made simpler since only three unknown parameters (E, s and α) are required. -- Highlights: • Theoretically and physically sound general order equation has been derived. • Can be employed in the calculation of saturated and non-saturated cases. • It is found to match with those evaluated using differential equation formalism. • Calculation in the saturated case requires only three unknown parameter

Money, form and the determination of value Dinero, forma y determinación del valor

Directory of Open Access Journals (Sweden)

Benetti Carlo

1998-06-01

Full Text Available This article seriously considers the form of value as an essential part of Marx's critique of political economy. It shows that this critique is especially relevant with respect to the modern theory of general equilibrium. By not leaving space for processes of decentralized exchange (even in equilibrium, neo-Walrasian theory is unable to adequately model market prices. However, Marx was not successful in his attempt to unite the determination of value and the monetary form of value. The authors propose a tentative model in which monetary values are determined according to the Marxist principle of "the unity of production and circulation".Este artículo considera seriamente la forma del valor como una parte esencial de la crpitica de Marx a la economía política. Muestra que esa crítica es particularmente relevante con respecto a la teoría moderna del equilibrio general. Al no dar cabida a los procesos de intercambio descentralizados (aun en quilibrio, la teoría neo-walrasiana es incapaz de modelar adecuadamente los precios de mercado. Sin embargo, Marx no tuvo éxito en su intento de unir la determinación de valor y la forma monetaria del valor. Los autores proponen un modelo tentativo en el que los valores monetarios se determinan de acuerdo con el principio marxista de la "unidad de la producción y la circulación"

Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

Science.gov (United States)

2017-07-01

Clinical Metastases PRINCIPAL INVESTIGATOR: Rosandra Kaplan CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017...2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases 5a...PRODUCTS:  publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will present this work at the Annual

Controls of oxygen isotope ratios of nitrate formed during nitrification in soils

International Nuclear Information System (INIS)

Mayer, B.; Bollwerk, S.M.; Vorhoff, B.; Mansfeldt, T.; Veizer, J.

1999-01-01

The isotopic composition of nitrate is increasingly used to determine sources and transformations of nitrogen in terrestrial and aquatic ecosystems. Oxygen isotope ratios of nitrate appear to be particularly useful, since they allow the differentiation between nitrate from atmospheric deposition (δ 18 O nitrate between +25 and +70 per mille), nitrate from fertilizers (δ 18 O nitrate +23 per mille), and nitrate derived from nitrification processes in soils (δ 18 O nitrate 3 molecule derive from H 2 O (with negative δ 18 O values dependent upon location) and one oxygen derives from atmospheric O 2 (δ 18 O = +23.5 per mille).. The objective of this study was to experimentally determine the extent to which water oxygen controls the δ 18 O value of nitrate, which is formed during nitrification in soils

[BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF): NEUROBIOLOGY AND MARKER VALUE IN NEUROPSYCHIATRY].

Science.gov (United States)

Levada, O A; Cherednichenko, N V

2015-01-01

In this review current publications about neurobiology and marker value of brain derived neurotrophic factor (BDNF) in neuropsychiatry are analyzed. It is shown that BDNF is an important member of the family of neurotrophins which widely represented in various structures of the CNS. In prenatal period BDNF is involved in all stages of neuronal networks formation, and in the postnatal period its main role is maintaining the normal brain architectonics, involvement in the processes of neurogenesis and realization of neuroprotective functions. BDNF plays an important role in learning and memory organization, food and motor behavior. BDNF brain expression decreases with age, as well as in degenerative and vascular dementias, affective, anxiety, and behavioral disorders. The reducing of BDNF serum, level reflects the decreasing of its cerebral expression and could be used as a neurobiological marker of these pathological processes but the rising of its concentration could indicate the therapy effectiveness.

Closed form solution to a second order boundary value problem and its application in fluid mechanics

International Nuclear Information System (INIS)

Eldabe, N.T.; Elghazy, E.M.; Ebaid, A.

2007-01-01

The Adomian decomposition method is used by many researchers to investigate several scientific models. In this Letter, the modified Adomian decomposition method is applied to construct a closed form solution for a second order boundary value problem with singularity

Amphiphilic chitosan derivatives as carrier agents for rotenone

Science.gov (United States)

Kamari, Azlan; Aljafree, Nurul Farhana Ahmad

2017-08-01

In the present study, the feasibility of amphiphilic chitosan derivatives, namely oleoyl carboxymethyl chitosan (OCMCs), N,N-dimethylhexadecyl carboxymethyl chitosan (DCMCs) and deoxycholic acid carboxymethyl chitosan (DACMCs) as carrier agents for rotenone in water-insoluble pesticide formulations was investigated. Fourier Transform Infrared (FTIR) Spectrometer, CHN-O Elemental Analyser (CHN-O) and Transmission Electron Microscope (TEM) were used to characterise amphiphilic chitosan derivatives. The critical micelle concentration (CMC) of amphiphilic chitosan derivatives was determined using a Fluorescence Spectrometer. A High Performance Liquid Chromatography (HPLC) was used to determine the ability of OCMCs, DCMCs and DACMCs to load and release rotenone in an in vitro system. Based on TEM analysis, results have shown that amphiphilic chitosan derivatives formed self-assembly and exhibited spherical shape. The CMC values determined for OCMCs, DCMCs and DACMCs were 0.093, 0.098 and 0.468 mg/mL, respectively. The encapsulation efficiency (EE) values for the materials were more than 97.0%, meanwhile the loading capacity (LC) values were greater than 0.90%. OCMCs, DCMCs and DACMCs micelles exhibited an excellent ability to control the release of rotenone, of which 90.0% of rotenone was released within 40 to 52 h. In conclusion, OCMCs, DCMCs and DACMCs possess several key features to act as effective carrier agents for rotenone. Overall, amphiphilic chitosan derivatives produced in this study were successfully increased the solubility of rotenone by 49.0 times higher than free rotenone.

Geometric Least Square Models for Deriving [0,1]-Valued Interval Weights from Interval Fuzzy Preference Relations Based on Multiplicative Transitivity

Directory of Open Access Journals (Sweden)

Xuan Yang

2015-01-01

Full Text Available This paper presents a geometric least square framework for deriving [0,1]-valued interval weights from interval fuzzy preference relations. By analyzing the relationship among [0,1]-valued interval weights, multiplicatively consistent interval judgments, and planes, a geometric least square model is developed to derive a normalized [0,1]-valued interval weight vector from an interval fuzzy preference relation. Based on the difference ratio between two interval fuzzy preference relations, a geometric average difference ratio between one interval fuzzy preference relation and the others is defined and employed to determine the relative importance weights for individual interval fuzzy preference relations. A geometric least square based approach is further put forward for solving group decision making problems. An individual decision numerical example and a group decision making problem with the selection of enterprise resource planning software products are furnished to illustrate the effectiveness and applicability of the proposed models.

Safe handling of potential peroxide forming compounds and their corresponding peroxide yielded derivatives.

Energy Technology Data Exchange (ETDEWEB)

Sears, Jeremiah Matthew; Boyle, Timothy J.; Dean, Christopher J.

2013-06-01

This report addresses recent developments concerning the identification and handling of potential peroxide forming (PPF) and peroxide yielded derivative (PYD) chemicals. PPF chemicals are described in terms of labeling, shelf lives, and safe handling requirements as required at SNL. The general peroxide chemistry concerning formation, prevention, and identification is cursorily presented to give some perspective to the generation of peroxides. The procedure for determining peroxide concentrations and the proper disposal methods established by the Hazardous Waste Handling Facility are also provided. Techniques such as neutralization and dilution are provided for the safe handling of any PYD chemicals to allow for safe handling. The appendices are a collection of all available SNL documentation pertaining to PPF/PYD chemicals to serve as a single reference.

Identification of the products of the cleavage of the galactans of red seaweeds in the form of pyridylamino derivatives

International Nuclear Information System (INIS)

Usov, A.I.; Dobkina, I.M.

1986-01-01

It has been shown that pyridylamino derivatives are convenient for the identification of various products of the galactans of red algae. Reductive amination with 2-aminopyridine and sodium thiohydroborate has been investigated for the case of several monosaccharides that are common components of the polysaccharide fractions of red seaweeds and also for carrabiose, agarobiose, and oligosaccharides of the neoagarobiose series. Various forms of chromatography and high-voltage paper electrophoresis were used to separate the pyridylamino derivatives, and NMR spectroscopy and mass spectroscopy of the full acetates for structural characterization

A global multicenter study on reference values: 1. Assessment of methods for derivation and comparison of reference intervals.

Science.gov (United States)

Ichihara, Kiyoshi; Ozarda, Yesim; Barth, Julian H; Klee, George; Qiu, Ling; Erasmus, Rajiv; Borai, Anwar; Evgina, Svetlana; Ashavaid, Tester; Khan, Dilshad; Schreier, Laura; Rolle, Reynan; Shimizu, Yoshihisa; Kimura, Shogo; Kawano, Reo; Armbruster, David; Mori, Kazuo; Yadav, Binod K

2017-04-01

The IFCC Committee on Reference Intervals and Decision Limits coordinated a global multicenter study on reference values (RVs) to explore rational and harmonizable procedures for derivation of reference intervals (RIs) and investigate the feasibility of sharing RIs through evaluation of sources of variation of RVs on a global scale. For the common protocol, rather lenient criteria for reference individuals were adopted to facilitate harmonized recruitment with planned use of the latent abnormal values exclusion (LAVE) method. As of July 2015, 12 countries had completed their study with total recruitment of 13,386 healthy adults. 25 analytes were measured chemically and 25 immunologically. A serum panel with assigned values was measured by all laboratories. RIs were derived by parametric and nonparametric methods. The effect of LAVE methods is prominent in analytes which reflect nutritional status, inflammation and muscular exertion, indicating that inappropriate results are frequent in any country. The validity of the parametric method was confirmed by the presence of analyte-specific distribution patterns and successful Gaussian transformation using the modified Box-Cox formula in all countries. After successful alignment of RVs based on the panel test results, nearly half the analytes showed variable degrees of between-country differences. This finding, however, requires confirmation after adjusting for BMI and other sources of variation. The results are reported in the second part of this paper. The collaborative study enabled us to evaluate rational methods for deriving RIs and comparing the RVs based on real-world datasets obtained in a harmonized manner. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Reference line-pair values of panoramic radiographs using an arch-form phantom stand to assess clinical image quality

International Nuclear Information System (INIS)

Choi, Da Hye; Choi, Bo Ram; Huh, Kyung Hoe; Heo, Min Suk; Choi, Soon Chul; Choi, Jin Woo; Yi, Won Jin; Lee, Sam Sun

2013-01-01

This study was performed to suggest reference line-pair values of panoramic images with clinically desirable qualities using an arch-form phantom stand. The line-pair test phantom was chosen. A real skull model was selected for setting the arch-form model of the phantom stand. The phantom stand had slits in four regions (incisor, premolar, molar, TMJ). Four raw images of the test phantom in each region and one raw image of the real skull were converted into 50 test phantom images and 50 skull phantom images with various line-pair values. 50 post-processed real skull phantom images were divided into 4 groups and were randomly submitted to 14 evaluators. Image quality was graded on a 4 point scale (1. good, 2. normal, 3. poor but interpretable, and 4. not interpretable). The reference line pair was determined as the first line-pair value scored less than 2 points. The mean scores tended to decrease as the line-pair values increased. The reference line-pair values were 3.19 LP/mm in the incisor, 2.32 LP/mm in the premolar and TMJ, and 1.88 LP/mm in the molar region. Image quality evaluation methods and criteria should be able to assess various regions considering the characteristics of panoramic systems. This study suggested overall and regional reference line-pair values and established a set of standard values for them.

Reference line-pair values of panoramic radiographs using an arch-form phantom stand to assess clinical image quality

Energy Technology Data Exchange (ETDEWEB)

Choi, Da Hye; Choi, Bo Ram; Huh, Kyung Hoe; Heo, Min Suk; Choi, Soon Chul [Dept. of Oral and Maxillofacial Radiology and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of); Choi, Jin Woo [Dept. of Oral and Maxillofacial Radiology, College of Dentistry, Dankook University, Cheonan (Korea, Republic of); Yi, Won Jin; Lee, Sam Sun [Dept. of Oral and Maxillofacial Radiology, BK21 Craniomaxillofacial Life Science, and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of)

2013-03-15

This study was performed to suggest reference line-pair values of panoramic images with clinically desirable qualities using an arch-form phantom stand. The line-pair test phantom was chosen. A real skull model was selected for setting the arch-form model of the phantom stand. The phantom stand had slits in four regions (incisor, premolar, molar, TMJ). Four raw images of the test phantom in each region and one raw image of the real skull were converted into 50 test phantom images and 50 skull phantom images with various line-pair values. 50 post-processed real skull phantom images were divided into 4 groups and were randomly submitted to 14 evaluators. Image quality was graded on a 4 point scale (1. good, 2. normal, 3. poor but interpretable, and 4. not interpretable). The reference line pair was determined as the first line-pair value scored less than 2 points. The mean scores tended to decrease as the line-pair values increased. The reference line-pair values were 3.19 LP/mm in the incisor, 2.32 LP/mm in the premolar and TMJ, and 1.88 LP/mm in the molar region. Image quality evaluation methods and criteria should be able to assess various regions considering the characteristics of panoramic systems. This study suggested overall and regional reference line-pair values and established a set of standard values for them.

Role of Mesenchymal Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical Metastases

Science.gov (United States)

2017-07-01

Clinical Metastases PRINCIPAL INVESTIGATOR: Jeffrey Green CONTRACTING ORGANIZATION: The Geneva Foundation Tacoma, WA 98402 REPORT DATE: July 2017 TYPE...2016 - 14 June 2017 4. TITLE AND SUBTITLE Role of Mesenchymal-Derived Stem Cells in Stimulating Dormant Tumor Cells to Proliferate and Form Clinical ...and/or select agents. Nothing to report. 6. PRODUCTS: • publications, conference papers, and presentations ; Jennifer Zhu submitted an abstract and will

Determination of pKa values of benzoxa-, benzothia- and benzoselena-zolinone derivatives by capillary electrophoresis. Comparison with potentiometric titration and spectrometric data.

Science.gov (United States)

Foulon, C; Duhal, N; Lacroix-Callens, B; Vaccher, C; Bonte, J P; Goossens, J F

2007-07-01

Acidity constants of benzoxa-, benzothia- and benzoselena-zolinone derivatives were determined by capillary electrophoresis, potentiometry and spectrophotometry experiments. These three analytical techniques gave pK(a) results that were in good agreement. A convenient, accurate and precise method for the determination of pK(a) was developed to measure changes in acidity constants induced by heteroatom or 6-benzoyl substituted derivatives. pK(a) values were determined simultaneously for two compounds characterized by different electrophoretic mobility (micro(e)) and pK(a) value and in the presence of an analogous neutral marker.

Solid state solvation effect and reduced amplified spontaneous emission threshold value of glass forming DCM derivative in PMMA films

Energy Technology Data Exchange (ETDEWEB)

Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV 1063 (Latvia); Zarins, Elmars; Kokars, Valdis [Institute of Applied Chemistry, Riga Technical University, 14/24 Azenes Street, Riga LV 1048 (Latvia)

2015-02-15

Molecule crystallization is one of the limitations for obtaining high-gain organic laser systems. One of the examples is well known red laser dye 4-(dicyanomethylene)-2-methyl-6-(p-dimethylaminostyryl)-4H-pyran (DCM). The lowest threshold value of amplified spontaneous emission was achieved by doping 2 wt% of DCM molecule in tris-(8-hydroxy quinoline) aluminum (Alq{sub 3}) matrix. Further increase of the DCM dye concentration makes the system less efficient as its threshold value increases. It is due to large intermolecular interaction, which induces photoluminescence quenching. Compounds with reduced intermolecular interaction could be prospective in organic laser systems due to higher possible doping. In this work photoluminescence and amplified spontaneous emission properties of modified DCM molecule in poly(methyl methacrylate) (PMMA) matrix were investigated. Bulky trityloxyethyl groups were attached to the donor part of DCM. These groups increase intermolecular distance wherewith reduce photoluminescence quenching. More than one order of magnitude lower excitation threshold energy of the amplified spontaneous emission was achieved in doped polymer films with investigated compound in comparison to doped polymer with DCM. It means that the investigated compound is more perspective as a laser material compared to the previously studied. In addition, amplified spontaneous emission maximum could be tuned within 15 nm by changing concentration from 0.1 wt% to 10 wt% DWK-1 in PMMA matrix due to solid state solvation effect. - Highlights: • Bulky groups attached to DCM dye reduce photoluminescence quenching. • Amplified spontaneous emission is in red spectral region. • Amplified spontaneous emission spectra were tuned by 15 nm. • Amplified spontaneous emission threshold value was reduced by one order of magnitude.

Original and Derived Judgment

DEFF Research Database (Denmark)

Foss, Kirsten; Foss, Nicolai Juul; Klein, Peter G.

2007-01-01

Recent work links entrepreneurship to the economic theory of the firm, using the concept of entrepreneurship as judgment introduced by Frank Knight. When judgment is complementary to other assets, it makes sense for entrepreneurs to hire labour and to own assets. The entrepreneur's role, then...... to subordinates, who exercise derived judgment. We call these employees `proxy-entrepreneurs', and ask how the firm's organizational structure - its formal and informal systems of rewards and punishments, rules for settling disputes and renegotiating agreements, means of evaluating performance and so on - can...... be designed to encourage forms of proxy entrepreneurship that increase firm value while discouraging actions that destroy value. Building on key ideas from the entrepreneurship literature, Austrian economics and the economic theory of the firm, we develop a framework for analysing the trade-off between...

A 'simple' hybrid model for power derivatives

International Nuclear Information System (INIS)

Lyle, Matthew R.; Elliott, Robert J.

2009-01-01

This paper presents a method for valuing power derivatives using a supply-demand approach. Our method extends work in the field by incorporating randomness into the base load portion of the supply stack function and equating it with a noisy demand process. We obtain closed form solutions for European option prices written on average spot prices considering two different supply models: a mean-reverting model and a Markov chain model. The results are extensions of the classic Black-Scholes equation. The model provides a relatively simple approach to describe the complicated price behaviour observed in electricity spot markets and also allows for computationally efficient derivatives pricing. (author)

Cranial vasculature in zebrafish forms by angioblast cluster-derived angiogenesis.

Science.gov (United States)

Proulx, Kira; Lu, Annie; Sumanas, Saulius

2010-12-01

Formation of embryonic vasculature involves vasculogenesis as endothelial cells differentiate and aggregate into vascular cords and angiogenesis which includes branching from the existing vessels. In the zebrafish which has emerged as an advantageous model to study vasculogenesis, cranial vasculature is thought to originate by a combination of vasculogenesis and angiogenesis, but how these processes are coordinated is not well understood. To determine how angioblasts assemble into cranial vasculature, we generated an etsrp:GFP transgenic line in which GFP reporter is expressed under the promoter control of an early regulator of vascular and myeloid development, etsrp/etv2. By utilizing time-lapse imaging we show that cranial vessels originate by angiogenesis from angioblast clusters, which themselves form by the mechanism of vasculogenesis. The two major pairs of bilateral clusters include the rostral organizing center (ROC) which gives rise to the most rostral cranial vessels and the midbrain organizing center (MOC) which gives rise to the posterior cranial vessels and to the myeloid and endocardial lineages. In Etsrp knockdown embryos initial cranial vasculogenesis proceeds normally but endothelial and myeloid progenitors fail to initiate differentiation, migration and angiogenesis. Such angioblast cluster-derived angiogenesis is likely to be involved during vasculature formation in other vertebrate systems as well. Copyright © 2010 Elsevier Inc. All rights reserved.

The value of reliability

DEFF Research Database (Denmark)

Fosgerau, Mogens; Karlström, Anders

2010-01-01

We derive the value of reliability in the scheduling of an activity of random duration, such as travel under congested conditions. Using a simple formulation of scheduling utility, we show that the maximal expected utility is linear in the mean and standard deviation of trip duration, regardless...... of the form of the standardised distribution of trip durations. This insight provides a unification of the scheduling model and models that include the standard deviation of trip duration directly as an argument in the cost or utility function. The results generalise approximately to the case where the mean...

Deviations of the lepton mapping matrix form the harrison-perkins-scott form

International Nuclear Information System (INIS)

Friedberg, R.; Lee, T.D.

2010-01-01

We propose a simple set of hypotheses governing the deviations of the leptonic mapping matrix from the Harrison-Perkins-Scott (HPS) form. These deviations are supposed to arise entirely from a perturbation of the mass matrix in the charged lepton sector. The perturbing matrix is assumed to be purely imaginary (thus maximally T-violating) and to have a strength in energy scale no greater (but perhaps smaller) than the muon mass. As we shall show,it then follows that the absolute value of the mapping matrix elements pertaining to the tau lepton deviate by no more than O((m μ /m τ ) 2 ) ≅ 3.5 x 10 -3 from their HPS values. Assuming that(m μ /m τ ) 2 can be neglected, we derive two simple constraints on the four parameters θ12, θ23, θ31, and δ of the mapping matrix. These constraints are independent of the details of the imaginary T-violating perturbation of the charged lepton mass matrix. We also show that the e and μ parts of the mapping matrix have a definite form governed by two parameters α and β; any deviation of order m μ /m τ can be accommodated by adjusting these two parameters. (authors)

The prognostic value of temporal in vitro and in vivo derived hypoxia gene-expression signatures in breast cancer

International Nuclear Information System (INIS)

Starmans, Maud H.W.; Chu, Kenneth C.; Haider, Syed; Nguyen, Francis; Seigneuric, Renaud; Magagnin, Michael G.; Koritzinsky, Marianne; Kasprzyk, Arek; Boutros, Paul C.; Wouters, Bradly G.

2012-01-01

Background and purpose: Recent data suggest that in vitro and in vivo derived hypoxia gene-expression signatures have prognostic power in breast and possibly other cancers. However, both tumour hypoxia and the biological adaptation to this stress are highly dynamic. Assessment of time-dependent gene-expression changes in response to hypoxia may thus provide additional biological insights and assist in predicting the impact of hypoxia on patient prognosis. Materials and methods: Transcriptome profiling was performed for three cell lines derived from diverse tumour-types after hypoxic exposure at eight time-points, which include a normoxic time-point. Time-dependent sets of co-regulated genes were identified from these data. Subsequently, gene ontology (GO) and pathway analyses were performed. The prognostic power of these novel signatures was assessed in parallel with previous in vitro and in vivo derived hypoxia signatures in a large breast cancer microarray meta-dataset (n = 2312). Results: We identified seven recurrent temporal and two general hypoxia signatures. GO and pathway analyses revealed regulation of both common and unique underlying biological processes within these signatures. None of the new or previously published in vitro signatures consisting of hypoxia-induced genes were prognostic in the large breast cancer dataset. In contrast, signatures of repressed genes, as well as the in vivo derived signatures of hypoxia-induced genes showed clear prognostic power. Conclusions: Only a subset of hypoxia-induced genes in vitro demonstrates prognostic value when evaluated in a large clinical dataset. Despite clear evidence of temporal patterns of gene-expression in vitro, the subset of prognostic hypoxia regulated genes cannot be identified based on temporal pattern alone. In vivo derived signatures appear to identify the prognostic hypoxia induced genes. The prognostic value of hypoxia-repressed genes is likely a surrogate for the known importance of

Calculation and validation of heat transfer coefficient for warm forming operations

Science.gov (United States)

Omer, Kaab; Butcher, Clifford; Worswick, Michael

2017-10-01

In an effort to reduce the weight of their products, the automotive industry is exploring various hot forming and warm forming technologies. One critical aspect in these technologies is understanding and quantifying the heat transfer between the blank and the tooling. The purpose of the current study is twofold. First, an experimental procedure to obtain the heat transfer coefficient (HTC) as a function of pressure for the purposes of a metal forming simulation is devised. The experimental approach was used in conjunction with finite element models to obtain HTC values as a function of die pressure. The materials that were characterized were AA5182-O and AA7075-T6. Both the heating operation and warm forming deep draw were modelled using the LS-DYNA commercial finite element code. Temperature-time measurements were obtained from both applications. The results of the finite element model showed that the experimentally derived HTC values were able to predict the temperature-time history to within a 2% of the measured response. It is intended that the HTC values presented herein can be used in warm forming models in order to accurately capture the heat transfer characteristics of the operation.

Value Assessment of Artificial Wetland Derived from Mining Subsided Lake: A Case Study of Jiuli Lake Wetland in Xuzhou

OpenAIRE

Laijian Wang; Lachun Wang; Pengcheng Yin; Haiyang Cui; Longwu Liang; Zhenbo Wang

2017-01-01

Mining subsided lakes are major obstacles for ecological restoration and resource reuse in mining regions. Transforming mining subsided lakes into artificial wetlands is an ecological restoration approach that has been attempted in China in recent years, but a value assessment of the approach still needs systematic research. This paper considers Jiuli Lake wetland, an artificial wetland derived from restoration of a mining subsided lake in plain area, as a case study. A value assessment model...

A Study on Market Efficiency of Selected Commodity Derivatives Traded on NCDEX During 2011

Science.gov (United States)

Sajipriya, N.

2012-10-01

The study aims at testing the weak form of Efficient Market Hypothesis in the context of an emerging commodity market - National Commodity Derivatives Exchange (NCDEX), which is considered as the prime commodity derivatives market in India. The study considered daily spot and futures prices of five selected commodities traded on NCDEX over 12 month period (the futures contracts originating and expiring during the period January 2011 to December 2011) The five commodities chosen are Pepper, Crude palm Oil, steel silver and Chana as they account for almost two-thirds of the value of agricultural commodity derivatives traded on NCDEX. The results of Run test indicate that both spot and futures prices are weak form efficient

Good neighbourly relations or family values?

DEFF Research Database (Denmark)

McQuaid, Sara Dybris

Good neighbourly relations or family values? Assessing British Irish cooperation in a comparative perspective 1990-2010. This paper forms part of a larger comparative study, which charts the past 20 years development of British Irish cooperation and Nordic cooperation. It examines specifically...... associations lies in the legitimacy they derive from a historical narrative of a common social, cultural, economic and political fabric. Importantly, however, the impetus behind the cooperation is constructed from both associative and ascriptive components of collective identity; cooperation is motivated...

A simple finite element method for boundary value problems with a Riemann–Liouville derivative

KAUST Repository

Jin, Bangti; Lazarov, Raytcho; Lu, Xiliang; Zhou, Zhi

2016-01-01

© 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-¹ in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and ^L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

A simple finite element method for boundary value problems with a Riemann–Liouville derivative

KAUST Repository

Jin, Bangti

2016-02-01

© 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-¹ in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and ^L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

On heterotic vacua with fermionic expectation values

Energy Technology Data Exchange (ETDEWEB)

Minasian, Ruben [Institut de Physique Theorique, Universite Paris Saclay, CEA, CNRS, Gif-sur-Yvette (France); Petrini, Michela [Sorbonne Universites, CNRS, LPTHE, UPMC Paris 06, UMR 7589, Paris (France); Svanes, Eirik Eik [Sorbonne Universites, CNRS, LPTHE, UPMC Paris 06, UMR 7589, Paris (France); Sorbonne Universites, Institut Lagrange de Paris, Paris (France)

2017-03-15

We study heterotic backgrounds with non-trivial H-flux and non-vanishing expectation values of fermionic bilinears, often referred to as gaugino condensates. The gaugini appear in the low energy action via the gauge-invariant three-form bilinear Σ{sub MNP} = tr anti χΓ{sub MNP}χ. For Calabi-Yau compactifications to four dimensions, the gaugino condensate corresponds to an internal three-form Σ{sub mnp} that must be a singlet of the holonomy group. This condition does not hold anymore when an internal H-flux is turned on and O(α{sup '}) effects are included. In this paper we study flux compactifications to three and four-dimensions on G-structure manifolds. We derive the generic conditions for supersymmetric solutions. We use integrability conditions and Lichnerowicz type arguments to derive a set of constraints whose solution, together with supersymmetry, is sufficient for finding backgrounds with gaugino condensate. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Testing of the derivative method and Kruskal-Wallis technique for sensitivity analysis of SYVAC

International Nuclear Information System (INIS)

Prust, J.O.; Edwards, H.H.

1985-04-01

The Kruskal-Wallis method of one-way analysis of variance by ranks has proved successful in identifying input parameters which have an important influence on dose. This technique was extended to test for first order interactions between parameters. In view of a number of practical difficulties and the computing resources required to carry out a large number of runs, this test is not recommended for detecting interactions between parameters. The derivative method of sensitivity analysis examines the partial derivative values of each input parameter with dose at various points across the parameter range. Important input parameters are associated with high derivatives and the results agreed well with previous sensitivity studies. The derivative values also provided information on the data generation distributions to be used for the input parameters in order to concentrate sampling in the high dose region of the parameter space to improve the sampling efficiency. Furthermore, the derivative values provided information on parameter interactions, the feasibility of developing a high dose algorithm and formed the basis for developing a regression equation. (author)

An Exact Soultion for the Investment and Market Value of a Firm Facing Uncertainty, Adjustment Costs, and Irreversibility

OpenAIRE

Andrew B. Abel; Janice C. Eberly

1993-01-01

This paper derives closed-form solutions for the investment and market value, under uncertainty, of competitive firms with constant returns to scale production and convex costs of adjustment. Solutions are derived for the case of irreversible investment as well as for reversible investment. Optimal investment is a non-decreasing function of q, the shadow value of capital. The conditions of optimality imply that q cannot contain a bubble; thus, optimal investment depends only on fundamentals. ...

Higher order alchemical derivatives from coupled perturbed self-consistent field theory.

Science.gov (United States)

Lesiuk, Michał; Balawender, Robert; Zachara, Janusz

2012-01-21

We present an analytical approach to treat higher order derivatives of Hartree-Fock (HF) and Kohn-Sham (KS) density functional theory energy in the Born-Oppenheimer approximation with respect to the nuclear charge distribution (so-called alchemical derivatives). Modified coupled perturbed self-consistent field theory is used to calculate molecular systems response to the applied perturbation. Working equations for the second and the third derivatives of HF/KS energy are derived. Similarly, analytical forms of the first and second derivatives of orbital energies are reported. The second derivative of Kohn-Sham energy and up to the third derivative of Hartree-Fock energy with respect to the nuclear charge distribution were calculated. Some issues of practical calculations, in particular the dependence of the basis set and Becke weighting functions on the perturbation, are considered. For selected series of isoelectronic molecules values of available alchemical derivatives were computed and Taylor series expansion was used to predict energies of the "surrounding" molecules. Predicted values of energies are in unexpectedly good agreement with the ones computed using HF/KS methods. Presented method allows one to predict orbital energies with the error less than 1% or even smaller for valence orbitals. © 2012 American Institute of Physics

Contrast reference values in panoramic radiographic images using an arch-form phantom stand

International Nuclear Information System (INIS)

Shin, Jae Myung; Lee, Che Na; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Won Jin; Heo, Min Suk; Choi, Soon Chul; Lee, Sam Sun

2016-01-01

The purpose of this study was to investigate appropriate contrast reference values (CRVs) by comparing the contrast in phantom and clinical images. Phantom contrast was measured using two methods: (1) counting the number of visible pits of different depths in an aluminum plate, and (2) obtaining the contrast-to-noise ratio (CNR) for 5 tissue-equivalent materials (porcelain, aluminum, polytetrafluoroethylene [PTFE], polyoxymethylene [POM], and polymethylmethacrylate [PMMA]). Four panoramic radiographs of the contrast phantom, embedded in the 4 different regions of the arch-form stand, and 1 real skull phantom image were obtained, post-processed, and compared. The clinical image quality evaluation chart was used to obtain the cut-off values of the phantom CRV corresponding to the criterion of being adequate for diagnosis. The CRVs were obtained using 4 aluminum pits in the incisor and premolar region, 5 aluminum pits in the molar region, and 2 aluminum pits in the temporomandibular joint (TMJ) region. The CRVs obtained based on the CNR measured in the anterior region were: porcelain, 13.95; aluminum, 9.68; PTFE, 6.71; and POM, 1.79. The corresponding values in the premolar region were: porcelain, 14.22; aluminum, 8.82; PTFE, 5.95; and POM, 2.30. In the molar region, the following values were obtained: porcelain, 7.40; aluminum, 3.68; PTFE, 1.27; and POM, - 0.18. The CRVs for the TMJ region were: porcelain, 3.60; aluminum, 2.04; PTFE, 0.48; and POM, - 0.43. CRVs were determined for each part of the jaw using the CNR value and the number of pits observed in phantom images

Contrast reference values in panoramic radiographic images using an arch-form phantom stand

Energy Technology Data Exchange (ETDEWEB)

Shin, Jae Myung [Dept. of Oral and Maxillofacial Surgery, Ilsan Paik Hospital, Inje University College of Medicine, Goyang (Korea, Republic of); Lee, Che Na; Kim, Jo Eun; Huh, Kyung Hoe; Yi, Won Jin; Heo, Min Suk; Choi, Soon Chul; Lee, Sam Sun [Dept. of Oral and Maxillofacial Radiology and Dental Research Institute, School of Dentistry, Seoul National University, Seoul (Korea, Republic of)

2016-09-15

The purpose of this study was to investigate appropriate contrast reference values (CRVs) by comparing the contrast in phantom and clinical images. Phantom contrast was measured using two methods: (1) counting the number of visible pits of different depths in an aluminum plate, and (2) obtaining the contrast-to-noise ratio (CNR) for 5 tissue-equivalent materials (porcelain, aluminum, polytetrafluoroethylene [PTFE], polyoxymethylene [POM], and polymethylmethacrylate [PMMA]). Four panoramic radiographs of the contrast phantom, embedded in the 4 different regions of the arch-form stand, and 1 real skull phantom image were obtained, post-processed, and compared. The clinical image quality evaluation chart was used to obtain the cut-off values of the phantom CRV corresponding to the criterion of being adequate for diagnosis. The CRVs were obtained using 4 aluminum pits in the incisor and premolar region, 5 aluminum pits in the molar region, and 2 aluminum pits in the temporomandibular joint (TMJ) region. The CRVs obtained based on the CNR measured in the anterior region were: porcelain, 13.95; aluminum, 9.68; PTFE, 6.71; and POM, 1.79. The corresponding values in the premolar region were: porcelain, 14.22; aluminum, 8.82; PTFE, 5.95; and POM, 2.30. In the molar region, the following values were obtained: porcelain, 7.40; aluminum, 3.68; PTFE, 1.27; and POM, - 0.18. The CRVs for the TMJ region were: porcelain, 3.60; aluminum, 2.04; PTFE, 0.48; and POM, - 0.43. CRVs were determined for each part of the jaw using the CNR value and the number of pits observed in phantom images.

Noncommutative differential forms on the kappa-deformed space

International Nuclear Information System (INIS)

Meljanac, Stjepan; Kresic-Juric, Sasa

2009-01-01

We construct a differential algebra of forms on the kappa-deformed space. For a given realization of noncommutative coordinates as formal power series in the Weyl algebra we find an infinite family of one-forms and nilpotent exterior derivatives. We derive explicit expressions for the exterior derivative and one-forms in covariant and noncovariant realizations. We also introduce higher order forms and show that the exterior derivative satisfies the graded Leibniz rule. The differential forms are generally not graded commutative, but they satisfy the graded Jacobi identity. We also consider the star-product of classical differential forms. The star-product is well defined if the commutator between the noncommutative coordinates and one-forms is closed in the space of one-forms alone. In addition, we show that in certain realizations the exterior derivative acting on the star-product satisfies the undeformed Leibniz rule.

Recurrence relations for the Epstein-Hubbell integral and its generalized forms

International Nuclear Information System (INIS)

Tezcan, Cevdet

2005-01-01

The generalized Epstein-Hubbell integral was recently considered by Lopez and Ferreira (IMA J. Appl. Math. 67 (2002) 301) for values of the variable k close to its upper limit k=1. Here different forms of the generalized Epstein-Hubbell integral Λ (λ,γ,μ) (α,β) (ρ,δ,k) proposed by Kalla and Tuan (Comput. Math. Appl. 32 (1996) 49) are considered for values of the variable k=1. The numerical values of S μ , R μ and P μ at k=1 are calculated by using the derived recurrence relations and are listed in tables

Fractal analytical approach of urban form based on spatial correlation function

International Nuclear Information System (INIS)

Chen, Yanguang

2013-01-01

Highlights: ► Many fractal parameter relations of cities can be derived by scaling analysis. ► The area-radius scaling of cities suggests a spatial correlation function. ► Spectral analysis can be used to estimate fractal dimension values of urban form. ► The valid range of fractal dimension of urban form comes between 1.5 and 2. ► The traditional scale concept will be replaced by scaling concept in geography. -- Abstract: Urban form has been empirically demonstrated to be of scaling invariance and can be described with fractal geometry. However, the rational range of fractal dimension value and the relationships between various fractal indicators of cities are not yet revealed in theory. By mathematical deduction and transform (e.g., Fourier transform), I find that scaling analysis, spectral analysis, and spatial correlation analysis are all associated with fractal concepts and can be integrated into a new approach to fractal analysis of cities. This method can be termed ‘3S analyses’ of urban form. Using the 3S analysis, I derived a set of fractal parameter equations, by which different fractal parameters of cities can be linked up with one another. Each fractal parameter has its own reasonable extent of values. According to the fractal parameter equations, the intersection of the rational ranges of different fractal parameters suggests the proper scale of the fractal dimension of urban patterns, which varies from 1.5 to 2. The fractal dimension equations based on the 3S analysis and the numerical relationships between different fractal parameters are useful for geographers to understand urban evolution and potentially helpful for future city planning

A class of constitutive relations with internal variable derivatives. Derivation from homogenization and initial value problem

International Nuclear Information System (INIS)

Andrieux, S.; Joussemet, M.; Lorentz, E.

1996-01-01

A general framework for deriving and using a class of constitutive laws incorporating spatial gradients of internal variables is presented. It uses two basic ingredients: a derivation of such models by homogenization techniques and a reformulation of the evolution equation at the scale of the whole structure. (orig.)

Intramolecular carbenoid ylide forming reactions of 2-diazo-3-keto-4-phthalimidocarboxylic esters derived from methionine and cysteine

Directory of Open Access Journals (Sweden)

Marc Enßle

2012-03-01

Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.

PowerForms

DEFF Research Database (Denmark)

Brabrand, Claus; Møller, Anders; Ricky, Mikkel

2000-01-01

All uses of HTML forms may benefit from validation of the specified input field values. Simple validation matches individual values against specified formats, while more advanced validation may involve interdependencies of form fields. There is currently no standard for specifying or implementing...

"Value"ing Children Differently? Migrant Children in Education

Science.gov (United States)

Devine, Dympna

2013-01-01

This paper considers dilemmas around "value" and the "valuing" of children and childhood(s) in schools. I argue that in neo-liberal contexts, processes of children's identity making become aligned with the idea of the corporate citizen--value and worth derived from the capacity to produce, excel, self-regulate as well as…

Optimal Mortgage Refinancing: A Closed Form Solution

Science.gov (United States)

Agarwal, Sumit; Driscoll, John C.; Laibson, David I.

2013-01-01

We derive the first closed-form optimal refinancing rule: Refinance when the current mortgage interest rate falls below the original rate by at least 1ψ[ϕ+W(−exp(−ϕ))]. In this formula W(.) is the Lambert W-function, ψ=2(ρ+λ)σ,ϕ=1+ψ(ρ+λ)κ∕M(1−τ), ρ is the real discount rate, λ is the expected real rate of exogenous mortgage repayment, σ is the standard deviation of the mortgage rate, κ/M is the ratio of the tax-adjusted refinancing cost and the remaining mortgage value, and τ is the marginal tax rate. This expression is derived by solving a tractable class of refinancing problems. Our quantitative results closely match those reported by researchers using numerical methods. PMID:25843977

Algebraic Bethe ansatz for a quantum integrable derivative nonlinear Schroedinger model

International Nuclear Information System (INIS)

Basu-Mallick, B.; Bhattacharyya, Tanaya

2002-01-01

We find that the quantum monodromy matrix associated with a derivative nonlinear Schroedinger (DNLS) model exhibits U(2) or U(1,1) symmetry depending on the sign of the related coupling constant. By using a variant of quantum inverse scattering method which is directly applicable to field theoretical models, we derive all possible commutation relations among the operator valued elements of such monodromy matrix. Thus, we obtain the commutation relation between creation and annihilation operators of quasi-particles associated with DNLS model and find out the S-matrix for two-body scattering. We also observe that, for some special values of the coupling constant, there exists an upper bound on the number of quasi-particles which can form a soliton state for the quantum DNLS model

Nitrogen fractionation in high-mass star-forming cores across the Galaxy

Science.gov (United States)

Colzi, L.; Fontani, F.; Rivilla, V. M.; Sánchez-Monge, A.; Testi, L.; Beltrán, M. T.; Caselli, P.

2018-04-01

The fractionation of nitrogen (N) in star-forming regions is a poorly understood process. To put more stringent observational constraints on the N-fractionation, we have observed with the IRAM-30m telescope a large sample of 66 cores in massive star-forming regions. We targeted the (1-0) rotational transition of HN13C, HC15N, H13CN and HC15N, and derived the 14N/15N ratio for both HCN and HNC. We have completed this sample with that already observed by Colzi et al. (2018), and thus analysed a total sample of 87 sources. The 14N/15N ratios are distributed around the Proto-Solar Nebula value with a lower limit near the terrestrial atmosphere value (˜272). We have also derived the 14N/15N ratio as a function of the Galactocentric distance and deduced a linear trend based on unprecedented statistics. The Galactocentric dependences that we have found are consistent, in the slope, with past works but we have found a new local 14N/15N value of ˜400, i.e. closer to the Prosolar Nebula value. A second analysis was done, and a parabolic Galactocentric trend was found. Comparison with Galactic chemical evolution models shows that the slope until 8 kpc is consistent with the linear analysis, while the flattening trend above 8 kpc is well reproduced by the parabolic analysis.

Valuing fire planning alternatives in forest restoration: using derived demand to integrate economics with ecological restoration.

Science.gov (United States)

Rideout, Douglas B; Ziesler, Pamela S; Kernohan, Nicole J

2014-08-01

Assessing the value of fire planning alternatives is challenging because fire affects a wide array of ecosystem, market, and social values. Wildland fire management is increasingly used to address forest restoration while pragmatic approaches to assessing the value of fire management have yet to be developed. Earlier approaches to assessing the value of forest management relied on connecting site valuation with management variables. While sound, such analysis is too narrow to account for a broad range of ecosystem services. The metric fire regime condition class (FRCC) was developed from ecosystem management philosophy, but it is entirely biophysical. Its lack of economic information cripples its utility to support decision-making. We present a means of defining and assessing the deviation of a landscape from its desired fire management condition by re-framing the fire management problem as one of derived demand. This valued deviation establishes a performance metric for wildland fire management. Using a case study, we display the deviation across a landscape and sum the deviations to produce a summary metric. This summary metric is used to assess the value of alternative fire management strategies on improving the fire management condition toward its desired state. It enables us to identify which sites are most valuable to restore, even when they are in the same fire regime condition class. The case study site exemplifies how a wide range of disparate values, such as watershed, wildlife, property and timber, can be incorporated into a single landscape assessment. The analysis presented here leverages previous research on environmental capital value and non-market valuation by integrating ecosystem management, restoration, and microeconomics. Copyright © 2014 Elsevier Ltd. All rights reserved.

A PC program for estimating organ dose and effective dose values in computed tomography

International Nuclear Information System (INIS)

Kalender, W.A.; Schmidt, B.; Schmidt, M.; Zankl, M.

1999-01-01

Dose values in CT are specified by the manufacturers for all CT systems and operating conditions in phantoms. It is not trivial, however, to derive dose values in patients from this information. Therefore, we have developed a PC-based program which calculates organ dose and effective dose values for arbitrary scan parameters and anatomical ranges. Values for primary radiation are derived from measurements or manufacturer specifications; values for scattered radiation are derived from Monte Carlo calculations tabulated for standard anthropomorphic phantoms. Based on these values, organ doses can be computed by the program for arbitrary scan protocols in conventional and in spiral CT. Effective dose values are also provided, both with ICRP 26 and ICRP 60 tissue-weighting coefficients. Results for several standard CT protocols are presented in tabular form in this paper. In addition, potential for dose reduction is demonstrated, for example, in spiral CT and in quantitative CT. Providing realistic patient dose estimates for arbitrary CT protocols is relevant both for the physician and the patient, and it is particularly useful for educational and training purposes. The program, called WinDose, is now in use at the Erlangen University hospitals (Germany) as an information tool for radiologists and patients. Further extensions are planned. (orig.)

Growth behavior of anodic oxide formed by aluminum anodizing in glutaric and its derivative acid electrolytes

Science.gov (United States)

Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.

2014-12-01

The growth behavior of anodic oxide films formed via anodizing in glutaric and its derivative acid solutions was investigated based on the acid dissociation constants of electrolytes. High-purity aluminum foils were anodized in glutaric, ketoglutaric, and acetonedicarboxylic acid solutions under various electrochemical conditions. A thin barrier anodic oxide film grew uniformly on the aluminum substrate by glutaric acid anodizing, and further anodizing caused the film to breakdown due to a high electric field. In contrast, an anodic porous alumina film with a submicrometer-scale cell diameter was successfully formed by ketoglutaric acid anodizing at 293 K. However, the increase and decrease in the temperature of the ketoglutaric acid resulted in non-uniform oxide growth and localized pitting corrosion of the aluminum substrate. An anodic porous alumina film could also be fabricated by acetonedicarboxylic acid anodizing due to the relatively low dissociation constants associated with the acid. Acid dissociation constants are an important factor for the fabrication of anodic porous alumina films.

Predictive value of cardiac magnetic resonance imaging-derived myocardial strain for poor outcomes in patients with acute myocarditis

Energy Technology Data Exchange (ETDEWEB)

Lee, Ji Won; Jeong, Yeon Joo; Lee, Gee Won; Lee, Nam Kyung; Lee, Hye Won; Kim, Jin You [Pusan National University School of Medicine and Medical Research Institute, Pusan National University Hospital, Busan (Korea, Republic of); Choi, Bum Sung; Choo, Ki Seok [Pusan National University Yangsan Hospital, Yangsan (Korea, Republic of)

2017-08-01

To evaluate the utility of cardiovascular magnetic resonance (CMR)-derived myocardial strain measurement for the prediction of poor outcomes in patients with acute myocarditis We retrospectively analyzed data from 37 patients with acute myocarditis who underwent CMR. Left ventricular (LV) size, LV mass index, ejection fraction and presence of myocardial late gadolinium enhancement (LGE) were analyzed. LV circumferential strain (EccSAX), radial strain (ErrSAX) from mid-ventricular level short-axis cine views and LV longitudinal strain (EllLV), radial strain (ErrLax) measurements from 2-chamber long-axis views were obtained. In total, 31 of 37 patients (83.8%) underwent follow-up echocardiography. The primary outcome was major adverse cardiovascular event (MACE). Incomplete LV functional recovery was a secondary outcome. During an average follow-up of 41 months, 11 of 37 patients (29.7%) experienced MACE. Multivariable Cox proportional hazard regression analysis, which included LV mass index, LV ejection fraction, the presence of LGE, EccSAX, ErrSAX, EllLV, and ErrLax values, indicated that the presence of LGE (hazard ratio, 42.88; p = 0.014), together with ErrLax (hazard ratio, 0.77 per 1%, p = 0.004), was a significant predictor of MACE. Kaplan-Meier analysis demonstrated worse outcomes in patient with LGE and an ErrLax value ≤ 9.48%. Multivariable backward regression analysis revealed that ErrLax values were the only significant predictors of LV functional recovery (hazard ratio, 0.54 per 1%; p = 0.042). CMR-derived ErrLax values can predict poor outcomes, both MACE and incomplete LV functional recovery, in patients with acute myocarditis, while LGE is only a predictor of MACE.

Financial Derivatives

DEFF Research Database (Denmark)

Wigan, Duncan

2013-01-01

Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....

A stochastic model for the derivation of economic values and their standard deviations for production and functional traits in dairy cattle

DEFF Research Database (Denmark)

Nielsen, Hanne-Marie; Groen, A F; Østergaard, Søren

2006-01-01

The objective of this paper was to present a model of a dairy cattle production system for the derivation of economic values and their standard deviations for both production and functional traits under Danish production circumstances. The stochastic model used is dynamic, and simulates production...... was -0.94 €/day per cow-year. Standard deviations of economic values expressing variation in realised profit of a farm before and after a genetic change were computed using a linear Taylor series expansion. Expressed as coefficient of variation, standard deviations of economic values based on 1000...

How to derive biological information from the value of the normalization constant in allometric equations.

Science.gov (United States)

Kaitaniemi, Pekka

2008-04-09

Allometric equations are widely used in many branches of biological science. The potential information content of the normalization constant b in allometric equations of the form Y = bX(a) has, however, remained largely neglected. To demonstrate the potential for utilizing this information, I generated a large number of artificial datasets that resembled those that are frequently encountered in biological studies, i.e., relatively small samples including measurement error or uncontrolled variation. The value of X was allowed to vary randomly within the limits describing different data ranges, and a was set to a fixed theoretical value. The constant b was set to a range of values describing the effect of a continuous environmental variable. In addition, a normally distributed random error was added to the values of both X and Y. Two different approaches were then used to model the data. The traditional approach estimated both a and b using a regression model, whereas an alternative approach set the exponent a at its theoretical value and only estimated the value of b. Both approaches produced virtually the same model fit with less than 0.3% difference in the coefficient of determination. Only the alternative approach was able to precisely reproduce the effect of the environmental variable, which was largely lost among noise variation when using the traditional approach. The results show how the value of b can be used as a source of valuable biological information if an appropriate regression model is selected.

Geochemical characteristics of Carboniferous-Permian coal-formed gas in Bohai Bay Basin

Energy Technology Data Exchange (ETDEWEB)

Shipeng Huang; Fengrong Liao; Xiaoqi Wu [PetroChina, Beijing (China). Research Institute of Petroleum Exploration & Development

2010-03-15

Coal-formed gas reservoirs have been found in several depressions in Bohai Bay Basin. The gas was mainly generated by the Carboniferous-Permian coal measures, which are good source rocks. The exploration of coal-formed gas has a broad prospect. The main reservoirs of the coal-formed gas are Ordovician, Carboniferous-Permian, and Paleogene stratum. Coal-formed gas in the Bohai Bay Basin is chiefly composed of hydrocarbon gases. The percentage content of carbon dioxide is more than that of the nitrogen gas. The stable carbon isotope values of the hydrocarbon gases of different depressions and different reservoirs usually reversed. The reversed values of gas samples account for 52.1% of all the samples. Reversion values of the carbon isotope are mainly because of the mixing of gases from same source rocks but with different maturity. Among the three main reservoirs, coal-formed gas preserved in Paleogene stratum has the heaviest carbon isotope, the second is the gas in Carboniferous-Permian stratum, and the Ordovician gas possesses the lightest carbon isotope. Based on the analysis of the characteristics of carbon isotope of hydrocarbon gases in well Qishen-1 and the distribution of the Carboniferous-Permian coal measures, the gas of the well is derived from the high-matured Carboniferous-Permian coal measures.

Accounting for Fair Value Headging

OpenAIRE

Botea Elena Mihaela; Stanila Oana Georgiana; SSahlian Daniela Nicoleta

2010-01-01

The derivatives appearance was generated by the discovery of new ways to limit and manage current activity risks. Derivatives couldn’t hedge any type of risk. Derivative operations can be used to hedge: interest rate risks, foreign currency exchange rate risks, credit risks. Derivatives used to hedge these risks can be handled to cover fair value exposure, cash flow exposure and exposure to changes in the value of a net investment in a foreign operation. The hedging accounting roll is to prot...

SPONSORING, BRAND VALUE AND SOCIAL MEDIA

Directory of Open Access Journals (Sweden)

Alexander Zauner

2012-10-01

Full Text Available The increasing involvement of individuals in social media over the past decade has enabled firms to pursue new avenues in communication and sponsoring activities. Besides general research on either social media or sponsoring, questions regarding the consequences of a joint activity (sponsoring activities in social media remain unexplored. Hence, the present study analyses whether the perceived image of the brand and the celebrity endorser credibility of a top sports team influence the perceived brand value of the sponsoring firm in a social media setting. Moreover, these effects are compared between existing customers and non-customers of the sponsoring firm. Interestingly, perceived celebrity endorser credibility plays no role in forming brand value perceptions in the case of the existing customers. Implications for marketing theory and practice are derived.

Taxation of Derivatives

DEFF Research Database (Denmark)

Dyppel, Katja Joo

2013-01-01

The main objective for this thesis is to analyse and systematise the Danish legislation on taxation of derivatives. According to financial terminology, a derivative is a financial instrument. Its value is derived from changes in the value of one or more underlying assets.The most common derivatives...... in the Danish tax legislation. However, contracts known as forwards (terminskontrakter) and options (aftaler om køberetter og salgsretter) are generally included in the term financials contracts covered by the Danish Act on Taxation of Gains and Losses on Claims and Debt. The main part of the analysis deals...... with the scope of sections 29-33 of the Danish Act on Taxation of Gains and Losses on Claims and Debt and the tax consequences for the covered financial contracts. In the analysis of taxation of derivatives, the fundamental issues of qualification and tax treatment of the instruments are dealt with....

The hematopoietic chemokine CXCL12 promotes integration of human endothelial colony forming cell-derived cells into immature vessel networks.

Science.gov (United States)

Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M

2014-11-15

Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.

Transmission FTIR derivative spectroscopy for estimation of furosemide in raw material and tablet dosage form

Directory of Open Access Journals (Sweden)

Máximo Gallignani

2014-10-01

Full Text Available A Fourier transform infrared derivative spectroscopy (FTIR-DS method has been developed for determining furosemide (FUR in pharmaceutical solid dosage form. The method involves the extraction of FUR from tablets with N,N-dimethylformamide by sonication and direct measurement in liquid phase mode using a reduced path length cell. In general, the spectra were measured in transmission mode and the equipment was configured to collect a spectrum at 4 cm−1 resolution and a 13 s collection time (10 scans co-added. The spectra were collected between 1400 cm−1 and 450 cm−1. Derivative spectroscopy was used for data processing and quantitative measurement using the peak area of the second order spectrum of the major spectral band found at 1165 cm−1 (SO2 stretching of FUR with baseline correction. The method fulfilled most validation requirements in the 2 mg/mL and 20 mg/mL range, with a 0.9998 coefficient of determination obtained by simple calibration model, and a general coefficient of variation <2%. The mean recovery for the proposed assay method resulted within the (100±3% over the 80%–120% range of the target concentration. The results agree with a pharmacopoeial method and, therefore, could be considered interchangeable.

Deriving site-specific soil clean-up values for metals and metalloids: rationale for including protection of soil microbial processes.

Science.gov (United States)

Kuperman, Roman G; Siciliano, Steven D; Römbke, Jörg; Oorts, Koen

2014-07-01

Although it is widely recognized that microorganisms are essential for sustaining soil fertility, structure, nutrient cycling, groundwater purification, and other soil functions, soil microbial toxicity data were excluded from the derivation of Ecological Soil Screening Levels (Eco-SSL) in the United States. Among the reasons for such exclusion were claims that microbial toxicity tests were too difficult to interpret because of the high variability of microbial responses, uncertainty regarding the relevance of the various endpoints, and functional redundancy. Since the release of the first draft of the Eco-SSL Guidance document by the US Environmental Protection Agency in 2003, soil microbial toxicity testing and its use in ecological risk assessments have substantially improved. A wide range of standardized and nonstandardized methods became available for testing chemical toxicity to microbial functions in soil. Regulatory frameworks in the European Union and Australia have successfully incorporated microbial toxicity data into the derivation of soil threshold concentrations for ecological risk assessments. This article provides the 3-part rationale for including soil microbial processes in the development of soil clean-up values (SCVs): 1) presenting a brief overview of relevant test methods for assessing microbial functions in soil, 2) examining data sets for Cu, Ni, Zn, and Mo that incorporated soil microbial toxicity data into regulatory frameworks, and 3) offering recommendations on how to integrate the best available science into the method development for deriving site-specific SCVs that account for bioavailability of metals and metalloids in soil. Although the primary focus of this article is on the development of the approach for deriving SCVs for metals and metalloids in the United States, the recommendations provided in this article may also be applicable in other jurisdictions that aim at developing ecological soil threshold values for protection of

Valuing Essays: Essaying Values

Science.gov (United States)

Badley, Graham

2010-01-01

The essay regularly comes under attack. It is criticised for being rigidly linear rather than flexible and reflective. I first challenge this view by examining reasons why the essay should be valued as an important genre. Secondly, I propose that in using the essay form students and academics necessarily exemplify their own critical values. Essays…

Designing neural networks that process mean values of random variables

International Nuclear Information System (INIS)

Barber, Michael J.; Clark, John W.

2014-01-01

We develop a class of neural networks derived from probabilistic models posed in the form of Bayesian networks. Making biologically and technically plausible assumptions about the nature of the probabilistic models to be represented in the networks, we derive neural networks exhibiting standard dynamics that require no training to determine the synaptic weights, that perform accurate calculation of the mean values of the relevant random variables, that can pool multiple sources of evidence, and that deal appropriately with ambivalent, inconsistent, or contradictory evidence. - Highlights: • High-level neural computations are specified by Bayesian belief networks of random variables. • Probability densities of random variables are encoded in activities of populations of neurons. • Top-down algorithm generates specific neural network implementation of given computation. • Resulting “neural belief networks” process mean values of random variables. • Such networks pool multiple sources of evidence and deal properly with inconsistent evidence

Designing neural networks that process mean values of random variables

Energy Technology Data Exchange (ETDEWEB)

Barber, Michael J. [AIT Austrian Institute of Technology, Innovation Systems Department, 1220 Vienna (Austria); Clark, John W. [Department of Physics and McDonnell Center for the Space Sciences, Washington University, St. Louis, MO 63130 (United States); Centro de Ciências Matemáticas, Universidade de Madeira, 9000-390 Funchal (Portugal)

2014-06-13

We develop a class of neural networks derived from probabilistic models posed in the form of Bayesian networks. Making biologically and technically plausible assumptions about the nature of the probabilistic models to be represented in the networks, we derive neural networks exhibiting standard dynamics that require no training to determine the synaptic weights, that perform accurate calculation of the mean values of the relevant random variables, that can pool multiple sources of evidence, and that deal appropriately with ambivalent, inconsistent, or contradictory evidence. - Highlights: • High-level neural computations are specified by Bayesian belief networks of random variables. • Probability densities of random variables are encoded in activities of populations of neurons. • Top-down algorithm generates specific neural network implementation of given computation. • Resulting “neural belief networks” process mean values of random variables. • Such networks pool multiple sources of evidence and deal properly with inconsistent evidence.

Two Forms of Philosophical Argument or Critique

Science.gov (United States)

Marshall, James D.

2004-01-01

In this paper the author looks at two forms of philosophical argument or critique. These are derived by himself from the work of the late Kantian scholar, Stephan Korner who, in his book "What is Philosophy?" (1969), draws a number of distinctions between different forms of "philosophical" argument or critique. The two forms of derived argument,…

A stochastic model for the derivation of economic values and their standard deviations for production and functional traits in dairy cattle

NARCIS (Netherlands)

Nielsen, H.M.; Groen, A.F.; Ostergaard, S.; Berg, P.

2006-01-01

The objective of this paper was to present a model of a dairy cattle production system for the derivation of economic values and their standard deviations for both production and functional traits under Danish production circumstances. The stochastic model used is dynamic, and simulates production

"Domestic Violence" and Different Forms of Conciliation

Directory of Open Access Journals (Sweden)

Guita Grin Debert

2008-01-01

Full Text Available Alternative conflict resolution based on conciliation have been identified as a possible response to problems of access to courts deriving from the numbers, costs and length of proceedings in the Brazilian's judicial system. This paper focuses on these alternative forms of justice, regarding domestic violence. Using ethnographic studies of Women's Police Stations and at Small Claim Courts, we argue that conciliation can be very different in these two institutions of the judicial system. The contrasts between moral values and the symbols used in different forms by these two institutions offer elements that can further be our understanding of the context in which Maria da Penha Law was created on August 17th of 2006. With the promulgation of this law, cases of domestic violence against women were excluded from Small Claim Courts in Brazil.

Optimization of the culturing conditions of human umbilical cord blood-derived endothelial colony-forming cells under xeno-free conditions applying a transcriptomic approach

NARCIS (Netherlands)

Zeisberger, Steffen M.; Zoller, Stefan; Riegel, Mariluce; Chen, Shuhua; Krenning, Guido; Harmsen, Martin C.; Sachinidis, Agapios; Zisch, Andreas H.

Establishment of fetal bovine serum (FBS)-free cell culture conditions is essential for transplantation therapies. Blood-derived endothelial colony-forming cells (ECFCs) are potential candidates for regenerative medicine applications. ECFCs were isolated from term umbilical cord blood units and

Mean value-based power allocation and ratio selection for MIMO cognitive radio systems

KAUST Repository

Tourki, Kamel; Qaraqe, Khalid A.; Alouini, Mohamed-Slim

2013-01-01

In this paper, we consider a spectrum sharing cognitive radio system with ratio selection using a mean value-based power allocation strategy. We first provide the exact statistics in terms of probability density function and cumulative density function of the secondary channel gain as well as of the interference channel gain. These statistics are then used to derive exact closed form expression of the secondary outage probability. Furthermore, asymptotical analysis is derived and generalized diversity gain is deduced. We validate our analysis with simulation results in a Rayleigh fading environment. © 2013 IEEE.

Mean value-based power allocation and ratio selection for MIMO cognitive radio systems

KAUST Repository

Tourki, Kamel

2013-06-01

In this paper, we consider a spectrum sharing cognitive radio system with ratio selection using a mean value-based power allocation strategy. We first provide the exact statistics in terms of probability density function and cumulative density function of the secondary channel gain as well as of the interference channel gain. These statistics are then used to derive exact closed form expression of the secondary outage probability. Furthermore, asymptotical analysis is derived and generalized diversity gain is deduced. We validate our analysis with simulation results in a Rayleigh fading environment. © 2013 IEEE.

Correction of conebeam CT values using a planning CT for derivation of the 'dose of the day'

International Nuclear Information System (INIS)

Zijtveld, Mathilda van; Dirkx, Maarten; Heijmen, Ben

2007-01-01

Background and purpose: Verification of the actually delivered 3D dose distribution during each treatment fraction ('dose of the day') is the most complete and clinical relevant 'in-vivo' check of an IMRT treatment. To do this, during patient treatment portal dose images are routinely acquired with our electronic portal imaging device to derive the delivered fluence map for each treatment field. In addition, a conebeam CT scan is acquired just prior to treatment to derive the patient geometry at the time of treatment. However, the use of conebeam CT scans for dose calculation is hampered by inaccuracies in the conversion of CT values to electron densities due to an enlarged scatter contribution. Materials and methods: In this work, a method is described for mapping of Hounsfield Units of the planning CT to the conebeam CT scan, while accounting for non-rigidity in the anatomy, e.g. related to weight loss, in an approximate way. The method was validated for head and neck cancer patients by comparing dose distributions calculated using adjusted Hounsfield Units with a golden standard. Results and conclusions: The observed dose differences were less than 1% in the majority of points, and in at least 96% of the points a 3D γ analysis resulted in γ values of less than 1 when applying a 2%/2 mm criterion, showing that this straightforward approach allows for an accurate dose calculation based on conebeam CT scans

Value encounters - Modeling and analyzing co-creation of value

NARCIS (Netherlands)

Weigand, H.; Godart, C.; Gronau, N.; Sharma, S.; Canals, G.

2009-01-01

Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value

Value encounters : Modelling and analyzing co-creation of value

NARCIS (Netherlands)

Weigand, H.; Jayasinghe Arachchig, J.

2009-01-01

Recent marketing and management literature has introduced the concept of co-creation of value. Current value modeling approaches such as e3-value focus on the exchange of value rather than co-creation. In this paper, an extension to e3-value is proposed in the form of a “value encounter”. Value

Finite volume form factors in the presence of integrable defects

International Nuclear Information System (INIS)

Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.

2014-01-01

We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee–Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee–Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found

Densities, form factors, transitions and multipole moments in the s-d shell, with the Skyrme force

International Nuclear Information System (INIS)

Oliveira, D.R. de; Mizrahi, S.S.

1977-09-01

The nuclear densities, radii, multipole moments, form-factors and transition probabilities obtained for the A = 4n type of nuclei in the s-d shell are reported, using the Hartree-Fock wave functions calculated with the Skyrme force. Experimental data and theoretical values derived by others are shown for comparison [pt

Forming technology motivational-valued attitudes toward healthy appearance and lifestyle for students institutes of higher Ministry of internal affairs of Russia

Directory of Open Access Journals (Sweden)

Klimenko B.A.

2010-10-01

Full Text Available Directions of forming healthy lifestyle are considered for students. 62 students took part in experiment. New conception of the health physical training is grounded high-quality for students. Tests are developed as evaluated by the measure of formed of healthy lifestyle for students. Offered approach to the maintainance of professional health, level of physical preparedness at the change of appearance and lifestyle. It is set that the author program forms for students motivational-valued attitude toward the healthy lifestyle.

18 CFR 367.2440 - Account 244, Derivative instrument liabilities.

Science.gov (United States)

2010-04-01

..., Derivative instrument liabilities. This account must include the change in the fair value of all derivative instrument liabilities not designated as cash flow or fair value hedges. Account 426.5, Other deductions... the fair value of the derivative instrument. ...

Use of thermodynamic sorption models to derive radionuclide Kd values for performance assessment: Selected results and recommendations of the NEA sorption project

Science.gov (United States)

Ochs, M.; Davis, J.A.; Olin, M.; Payne, T.E.; Tweed, C.J.; Askarieh, M.M.; Altmann, S.

2006-01-01

For the safe final disposal and/or long-term storage of radioactive wastes, deep or near-surface underground repositories are being considered world-wide. A central safety feature is the prevention, or sufficient retardation, of radionuclide (RN) migration to the biosphere. To this end, radionuclide sorption is one of the most important processes. Decreasing the uncertainty in radionuclide sorption may contribute significantly to reducing the overall uncertainty of a performance assessment (PA). For PA, sorption is typically characterised by distribution coefficients (Kd values). The conditional nature of Kd requires different estimates of this parameter for each set of geochemical conditions of potential relevance in a RN's migration pathway. As it is not feasible to measure sorption for every set of conditions, the derivation of Kd for PA must rely on data derived from representative model systems. As a result, uncertainty in Kd is largely caused by the need to derive values for conditions not explicitly addressed in experiments. The recently concluded NEA Sorption Project [1] showed that thermodynamic sorption models (TSMs) are uniquely suited to derive K d as a function of conditions, because they allow a direct coupling of sorption with variable solution chemistry and mineralogy in a thermodynamic framework. The results of the project enable assessment of the suitability of various TSM approaches for PA-relevant applications as well as of the potential and limitations of TSMs to model RN sorption in complex systems. ?? by Oldenbourg Wissenschaftsverlag.

The derivation of the general form of kinematics with the universal reference system

Science.gov (United States)

Szostek, Karol; Szostek, Roman

2018-03-01

In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether - with any transverse contraction. The entire article contains only original research conducted by its authors.

EURRECA—Estimating Selenium Requirements for Deriving Dietary Reference Values

NARCIS (Netherlands)

Hurst, R.; Collings, R.; Harvey, L.J.; King, M.; Hooper, L.; Bouwman, J.; Gurinovic, M.; Fairweather-Tait, S.J.

2013-01-01

Current reference values for selenium, an essential micronutrient, are based on the intake of selenium that is required to achieve maximal glutathione peroxidase activity in plasma or erythrocytes. In order to assess the evidence of relevance to setting dietary reference values for selenium, the

Equivalence, commensurability, value

DEFF Research Database (Denmark)

Albertsen, Niels

2017-01-01

Deriving value in Capital Marx uses three commensurability arguments (CA1-3). CA1 establishes equivalence in exchange as exchangeability with the same third commodity. CA2 establishes value as common denominator in commodities: embodied abstract labour. CA3 establishes value substance...... as commonality of labour: physiological labour. Tensions between these logics have permeated Marxist interpretations of value. Some have supported value as embodied labour (CA2, 3), others a monetary theory of value and value as ‘pure’ societal abstraction (ultimately CA1). They all are grounded in Marx....

Radiological protection optimization using derivatives

International Nuclear Information System (INIS)

Freitas Acosta Perez, C. de; Sordi, G.M.A.A.

2006-01-01

The aim of this paper is to provide a different approach related to the integral cost-benefit and extended cost-benefit analysis used in the decision-aiding techniques. In the ICRP publication 55 the annual protection cost is envisaged as a set of points, each of them representing an option, linked by a straight line. The detriment cost function is considered a linear function whose angular coefficient is determined by the alpha value. In this paper the uranium mine example considered in the ICRP publication 55 was used. But the potential curve was introduced both in the integral cost benefit analysis and in the extended cost-benefit analysis, which the individual dose distribution attribute is added. The result was obtained using derivatives. The detriment cost, Y, is not necessary because the alpha value is known. The Y derivative dS/dY is the alpha value itself and so, the attention is directed to the derivative -dX/dS on the points that, along with the alpha value, present the optimum option. The results makes clear that the prevailing factor in the optimum option selection is the alpha value imputed, and those a single alpha value, as suggested now, probably as little efficiency on the optimization process. Obtaining a curve for the alpha value and using the derivative technique introduced in this paper, the analytical solution is more convenient and reliable compared to the one used now. (authors)

18 CFR 367.1750 - Account 175, Derivative instrument assets.

Science.gov (United States)

2010-04-01

... the corresponding amount of the change in the fair value of the derivative instrument. ... instrument assets. This account must include the amounts paid for derivative instruments, and the change in the fair value of all derivative instrument assets not designated as cash flow or fair value hedges...

Modern approaches to forming value orientations of junior pupils nowadays

Directory of Open Access Journals (Sweden)

Liudmyla Matsuk

2017-04-01

Full Text Available A number of approaches to the formation of value orientations of primary school children today is outlined in the article. One of the most important tasks of the school in terms of national revival of Ukraine appears education of harmonious, spiritually rich and nationally conscious personality. Educating of the current generation needs serious updating of educational content, development of a wide spectrum of problems associated with the formation of ideological orientations of a personality, development and activity, independence, consciousness, self-consciousness. The solution of the abovementioned problem is possible subject to optimize management of process education through the humanization of education that will ensure the establishment of priority of human values in society.Key words: values, value orientations, training and education, junior pupils, patriotism, identity, dignity, courage, duty, responsibility, tolerance.

Prognostic value of CT-derived left atrial and left ventricular measures in patients with acute chest pain

Energy Technology Data Exchange (ETDEWEB)

Takx, Richard A.P. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Radiology, University Medical Center Utrecht (Netherlands); Vliegenthart, Rozemarijn [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); University of Groningen/University Medical Center Groningen, Center for Medical Imaging − North East Netherlands, Department of Radiology, Groningen (Netherlands); Schoepf, U. Joseph, E-mail: schoepf@musc.edu [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); Nance, John W. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Bamberg, Fabian [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Department of Diagnostic and Interventional Radiology, Eberhard-Karls University Tuebingen, Tuebingen (Germany); Abro, Joseph A. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Carr, Christine M. [Division of Emergency Medicine, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); Litwin, Sheldon E. [Division of Cardiovascular Imaging, Department of Radiology and Radiological Science, Medical University of South Carolina, Charleston, SC (United States); Division of Cardiology, Department of Medicine, Medical University of South Carolina, Charleston, SC (United States); and others

2017-01-15

Highlights: • LV mass and LA diameter are independent prognostic factor for composite MACE. • LV mass and LA diameter were not significant prognostic factors for MACE in African Americans. • Assessment of LV mass by CT may have a role in the management of patients. - Abstract: Purpose: To determine which left atrial (LA) and left ventricular (LV) parameters are associated with future major adverse cardiac event (MACE) and whether these measurements have independent prognostic value beyond risk factors and computed tomography (CT)-derived coronary artery disease measures. Materials and methods: This retrospective analysis was performed under an IRB waiver and in HIPAA compliance. Subjects underwent coronary CT angiography (CCTA) using a dual-source CT system for acute chest pain evaluation. LV mass, LV ejection fraction (EF), LV end-systolic volume (ESV) and LV end-diastolic volume (EDV), LA ESV and LA diameter, septal wall thickness and cardiac chamber diameters were measured. MACE was defined as cardiac death, non-fatal myocardial infarction, unstable angina, or late revascularization. The association between cardiac CT measures and the occurrence of MACE was quantified using Cox proportional hazard analysis. Results: 225 subjects (age, 56.2 ± 11.2; 140 males) were analyzed, of whom 42 (18.7%) experienced a MACE during a median follow-up of 13 months. LA diameter (HR:1.07, 95%CI:1.01–1.13 per mm) and LV mass (HR:1.05, 95%CI:1.00–1.10 per g) remained significant prognostic factor of MACE after controlling for Framingham risk score. LA diameter and LV mass were also found to have prognostic value independent of each other. The other morphologic and functional cardiac measures were no significant prognostic factors for MACE. Conclusion: CT-derived LA diameter and LV mass are associated with future MACE in patients undergoing evaluation for chest pain, and portend independent prognostic value beyond traditional risk factors, coronary calcium score, and

Diffusion from cylindrical waste forms

International Nuclear Information System (INIS)

Thomas, G.F.

1985-05-01

The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

Efficient Closed Form Cut-Off Planes and Propagation Planes Characteristics for Dielectric Slab Loaded Boundary Value Problems

OpenAIRE

Zafar, Junaid

2012-01-01

The geometrical relationship between the cut-off and propagating planes of any waveguide system is a prerequisite for any design process. The characterization of cut-off planes and optimisation are challenging for numerical methods, closed-form solutions are always preferred. In this paper Maxwells coupled field equations are used to characterise twin E-plane and H-plane slab loaded boundary value problems. The single mode bandwidths and dispersion characteristics of these structures are pres...

The derivation of the general form of kinematics with the universal reference system

Directory of Open Access Journals (Sweden)

Karol Szostek

2018-03-01

Full Text Available In the article, the whole class of time and position transformations was derived. These transformations were derived based on the analysis of the Michelson-Morley experiment and its improved version, that is the Kennedy-Thorndike experiment. It is possible to derive a different kinematics of bodies based on each of these transformations. In this way, we demonstrated that the Special Theory of Relativity is not the only theory explaining the results of experiments with light. There is the whole continuum of the theories of kinematics of bodies which correctly explain the Michelson-Morley experiment and other experiments in which the velocity of light is measured. Based on the derived transformations, we derive the general formula for the velocity of light in vacuum measured in any inertial reference system. We explain why the Michelson-Morley and Kennedy-Thorndike experiments could not detect the ether. We present and discuss three examples of specific transformations. Finally, we explain the phenomenon of anisotropy of the cosmic microwave background radiation by means of the presented theory. The theory derived in this work is called the Special Theory of Ether – with any transverse contraction. The entire article contains only original research conducted by its authors. Keywords: Kinematics of bodies, Universal frame of reference, Transformation of time and position, One-way speed of light, Anisotropy of cosmic microwave background

Functional neuromuscular junctions formed by embryonic stem cell-derived motor neurons.

Directory of Open Access Journals (Sweden)

Joy A Umbach

Full Text Available A key objective of stem cell biology is to create physiologically relevant cells suitable for modeling disease pathologies in vitro. Much progress towards this goal has been made in the area of motor neuron (MN disease through the development of methods to direct spinal MN formation from both embryonic and induced pluripotent stem cells. Previous studies have characterized these neurons with respect to their molecular and intrinsic functional properties. However, the synaptic activity of stem cell-derived MNs remains less well defined. In this study, we report the development of low-density co-culture conditions that encourage the formation of active neuromuscular synapses between stem cell-derived MNs and muscle cells in vitro. Fluorescence microscopy reveals the expression of numerous synaptic proteins at these contacts, while dual patch clamp recording detects both spontaneous and multi-quantal evoked synaptic responses similar to those observed in vivo. Together, these findings demonstrate that stem cell-derived MNs innervate muscle cells in a functionally relevant manner. This dual recording approach further offers a sensitive and quantitative assay platform to probe disorders of synaptic dysfunction associated with MN disease.

Cassava (Manihot esculenta Crantz) and Yam (Dioscorea spp.) Crops and Their Derived Foodstuffs: Safety, Security and Nutritional Value.

Science.gov (United States)

Ferraro, Vincenza; Piccirillo, Clara; Tomlins, Keith; Pintado, Manuela E

2016-12-09

Cassava (Manihot esculenta Crantz) and yam (Dioscorea spp.) are tropical crops consumed by ca. 2 billion people and represent the main source of carbohydrate and energy for the approximately 700 million people living in the tropical and sub-tropical areas. They are a guarantee of food security for developing countries. The production of these crops and the transformation into food-derived commodities is increasing, it represents a profitable business and farmers generate substantial income from their market. However, there are some important concerns related to the food safety and food security. The high post-harvest losses, mainly for yam, the contamination by endogenous toxic compounds, mainly for cassava, and the contamination by external agents (such as micotoxins, pesticides, and heavy metal) represent a depletion of economic value and income. The loss in the raw crops or the impossibility to market the derived foodstuffs, due to incompliance with food regulations, can seriously limit all yam tubers and the cassava roots processors, from farmers to household, from small-medium to large enterprises. One of the greatest challenges to overcome those concerns is the transformation of traditional or indigenous processing methods into modern industrial operations, from the crop storage to the adequate package of each derived foodstuff.

OCOPTR, Minimization of Nonlinear Function, Variable Metric Method, Derivative Calculation. DRVOCR, Minimization of Nonlinear Function, Variable Metric Method, Derivative Calculation

International Nuclear Information System (INIS)

Nazareth, J. L.

1979-01-01

1 - Description of problem or function: OCOPTR and DRVOCR are computer programs designed to find minima of non-linear differentiable functions f: R n →R with n dimensional domains. OCOPTR requires that the user only provide function values (i.e. it is a derivative-free routine). DRVOCR requires the user to supply both function and gradient information. 2 - Method of solution: OCOPTR and DRVOCR use the variable metric (or quasi-Newton) method of Davidon (1975). For OCOPTR, the derivatives are estimated by finite differences along a suitable set of linearly independent directions. For DRVOCR, the derivatives are user- supplied. Some features of the codes are the storage of the approximation to the inverse Hessian matrix in lower trapezoidal factored form and the use of an optimally-conditioned updating method. Linear equality constraints are permitted subject to the initial Hessian factor being chosen correctly. 3 - Restrictions on the complexity of the problem: The functions to which the routine is applied are assumed to be differentiable. The routine also requires (n 2 /2) + 0(n) storage locations where n is the problem dimension

Value-added potential of expeller-pressed canola oil refining: characterization of sinapic acid derivatives and tocopherols from byproducts.

Science.gov (United States)

Chen, Yougui; Thiyam-Hollander, Usha; Barthet, Veronique J; Aachary, Ayyappan A

2014-10-08

Valuable phenolic antioxidants are lost during oil refining, but evaluation of their occurrence in refining byproducts is lacking. Rapeseed and canola oil are both rich sources of sinapic acid derivatives and tocopherols. The retention and loss of sinapic acid derivatives and tocopherols in commercially produced expeller-pressed canola oils subjected to various refining steps and the respective byproducts were investigated. Loss of canolol (3) and tocopherols were observed during bleaching (84.9%) and deodorization (37.6%), respectively. Sinapic acid (2) (42.9 μg/g), sinapine (1) (199 μg/g), and canolol (344 μg/g) were found in the refining byproducts, namely, soap stock, spent bleaching clay, and wash water, for the first time. Tocopherols (3.75 mg/g) and other nonidentified phenolic compounds (2.7 mg sinapic acid equivalent/g) were found in deodistillates, a byproduct of deodorization. DPPH radical scavenging confirmed the antioxidant potential of the byproducts. This study confirms the value-added potential of byproducts of refining as sources of endogenous phenolics.

Flexibility and Project Value: Interactions and Multiple Real Options

Science.gov (United States)

Čulík, Miroslav

2010-06-01

This paper is focused on a project valuation with embedded portfolio of real options including their interactions. Valuation is based on the criterion of Net Present Value on the simulation basis. Portfolio includes selected types of European-type real options: option to expand, contract, abandon and temporarily shut down and restart a project. Due to the fact, that in reality most of the managerial flexibility takes the form of portfolio of real options, selected types of options are valued not only individually, but also in combination. The paper is structured as follows: first, diffusion models for forecasting of output prices and variable costs are derived. Second, project value is estimated on the assumption, that no real options are present. Next, project value is calculated with the presence of selected European-type options; these options and their impact on project value are valued first in isolation and consequently in different combinations. Moreover, intrinsic value evolution of given real options with respect to the time of exercising is analysed. In the end, results are presented graphically; selected statistics and risk measures (Value at Risk, Expected Shortfall) of the NPV's distributions are calculated and commented.

18 CFR 367.2450 - Account 245, Derivative instrument liabilities-Hedges

Science.gov (United States)

2010-04-01

..., Derivative instrument liabilities—Hedges (a) This account must include the change in the fair value of... service company must record the change in the fair value of a derivative instrument liability related to a... change in the fair value of a derivative instrument liability related to a fair value hedge in this...

Fecal concentrations of bacterially-derived vitamin K forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults

Science.gov (United States)

Background: Emerging evidence suggests novel roles for bacterially-derived vitamin K forms known as menaquinones (MKn) in health and disease which may be attributable in part to anti-inflammatory effects. However, the relevance of MKn produced by gut bacteria to vitamin K requirements and inflammati...

Standard and Null Weak Values

OpenAIRE

Zilberberg, Oded; Romito, Alessandro; Gefen, Yuval

2013-01-01

Weak value (WV) is a quantum mechanical measurement protocol, proposed by Aharonov, Albert, and Vaidman. It consists of a weak measurement, which is weighed in, conditional on the outcome of a later, strong measurement. Here we define another two-step measurement protocol, null weak value (NVW), and point out its advantages as compared to WV. We present two alternative derivations of NWVs and compare them to the corresponding derivations of WVs.

Cadmium risks to freshwater life: derivation and validation of low-effect criteria values using laboratory and field studies

Science.gov (United States)

Mebane, Christopher A.

2006-01-01

In 2001, the U.S. Environmental Protection Agency (EPA) released updated aquatic life criteria for cadmium. Since then, additional data on the effects of cadmium to aquatic life have become available from studies supported by the EPA, Idaho Department of Environmental Quality (IDEQ), and the U.S. Geological Survey, among other sources. Updated data on the effects of cadmium to aquatic life were compiled and reviewed and low-effect concentrations were estimated. Low-effect values were calculated using EPA's guidelines for deriving numerical national water-quality criteria for the protection of aquatic organisms and their uses. Data on the short-term (acute) effects of cadmium on North American freshwater species that were suitable for criteria derivation were located for 69 species representing 57 genera and 33 families. For longer-term (chronic) effects of cadmium on North American freshwater species, suitable data were located for 28 species representing 21 genera and 17 families. Both the acute and chronic toxicity of cadmium were dependent on the hardness of the test water. Hardness-toxicity regressions were developed for both acute and chronic datasets so that effects data from different tests could be adjusted to a common water hardness. Hardness-adjusted effects values were pooled to obtain species and genus mean acute and chronic values, which then were ranked by their sensitivity to cadmium. The four most sensitive genera to acute exposures were, in order of increasing cadmium resistance, Oncorhynchus (Pacific trout and salmon), Salvelinus ('char' trout), Salmo (Atlantic trout and salmon), and Cottus (sculpin). The four most sensitive genera to chronic exposures were Hyalella (amphipod), Cottus, Gammarus (amphipod), and Salvelinus. Using the updated datasets, hardness dependent criteria equations were calculated for acute and chronic exposures to cadmium. At a hardness of 50 mg/L as calcium carbonate, the criterion maximum concentration (CMC, or 'acute

Evaluation of satellite derived spectral diffuse attenuation coefficients

Digital Repository Service at National Institute of Oceanography (India)

Suresh, T.; Talaulikar, M.; Desa, E.; Mascarenhas, A.A.M.Q.; Matondkar, S.G.P.

, 443, 490, 510, 555 and 670 nm derived from the ocean color satellite sensor, SeaWiFS with the in-situ measured values from the Arabian Sea is compared. The satellite derived values are found to be comparable to the measured values in the lower...

THE JCMT GOULD BELT SURVEY: EVIDENCE FOR DUST GRAIN EVOLUTION IN PERSEUS STAR-FORMING CLUMPS

Energy Technology Data Exchange (ETDEWEB)

Chen, Michael Chun-Yuan; Francesco, J. Di; Johnstone, D.; Broekhoven-Fiene, H. [Department of Physics and Astronomy, University of Victoria, Victoria, BC, V8P 1A1 (Canada); Sadavoy, S. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Hatchell, J. [Physics and Astronomy, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom); Mottram, J. C.; Hogerheijde, M. R. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Kirk, H. [NRC Herzberg Astronomy and Astrophysics, 5071 West Saanich Road, Victoria, BC, V9E 2E7 (Canada); Buckle, J.; Salji, C. [Astrophysics Group, Cavendish Laboratory, J J Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Berry, D. S.; Currie, M. J.; Jenness, T. [Joint Astronomy Centre, 660 North A‘ohōkū Place, University Park, Hilo, HI-96720 (United States); Fich, M.; Tisi, S. [Department of Physics and Astronomy, University of Waterloo, Waterloo, Ontario, N2L 3G1 (Canada); Nutter, D.; Quinn, C. [School of Physics and Astronomy, Cardiff University, The Parade, Cardiff, CF24 3AA (United Kingdom); Pattle, K. [Jeremiah Horrocks Institute, University of Central Lancashire, Preston, Lancashire, PR1 2HE (United Kingdom); Pineda, J. E. [European Southern Observatory (ESO), Garching (Germany); and others

2016-07-20

The dust emissivity spectral index, β , is a critical parameter for deriving the mass and temperature of star-forming structures and, consequently, their gravitational stability. The β value is dependent on various dust grain properties, such as size, porosity, and surface composition, and is expected to vary as dust grains evolve. Here we present β , dust temperature, and optical depth maps of the star-forming clumps in the Perseus Molecular Cloud determined from fitting spectral energy distributions to combined Herschel and JCMT observations in the 160, 250, 350, 500, and 850 μ m bands. Most of the derived β and dust temperature values fall within the ranges of 1.0–2.7 and 8–20 K, respectively. In Perseus, we find the β distribution differs significantly from clump to clump, indicative of grain growth. Furthermore, we also see significant localized β variations within individual clumps and find low- β regions correlate with local temperature peaks, hinting at the possible origins of low- β grains. Throughout Perseus, we also see indications of heating from B stars and embedded protostars, as well evidence of outflows shaping the local landscape.

Variational derivation of a time-dependent Hartree-Fock Hamiltonian

International Nuclear Information System (INIS)

Lichtner, P.C.; Griffin, J.J.; Schultheis, H.; Schultheis, R.; Volkov, A.B.

1979-01-01

The variational derivation of the time-dependent Hartree-Fock equation is reviewed. When norm-violating variations are included, a unique time-dependent Hartree-Fock Hamiltonian, which differs from that customarily used in time-dependent Hartree-Fock analyses, is implied. This variationally ''true'' Hartree-Fock Hamiltonian has the same expectation value as the exact Hamiltonian, equal to the average energy of the system. Since this quantity remains constant under time-dependent Hartree-Fock time evolution, we suggest the label ''constant '' for this form of time-dependent Hartree-Fock theory

Validation of the Long- and Short-Form of the Ethical Values Assessment (EVA): A Questionnaire Measuring the Three Ethics Approach to Moral Psychology

Science.gov (United States)

Padilla-Walker, Laura Maria; Jensen, Lene Arnett

2016-01-01

Moral psychology has been moving toward consideration of multiple kinds of moral concepts and values, such as the Ethics of Autonomy, Community, and Divinity. While these three ethics have commonly been measured qualitatively, the current study sought to validate the long and short forms of the Ethical Values Assessment (EVA), which is a…

THE INFLUENCE OF ECONOMIC VALUE ADDED AND MARKET VALUE ADDED ON CORPORATE VALUE

Directory of Open Access Journals (Sweden)

Taslim F.A.

2018-02-01

Full Text Available This research aims to determine the influence of economic value added and market value added on corporate value of manufacturing companies on sector consumer goods industry listed in Indonesia Stock Exchanges of 2011-2014. The sample of this research was 10 manufacturing companies on sector consumer goods industry listed in Indonesia Stock Exchanges. The method used was purposive sampling technique. This research used confirmatory factor analysis to form a combined proxy of corporate value comprised price earning ratio, price to book value and Tobin's Q.

A zeta potential value determines the aggregate's size of penta-substituted [60]fullerene derivatives in aqueous suspension whereas positive charge is required for toxicity against bacterial cells.

Science.gov (United States)

Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E

2015-08-08

The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the

Value of travel time savings

DEFF Research Database (Denmark)

Le Masurier, P.; Polak, J.; Pawlak, Janet

2015-01-01

A team of specialist market researchers and Value of Time experts comprising members from SYSTRA, Imperial College London and the Technical University of Denmark has conducted a formal audit and peer review of research undertaken by Arup/ITS Leeds/Accent to derive Value of Travel Time Savings...... Preference (RP) models that were used to derive final Values of Travel Time (VTT). This report contains the findings of our audit and peer review of the procedures adopted by the research team during data collection of the three surveys (SP, RP and Employers Surveys); a peer review of the reported approach...

Derived ERLs for inhalation of alpha-emitting aerorols

International Nuclear Information System (INIS)

Macdonald, H.F.

1977-01-01

Derived alpha action levels are expressed as dpm/m 3 and give the airborne concentration of an assumed mixture of α-emitters which if inhaled for a period of 4 hours would result in a dose commitment to members of the critical group in the exposed population equal to the emergency reference levels (ERLs) of dose recommended by the Medical Research Council (1975). The period of 4 hours is chosen as a realistic time during which an assessment of the severity of a release may be made and appropriate countermeasures instituted. The derived α ERLs are set with reference to the potential range of isotopic releases for a specific reactor system and in the case of gas-cooled magnox reactors, a value of 10 3 dpm/m 3 (170 Bqm -3 ) has been used. This level was based upon the lung and GI tract models originally recommended by ICRP 2 (1959:1964) and revised ERLs for the inhalation of α-emitters consequent upon the improved metabolic models subsequently proposed by the ICRP (1966:1972) are evaluated. It is shown that the derived α ERLs for irradiated magnox and AGR fuels are largely independent of the physico-chemical forms of the released material, while variations with cooling time of fuel are also discussed. In addition, the special limits imposed by the chemical toxicity of uranium when inhaled in a soluble, low enriched form are briefly outlined

Badly approximable systems of linear forms in absolute value

DEFF Research Database (Denmark)

Hussain, M.; Kristensen, Simon

In this paper we show that the set of mixed type badly approximable simultaneously small linear forms is of maximal dimension. As a consequence of this theorem we settle the conjecture stated in [9]....

Current algebra constraints on K13 form factors

International Nuclear Information System (INIS)

Simmons, L.D.

1975-01-01

New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences

Spectral detector CT-derived virtual non-contrast images: comparison of attenuation values with unenhanced CT.

Science.gov (United States)

Ananthakrishnan, Lakshmi; Rajiah, Prabhakar; Ahn, Richard; Rassouli, Negin; Xi, Yin; Soesbe, Todd C; Lewis, Matthew A; Lenkinski, Robert E; Leyendecker, John R; Abbara, Suhny

2017-03-01

To assess virtual non-contrast (VNC) images obtained on a detection-based spectral detector CT scanner and determine how attenuation on VNC images derived from various phases of enhanced CT compare to those obtained from true unenhanced images. In this HIPAA compliant, IRB approved prospective multi-institutional study, 46 patients underwent pre- and post-contrast imaging on a prototype dual-layer spectral detector CT between October 2013 and November 2015, yielding 84 unenhanced and VNC pairs (25 arterial, 39 portal venous/nephrographic, 20 urographic). Mean attenuation was measured by one of three readers in the liver, spleen, kidneys, psoas muscle, abdominal aorta, and subcutaneous fat. Equivalence testing was used to determine if the mean difference between unenhanced and VNC attenuation was less than 5, 10, or 15 HU. VNC image quality was assessed on a 5 point scale. Mean difference between unenhanced and VNC attenuation was VNC attenuation were equivalent in all tissues except fat using a threshold of VNC overestimated the HU relative to unenhanced images. VNC image quality was rated as excellent or good in 84% of arterial phase and 85% of nephrographic phase cases, but only 40% of urographic phase. VNC images derived from novel dual layer spectral detector CT demonstrate attenuation values similar to unenhanced images in all tissues evaluated except for subcutaneous fat. Further study is needed to determine if attenuation thresholds currently used clinically for common pathology should be adjusted, particularly for lesions containing fat.

The value of innovation under value-based pricing

Science.gov (United States)

Moreno, Santiago G.; Ray, Joshua A.

2016-01-01

Objective The role of cost-effectiveness analysis (CEA) in incentivizing innovation is controversial. Critics of CEA argue that its use for pricing purposes disregards the ‘value of innovation’ reflected in new drug development, whereas supporters of CEA highlight that the value of innovation is already accounted for. Our objective in this article is to outline the limitations of the conventional CEA approach, while proposing an alternative method of evaluation that captures the value of innovation more accurately. Method The adoption of a new drug benefits present and future patients (with cost implications) for as long as the drug is part of clinical practice. Incidence patients and off-patent prices are identified as two key missing features preventing the conventional CEA approach from capturing 1) benefit to future patients and 2) future savings from off-patent prices. The proposed CEA approach incorporates these two features to derive the total lifetime value of an innovative drug (i.e., the value of innovation). Results The conventional CEA approach tends to underestimate the value of innovative drugs by disregarding the benefit to future patients and savings from off-patent prices. As a result, innovative drugs are underpriced, only allowing manufacturers to capture approximately 15% of the total value of innovation during the patent protection period. In addition to including the incidence population and off-patent price, the alternative approach proposes pricing new drugs by first negotiating the share of value of innovation to be appropriated by the manufacturer (>15%?) and payer (price that satisfies this condition. Conclusion We argue for a modification to the conventional CEA approach that integrates the total lifetime value of innovative drugs into CEA, by taking into account off-patent pricing and future patients. The proposed approach derives a price that allows manufacturers to capture an agreed share of this value, thereby incentivizing

The value of innovation under value-based pricing.

Science.gov (United States)

Moreno, Santiago G; Ray, Joshua A

2016-01-01

The role of cost-effectiveness analysis (CEA) in incentivizing innovation is controversial. Critics of CEA argue that its use for pricing purposes disregards the 'value of innovation' reflected in new drug development, whereas supporters of CEA highlight that the value of innovation is already accounted for. Our objective in this article is to outline the limitations of the conventional CEA approach, while proposing an alternative method of evaluation that captures the value of innovation more accurately. The adoption of a new drug benefits present and future patients (with cost implications) for as long as the drug is part of clinical practice. Incidence patients and off-patent prices are identified as two key missing features preventing the conventional CEA approach from capturing 1) benefit to future patients and 2) future savings from off-patent prices. The proposed CEA approach incorporates these two features to derive the total lifetime value of an innovative drug (i.e., the value of innovation). The conventional CEA approach tends to underestimate the value of innovative drugs by disregarding the benefit to future patients and savings from off-patent prices. As a result, innovative drugs are underpriced, only allowing manufacturers to capture approximately 15% of the total value of innovation during the patent protection period. In addition to including the incidence population and off-patent price, the alternative approach proposes pricing new drugs by first negotiating the share of value of innovation to be appropriated by the manufacturer (>15%?) and payer (price that satisfies this condition. We argue for a modification to the conventional CEA approach that integrates the total lifetime value of innovative drugs into CEA, by taking into account off-patent pricing and future patients. The proposed approach derives a price that allows manufacturers to capture an agreed share of this value, thereby incentivizing innovation, while supporting health

The study of biological value of peptone derived from secondary raw fish

Directory of Open Access Journals (Sweden)

Kuranova L. K.

2016-09-01

Full Text Available The possibility of using secondary fish raw materials in particular musculoskeletal waste from filleting the cod species of fish as raw material base for production of food peptones has been studied. The content of water, fat, protein substances, chloride sodium in the raw material and the product have been determined by standard methods. Amino-acid composition has been determined by high effective liquid chromatography. The biological value of peptone and the balance of essential amino acids have been calculated. It has been established that waste from the cod filleting (the humerus with excess flesh contains 18.95 % protein and a slight (0.15 % amount of fat. The models of peptone – fermentative fish hydrolyzate obtained from cod withdrawals – have been researched. Proteolytic activity used in the hydrolysis of enzyme (protosubtilin G3X has been defined as 560.77 mmol TYR/g. Peptone is an amorphous, fine powder of a light beige color. The product is hygroscopic, readily soluble in water. The chemical and biochemical quality characteristics of enzymatic peptone have been defined. Mass fraction of protein in the derived product is 92.27 %, mass fraction of water – 4.7 %, sodium chloride and 2.6 %, fat – 0.3 %. The total number of amino acids in the product is 94.7 %. Peptone in protein contains all the essential amino acids, the total content of which is 40.8 %. The biological value of the product has been estimated by calculation methods. It has been established that tryptophan is the only limiting amino acid in the protein of peptone, amino-acid score is 66.8 %, the rationality coefficient of the product is 0.42, which characterizes it as a fairly balanced protein product. Peptone obtained from secondary fish raw materials by protein content and its properties corresponds to the category of protein isolates and can be recommended for use in food as complete protein food additives and as protein content in sports nutrition products.

Fractionalization of the complex-valued Brownian motion of order n using Riemann-Liouville derivative. Applications to mathematical finance and stochastic mechanics

International Nuclear Information System (INIS)

Jumarie, Guy

2006-01-01

The (complex-valued) Brownian motion of order n is defined as the limit of a random walk on the complex roots of the unity. Real-valued fractional noises are obtained as fractional derivatives of the Gaussian white noise (or order two). Here one combines these two approaches and one considers the new class of fractional noises obtained as fractional derivative of the complex-valued Brownian motion of order n. The key of the approach is the relation between differential and fractional differential provided by the fractional Taylor's series of analytic function f(z+h)=E α (h α D z α ).f(z), where E α is the Mittag-Leffler function on the one hand, and the generalized Maruyama's notation, on the other hand. Some questions are revisited such as the definition of fractional Brownian motion as integral w.r.t. (dt) α , and the exponential growth equation driven by fractional Brownian motion, to which a new solution is proposed. As a first illustrative example of application, in mathematical finance, one proposes a new approach to the optimal management of a stochastic portfolio of fractional order via the Lagrange variational technique applied to the state moment dynamical equations. In the second example, one deals with non-random Lagrangian mechanics of fractional order. The last example proposes a new approach to fractional stochastic mechanics, and the solution so obtained gives rise to the question as to whether physical systems would not have their own internal random times

Credit derivatives and risk management

OpenAIRE

Michael S. Gibson

2007-01-01

The striking growth of credit derivatives suggests that market participants find them to be useful tools for risk management. I illustrate the value of credit derivatives with three examples. A commercial bank can use credit derivatives to manage the risk of its loan portfolio. An investment bank can use credit derivatives to manage the risks it incurs when underwriting securities. An investor, such as an insurance company, asset manager, or hedge fund, can use credit derivatives to align its...

Value Assessment of Artificial Wetland Derived from Mining Subsided Lake: A Case Study of Jiuli Lake Wetland in Xuzhou

Directory of Open Access Journals (Sweden)

Laijian Wang

2017-10-01

Full Text Available Mining subsided lakes are major obstacles for ecological restoration and resource reuse in mining regions. Transforming mining subsided lakes into artificial wetlands is an ecological restoration approach that has been attempted in China in recent years, but a value assessment of the approach still needs systematic research. This paper considers Jiuli Lake wetland, an artificial wetland derived from restoration of a mining subsided lake in plain area, as a case study. A value assessment model for the artificial wetland was established based on cost–benefit analysis by means of field monitoring, social surveys, GIS geostatistics, raster calculation methods, etc. Empirical analysis and calculations were performed on the case study region. The following conclusions were drawn: (1 after ecological restoration, ecosystem services of Jiuli Lake wetland which has become a national level wetland park yield positive values; (2 the improved environment of the Jiuli Lake wetland has a spillover effect on the price of surrounding land, resulting in land price appreciation; (3 using GIS geostatistics and raster calculation methods, the impact range, strength, and value of the spillover effect can be explicitly measured; (4 through the establishment of a value assessment model of the artificial wetland, incomes of the ecological restoration was found to be sufficient to cover the implementation costs, which provides a research foundation for economic feasibility of ecological restoration of mining subsided lakes.

THE DETERMINATION OF BUPROPION HYDROCHLORIDE IN PHARMACEUTICAL DOSAGE FORMS BY ORIGINAL UV- AND SECOND DERIVATIVE UV SPECTROPHOTOMETRY, POTENTIOMETRIC AND CONDUCTOMETRIC METHODS

Directory of Open Access Journals (Sweden)

Duygu YENİCELİ

2010-08-01

Full Text Available Spectrophotometric, potentiometric and conductometric methods are developed for the determination of bupropion hydrochloride (BLIP in pharmaceutical tablets. For the first method, original UV-spectrophotometry, 252 nm was determined as the optimum wavelength and used for the determinations. For the other method, second derivative UV spectrophotometry, the absorbances were measured at 217.4 and 221.8 nm and the distance between these extremum values was determined according to peak to peak method. Two spectrophotometric methods were validated over the concentration range of 5.72 - 20.03 ug/mL. The limit of detection and limit of quantitation values of original UV-spectrophotometry were 0.75 ug/mL and 2.28 jug/mL. Also, these parameters were determined as 0.23 ug/mL and 0.68 ug/mL respectively, for the second derivative UV spectrophotometry. Developed methods were fully validated and the applicability of the methods for the determination of BUP in pharmaceuticals were demonstrated. Also, simple potentiometric and conductometric methods were developed and the applicability of these methods were demonstrated. The results of four analytical methods were compared with ANOVA test and no significant difference was found statistically. As a result, the developed methods could be proposed to the rutin content analysis to be simple, cheap, accurate, and precise

Polythiophenes and fullerene derivatives based donor-acceptor system: topography by atomic force microscopy

International Nuclear Information System (INIS)

Marcakova, M. L.; Repovsky, D.; Cik, G.; Velic, D.

2017-01-01

The goal of this work is to examine the surface of a polythiophene/fullerene film in order to understand the structure. In this work polythiophene is used as electron donor and fullerene-derivative is used as electron acceptor. Atomic force microscopy (AFM), is an ideal method to study surfaces and nanostructures. Surfaces of fullerene C60 , fullerene-derivates PCBM, polythiophene P12 and a mixture of P12 and PCBM are characterized. In all samples, the average roughness, the arithmetical value of divergence from the high of the surface, is determined concluding that P12 and PCBM mix together well and form a film with specific topography. (authors)

Differential forms orthogonal to holomorphic functions or forms, and their properties

CERN Document Server

Aizenberg, L A

1983-01-01

The authors consider the problem of characterizing the exterior differential forms which are orthogonal to holomorphic functions (or forms) in a domain D\\subset {\\mathbf C}^n with respect to integration over the boundary, and some related questions. They give a detailed account of the derivation of the Bochner-Martinelli-Koppelman integral representation of exterior differential forms, which was obtained in 1967 and has already found many important applications. They study the properties of \\overline \\partial-closed forms of type (p, n - 1), 0\\leq p\\leq n - 1, which turn out to be the duals (with respect to the orthogonality mentioned above) to holomorphic functions (or forms) in several complex variables, and resemble holomorphic functions of one complex variable in their properties.

18 CFR 367.1760 - Account 176, Derivative instrument assets-Hedges.

Science.gov (United States)

2010-04-01

... change in the fair value of derivative instrument assets designated by the service company as cash flow... flow hedge it will record the change in the fair value of the derivative instrument in this account... must record the change in the fair value of the derivative instrument in this account with a concurrent...

Best linear unbiased prediction of genomic breeding values using a trait-specific marker-derived relationship matrix.

Directory of Open Access Journals (Sweden)

Zhe Zhang

2010-09-01

Full Text Available With the availability of high density whole-genome single nucleotide polymorphism chips, genomic selection has become a promising method to estimate genetic merit with potentially high accuracy for animal, plant and aquaculture species of economic importance. With markers covering the entire genome, genetic merit of genotyped individuals can be predicted directly within the framework of mixed model equations, by using a matrix of relationships among individuals that is derived from the markers. Here we extend that approach by deriving a marker-based relationship matrix specifically for the trait of interest.In the framework of mixed model equations, a new best linear unbiased prediction (BLUP method including a trait-specific relationship matrix (TA was presented and termed TABLUP. The TA matrix was constructed on the basis of marker genotypes and their weights in relation to the trait of interest. A simulation study with 1,000 individuals as the training population and five successive generations as candidate population was carried out to validate the proposed method. The proposed TABLUP method outperformed the ridge regression BLUP (RRBLUP and BLUP with realized relationship matrix (GBLUP. It performed slightly worse than BayesB with an accuracy of 0.79 in the standard scenario.The proposed TABLUP method is an improvement of the RRBLUP and GBLUP method. It might be equivalent to the BayesB method but it has additional benefits like the calculation of accuracies for individual breeding values. The results also showed that the TA-matrix performs better in predicting ability than the classical numerator relationship matrix and the realized relationship matrix which are derived solely from pedigree or markers without regard to the trait. This is because the TA-matrix not only accounts for the Mendelian sampling term, but also puts the greater emphasis on those markers that explain more of the genetic variance in the trait.

Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

Science.gov (United States)

Sasaki, Tomoyuki; Shoho, Takashi; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi

2014-04-01

A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

Temporal characteristics of polarization holographic gratings formed in a photosensitive polymeric film containing N-benzylideneaniline derivative side groups

Energy Technology Data Exchange (ETDEWEB)

Sasaki, Tomoyuki, E-mail: sasaki-tomoy@vos.nagaokaut.ac.jp; Shoho, Takashi; Noda, Kohei; Ono, Hiroshi [Department of Electrical Engineering, Nagaoka University of Technology, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Kawatsuki, Nobuhiro [Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo 671-2280 (Japan)

2014-04-21

A polarization holographic grating was recorded in a transparent thin film formed from polymethacrylate with N-benzylideneaniline (NBA) derivative side groups. We measured the real time diffraction properties. The data were analyzed based on a theoretical model that accounted for the distribution of optical anisotropy caused by molecular reorientation as well as for surface relief (SR) deformation caused by molecular motion. Optical anisotropy rapidly increased and then slowly decreased, with increasing recording time. This phenomenon was described based on photoisomerization and photocleavage reactions of the NBA side groups. SR deformation was also induced in the film by polarization holographic recording, without any subsequent processes. The photoinduced optical anisotropy and SR deformation were retained after the recording was turned off.

Semiclassical initial value treatment of wave functions

International Nuclear Information System (INIS)

Kay, Kenneth G.

2010-01-01

A semiclassical initial value approximation for time-independent wave functions, previously derived for integrable systems, is rederived in a form which allows it to be applied to more general systems. The wave function is expressed as an integral over a Lagrangian manifold that is constructed by propagating trajectories from an initial manifold formed on a Poincare surface. Even in the case of bound, integrable systems, it is unnecessary to identify action-angle variables or construct quantizing tori. The approximation is numerically tested for separable and highly chaotic two-dimensional quartic oscillator systems. For the separable (but highly anharmonic) system, the accuracy of the approximation is found to be excellent: overlaps of the semiclassical wave functions with the corresponding quantum wave functions exceed 0.999. For the chaotic system, semiclassical-quantum overlaps are found to range from 0.989 to 0.994, indicating accuracy that is still very good, despite the short classical trajectories used in the calculations.

Intact and cleaved uPAR forms: diagnostic and prognostic value in cancer

DEFF Research Database (Denmark)

Rasch, M.G.; Lund, I.K.; Hoyer-Hansen, G.

2008-01-01

identified in tissue and body fluids. It is well-established, that the total amount of all uPAR forms is a strong prognostic marker in different types of cancer. Using immunoassays, measuring the individual uPAR forms, has revealed that the cleaved uPAR forms are even stronger prognostic markers and have...... diagnostic utility. This review will focus on the mechanism of uPAR cleavage and the functional consequences, as well as the clinical applicability of cleaved uPAR forms Udgivelsesdato: 2008...

Boronate Derivatives of Functionally Diverse Catechols: Stability Studies

Directory of Open Access Journals (Sweden)

Kamal Aziz Ketuly

2010-03-01

Full Text Available Benzeneboronate of catecholic carboxyl methyl esters, N-acetyldopamine, coumarin and catechol estrogens were prepared as crystalline derivatives in high yield. Related catechol compounds with extra polar functional group(s (OH, NH2 do not form or only partially form unstable cyclic boronate derivatives.

Laguerre-type derivatives: Dobinski relations and combinatorial identities

International Nuclear Information System (INIS)

Penson, K. A.; Blasiak, P.; Horzela, A.; Duchamp, G. H. E.; Solomon, A. I.

2009-01-01

We consider properties of the operators D(r,M)=a r (a † a) M (which we call generalized Laguerre-type derivatives), with r=1,2,..., M=0,1,..., where a and a † are boson annihilation and creation operators, respectively, satisfying [a,a † ]=1. We obtain explicit formulas for the normally ordered form of arbitrary Taylor-expandable functions of D(r,M) with the help of an operator relation that generalizes the Dobinski formula. Coherent state expectation values of certain operator functions of D(r,M) turn out to be generating functions of combinatorial numbers. In many cases the corresponding combinatorial structures can be explicitly identified.

Multiple Forms and Settings of Exposure to Violence and Values: Unique and Interactive Relationships With Antisocial Behavior in Adolescence.

Science.gov (United States)

Bacchini, Dario; Affuso, Gaetana; Aquilar, Serena

2015-10-01

The general purpose of this study was to investigate the relationships between multiple forms and settings of exposure to violence (ETV) as well as personal values and antisocial behavior (ASB) in adolescence. The association of ETV as witness or victim in different contexts (family, school, or neighborhood) and the association of the selected values of power, universalism, and conformity with ASB were analyzed. In addition, the role of ETV in moderating the relationship between values and ASB was tested. A total of 369 adolescents participated in the study. Hierarchical multiple regression analysis was performed. Results revealed that ASB was independently affected by exposure to family violence as a victim, exposure to school violence as a witness, exposure to neighborhood violence as a witness, and by all three selected values. The associations of ASB with universalism and conformity were negative. Conversely, the association of ASB with power was positive. One interaction had statistically significant effects. Results revealed that exposure to school violence as a witness moderates the relationship between universalism and ASB. The results highlight a high percentage of explained variance by ETV and values on ASB and suggest the importance of adopting a socio-ecological framework in interpreting adolescent behavior. © The Author(s) 2014.

Generic clearance values

International Nuclear Information System (INIS)

Bossio, M.C.; Muniz, C.C.

2009-01-01

This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document 'Safety Reports Series Nr 44' of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (author)

Generic Clearance Values

International Nuclear Information System (INIS)

Bossio, M.C.; Muniz, C.C.

2010-01-01

This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on the one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document Safety Reports Series 44 of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (authors) [es

Structure activity relationships of quinoxalin-2-one derivatives as platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors, derived from molecular modeling.

Science.gov (United States)

Mori, Yoshikazu; Hirokawa, Takatsugu; Aoki, Katsuyuki; Satomi, Hisanori; Takeda, Shuichi; Aburada, Masaki; Miyamoto, Ken-ichi

2008-05-01

We previously reported a quinoxalin-2-one compound (Compound 1) that had inhibitory activity equivalent to existing platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors. Lead optimization of Compound 1 to increase its activity and selectivity, using structural information regarding PDGFbeta R-ligand interactions, is urgently needed. Here we present models of the PDGFbeta R kinase domain complexed with quinoxalin-2-one derivatives. The models were constructed using comparative modeling, molecular dynamics (MD) and ligand docking. In particular, conformations derived from MD, and ligand binding site information presented by alpha-spheres in the pre-docking processing, allowed us to identify optimal protein structures for docking of target ligands. By carrying out molecular modeling and MD of PDGFbeta R in its inactive state, we obtained two structural models having good Compound 1 binding potentials. In order to distinguish the optimal candidate, we evaluated the structural activity relationships (SAR) between the ligand-binding free energies and inhibitory activity values (IC50 values) for available quinoxalin-2-one derivatives. Consequently, a final model with a high SAR was identified. This model included a molecular interaction between the hydrophobic pocket behind the ATP binding site and the substitution region of the quinoxalin-2-one derivatives. These findings should prove useful in lead optimization of quinoxalin-2-one derivatives as PDGFb R inhibitors.

Derivation of Hamiltonians for accelerators

Energy Technology Data Exchange (ETDEWEB)

Symon, K.R.

1997-09-12

In this report various forms of the Hamiltonian for particle motion in an accelerator will be derived. Except where noted, the treatment will apply generally to linear and circular accelerators, storage rings, and beamlines. The generic term accelerator will be used to refer to any of these devices. The author will use the usual accelerator coordinate system, which will be introduced first, along with a list of handy formulas. He then starts from the general Hamiltonian for a particle in an electromagnetic field, using the accelerator coordinate system, with time t as independent variable. He switches to a form more convenient for most purposes using the distance s along the reference orbit as independent variable. In section 2, formulas will be derived for the vector potentials that describe the various lattice components. In sections 3, 4, and 5, special forms of the Hamiltonian will be derived for transverse horizontal and vertical motion, for longitudinal motion, and for synchrobetatron coupling of horizontal and longitudinal motions. Hamiltonians will be expanded to fourth order in the variables.

Controllability of switched singular mix-valued logical control networks with constraints

Science.gov (United States)

Deng, Lei; Gong, Mengmeng; Zhu, Peiyong

2018-03-01

The present paper investigates the controllability problem of switched singular mix-valued logical control networks (SSMLCNs) with constraints on states and controls. First, using the semi-tenser product (STP) of matrices, the SSMLCN is expressed in an algebraic form, based on which a necessary and sufficient condition is given for the uniqueness of solution of SSMLCNs. Second, a necessary and sufficient criteria is derived for the controllability of constrained SSMLCNs, by converting a constrained SSMLCN into a parallel constrained switched mix-valued logical control network. Third, an algorithm is presented to design a proper switching sequence and a control scheme which force a state to a reachable state. Finally, a numerical example is given to demonstrate the efficiency of the results obtained in this paper.

Customer Value Controlling ¨C Combining Different Value Perspectives

OpenAIRE

Andreas Kramer; Thomas Burgartz

2015-01-01

The article begins by presenting a model for the structuring of customer data which can be used to demonstrate the value of data in different forms of aggregation. Since Customer Value plays a crucial role in this model the term is examined more closely. As part of a value-based customer relationship management critical parameters are customer benefits and customer profitability. Both perspectives are included in the term Customer Value. A segmentation approach is shown which integrates the k...

Identities for the electron forms 2 and their 3D representation

International Nuclear Information System (INIS)

Minogin, Vladimir G.

2012-01-01

New type of identities for products of the electron forms 2 (Fs2) and the bilinear forms (BFs) are derived. The identities are found for both temporal Fs2 describing the electron energy and quasi energy densities and spatial Fs2 describing the linear momentum and quasi linear momentum densities. The identities allow one to transform the quasi energy densities into the energy densities as well as the quasi linear momentum densities into the linear momentum densities. It is shown that by choosing any one of the 16 electron temporal or spatial Fs2 one can represent the remaining 15 temporal or spatial Fs2 as combinations of a chosen form 2 (F2) and the derivatives of a number of BFs. Any one of such 16 sets of identities can be considered as a specific form of an irreducible representation for the temporal or spatial Fs2. Similar to the bilinear identities for BFs the derived identities can be used for reduction different physical quantities describing the electron to the forms defined by the basic physical observables. As an example we consider transformation of the electron energy density to a new fundamental form that presents the energy density through the linear momentum density. - Highlights: ► New type of identities connecting electron forms 2 and bilinear forms is derived.► Identities are found for temporal and spatial forms 2. ► Irreducible representation of the identities is derived. ► New forms of the electron energy density are presented.

PROCEDURES FOR THE DERIVATION OF EQUILIBRIUM ...

Science.gov (United States)

This equilibrium partitioning sediment benchmark (ESB) document describes procedures to derive concentrations for 32 nonionic organic chemicals in sediment which are protective of the presence of freshwater and marine benthic organisms. The equilibrium partitioning (EqP) approach was chosen because it accounts for the varying biological availability of chemicals in different sediments and allows for the incorporation of the appropriate biological effects concentration. This provides for the derivation of benchmarks that are causally linked to the specific chemical, applicable across sediments, and appropriately protective of benthic organisms. EqP can be used to calculate ESBs for any toxicity endpoint for which there are water-only toxicity data; it is not limited to any single effect endpoint. For the purposes of this document, ESBs for 32 nonionic organic chemicals, including several low molecular weight aliphatic and aromatic compounds, pesticides, and phthalates, were derived using Final Chronic Values (FCV) from Water Quality Criteria (WQC) or Secondary Chronic Values (SCV) derived from existing toxicological data using the Great Lakes Water Quality Initiative (GLI) or narcosis theory approaches. These values are intended to be the concentration of each chemical in water that is protective of the presence of aquatic life. For nonionic organic chemicals demonstrating a narcotic mode of action, ESBs derived using the GLI approach specifically for fres

Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow–Derived Cells for Large Osteochondral Defects in Rabbit Knees

Science.gov (United States)

Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

2013-01-01

Objective: The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells. Methods: Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow–derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O’Driscoll score). Results: The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O’Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. Conclusions: This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated. PMID:26069678

Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow-Derived Cells for Large Osteochondral Defects in Rabbit Knees.

Science.gov (United States)

Yoshioka, Tomokazu; Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

2013-10-01

The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells. Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow-derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O'Driscoll score). The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O'Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow-derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated.

Phosphorylated derivatives of anabasine: synthesis, constitution and complex forming properties

International Nuclear Information System (INIS)

Babaev, B.N.

2004-01-01

Full text: With the purpose of detection of new effective extra gents of metals from number of sulphur containing derivatives of acids of phosphorus with different functional groups, analysis of effect of the different factors on selectivity of allocation of metals, installation of optimum conditions of an extraction, the detections of effective extra gents of noble metals from industrial sewage waters, are synthesized phosphorylated derivatives of the anabasine - O-alkyl-O-(anaba-sinoisopropyl)- and O-alkyl-O-(anabasinobutyn-2-yl)phenyl phosphonates and O-(anabasinoisopropyl)- and O-(anabasinobutyn-2-yl)diphenyl phosphonates In an IR-spectrum about O-pentyl-O-[anabasinoisopropyl]phenylphosphonate There are absorption band of the following functional groups (ν, cm -1 ): (P-O-C 5 H 11 ) 990-1000, (P = 0) 1250, (P-C 6 H 5 )1450, (C-N in cycle) 1550. In a spectrum PMR O-(anabasinobutyn-2-yl)phenylphosphonate in the field of a weak field apart from signals of two phenylic radicals the signals of a b-displaced pyridine, reference for a molecule anabasine are observed: Hαa-8,46 p.m., H α '-8,41 p.m., H γ -7,60 p.m. And H β -7,15 p.m. A double triplet at 4,70 p.m. And triplet at 3,05 p.m. Belong to signals OCH 2 and N-CH 2 of groups, accordingly, separated by acetylene bond. The signals of piperidine cycle of anabasine have the following chemical shifts: H 2a -3,27 p.m., H 6e -2,78 p.m., H 6a -2,45 p.m., and remaining protons (6H, m, CH 2 ) are in resonance in the field of 1,1-1,9 p.m. The analysis of mass-spectrometer decay of the synthesized connections has shown, that the mass-spectrometer fragmentation M * about - O-alkyl-O- (anabasinoisopropyl) phenylphosphonates flows past in different directions and is characterized, as against about O-alkyl-O-(anabasinobutyn-2-yl)phenyl-phosphonates, large number of phosphor containing ions; the availability of the second phenylic radical in molecules anabasincontaining derivatives of a diphenyl phosphinic acid essentially

Developing a closed-form cost expression for an (R, s, nQ) policy where the demand process is compound generalized Erlang

DEFF Research Database (Denmark)

Larsen, Christian; Kiesmüller, G.P

2007-01-01

We derive a closed-form cost expression for an (R,s,nQ) inventory control policy where all replenishment orders have a constant lead-time, unfilled demand is back-logged and inter-arrival times of order requests are generalized Erlang distributed. For given values of Q and R we show how to compute...

Effect of field-of-view size on gray values derived from cone-beam computed tomography compared with the Hounsfield unit values from multidetector computed tomography scans.

Science.gov (United States)

Shokri, Abbas; Ramezani, Leila; Bidgoli, Mohsen; Akbarzadeh, Mahdi; Ghazikhanlu-Sani, Karim; Fallahi-Sichani, Hamed

2018-03-01

This study aimed to evaluate the effect of field-of-view (FOV) size on the gray values derived from conebeam computed tomography (CBCT) compared with the Hounsfield unit values from multidetector computed tomography (MDCT) scans as the gold standard. A radiographic phantom was designed with 4 acrylic cylinders. One cylinder was filled with distilled water, and the other 3 were filled with 3 types of bone substitute: namely, Nanobone, Cenobone, and Cerabone. The phantom was scanned with 2 CBCT systems using 2 different FOV sizes, and 1 MDCT system was used as the gold standard. The mean gray values (MGVs) of each cylinder were calculated in each imaging protocol. In both CBCT systems, significant differences were noted in the MGVs of all materials between the 2 FOV sizes ( P <.05) except for Cerabone in the Cranex3D system. Significant differences were found in the MGVs of each material compared with the others in both FOV sizes for each CBCT system. No significant difference was seen between the Cranex3D CBCT system and the MDCT system in the MGVs of bone substitutes on images obtained with a small FOV. The size of the FOV significantly changed the MGVs of all bone substitutes, except for Cerabone in the Cranex3D system. Both CBCT systems had the ability to distinguish the 3 types of bone substitutes based on a comparison of their MGVs. The Cranex3D CBCT system used with a small FOV had a significant correlation with MDCT results.

Human Capital-Intensive Firms and Symbolic Value Creation

Directory of Open Access Journals (Sweden)

Cezanne Cécile

2014-06-01

Full Text Available The aim of this paper is to study the process of symbolic value creation of human capital-intensive firms. Human capital is a critical resource for firms’ activities. Nevertheless, this dimension is often obscured by industrial economists. In the light of critical resource theory, we analyze how taking into account the inalienable and inimitable nature of specific human capital entails a reconsideration of the role and boundaries of the firm. We show that the firm seeks to coordinate the specialization of its key partners within the frame of its economic boundaries to ensure the long-term optimization of its potential of value. Therefore, the value of the firm depends on all the resources that the firm coordinates. Then we focus on the way HCIF can create different values. We suggest that the firm builds its competitive advantage on different forms of values, in particular the symbolic value incorporated in human capital. Finally, on the basis of these considerations, we identify the wealth included in the critical resources of the firm and to bring to light the process of symbolic value creation associated with it. We suggest that the firm is the value creating entity and the customer both recognizes and derives the value created from whatever it is that the firm provides. We propose a definition of this value and a schema of its creation process based on management works attempts. We conclude by proposing paths of research that could fruitfully be explored to further develop this new subject.

IMAGE - REPUTATION - BRAND: STRATEGY OF FORMING OF VALUE OF THE POWER

Directory of Open Access Journals (Sweden)

Н Н Розанова

2017-12-01

Full Text Available Article is devoted to consideration of process of forming of valuable symbolical space of the Russian power in the context of forming of the new model of development of society determined as one of the priority directions of the Concept of long-term social and economic development of the Russian Federation for the period till 2020. This vector of development of the relations of the state and society is determined by the author as strategy of forming of the valuable relation to the power - the purposeful, system, jointly performed activities of the power and society for creation of valuable space of the Russian power through transformation and consecutive transition each other of the following symbolical categories of the power: “identity” - “image” - “reputation” - “brand”. Content of the specified categories is opened, interpretation of measurements of the valuable field of a brand of the power on the basis of model of a four-dimensional brand of T. Ged is offered. The special attention is paid to process of forming of reputation of the power as to a subject of independent author research, on the example of studying of reputation of the regional power of the Smolensk region.

Effect-based trigger values for in vitro bioassays: Reading across from existing water quality guideline values.

Science.gov (United States)

Escher, Beate I; Neale, Peta A; Leusch, Frederic D L

2015-09-15

Cell-based bioassays are becoming increasingly popular in water quality assessment. The new generations of reporter-gene assays are very sensitive and effects are often detected in very clean water types such as drinking water and recycled water. For monitoring applications it is therefore imperative to derive trigger values that differentiate between acceptable and unacceptable effect levels. In this proof-of-concept paper, we propose a statistical method to read directly across from chemical guideline values to trigger values without the need to perform in vitro to in vivo extrapolations. The derivation is based on matching effect concentrations with existing chemical guideline values and filtering out appropriate chemicals that are responsive in the given bioassays at concentrations in the range of the guideline values. To account for the mixture effects of many chemicals acting together in a complex water sample, we propose bioanalytical equivalents that integrate the effects of groups of chemicals with the same mode of action that act in a concentration-additive manner. Statistical distribution methods are proposed to derive a specific effect-based trigger bioanalytical equivalent concentration (EBT-BEQ) for each bioassay of environmental interest that targets receptor-mediated toxicity. Even bioassays that are indicative of the same mode of action have slightly different numeric trigger values due to differences in their inherent sensitivity. The algorithm was applied to 18 cell-based bioassays and 11 provisional effect-based trigger bioanalytical equivalents were derived as an illustrative example using the 349 chemical guideline values protective for human health of the Australian Guidelines for Water Recycling. We illustrate the applicability using the example of a diverse set of water samples including recycled water. Most recycled water samples were compliant with the proposed triggers while wastewater effluent would not have been compliant with a few

Development trends of the international derivatives market

OpenAIRE

Motorniuk, U.; Terebukh, M.; Kharchuk, V.

2016-01-01

The factors forming international derivatives market trends are researched in this article. The history of the formation of the global derivatives market was analyzed, in particular, events which have led to the growth of the derivatives market. Global derivatives market has revealed major changes in its trends and witnessed the gradual transformation of its structure, observed in recent years. Global derivatives market has revealed major changes in its trends and witnessed the gradual transf...

Complex-valued derivative propagation method with approximate Bohmian trajectories: Application to electronic nonadiabatic dynamics

Science.gov (United States)

Wang, Yu; Chou, Chia-Chun

2018-05-01

The coupled complex quantum Hamilton-Jacobi equations for electronic nonadiabatic transitions are approximately solved by propagating individual quantum trajectories in real space. Equations of motion are derived through use of the derivative propagation method for the complex actions and their spatial derivatives for wave packets moving on each of the coupled electronic potential surfaces. These equations for two surfaces are converted into the moving frame with the same grid point velocities. Excellent wave functions can be obtained by making use of the superposition principle even when nodes develop in wave packet scattering.

Synthesis, kinetic mechanism and docking studies of vanillin derivatives as inhibitors of mushroom tyrosinase.

Science.gov (United States)

Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf

2015-09-01

The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

THE VALUE-BASED MANAGEMENT APPROACH: FROM THE SHAREHOLDER VALUE TO THE STAKEHOLDER VALUE

OpenAIRE

VALENTIN MUNTEANU; DOINA DANAIATA; LUMINITA HURBEAN; ALICE BERGLER

2012-01-01

The ongoing discussion about the adequate management form and the purpose of organizations in the contemporary postmodern society have once again gained in importance and interest after the financial crises of 2008. Different management concepts have been developed throughout the time, which propose objectives for organizations and thus managerial goals, activities and decision making. Considering the value based management approach and the stakeholder theory, we propose a shift in the value ...

An Optimization of the Risk Management using Derivatives

Directory of Open Access Journals (Sweden)

Ovidiu ŞONTEA

2011-07-01

Full Text Available This article aims to provide a process that can be used in financial risk management by resolving problems of minimizing the risk measure (VaR using derivatives products, bonds and options. This optimization problem was formulated in the hedging situation of a portfolio formed by an active and a put option on this active, respectively a bond and an option on this bond. In the first optimization problem we will obtain the coverage ratio of the optimal price for the excertion of the option which is in fact the relative cost of the option’s value. In the second optimization problem we obtained optimal exercise price for a put option which is to support a bond.

Functional self-assembled lipidic systems derived from renewable resources.

Science.gov (United States)

Silverman, Julian R; Samateh, Malick; John, George

2016-01-01

Self-assembled lipidic amphiphile systems can create a variety of multi-functional soft materials with value-added properties. When employing natural reagents and following biocatalytic syntheses, self-assembling monomers may be inherently designed for degradation, making them potential alternatives to conventional and persistent polymers. By using non-covalent forces, self-assembled amphiphiles can form nanotubes, fibers, and other stimuli responsive architectures prime for further applied research and incorporation into commercial products. By viewing these lipid derivatives under a lens of green principles, there is the hope that in developing a structure-function relationship and functional smart materials that research may remain safe, economic, and efficient.

Asymptotic Performance Analysis of the k-th Best Link Selection over Wireless Fading Channels: An Extreme Value Theory Approach

KAUST Repository

Al-Badarneh, Yazan Hussein

2018-01-25

We consider a general selection-diversity (SD) scheme in which the k-th best link is selected from a number of links. We use extreme value theory (EVT) to derive simple closed-form asymptotic expressions for the average throughput, effective throughput and average bit error probability (BEP) for the k-th best link over various channel models that are widely used to characterize fading in wireless communication systems. As an application example, we consider the Weibull fading channel model and verify the accuracy of the derived asymptotic expressions through Monte Carlo simulations.

Asymptotic Performance Analysis of the k-th Best Link Selection over Wireless Fading Channels: An Extreme Value Theory Approach

KAUST Repository

Al-Badarneh, Yazan Hussein; Georghiades, Costas; Alouini, Mohamed-Slim

2018-01-01

We consider a general selection-diversity (SD) scheme in which the k-th best link is selected from a number of links. We use extreme value theory (EVT) to derive simple closed-form asymptotic expressions for the average throughput, effective throughput and average bit error probability (BEP) for the k-th best link over various channel models that are widely used to characterize fading in wireless communication systems. As an application example, we consider the Weibull fading channel model and verify the accuracy of the derived asymptotic expressions through Monte Carlo simulations.

Novel Trolox derivatives as antioxidant: A DFT investigation

Directory of Open Access Journals (Sweden)

Farmanzadeh Dvood

2016-01-01

Full Text Available In this paper the antioxidant activity of Trolox derivatives were investigated by density function theory and polarization continuum model as solvent model in order to propose the novel derivatives with higher antioxidant activity from a theoretical viewpoint. The effects of various ortho and meta substituents on the reaction enthalpies of antioxidant mechanisms of Trolox were investigated. Also the effect of reducing the number of atoms in the heterocyclic ring and effect of replacing the oxygen heteroatom of Trolox with other heteroatoms on the antioxidant activity of Trolox were evaluated. Results show that the NH2, OH and NHMe substituents in meta and ortho positions decrease the BDE and IP values and also increase the antioxidant activity of Trolox from the theoretical viewpoint. The derivatives e, c and d with NH, S and Se instead of O have higher antioxidant activity from the theoretical viewpoint. Obtained results show that reducing the number of atom in the heterocyclic ring (derivatives a and b decrease the BDE and IP values and also increase the antioxidant activity of Trolox from the theoretical viewpoint. The linear dependencies between BDE of OH bond and IP values of studied Trolox derivatives and corresponding EHOMO and R(O-H values can be useful to propose novel derivatives with higher antioxidant activity from the theoretical viewpoint.

Recovery actinide values

International Nuclear Information System (INIS)

Horwitz, E.P.; Delphin, W.H.; Mason, G.W.

1979-01-01

A process is described for partitioning and recovering actinide values from acidic waste solutions resulting from reprocessing of irradiated nuclear fuels by adding hydroxylammonium nitrate and hydrazine to the waste solution to adjust the valence of the neptunium and plutonium values in the solution to the +4 oxidation state, thus forming a feed solution and contacting the feed solution with an extractant of di-hexoxyethyl phosphoric acid in an organic diluent whereby the actinide values, most of the rare earth values and some fission product values are taken up by the extractant. Separation is achieved by contacting the loaded extractant with two aqueous strip solutions, a nitric acid solution to selectively strip the americium, curium and rare earth values and an oxalate solution of tetramethylammonium hydrogen oxalate and oxalic acid or trimethylammonium hydrogen oxalate to selectively strip the neptunium, plutonium and fission product values. Uranium values remain in the extractant and may be recovered with a phosphoric acid strip. The neptunium and plutonium values are recovered from the oxalate by adding sufficient nitric acid to destroy the complexing ability of the oxalate, forming a second feed, and contacting the second feed with a second extractant of tricaprylmethylammonium nitrate in an inert diluent whereby the neptunium and plutonium values are selectively extracted. The values are recovered from the extractant with formic acid. (author)

Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

Science.gov (United States)

Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

2014-05-06

Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

Molecular Form Differences Between Prostate-Specific Antigen (PSA) Standards Create Quantitative Discordances in PSA ELISA Measurements

Science.gov (United States)

McJimpsey, Erica L.

2016-02-01

The prostate-specific antigen (PSA) assays currently employed for the detection of prostate cancer (PCa) lack the specificity needed to differentiate PCa from benign prostatic hyperplasia and have high false positive rates. The PSA calibrants used to create calibration curves in these assays are typically purified from seminal plasma and contain many molecular forms (intact PSA and cleaved subforms). The purpose of this study was to determine if the composition of the PSA molecular forms found in these PSA standards contribute to the lack of PSA test reliability. To this end, seminal plasma purified PSA standards from different commercial sources were investigated by western blot (WB) and in multiple research grade PSA ELISAs. The WB results revealed that all of the PSA standards contained different mass concentrations of intact and cleaved molecular forms. Increased mass concentrations of intact PSA yielded higher immunoassay absorbance values, even between lots from the same manufacturer. Standardization of seminal plasma derived PSA calibrant molecular form mass concentrations and purification methods will assist in closing the gaps in PCa testing measurements that require the use of PSA values, such as the % free PSA and Prostate Health Index by increasing the accuracy of the calibration curves.

Overstating values: medical facts, diverse values, bioethics and values-based medicine.

Science.gov (United States)

Parker, Malcolm

2013-02-01

Fulford has argued that (1) the medical concepts illness, disease and dysfunction are inescapably evaluative terms, (2) illness is conceptually prior to disease, and (3) a model conforming to (2) has greater explanatory power and practical utility than the conventional value-free medical model. This 'reverse' model employs Hare's distinction between description and evaluation, and the sliding relationship between descriptive and evaluative meaning. Fulford's derivative 'Values Based Medicine' (VBM) readjusts the imbalance between the predominance of facts over values in medicine. VBM allegedly responds to the increased choices made available by, inter alia, the progress of medical science itself. VBM attributes appropriate status to evaluative meaning, where strong consensus about descriptive meaning is lacking. According to Fulford, quasi-legal bioethics, while it can be retained as a kind of deliberative framework, is outcome-based and pursues 'the right answer', while VBM approximates a democratic, process-oriented method for dealing with diverse values, in partnership with necessary contributions from evidence-based medicine (EBM). I support the non-cognitivist underpinnings of VBM, and its emphasis on the importance of values in medicine. But VBM overstates the complexity and diversity of values, misrepresents EBM and VBM as responses to scientific and evaluative complexity, and mistakenly depicts 'quasi-legal bioethics' as a space of settled descriptive meaning. Bioethical reasoning can expose strategies that attempt to reduce authentic values to scientific facts, illustrating that VBM provides no advantage over bioethics in delineating the connections between facts and values in medicine. © 2011 Blackwell Publishing Ltd.

Directory of energy data collection forms. Forms in use as of October 1995

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-01-01

This is an authoritative listing of selected public use forms currently used as basic energy information gathering tools by the Department of Energy (DOE). This directory provides an overview of DOE`s energy information collection programs for decisionmakers in Government and industry. Forms designed to collect energy information and used by the Energy Information Administration (EIA) as of October 1995 are included in this directory. For each form listed in this directory, an abstract is included that describes the form`s uses, its respondents, and the data collected. For the reader`s convenience in finding specific types of collections, several indices have been provided in this directory. A listing of the forms grouped by energy source and function begins on page 26. Beginning on page 38 are the publications derived from the collections, and on page 50, are the forms linked to general respondent categories.

In vitro induction of alkaline phosphatase levels predicts in vivo bone forming capacity of human bone marrow stromal cells

Directory of Open Access Journals (Sweden)

Henk-Jan Prins

2014-03-01

Full Text Available One of the applications of bone marrow stromal cells (BMSCs that are produced by ex vivo expansion is for use in in vivo bone tissue engineering. Cultured stromal cells are a mixture of cells at different stages of commitment and expansion capability, leading to a heterogeneous cell population that each time can differ in the potential to form in vivo bone. A parameter that predicts for in vivo bone forming capacity is thus far lacking. We employed single colony-derived BMSC cultures to identify such predictive parameters. Using limiting dilution, we have produced sixteen single CFU-F derived BMSC cultures from human bone marrow and found that only five of these formed bone in vivo. The single colony-derived BMSC strains were tested for proliferation, osteogenic-, adipogenic- and chondrogenic differentiation capacity and the expression of a variety of associated markers. The only robust predictors of in vivo bone forming capacity were the induction of alkaline phosphatase, (ALP mRNA levels and ALP activity during in vitro osteogenic differentiation. The predictive value of in vitro ALP induction was confirmed by analyzing “bulk-cultured” BMSCs from various bone marrow biopsies. Our findings show that in BMSCs, the additional increase in ALP levels over basal levels during in vitro osteogenic differentiation is predictive of in vivo performance.

Transfer coefficients for terrestrial foodchain: their derivation and limitations

International Nuclear Information System (INIS)

Ng, Y.C.; Colsher, C.S.; Thompson, S.E.

1979-01-01

Transfer coefficients to predict the passage of isotopes from the environment to terrestrial foods have been derived for various radionuclides of importance in the nuclear fuel cycle. These data update and extend previously recommended handbook values. We derive transfer coefficients to terrestrial foods and describe the systematics of the derived transfer coefficients. Suggestions are offered for changes in the values of transfer coefficients to terrestrial foods that now appear in federal regulatory guides. Deficiencies in our present knowledge concerning transfer coefficients and limitations in the use of these values to ensure compliance with radiation protection standards are discussed

The Value in Comparing Organizational Fields and Forms

DEFF Research Database (Denmark)

Pinheiro, Rómulo; Ramirez, Francisco O.; Geschwind, Lars

2016-01-01

Following the spirit of an earlier volume in the series focusing on ‘Comparative Approaches to Organizational Research’, the mandate of the current volume is to provide a comparative account of dynamics across two organizational fields – health care and higher education – and, subsequently, two...... specific types of organizational forms – hospitals and universities. In so doing, we take a broader perspective encompassing various conceptual and theoretical points of departure emanating from, mostly, the institutional literature in the social sciences (and its various perspectives), but also from...... public policy and administration literatures – of relevance to scholars and the communities of practice working within either field. In this introductory paper to the volume, we provide a brief overview of developments across the two organizational fields and illuminate on the most important scholarly...

Weak values as context-dependent values of observables and Born's rule

International Nuclear Information System (INIS)

Hosoya, Akio; Koga, Minoru

2011-01-01

We characterize a value of an observable by a 'sum rule' for generally non-commuting observables and a 'product rule' when restricted to a maximal commuting subalgebra of observables together with the requirement that the value is unity for the projection operator of the prepared state and the values are zero for the projection operators of the states which are orthogonal to the prepared state. The crucial requirement is that the expectation value and the variance of an observable should be independent of the way of measurement, i.e. the choice of the maximal commuting subalgebra of observables. We shall call the value a 'contextual value'. We show that the contextual value of an observable coincides with the weak value advocated by Aharonov and his colleagues by demanding the consistency of quantum mechanics with Kolmogorov's measure theory of probability. This also gives a derivation of Born's rule, which is one of the axioms of conventional quantum mechanics. (paper)

Frequency of and Prognostic Significance of Cardiac Involvement at Presentation in Hereditary Transthyretin-Derived Amyloidosis and the Value of N-Terminal Pro-B-Type Natriuretic Peptide

NARCIS (Netherlands)

Klaassen, Sebastiaan H C; Tromp, Jasper; Nienhuis, Hans L A; van der Meer, Peter; van den Berg, Maarten P; Blokzijl, Hans; van Veldhuisen, Dirk J; Hazenberg, Bouke P C

2018-01-01

The aim of this study is to assess the prevalence of cardiac involvement in hereditary transthyretin-derived (ATTRm) amyloidosis at the time of diagnosis and to determine the diagnostic and clinical value of N-terminal pro-B-type natriuretic peptide (NT-proBNP). The University Medical Center

Values beyond value? Is anything beyond the logic of capital?

Science.gov (United States)

Skeggs, Bev

2014-03-01

We are living in a time when it is frequently assumed that the logic of capital has subsumed every single aspect of our lives, intervening in the organization of our intimate relations as well as the control of our time, including investments in the future (e.g. via debt). The theories that document the incursion of this logic (often through the terms of neoliberalism and/or governmentality) assume that this logic is internalized, works and organizes everything including our subjectivity. These theories performatively reproduce the very conditions they describe, shrinking the domain of values and making it subject to capital's logic. All values are reduced to value. Yet values and value are always dialogic, dependent and co-constituting. In this paper I chart the history by which value eclipses values and how this shrinks our sociological imagination. By outlining the historical processes that institutionalized different organizations of the population through political economy and the social contract, producing ideas of proper personhood premised on propriety, I detail how forms of raced, gendered and classed personhood was formed. The gaps between the proper and improper generate significant contradictions that offer both opportunities to and limits on capitals' lines of flight. It is the lacks, the residues, and the excess that cannot be captured by capital's mechanisms of valuation that will be explored in order to think beyond the logic of capital and show how values will always haunt value. © London School of Economics and Political Science 2014.

Predicting the calorific value of refuse derived fuel from the characteristics of municipal solid waste

International Nuclear Information System (INIS)

Sivapalan Kathiravale; Muhd Noor Muhd Yunus; Mohamad Puad Abu; Mohamad Azman Che Mat Isa; Mohd Fairus Abdul Farid; Norasalwa Zakaria; Khaironie Mohd Takip; Rohyiza Ba'an

2006-01-01

The Imposing need to manage the municipal solid waste generated by society in a proper manner has urged municipalities to look into new management methods, which are not only environmentally friendly but also economically profitable. One such way is by converting this waste material into fuel. Currently, Kajang in the State of Selangor, Malaysia, generates about 700 tons of Municipal Solid Waste (MSW) a day. Due to rapid development, lack of land area for new landfill and the environmental impact of raw landfills, the local municipal council has collaborated with a local company in the management of this waste. The company has proposed to convert the MSW to Refuse Derived Fuel (RDF). In view of this, a pilot plant to convert MSW to RDF was erected by the company and begun operation in January 2002. This pilot plant has the capability of converting 15 tons of MSW to 5 tons of RDF. At the same time studies, have been carried out to assess the plant performance, the flue gas analysis, and also the MSW and RDF characteristic. This paper will highlight the findings of the MSW and RDF characterization work carried out over the past year. Sampling and analysis was carried in accordance with ASTM standards. Results of the waste analysis showed that the calorific value of the resulting RDF could be predicted from the physical characteristics as well as the moisture content. Regression analysis on the available data has been used to create equations relating the proximate composition and moisture content of the incoming municipal solid waste to the calorific value of the RDF

A class of constitutive relations with internal variable derivatives: derivation from homogenization and initial value problem

International Nuclear Information System (INIS)

Andrieux, S.; Joussemet, M.; Lorentz, E.

1996-01-01

When they are subjected to excessive loads, some materials may exhibit a softening behaviour resulting from the deterioration of their mechanical properties. To idealize such behaviours, constitutive relations with softening are introduced, for which the size of the domain of reversibility in the stress-space decreases. These models feature a strain localization within the material, in agreement with experiments, but cannot predict the subsequent behaviour because they lead to shear bands the width of which is equal to zero, physically unacceptable and numerically troublesome. It has been proposed in the literature to overcome these difficulties by adding to the list of internal variable the spatial gradients of some of them. This procedure suffers from lack of firm methodological basis. Although, some quantitative justification have been advanced relying on some kind of microscopic analysis. Therefore, we propose to extend the classical (local) models by introducing the internal state variable first gradients. Given local model within the framework of standard generalized materials, consistent homogenization procedure is put forward to derive macroscopic free energy and dissipation potentials. The standard generalized character is preserved, with an extended set of state variables, containing not only the strain and the internal variables but also the internal variable derivatives. Nevertheless, when dealing with the whole structure, the independence between the new state variables is lost. We propose then to generalize the constitutive relations, leading to a new variational principle that ensures the Clausius-Duhem inequality at the structure scale. (authors)

A point-value enhanced finite volume method based on approximate delta functions

Science.gov (United States)

Xuan, Li-Jun; Majdalani, Joseph

2018-02-01

We revisit the concept of an approximate delta function (ADF), introduced by Huynh (2011) [1], in the form of a finite-order polynomial that holds identical integral properties to the Dirac delta function when used in conjunction with a finite-order polynomial integrand over a finite domain. We show that the use of generic ADF polynomials can be effective at recovering and generalizing several high-order methods, including Taylor-based and nodal-based Discontinuous Galerkin methods, as well as the Correction Procedure via Reconstruction. Based on the ADF concept, we then proceed to formulate a Point-value enhanced Finite Volume (PFV) method, which stores and updates the cell-averaged values inside each element as well as the unknown quantities and, if needed, their derivatives on nodal points. The sharing of nodal information with surrounding elements saves the number of degrees of freedom compared to other compact methods at the same order. To ensure conservation, cell-averaged values are updated using an identical approach to that adopted in the finite volume method. Here, the updating of nodal values and their derivatives is achieved through an ADF concept that leverages all of the elements within the domain of integration that share the same nodal point. The resulting scheme is shown to be very stable at successively increasing orders. Both accuracy and stability of the PFV method are verified using a Fourier analysis and through applications to the linear wave and nonlinear Burgers' equations in one-dimensional space.

Form factors of the finite quantum XY-chain

International Nuclear Information System (INIS)

Iorgov, Nikolai

2011-01-01

Explicit factorized formulas for the matrix elements (form factors) of the spin operators σ x and σ y between the eigenvectors of the Hamiltonian of the finite quantum periodic XY-chain in a transverse field were derived. The derivation is based on the relations between three models: the model of quantum XY-chain, Ising model on 2D lattice and N = 2 Baxter-Bazhanov-Stroganov τ (2) -model. Due to these relations we transfer the formulas for the form factors of the latter model recently obtained by the use of separation of variables method to the model of quantum XY-chain. Hopefully, the formulas for the form factors will help in analysis of multipoint dynamic correlation functions at a finite temperature. As an example, we re-derive the asymptotics of the two-point correlation function in the disordered phase without the use of the Toeplitz determinants and the Wiener-Hopf factorization method.

New Metabolites and Bioactive Chlorinated Benzophenone Derivatives Produced by a Marine-Derived Fungus Pestalotiopsis heterocornis

Directory of Open Access Journals (Sweden)

Hui Lei

2017-03-01

Full Text Available Four new compounds, including two isocoumarins, pestaloisocoumarins A and B (1, 2, one sesquiterpenoid degradation, isopolisin B (4, and one furan derivative, pestalotiol A (5, together with one known isocoumarin, gamahorin (3, and three chlorinated benzophenone derivatives, pestalachloride B (6, pestalachloride E (7 and a mixture of pestalalactone atropisomers (8a/8b, were isolated from a culture of the fungus Pestalotiopsis heterocornis associated with sponge Phakellia fusca. These new chemical structures were established using NMR and MS spectroscopic data, as well as single-crystal X-ray crystallographic analysis and CD Cotton effects. All of the isolated compounds were evaluated for their antimicrobial and cytotoxic activities. Isocoumarins 1–3, showed antibacterial activities against Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis with MIC values ranging from 25 to 100 μg/mL and weak antifungal activities. Chlorinated benzophenone derivatives 6–8 exhibited antibacterial activities against S. aureus and B. subtilis with MIC values ranging from 3.0 to 50 μg/mL and cytotoxicities against four human cancer cell lines with IC50 values of 6.8–87.8 μM.

Form of the manifestly covariant Lagrangian

Science.gov (United States)

Johns, Oliver Davis

1985-10-01

The preferred form for the manifestly covariant Lagrangian function of a single, charged particle in a given electromagnetic field is the subject of some disagreement in the textbooks. Some authors use a ``homogeneous'' Lagrangian and others use a ``modified'' form in which the covariant Hamiltonian function is made to be nonzero. We argue in favor of the ``homogeneous'' form. We show that the covariant Lagrangian theories can be understood only if one is careful to distinguish quantities evaluated on the varied (in the sense of the calculus of variations) world lines from quantities evaluated on the unvaried world lines. By making this distinction, we are able to derive the Hamilton-Jacobi and Klein-Gordon equations from the ``homogeneous'' Lagrangian, even though the covariant Hamiltonian function is identically zero on all world lines. The derivation of the Klein-Gordon equation in particular gives Lagrangian theoretical support to the derivations found in standard quantum texts, and is also shown to be consistent with the Feynman path-integral method. We conclude that the ``homogeneous'' Lagrangian is a completely adequate basis for covariant Lagrangian theory both in classical and quantum mechanics. The article also explores the analogy with the Fermat theorem of optics, and illustrates a simple invariant notation for the Lagrangian and other four-vector equations.

Superiority in value and the repugnant conclusion

DEFF Research Database (Denmark)

Jensen, Karsten Klint

2007-01-01

superiority does not amount to a radical value difference at all. I then spell out the consequences of these results for different interpretations of Griffin's suggestion regarding population ethics. None of them comes out very successful, but perhaps they nevertheless retain some interest.......James Griffin has considered a weak form of superiority in value a possible remedy to the Repugnant Conclusion. In this paper, I demonstrate that, in a context where value is additive, this weaker form collapses into a stronger form of superiority. And in a context where value is non-additive, weak...

Infection studies in mink with seal-derived morbillivirus

DEFF Research Database (Denmark)

Blixenkrone-Møller, M; Svansson, V; Have, P.

1989-01-01

Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper.......Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper....

Gauge-invariant expectation values of the energy of a molecule in an electromagnetic field

International Nuclear Information System (INIS)

Mandal, Anirban; Hunt, Katharine L. C.

2016-01-01

In this paper, we show that the full Hamiltonian for a molecule in an electromagnetic field can be separated into a molecular Hamiltonian and a field Hamiltonian, both with gauge-invariant expectation values. The expectation value of the molecular Hamiltonian gives physically meaningful results for the energy of a molecule in a time-dependent applied field. In contrast, the usual partitioning of the full Hamiltonian into molecular and field terms introduces an arbitrary gauge-dependent potential into the molecular Hamiltonian and leaves a gauge-dependent form of the Hamiltonian for the field. With the usual partitioning of the Hamiltonian, this same problem of gauge dependence arises even in the absence of an applied field, as we show explicitly by considering a gauge transformation from zero applied field and zero external potentials to zero applied field, but non-zero external vector and scalar potentials. We resolve this problem and also remove the gauge dependence from the Hamiltonian for a molecule in a non-zero applied field and from the field Hamiltonian, by repartitioning the full Hamiltonian. It is possible to remove the gauge dependence because the interaction of the molecular charges with the gauge potential cancels identically with a gauge-dependent term in the usual form of the field Hamiltonian. We treat the electromagnetic field classically and treat the molecule quantum mechanically, but nonrelativistically. Our derivation starts from the Lagrangian for a set of charged particles and an electromagnetic field, with the particle coordinates, the vector potential, the scalar potential, and their time derivatives treated as the variables in the Lagrangian. We construct the full Hamiltonian using a Lagrange multiplier method originally suggested by Dirac, partition this Hamiltonian into a molecular term H m and a field term H f , and show that both H m and H f have gauge-independent expectation values. Any gauge may be chosen for the calculations; but

The anti-tumor efficacy of nanoparticulate form of ICD-85 versus free form

Directory of Open Access Journals (Sweden)

Zare Mirakabadi, A.

2015-04-01

Full Text Available Biodegradable polymeric nanoparticles (NPs have been intensively studied as a possible way to enhance anti-tumor efficacy while reducing side effects. ICD-85, derived from the venom of two separate species of venomous animals, has been shown to exhibit anti-cancer activity. In this report polymer based sodium alginate nanoparticles of ICD-85 was used to enhance its therapeutic effects and reduce its side effects. The inhibitory effect was evaluated by MTT assay. The necrotic effect was assessed using LDH assay. The induction of apoptosis was analyzed by caspase-8 colorimetric assay kit. Cytotoxicity assay in HeLa cells demonstrated enhanced efficacy of ICD-85 loaded NPs compared to the free ICD-85. The IC50 values obtained in HeLa cells after 48 h, for free ICD-85 and ICD-85 loaded NPs were 26±2.9μg ml-1 and 18±2.5μg ml-1, respectively. While it was observed that free ICD-85 exhibits mild cytotoxicity towards normal MRC-5 cells (IC50>60μg ml-1, ICD-85 loaded NPs was found to have higher efficacy in anti-proliferative activity on HeLa cells in vitro without any significant cytotoxic effect on normal MRC-5 cells. The apoptosis-induction mechanism by both form of ICD-85 on HeLa cells was found to be through activation of caspase-8 with approximately 2 fold greater of ICD-85 loaded NPs as compared to free ICD-85. Our work reveals that although ICD-85 in free form is relatively selective to inhibit the growth of cancer cells via apoptosis as compared to normal cells, but nanoparticulate form increases its selectivity towards cancer cells.

Biomimicry of Palm Tree Leaves Form and Pattern on Building Form

Directory of Open Access Journals (Sweden)

Agus Salim N.A.

2014-01-01

Full Text Available This article is a study on biomimicry of palm tree towards a building form. It is to find a suitable form and pattern that can be applied to building shell to ease building maintenance operation beside to enhance the aesthetic value of a building architecture. The research has been carried out by observation and modeling on some various species of palm tree’s patterns and forms. The result expectation can be found at the end of this research by producing the best pattern of palm tree that can be adapted to building envelop as the whole form of a building.

Two-loop SL(2) form factors and maximal transcendentality

International Nuclear Information System (INIS)

Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

2016-01-01

Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

Two-loop SL(2) form factors and maximal transcendentality

Energy Technology Data Exchange (ETDEWEB)

Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)

2016-12-19

Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

Disjoint forms in graphical user interfaces

NARCIS (Netherlands)

Evers, S.; Achten, P.M.; Plasmeijer, M.J.; Loidl, H.W.

Forms are parts of a graphical user interface (GUI) that show a set of values and allow the user to update them. The declarative form construction library FunctionalForms is extended with disjoint form combinators to capture some common patterns in which the form structure expresses a choice. We

On computing Laplace's coefficients and their derivatives.

Science.gov (United States)

Gerasimov, I. A.; Vinnikov, E. L.

The algorithm of computing Laplace's coefficients and their derivatives is proposed with application of recurrent relations. The A.G.M.-method is used for the calculation of values L0(0), L0(1). The FORTRAN-program corresponding to the algorithm is given. The precision control was provided with numerical integrating by Simpsons method. The behavior of Laplace's coefficients and their third derivatives whith varying indices K, n for fixed values of the α-parameter is presented graphically.

Determination of pKa values of new phenacyl-piperidine derivatives by potentiometric titration method in aqueous medium at room temperature (25±0.5oC).

Science.gov (United States)

Zafar, Shaista; Akhtar, Shamim; Tariq, Talat; Mushtaq, Noushin; Akram, Arfa; Ahmed, Ahsaan; Arif, Muhammad; Naeem, Sabahat; Anwar, Sana

2014-07-01

Dissociation constant (pKa) of ten novel phenacyl derivatives of piperidine were determined by potentiometric titration method in aqueous medium at room temperature (25 ±0.5°C). The sample solutions were prepared in deionized water with ionic strength 0.01M and titrated with 0.1M NaOH solution. In addition, ΔG values were also calculated. Different prediction software programs were used to calculate pKa values too and compared to the experimentally observed pKa values. The experimental and theoretical values were found in close agreement. The results obtained in this research would help to predict the good absorption of the studied compounds and can be selected as lead molecules for the synthesis of CNS active agents because of their lipophilic nature especially compound VII.

Arbitrage-free valuation of energy derivatives

International Nuclear Information System (INIS)

Amin, K.; Ng, V.; Pirrong, C.

1999-01-01

This chapter focuses on techniques available for valuing energy-contingent claims and develops an arbitrage-free framework to value energy derivatives. The relationship between the spot, forward and futures prices is explained. Option valuation with deterministic convenience yields is discussed using an extension of the Black (1976) framework, and details of the risk-neutral valuation of European options, and valuation of American and European-style options are given. Option valuations with stochastic convenience yields, the evolution of the term structure of convenience yield, and a tree approach to valuing American and other options are discussed. Applications and limitations of the models for pricing energy derivative products are considered. The stochastic differential equation for the futures prices when the convenience yields are stochastic is presented in an appendix

RELATIONSHIP DERIVATIVES FINANCIAL MARKETS, MONEY AND STOCK MARKETS AS A SUBSYSTEM OF FINANCIAL MARKET

Directory of Open Access Journals (Sweden)

Yulia Yelnikova

2016-11-01

regulation of derivatives aimed at rational its development. Value/originality. The approach to the structural modelling of money and stock markets impact on market of derivatives allows not only to determine the effect of each factor, but also to form a complete system of state regulation of derivatives aimed at rational its development.

Selective displacement of the tributylstannyl group to form [125I]phenylboronic acid derivatives

International Nuclear Information System (INIS)

Kinsey, B.M.; Kassis, A.I.

1990-01-01

Three radioiodinated phenylboronic acid derivatives (1a, 2a, 3a) were prepared at the no-carrier-added level by selective displacement of the corresponding tributylstannyl group. The tributylstannyl compounds 1b, 2b, and 3b were synthesized from the bromo derivatives 1c, 2c and 3c. Radioiodination was accomplished using Na 125 I and either Chloramine-T or peracetic acid to give 1a, 2a and 3a in radiochemical yields of 46, 26, and 67% respectively after HPLC purification. Compounds 1a, 2a and 3a were concentrated in vitro preferentially in HT-29 human colon carcinoma cells compared to V79 Chinese hamster lung fibroblasts, with 3a having the highest uptake

PROCESS USING POTASSIUM LANTHANUM SULFATE FOR FORMING A CARRIER PRECIPITATE FOR PLUTONIUM VALUES

Science.gov (United States)

Angerman, A.A.

1958-10-21

A process is presented for recovering plutonium values in an oxidation state not greater than +4 from fluoride-soluble fission products. The process consists of adding to an aqueous acidic solution of such plutonium values a crystalline potassium lanthanum sulfate precipitate which carries the plutonium values from the solution.

Employing Sensitivity Derivatives for Robust Optimization under Uncertainty in CFD

Science.gov (United States)

Newman, Perry A.; Putko, Michele M.; Taylor, Arthur C., III

2004-01-01

A robust optimization is demonstrated on a two-dimensional inviscid airfoil problem in subsonic flow. Given uncertainties in statistically independent, random, normally distributed flow parameters (input variables), an approximate first-order statistical moment method is employed to represent the Computational Fluid Dynamics (CFD) code outputs as expected values with variances. These output quantities are used to form the objective function and constraints. The constraints are cast in probabilistic terms; that is, the probability that a constraint is satisfied is greater than or equal to some desired target probability. Gradient-based robust optimization of this stochastic problem is accomplished through use of both first and second-order sensitivity derivatives. For each robust optimization, the effect of increasing both input standard deviations and target probability of constraint satisfaction are demonstrated. This method provides a means for incorporating uncertainty when considering small deviations from input mean values.

CASSAVA BREEDING I: THE VALUE OF BREEDING VALUE

Directory of Open Access Journals (Sweden)

Hernán Ceballos

2016-08-01

Full Text Available Breeding cassava relies on several selection stages (single row trial-SRT; preliminary; advanced; and uniform yield trials - UYT. This study uses data from 14 years of evaluations. From more than 20,000 genotypes initially evaluated only 114 reached the last stage. The objective was to assess how the data at SRT could be used to predict the probabilities of genotypes reaching the UYT. Phenotypic data from each genotype at SRT was integrated into the selection index (SIN used by the cassava breeding program. Average SIN from all the progenies derived from each progenitor was then obtained. Average SIN is an approximation of the breeding value of each progenitor. Data clearly suggested that some genotypes were better progenitors than others (e.g. high number of their progenies reaching the UYT, suggesting important variation in breeding values of progenitors. However, regression of average SIN of each parental genotype on the number of their respective progenies reaching UYT resulted in a negligible coefficient of determination (r2 = 0.05. Breeding value (e.g. average SIN at SRT was not efficient predicting which genotypes were more likely to reach the UYT stage. Number of families and progenies derived from a given progenitor were more efficient predicting the probabilities of the progeny from a given parent reaching the UYT stage. Large within-family genetic variation tends to mask the true breeding value of each progenitor. The use of partially inbred progenitors (e.g. S1 or S2 genotypes would reduce the within-family genetic variation thus making the assessment of breeding value more accurate. Moreover, partial inbreeding of progenitors can improve the breeding value of the original (S0 parental material and sharply accelerate genetic gains. For instance, homozygous S1 genotypes for the dominant resistance to cassava mosaic disease could be generated and selected. All gametes from these selected S1 genotypes would carry the desirable allele

Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

Science.gov (United States)

The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

Prognostic value of circulating VEGFR2+ bone marrow-derived progenitor cells in patients with advanced cancer.

Science.gov (United States)

Massard, Christophe; Borget, Isabelle; Le Deley, Marie Cécile; Taylor, Melissa; Gomez-Roca, Carlos; Soria, Jean Charles; Farace, Françoise

2012-06-01

We hypothesised that host-related markers, possibly reflecting tumour aggressiveness, such as circulating endothelial cells (CEC) and circulating VEGFR2(+) bone marrow-derived (BMD) progenitor cells, could have prognostic value in patients with advanced cancer enrolled in early anticancer drug development trials. Baseline CECs (CD45(-)CD31(+)CD146(+)7AAD(-) cells) and circulating VEGFR2(+)-BMD progenitor cells (defined as CD45(dim)CD34(+)VEGFR2(+)7AAD(-) cells) were measured by flow-cytometry in 71 and 58 patients included in phase 1 trials testing novel anti-vascular or anti-angiogenic agents. Correlations between levels of CECs, circulating VEGFR2(+)-BMD progenitor cells, clinical and biological prognostic factors (i.e. the Royal Marsden Hospital (RMH) score), and overall survival (OS) were studied. The median value of CECs was 12 CEC/ml (range 0-154/ml). The median level of VEGFR2(+)-BMD progenitor cells was 1.3% (range 0-32.5%) of circulating BMD-CD34(+) progenitors. While OS was not correlated with CEC levels, it was significantly worse in patients with high VEGFR2(+)-BMD progenitor levels (>1%) (median OS 9.0 versus 17.0 months), and with a RMH prognostic score >0 (median OS 9.0 versus 24.2 months). The prognostic value of VEGFR2(+)-BMD progenitor levels remained significant (hazard ratio (HR) = 2.3, 95% confidence interval (CI), 1.1-4.6, p = 0.02) after multivariate analysis. A composite VEGFR2(+)-BMD progenitor level/RHM score ≥ 2 was significantly associated with an increased risk of death compared to scores of 0 or 1 (median OS 9.0 versus 18.4 months, HR = 2.6 (95%CI, 1.2-5.8, p = 0.02)). High circulating VEGFR2(+)-BMD progenitor levels are associated with poor prognostics and when combined to classical clinical and biological parameters could provide a new tool for patient selection in early anticancer drug trials. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Extensions of vector-valued functions with preservation of derivatives

Czech Academy of Sciences Publication Activity Database

Koc, M.; Kolář, Jan

2017-01-01

Roč. 449, č. 1 (2017), s. 343-367 ISSN 0022-247X R&D Projects: GA ČR(CZ) GA14-07880S Institutional support: RVO:67985840 Keywords : vector-valued differentiable functions * extensions * strict differentiability * partitions of unity Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.064, year: 2016 http://www.sciencedirect.com/science/article/pii/S0022247X16307703

Molecular Form Differences Between Prostate-Specific Antigen (PSA) Standards Create Quantitative Discordances in PSA ELISA Measurements

Science.gov (United States)

McJimpsey, Erica L.

2016-01-01

The prostate-specific antigen (PSA) assays currently employed for the detection of prostate cancer (PCa) lack the specificity needed to differentiate PCa from benign prostatic hyperplasia and have high false positive rates. The PSA calibrants used to create calibration curves in these assays are typically purified from seminal plasma and contain many molecular forms (intact PSA and cleaved subforms). The purpose of this study was to determine if the composition of the PSA molecular forms found in these PSA standards contribute to the lack of PSA test reliability. To this end, seminal plasma purified PSA standards from different commercial sources were investigated by western blot (WB) and in multiple research grade PSA ELISAs. The WB results revealed that all of the PSA standards contained different mass concentrations of intact and cleaved molecular forms. Increased mass concentrations of intact PSA yielded higher immunoassay absorbance values, even between lots from the same manufacturer. Standardization of seminal plasma derived PSA calibrant molecular form mass concentrations and purification methods will assist in closing the gaps in PCa testing measurements that require the use of PSA values, such as the % free PSA and Prostate Health Index by increasing the accuracy of the calibration curves. PMID:26911983

Analysis of the effects of wing interference on the tail contributions to the rolling derivatives

Science.gov (United States)

Michael, William H , Jr

1952-01-01

An analysis of the effects of wing interference on the tail contributions to the rolling stability derivatives of complete airplane configurations is made by calculating the angularity of the air stream at the vertical tail due to rolling and determining the resulting forces and moments. Some of the important factors which affect the resultant angularity on the vertical tail are wing aspect ratio and sweepback, vertical-tail span, and considerations associated with angle of attack and airplane geometry. Some calculated sidewash results for a limited range of plan forms and vertical-tail sizes are presented. Equations taking into account the sidewash results are given for determining the tail contributions to the rolling derivatives. Comparisons of estimated and experimental results indicate that a consideration of wing interference effects improves the estimated values of the tail contributions to the rolling derivatives and that fair agreement with available experimental data is obtained.

Mathematical constraint on functions with continuous second partial derivatives

International Nuclear Information System (INIS)

Franson, J D

2012-01-01

A new integral identity for functions with continuous second partial derivatives is derived. It is shown that the value of any function f(r, t) at position r and time t is completely determined by its previous values at all other locations r′ and retarded times t′ ⩽ t, provided that the function vanishes at infinity and has continuous second partial derivatives. Functions of this kind occur in many areas of physics and it seems somewhat surprising that they are constrained in this way. (paper)

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

Science.gov (United States)

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Closed-form Capacity Expressions for the α-μ Fading Channel with SC Diversity under Different Adaptive Transmission Strategies

Science.gov (United States)

Mohamed, Refaat; Ismail, Mahmoud H.; Newagy, Fatma; Mourad, Heba M.

2013-03-01

Stemming from the fact that the α-μ fading distribution is one of the very general fading models used in the literature to describe the small scale fading phenomenon, in this paper, closed-form expressions for the Shannon capacity of the α-μ fading channel operating under four main adaptive transmission strategies are derived assuming integer values for μ. These expressions are derived for the case of no diversity as well as for selection combining diversity with independent and identically distributed branches. The obtained expressions reduce to those previously derived in the literature for the Weibull as well as the Rayleigh fading cases, which are both special cases of the α-μ channel. Numerical results are presented for the capacity under the four adaptive transmission strategies and the effect of the fading parameter as well as the number of diversity branches is studied.

Valuing put options on single stock futures: Does the put-call parity relationship hold in the South African derivatives market?

Directory of Open Access Journals (Sweden)

A Biebuyck

2014-12-01

Full Text Available This study attempts to determine whether mispricing of options on single stock futures is present in the South African derivatives market. The valuation of options on single stock futures is considered through the put-call parity relationship. The theoretical fair values obtained, are compared to the actual market values over a period of three years, that is, from 2009 to 2011. Only put options are considered in this research.The results show that arbitrage put option opportunities do present themselves for the chosen shares. The actual put options were found to be underpriced in 5 out of 6 (83% of the cases considered over the evaluation periods chosen. The mispricing was significant for both the BHP Billiton options with 100% and in the case of Sasol options (66% of the time. Whether profitable arbitrage opportunities is possible, will depend on the magnitude of the mispricing and the transaction fees payable. Further, more extensive research may help identify tendencies which may be of use for the formulation of arbitrage strategies

Exact solutions to the time-fractional differential equations via local fractional derivatives

Science.gov (United States)

Guner, Ozkan; Bekir, Ahmet

2018-01-01

This article utilizes the local fractional derivative and the exp-function method to construct the exact solutions of nonlinear time-fractional differential equations (FDEs). For illustrating the validity of the method, it is applied to the time-fractional Camassa-Holm equation and the time-fractional-generalized fifth-order KdV equation. Moreover, the exact solutions are obtained for the equations which are formed by different parameter values related to the time-fractional-generalized fifth-order KdV equation. This method is an reliable and efficient mathematical tool for solving FDEs and it can be applied to other non-linear FDEs.

Two forms for 3-uniform states of eight-qubits

Science.gov (United States)

Zha, Xinwei; Da, Zhang; Ahmed, Irfan; Zhang, Yanpeng

2018-05-01

In this paper, we study the relations between average bipartite entanglement and the n-tangle of eight-qubits. We have derived two forms for 3-uniform states of eight-qubits. One form has the n-tangle equal to zero; the other form has the n-tangle equal to unity.

Soliton Resolution for the Derivative Nonlinear Schrödinger Equation

Science.gov (United States)

Jenkins, Robert; Liu, Jiaqi; Perry, Peter; Sulem, Catherine

2018-05-01

We study the derivative nonlinear Schrödinger equation for generic initial data in a weighted Sobolev space that can support bright solitons (but exclude spectral singularities). Drawing on previous well-posedness results, we give a full description of the long-time behavior of the solutions in the form of a finite sum of localized solitons and a dispersive component. At leading order and in space-time cones, the solution has the form of a multi-soliton whose parameters are slightly modified from their initial values by soliton-soliton and soliton-radiation interactions. Our analysis provides an explicit expression for the correction dispersive term. We use the nonlinear steepest descent method of Deift and Zhou (Commun Pure Appl Math 56:1029-1077, 2003) revisited by the {\\overline{partial}} -analysis of McLaughlin and Miller (IMRP Int Math Res Pap 48673:1-77, 2006) and Dieng and McLaughlin (Long-time asymptotics for the NLS equation via dbar methods. Preprint, arXiv:0805.2807, 2008), and complemented by the recent work of Borghese et al. (Ann Inst Henri Poincaré Anal Non Linéaire, https://doi.org/10.1016/j.anihpc.2017.08.006, 2017) on soliton resolution for the focusing nonlinear Schrödinger equation. Our results imply that N-soliton solutions of the derivative nonlinear Schrödinger equation are asymptotically stable.

Conservation form of the equations of fluid dynamics in general nonsteady coordinates

Science.gov (United States)

Zhang, H.; Camarero, R.; Kahawita, R.

1985-11-01

Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations.

Conservation form of the equations of fluid dynamics in general nonsteady coordinates

International Nuclear Information System (INIS)

Zhang, H.; Camarero, R.; Kahawita, R.

1985-01-01

Many of the differential equations arising in fluid dynamics may be stated in conservation-law form. A number of investigations have been conducted with the aim to derive the conservation-law form of the Navier-Stokes equations in general nonsteady coordinate systems. The present note has the objective to illustrate a mathematical methodology with which such forms of the equations may be derived in an easier and more general fashion. For numerical applications, the scalar form of the equations is eventually provided. Attention is given to the conservation form of equations in curvilinear coordinates and numerical considerations. 6 references

Numerical Method for Darcy Flow Derived Using Discrete Exterior Calculus

Science.gov (United States)

Hirani, A. N.; Nakshatrala, K. B.; Chaudhry, J. H.

2015-05-01

We derive a numerical method for Darcy flow, and also for Poisson's equation in mixed (first order) form, based on discrete exterior calculus (DEC). Exterior calculus is a generalization of vector calculus to smooth manifolds and DEC is one of its discretizations on simplicial complexes such as triangle and tetrahedral meshes. DEC is a coordinate invariant discretization, in that it does not depend on the embedding of the simplices or the whole mesh. We start by rewriting the governing equations of Darcy flow using the language of exterior calculus. This yields a formulation in terms of flux differential form and pressure. The numerical method is then derived by using the framework provided by DEC for discretizing differential forms and operators that act on forms. We also develop a discretization for a spatially dependent Hodge star that varies with the permeability of the medium. This also allows us to address discontinuous permeability. The matrix representation for our discrete non-homogeneous Hodge star is diagonal, with positive diagonal entries. The resulting linear system of equations for flux and pressure are saddle type, with a diagonal matrix as the top left block. The performance of the proposed numerical method is illustrated on many standard test problems. These include patch tests in two and three dimensions, comparison with analytically known solutions in two dimensions, layered medium with alternating permeability values, and a test with a change in permeability along the flow direction. We also show numerical evidence of convergence of the flux and the pressure. A convergence experiment is included for Darcy flow on a surface. A short introduction to the relevant parts of smooth and discrete exterior calculus is included in this article. We also include a discussion of the boundary condition in terms of exterior calculus.

Co-creating value through agents interaction within service network

International Nuclear Information System (INIS)

Okdinawati, L.; Simatupang, T.M.; Sunitiyoso, Y.

2017-01-01

The purpose of this paper is to gives further understanding on value co-creation mechanisms in B-to-B service network by reinforcing the processes, the relationships, and influences of other agents where Collaborative Transportation Management (CTM) forms might be best employed. Design/methodology/approach: In order to model the interactions among agents in the collaboration processes and the value co-creation processes, this research used three collaboration cases in Indonesia. Then, the agent-based simulation was used to capture both the collaboration process and the value co-creation process of the three collaboration cases. Findings: The interactions among the agents both inside and outside their collaboration environment determined agent’s role as a value co-creator. The willingness of an agent to accept the opinion of another agent determined the degree of their willingness to co-operate and to change their strategies, and perceptions. Therefore, influenced the size of the value obtained by them in each collaboration process. Research limitations/implications: The findings of the simulations subject to assumptions based on the collaboration cases. Further research is related to how to encourage agents to co-operate and adjust their perceptions. Practical implications: It is crucial for the practitioners to interact with another agent both inside and outside their collaboration environment. The opinions of another agent inside the collaboration environment also need to be considered. Originality/value: This research is derived from its emphasis on how a value is co-created by reinforcing both the collaborative processes and the interactions among agents as well as on how CTM might be best employed.

Co-creating value through agents interaction within service network

Energy Technology Data Exchange (ETDEWEB)

Okdinawati, L.; Simatupang, T.M.; Sunitiyoso, Y.

2017-07-01

The purpose of this paper is to gives further understanding on value co-creation mechanisms in B-to-B service network by reinforcing the processes, the relationships, and influences of other agents where Collaborative Transportation Management (CTM) forms might be best employed. Design/methodology/approach: In order to model the interactions among agents in the collaboration processes and the value co-creation processes, this research used three collaboration cases in Indonesia. Then, the agent-based simulation was used to capture both the collaboration process and the value co-creation process of the three collaboration cases. Findings: The interactions among the agents both inside and outside their collaboration environment determined agent’s role as a value co-creator. The willingness of an agent to accept the opinion of another agent determined the degree of their willingness to co-operate and to change their strategies, and perceptions. Therefore, influenced the size of the value obtained by them in each collaboration process. Research limitations/implications: The findings of the simulations subject to assumptions based on the collaboration cases. Further research is related to how to encourage agents to co-operate and adjust their perceptions. Practical implications: It is crucial for the practitioners to interact with another agent both inside and outside their collaboration environment. The opinions of another agent inside the collaboration environment also need to be considered. Originality/value: This research is derived from its emphasis on how a value is co-created by reinforcing both the collaborative processes and the interactions among agents as well as on how CTM might be best employed.

Brevianamides and Mycophenolic Acid Derivatives from the Deep-Sea-Derived Fungus Penicillium brevicompactum DFFSCS025

Directory of Open Access Journals (Sweden)

Xinya Xu

2017-02-01

Full Text Available Four new compounds (1–4, including two brevianamides and two mycochromenic acid derivatives along with six known compounds were isolated from the deep-sea-derived fungus Penicillium brevicompactum DFFSCS025. Their structures were elucidated by spectroscopic analysis. Moreover, the absolute configurations of 1 and 2 were determined by quantum chemical calculations of the electronic circular dichroism (ECD spectra. Compound 9 showed moderate cytotoxicity against human colon cancer HCT116 cell line with IC50 value of 15.6 μM. In addition, 3 and 5 had significant antifouling activity against Bugula neritina larval settlement with EC50 values of 13.7 and 22.6 μM, respectively. The NMR data of 6, 8, and 9 were assigned for the first time.

'Generalizability' of a radial-aortic transfer function for the derivation of central aortic waveform parameters.

Science.gov (United States)

Hope, Sarah A; Meredith, Ian T; Tay, David; Cameron, James D

2007-09-01

Arterial transfer functions (TFs) describe the relationship between the pressure waveform at different arterial sites. Generalized TFs are used to reconstruct central aortic waveforms from non-invasively obtained peripheral waveforms and have been promoted as potentially clinically useful. A limitation is the paucity of information on their 'generalizability' with no information existing on the number of subjects required to construct a satisfactory TF, nor is adequate prospective validation available. We therefore investigated the uniformity of radial-aortic TFs and prospectively estimated the capacity of a generalized TF to reconstruct individual central blood pressure parameters. Ninety-three subjects (64 male) were studied by simultaneous radial applanation and high-fidelity (Millar Mikro-tip catheter) direct measurement of central aortic BP during elective coronary procedures. Subjects were prospectively randomized to either a derivation or validation group. Increasing numbers of individual TFs from the derivation group were averaged to form a generalized TF. There was minimal change with greater than 20 TFs averaged. In the validation group, the error in most reconstructed parameters related to the absolute value of the directly measured parameter [systolic blood pressure (SBP) and pulse pressure, Pcentral aortic SBP and pulse pressure (negatively) and time to peak systole (positively) (all PInclusion of more than 20 individual TFs in the construction of a generalized TF does not improve 'generalizability'. There appear to be systematic errors in derived central pressure waveforms and derived aortic augmentation index is inaccurate compared to the directly measured value.

Value Creation in International Business

DEFF Research Database (Denmark)

is a pioneering two volume work intended to provoke theoretical and empirical development in International Business research. Moreover, it is intended as a bridge between concepts derived from general business firm-level research agendas such as value creation and business model, and internationalization......The edited collection brings into focus the meanings, interpretations and the process of value creation in international business. Exploring value creation in the context of emerging and developed economies, Volume 2 takes the perspective of small and medium sized enterprises and examines various...

Usefulness Of Derivative Instruments In Emerging Markets: Turkish Experience

OpenAIRE

Cem Saatcioglu; Iskender Karagul; Ara G. Volkan

2011-01-01

This article presents an overview of derivative markets, definitions of derivative investment instruments, development of global derivative markets and the applicability of derivative markets in Turkey, given their economic value added to the Turkish economy. Readers will acquire insight into investing in various investment instruments and hedging against risk. Turkish derivative markets will be described, supportive statistical data will be presented, and readers will be introduced to the de...

Value Creation in International Business

DEFF Research Database (Denmark)

The edited collection brings into focus the meanings, interpretations and the process of value creation in international business. Exploring value creation in the context of emerging and developed economies, Volume 2 takes the perspective of small and medium sized enterprises and examines various...... approaches to value creation in the process of firm internationalization. Providing theoretical and practical insights, the authors open an intellectual debate into what value is, and how it is created through the internationalization activities of firms. Value Creation in International Business...... is a pioneering two volume work intended to provoke theoretical and empirical development in International Business research. Moreover, it is intended as a bridge between concepts derived from general business firm-level research agendas such as value creation and business model, and internationalization...

Localization of bulk form fields on dilatonic domain walls

International Nuclear Information System (INIS)

Youm, Donam

2001-06-01

We study the localization properties of bulk form potentials on dilatonic domain walls. We find that bulk form potentials of any ranks can be localized as form potentials of the same ranks or one lower ranks, for any values of the dilaton coupling parameter. For large enough values of the dilaton coupling parameter, bulk form potentials of any ranks can be localized as form potentials of both the same ranks and one lower ranks. (author)

Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, their hierarchies and bi-Hamiltonian structures

Energy Technology Data Exchange (ETDEWEB)

Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

2009-10-02

Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.

The covariance matrix of derived quantities and their combination

International Nuclear Information System (INIS)

Zhao, Z.; Perey, F.G.

1992-06-01

The covariance matrix of quantities derived from measured data via nonlinear relations are only approximate since they are functions of the measured data taken as estimates for the true values of the measured quantities. The evaluation of such derived quantities entails new estimates for the true values of the measured quantities and consequently implies a modification of the covariance matrix of the derived quantities that was used in the evaluation process. Failure to recognize such an implication can lead to inconsistencies between the results of different evaluation strategies. In this report we show that an iterative procedure can eliminate such inconsistencies

Molecular Docking Study on Galantamine Derivatives as Cholinesterase Inhibitors.

Science.gov (United States)

Atanasova, Mariyana; Yordanov, Nikola; Dimitrov, Ivan; Berkov, Strahil; Doytchinova, Irini

2015-06-01

A training set of 22 synthetic galantamine derivatives binding to acetylcholinesterase was docked by GOLD and the protocol was optimized in terms of scoring function, rigidity/flexibility of the binding site, presence/absence of a water molecule inside and radius of the binding site. A moderate correlation was found between the affinities of compounds expressed as pIC50 values and their docking scores. The optimized docking protocol was validated by an external test set of 11 natural galantamine derivatives and the correlation coefficient between the docking scores and the pIC50 values was 0.800. The derived relationship was used to analyze the interactions between galantamine derivatives and AChE. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Higher derivatives in Type II and M-theory on Calabi-Yau threefolds

Science.gov (United States)

Grimm, Thomas W.; Mayer, Kilian; Weissenbacher, Matthias

2018-02-01

The four- and five-dimensional effective actions of Calabi-Yau threefold compactifications are derived with a focus on terms involving up to four space-time derivatives. The starting points for these reductions are the ten- and eleven-dimensional supergravity actions supplemented with the known eight-derivative corrections that have been inferred from Type II string amplitudes. The corrected background solutions are determined and the fluctuations of the Kähler structure of the compact space and the form-field back-ground are discussed. It is concluded that the two-derivative effective actions for these fluctuations only takes the expected supergravity form if certain additional ten- and eleven-dimensional higher-derivative terms for the form-fields are included. The main results on the four-derivative terms include a detailed treatment of higher-derivative gravity coupled to Kähler structure deformations. This is supplemented by a derivation of the vector sector in reductions to five dimensions. While the general result is only given as an expansion in the fluctuations, a complete treatment of the one-Kähler modulus case is presented for both Type II theories and M-theory.

Nucleon form factors in dispersively improved chiral effective field theory. II. Electromagnetic form factors

Science.gov (United States)

Alarcón, J. M.; Weiss, C.

2018-05-01

We study the nucleon electromagnetic form factors (EM FFs) using a recently developed method combining chiral effective field theory (χ EFT ) and dispersion analysis. The spectral functions on the two-pion cut at t >4 Mπ2 are constructed using the elastic unitarity relation and an N /D representation. χ EFT is used to calculate the real functions J±1(t ) =f±1(t ) /Fπ(t ) (ratios of the complex π π →N N ¯ partial-wave amplitudes and the timelike pion FF), which are free of π π rescattering. Rescattering effects are included through the empirical timelike pion FF | Fπ(t) | 2 . The method allows us to compute the isovector EM spectral functions up to t ˜1 GeV2 with controlled accuracy (leading order, next-to-leading order, and partial next-to-next-to-leading order). With the spectral functions we calculate the isovector nucleon EM FFs and their derivatives at t =0 (EM radii, moments) using subtracted dispersion relations. We predict the values of higher FF derivatives, which are not affected by higher-order chiral corrections and are obtained almost parameter-free in our approach, and explain their collective behavior. We estimate the individual proton and neutron FFs by adding an empirical parametrization of the isoscalar sector. Excellent agreement with the present low-Q2 FF data is achieved up to ˜0.5 GeV2 for GE, and up to ˜0.2 GeV2 for GM. Our results can be used to guide the analysis of low-Q2 elastic scattering data and the extraction of the proton charge radius.

UK Nuclear Decommissioning Authority - Value framework, its development and role in decision making - 16399

International Nuclear Information System (INIS)

Wareing, Mark

2009-01-01

As part of its day to day business NDA must be able to demonstrate that it is delivering value for money across its entire estate, as this is essential to securing funding from government and demonstrating to stakeholders that NDA is delivering on its mission. Value comes in many forms such as an improved environment, hazard reduction, changes in sky line, social amenities, money, employment etc. Depending on the perspective of the receiver, and their closeness to the affected area, the relative weighting they place on the different aspects of value will vary. Therefore the challenge to NDA has been how to get a consistent approach to measuring value that is broadly acceptable to stakeholders and allows the different aspects of value to be compared and decisions made on a national basis. This paper describes the work undertaken by NDA to develop a Value Framework to support decision making at both the strategic and tactical level and addresses the following topics: - The relationship between the value framework and UK government guidance on business case development and options appraisal - The development of the value framework tool kit including previous work on the NDA prioritisation process and the derivation of Safety and Environmental Detriment scores - How NDA uses the value framework in its decision making processes. (author)

An intrinsic and exterior form of the Bianchi identities

Science.gov (United States)

Do, Thoan; Prince, Geoff

2017-09-01

We give an elegant formulation of the structure equations (of Cartan) and the Bianchi identities in terms of exterior calculus without reference to a particular basis and without the exterior covariant derivative. This approach allows both structure equations and the Bianchi identities to be expressed in terms of forms of arbitrary degree. We demonstrate the relationship with both the conventional vector version of the Bianchi identities and to the exterior covariant derivative approach. Contact manifolds, codimension one foliations and the Cartan form of classical mechanics are studied as examples of its flexibility and utility.

Higher-derivative superparticle in AdS3 space

Science.gov (United States)

Kozyrev, Nikolay; Krivonos, Sergey; Lechtenfeld, Olaf

2016-03-01

Employing the coset approach we construct component actions for a superparticle moving in AdS3 with N =(2 ,0 ), D =3 supersymmetry partially broken to N =2 , d =1 . These actions may contain higher time-derivative terms, which are chosen to possess the same (super)symmetries as the free superparticle. In terms of the nonlinear-realization superfields, the component actions always take a simpler form when written in terms of covariant Cartan forms. We also consider in detail the reduction to the nonrelativistic case and construct the corresponding action of a Newton-Hooke superparticle and its higher-derivative generalizations. The structure of these higher time-derivative generalizations is completely fixed by invariance under the supersymmetric Newton-Hooke algebra extended by two central charges.

Predictive value of [-2]propsa (p2psa and its derivatives for the prostate cancer detection in the 2.0 to 10.0ng/mL PSA range

Directory of Open Access Journals (Sweden)

I. Vukovic

Full Text Available ABSTRACT Introduction To assess predictive value of new tumor markers, precursor of prostate specific antigen (p2PSA and its derivates-%p2PSA and prostate health index (PHI in detection of patients with indolent and aggressive prostate cancer (PC in a subcohort of man whose total PSA ranged from 2 to 10ng/mL. Materials and Methods This cross-sectional study included 129 consecutive male patients aged over 50 years, with no previous history of PC and with normal digital rectal examination findings, but with serum PSA in interval between 2 and 10ng/mL. All patients underwent standard transrectal ultrasonography guided prostate biopsy for the first time. For all patients, serum PSA, free PSA (fPSA and p2PSA were measured and PHI and %p2PSA were calculated. Results PHI and %p2PSA levels were significanlty higher in patients with PC compared to those without this malignancy. The same findings have been observed in group of patients with Gleason score ≥7 compared to those with Gleason score <7. ROC analysis reveled the highest area under the curve with these two markers. Multivariate logistic regression showed significant improvement in PC detection and its agressive form (assumed as Gleason score ≥7. Conclusions New markers, derivates of p2PSA (especially %p2PSA and PHI, represente potentially very important clinical tool for predicting presence of PC, and even more important, to discriminate patients with Gleason score <7 from those with Gleason score ≥7 with total PSA in range from 2 to 10ng/mL.

Predictive value of [-2]propsa (p2psa) and its derivatives for the prostate cancer detection in the 2.0 to 10.0ng/mL PSA range.

Science.gov (United States)

Vukovic, I; Djordjevic, D; Bojanic, N; Babic, U; Soldatovic, I

2017-01-01

To assess predictive value of new tumor markers, precursor of prostate specific antigen (p2PSA) and its derivates-%p2PSA and prostate health index (PHI) in detection of patients with indolent and aggressive prostate cancer (PC) in a subcohort of man whose total PSA ranged from 2 to 10ng/mL. This cross-sectional study included 129 consecutive male patients aged over 50 years, with no previous history of PC and with normal digital rectal examination findings, but with serum PSA in interval between 2 and 10ng/mL. All patients underwent standard transrectal ultrasonography guided prostate biopsy for the first time. For all patients, serum PSA, free PSA (fPSA) and p2PSA were measured and PHI and %p2PSA were calculated. PHI and %p2PSA levels were significanlty higher in patients with PC compared to those without this malignancy. The same findings have been observed in group of patients with Gleason score ≥7 compared to those with Gleason score <7. ROC analysis reveled the highest area under the curve with these two markers. Multivariate logistic regression showed significant improvement in PC detection and its agressive form (assumed as Gleason score ≥7). New markers, derivates of p2PSA (especially %p2PSA and PHI), represente potentially very important clinical tool for predicting presence of PC, and even more important, to discriminate patients with Gleason score <7 from those with Gleason score ≥7 with total PSA in range from 2 to 10ng/mL. Copyright® by the International Brazilian Journal of Urology.

Rethinking Value in the Bio-economy: Finance, Assetization, and the Management of Value.

Science.gov (United States)

Birch, Kean

2017-05-01

Current debates in science and technology studies emphasize that the bio-economy-or, the articulation of capitalism and biotechnology-is built on notions of commodity production, commodification, and materiality, emphasizing that it is possible to derive value from body parts, molecular and cellular tissues, biological processes, and so on. What is missing from these perspectives, however, is consideration of the political-economic actors, knowledges, and practices involved in the creation and management of value. As part of a rethinking of value in the bio-economy, this article analyzes three key political-economic processes: financialization, capitalization, and assetization. In doing so, it argues that value is managed as part of a series of valuation practices, it is not inherent in biological materialities.

Derivatives Trading and Negative Voting

OpenAIRE

Spamann, Holger

2012-01-01

This paper exposits a model of parallel trading of corporate securities (shares, bonds) and derivatives in which a large trader can sometimes profitably acquire securities with their corporate control rights for the sole purpose of reducing the corporations value and gaining on a net short position created through off-setting derivatives. At other times, the large trader profitably takes a net long position. The large trader requires no private information beyond its own trades. The problem i...

Diagnostic value of transmural perfusion ratio derived from dynamic CT-based myocardial perfusion imaging for the detection of haemodynamically relevant coronary artery stenosis

Energy Technology Data Exchange (ETDEWEB)

Coenen, Adriaan; Lubbers, Marisa M.; Dedic, Admir; Chelu, Raluca G.; Geuns, Robert-Jan M. van; Nieman, Koen [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Erasmus University Medical Center, Department of Cardiology, Rotterdam (Netherlands); Kurata, Akira; Kono, Atsushi; Dijkshoorn, Marcel L. [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Rossi, Alexia [Erasmus University Medical Center, Department of Radiology, Rotterdam (Netherlands); Barts Health NHS Trust, NIHR Cardiovascular Biomedical Research Unit at Barts, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London and Department of Cardiology, London (United Kingdom)

2017-06-15

To investigate the additional value of transmural perfusion ratio (TPR) in dynamic CT myocardial perfusion imaging for detection of haemodynamically significant coronary artery disease compared with fractional flow reserve (FFR). Subjects with suspected or known coronary artery disease were prospectively included and underwent a CT-MPI examination. From the CT-MPI time-point data absolute myocardial blood flow (MBF) values were temporally resolved using a hybrid deconvolution model. An absolute MBF value was measured in the suspected perfusion defect. TPR was defined as the ratio between the subendocardial and subepicardial MBF. TPR and MBF results were compared with invasive FFR using a threshold of 0.80. Forty-three patients and 94 territories were analysed. The area under the receiver operator curve was larger for MBF (0.78) compared with TPR (0.65, P = 0.026). No significant differences were found in diagnostic classification between MBF and TPR with a territory-based accuracy of 77 % (67-86 %) for MBF compared with 70 % (60-81 %) for TPR. Combined MBF and TPR classification did not improve the diagnostic classification. Dynamic CT-MPI-based transmural perfusion ratio predicts haemodynamically significant coronary artery disease. However, diagnostic performance of dynamic CT-MPI-derived TPR is inferior to quantified MBF and has limited incremental value. (orig.)

Perturbative method for the derivation of quantum kinetic theory based on closed-time-path formalism

International Nuclear Information System (INIS)

Koide, Jun

2002-01-01

Within the closed-time-path formalism, a perturbative method is presented, which reduces the microscopic field theory to the quantum kinetic theory. In order to make this reduction, the expectation value of a physical quantity must be calculated under the condition that the Wigner distribution function is fixed, because it is the independent dynamical variable in the quantum kinetic theory. It is shown that when a nonequilibrium Green function in the form of the generalized Kadanoff-Baym ansatz is utilized, this condition appears as a cancellation of a certain part of contributions in the diagrammatic expression of the expectation value. Together with the quantum kinetic equation, which can be derived in the closed-time-path formalism, this method provides a basis for the kinetic-theoretical description

A new derivation of Dirac's magnetic monopole strength

International Nuclear Information System (INIS)

Panat, P V

2003-01-01

A new derivation of the strength of Dirac's magnetic monopole is presented which does not require an explicit form of the magnetic induction in terms of g, the magnetic pole strength. The derivation essentially uses a modification of Faraday's law of induction and quantization of angular momentum

Optimal economic order quantity for buyer-distributor-vendor supply chain with backlogging derived without derivatives

Science.gov (United States)

Teng, Jinn-Tsair; Cárdenas-Barrón, Leopoldo Eduardo; Lou, Kuo-Ren; Wee, Hui Ming

2013-05-01

In this article, we first complement an inappropriate mathematical error on the total cost in the previously published paper by Chung and Wee [2007, 'Optimal the Economic Lot Size of a Three-stage Supply Chain With Backlogging Derived Without Derivatives', European Journal of Operational Research, 183, 933-943] related to buyer-distributor-vendor three-stage supply chain with backlogging derived without derivatives. Then, an arithmetic-geometric inequality method is proposed not only to simplify the algebraic method of completing prefect squares, but also to complement their shortcomings. In addition, we provide a closed-form solution to integral number of deliveries for the distributor and the vendor without using complex derivatives. Furthermore, our method can solve many cases in which their method cannot, because they did not consider that a squared root of a negative number does not exist. Finally, we use some numerical examples to show that our proposed optimal solution is cheaper to operate than theirs.

Power correction to the asymptotics of the pion electromagnetic form factor

International Nuclear Information System (INIS)

Geshkenbein, B.V.; Terentyev, M.V.

1982-01-01

The contribution of the power correction approximately (μ 2 /Q 2 ) 2 enhanced by the factor approximately μ 2 /anti m 2 , to the pion form factor (FF) is calculated (here μ is the pion mass, anti m=1/2(msub(u)+msub(α)) is the mean value of the u- and d-quark masses, Q 2 =-(p-p') 2 > 0, where p, p' are meson momenta at initial and final state. It is shown that the only source of large corrections is due to the contribution of the local pseudoscalar current. The main (approximately 1/Q 2 ) asymptotics of FF associated with the axial current contribution, is derived. The contribution (approximately 1/Q 4 ) of the pseudoscalar current is calculated

Universal analytical scattering form factor for shell-, core-shell, or homogeneous particles with continuously variable density profile shape.

Science.gov (United States)

Foster, Tobias

2011-09-01

A novel analytical and continuous density distribution function with a widely variable shape is reported and used to derive an analytical scattering form factor that allows us to universally describe the scattering from particles with the radial density profile of homogeneous spheres, shells, or core-shell particles. Composed by the sum of two Fermi-Dirac distribution functions, the shape of the density profile can be altered continuously from step-like via Gaussian-like or parabolic to asymptotically hyperbolic by varying a single "shape parameter", d. Using this density profile, the scattering form factor can be calculated numerically. An analytical form factor can be derived using an approximate expression for the original Fermi-Dirac distribution function. This approximation is accurate for sufficiently small rescaled shape parameters, d/R (R being the particle radius), up to values of d/R ≈ 0.1, and thus captures step-like, Gaussian-like, and parabolic as well as asymptotically hyperbolic profile shapes. It is expected that this form factor is particularly useful in a model-dependent analysis of small-angle scattering data since the applied continuous and analytical function for the particle density profile can be compared directly with the density profile extracted from the data by model-free approaches like the generalized inverse Fourier transform method. © 2011 American Chemical Society

Interministerial decree of 10 February 1988 fixing the derived limits of the air concentration and the annual intake limit and the values of the quality factor and the neutron fluence rate

International Nuclear Information System (INIS)

1988-01-01

This decree establishes the derived concentration limits in the air and annual inhalation limits for the radioisotopes and the values of the quality factors and the conversion factors fluence/dose equivalent for neutrons and protons

Plant cultivars derived from mutation induction or the use of induced mutants in cross breeding

International Nuclear Information System (INIS)

Micke, A.; Maluszynski, M.; Donini, B.

1985-01-01

Since 1969 we have collected information on cultivated varieties of plants, developed by using induced mutations. Whenever we learn about a cultivar presumably derived from an induced mutant or from use of mutants in crosses. we mail a questionnaire to the breeder. The information gathered in this way is stored in our file on ''Mutant Varieties''. Excerpts are published regularly in the form of a list in the FAO/IAEA Mutation Breeding Newsletter. Our mutant variety list has repeatedly provided a basis for analyses on the value and prospects of mutation breeding

Plant cultivars derived from mutation induction or the use of induced mutants in cross breeding

Energy Technology Data Exchange (ETDEWEB)

Micke, A; Maluszynski, M; Donini, B [Joint FAO/IAEA Division, Plant Breeding and Genetics Section, Vienna (Austria)

1985-05-01

Since 1969 we have collected information on cultivated varieties of plants, developed by using induced mutations. Whenever we learn about a cultivar presumably derived from an induced mutant or from use of mutants in crosses. we mail a questionnaire to the breeder. The information gathered in this way is stored in our file on ''Mutant Varieties''. Excerpts are published regularly in the form of a list in the FAO/IAEA Mutation Breeding Newsletter. Our mutant variety list has repeatedly provided a basis for analyses on the value and prospects of mutation breeding.

Researching Values in Education.

Science.gov (United States)

Halliday, John

2002-01-01

Considers methodological issues that arise when values form the main focus of empirical educational research. Includes discussion of the idea that social science, in general, and educational research, in particular, are forms of moral inquiry. Outlines a methodology of educational research, drawing from work by Imre Lakatos, Alasdair MacIntyre,…

Preparation of 7-substituted ginkgolide derivatives

DEFF Research Database (Denmark)

Vogensen, Stine Byskov; Strømgaard, Kristian; Shindou, Hideo

2003-01-01

alpha-fluoro ginkgolide B was equipotent to ginkgolide B underlining the critical importance of the 7-position of ginkgolides for PAF receptor activity. Herein we describe the synthesis of a series of ginkgolide B derivatives with modifications at the 7-position and the pharmacological evaluation...... of these derivatives as assayed by cloned PAF receptors. In two cases nucleophilic attack on a 7beta-O-triflate ginkgolide B did not lead to the expected products, but gave rise to two unprecedented ginkgolide derivatives, one with a novel rearranged skeleton. Furthermore, standard reduction of 7alpha-azido ginkgolide......-chloro ginkgolide B, the most potent nonaromatic ginkgolide derivative described to date with a K(i) value of 110 nM....

Dietary Reference Values for choline

DEFF Research Database (Denmark)

Sjödin, Anders Mikael

2016-01-01

Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives Dietary Reference Values (DRVs) for choline. In this Opinion, the Panel considers dietary choline including choline compounds (e.g. glycerophosphocholine, phosphocholine...

Forest ecosystem services: Cultural values

Science.gov (United States)

Melissa M. Kreye; Damian C. Adams; Ramesh Ghimire; Wayde Morse; Taylor Stein; J. M. Bowker

2017-01-01

How we define “culture” and societal well-being related to culture depends heavily on who is looking at it, but culture can be generally described as “the customs and beliefs of a particular group of people that are used to express their collectively held values” (Soulbury Commission 2012). In the context of forests, culturally derived norms, beliefs, and values help...

Identifying A Molecular Phenotype for Bone Marrow Stromal Cells With In Vivo Bone Forming Capacity

DEFF Research Database (Denmark)

Larsen, Kenneth H; Frederiksen, Casper M; Burns, Jorge S

2009-01-01

(17% versus 5%) and a larger percentage of genes with predicted SP3 transcription factor binding sites in their promoter region (21% versus 8%). On the other hand, hBMSC-TERT(-Bone) cells expressed a larger number of immune-response related genes (26% versus 8%). In order to test for the predictive...... value of these markers, we studied the correlation between their expression levels in 6 different hBMSC-derived clones and the ability to form bone in vivo. We found a significant correlation for, decorin, lysyl oxidase-like 4, natriuretic peptide receptor C, and tetranectin. No significant positive...

Investigation of Antileishmanial Activities of Acridines Derivatives against Promastigotes and Amastigotes Form of Parasites Using Quantitative Structure Activity Relationship Analysis

Directory of Open Access Journals (Sweden)

Samir Chtita

2016-01-01

Full Text Available In a search of newer and potent antileishmanial (against promastigotes and amastigotes form of parasites drug, a series of 60 variously substituted acridines derivatives were subjected to a quantitative structure activity relationship (QSAR analysis for studying, interpreting, and predicting activities and designing new compounds by using multiple linear regression and artificial neural network (ANN methods. The used descriptors were computed with Gaussian 03, ACD/ChemSketch, Marvin Sketch, and ChemOffice programs. The QSAR models developed were validated according to the principles set up by the Organisation for Economic Co-operation and Development (OECD. The principal component analysis (PCA has been used to select descriptors that show a high correlation with activities. The univariate partitioning (UP method was used to divide the dataset into training and test sets. The multiple linear regression (MLR method showed a correlation coefficient of 0.850 and 0.814 for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. Internal and external validations were used to determine the statistical quality of QSAR of the two MLR models. The artificial neural network (ANN method, considering the relevant descriptors obtained from the MLR, showed a correlation coefficient of 0.933 and 0.918 with 7-3-1 and 6-3-1 ANN models architecture for antileishmanial activities against promastigotes and amastigotes forms of parasites, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outsides compounds. The effects of different descriptors in the activities were described and used to study and design new compounds with higher activities compared to the existing ones.

Sol-gel derived sorbents

Science.gov (United States)

Sigman, Michael E.; Dindal, Amy B.

2003-11-11

Described is a method for producing copolymerized sol-gel derived sorbent particles for the production of copolymerized sol-gel derived sorbent material. The method for producing copolymerized sol-gel derived sorbent particles comprises adding a basic solution to an aqueous metal alkoxide mixture for a pH.ltoreq.8 to hydrolyze the metal alkoxides. Then, allowing the mixture to react at room temperature for a precalculated period of time for the mixture to undergo an increased in viscosity to obtain a desired pore size and surface area. The copolymerized mixture is then added to an immiscible, nonpolar solvent that has been heated to a sufficient temperature wherein the copolymerized mixture forms a solid upon the addition. The solid is recovered from the mixture, and is ready for use in an active sampling trap or activated for use in a passive sampling trap.

Modified truncated randomized singular value decomposition (MTRSVD) algorithms for large scale discrete ill-posed problems with general-form regularization

Science.gov (United States)

Jia, Zhongxiao; Yang, Yanfei

2018-05-01

In this paper, we propose new randomization based algorithms for large scale linear discrete ill-posed problems with general-form regularization: subject to , where L is a regularization matrix. Our algorithms are inspired by the modified truncated singular value decomposition (MTSVD) method, which suits only for small to medium scale problems, and randomized SVD (RSVD) algorithms that generate good low rank approximations to A. We use rank-k truncated randomized SVD (TRSVD) approximations to A by truncating the rank- RSVD approximations to A, where q is an oversampling parameter. The resulting algorithms are called modified TRSVD (MTRSVD) methods. At every step, we use the LSQR algorithm to solve the resulting inner least squares problem, which is proved to become better conditioned as k increases so that LSQR converges faster. We present sharp bounds for the approximation accuracy of the RSVDs and TRSVDs for severely, moderately and mildly ill-posed problems, and substantially improve a known basic bound for TRSVD approximations. We prove how to choose the stopping tolerance for LSQR in order to guarantee that the computed and exact best regularized solutions have the same accuracy. Numerical experiments illustrate that the best regularized solutions by MTRSVD are as accurate as the ones by the truncated generalized singular value decomposition (TGSVD) algorithm, and at least as accurate as those by some existing truncated randomized generalized singular value decomposition (TRGSVD) algorithms. This work was supported in part by the National Science Foundation of China (Nos. 11771249 and 11371219).

Separation of [Rh-103m]-rhodocene-derivatives from the parent [103Ru]ruthenocen-derivatives and their organ distribution

International Nuclear Information System (INIS)

Wenzel, M.; Wu, Y.

1987-01-01

The radioactive decay of [ 103 Ru]ruthenocene derivatives leads to sup(103m)Rh labelled rhodocinium derivatives, which can be separated by the extraction of a lipophilic solution of the ruthenocen derivate with water. The separation factor sup(103m)Rh/ 103 Ru reaches values of 32:1 Rh 3+ ions are not liberated and extracted. The organ distribution of the sup(103m)Rh labelled rhodocinium derivatives gained from ruthenocene and from N-isopropyl-ruthenocene amphetamine is different from the distribution of the parent ruthenocene compound. The liver and kidney uptake of the rhodocinium-amphetamine is much higher than the uptake with ruthenocene amphetamine. (author)

Do planets remember how they formed?

Science.gov (United States)

Kipping, David

2018-01-01

One of the most directly observable features of a transiting multiplanet system is their size-ordering when ranked in orbital separation. Kepler has revealed a rich diversity of outcomes, from perfectly ordered systems, like Kepler-80, to ostensibly disordered systems, like Kepler-20. Under the hypothesis that systems are born via preferred formation pathways, one might reasonably expect non-random size-orderings reflecting these processes. However, subsequent dynamical evolution, often chaotic and turbulent in nature, may erode this information and so here we ask - do systems remember how they formed? To address this, we devise a model to define the entropy of a planetary system's size-ordering, by first comparing differences between neighbouring planets and then extending to accommodate differences across the chain. We derive closed-form solutions for many of the microstate occupancies and provide public code with look-up tables to compute entropy for up to 10-planet systems. All three proposed entropy definitions exhibit the expected property that their credible interval increases with respect to a proxy for time. We find that the observed Kepler multis display a highly significant deficit in entropy compared to a randomly generated population. Incorporating a filter for systems deemed likely to be dynamically packed, we show that this result is robust against the possibility of missing planets too. Put together, our work establishes that Kepler systems do indeed remember something of their younger years and highlights the value of information theory for exoplanetary science.

Anisotropic inflation with derivative couplings

Science.gov (United States)

Holland, Jonathan; Kanno, Sugumi; Zavala, Ivonne

2018-05-01

We study anisotropic power-law inflationary solutions when the inflaton and its derivative couple to a vector field. This type of coupling is motivated by D-brane inflationary models, in which the inflaton, and a vector field living on the D-brane, couple disformally (derivatively). We start by studying a phenomenological model where we show the existence of anisotropic solutions and demonstrate their stability via a dynamical system analysis. Compared to the case without a derivative coupling, the anisotropy is reduced and thus can be made consistent with current limits, while the value of the slow-roll parameter remains almost unchanged. We also discuss solutions for more general cases, including D-brane-like couplings.

Comments on electromagnetic form factors of the nucleon

International Nuclear Information System (INIS)

Sachs, R.G.; Wali, K.C.

1989-01-01

This paper draws the concept of nucleon form factors further to consider the electromagnetic aspect based on the magnetic moment of the nucleon. These are seen as valid physical interpretations of form factors in electron-nucleon interactions. A linear combination of two functions, associated with charge radius, is derived, which agreed well with experimental results. The paper also expands the specific form to include relativistic cases and consider appropriate frames of reference. (UK)

Value function in economic growth model

Science.gov (United States)

Bagno, Alexander; Tarasyev, Alexandr A.; Tarasyev, Alexander M.

2017-11-01

Properties of the value function are examined in an infinite horizon optimal control problem with an unlimited integrand index appearing in the quality functional with a discount factor. Optimal control problems of such type describe solutions in models of economic growth. Necessary and sufficient conditions are derived to ensure that the value function satisfies the infinitesimal stability properties. It is proved that value function coincides with the minimax solution of the Hamilton-Jacobi equation. Description of the growth asymptotic behavior for the value function is provided for the logarithmic, power and exponential quality functionals and an example is given to illustrate construction of the value function in economic growth models.

Derivation methods for clearance levels applied to reactors

International Nuclear Information System (INIS)

Okoshi, Minoru; Seki, Takeo

2001-01-01

In order to support the discussion by the Nuclear Safety Commission, JAERI derived the unconditional clearance levels for concrete and metal arising from the operation and dismantling of nuclear reactors. The clearance levels of 20 radionuclides were derived from 10 μSv/y of individual doses by deterministic approach. In this approach, calculation models were established to assess individual doses resulting from 73 exposure pathways related to disposal and recycle/reuse, and realistic parameter values were selected considering Japanese natural and social conditions. The appropriateness of selected parameter values was confirmed by stochastic analyses. (author)

Modeling the Effect of Grain Size Mixing on Thermal Inertia Values Derived from Diurnal and Seasonal THEMIS Measurements

Science.gov (United States)

McCarty, C.; Moersch, J.

2017-12-01

Sedimentary processes have slowed over Mars' geologic history. Analysis of the surface today can provide insight into the processes that may have affected it over its history. Sub-resolved checkerboard mixtures of materials with different thermal inertias (and therefore different grain sizes) can lead to differences in thermal inertia values inferred from night and day radiance observations. Information about the grain size distribution of a surface can help determine the degree of sorting it has experienced or it's geologic maturity. Standard methods for deriving thermal inertia from measurements made with THEMIS can give values for the same location that vary by as much as 20% between scenes. Such methods make the assumption that each THEMIS pixel contains material that has uniform thermophysical properties. Here we propose that if a mixture of small and large particles is present within a pixel, the inferred thermal inertia will be strongly dominated by whichever particle is warmer at the time of the measurement because the power radiated by a surface is proportional (by the Stefan-Boltzmann law) to the fourth power of its temperature. This effect will result in a change in thermal inertia values inferred from measurements taken at different times of day and night. Therefore, we expect to see correlation between the magnitude of diurnal variations in inferred thermal inertia values and the degree of grain size mixing for a given pixel location. Preliminary work has shown that the magnitude of such diurnal variation in inferred thermal inertias is sufficient to detect geologically useful differences in grain size distributions. We hypothesize that at least some of the 20% variability in thermal inertias inferred from multiple scenes for a given location could be attributed to sub-pixel grain size mixing rather than uncertainty inherent to the experiment, as previously thought. Mapping the difference in inferred thermal inertias from day and night THEMIS

Innovation Forms and Firm Export Performance: Empirical Evidence from ECA Countries

Directory of Open Access Journals (Sweden)

Andrzej Cieślik

2017-06-01

Full Text Available Objective: The main objective of this paper is to verify empirically the relationship between various forms of innovation and export performance of firms from European and Central Asian (ECA countries. Research Design & Methods: In our empirical approach we refer to the self-selection hypothesis derived from the Melitz (2003 model which proposed the existence of a positive relationship between firm productivity and the probability of exporting. We argue that innovation activities should be regarded as a key element that can increase the level of firm productivity. We focus our analysis on four forms of innovation activities: product, process, marketing, organizational and managerial innovation. The empirical implementation of our analytical framework is based on the probit model, applied to the fifth edition of the BEEPS firm level dataset covering 2011-2014. Findings: Our empirical results indicate that the probability of exporting is positively related to both product and process innovations. The marketing and managerial innovations do not seem to affect positively export performance of firms from ECA countries. Implications & Recommendations: It is recommended to develop innovation supporting mechanisms that would target both product and process innovations rather than other forms of innovation in the ECA countries. Contribution & Value Added: The originality of this work lies in the use of the multi-country firm level dataset that allows distinguishing between various forms of innovations in the ECA countries.

Whole lesion histogram analysis of meningiomas derived from ADC values. Correlation with several cellularity parameters, proliferation index KI 67, nucleic content, and membrane permeability.

Science.gov (United States)

Surov, Alexey; Hamerla, Gordian; Meyer, Hans Jonas; Winter, Karsten; Schob, Stefan; Fiedler, Eckhard

2018-09-01

To analyze several histopathological features and their possible correlations with whole lesion histogram analysis derived from ADC maps in meningioma. The retrospective study involved 36 patients with primary meningiomas. For every tumor, the following histogram analysis parameters of apparent diffusion coefficient (ADC) were calculated: ADC mean , ADC max , ADC min , ADC median , ADC mode , ADC percentiles: P10, P25, P75, P90, as well kurtosis, skewness, and entropy. All measures were performed by two radiologists. Proliferation index KI 67, minimal, maximal and mean cell count, total nucleic area, and expression of water channel aquaporin 4 (AQP4) were estimated. Spearman's correlation coefficient was used to analyze associations between investigated parameters. A perfect interobserver agreement for all ADC values (0.84-0.97) was identified. All ADC values correlated inversely with tumor cellularity with the strongest correlation between P10, P25 and mean cell count (-0.558). KI 67 correlated inversely with all ADC values except ADC min . ADC parameters did not correlate with total nucleic area. All ADC values correlated statistically significant with expression of AQP4. ADC histogram analysis is a valid method with an excellent interobserver agreement. Cellularity parameters and proliferation potential are associated with different ADC values. Membrane permeability may play a greater role for water diffusion than cell count and proliferation activity. Copyright © 2018 Elsevier Inc. All rights reserved.

Clinical evaluation of the Serum CrossLaps One Step ELISA, a new assay measuring the serum concentration of bone-derived degradation products of type I collagen C-telopeptides

DEFF Research Database (Denmark)

Christgau, S; Rosenquist, C; Alexandersen, P

1998-01-01

The Serum CrossLaps One Step ELISA is a sandwich assay using two monoclonal antibodies specific for a beta-aspartate form of the epitope EKAHDGGR derived from the carboxy-terminal telopeptide region of type I collagen alpha1-chain. Our objective was to assess the clinical value of the Serum Cross...

Application of the moving frame method to deformed Willmore surfaces in space forms

Science.gov (United States)

Paragoda, Thanuja

2018-06-01

The main goal of this paper is to use the theory of exterior differential forms in deriving variations of the deformed Willmore energy in space forms and study the minimizers of the deformed Willmore energy in space forms. We derive both first and second order variations of deformed Willmore energy in space forms explicitly using moving frame method. We prove that the second order variation of deformed Willmore energy depends on the intrinsic Laplace Beltrami operator, the sectional curvature and some special operators along with mean and Gauss curvatures of the surface embedded in space forms, while the first order variation depends on the extrinsic Laplace Beltrami operator.

Bounded Densities and Their Derivatives

DEFF Research Database (Denmark)

Kozine, Igor; Krymsky, V.

2009-01-01

This paper describes how one can compute interval-valued statistical measures given limited information about the underlying distribution. The particular focus is on a bounded derivative of a probability density function and its combination with other available statistical evidence for computing ...... quantities of interest. To be able to utilise the evidence about the derivative it is suggested to adapt the ‘conventional’ problem statement to variational calculus and the way to do so is demonstrated. A number of examples are given throughout the paper....

Dietary reference values for riboflavin

DEFF Research Database (Denmark)

Sjödin, Anders Mikael

2017-01-01

Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for riboflavin. The Panel considers that the inflection point in the urinary riboflavin excretion curve in relation to riboflavin intake...

ARCHITECTURAL CONCEPTS FOR VALUE CHAINS

OpenAIRE

A.C. Janse van Rensburg

2012-01-01

ENGLISH ABSTRACT:The Porter Value Chain has been widely adopted by the business community as a mechanism to understand and comprehend complexity in business environments, with the ultimate goal of structuring the business to maximize its competitive advantage. Implementing the Value Chain is not easy: a number of organizations can testify to their failure to derive any benefits at all from this concept. To overcome this problem, an approach is presented to assist the organization in ...

Physical equivalence of the point and instant forms of relativistic dynamics

Energy Technology Data Exchange (ETDEWEB)

Sokolov, S N [Gosudarstvennyj Komitet po Ispol' zovaniyu Atomnoj Ehnergii SSSR, Serpukhov. Inst. Fiziki Vysokikh Ehnergij

1975-01-01

As a proof of total physical equivalence of point and instantaneous forms of dynamics, a unitary transformation is derived which connects these forms of dynamics without changing the scattering matrix.

Ionic double layer of atomically flat gold formed on mica templates

International Nuclear Information System (INIS)

Chilcott, Terry C.; Wong, Elicia L.S.; Coster, Hans G.L.; Coster, Adelle C.F.; James, Michael

2009-01-01

Electrical impedance spectroscopy characterisations of gold surfaces formed on mica templates in contact with potassium chloride electrolytes were performed at the electric potential of zero charge over a frequency range of 6 x 10 -3 to 100 x 10 3 Hz. They revealed constant-phase-angle (CPA) behaviour with a frequency exponent value of 0.96 for surfaces that were also characterised as atomically flat using atomic force microscopy (AFM). As the frequency exponent value was only marginally less than unity, the CPA behaviour yielded a realistic estimate for the capacitance of the ionic double layer. The retention of the CPA behaviour was attributed to specific adsorption of chloride ions which was detected as an adsorption conductance element in parallel with the CPA impedance element. Significant variations in the ionic double layer capacitance as well as the adsorption conductance were observed for electrolyte concentrations ranging from 33 μM to 100 mM, but neither of these variations correlated with concentration. This is consistent with the electrical properties of the interface deriving principally from the inner or Stern region of the double layer.

Experimental thermochemical study of fluoro-, chloro-, and bromo-derivatives of uracil

International Nuclear Information System (INIS)

Ribeiro da Silva, Manuel A.V.; Amaral, Luísa M.P.F.; Szterner, Piotr

2012-01-01

Highlights: ► Combustion calorimetry was used to determine Δ f H m ∘ (cr) of halo derivatives of uracil. ► Gas-phase Δ f H m ∘ of the studied compounds have been derived. ► The influence of the halogen atoms on the enthalpic stability of the halo-uracils is discussed. - Abstract: The values of the standard molar enthalpies of formation, of 5-fluorouracil, 5-chlorouracil, 5-bromouracil, and 6-chlorouracil, in the crystalline phase, at T = 298.15 K, were derived from the standard massic energies of combustion, in oxygen, at T = 298.15 K, measured by rotating bomb combustion calorimetry. The combination of the derived values of the standard molar enthalpies of formation, in the crystalline phase, and the literature values of the standard molar enthalpies of sublimation, allowed the calculation of the standard molar enthalpies of formation, in the gaseous phase, at T = 298.15 K, which are interpreted in terms of the influence of the halogen atoms upon the enthalpic stability of the halogen derivatives of uracil.

Internalization of Conservation Values in Forming Green Consumption Attitude

Directory of Open Access Journals (Sweden)

Syamsu Hadi

2017-06-01

Full Text Available The research aims to know a friendly environmental governance system. One sector of economic governance can certainly be initiated through green consumption. The focus of the problem was the green consumption education. This research was conducted by using qualitative approach in order to reveal how the process of conservation education in the Faculty of Economics in fostering behaviors that tend to conserve the consumption behavior in this case the green consumption attitude. The collecting data of research used observation, documentation and interview. This research uncovers how the conservation education is able to shape and build the green consumption attitudes that exist among the students from planning process, implementation, and evaluation of conservation education on the aspects of green consumption. Internalization of conservation value performed by the educators (in this case the lecturers at the Faculty of Economics, Universitas Negeri Semarang runs well enough.

Polyphony and verb forms

Directory of Open Access Journals (Sweden)

Jelena Rajić

2012-12-01

Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.

Human Value, Dignity, and the Presence of Others.

Science.gov (United States)

Hernandez, Jill Graper

2015-09-01

In the health care professions, the meaning of--and implications for--'dignity' and 'value' are progressively more important, as scholars and practitioners increasingly have to make value judgments when making care decisions. This paper looks at the various arguments for competing sources of human value that medical professionals can consider--human rights, autonomy, and a higher-order moral value--and settles upon a foundational model that is related to (though distinct from) the Kantian model that is popular within the medical community: human value is foundational; human dignity, autonomy, and rights derive from the relational quality of human dignity. Moral dignity is expressed though the relationships we cultivate, the communal ends we pursue, and the rights we enjoy. Correlatively, human dignity is inseparable from its ground (i.e., morality), and the relationship between these two is best represented for Kant in the humanities formulation. The foundational model of dignity ensures that human value is non-circularly derived, but is ultimately tied to expressions of individual human dignity that comes from the dignity of morality. Linking Kant's dignity of humanity to the dignity of morality affords a unique and efficacious response to the discussion of human value. In one sense, dignity is amplificatory, since its worth is inextricable with that of autonomy and the rights afforded to the autonomous. But that isn't to say that the worth of dignity is merely amplificatory. Rather, human dignity indicates the absolute inner value (MM 6:435) found in each individual in virtue of being human (MM 6:435, 462). That inner worth engenders certain universal rights--derivable from the dignity and fundamental rational appeal of morality--just as it provides for the possibility for a community of beings to seek to live the moral life.

Variational problems with fractional derivatives: Euler-Lagrange equations

International Nuclear Information System (INIS)

Atanackovic, T M; Konjik, S; Pilipovic, S

2008-01-01

We generalize the fractional variational problem by allowing the possibility that the lower bound in the fractional derivative does not coincide with the lower bound of the integral that is minimized. Also, for the standard case when these two bounds coincide, we derive a new form of Euler-Lagrange equations. We use approximations for fractional derivatives in the Lagrangian and obtain the Euler-Lagrange equations which approximate the initial Euler-Lagrange equations in a weak sense

Protonated form: the potent form of potassium-competitive acid blockers.

Directory of Open Access Journals (Sweden)

Hua-Jun Luo

Full Text Available Potassium-competitive acid blockers (P-CABs are highly safe and active drugs targeting H+,K+-ATPase to cure acid-related gastric diseases. In this study, we for the first time investigate the interaction mechanism between the protonated form of P-CABs and human H+,K+-ATPase using homology modeling, molecular docking, molecular dynamics and binding free energy calculation methods. The results explain why P-CABs have higher activities with higher pKa values or at lower pH. With positive charge, the protonated forms of P-CABs have more competitive advantage to block potassium ion into luminal channel and to bind with H+,K+-ATPase via electrostatic interactions. The binding affinity of the protonated form is more favorable than that of the neutral P-CABs. In particular, Asp139 should be a very important binding site for the protonated form of P-CABs through hydrogen bonds and electrostatic interactions. These findings could promote the rational design of novel P-CABs.

Protonated form: the potent form of potassium-competitive acid blockers.

Science.gov (United States)

Luo, Hua-Jun; Deng, Wei-Qiao; Zou, Kun

2014-01-01

Potassium-competitive acid blockers (P-CABs) are highly safe and active drugs targeting H+,K+-ATPase to cure acid-related gastric diseases. In this study, we for the first time investigate the interaction mechanism between the protonated form of P-CABs and human H+,K+-ATPase using homology modeling, molecular docking, molecular dynamics and binding free energy calculation methods. The results explain why P-CABs have higher activities with higher pKa values or at lower pH. With positive charge, the protonated forms of P-CABs have more competitive advantage to block potassium ion into luminal channel and to bind with H+,K+-ATPase via electrostatic interactions. The binding affinity of the protonated form is more favorable than that of the neutral P-CABs. In particular, Asp139 should be a very important binding site for the protonated form of P-CABs through hydrogen bonds and electrostatic interactions. These findings could promote the rational design of novel P-CABs.

Synthesis of Various Polyaniline / Clay Nanocomposites Derived from Aniline and Substituted Aniline Derivatives by Mechanochemical Intercalation Method

Directory of Open Access Journals (Sweden)

N. Kalaivasan

2010-01-01

Full Text Available Polyaniline clay nanocomposite can be prepared by mechano-chemical method in which intercalation of anilinium ion into the clay lattices accomplished by mechanical grinding of sodium montmorillonite (Na+MMT in presence of anilinium hydrochloride at room temperature using mortar & pestle for about 30 min and subsequent grinding with oxidizing agent, ammonium peroxysulfate. The appearance of green colour indicates the formation of polyaniline/clay nanocomposite (PANI/Clay. Similarly aniline derivatives like o-toludine and o-anisidine in the form of HCl salt can form intercalation into the clay lattices. The intercalated aniline derivatives were ground mechanically in presence of oxidizing agent ammonium peroxysulfate lead to formation of substituted polyaniline/ clay nanocomposites. The characteristics of various polyaniline-clay nanocomposites were investigated using UV-Visible, FT-IR, cyclic voltammetry studies.

INTEREST RATE DERIVATIVES IN DEVELOPING COUNTRIES IN EUROPE

OpenAIRE

SLOBODAN CEROVIC; MARINA PEPIC

2011-01-01

Financial derivatives (interest rate futures, options and swaps) are a very simple way to minimize interest rate risk and therefore are extremely popular. The value of interest rate derivatives transactions in the world is increasing dramatically. Unfortunately, this is not the case with developing countries in Europe. Although significantly increased in the last decade, interest rate derivatives markets in developing countries are still in nascent stage. In most developing countries still t...

Dietary reference values for potassium

DEFF Research Database (Denmark)

Sjödin, Anders Mikael

2016-01-01

Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derives dietary reference values (DRVs) for potassium. The Panel decides to set DRVs on the basis of the relationships between potassium intake and blood pressure and stroke...

Synthesis and characterization of ester and amide derivatives of titanium(IV) carboxymethylphosphonate

International Nuclear Information System (INIS)

Melánová, Klára; Beneš, Ludvík; Trchová, Miroslava; Svoboda, Jan; Zima, Vítězslav

2013-01-01

A set of layered ester and amide derivatives of titanium(IV) carboxymethylphosphonate was prepared by solvothermal treatment of amorphous titanium(IV) carboxymethylphosphonate with corresponding 1-alkanols, 1,ω-alkanediols, 1-aminoalkanes, 1,ω-diaminoalkanes and 1,ω-amino alcohols and characterized by powder X-ray diffraction, IR spectroscopy and thermogravimetric analysis. Whereas alkyl chains with one functional group form bilayers tilted to the layers, 1,ω-diaminoalkanes and most of 1,ω-alkanediols form bridges connecting the adjacent layers. In the case of amino alcohols, the alkyl chains form bilayer and either hydroxyl or amino group is used for bonding. This simple method for the synthesis of ester and amide derivatives does not require preparation of acid chloride derivative as a precursor or pre-intercalation with alkylamines and can be used also for the preparation of ester and amide derivatives of titanium carboxyethylphosphonate and zirconium carboxymethylphosphonate. - Graphical abstract: Ester and amide derivatives of layered titanium carboxymethylphosphonate were prepared by solvothermal treatment of amorphous solid with alkanol or alkylamine. - Highlights: • Ester and amide derivatives of titanium carboxymethylphosphonate. • Solvothermal treatment of amorphous solid with alkanol or alkylamine. • Ester and amide formation confirmed by IR spectroscopy

Simulating WTP Values from Random-Coefficient Models

OpenAIRE

Maurus Rischatsch

2009-01-01

Discrete Choice Experiments (DCEs) designed to estimate willingness-to-pay (WTP) values are very popular in health economics. With increased computation power and advanced simulation techniques, random-coefficient models have gained an increasing importance in applied work as they allow for taste heterogeneity. This paper discusses the parametrical derivation of WTP values from estimated random-coefficient models and shows how these values can be simulated in cases where they do not have a kn...

Milk-derived proteins and peptides in clinical trials

Directory of Open Access Journals (Sweden)

Jolanta Artym

2013-08-01

Full Text Available Clinical trials are reviewed, involving proteins and peptides derived from milk (predominantly bovine, with the exception of lactoferrin, which will be the subject of another article. The most explored milk fraction is α-lactalbumin (LA, which is often applied with glycomacropeptide (GMP – a casein degradation product. These milk constituents are used in health-promoting infant and adult formulae as well as in a modified form (HAMLET to treat cancer. Lactoperoxidase (LCP is used as an additive to mouth hygiene products and as a salivary substitute. Casein derivatives are applied, in addition, in the dry mouth syndrome. On the other hand, casein hydrolysates, containing active tripeptides, found application in hypertension and in type 2 diabetes. Lysozyme is routinely used for food conservation and in pharmaceutical products. It was successfully used in premature infants with concomitant diseases to improve health parameters. When used as prophylaxis in patients with scheduled surgery, it significantly reduced the incidence of hepatitis resulting from blood transfusion. Lysozyme was also used in infected children as an antimicrobial agent showing synergistic effects in combination with different antibiotics. Proline-rich polypeptide (PRP was introduced to therapy of Alzheimer’s disease patients. The therapeutic value of PRP was proved in several clinical trials and supported by studies on its mechanism of action. Concentrated immunoglobulin preparations from colostrum and milk of hyperimmunized cows showed efficacy in prevention of infections by bacteria, viruses and protozoa. A nutrition formula with milk-derived TGF-β2 (Modulen IBD® found application in treatment of pediatric Crohn’s disease. In conclusion, the preparations containing milk-derived products are safe and effective measures in prevention and treatment of infections as well as autoimmune and neoplastic diseases.

Separation of (Rh-103m)-rhodocene-derivatives from the parent (/sup 103/Ru)ruthenocen-derivatives and their organ distribution

Energy Technology Data Exchange (ETDEWEB)

Wenzel, M.; Wu, Y.

1987-01-01

The radioactive decay of (/sup 103/Ru)ruthenocene derivatives leads to sup(103m)Rh labelled rhodocinium derivatives, which can be separated by the extraction of a lipophilic solution of the ruthenocen derivate with water. The separation factor sup(103m)Rh//sup 103/Ru reaches values of 32:1 Rh/sup 3 +/ ions are not liberated and extracted. The organ distribution of the sup(103m)Rh labelled rhodocinium derivatives gained from ruthenocene and from N-isopropyl-ruthenocene amphetamine is different from the distribution of the parent ruthenocene compound. The liver and kidney uptake of the rhodocinium-amphetamine is much higher than the uptake with ruthenocene amphetamine.

The value of service reliability

OpenAIRE

Benezech , Vincent; Coulombel , Nicolas

2013-01-01

International audience; This paper studies the impact of service frequency and reliability on the choice of departure time and the travel cost of transit users. When the user has (α, β, γ) scheduling preferences, we show that the optimal head start decreases with service reliability, as expected. It does not necessarily decrease with service frequency, however. We derive the value of service headway (VoSH) and the value of service reliability (VoSR), which measure the marginal effect on the e...

Principal Component Analysis for Normal-Distribution-Valued Symbolic Data.

Science.gov (United States)

Wang, Huiwen; Chen, Meiling; Shi, Xiaojun; Li, Nan

2016-02-01

This paper puts forward a new approach to principal component analysis (PCA) for normal-distribution-valued symbolic data, which has a vast potential of applications in the economic and management field. We derive a full set of numerical characteristics and variance-covariance structure for such data, which forms the foundation for our analytical PCA approach. Our approach is able to use all of the variance information in the original data than the prevailing representative-type approach in the literature which only uses centers, vertices, etc. The paper also provides an accurate approach to constructing the observations in a PC space based on the linear additivity property of normal distribution. The effectiveness of the proposed method is illustrated by simulated numerical experiments. At last, our method is applied to explain the puzzle of risk-return tradeoff in China's stock market.

Enabling quaternion derivatives: the generalized HR calculus

Science.gov (United States)

Xu, Dongpo; Jahanchahi, Cyrus; Took, Clive C.; Mandic, Danilo P.

2015-01-01

Quaternion derivatives exist only for a very restricted class of analytic (regular) functions; however, in many applications, functions of interest are real-valued and hence not analytic, a typical case being the standard real mean square error objective function. The recent HR calculus is a step forward and provides a way to calculate derivatives and gradients of both analytic and non-analytic functions of quaternion variables; however, the HR calculus can become cumbersome in complex optimization problems due to the lack of rigorous product and chain rules, a consequence of the non-commutativity of quaternion algebra. To address this issue, we introduce the generalized HR (GHR) derivatives which employ quaternion rotations in a general orthogonal system and provide the left- and right-hand versions of the quaternion derivative of general functions. The GHR calculus also solves the long-standing problems of product and chain rules, mean-value theorem and Taylor's theorem in the quaternion field. At the core of the proposed GHR calculus is quaternion rotation, which makes it possible to extend the principle to other functional calculi in non-commutative settings. Examples in statistical learning theory and adaptive signal processing support the analysis. PMID:26361555

Spinors, tensors and the covariant form of Dirac's equation

International Nuclear Information System (INIS)

Chen, W.Q.; Cook, A.H.

1986-01-01

The relations between tensors and spinors are used to establish the form of the covariant derivative of a spinor, making use of the fact that certain bilinear combinations of spinors are vectors. The covariant forms of Dirac's equation are thus obtained and examples in specific coordinate systems are displayed. (author)

Canonical form of Euler-Lagrange equations and gauge symmetries

Energy Technology Data Exchange (ETDEWEB)

Geyer, B [Naturwissenschaftlich-Theoretisches Zentrum und Institut fuer Theoretische Physik, Universitaet Leipzig, Leipzig (Germany); Gitman, D M [Institute of Physics, University of Sao Paulo, Sao Paulo (Brazil); Tyutin, I V [Lebedev Physics Institute, Moscow (Russian Federation)

2003-06-13

The structure of the Euler-Lagrange equations for a general Lagrangian theory (e.g. singular, with higher derivatives) is studied. For these equations we present a reduction procedure to the so-called canonical form. In the canonical form the equations are solved with respect to highest-order derivatives of nongauge coordinates, whereas gauge coordinates and their derivatives enter the right-hand sides of the equations as arbitrary functions of time. The reduction procedure reveals constraints in the Lagrangian formulation of singular systems and, in that respect, is similar to the Dirac procedure in the Hamiltonian formulation. Moreover, the reduction procedure allows one to reveal the gauge identities between the Euler-Lagrange equations. Thus, a constructive way of finding all the gauge generators within the Lagrangian formulation is presented. At the same time, it is proved that for local theories all the gauge generators are local in time operators.

The multiple zeta value data mine

International Nuclear Information System (INIS)

Buemlein, J.; Broadhurst, D.J.

2009-07-01

We provide a data mine of proven results for multiple zeta values (MZVs) of the form ζ(s 1 ,s 2 ,..,s k ) = sum ∞ n 1 >n 2 >...>n k >0 {1/(n 1 s 1 ..n k s k )} with weight w = sum K i=1 s i and depth k and for Euler sums of the form sum ∞ n 1 >n 2 >...>n k >0 {(ε 1 n 1 ..ε 1 n k )/(n 1 s 1 ..n k s k )} with signs ε i = ± 1. Notably, we achieve explicit proven reductions of all MZVs with weights w≤22, and all Euler sums with weights w≤12, to bases whose dimensions, bigraded by weight and depth, have sizes in precise agreement with the Broadhurst. Kreimer and Broadhurst conjectures. Moreover, we lend further support to these conjectures by studying even greater weights (w≤30), using modular arithmetic. To obtain these results we derive a new type of relation for Euler sums, the Generalized Doubling Relations. We elucidate the ''pushdown'' mechanism, whereby the ornate enumeration of primitive MZVs, by weight and depth, is reconciled with the far simpler enumeration of primitive Euler sums. There is some evidence that this pushdown mechanism finds its origin in doubling relations. We hope that our data mine, obtained by exploiting the unique power of the computer algebra language FORM, will enable the study of many more such consequences of the double-shuffle algebra of MZVs, and their Euler cousins, which are already the subject of keen interest, to practitioners of quantum field theory, and to mathematicians alike. (orig.)

Currents, HF Radio-derived, Ano Nuevo, Normal Model, Meridional, EXPERIMENTAL

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The data is the meridional component of ocean surface currents derived from High Frequency Radio-derived measurements, with missing values filled in by a normal...

Currents, HF Radio-derived, Monterey Bay, Normal Model, Meridional, EXPERIMENTAL

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The data is the meridional component of ocean surface currents derived from High Frequency Radio-derived measurements, with missing values filled in by a normal...

Experimental study on the thermochemistry of some amino derivatives of uracil

International Nuclear Information System (INIS)

Ribeiro da Silva, Manuel A.V.; Amaral, Luisa M.P.F.; Szterner, Piotr

2011-01-01

Highlights: → Combustion calorimetry was used to determine Δ f H m 0 (cr) of amino derivatives of uracil. → Gas-phase Δ f H m 0 of amino derivatives of uracil have been derived. → The relative enthalpic stability of the title compounds is discussed in structural terms. - Abstract: Values of the standard (p 0 = 0.1 MPa) molar enthalpy of combustion, Δ c H m 0 , of four crystalline compounds: 5-aminouracil, 6-aminouracil, 6-amino-1-methyluracil, and 6-amino-1,3-dimethyluracil, were determined, at T = 298.15 K, using a static bomb combustion calorimeter. The values obtained of standard molar enthalpy of combustion were used to derive the standard molar enthalpy of formation of the compounds investigated in their condensed phase and together with literature values of the standard molar enthalpy of sublimation, yielded the standard molar enthalpies of formation in the gaseous phase. These are discussed in terms of the effects of the molecular structure on the relative enthalpic stability.

Plasma folic acid cutoff value, derived from its relationship with homocyst(e)ine.

Science.gov (United States)

Brouwer, D A; Welten, H T; Reijngoud, D J; van Doormaal, J J; Muskiet, F A

1998-07-01

We established the cutoff value for plasma folic acid, using plasma homocyst(e)ine as the functional marker. To do this, we investigated the relationship of the plasma folic acid of 103 apparently healthy adults with their fasting plasma homocyst(e)ine and with their plasma homocyst(e)ine 6 h after oral methionine challenge (100 mg/kg). We also studied the relationship of their plasma folic acid with the decline of fasting plasma homocyst(e)ine after 7 days of folic acid supplementation (5 mg/day). The three approaches suggested a cutoff value of 10 nmol/L. The chances of individuals to significantly (P ine after folic acid supplementation proved significantly higher at plasma folic acid concentrations < or = 10 nmol/L, as compared with folic acid concentrations above this value (odds ratio, 5.02; 95% confidence interval, 1.87-13.73). We suggest adopting a 10 nmo/L plasma folic acid cutoff value on functional grounds.

Currents, HF Radio-derived, Monterey Bay, Normal Model, Zonal, EXPERIMENTAL

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The data is the zonal component of ocean surface currents derived from High Frequency Radio-derived measurements, with missing values filled in by a normal model....

On passive scalar derivative statistics in grid turbulence

International Nuclear Information System (INIS)

Tong, C.; Warhaft, Z.

1994-01-01

The probability density function, and related statistics, of scalar (temperature) derivative fluctuations in decaying grid turbulence with an imposed cross-stream, passive linear temperature profile, is studied for a turbulence Reynolds number range, Re l , varying from 50 to 1200, (corresponding to a Taylor Reynolds number range 30 λ θy has a value of 1.8±0.2 (twice the value observed in shear flows), and has no significant variation with Reynolds number. The ratio of the temperature derivative standard deviation along the gradient to that normal to it is approximately 1.2±0.1 also, with no variation with Re. The kurtosis of the derivatives increases approximately as Re 0.2 l . The results show that the rare, intense temperature deviations that produce the skewed scalar derivative, increase in frequency, but their area fraction (of the total field) becomes smaller as the Reynolds number increases. Thus, since S θy remains constant, they become sharper and more intense, occurring deeper in the tails of the probability density function. Measurements in a thermal mixing layer, which has a nonlinear mean temperature profile, are also presented, and these show a similar value of S θy to the linear profile case. The experiments broadly confirm the two-dimensional numerical simulations of Holzer and Siggia [Phys. Fluids (in press)], as well as other recent simulations, although there are some differences

The Constitutive Values of Science

Directory of Open Access Journals (Sweden)

Hugh Lacey

1997-06-01

Full Text Available Cognitive values are the characteristics that are constitutive of good theories, the criteria to which we appeal when choosing among competing theories. I argue that, in order to count as a cognitive value, a characteristic must be needed to explain actually made theory choices, and its cognitive significance must be well defended especially in view of considerations derived from the objective of science. A number of proposed objectives of science are entertained, and it is argued that adopting a par-ticular objective is dialectically intertwined with commitment to certain social values.Then, the ways in which science is, and is not value free is explored briefly, leading to the identification of a level of analysis where values may influence theory choice without causing paradox or threatening the impartiality of soundly-made scientific judgments.

Multiscale analysis of the CMB temperature derivatives

Energy Technology Data Exchange (ETDEWEB)

Marcos-Caballero, A.; Martínez-González, E.; Vielva, P., E-mail: marcos@ifca.unican.es, E-mail: martinez@ifca.unican.es, E-mail: vielva@ifca.unican.es [Instituto de Física de Cantabria, CSIC-Universidad de Cantabria, Avda. de los Castros s/n, 39005 Santander, Spain. (Spain)

2017-02-01

We study the Planck CMB temperature at different scales through its derivatives up to second order, which allows one to characterize the local shape and isotropy of the field. The problem of having an incomplete sky in the calculation and statistical characterization of the derivatives is addressed in the paper. The analysis confirms the existence of a low variance in the CMB at large scales, which is also noticeable in the derivatives. Moreover, deviations from the standard model in the gradient, curvature and the eccentricity tensor are studied in terms of extreme values on the data. As it is expected, the Cold Spot is detected as one of the most prominent peaks in terms of curvature, but additionally, when the information of the temperature and its Laplacian are combined, another feature with similar probability at the scale of 10{sup o} is also observed. However, the p -value of these two deviations increase above the 6% when they are referred to the variance calculated from the theoretical fiducial model, indicating that these deviations can be associated to the low variance anomaly. Finally, an estimator of the directional anisotropy for spinorial quantities is introduced, which is applied to the spinors derived from the field derivatives. An anisotropic direction whose probability is <1% is detected in the eccentricity tensor.

A patient-derived mutant form of the Fanconi anemia protein, FANCA, is defective in nuclear accumulation.

Science.gov (United States)

Kupfer, G; Naf, D; Garcia-Higuera, I; Wasik, J; Cheng, A; Yamashita, T; Tipping, A; Morgan, N; Mathew, C G; D'Andrea, A D

1999-04-01

Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with at least eight complementation groups (A-H). Three FA genes, corresponding to complementation groups A, C, and G, have been cloned, but the function of the encoded FA proteins remains unknown. We recently demonstrated that the FANCA and FANCC proteins bind and form a nuclear complex. In the current study, we identified a homozygous mutation in the FANCA gene (3329A>C) in an Egyptian FA patient from a consanguineous family. This mutant FANCA allele is predicted to encode a mutant FANCA protein, FANCA(H1110P), in which histidine 1110 is changed to proline. Initially, we characterized the FANCA(H1110P) protein, expressed in an Epstein Barr virus (EBV)-immortalized lymphoblast line derived from the patient. Unlike wild-type FANCA protein expressed in normal lymphoblasts, FANCA(H1110P) was not phosphorylated and failed to bind to FANCC. To test directly the effect of this mutation on FANCA function, we used retroviral-mediated transduction to express either wild-type FANCA or FANCA(H1110P) protein in the FA-A fibroblast line, GM6914. Unlike wild-type FANCA, the mutant protein failed to complement the mitomycin C sensitivity of these cells. In addition, the FANCA(H1110P) protein was defective in nuclear accumulation in the transduced cells. The characteristics of this mutant protein underscore the importance of FANCA phosphorylation, FANCA/FANCC binding, and nuclear accumulation in the function of the FA pathway.

An interval-valued reliability model with bounded failure rates

DEFF Research Database (Denmark)

Kozine, Igor; Krymsky, Victor

2012-01-01

The approach to deriving interval-valued reliability measures described in this paper is distinctive from other imprecise reliability models in that it overcomes the issue of having to impose an upper bound on time to failure. It rests on the presupposition that a constant interval-valued failure...... rate is known possibly along with other reliability measures, precise or imprecise. The Lagrange method is used to solve the constrained optimization problem to derive new reliability measures of interest. The obtained results call for an exponential-wise approximation of failure probability density...

Functional form comparison between the population and the individual Poisson based TCP models

International Nuclear Information System (INIS)

Schinkel, C.; Stavreva, N.; Stavrev, P.; Carlone, M.; Fallone, B.G.

2007-01-01

In this work, the functional form similarity between the individual and fundamental population TCP models is investigated. Using the fact that both models can be expressed in terms of the geometric parameters γ 50 and D 50 , we show that they have almost identical functional form for values of γ 50 ≥1. The conceptual inadequacy of applying an individual model to clinical data is also discussed. A general individual response TCP expression is given, parameterized by D f and γ f - the dose corresponding to a control level of f, and the normalized slope at that point. It is shown that the dose-response may be interpreted as an individual response only if γ 50 is sufficiently high. Based on the functional form equivalency between the individual and the population TCP models, we discuss the possibility of applying the individual TCP model for the case of heterogeneous irradiations. Due to the fact that the fundamental population TCP model is derived for homogeneous irradiations only, we propose the use of the EUD, given by the generalized mean dose, when the fundamental population TCP model is used to fit clinical data. (author)

Simultaneous Estimation of Ibuprofen and Phenylephrine Hydrochloride in Bulk and Combined Dosage Form by First Derivative UV Spectrophotometry Method

Directory of Open Access Journals (Sweden)

Mehul Patel

2013-01-01

Full Text Available A simple, precise, rapid, and economic method was developed for the simultaneous determination of Ibuprofen and Phenylephrine HCl in bulk and combined dosage form. This method involves first-order derivative spectroscopy using 248 nm and 237 nm as zero crossing points for Ibuprofen and Phenylephrine HCl, respectively. For spectrophotometric method 0.1 N NaOH was used as a solvent. The linearity was established over the concentration range of 12–72 μg/mL and 1.5–22 μg/mL for Ibuprofen and Phenylephrine HCl with correlation coefficient (r2 of 0.9972 and 0.9981, respectively. The mean % recoveries were found to be in the range of 98.88% and 98.54% for Ibuprofen and Phenylephrine HCl, respectively. Interday and intraday studies showed repeatability of the method. The method was found to be specific and robust. The method was successfully applied to pharmaceutical formulation, with no interference from excipients as indicated by the recovery study. Results of analysis were validated statistically and by recovery studies.

Evaluation of the Precision of Satellite-Derived Sea Surface Temperature Fields

Science.gov (United States)

Wu, F.; Cornillon, P. C.; Guan, L.

2016-02-01

A great deal of attention has been focused on the temporal accuracy of satellite-derived sea surface temperature (SST) fields with little attention being given to their spatial precision. Specifically, the primary measure of the quality of SST fields has been the bias and variance of selected values minus co-located (in space and time) in situ values. Contributing values, determined by the location of the in situ values and the necessity that the satellite-derived values be cloud free, are generally widely separated in space and time hence provide little information related to the pixel-to-pixel uncertainty in the retrievals. But the main contribution to the uncertainty in satellite-derived SST retrievals relates to atmospheric contamination and because the spatial scales of atmospheric features are, in general, large compared with the pixel separation of modern infra-red sensors, the pixel-to-pixel uncertainty is often smaller than the accuracy determined from in situ match-ups. This makes selection of satellite-derived datasets for the study of submesoscale processes, for which the spatial structure of the upper ocean is significant, problematic. In this presentation we present a methodology to characterize the spatial precision of satellite-derived SST fields. The method is based on an examination of the high wavenumber tail of the 2-D spectrum of SST fields in the Sargasso Sea, a low energy region of the ocean close to the track of the MV Oleander, a container ship making weekly roundtrips between New York and Bermuda, with engine intake temperatures sampled every 75 m along track. Important spectral characteristics are the point at which the satellite-derived spectra separate from the Oleander spectra and the spectral slope following separation. In this presentation a number of high resolution 375 m to 10 km SST datasets are evaluated based on this approach.

Turbulence modeling with fractional derivatives: Derivation from first principles and initial results

Science.gov (United States)

Epps, Brenden; Cushman-Roisin, Benoit

2017-11-01

Fluid turbulence is an outstanding unsolved problem in classical physics, despite 120+ years of sustained effort. Given this history, we assert that a new mathematical framework is needed to make a transformative breakthrough. This talk offers one such framework, based upon kinetic theory tied to the statistics of turbulent transport. Starting from the Boltzmann equation and ``Lévy α-stable distributions'', we derive a turbulence model that expresses the turbulent stresses in the form of a fractional derivative, where the fractional order is tied to the transport behavior of the flow. Initial results are presented herein, for the cases of Couette-Poiseuille flow and 2D boundary layers. Among other results, our model is able to reproduce the logarithmic Law of the Wall in shear turbulence.

Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

International Nuclear Information System (INIS)

Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D.M.; Conway, Barbara R.; Timmins, Peter

2007-01-01

We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2 NC(CH 3 ) 3- n (CH 2 OH) n , with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family (n=0, 1, 2), but significantly contrasting structural properties for the member with n=3. - Graphical abstract: Structural properties of a family of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine are discussed and rationalized

On derived groups of division rings II

International Nuclear Information System (INIS)

Mahdavi Hezavehi, M.; Akbari Feyzaabaadi, S.; Mehraabaadi, M.; Hajie Abolhassan, H.

1995-05-01

Let D be a division ring with centre F and denote by D' the derived group (commutator subgroup) of D * = D - {0}. It is shown that if each element of D' is algebraic over F, then D is algebraic over F. It is also proved that each finite separable extension of F in D is of the form F(c) for some element c in the derived group D'. Using these results, it is shown that if each element of the derived group D' is of bounded degree over F, then D is finite dimensional over F. (author). 5 refs

Locating tissue collections in tissue economies--deriving value from biomedical research

DEFF Research Database (Denmark)

Tupasela, Aaro Mikael

2006-01-01

sample collections are challenged by varying conceptions of value, as well as structural factors that relate to the combination of different public population information systems in the Finnish research system. Such challenges reflect a tension in the economic aspirations of the ideology of the knowledge...

Langmuir-Blodgett Films of Graphene Derivatives

DEFF Research Database (Denmark)

Petersen, Søren Vermehren

The work presented in this PhD thesis can be divided into two main categories: 1) Syn-thesis and Langmuir-Blodgett assembly of graphene derivatives and 2) Application and characterization of graphene derivatives as an interface material in molecular electron-ics. While the first category could...... be divided further, the synthesis and Langmuir-Blodgett results are intertwined in such a way that it would be more confusing to pre-sent them separately. The Langmuir-Blodgett deposition also played a crucial, but more isolated, part in the investigation of graphene derivatives as interface material....... Solution processable graphene in the form of chemically derived graphene has been synthesized through the modified Hummers method with subsequent reduction into reduced graphene oxide with hydrazine. The completeness of oxidation, the effect of the refinement steps and the reduction of the graphene oxide...

Interpreting two state instruments for intermediary values

International Nuclear Information System (INIS)

Good, R.R.

1979-01-01

Interpolating data from instruments which produce only two distinct binary outputs is discussed. The problem of determining void fraction, given an instrument which produces only a liquid or a no-liquid output, is used to demonstrate three different methods of data interpolation. The three methods involve a form of time averaging. The methods are signal amplitude histogram, signal derivative, and signal derivative discriminator. The advantages, disadvantages, and accuracies of each method are described

Sizes of particles formed during municipal wastewater treatment.

Science.gov (United States)

Lech, Smoczynski; Marta, Kosobucka; Michal, Smoczynski; Harsha, Ratnaweera; Krystyna, Pieczulis-Smoczynska

2017-02-01

Volumetric diameters Dv and specific surface area SpS of sludge particles formed during chemical coagulation and electrocoagulation of sewage were determined. The obtained aggregate-flocs differed substantially in both Dv and SpS values. The differences in Dv and SpS values of the analyzed particles were interpreted based on theoretical models for expanding aggregates. The most uniform particles were formed under exposure to: (a) optimal and maximal doses of PIX, (b) optimal doses of PAX, (c) maximal doses of the Al electro-coagulant. The lowest PIX dose produced the least uniform particles. Sludge aggregates-particles produced under exposure to minimal doses of PIX and the Al electro-coagulant were characterized by the lowest SpS values. Sludge particles coagulated by PAX and the particles formed at higher doses of PIX and the Al electro-coagulant had higher SpS values. The particles formed at all doses of the applied coagulants and electro-coagulants were generally classified into two size ranges: the main range and the secondary range. Most particles belonged to the main size range. An increase in the percentage of colloidal hydroxide particles in sewage sludge increased SpS.

Forming of political opinion and decision

International Nuclear Information System (INIS)

Urban, K.

1980-01-01

Taking the SNR-300 reactor in Kalkar as an example, the process of forming of political opinion and decision is reconstructed in order to get a picture of typical consensus- and conflict patterns in the discussion of safety problems. On this basis, it should be possible to derive a freedom of action for the political and administrative managing of safety matters by means of feed back with social groups. As a crucial point the aspects concerning the steps of the forming of political opinion and decision are examined. (DG) [de

Two dechlorinated chlordecone derivatives formed by in situ chemical reduction are devoid of genotoxicity and mutagenicity and have lower proangiogenic properties compared to the parent compound.

Science.gov (United States)

Legeay, Samuel; Billat, Pierre-André; Clere, Nicolas; Nesslany, Fabrice; Bristeau, Sébastien; Faure, Sébastien; Mouvet, Christophe

2018-05-01

Chlordecone (CLD) is a chlorinated hydrocarbon insecticide, now classified as a persistent organic pollutant. Several studies have previously reported that chronic exposure to CLD leads to hepatotoxicity, neurotoxicity, raises early child development and pregnancy complications, and increases the risk of liver and prostate cancer. In situ chemical reduction (ISCR) has been identified as a possible way for the remediation of soils contaminated by CLD. In the present study, the objectives were (i) to evaluate the genotoxicity and the mutagenicity of two CLD metabolites formed by ISCR, CLD-5a-hydro, or CLD-5-hydro (5a- or 5- according to CAS nomenclature; CLD-1Cl) and tri-hydroCLD (CLD-3Cl), and (ii) to explore the angiogenic properties of these molecules. Mutagenicity and genotoxicity were investigated using the Ames's technique on Salmonella typhimurium and the in vitro micronucleus micromethod with TK6 human lymphoblastoid cells. The proangiogenic properties were evaluated on the in vitro capillary network formation of human primary endothelial cells. Like CLD, the dechlorinated derivatives of CLD studied were devoid of genotoxic and mutagenic activity. In the assay targeting angiogenic properties, significantly lower microvessel lengths formed by endothelial cells were observed for the CLD-3Cl-treated cells compared to the CLD-treated cells for two of the three tested concentrations. These results suggest that dechlorinated CLD derivatives are devoid of mutagenicity and genotoxicity and have lower proangiogenic properties than CLD.

A QQ→QQ planar double box in canonical form

Directory of Open Access Journals (Sweden)

Marco S. Bianchi

2018-02-01

Full Text Available We consider a planar double box with four massive external momenta and two massive internal propagators. We derive the system of differential equations for the relevant master integrals, cast it in canonical form, write it as a dlog form and solve it in terms of iterated integrals up to depth four.

Hedging Yield with Weather Derivatives: A Role for Options

OpenAIRE

Manfredo, Mark R.; Richards, Timothy J.

2005-01-01

While there are few risk management alternatives available to specialty crop growers, weather derivatives provide an important advancement. As with the use of any derivatives contract, the behavior of the basis will ultimately determine the net-hedged outcome. However, when using weather derivatives to hedge yield risks for specialty crops, growers face a unique form of basis risk because weather (temperature) and yield are nonlinearly related. Using the forecast encompassing principle, this ...

Methods of valuing air pollution and estimated monetary values of air pollutants in various U.S. regions

Energy Technology Data Exchange (ETDEWEB)

Wang, M.Q.; Santini, D.J.; Warinner, S.A.

1994-12-01

Air pollutant emission values are used to determine the social costs of various technologies that cause air pollution and to estimate the benefits of emission control technologies. In this report, the authors present two methods of estimating air pollutant emission values--the damage value method and the control cost method--and review 15 recent studies in which these methods were employed to estimate emission values. The reviewed studies derived emission values for only a limited number of areas; emission value estimates are needed for other US regions. Using the emission values estimated in the reviewed studies, they establish regression relationships between emission values, air pollutant concentrations, and total population exposed, and apply the established relationships to 17 US metropolitan areas to estimate damage-based and control-cost-based emission values for reactive organic gases, nitrogen oxides, particulate matter measuring less than 10 microns, sulfur oxides, and carbon monoxide in these areas. Their estimates show significant variations in emission values across the 17 regions.

Investigation of the Dirac Equation by Using the Conformable Fractional Derivative

Science.gov (United States)

Mozaffari, F. S.; Hassanabadi, H.; Sobhani, H.; Chung, W. S.

2018-05-01

In this paper,the Dirac equation is constructed using the conformable fractional derivative so that in its limit for the fractional parameter, the normal version is recovered. Then, the Cornell potential is considered as the interaction of the system. In this case, the wave function and the energy eigenvalue equation are derived with the aim of the bi-confluent Heun functions. use of the conformable fractional derivative is proven to lead to a branching treatment for the energy of the system. Such a treatment is obvious for small values of the fractional parameter, and a united value as the fractional parameter approaches unity.

Derivative-Based Trapezoid Rule for the Riemann-Stieltjes Integral

Directory of Open Access Journals (Sweden)

Weijing Zhao

2014-01-01

Full Text Available The derivative-based trapezoid rule for the Riemann-Stieltjes integral is presented which uses 2 derivative values at the endpoints. This kind of quadrature rule obtains an increase of two orders of precision over the trapezoid rule for the Riemann-Stieltjes integral and the error term is investigated. At last, the rationality of the generalization of derivative-based trapezoid rule for Riemann-Stieltjes integral is demonstrated.

Weather Derivatives – Origin, Types and Application

Directory of Open Access Journals (Sweden)

Piotr Binkowski

2008-01-01

Full Text Available The number of companies that are exposed to the revenues loss risk caused by weather variability is still increasing. The businesses that are mostly exposed to weather risk are following: energy, agriculture, constructions and transport. That situation has initiated dynamic growth of weather derivatives markets as well as the awareness of the weather risk among the market participants. Presently, the weather derivatives markets evaluate rapidly in all the mature economies: USA, Asia and Europe. Constructing weather derivatives relies on qu- antifying climate factors in the form of indexes, what is quite simple task, more difficultly can be gathering precise historical data of required climate factors. Taking into consideration so far development of derivatives especially the financial derivatives based on different types of indexes financial market has at disposal wide range of different types of proved derivatives (futures, forward, options, swaps, which can be successfully utilised on the weather-driven markets both for hedging weather risk and speculating.

Three-Dimensional Numerical Simulation of Plate Forming by Line Heating

DEFF Research Database (Denmark)

Clausen, Henrik Bisgaard

1999-01-01

addressed the problem of simulating the process, and although very few have been successful in gaining accurate results valuable information about the mechanics have been derived. However, the increasing power of computers now allows for numerical simulations of the forming process using a three......Line Heating is the process of forming (steel) plates into shape by means of localised heating often along a line. Though any focussed heat source will do, the inexpensive and widely available oxyacettylene gas torch is commonly applied in ship production.Over the years, many researchers have......-dimensional thermo-mechanical model. Although very few have been successful in gaining accurate results valuable information about the mechanics has been derived. However, the increasing power of computers now allows for numerical simulations of the forming process using a three-dimensional thermo-mechanical model....

Meteorite Dichotomy Implies that Jupiter Formed Early

Science.gov (United States)

Kruijer, T. S.; Burkhardt, C.; Budde, G.; Kleine, T.

2018-05-01

Meteorites derive from two distinct nebular reservoirs that co-existed and remained spatially separated between 1 and 3–4 Ma after CAIs. This can most easily be explained if Jupiter acted as a barrier and formed early, within less than 1 Ma.

Conference Proceedings: Effectively utilizing energy derivatives in a deregulated electricity market

International Nuclear Information System (INIS)

1998-01-01

This conference was devoted to a discussion about the likely impacts of deregulation on electricity markets in North America. Many of the presentations emphasized price risk in a competitive open access energy market. It was noted that deregulation is frequently associated with the creation of larger companies, higher risks and lower costs. Some of the individual topics addressed by the speakers included discussion of : (1) how underlying physical markets will work in Ontario, (2) experiences in derivative trading in the natural gas industry, (3) how to create value through multiple commodity risk management products, (4) trading with energy derivatives in the U.S. (5) how derivatives can add value for municipal electrical utilities, and (6) risk management mechanisms for energy derivative trading. refs., tabs., figs

Radiation damage studies related to nuclear waste forms

International Nuclear Information System (INIS)

Gray, W.J.; Wald, J.W.; Turcotte, R.P.

1981-12-01

Much of the previously reported work on alpha radiation effects on crystalline phases of importance to nuclear waste forms has been derived from radiation effects studies of composite waste forms. In the present work, two single-phase crystalline materials, Gd 2 Ti 2 O 7 (pyrochlore) and CaZrTi 2 O 7 (zirconolite), of relative importance to current waste forms were studied independently by doping with 244 Cm at the 3 wt % level. Changes in the crystalline structure measured by x-ray diffraction as a function of dose show that damage ingrowth follows an expected exponential relationship of the form ΔV/V 0 = A[1-exp(-BD)]. In both cases, the materials became x-ray amorphous before the estimated saturation value was reached. The predicted magnitudes of the unit cell volume changes at saturation are 5.4% and 3.5%, respectively, for Gd 2 Ti 2 O 7 and CaZrTi 2 O 7 . The later material exhibited anisotropic behavior in which the expansion of the monoclinic cell in the c 0 direction was over five times that of the a 0 direction. The effects of transmutations on the properties of high-level waste solids have not been studied until now because of the long half-lives of the important fission products. This problem was circumvented in the present study by preparing materials containing natural cesium and then irradiating them with neutrons to produce 134 Cs, which has only a 2y half-life. The properties monitored at about one year intervals following irradiation have been density, leach rate and microstructure. A small amount of x-ray diffraction work has also been done. Small changes in density and leach rate have been observed for some of the materials, but they were not large enough to be of any consequence for the final disposal of high level wastes

Human rights values or cultural values? Pursuing values to maintain positive discipline in multicultural schools

Directory of Open Access Journals (Sweden)

Petro du Preez

2010-01-01

Full Text Available Discussions on discipline in education often accentuate corporal punishment or measures to infuse moral fibre. In addition, many authors argue that inculcating a particular value system can promote discipline in schools. This could however be profoundly problematic in the light of the Constitution. We argue that positive discipline in multicultural school environments needs to be based in part on human rights values that are neither solely universally interpreted nor particularistically interpreted. We report on the data generated at a research workshop held as the final dissemination process of a four-year international research project entitled "Understanding human rights through different belief systems: intercultural and interreligious dialogue". Dialogue was chosen as a form of data gathering since it is more spontaneous than conventional questioning techniques and can thus generate more naturally occurring data to strengthen the outcomes of the project. It appears that some teachers believe discipline can only be maintained through the elevation of cultural values (particularism. We argue that schools should start negotiating, at the most basic level, the values, including emancipatory, human rights values, and cultural values, which could underpin positive discipline in multicultural schools. Drawing solely on cultural values is not only unlikely to solve the problem of discipline, but could also undermine the efforts to transform our diverse, democratic society.

Synthesis of nanodiamond derivatives carrying amino functions and quantification by a modified Kaiser test

Directory of Open Access Journals (Sweden)

Gerald Jarre

2014-11-01

Full Text Available Nanodiamonds functionalized with different organic moieties carrying terminal amino groups have been synthesized. These include conjugates generated by Diels–Alder reactions of ortho-quinodimethanes formed in situ from pyrazine and 5,6-dihydrocyclobuta[d]pyrimidine derivatives. For the quantification of primary amino groups a modified photometric assay based on the Kaiser test has been developed and validated for different types of aminated nanodiamond. The results correspond well to values obtained by thermogravimetry. The method represents an alternative wet-chemical quantification method in cases where other techniques like elemental analysis fail due to unfavourable combustion behaviour of the analyte or other impediments.

Fossil fuel derivatives with reduced carbon. Phase I final report

Energy Technology Data Exchange (ETDEWEB)

Kennel, E.B.; Zondlo, J.W.; Cessna, T.J.

1999-06-30

This project involves the simultaneous production of clean fossil fuel derivatives with reduced carbon and sulfur, along with value-added carbon nanofibers. This can be accomplished because the nanofiber production process removes carbon via a catalyzed pyrolysis reaction, which also has the effect of removing 99.9% of the sulfur, which is trapped in the nanofibers. The reaction is mildly endothermic, meaning that net energy production with real reductions in greenhouse emissions are possible. In Phase I research, the feasibility of generating clean fossil fuel derivatives with reduced carbon was demonstrated by the successful design, construction and operation of a facility capable of utilizing coal as well as natural gas as an inlet feedstock. In the case of coal, for example, reductions in CO{sub 2} emissions can be as much as 70% (normalized according to kilowatts produced), with the majority of carbon safely sequestered in the form of carbon nanofibers or coke. Both of these products are value-added commodities, indicating that low-emission coal fuel can be done at a profit rather than a loss as is the case with most clean-up schemes. The main results of this project were as follows: (1) It was shown that the nanofiber production process produces hydrogen as a byproduct. (2) The hydrogen, or hydrogen-rich hydrocarbon mixture can be consumed with net release of enthalpy. (3) The greenhouse gas emissions from both coal and natural gas are significantly reduced. Because coal consumption also creates coke, the carbon emission can be reduced by 75% per kilowatt-hour of power produced.

Reward value determines memory consolidation in parasitic wasps.

Science.gov (United States)

Kruidhof, H Marjolein; Pashalidou, Foteini G; Fatouros, Nina E; Figueroa, Ilich A; Vet, Louise E M; Smid, Hans M; Huigens, Martinus E

2012-01-01

Animals can store learned information in their brains through a series of distinct memory forms. Short-lasting memory forms can be followed by longer-lasting, consolidated memory forms. However, the factors determining variation in memory consolidation encountered in nature have thus far not been fully elucidated. Here, we show that two parasitic wasp species belonging to different families, Cotesia glomerata (Hymenoptera: Braconidae) and Trichogramma evanescens (Hymenoptera; Trichogrammatidae), similarly adjust the memory form they consolidate to a fitness-determining reward: egg-laying into a host-insect that serves as food for their offspring. Protein synthesis-dependent long-term memory (LTM) was consolidated after single-trial conditioning with a high-value host. However, single-trial conditioning with a low-value host induced consolidation of a shorter-lasting memory form. For Cotesia glomerata, we subsequently identified this shorter-lasting memory form as anesthesia-resistant memory (ARM) because it was not sensitive to protein synthesis inhibitors or anesthesia. Associative conditioning using a single reward of different value thus induced a physiologically different mechanism of memory formation in this species. We conclude that the memory form that is consolidated does not only change in response to relatively large differences in conditioning, such as the number and type of conditioning trials, but is also sensitive to more subtle differences, such as reward value. Reward-dependent consolidation of exclusive ARM or LTM provides excellent opportunities for within-species comparison of mechanisms underlying memory consolidation.

Volume-preserving normal forms of Hopf-zero singularity

International Nuclear Information System (INIS)

Gazor, Majid; Mokhtari, Fahimeh

2013-01-01

A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto–Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple. (paper)

Volume-preserving normal forms of Hopf-zero singularity

Science.gov (United States)

Gazor, Majid; Mokhtari, Fahimeh

2013-10-01

A practical method is described for computing the unique generator of the algebra of first integrals associated with a large class of Hopf-zero singularity. The set of all volume-preserving classical normal forms of this singularity is introduced via a Lie algebra description. This is a maximal vector space of classical normal forms with first integral; this is whence our approach works. Systems with a nonzero condition on their quadratic parts are considered. The algebra of all first integrals for any such system has a unique (modulo scalar multiplication) generator. The infinite level volume-preserving parametric normal forms of any nondegenerate perturbation within the Lie algebra of any such system is computed, where it can have rich dynamics. The associated unique generator of the algebra of first integrals are derived. The symmetry group of the infinite level normal forms are also discussed. Some necessary formulas are derived and applied to appropriately modified Rössler and generalized Kuramoto-Sivashinsky equations to demonstrate the applicability of our theoretical results. An approach (introduced by Iooss and Lombardi) is applied to find an optimal truncation for the first level normal forms of these examples with exponentially small remainders. The numerically suggested radius of convergence (for the first integral) associated with a hypernormalization step is discussed for the truncated first level normal forms of the examples. This is achieved by an efficient implementation of the results using Maple.

Second derivative spectrophotometric determination of ...

African Journals Online (AJOL)

A new, simple, rapid, wide applicable range and reliable second derivative spectrophotometric method has been developed for determination of cyclophosphamide (CP) in bulk and pharmaceutical dosage forms. Calibration graph is linear in the concentration range of 25 - 200 μg/ml of CP with 10 μg/ml of detection limit and ...

Enthalpies of Formation of Hydrazine and Its Derivatives.

Science.gov (United States)

Dorofeeva, Olga V; Ryzhova, Oxana N; Suchkova, Taisiya A

2017-07-20

Enthalpies of formation, Δ f H 298 ° , in both the gas and condensed phase, and enthalpies of sublimation or vaporization have been estimated for hydrazine, NH 2 NH 2 , and its 36 various derivatives using quantum chemical calculations. The composite G4 method has been used along with isodesmic reaction schemes to derive a set of self-consistent high-accuracy gas-phase enthalpies of formation. To estimate the enthalpies of sublimation and vaporization with reasonable accuracy (5-20 kJ/mol), the method of molecular electrostatic potential (MEP) has been used. The value of Δ f H 298 ° (NH 2 NH 2 ,g) = 97.0 ± 3.0 kJ/mol was determined from 75 isogyric reactions involving about 50 reference species; for most of these species, the accurate Δ f H 298 ° (g) values are available in Active Thermochemical Tables (ATcT). The calculated value is in excellent agreement with the reported results of the most accurate models based on coupled cluster theory (97.3 kJ/mol, the average of six calculations). Thus, the difference between the values predicted by high-level theoretical calculations and the experimental value of Δ f H 298 ° (NH 2 NH 2 ,g) = 95.55 ± 0.19 kJ/mol recommended in the ATcT and other comprehensive reference sources is sufficiently large and requires further investigation. Different hydrazine derivatives have been also considered in this work. For some of them, both the enthalpy of formation in the condensed phase and the enthalpy of sublimation or vaporization are available; for other compounds, experimental data for only one of these properties exist. Evidence of accuracy of experimental data for the first group of compounds was provided by the agreement with theoretical Δ f H 298 ° (g) value. The unknown property for the second group of compounds was predicted using the MEP model. This paper presents a systematic comparison of experimentally determined enthalpies of formation and enthalpies of sublimation or vaporization with the results of

Deriving a model for influenza epidemics from historical data.

Energy Technology Data Exchange (ETDEWEB)

Ray, Jaideep; Lefantzi, Sophia

2011-09-01

In this report we describe how we create a model for influenza epidemics from historical data collected from both civilian and military societies. We derive the model when the population of the society is unknown but the size of the epidemic is known. Our interest lies in estimating a time-dependent infection rate to within a multiplicative constant. The model form fitted is chosen for its similarity to published models for HIV and plague, enabling application of Bayesian techniques to discriminate among infectious agents during an emerging epidemic. We have developed models for the progression of influenza in human populations. The model is framed as a integral, and predicts the number of people who exhibit symptoms and seek care over a given time-period. The start and end of the time period form the limits of integration. The disease progression model, in turn, contains parameterized models for the incubation period and a time-dependent infection rate. The incubation period model is obtained from literature, and the parameters of the infection rate are fitted from historical data including both military and civilian populations. The calibrated infection rate models display a marked difference in which the 1918 Spanish Influenza pandemic differed from the influenza seasons in the US between 2001-2008 and the progression of H1N1 in Catalunya, Spain. The data for the 1918 pandemic was obtained from military populations, while the rest are country-wide or province-wide data from the twenty-first century. We see that the initial growth of infection in all cases were about the same; however, military populations were able to control the epidemic much faster i.e., the decay of the infection-rate curve is much higher. It is not clear whether this was because of the much higher level of organization present in a military society or the seriousness with which the 1918 pandemic was addressed. Each outbreak to which the influenza model was fitted yields a separate set of

Value Creation in Knowledge Networks

DEFF Research Database (Denmark)

Hansen, Magnus Rotvit Perlt; Pries-Heje, Jan

2017-01-01

Knowledge networks enable businesses to enhance their levels of innovation and market competitiveness. In this paper, we propose five principles for designing IT tools that can support the facilitation and improvement of knowledge networks. We also introduce a new value proposition that constitutes...... a nascent design theory in the domain of knowledge network improvement. The design principles are derived from an iterative process applied in three different case settings. In each case, we apply and evaluate the network nexus tool to determine whether the knowledge network provides value to its...

Dietary reference values for thiamin

DEFF Research Database (Denmark)

Sjödin, Anders Mikael

2016-01-01

Following a request from the European Commission, the EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) derived dietary reference values (DRVs) for thiamin (vitamin B1). The Panel considers that data from depletion–repletion studies in adults on the amount of dietary thiamin intake...... were measured. Results from other depletion–repletion studies are in agreement with this value. The Panel agrees on the coefficient of variation of 20% used by the SCF to cover uncertainties related to distribution of thiamin requirements in the general population, and endorses the population reference...

The synthesis of a water-soluble derivative of rutin as an antiradical agent

Energy Technology Data Exchange (ETDEWEB)

Pedriali, Carla Aparecida; Fernandes, Adjaci Uchoa [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Dept. de Bioquimica]. E-mail: capedriali@hotmail.com; Bernusso, Leandra de Cassia; Polakiewicz, Bronislaw [Universidade de Sao Paulo (USP), SP (Brazil). Faculdade de Ciencias Farmaceuticas. Dept. de Tecnologia Bioquimico-Farmaceutica

2008-07-01

The purpose of this study was to synthesize a water-soluble derivative of rutin (compound 2) by introducing carboxylate groups on rutin's sugar moiety. The rutin derivative showed an almost 100-fold solubility increase in water. The antiradical capacity of compound 2 was evaluated using the luminol/AAPH system, and the derivative's activity was 1.5 times greater than that of Trolox. Despite the derivative's high solubility in water (log P = -1.13), lipid peroxidation of brain homogenate membranes was very efficiently inhibited (inhibition values were only 19% lower than the inhibition values of rutin). (author)

The synthesis of a water-soluble derivative of rutin as an antiradical agent

International Nuclear Information System (INIS)

Pedriali, Carla Aparecida; Fernandes, Adjaci Uchoa; Bernusso, Leandra de Cassia; Polakiewicz, Bronislaw

2008-01-01

The purpose of this study was to synthesize a water-soluble derivative of rutin (compound 2) by introducing carboxylate groups on rutin's sugar moiety. The rutin derivative showed an almost 100-fold solubility increase in water. The antiradical capacity of compound 2 was evaluated using the luminol/AAPH system, and the derivative's activity was 1.5 times greater than that of Trolox. Despite the derivative's high solubility in water (log P = -1.13), lipid peroxidation of brain homogenate membranes was very efficiently inhibited (inhibition values were only 19% lower than the inhibition values of rutin). (author)

Local survey of the distribution of industrial melanic forms in the moth Biston betularia and estimates of the selective values of these in an industrial environment

Energy Technology Data Exchange (ETDEWEB)

Clarke, C A; Sheppard, P M

1966-01-01

A survey has shown that there is a rapid decline in the frequency of the industrial melanic carbonaria of the moth Biston betularia from a value of about 97% in Liverpool to less than 10% 50 miles to the west in North Wales. The decline in the frequency of the intermediate phenotype insularia in this area, controlled by an allelomorph at the same locus, is from about 14% on the Wirral (no reliable frequency is available for Liverpool) to about 4% 30 miles to the west. Experiments using dead moths placed in life-like positions on tree trunks at Caldy and in Liverpool confirmed that carbonaria is better camouflaged on the blackened tree trunks of industrial areas. Estimates of the selective disadvantage of the typical form in Liverpool, using data from the survey and these experiments, together with a variety of assumptions, indicate values of the order of 60%, which is somewhat higher than previous estimates. At Caldy the typical form appears to have been at a disadvantage of about 50% prior to the introduction of the smokeless zones and is now at about a 20% disadvantage, using assumptions similar to those in the Liverpool estimates. Although these estimates are subject to considerable error, there is little doubt that they reflect the correct order of magnitude of the relative selective values. 8 references, 1 figure, 4 tables.

A spatial structural derivative model for ultraslow diffusion

Directory of Open Access Journals (Sweden)

Xu Wei

2017-01-01

Full Text Available This study investigates the ultraslow diffusion by a spatial structural derivative, in which the exponential function ex is selected as the structural function to construct the local structural derivative diffusion equation model. The analytical solution of the diffusion equation is a form of Biexponential distribution. Its corresponding mean squared displacement is numerically calculated, and increases more slowly than the logarithmic function of time. The local structural derivative diffusion equation with the structural function ex in space is an alternative physical and mathematical modeling model to characterize a kind of ultraslow diffusion.

Accuracies of genomic breeding values in American Angus beef cattle using K-means clustering for cross-validation.

Science.gov (United States)

Saatchi, Mahdi; McClure, Mathew C; McKay, Stephanie D; Rolf, Megan M; Kim, JaeWoo; Decker, Jared E; Taxis, Tasia M; Chapple, Richard H; Ramey, Holly R; Northcutt, Sally L; Bauck, Stewart; Woodward, Brent; Dekkers, Jack C M; Fernando, Rohan L; Schnabel, Robert D; Garrick, Dorian J; Taylor, Jeremy F

2011-11-28

Genomic selection is a recently developed technology that is beginning to revolutionize animal breeding. The objective of this study was to estimate marker effects to derive prediction equations for direct genomic values for 16 routinely recorded traits of American Angus beef cattle and quantify corresponding accuracies of prediction. Deregressed estimated breeding values were used as observations in a weighted analysis to derive direct genomic values for 3570 sires genotyped using the Illumina BovineSNP50 BeadChip. These bulls were clustered into five groups using K-means clustering on pedigree estimates of additive genetic relationships between animals, with the aim of increasing within-group and decreasing between-group relationships. All five combinations of four groups were used for model training, with cross-validation performed in the group not used in training. Bivariate animal models were used for each trait to estimate the genetic correlation between deregressed estimated breeding values and direct genomic values. Accuracies of direct genomic values ranged from 0.22 to 0.69 for the studied traits, with an average of 0.44. Predictions were more accurate when animals within the validation group were more closely related to animals in the training set. When training and validation sets were formed by random allocation, the accuracies of direct genomic values ranged from 0.38 to 0.85, with an average of 0.65, reflecting the greater relationship between animals in training and validation. The accuracies of direct genomic values obtained from training on older animals and validating in younger animals were intermediate to the accuracies obtained from K-means clustering and random clustering for most traits. The genetic correlation between deregressed estimated breeding values and direct genomic values ranged from 0.15 to 0.80 for the traits studied. These results suggest that genomic estimates of genetic merit can be produced in beef cattle at a young age but

The third-order nonlinear optical susceptibility of C{sub 60}-derived nanotubes

Energy Technology Data Exchange (ETDEWEB)

Xiangang, Wan [Nanjing Univ. (China). National Lab. of Solid State Microstructures; [Center for Advanced Studies in Science and Technology of Microstructures, Nanjing (China); Jinming, Dong [Nanjing Univ. (China). National Lab. of Solid State Microstructures; [Center for Advanced Studies in Science and Technology of Microstructures, Nanjing (China); Jie, Jiang [Nanjing Univ., JS (China). Dept. of Physics; Xing, D Y [Nanjing Univ., JS (China). Dept. of Physics

1997-02-01

Using the extended Su-Schrieffer-Heeger (SSH) model and the sum-over-state (SOS) method, we have calculated the third-order nonlinear polarizability {gamma} and its dispersion spectra for C{sub 60}-derived nanotubes, which is one of the narrowest tubes. Our numerical calculations indicate that both symmetry and size of the nanotubes have great effect on the third-order nonlinear polarizability {gamma} spectra. We find that with increasing size, both static {gamma} values and dynamical response peak values increase. When the atom number of the C{sub 60}-derived nanotubes is 140, the static {gamma} value is about 65 times larger than that of C{sub 60}, and the highest peak value of {gamma} (at 3{omega} = 3.52 eV) is about three orders larger than that of C{sub 60}. So, C{sub 60}-derived nanotubes may become a kind of good nonlinear optical materials. (orig.)

Spectrophotometric study of the protonation processes of some indole derivatives in sulfuric acid

Directory of Open Access Journals (Sweden)

GORAN M. STOJKOVIC

1999-12-01

Full Text Available The protonation of 3-methylindole, D-tryptophan, 3-formylindole, 3-acetylindole and indolyl-2-carboxylic acid in sulfuric acid media was studied by UV spectro-scopy. The measurement of the absorbance at four selected wavelengths enabled the calculation of the corresponding molar absorptivities. The results were used to calculate the pKa value of the protonated form of the indole derivatives by the Hammett Method. The Hammett postulate (the slope of the plot log [c(BH+/c(B] vs. H should be equal to 1 was tested. The dissociation constants and solvent parameter m* were also obtained by applying the Excess Acidity Method. The position of the additional protons in the protonated compounds is discussed.

Cu-catalyzed aerobic oxidative cyclizations of 3-N-hydroxyamino-1,2-propadienes with alcohols, thiols, and amines to form α-O-, S-, and N-substituted 4-methylquinoline derivatives.

Science.gov (United States)

Sharma, Pankaj; Liu, Rai-Shung

2015-03-16

A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Free Abelian 2-form gauge theory: BRST approach

International Nuclear Information System (INIS)

Malik, R.P.

2008-01-01

We discuss various symmetry properties of the Lagrangian density of a four- (3+1)-dimensional (4D) free Abelian 2-form gauge theory within the framework of Becchi-Rouet-Stora-Tyutin (BRST) formalism. The present free Abelian gauge theory is endowed with a Curci-Ferrari type condition, which happens to be a key signature of the 4D non-Abelian 1-form gauge theory. In fact, it is due to the above condition that the nilpotent BRST and anti-BRST symmetries of our present theory are found to be absolutely anticommuting in nature. For the present 2-form theory, we discuss the BRST, anti-BRST, ghost and discrete symmetry properties of the Lagrangian densities and derive the corresponding conserved charges. The algebraic structure, obeyed by the above conserved charges, is deduced and the constraint analysis is performed with the help of physicality criteria, where the conserved and nilpotent (anti-)BRST charges play completely independent roles. These physicality conditions lead to the derivation of the above Curci-Ferrari type restriction, within the framework of the BRST formalism, from the constraint analysis. (orig.)

Semantic False Memories in the Form of Derived Relational Intrusions Following Training

Science.gov (United States)

Guinther, Paul M.; Dougher, Michael J.

2010-01-01

Contemporary behavior analytic research is making headway in characterizing memory phenomena that typically have been characterized by cognitive models, and the current study extends this development by producing "false memories" in the form of functional equivalence responding. A match-to-sample training procedure was administered in order to…

76 FR 4751 - Position Limits for Derivatives

Science.gov (United States)

2011-01-26

... saleable by long traders at its market value in normal cash marketing channels at the derivative contract's... Association, Futures Industry Association, GDF Suez Energy, Morgan Stanley, and NextEra Energy Power Marketing...

Synthesis, α-glucosidase inhibition and molecular docking study of coumarin based derivatives.

Science.gov (United States)

Taha, Muhammad; Shah, Syed Adnan Ali; Afifi, Muhammad; Imran, Syahrul; Sultan, Sadia; Rahim, Fazal; Khan, Khalid Mohammed

2018-04-01

We have synthesized seventeen Coumarin based derivatives (1-17), characterized by 1 HNMR, 13 CNMR and EI-MS and evaluated for α-glucosidase inhibitory potential. Among the series, all derivatives exhibited outstanding α-glucosidase inhibition with IC 50 values ranging between 1.10 ± 0.01 and 36.46 ± 0.70 μM when compared with the standard inhibitor acarbose having IC 50 value 39.45 ± 0.10 μM. The most potent derivative among the series is derivative 3 having IC 50 value 1.10 ± 0.01 μM, which are many folds better than the standard acarbose. The structure activity relationship (SAR) was mainly based upon by bring about difference of substituent's on phenyl part. Molecular docking studies were carried out to understand the binding interaction of the most active compounds. Copyright © 2018 Elsevier Inc. All rights reserved.

Generalised derived limits for radioisotopes of iodine

International Nuclear Information System (INIS)

Hughes, J.S.; Haywood, S.M.; Simmonds, J.R.

1984-04-01

Generalised Derived Limits (GDLs) are evaluated for iodine-125,129,131,132,133,134,135 in selected materials from the terrestrial and aquatic environments and for discharge to atmosphere. They are intended for use as convenient reference levels against which the results of environmental monitoring can be compared and atmospheric discharges assessed. GDLs are intended for use when the environmental contamination or discharge to atmosphere is less than about 5% of the GDL. If the level of environmental contamination or discharge to the atmosphere exceeds this percentage of the GDL it does not necessarily mean that the dose equivalents to members of the public are approaching the dose equivalent limit. It is rather an indication that it may be appropriate to obtain a more specific derived limit for the particular situation by reviewing the values of the parameters involved in the calculation. GDL values are specified for iodine radionuclides in water, soil, grass, sediments and various foodstuffs derived from the terrestrial and aquatic environments. GDLs are also given for iodine radionuclides on terrestrial surfaces and for their discharge to atmosphere. (author)

Correlation of Resistivity Value with Geotechnical N-Value of Sedimentary Area in Nusajaya, Johor, Malaysia

Science.gov (United States)

Akip Tan, S. N. Mohd; Edy Tonnizam, M.; Saad, R.; Dan, M. F. Md; Nordiana, M. M.; Hazreek, Z. A. M.; Madun, A.

2018-04-01

Electrical resistivity survey and the geotechnical SPT blow counts (N-value) were carried out simultaneously on the tropically weathered sedimentary rock mass for an excavation project at Nusajaya, Johor, Malaysia. This study aims to determine subsurface profile by using 2D-resistivity methods and correlate with N-value derived from boring works. Four boreholes were investigated in five survey lines that revealed the site is underlain by moderately to completely weathered sandstone, clay, silt and shale. Data analysis from 2D-resistivity image shows that zones with high resistivity value generally have high N-value, and vice versa. Five zones have inversed the proportional relation between N-value and resistivity Ωm value due to different types of soil lithology. It indicates that 2D-resistivity is significance to detect bodies of anomalous materials or estimating the depth of bedrock. As a conclusion, the integration of geophysical and geotechnical analysis provides a promise approach to understand some relationship concerning the subsurface subsurface ground through the combination of 2D-resistivity and N-value.

Reconstructing weak values without weak measurements

International Nuclear Information System (INIS)

Johansen, Lars M.

2007-01-01

I propose a scheme for reconstructing the weak value of an observable without the need for weak measurements. The post-selection in weak measurements is replaced by an initial projector measurement. The observable can be measured using any form of interaction, including projective measurements. The reconstruction is effected by measuring the change in the expectation value of the observable due to the projector measurement. The weak value may take nonclassical values if the projector measurement disturbs the expectation value of the observable

Acceleration of the universe, vacuum metamorphosis, and the large-time asymptotic form of the heat kernel

International Nuclear Information System (INIS)

Parker, Leonard; Vanzella, Daniel A.T.

2004-01-01

We investigate the possibility that the late acceleration observed in the rate of expansion of the Universe is due to vacuum quantum effects arising in curved spacetime. The theoretical basis of the vacuum cold dark matter (VCDM), or vacuum metamorphosis, cosmological model of Parker and Raval is reexamined and improved. We show, by means of a manifestly nonperturbative approach, how the infrared behavior of the propagator (related to the large-time asymptotic form of the heat kernel) of a free scalar field in curved spacetime leads to nonperturbative terms in the effective action similar to those appearing in the earlier version of the VCDM model. The asymptotic form that we adopt for the propagator or heat kernel at large proper time s is motivated by, and consistent with, particular cases where the heat kernel has been calculated exactly, namely in de Sitter spacetime, in the Einstein static universe, and in the linearly expanding spatially flat Friedmann-Robertson-Walker (FRW) universe. This large-s asymptotic form generalizes somewhat the one suggested by the Gaussian approximation and the R-summed form of the propagator that earlier served as a theoretical basis for the VCDM model. The vacuum expectation value for the energy-momentum tensor of the free scalar field, obtained through variation of the effective action, exhibits a resonance effect when the scalar curvature R of the spacetime reaches a particular value related to the mass of the field. Modeling our Universe by an FRW spacetime filled with classical matter and radiation, we show that the back reaction caused by this resonance drives the Universe through a transition to an accelerating expansion phase, very much in the same way as originally proposed by Parker and Raval. Our analysis includes higher derivatives that were neglected in the earlier analysis, and takes into account the possible runaway solutions that can follow from these higher-derivative terms. We find that the runaway solutions do

Initial value gravitational quadrupole radiation theorem

International Nuclear Information System (INIS)

Winicour, J.

1987-01-01

A rigorous version of the quadrupole radiation formula is derived using the characteristic initial value formulation of a general relativistic fluid space-time. Starting from initial data for a Newtonian fluid, an algorithm is presented that determines characteristic initial data for a one-parameter family of general relativistic fluid space-times. At the initial time, a one-parameter family of space-times with this initial data osculates the evolution of the Newtonian fluid and has leading order news function equal to the third time derivative of the transverse Newtonian quadrupole moment

Some continual integrals from gaussian forms

International Nuclear Information System (INIS)

Mazmanishvili, A.S.

1985-01-01

The result summary of continual integration of gaussian functional type is given. The summary contains 124 continual integrals which are the mathematical expectation of the corresponding gaussian form by the continuum of random trajectories of four types: real-valued Ornstein-Uhlenbeck process, Wiener process, complex-valued Ornstein-Uhlenbeck process and the stochastic harmonic one. The summary includes both the known continual integrals and the unpublished before integrals. Mathematical results of the continual integration carried in the work may be applied in the problem of the theory of stochastic process, approaching to the finding of mean from gaussian forms by measures generated by the pointed stochastic processes

Quasi-projective synchronization of fractional-order complex-valued recurrent neural networks.

Science.gov (United States)

Yang, Shuai; Yu, Juan; Hu, Cheng; Jiang, Haijun

2018-08-01

In this paper, without separating the complex-valued neural networks into two real-valued systems, the quasi-projective synchronization of fractional-order complex-valued neural networks is investigated. First, two new fractional-order inequalities are established by using the theory of complex functions, Laplace transform and Mittag-Leffler functions, which generalize traditional inequalities with the first-order derivative in the real domain. Additionally, different from hybrid control schemes given in the previous work concerning the projective synchronization, a simple and linear control strategy is designed in this paper and several criteria are derived to ensure quasi-projective synchronization of the complex-valued neural networks with fractional-order based on the established fractional-order inequalities and the theory of complex functions. Moreover, the error bounds of quasi-projective synchronization are estimated. Especially, some conditions are also presented for the Mittag-Leffler synchronization of the addressed neural networks. Finally, some numerical examples with simulations are provided to show the effectiveness of the derived theoretical results. Copyright © 2018 Elsevier Ltd. All rights reserved.

Beam-scanning system for determination of beam profiles and form factors in merged-beam experiments

International Nuclear Information System (INIS)

Keyser, C.J.; Froelich, H.R.; Mitchell, J.B.A.; McGowan, J.W.

1979-01-01

A beam-scanning system for a merged electron-ion beam experiment is described. This system is used to determine the horizontal and vertical beam profiles and the form factors at three different locations along the axis of the beams. Design details of the wedge-shaped scanners and the electronic circuit for obtaining beam profiles and form factors are described. The form factor derivation for merged beams is given and an expression in terms of measured quantities is derived. (author)

Infrapatellar Fat Pad: An Alternative Source of Adipose-Derived Mesenchymal Stem Cells

Directory of Open Access Journals (Sweden)

P. Tangchitphisut

2016-01-01

Full Text Available Introduction. The Infrapatellar fat pad (IPFP represents an emerging alternative source of adipose-derived mesenchymal stem cells (ASCs. We compared the characteristics and differentiation capacity of ASCs isolated from IPFP and SC. Materials and Methods. ASCs were harvested from either IPFP or SC. IPFPs were collected from patients undergoing total knee arthroplasty (TKA, whereas subcutaneous tissues were collected from patients undergoing lipoaspiration. Immunophenotypes of surface antigens were evaluated. Their ability to form colony-forming units (CFUs and their differentiation potential were determined. The ASCs karyotype was evaluated. Results. There was no difference in the number of CFUs and size of CFUs between IPFP and SC sources. ASCs isolated from both sources had a normal karyotype. The mesenchymal stem cells (MSCs markers on flow cytometry was equivalent. IPFP-ASCs demonstrated significantly higher expression of SOX-9 and RUNX-2 over ASCs isolated from SC (6.19 ± 5.56-, 0.47 ± 0.62-fold; p value = 0.047, and 17.33 ± 10.80-, 1.56 ± 1.31-fold; p value = 0.030, resp.. Discussion and Conclusion. CFU assay of IPFP-ASCs and SC-ASCs harvested by lipoaspiration technique was equivalent. The expression of key chondrogenic and osteogenic genes was increased in cells isolated from IPFP. IPFP should be considered a high quality alternative source of ASCs.

Parametric form of QCD travelling waves

OpenAIRE

Peschanski, R.

2005-01-01

We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.

Forms of global governence

Directory of Open Access Journals (Sweden)

Maxim V. Kharkevich

2014-01-01

Full Text Available Global governance as a concept defines the meaning of contemporary world politics both as a discipline and as reality. Interdependent and globalized world requires governance, and a global government has not been formed yet. The theoretical possibility of global governance without global government is proved and justified. The purpose of this article is to analytically identify possible forms of global governance. Three such forms of global governance are identified: hierarchical, market and network. In a hierarchy the governance is due to the asymmetry of power between the parties. Market control happens via anonymous pricing mechanism. Network, in contrast to the market is characterized by a closer value link between the actors, but unlike the hierarchical relationship actors are free to leave the network. Global governance takes three forms and is being implemented by different actors. To determine the most efficient form of global governance is impossible. Efficiency depends on the match between a form and an object of government. It should be noted that meta governance is likely to remain a monopoly of institutionally strong states in global governance.

Form factors of heavy mesons in QCD

International Nuclear Information System (INIS)

Shifman, M.A.; Vysotsky, M.I.

1980-01-01

Logarithmic corrections to form factors of mesons built from heavy quarks are dirived in the framework of quantum chromodynamics. The reactions e + e - → etasub(c)γ and H → J/PSIγ are considered as an example. A novel feature as compared to the well studied problem of the pion form factor is the existence of the transformations between the quark-antiquark state c anti c and the gluonic one. O(αsub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms is summed up with the help of the operator technique. Apart from already known results for quark operators some new results referring to gluon operators and their mixing with the quark ones are used. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second derivation is based on conformal symmetry considerations

Advancing Material Models for Automotive Forming Simulations

International Nuclear Information System (INIS)

Vegter, H.; An, Y.; Horn, C.H.L.J. ten; Atzema, E.H.; Roelofsen, M.E.

2005-01-01

Simulations in automotive industry need more advanced material models to achieve highly reliable forming and springback predictions. Conventional material models implemented in the FEM-simulation models are not capable to describe the plastic material behaviour during monotonic strain paths with sufficient accuracy. Recently, ESI and Corus co-operate on the implementation of an advanced material model in the FEM-code PAMSTAMP 2G. This applies to the strain hardening model, the influence of strain rate, and the description of the yield locus in these models. A subsequent challenge is the description of the material after a change of strain path.The use of advanced high strength steels in the automotive industry requires a description of plastic material behaviour of multiphase steels. The simplest variant is dual phase steel consisting of a ferritic and a martensitic phase. Multiphase materials also contain a bainitic phase in addition to the ferritic and martensitic phase. More physical descriptions of strain hardening than simple fitted Ludwik/Nadai curves are necessary.Methods to predict plastic behaviour of single-phase materials use a simple dislocation interaction model based on the formed cells structures only. At Corus, a new method is proposed to predict plastic behaviour of multiphase materials have to take hard phases into account, which deform less easily. The resulting deformation gradients create geometrically necessary dislocations. Additional micro-structural information such as morphology and size of hard phase particles or grains is necessary to derive the strain hardening models for this type of materials.Measurements available from the Numisheet benchmarks allow these models to be validated. At Corus, additional measured values are available from cross-die tests. This laboratory test can attain critical deformations by large variations in blank size and processing conditions. The tests are a powerful tool in optimising forming simulations prior

Asymptotic formulae for the Lommel and Bessel functions and their derivatives.

Science.gov (United States)

Aleksandrova, N I

2014-10-01

We derive new approximate representations of the Lommel functions in terms of the Scorer function and approximate representations of the first derivative of the Lommel functions in terms of the derivative of the Scorer function. Using the same method, we obtain previously known approximate representations of the Nicholson type for Bessel functions and their first derivatives. We study also for what values of the parameters our representations have reasonable accuracy.

On the expected value and variance for an estimator of the spatio-temporal product density function

DEFF Research Database (Denmark)

Rodríguez-Corté, Francisco J.; Ghorbani, Mohammad; Mateu, Jorge

Second-order characteristics are used to analyse the spatio-temporal structure of the underlying point process, and thus these methods provide a natural starting point for the analysis of spatio-temporal point process data. We restrict our attention to the spatio-temporal product density function......, and develop a non-parametric edge-corrected kernel estimate of the product density under the second-order intensity-reweighted stationary hypothesis. The expectation and variance of the estimator are obtained, and closed form expressions derived under the Poisson case. A detailed simulation study is presented...... to compare our close expression for the variance with estimated ones for Poisson cases. The simulation experiments show that the theoretical form for the variance gives acceptable values, which can be used in practice. Finally, we apply the resulting estimator to data on the spatio-temporal distribution...

Derived crop management data for the LandCarbon Project

Science.gov (United States)

Schmidt, Gail; Liu, Shu-Guang; Oeding, Jennifer

2011-01-01

The LandCarbon project is assessing potential carbon pools and greenhouse gas fluxes under various scenarios and land management regimes to provide information to support the formulation of policies governing climate change mitigation, adaptation and land management strategies. The project is unique in that spatially explicit maps of annual land cover and land-use change are created at the 250-meter pixel resolution. The project uses vast amounts of data as input to the models, including satellite, climate, land cover, soil, and land management data. Management data have been obtained from the U.S. Department of Agriculture (USDA) National Agricultural Statistics Service (NASS) and USDA Economic Research Service (ERS) that provides information regarding crop type, crop harvesting, manure, fertilizer, tillage, and cover crop (U.S. Department of Agriculture, 2011a, b, c). The LandCarbon team queried the USDA databases to pull historic crop-related management data relative to the needs of the project. The data obtained was in table form with the County or State Federal Information Processing Standard (FIPS) and the year as the primary and secondary keys. Future projections were generated for the A1B, A2, B1, and B2 Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) scenarios using the historic data values along with coefficients generated by the project. The PBL Netherlands Environmental Assessment Agency (PBL) Integrated Model to Assess the Global Environment (IMAGE) modeling framework (Integrated Model to Assess the Global Environment, 2006) was used to develop coefficients for each IPCC SRES scenario, which were applied to the historic management data to produce future land management practice projections. The LandCarbon project developed algorithms for deriving gridded data, using these tabular management data products as input. The derived gridded crop type, crop harvesting, manure, fertilizer, tillage, and cover crop

A Novel Interaction Between the TLR7 and a Colchicine Derivative Revealed Through a Computational and Experimental Study

Directory of Open Access Journals (Sweden)

Francesco Gentile

2018-02-01

Full Text Available The Toll-Like Receptor 7 (TLR7 is an endosomal membrane receptor involved in the innate immune system response. Its best-known small molecule activators are imidazoquinoline derivatives such as imiquimod (R-837 and resiquimod (R-848. Recently, an interaction between R-837 and the colchicine binding site of tubulin was reported. To investigate the possibility of an interaction between structural analogues of colchicine and the TLR7, a recent computational model for the dimeric form of the TLR7 receptor was used to determine a possible interaction with a colchicine derivative called CR42-24, active as a tubulin polymerization inhibitor. The estimated values of the binding energy of this molecule with respect to the TLR7 receptor were comparable to the energies of known binders as reported in a previous study. The binding to the TLR7 was further assessed by introducing genetic transformations in the TLR7 gene in cancer cell lines and exposing them to the compound. A negative shift of the IC50 value in terms of cell growth was observed in cell lines carrying the mutated TLR7 gene. The reported study suggests a possible interaction between TLR7 and a colchicine derivative, which can be explored for rational design of new drugs acting on this receptor by using a colchicine scaffold for additional modifications.

Anomaly, mixing and transition form factors of pseudoscalar mesons

International Nuclear Information System (INIS)

Klopot, Yaroslav; Oganesian, Armen; Teryaev, Oleg

2011-01-01

We derive the exact non-perturbative QCD sum rule for the transition form factors of η and η ′ using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on η,η ′ transition form factors in the range from real to highly virtual photons was obtained.

Solubilization of Phenol Derivatives in Polymer Micelles Formed by Cationic Block Copolymer

Directory of Open Access Journals (Sweden)

Irma Fuentes

2017-01-01

Full Text Available The aggregation of cationic block copolymers formed by polystyrene (PS and poly(ethyl-4-vinylpyridine (PS-b-PE4VP was studied in aqueous solution. Diblock copolymers of PS and poly(4-vinylpyridine were synthesized by sequential anionic polymerization using BuLi as initiator. Subsequently, the 4-vinylpyridine units were quaternized with ethyl bromide to obtain cationic PS-b-PE4VP block copolymers with different quaternization degree. The self-aggregation of cationic block copolymers was studied by fluorescence probing, whereas the morphology and size of polymer micelles were determined by transmission electronic microscopy. Results indicate that spherical micelles with sizes lower than 100 nm were formed, whereas their micropolarity decreases with increasing quaternization degree. The partition of phenols between the micellar and aqueous phase was studied by using the pseudo-phase model, and the results show that the partition coefficients increase with increasing length of the side alkyl chain and are larger for star micelles. These results are discussed in terms of three-region model.

Active Inference, Epistemic Value, and Vicarious Trial and Error

Science.gov (United States)

Pezzulo, Giovanni; Cartoni, Emilio; Rigoli, Francesco; io-Lopez, Léo; Friston, Karl

2016-01-01

Balancing habitual and deliberate forms of choice entails a comparison of their respective merits--the former being faster but inflexible, and the latter slower but more versatile. Here, we show that arbitration between these two forms of control can be derived from first principles within an Active Inference scheme. We illustrate our arguments…

The Role of Mythical Form of Thinking Embedded into Earlier and Recent Computer Games in Teaching Religious and Ethical Values

Directory of Open Access Journals (Sweden)

Hülya ALTUNYA

2017-08-01

Full Text Available In the world of eastern thought, narration of exemplary events is common through methods of mythical expression such as fairy tales, stories, myths etc. In these discourses, it is aimed at giving moral advice and thus educating the audience. It is stated in these discourses in which surreal events are told people who stand up against distress and difficulties retain their happiness. In such narrative texts, on one hand hope is being kept alive; on the other hand, such messages as patience, clinging to honesty under harsh times and possessing stamina are conveyed to the audience. Likewise, today, surreal events; namely, mythical fictions are animated in cartoons, animation and computer games. In these games, it is told that the most brutal battles are carried out through the most merciless weapons and only the most powerful one wins. These games, causing youth to grow up as aggressive, merciless and likely to try each way to seize power, should be examined in terms of education as well as that way of thinking. In this article, the form of thinking in the stories in which surreal events in the past were narrated is compared in terms of ethical values with the form of thinking in recent computer games in which surreal events are embedded.

Rethinking Value in the Bio-economy

Science.gov (United States)

2016-01-01

Current debates in science and technology studies emphasize that the bio-economy—or, the articulation of capitalism and biotechnology—is built on notions of commodity production, commodification, and materiality, emphasizing that it is possible to derive value from body parts, molecular and cellular tissues, biological processes, and so on. What is missing from these perspectives, however, is consideration of the political-economic actors, knowledges, and practices involved in the creation and management of value. As part of a rethinking of value in the bio-economy, this article analyzes three key political-economic processes: financialization, capitalization, and assetization. In doing so, it argues that value is managed as part of a series of valuation practices, it is not inherent in biological materialities. PMID:28458406

Derivative based sensitivity analysis of gamma index

Directory of Open Access Journals (Sweden)

Biplab Sarkar

2015-01-01

Full Text Available Originally developed as a tool for patient-specific quality assurance in advanced treatment delivery methods to compare between measured and calculated dose distributions, the gamma index (γ concept was later extended to compare between any two dose distributions. It takes into effect both the dose difference (DD and distance-to-agreement (DTA measurements in the comparison. Its strength lies in its capability to give a quantitative value for the analysis, unlike other methods. For every point on the reference curve, if there is at least one point in the evaluated curve that satisfies the pass criteria (e.g., δDD = 1%, δDTA = 1 mm, the point is included in the quantitative score as "pass." Gamma analysis does not account for the gradient of the evaluated curve - it looks at only the minimum gamma value, and if it is <1, then the point passes, no matter what the gradient of evaluated curve is. In this work, an attempt has been made to present a derivative-based method for the identification of dose gradient. A mathematically derived reference profile (RP representing the penumbral region of 6 MV 10 cm × 10 cm field was generated from an error function. A general test profile (GTP was created from this RP by introducing 1 mm distance error and 1% dose error at each point. This was considered as the first of the two evaluated curves. By its nature, this curve is a smooth curve and would satisfy the pass criteria for all points in it. The second evaluated profile was generated as a sawtooth test profile (STTP which again would satisfy the pass criteria for every point on the RP. However, being a sawtooth curve, it is not a smooth one and would be obviously poor when compared with the smooth profile. Considering the smooth GTP as an acceptable profile when it passed the gamma pass criteria (1% DD and 1 mm DTA against the RP, the first and second order derivatives of the DDs (δD', δD" between these two curves were derived and used as the

A comparison of hydrogen with alternate energy forms from coal and nuclear energy

International Nuclear Information System (INIS)

Cox, K.E.

1976-01-01

Alternate energy forms that can be produced from coal and nuclear energy have been analyzed on efficiency, economic and end-use grounds. These forms include hydrogen, methane, electricity, and EVA-ADAM, a 'chemical heat pipe' approach to energy transmission. The EVA-ADAM system for nuclear heat appears to be economically competitive with the other energy carriers except over very large distances. The cost of hydrogen derived from coal is approximately equal to that of methane derived from the same source when compared on an equal BTU basis. Thermochemically derived hydrogen from nuclear energy shows a break-even range with hydrogen derived from coal at coal costs of from Pound33 to 80/ton depending on the cost of nuclear heat. Electricity and electrolytically derived hydrogen are the most expensive energy carriers and electricity's use should be limited to applications involving work rather than heat. Continued work in thermochemical hydrogen production schemes should be supported as an energy option for the future. (author)

The Pricing of Traffic Light Options and other Correlation Derivatives

DEFF Research Database (Denmark)

Kokholm, Thomas

This paper considers the valuation of European style derivatives with payoffs depending on both a stock index and underlying LIBOR rates. The model has the attractive feature that it is based on observable market quantities which makes it very easy to calibrate. A closed form solution is derived...... for the price of the correlation derivative known as the traffic light option under lognormality assumptions for the underlying processes. A pricing approach for more general payoffs is presented, and an illustration is performed with Monte Carlo simulation by the pricing of a specific hybrid derivative...

Why should correction values be better known than the measurand true value?

International Nuclear Information System (INIS)

Pavese, Franco

2013-01-01

Since the beginning of the history of modern measurement science, the experimenters faced the problem of dealing with systematic effects, as distinct from, and opposed to, random effects. Two main schools of thinking stemmed from the empirical and theoretical exploration of the problem, one dictating that the two species should be kept and reported separately, the other indicating ways to combine the two species into a single numerical value for the total uncertainty (often indicated as 'error'). The second way of thinking was adopted by the GUM, and, generally, adopts the method of assuming that their expected value is null by requiring, for all systematic effects taken into account in the model, that corresponding 'corrections' are applied to the measured values before the uncertainty analysis is performed. On the other hand, about the value of the measurand intended to be the object of measurement, classical statistics calls it 'true value', admitting that a value should exist objectively (e.g. the value of a fundamental constant), and that any experimental operation aims at obtaining an ideally exact measure of it. However, due to the uncertainty affecting every measurement process, this goal can be attained only approximately, in the sense that nobody can ever know exactly how much any measured value differs from the true value. The paper discusses the credibility of the numerical value attributed to an estimated correction, compared with the credibility of the estimate of the location of the true value, concluding that the true value of a correction should be considered as imprecisely evaluable as the true value of any 'input quantity', and of the measurand itself. From this conclusion, one should derive that the distinction between 'input quantities' and 'corrections' is not justified and not useful

Derivation of the spin-glass order parameter from stochastic thermodynamics

Science.gov (United States)

Crisanti, A.; Picco, M.; Ritort, F.

2018-05-01

A fluctuation relation is derived to extract the order parameter function q (x ) in weakly ergodic systems. The relation is based on measuring and classifying entropy production fluctuations according to the value of the overlap q between configurations. For a fixed value of q , entropy production fluctuations are Gaussian distributed allowing us to derive the quasi-FDT so characteristic of aging systems. The theory is validated by extracting the q (x ) in various types of glassy models. It might be generally applicable to other nonequilibrium systems and experimental small systems.

Medium modifications of nucleon electromagnetic form factors

Energy Technology Data Exchange (ETDEWEB)

Horikawa, T. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan); Bentz, W. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan)]. E-mail: bentz@keyaki.cc.u-tokai.ac.jp

2005-11-28

We use the Nambu-Jona-Lasinio model as an effective quark theory to investigate the medium modifications of the nucleon electromagnetic form factors. By using the equation of state of nuclear matter derived in this model, we discuss the results based on the naive quark-scalar diquark picture, the effects of finite diquark size, and the meson cloud around the constituent quarks. We apply this description to the longitudinal response function for quasielastic electron scattering. RPA correlations, based on the nucleon-nucleon interaction derived in the same model, are also taken into account in the calculation of the response function.

A quadratic form of the Coulomb operator and an optimization scheme for the extended Kohn-Sham models

International Nuclear Information System (INIS)

Kusakabe, Koichi

2009-01-01

To construct an optimization scheme for an extension of the Kohn-Sham approach, I introduce an operator form of the Coulomb interaction. This form is the sum of quadratic form pairs, which can be redefined in a self-consistent calculation of a multi-reference density functional theory. A detailed derivation of the form is given. A fluctuation term introduced in the extended Kohn-Sham scheme is expressed in this form for regularization. The present procedure also provides an exact derivation of effective negative interactions in charge fluctuation channels. Relevance to high-temperature superconductors is discussed.

Dispersive analysis of the pion transition form factor

Science.gov (United States)

Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

2014-11-01

We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

Arsenic and other oxyanion-forming trace elements in an alluvial basin aquifer: Evaluating sources and mobilization by isotopic tracers (Sr, B, S, O, H, Ra)

Energy Technology Data Exchange (ETDEWEB)

Vinson, David S., E-mail: dsv3@duke.edu [Duke University, Division of Earth and Ocean Sciences, Box 90227, Durham, NC 27708 (United States); McIntosh, Jennifer C. [University of Arizona, Department of Hydrology and Water Resources, 1133 E. James E. Rogers Way, Tucson, AZ 85721 (United States); Dwyer, Gary S.; Vengosh, Avner [Duke University, Division of Earth and Ocean Sciences, Box 90227, Durham, NC 27708 (United States)

2011-08-15

Highlights: > Elevated natural As and F occur in the Willcox Basin aquifer of Arizona. > Oxyanion-forming elements are derived from volcanic-source aquifer sediments. > Sr isotopes trace sediment sources linked to oxyanion-forming trace elements. > {sup 87}Sr/{sup 86}Sr > 0.720 indicates Proterozoic crystalline-source sediment contributing low As. > Both sediment source and hydrogeochemical evolution (Ca/Na) affect As levels. - Abstract: The Willcox Basin is a hydrologically closed basin in semi-arid southeastern Arizona (USA) and, like many other alluvial basins in the southwestern USA, is characterized by oxic, near-neutral to slightly basic groundwater containing naturally elevated levels of oxyanion-forming trace elements such as As. This study evaluates the sources and mobilization of these oxyanionic trace elements of health significance by using several isotopic tracers of water-rock interaction and groundwater sources ({sup 87}Sr/{sup 86}Sr, {delta}{sup 34}S{sub SO4}, {delta}{sup 11}B, {delta}{sup 2}H, {delta}{sup 18}O, {sup 3}H). Values of {delta}{sup 2}H (-85 per mille to -64 per mille) and {delta}{sup 18}O (-11.8 per mille to -8.6 per mille) are consistent with precipitation and groundwater in adjacent alluvial basins, and low to non-detectable {sup 3}H activities further imply that modern recharge is slow in this semi-arid environment. Large variations in {sup 87}Sr/{sup 86}Sr ratios imply that groundwater has interacted with multiple sediment sources that constitute the basin-fill aquifer, including Tertiary felsic volcanic rocks, Paleozoic sedimentary rocks, and Proterozoic crystalline rocks. In general, low concentrations of oxyanion-forming trace elements and F{sup -} are associated with a group of waters exhibiting highly radiogenic values of {sup 87}Sr/{sup 86}Sr (0.72064-0.73336) consistent with waters in Proterozoic crystalline rocks in the mountain blocks (0.73247-0.75010). Generally higher As concentrations (2-29 {mu}g L{sup -1}), other

13C and 15N CP/MAS, 1H-15N SCT CP/MAS and FTIR spectroscopy as tools for qualitative detection of the presence of zwitterionic and non-ionic forms of ansa-macrolide 3-formylrifamycin SV and its derivatives in solid state.

Science.gov (United States)

Przybylski, Piotr; Pyta, Krystian; Klich, Katarzyna; Schilf, Wojciech; Kamieński, Bohdan

2014-01-01

(13)C, (15)N CP/MAS, including (1)H-(13)C and (1)H-(15)N short contact time CP/MAS experiments, and FTIR methods were applied for detailed structural characterization of ansa-macrolides as 3-formylrifamycin SV (1) and its derivatives (2-6) in crystal and in powder forms. Although HPLC chromatograms for 2/CH3 OH and 2/CH3 CCl3 were the same for rifampicin crystals dissolved in respective solvents, the UV-vis data recorded for them were different in 300-375 nm region. Detailed solid state (13)C and (15)N CP/MAS NMR and FTIR studies revealed that rifampicin (2), in contrast to 3-formylrifamycin SV (1) and its amino derivatives (3-6), can occur in pure non-ionic or zwitterionic forms in crystal and in pure these forms or a mixture of them in a powder. Multinuclear CP/MAS and FTIR studies demonstrated also that 3-6 derivatives were present exclusively in pure zwitterionic forms, both in powder and in crystal. On the basis of the solid state NMR and FTIR studies, two conformers of 3-formylrifamycin SV were detected in powder form due to the different orientations of carbonyl group of amide moiety. The PM6 molecular modeling at the semi-empirical level of theory, allowed visualization the most energetically favorable non-ionic and zwitterionic forms of 1-6 antibiotics, strongly stabilized via intramolecular H-bonds. FTIR studies indicated that the originally adopted forms of these type antibiotics in crystal or in powder are stable in standard laboratory conditions in time. The results presented point to the fact that because of a possible presence of two forms of rifampicin (compound 2), quantification of the content of this antibiotic in relevant pharmaceuticals needs caution. Copyright © 2013 John Wiley & Sons, Ltd.

Electromagnetic form factors of a massive neutrino

International Nuclear Information System (INIS)

Dvornikov, M.S.; Studenikin, A.I.

2004-01-01

Electromagnetic form factors of a massive neutrino are studied in a minimally extended standard model in an arbitrary R ξ gauge and taking into account the dependence on the masses of all interacting particles. The contribution from all Feynman diagrams to the electric, magnetic, and anapole form factors, in which the dependence of the masses of all particles as well as on gauge parameters is accounted for exactly, are obtained for the first time in explicit form. The asymptotic behavior of the magnetic form factor for large negative squares of the momentum of an external photon is analyzed and the expression for the anapole moment of a massive neutrino is derived. The results are generalized to the case of mixing between various flavors of the neutrino. Explicit expressions are obtained for the electric, magnetic, and electric dipole and anapole transitional form factors as well as for the transitional electric dipole moment

Remarks on the microscopic derivation of the collective model

International Nuclear Information System (INIS)

Toyoda, T.; Wildermuth, K.

1984-01-01

The rotational part of the phenomenological collective model of Bohr and Mottelson and others is derived microscopically, starting with the Schrodinger equation written in projection form and introducing a new set of 'relative Euler angles'. In order to derive the local Schrodinger equation of the collective model, it is assumed that the intrinsic wave functions give strong peaking properties to the overlapping kernels

Enantiomer excesses of rare and common sugar derivatives in carbonaceous meteorites

OpenAIRE

Cooper, George; Rios, Andro C.

2016-01-01

The majority of biological sugars and their derivatives contain higher abundances of the “d” mirror-image forms relative to the “l” forms. For example, nucleic acids are composed of only d sugars. Carbonaceous meteorites can potentially assist in understanding the long-sought origin of such phenomena; They preserve a record of the earliest (∼4.5 Gy) chemical processes in the Solar System. To date, there have been no systematic studies of d/l (i.e., enantiomer) ratios of meteoritic sugar deriv...

How to assess the value of medicines?

Science.gov (United States)

Simoens, Steven

2010-01-01

This study aims to discuss approaches to assessing the value of medicines. Economic evaluation assesses value by means of the incremental cost-effectiveness ratio (ICER). Health is maximized by selecting medicines with increasing ICERs until the budget is exhausted. The budget size determines the value of the threshold ICER and vice versa. Alternatively, the threshold value can be inferred from pricing/reimbursement decisions, although such values vary between countries. Threshold values derived from the value-of-life literature depend on the technique used. The World Health Organization has proposed a threshold value tied to the national GDP. As decision makers may wish to consider multiple criteria, variable threshold values and weighted ICERs have been suggested. Other approaches (i.e., replacement approach, program budgeting and marginal analysis) have focused on improving resource allocation, rather than maximizing health subject to a budget constraint. Alternatively, the generalized optimization framework and multi-criteria decision analysis make it possible to consider other criteria in addition to value.

How to assess the value of medicines?

Directory of Open Access Journals (Sweden)

Steven Simoens

2010-09-01

Full Text Available This study aims to discuss approaches to assessing the value of medicines. Economic evaluation assesses value by means of the incremental cost-effectiveness ratio (ICER. Health is maximised by selecting medicines with increasing ICERs until the budget is exhausted. The budget size determines the value of the threshold ICER and vice versa. Alternatively, the threshold value can be inferred from pricing/reimbursement decisions, although such values vary between countries. Threshold values derived from the value-of-life literature depend on the technique used. The WHO has proposed a threshold value tied to the national GDP. As decision makers may wish to consider multiple criteria, variable threshold values and weighted ICERs have been suggested. Other approaches (i.e. replacement approach, program budgeting and marginal analysis have focused on improving resource allocation, rather than maximising health subject to a budget constraint. Alternatively, the generalised optimisation framework and multi-criteria decision analysis make it possible to consider other criteria in addition to value.

Anomaly, mixing and transition form factors of pseudoscalar mesons

Energy Technology Data Exchange (ETDEWEB)

Klopot, Yaroslav, E-mail: klopot@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Oganesian, Armen, E-mail: armen@itep.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Institute of Theoretical and Experimental Physics, B. Cheremushkinskaya 25, Moscow 117218 (Russian Federation); Teryaev, Oleg, E-mail: teryaev@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation)